19) Biodiversity and Sequences ABSTRACT ENDOPHYTIC FUNGAL DIVERSITY IN CHEILANTHES TENUIFOLIA (Pteridaceae) Thushara Susan Sabu1, Reshma

John1, Linu Mathew*

School of Biosciences, Mahatma Gandhi University, Kottayam, Kerala *corresponding author Email ID : linumathew@mgu.ac.in, Contact number: 9447505690

Endophytes are microbes that colonize living internal tissue of plants, without causing any immediate negative effects. Endophytes also induce or activate host plant defense mechanisms. In the present study Cheilanthes tenuifolia of the family Pteridaceae and order Polypodiales are used for the screening of endophytic fungi residing in it. Common names include Poison Rock Fern and Mulga Fern. Ferns were collected from different districts of Kerala. Plant materials were properly surface sterilized prior to inoculation. The leaves, stem, root and rhizoid were cut into small pieces of 55 mm and were placed on PDA plates supplemented with streptomycin sulphate (300mg/l) . Fungal endophytes are identified according to their morphological and microscopic characteristics. The colonization frequency (% CF) of fungal species was calculated as: % CF = (Ncol/ Nt) 100; Ncol = Number of segments colonized by each fungus and Nt = Total number of segments studied (Suryanarayanan et al 2003). The dominant fungi from the isolated endophytes were identified by sequencing of the ITS region. The internal transcribed region of the fungal DNA was amplified using ITS 1 (5 TCCGATGGTGAACCTGCGG3) and ITS4 primers (5TCCTCCGCTTATTGATATGC3). Based on the sequence data the endophytes were identified as Fusarium oxysporum, Colletotrichum gloeosporoides and Lasiodiplodia theobromae. The sequence data was analyzed using BLAST with the available database in NCBI and dendrogram was constructed. Keywords: endophyte, ferns, ITS, Colonisation frequency, Cheilanthes tenuifolia,