Você está na página 1de 77

Biologia 1

Citologia

Captulo 1
01. Existe uma srie de caractersticas que distinguem os seres vivos da matria bruta. Analise as caractersticas a seguir e, depois, assinale aquelas caractersticas que so exclusivas dos seres vivos: I. metabolismo; II. ausncia de molculas; III. reproduo; IV. material gentico. Esto corretas: a) apenas I e III b) I, II e IV c) I, III e IV d) II, III e IV e) Apenas III e IV 0 2. Assinale uma das caractersticas da clula procaritica, como as bactrias. a) Apresenta uma carioteca dupla e rica em poros. b) Mostra o material nuclear difuso pelo citoplasma. c) Apresenta uma parede celular rica em celulose. d) Possui organelas membranosas, como, por exemplo, retculo endoplasmtico. e) Como nas clulas animais, possui parede celular. 03. Uma clula bacteriana no possui: a) material hereditrio e carioteca. b) parede celular e centrolo. c) ribossomos e complexo golgiense. d) membrana plasmtica. e) nuclolo e carioteca. 04. Fuvest-SP Um pesquisador estudou uma clula ao microscpio eletrnico, vericando a ausncia de ncleo e de compartimentos membranosos. Com base nessas observaes, ele conclui que a clula pertence a: a) uma bactria. b) uma planta. c) um animal. d) um fungo. e) um vrus. 05. UEL-PR Observe o esquema a seguir.

Ele representa: a) uma bactria. b) um protozorio. c) um fungo. d) uma clula animal. e) uma clula vegetal. 06. Analise o texto a seguir. Nas bactrias, o material gentico est organizado em uma ta contnua de __________ que ca localizado em uma rea chamada de ____________. Assinale a alternativa que completa corretamente o texto: a) cromossomos nucleossomo. b) DNA nucleossomo. c) Plasmdeo nucleide. d) DNA nucleide. e) RNA ncleo. 07. Bactrias e cianobactrias so seres vivos unicelulares e procariontes porque: a) podem causar doenas no homem e nos animais, possuem membrana plasmtica e membrana nuclear. b) so constitudos por uma clula apenas, no possuem membrana plasmtica e possuem membrana nuclear. c) so constitudos por uma clula apenas, possuem membrana plasmtica e no possuem membrana nuclear. d) so constitudos por uma clula apenas e podem formar colnias. e) No formam colnias e podem causar doenas no homem e nos animais.

PV2D-07-BIO-14

105

08. PUC-RS Um biologista, estudando a estrutura de uma clula bacteriana, iria encontrar, como uma organela deste tipo celular, o: a) cloroplasto. b) retculo endoplasmtico liso. c) centrolo. d) ribossomo. e) retculo endoplasmtico rugoso. 09. Qual alternativa aponta uma estrutura encontrada em clulas procariontes e sua respectiva funo? a) Cloroplasto fotossntese b) Carioteca proteo do material gentico c) Parede celular liberao de energia d) Lisossomo digesto e) Ribossomos sntese de protenas 10. Mackenzie-SP Assinale a alternativa que apresenta estruturas encontradas em todos os tipos de clulas. a) Ncleo, mitocndrias e ribossomos. b) Parede celular, ribossomos e nuclolo. c) Centrolo, complexo de Golgi e ncleo. d) Ribossomos, membrana plasmtica e hialoplasma. e) Hialoplasma, carioteca e retculo endoplasmtico. 11. UEL-PR Considere os seguintes componentes celulares: I. parede celular V. mesossomo II. ribossomos VI. DNA III. ncleo organizado VII. mitocndria IV. membrana plasmtica Uma clula bacteriana desprovida, apenas, de: a) I e VII. d) II e V. b) III e VII. e) III, IV e VI. c) I e III. 12. Correlacione a coluna 1 com a coluna 2. Coluna 1 1. Ribossomos 2. Parede celular 3. Membrana plasmtica 4. Mesossomo Coluna 2 ( ) permeabilidade seletiva ( ) sntese de protenas ( ) proteo ( ) contm enzimas envolvidas com a respirao celular bacteriana. A seqncia correta : a) 1, 2, 3, 4 b) 4, 3, 2, 1 c) 3, 1, 2, 4
106

13. UFSCar-SP Toda clula viva possui: a) membrana plasmtica, mas pode no possuir ncleo organizado e mitocndrias. b) membrana plasmtica e mitocndrias, mas pode no possuir ncleo organizado. c) ncleo, mas pode no possuir membrana plasmtica e mitocndrias. d) ncleo e mitocndrias, mas pode no possuir membrana plasmtica. e) ncleo organizado, membrana plasmtica e mitocndrias. 14. Fuvest-SP Um estudante escreveu o seguinte em uma prova: As bactrias no tm ncleo nem DNA. Voc concorda com o estudante? Justique. 15. Vunesp Os procariontes diferenciam-se dos eucariontes porque os primeiros, entre outras caractersticas: a) no possuem material gentico. b) possuem material gentico como os eucariontes, mas so anucleados. c) possuem ncleo, mas o material gentico encontra-se disperso no citoplasma. d) possuem material gentico disperso no citoplasma em estruturas organizadas denominadas mesossomos. e) possuem ncleo e material gentico organizado. 16. UFU-MG O desenho a seguir representa uma bactria. De acordo com ele e com base em seus conhecimentos sobre o assunto, resolva a questo.

a) A clula procaritica ou eucaritica? Justique. b) Quais so os nomes das estruturas numeradas e suas respectivas funes? 17. UFSCar-SP (modificado) A Escherichia coli um organismo procarionte. Isto signica que: a) um parasita intracelular obrigatrio. b) sua sntese protica depende do RER. c) so desprovidos de parede celular. d) os mesossomos participam da diviso celular e podem estar envolvidos com a respirao celular. e) possuem organizao celular complexa.

d) 3, 2, 4, 1 e) 2, 1, 3, 4

18. Os seres procariontes no apresentam a carioteca envolvendo o material gentico. So exemplos de seres procariontes: a) algas e protozorios. b) vrus e bactrias. c) bactrias e cianobactrias. d) fungos e protozorios. e) animais e vegetais. 19. PUC-MG Sobre as cianobactrias, incorreto armar que: a) no possuem ncleo individualizado. b) possuem clorola como pigmento fotossintetizante. c) possuem cloroplastos. d) possuem ribossomos. e) no possuem organelas membranosas. 20. UFPI

22. Mackenzie-SP Nas bactrias, o mesossomo apresenta uma coleo enzimtica responsvel por um processo que tambm ocorre: a) nas lamelas dos cloroplastos. b) na membrana do retculo endoplasmtico rugoso. c) no nuclolo. d) no complexo de Golgi. e) nas cristas mitocondriais. 23. Cesgranrio-RJ Esta questo apresenta duas armaes, podendo a segunda ser uma razo para a primeira. Primeira armao As bactrias e as cianobactrias so designadas como clulas procariticas, porque, Segunda armao Em contraste com as clulas ditas eucariticas, as bactrias e as cianobactrias possuem caractersticas estruturais mais simples, destacando-se a ausncia do envoltrio nuclear e do retculo endoplasmtico. Assinale a alternativa: a) se as duas armaes forem verdadeiras e a segunda for uma justicativa da primeira. b) se as duas armaes forem verdadeiras e a segunda no for uma justicativa da primeira. c) se a primeira armao for verdadeira e a segunda armao for falsa. d) se a primeira armao for falsa e a segunda armao for verdadeira. e) se a primeira e a segunda armaes forem falsas. 24. UFAL Uma clula classicada como eucaritica se contiver: a) compartimentos membranosos internos. b) parede celular rgida. c) membrana plasmtica. d) cidos nuclicos. e) ribossomos. 25. UEL-PR As estruturas que podem estar aderidas ao retculo endoplasmtico so: a) os lisossomos. b) os ribossomos. c) os vacolos. d) as mitocndrias. e) os pinossomos. 26. UMC-SP Indispensvel ao trabalho celular a liberao de energia que se processa no(s) na(s): a) mitocndrias. b) complexo de Golgi. c) lisossomos. d) ribossomos. e) vacolos.
107

A gura representa o desenho esquemtico de uma clula bacteriana. Como todo ser vivo, este tambm se reproduz e transmite as informaes genticas sua descendncia, atravs do seu DNA. A alternativa que cita os dois componentes celulares bacterianos que contm DNA : a) nucloide e mesossomo. b) parede celular e plasmdio. c) plasmdio e nucleide. d) mesossomo e ribossomo. e) membrana plasmtica e mesossomo. 21. UFPE Na gura est representada esquematicamente uma bactria. Sabendo-se que as enzimas relacionadas com a respirao nesses organismos esto ligadas face interna de uma determinada estrutura, assinale a alternativa que indica esta estrutura e o nmero que a representa na gura.

a) b) c) d) e)

citoplasma (1). membrana plasmtica (2). ncleo (3). parede celular (4). cpsula (5).

PV2D-07-BIO-14

27. PUCCamp-SP Uma clula secretora apresenta, como organela mais desenvolvida, o retculo endoplasmtico liso. Pode-se concluir que esta clula produz: a) aminocidos. d) glicoprotenas. b) protenas. e) lipdios. c) muco. 28. UFRJ Os lisossomos so estruturas celulares encarregadas do seguinte processo: a) secreo. b) transporte. c) reproduo. d) digesto. e) metabolismo energtico. 29. UFRN A gua oxigenada normalmente formada nas clulas como um subproduto de algumas reaes qumicas. Devido ser extremamente txica, deve ser rapidamente decomposta. Para neutralizar a ao da gua oxigenada, a clula utiliza-se da enzima X contida na organela Y. X e Y so respectivamente: a) catalase e peroxissomo. b) glicosidase e retculo endoplasmtico rugoso. c) peroxidase e lisossomo. d) catalase e complexo de Golgi. e) esngomielinase e lisossomo. 30. Unifor-CE A gura abaixo mostra uma clula animal:

De acordo com a gura apresentada e o assunto abordado, analise as armativas a seguir e assinale a alternativa correta. a) I responsvel pela secreo de substncias que iro atuar no meio extracelular. b) As duas organelas apresentadas so constituintes de clulas eucariotas. c) O centro de armazenamento e empacotamento intracelular localiza-se em I. d) II rico em ribossomos, sendo responsvel pela sntese de protenas. 32. Fuvest-SP Alimento protico marcado com radioatividade foi fagocitado por paramcios. Poucos minutos depois, os paramcios foram analisados e a maior concentrao de radioatividade foi encontrada: a) nos centrolos. b) nas mitocndrias. c) na carioteca. d) no nuclolo. e) no retculo endoplasmtico. 33. UFSM-RS

SOARES, J. L.: Biologia. So Paulo: Scipione, vol. nico, 1999. p. 38 e 44.

Mitocndrias e retculo endoplasmtico rugoso esto representados, respectivamente, por: a) I e IV d) III e V b) II e I e) IV e I c) II e III 31. O trabalho desenvolvido por uma determinada clula no nosso organismo resultado das funes de vrias de suas organelas. A gura a seguir representa duas organelas celulares. Observe-as.

As guras I e II representam, respectivamente: a) clula eucarionte e clula procarionte. b) clula vegetal e clula animal. c) clula animal e clula vegetal. d) clula procarionte e clula eucarionte. e) clula eucarionte e clula vegetal. 34. Fuvest-SP Clulas de bactrias e de animais apresentam semelhanas e diferenas. a) Qual estrutura presente em ambas realiza a sntese de protena? b) Qual a diferena intracelular que leva classicao de bactrias como procariontes e de animais como eucariontes? 35. Fuvest-SP a) Quais so as diferenas existentes entre clulas procariontes e eucariontes quanto a ncleo e citoplasma? b) Em que grupos de organismos so encontradas as clulas procariontes?

I
108

II

36. Unimep-SP (modificado) Sobre a biologia celular, assinale a alternativa correta com relao s estruturas da clula. a) A membrana nuclear apenas observada nas clulas procariticas. b) O hialoplasma um recheio nuclear lquido das clulas eucariticas. c) Podemos encontrar mitocndrias em clulas vegetais, protozorios e bactrias. d) O material gentico, constitudo de DNA, encontrado apenas nas clulas eucariticas. e) A membrana plasmtica de natureza lipoprotica encontrada em todas as clulas, sejam procariticas ou eucariticas. 37. PUC-MG (modificado) Os diversos tipos de organides celulares aparecem nas clulas com maior ou menor intensidade de acordo com seu metabolismo. Os osteoblastos so clulas sseas responsveis por grande produo de colgenos (protenas) para a matriz extracelular, sendo por isso ricos em: a) retculo endoplasmtico liso. b) retculo endoplasmtico rugoso. c) centrolo. d) lisossomos. e) cloroplastos. 38. UFRN A extremidade do axnio da clula nervosa apresenta grande atividade metablica durante a passagem do impulso nervoso para os dendritos da clula seguinte. Essa atividade metablica elevada possvel devido presena de um grande nmero de: a) mitocndrias. c) vacolos. b) ribossomos. d) lisossomos. 39. PUC-RS Responder questo relacionando as estruturas presentes na coluna I com as informaes presentes na coluna II. Coluna I ( ) mitocndrias ( ) protenas ( ) centrolos ( ) peroxissomos ( ) DNA ( ) RNA ( ) ribossomos Coluna II 1. presente apenas nas clulas eucariotas 2. presente apenas nas clulas procariotas 3. presente tanto em clulas eucariotas como em procariotas A ordem correta dos parnteses da coluna I, de cima para baixo, : a) 1 1 3 3 3 1 3. b) 1 2 3 1 1 2 1. c) 2 1 1 2 3 1 2. d) 2 2 3 3 3 2 3. e) 3 1 2 3 1 2 1.

40. UFU-MG Analise o seguinte texto: I. As clulas da mucosa intestinal secretam muco, que lubrica este rgo e facilita o transporte do alimento. II. As clulas da cauda do girino so, normalmente, reabsorvidas pelo processo de autlise, por ao de proteases liberadas na clula. III. Nas bras musculares estriadas, as organelas que liberam ATP para o trabalho muscular encontramse dispostas entre os feixes das miobrilas. Os itens I, II e III se referem a quais estruturas citoplasmticas? Justique. 41. UFV-MG Uma caracterstica das clulas eucariticas a presena de organelas, as quais delimitam compartimentos que desempenham funes especcas no metabolismo celular. Nesse sentido, a clula eucaritica pode ser comparada a uma fbrica organizada em sees de estoque, montagem, embalagem, produo, limpeza etc. Considerando esta analogia, assinale a alternativa incorreta: a) O nuclolo pode representar uma das sees de montagem, uma vez que produz subunidades ribossomais que vo atuar na sntese protica. b) O retculo endoplasmtico liso pode funcionar como seo de estoque, pois desempenha a funo de armazenar o cdigo gentico. c) O lisossomo pode representar a seo de limpeza, pois o responsvel pela digesto intracelular. d) O complexo de Golgi pode ser comparado com a seo de embalagem, pois empacota as substncias formando grnulos de secreo. e) O ergastoplasma pode representar a seo de produo, pois responsvel pela sntese de substncias. 42. Unioeste-PR A gura a seguir representa uma clula eucariota animal. Relativamente s estruturas e organelas, assinale a(s) alternativa(s) correta(s) e some-as.

PV2D-07-BIO-14

109

01. 1 representa o envelope nuclear e formado por duas membranas porosas. 02. 2 representa o centrolo e est envolvido na sntese de lisossomos. 04. 3 representa o retculo endoplasmtico rugoso, cuja membrana contnua com o envelope nuclear. 08. 4 representa os ribossomos, que so formados por RNAs e protenas e esto envolvidos com a sntese protica. 16. 5 representa um vacolo, responsvel pela degradao de protenas provenientes do meio extracelular. 32. 6 representa a mitocndria, organela responsvel pela quebra da glicose em H2O e CO2, processo este denominado respirao celular. 64. 7 representa os nuclolos, incapazes de autoduplicao e responsveis pela formao de microvilosidades. 43. Unioeste-PR (modificado) Numerando-se organelas com algarismos romanos e funes celulares com algarismos arbicos: Organelas I. Mitocndria II. Complexo de Golgi III. Lisossomos IV. Ribossomos V. Retculo endoplasmtico Funes celulares 1. Sntese de protenas 2. Ao enzimtica 3. Transporte de substncias 4. Respirao celular 5. Sntese de lipdios 6. Digesto intracelular 7. Armazenamento de secrees Escolha a alternativa que relaciona corretamente organelas e funes celulares: a) I (2, 5); II (1, 4); IV (6, 3) b) I (4); III (2); IV (1) c) II (2, 1); IV (6, 7); V (6, 7) d) II (2, 5); IV (5, 6); V (2, 7) e) I (4); III (2); V (3, 5, 6, 7) 44. UEM-PR (modificado) Sobre as estruturas e funes celulares, assinale o que for correto. 01. Na clula, h movimentao de protenas, carboidratos e lipdios entre as organelas. Essa transferncia de molculas ocorre no interior do ergastoplasma. 02. O complexo de Golgi o principal local da clula onde ocorre digesto, ou seja, a degradao de macromolculas. 04. A membrana plasmtica e todas as membranas encontradas no interior da clula so lipoproticas. 08. Parede celular uma estrutura que envolve as clulas animais. 16. Nas clulas animais o DNA encontrado no ncleo e nas mitocndrias. 32. Nenhum tipo de bactria possui mitocndrias. Portanto, nenhuma bactria utiliza o oxignio para a respirao.
110

45. UFPR Das caractersticas apresentadas a seguir, selecione aquelas que so comuns tanto a bactrias como a clulas animais. 01. Presena de parede celular rgida. 02. Material gentico constitudo por DNA. 04. Presena de retculo endoplasmtico e complexo de Golgi. 08. Presena de membrana plasmtica. 16. Mitocndria como principal organela para obteno de energia qumica. 32. Presena de ribossomos. 64. Vida livre. D a soma dos itens corretos. 46. Mackenzie-SP

Assinale a alternativa correta a respeito da organela representada ao lado. a) Sua principal funo a de armazenar substncias. b) Os grnulos observados em sua superfcie so responsveis pelo fornecimento de energia para o seu funcionamento. c) membranosa e apresenta relao ntima com a carioteca. d) Est presente em todos os tipos de clulas. e) Sua atividade no est relacionada ao funcionamento do ncleo. 47. UFMS Entre as organelas citoplasmticas que realizam mecanismo de sntese, armazenamento e transporte de macromolculas, pode-se citar o peroxissomo, que uma estrutura vesiculosa delimitada por membrana lipoprotica, cuja(s) principal(ais) funo(es) (so): 01. realizar o controle osmtico dos organismos em que esto presentes. 02. realizar o mecanismo de digesto intracelular atravs de suas enzimas hidrolisantes. 04. constituir formas de reservas celulares como gordura e glicognio. 08. desintoxicar os organismos do efeito do lcool, pela quebra do etanol. 16. sintetizar protenas em associao com o RNAm. 32. decompor gua oxigenada pela atividade da enzima catalase. D a soma das proposies corretas.

48. UFPR (modificado) Trs linhagens celulares distintas, estabelecidas em cultura (linhagens 1, 2 e 3), tiveram o contedo de suas membranas existentes em maior quantidade nas respectivas linhagens. Os resultados experimentais obtidos foram os seguintes: Linhagem celular Membranas do retculo endoplasmtico rugoso Membranas do Complexo de Golgi (%) Membranas do retculo endoplasmtico liso (%) Membranas do envoltrio nuclear (%) Membranas de mitocndrias (%) 1 32 14 1 7 3 2 8 7 53 6 8 3 60 1 1 6 7

50. Unifesp Nas bactrias, a cadeia respiratria encontra-se associada membrana plasmtica e os cidos nuclicos esto associados ao citoplasma. a) assim tambm em um protista, em um animal e em um vegetal? Justique. b) A clonagem de bactrias, comparada clonagem de animais, um processo mais complexo ou mais simples? Justique. 51. UEG-GO A pardia da clula No encontro internacional das clulas, muitas delas aproveitaram o evento para discutir as novas descobertas no campo da medicina e para relembrar os tempos ureos de juventude e vigor. No encontro, a clula A dizia que, quando era jovem, sua funo secretora era intensa e, pelo fato de pertencer a um tecido avascular de revestimento, lamentava ter tido uma vida curta, quando comparada quela em que vivera em um ambiente em que a vascularizao era abundante. J a clula B dizia que ter uma vida longa, sem a capacidade de se dividir, tinha o seu lado ruim. Trabalhou sem descanso e, como tudo que envelhece, passou a ter limitaes de funcionamento que incomodavam a sua antiga virilidade. Dizia ela: Tive meus momentos de glria e hoje funciono limitadamente, pois uma enfermidade progressiva e sem cura me atingiu e prejudicou minha capacidade de armazenar informaes. Muito inteirada no bate-papo, a clula C, muito jovem e envaidecida por estar na mdia, disse a elas: No desanimem, esto descobrindo em mim funes que solucionaro muitos problemas. Em breve, minha linhagem ser capaz de resolver muitas frustaes de outras clulas e, at mesmo, de substituir as funes daquelas que, por infelicidade do destino, jamais tiveram o prazer de funcionar adequadamente.
Fbio Asmar - CBB/UCG

Com base nesses dados, julgue (V ou F): ( ( ( ) As clulas da linhagem 1 caracterizam-se por elevada taxa de respirao celular. ) As caractersticas das clulas da linhagem 2 so compatveis com a produo de lipdios. ) A linhagem 3 representa clulas especializadas em secreo.

49. Um aluno observou fotomicrograas de alguns tecidos animais e construiu a tabela abaixo: Tecido Muscular Conjuntivo frouxo Epitelial (mucosa) Epitlio do tbulo renal Epitlio intestinal sseo Representao simblica da quantidade de mitocndrias ++++++++ ++ +++ +++++++++ +++++ ++++

Aps a anlise, o aluno chegou a cinco concluses, mas apenas uma est correta; assinale-a. a) Quanto maior for a atividade biolgica de um tecido, maior ser o nmero de mitocndrias. b) O nmero de mitocndrias varia inversamente atividade do tecido. c) A atividade bioenergtica do tecido epitelial maior que a do epitlio do tbulo renal.
PV2D-07-BIO-14

d) O nmero de mitocndrias s interfere quando os tecidos esto em desenvolvimento. e) A atividade mitocondrial no interfere no metabolismo energtico dos diferentes tecidos.

Julgue (V ou F) os itens a seguir apresentado. ( ) De acordo com a descrio acima, a clula A pertence ao tecido epitelial e apresenta um citoplasma rico em ribossomos e em retculo endoplasmtico rugoso. ( ) A clula B um neurnio e apresenta um citoplasma rico em mitocndrias. ( ) A enfermidade progressiva qual se refere a clula B pode ser a doena de Alzheimer que acomete indivduos idosos e determina, principalmente, decincia no mecanismo de memria do indivduo. ( ) A clula C uma clula-tronco e apresenta grande capacidade de assumir mltiplas funes no organismo, quando adequadamente manipulada. ( ) A incapacidade de se dividir, lamentada pela clula B, evidencia perda, ao longo do tempo, de meiose para originar clulas idnticas anatmicamente e funcionalmente, as quais poderiam substitu-la em suas carncias de funcionamento. ( ) A cincia deposita hoje grande esperana de cura de doenas genticas com a utilizao teraputica das clulas C.
111

52. A carioteca (membrana nuclear ou envelope nuclear) faz parte de um conjunto amplo de estruturas limitadas por membranas de mesma natureza e que se encontram mergulhadas apenas no hialoplasma das clulas eucariticas. Fazem parte desse conjunto de organides membranosos: a) os cromossomos (DNA), as mitocndrias e o complexo de Golgi. b) retculo endoplasmtico, ribossomos e cloroplastos. c) mitocndria, cloroplasto e ergastoplasma. d) mitocndria, cloroplasto e ribossomos. e) ribossomos, cloroplasto e complexo de Golgi. 53. Derrubamos a grande barreira que soprava os reinos animal e vegetal: a clula a unidade da matria viva. Essa armativa foi feita por cientistas ao descobrirem, em 1839, aquilo que lrios, guas-vivas, gafanhotos, minhocas, samambaias e humanos tm em comum. Pode-se dizer que todas as clulas dos seres acima citados tm as seguintes caractersticas: a) Centrolo e lisossomo b) Parede celular e menossomo c) Ncleo individualizado e mitocndria d) Material nuclear disperso e cloropasto 54. Comparando uma clula procaritica com clulas eucariticas vegetal e animal, em comum as trs apresentam: a) mitocndrias, centrolos e agelos. b) membrana plasmtica, ribossomos e cromatina. c) membrana esqueltica, ribossomos e cromatina. d) parede celular celulsica, membrana plamtica e lisossomos. e) membrana esqueltica, membrana plasmtica e cromatina. 55. Assinale a opo que contm as estruturas presentes tanto em clulas vegetais quanto em clulas animais. a) Membrana plasmtica, parede celular e citoplasma. b) Retculo endoplasmtico, mitocndrias e complexo de Golgi. c) Cloroplastos, lisossomos e centrolos . d) Vacolos, carioteca e lisossomos. e) Cromossomos, carioteca e cloroplastos. 56. Vunesp (modificado) Dos pares de organelas a seguir relacionados, aparecem em clulas vegetais, mas no em animais: a) membrana plasmtica e parede celular. b) parede celular e plastos. c) plastos e centrolos. d) centrolos e lisossomos. e) lisossomos e mitocndrias.
112

57. UFRJ (modificado) Observe os esquemas abaixo, que reproduzem as caractersticas morfolgicas dos tipos celulares l e ll com as respectivas estruturas assinaladas.

Nesses tipos celulares, pode-se armar que as estruturas que so tpicas da clula vegetal esto marcadas com os seguintes nmeros: a) 1 e 4 d) 6 e 7 b) 2 e 3 e) 8 e 10 c) 5 e 9 58. UFMT Quais so as respectivas organelas da clula vegetal responsveis pela respirao, regulao osmtica e sntese de protena? a) Mitocndria, complexo de Golgi e retculo endoplasmtico b) Mitocndria, vacolo e lisossomo c) Ribossomo, vacolo e complexo de Golgi d) Ribossomo, plasmalema e plasto e) Mitocndria, vacolo e ribossomo 59. UFU-MG Considerando uma clula vegetal tpica, d o nome de cada estrutura ou composto cuja funo respectivamente citada a seguir pelas letras de A a D. a) Organela fotossintetizante. b) Organela responsvel pela respirao celular. c) Organela na qual vrias substncias so armazenadas, porm nenhuma substncia ali produzida. Essa organela ocupa um grande espao intracelular. d) Principal constituinte da parede celular. 60. Dentre as vrias organelas presentes numa clula eucaritica, h algumas que apresentam DNA em seu interior (I) e algumas que no so membranosas (II). Constituem exemplos de I e II, respectivamente: a) lisossomos e centrolos. b) cloroplastos e ribossomos. c) mitocndrias e lisossomos. d) dictiossomos e ribossomos. e) mitocndrias e cloroplastos.

61. UFU-MG As clulas animais diferem das clulas vegetais no que diz respeito a algumas estruturas e organelas. Enumere trs caractersticas especcas de vegetais, apontando suas funes celulares. 62. Fuvest-SP (modificado) As principais diferenas entre uma clula vegetal tpica e uma clula animal tpica so: a) presena de membrana plasmtica e ncleo nas clulas animais e ausncia dessas estruturas nas clulas vegetais. b) presena de mitocndrias e plastos nas clulas vegetais e ausncia dessas estruturas nas clulas animais. c) presena de complexo de Golgi e mitocndrias nas clulas animais e ausncia dessas estruturas nas clulas vegetais. d) presena de plastos e parede celulsica nas clulas vegetais e ausncia dessas estruturas nas clulas animais. e) presena de mitocndrias e parede celulsica nas clulas vegetais e ausncia dessas estruturas nas clulas animais. 63. UFRGS-RS (modificado) Observe, a seguir, o desenho de uma clula.

64. Unicamp-SP A gura abaixo mostra o esquema do corte de uma clula, observado ao microscpio eletrnico.

a) A clula proveniente do tecido animal ou vegetal? Justique. b) Se esta clula estivesse em intensa atividade de sntese protica, que organelas estariam mais desenvolvidas ou presentes em maior quantidade? Por qu? 65. UFPR Com base no desenho a seguir, que representa uma clula vegetal, foram feitas seis armaes.

PV2D-07-BIO-14

A partir da anlise do desenho, pode-se armar que se trata de uma clula ..................... . O nmero 1 representa ......................, o nmero 2 corresponde ............. e o nmero 3 refere-se estrutura responsvel por ............... . Assinale a alternativa que completa corretamente as lacunas da descrio anterior. a) vegetal o retculo endoplasmtico mitocndria proteger a clula b) animal o aparelho de Golgi ao cloroplasto armazenar gua e sais minerais c) animal o retculo endoplasmtico mitocndria digerir partculas celulares d) vegetal o retculo endoplasmtico ao cloroplasto organizar os ribossomos e) vegetal o aparelho de Golgi mitocndria realizar a sntese de protenas

1. A estrutura 1 est presente apenas nas clulas de organismos eucariontes. 2. As estruturas 2, 3 e 4 correspondem, respectivamente, a cloroplasto, mitocndria e retculo endoplasmtico rugoso. 3. A estrutura 5 d origem aos ribossomos. 4. A estrutura 6 tem funo de armazenamento de substncias e regulao da presso osmtica. 5. A estrutura 7 tambm est presente nas clulas animais. Esto corretas as armaes: a) 1 2 3 d) 3 5 b) 2 4 5 e) 1 3 5 c) 2 3 4 5 66. UFPE As clulas eucariticas, animal e vegetal, embora guardem semelhanas estruturais e funcionais, apresentam importantes diferenas. Analise as proposies a seguir e assinale a alternativa correta. 1. O vacolo das clulas vegetais atua na digesto intracelular, visto que nestas clulas no h lisossomos como nas clulas animais. 2. O retculo endoplasmtico rugoso e o aparelho de Golgi esto presentes tanto em clulas animais quanto em clulas vegetais.

113

3. Os centrolos, estruturas relacionadas aos movimentos cromossmicos, so ausentes na maioria dos animais e amplamente difundidos entre os vegetais superiores. 4. Os cloroplastos bem como a parede celular esto presentes em clulas vegetais. 5. Nas clulas vegetais no h membrana plasmtica, uma vez que a parede celular existente j sucientemente forte. Esto corretas apenas: a) 1, 3 e 5 b) 1, 2 e 3 c) 2, 3 e 4 d) 2 e 4 e) 1, 2, 3 e 4

70. PUC-MG Observe as estruturas a seguir.

67. UNA-MG Assinale a alternativa correta que relaciona os organides celulares s suas funes correspondentes.

correto armar que: a) a estrutura de nmero 1 responsvel pela produo de carboidratos. b) a estrutura de nmero 1 encontrada apenas nas clulas animais e responsvel pela produo de energia. c) a estrutura de nmero 2 est presente em todas as clulas e o local onde ocorre a fotossntese. d) a estrutura de nmero 3 formada no ncleo celular e tem a funo de armazenar substncias. e) a estrutura 2 pode ocorrer em procariontes e eucariontes. 71. Unifor-CE Fizeram-se as seguintes armaes sobre clulas animais e clulas vegetais superiores: I. Os dois tipos de clulas possuem membrana plasmtica, complexo de Golgi e vcuolo pulstil. II. As clulas vegetais fabricam substncias orgnicas a partir de compostos inorgnicos. III. Cloroplastos, vacolo e parede celular caracterizam as clulas vegetais, enquanto que nuclolo, ribossomos e retculo endoplasmtico so exclusivos de clulas animais. IV. Tanto as clulas animais como as clulas vegetais apresentam peroxissomos e mitocndrias. Somente correto o que se armou em: a) I e II d) II e IV b) I e III e) III e IV c) II e III 72. Os avonides encontrados em vinhos tintos e no suco de uva tm recebido considervel ateno, devido observao de efeitos positivos no controle da taxa de colesterol no sangue. Essas substncias representam tipos de metablitos secundrios, presentes em algumas clulas vegetais. A gura a seguir representa uma clula vegetal. Observe-a.

68. UFR-RJ Um momento mgico de fora e embriaguez foi a mim proporcionado pela natureza brilhante das algas do gnero Noctiluca, quando coletava material para elaborao de minha dissertao. (...)
(Brasil, A.C.S. 1995).

Os organismos, mencionados no texto anterior, so muitas vezes considerados por zologos como animais e por botnicos como vegetais. Como podemos diferenciar esses dois grupos de organismos, segundo os critrios siolgico e celular? 69. Unifesp Considerando a clula do intestino de uma vaca, a clula do parnquima foliar de uma rvore e uma bactria, podemos armar que todas possuem: a) DNA e membrana plasmtica, porm s as clulas do intestino e do parnquima foliar possuem ribossomos. b) DNA, ribossomos e mitocndrias, porm s a clula do parnquima foliar possui parede celular. c) DNA, membrana plasmtica e ribossomos, porm s a bactria e a clula do parnquima foliar possuem parede celular. d) membrana plasmtica e ribossomos, porm s a bactria possui parede celular. e) membrana plasmtica e ribossomos, porm s a clula do intestino possui mitocndrias.
114

Considerando o assunto abordado, assinale a alternativa que indica o local da clula mais provvel de serem encontrados os avonides. a) I c) III b) IV d) II 73. UFSC (modificado) Considere os seres procariontes e eucariontes. Entre as combinaes seguintes, assinale aquela(s) que representa(m) correspondncia correta entre seus elementos e some-as.

75. Unicamp-SP Considere as caractersticas das clulas A, B e C indicadas na tabela adiante presena (+) ou ausncia () de alguns componentes e responda:

a) Quais das clulas A, B e C so eucariticas e quais so procariticas? b) Qual clula (A, B ou C) caracterstica de cada um dos seguintes reinos: monera, animal e vegetal? Que componentes celulares presentes e ausentes os diferenciam? 76. Se fssemos comparar o funcionamento e organizao de uma clula eucarionte com o que ocorre em uma cidade, poderamos estabelecer determinadas analogias. Por exemplo, a membrana plasmtica seria o permetro urbano e o hialoplasma corresponderia ao espao ocupado pelos edifcios, ruas e casas com seus habitantes. As colunas renem algumas similaridades funcionais entre as cidades e a clula eucarionte. 74. Vunesp (modificado) Um aluno, aps ter estudado a organizao celular de seres eucariontes e procariontes, elaborou um quadro indicando com sinais (+) e (), respectivamente, a presena ou ausncia da estrutura em cada tipo de clula. Cidade I. Ruas e avenidas II. Silos e armazns III. Central eltrica IV. Casas com aquecimento solar V. Restaurantes e lanchonetes Clula eucaritica 1. Mitocndria 2. Lisossomo 3. Retculo endoplasmtico 4. Complexo golgiense 5. Cloroplasto Correlacione os locais da cidade com as principais funes correspondentes s organelas celulares e assinale a alternativa correta. a) I 3, II 4, III 1, IV 5 e V 2 a) O aluno, ao construir o quadro, cometeu quatro erros. Quais foram os erros cometidos? b) A permeabilidade seletiva e a diviso celular esto relacionadas a quais estruturas no quadro? b) I 4, II 3, III 2, IV 5 e V 1 c) I 3, II 4, III 5, IV 1 e V 2 d) I 1, II 2, III 3, IV 4 e V 5 e) I 5, II 4, III 1, IV 3 e V 2

PV2D-07-BIO-14

115

77. UFRN (modificado) Analise a ilustrao que segue.

Com base na ilustrao: a) indique o tipo de clula representado, respectivamente, por I, II e III; b) justique a declarao que I faz para II; c) apresente, sob o ponto de vista estrutural e funcional, as razes que levam III a supor que possui algum grau de parentesco com II.

Captulo 2
78. PUC-RS Recentes descobertas sobre Marte, feitas pela NASA, sugerem que o Planeta Vermelho pode ter tido vida no passado. Esta hiptese est baseada em indcios: a) da existncia de esporos no subsolo marciano. b) da presena de uma grande quantidade de oxignio em sua atmosfera. c) de marcas deixadas na areia por seres vivos. d) da existncia de gua lquida no passado. e) de sinais de rdio oriundos do planeta. 79. A quantidade de gua num organismo depende: a) de sua idade e atividade, mas no da espcie a que ele pertence. b) da espcie a que ele pertence e de sua atividade, mas no de sua idade. c) da espcie a que ele pertence e de sua idade, mas no de sua atividade. d) da espcie a que ele pertence, de sua idade e atividade. e) de sua idade, mas no da espcie a que ele pertence ou de sua atividade. 80. Cesesp-PE So funes da gua na clula: I. atuar como solvente da maioria das substncias. II. no atuar na manuteno do equilbrio osmtico dos organismos em relao ao meio ambiente. III. constituir o meio dispersante das substncias celulares. IV. participar das reaes de hidrlise. V. agir como ativador enzimtico.
116

A alternativa que contm as funes verdadeiras : a) I, II, III b) III, IV, V c) I, III, IV d) V, II, III e) III, II, I 81. Madonna, em sua estada em So Paulo, requisitou ao hotel em que estava hospedada o abastecimento de sua sute com determinada bebida chamada Gatorade, alegando perdas por transpirao. No processo de transpirao, alm da gua, ocorrem perdas de: a) sais minerais. b) lipdeos e aminocidos. c) carboidratos. d) protenas. e) aminocidos. 82. PUC-RS O citoplasma celular composto por organelas dispersas numa soluo aquosa denominada citosol. A gua, portanto, tem papel fundamental na clula. Das funes que a gua desempenha no citosol, qual no est correta? a) Participa no equilbrio osmtico. b) Catalisa reaes qumicas. c) Atua como solvente universal. d) Participa de reaes de hidrlise. e) Participa do transporte de molculas.

83. UFRN Elementos que fazem parte da constituio das molculas de ATP, clorola e hemoglobina, so, respectivamente: a) magnsio, ferro e fsforo. b) ferro, magnsio e fsforo. c) fsforo, magnsio e ferro. d) magnsio, fsforo e ferro. e) fsforo, ferro e magnsio. 84. Assinale a alternativa falsa: a) O on de sdio est relacionado com a conduo de impulsos nervosos. b) O on clcio participa da contrao muscular. c) O iodo constituinte das molculas dos hormnios sintetizados pela glndula tireide. d) O on magnsio est presente na molcula da clorola, pigmento fotossintetizante das plantas verdes. e) O on clcio faz parte da molcula da hemoglobina e dos citocromos da cadeia respiratria. 85. UFU-MG Os sais minerais possuem funes diversicadas, podendo existir, nos seres vivos, dissolvidos em gua, sob a forma de ons, ou imobilizados como componentes de esqueletos. Assim sendo, podemos dizer que, dos sais minerais encontrados sob a forma de on, a) o clcio est presente na clorola e indispensvel para que ocorra o processo de fotossntese. b) o sdio apresenta-se sempre em concentraes maiores dentro da clula do que fora dela. c) o ferro est presente na hemoglobina, molcula responsvel pelo transporte de oxignio no organismo. d) o magnsio um on indispensvel na transferncia de energia nos processos metablicos celulares. 86. UFRGS-RS Associe os elementos qumicos da coluna superior com as funes orgnicas da coluna inferior. 1. Magnsio 2. Potssio 3. Iodo 4. Clcio 5. Sdio 6. Ferro ( ( ( ( ( ) Formao do tecido sseo ) Transporte de oxignio ) Assimilao de energia luminosa ) Equilbrio de gua no corpo ) Transmisso de impulso nervoso

A seqncia numrica correta, de cima para baixo, na coluna inferior, : a) 4 3 1 5 2 b) 5 6 3 4 1 c) 4 6 1 5 2 d) 5 4 3 6 1 e) 6 4 2 3 1 87. Mackenzie-SP Um dos riscos de uma dieta exclusivamente vegetariana a ocorrncia de anemia. Assinale a alternativa que apresenta a relao correta entre esse tipo de dieta e a anemia. a) O excesso de bras vegetais provoca uma intoxicao alimentar conhecida como anemia. b) A falta de carne provoca carncia de vitamina D, acarretando anemia. c) A carne contm grandes quantidades de ferro, cuja falta provoca anemia. d) O excesso de vegetais na dieta provoca um aumento nos movimentos peristlticos, provocando perda de nutrientes. e) A falta de aminocidos, encontrados exclusivamente em animais, a causa da anemia. 88. FCMSC-SP Pode-se dizer corretamente que o teor de gua nos tecidos animais superiores: a) maior quanto maior for o seu metabolismo e diminui com o aumento da idade. b) maior quanto maior for o seu metabolismo e aumenta com o aumento da idade. c) maior quanto menor for o seu metabolismo e diminui com o aumento da idade. d) maior quanto menor for o seu metabolismo e aumenta com o aumento da idade. e) apresenta variaes diferentes das citadas nas alternativas anteriores. 89. Analise as frases seguintes e assinale a alternativa correta: I. A distribuio de cargas eltricas na molcula de gua lhe d caractersticas de uma substncia apolar. II. O grande poder de dissoluo da gua muito importante para os organismos, pois todas as reaes qumicas ocorrem no meio aquoso. III. O alto calor especco da gua impede mudanas bruscas de temperatura dentro das clulas. a) Apenas as frases I e II esto corretas. b) Apenas a frase I est correta. c) Apenas as frases II e III esto corretas. d) Todas as frases esto corretas. e) Todas as frases esto erradas.

PV2D-07-BIO-14

117

90. UFSC A gua a substncia mais abundante na constituio dos mamferos. encontrada nos compartimentos extracelulares (lquido intersticial), intracelulares (no citoplasma) e transcelulares (dentro de rgos como a bexiga e o estmago). Sobre a gua e sua presena nos mamferos correto armar que: 01. a quantidade em que encontrada nos organismos invarivel de espcie para espcie. 02. com o passar dos anos, existe uma tendncia de aumentar seu percentual em um determinado tecido. 04. importante fator de regulao trmica dos organismos. 08. em tecidos metabolicamente ativos inexistente. 16. participa da constituio dos uidos orgnicos que transportam substncias dissolvidas por todo o corpo. 32. constitui meio dispersante para facilitar a realizao das reaes qumicas. D como resposta a soma dos nmeros dos tens corretos. 91. Unifesp Um ser humano adulto tem de 40% a 60% de sua massa corprea constituda por gua. A maior parte dessa gua encontra-se localizada: a) no meio intracelular. b) no lquido linftico. c) nas secrees glandulares e intestinais. d) na saliva. e) no plasma sangneo. 92. A contrao muscular e a coagulao do sangue, apesar de serem processos metablicos bastante distintos, tm em comum a dependncia em relao: a) ao fosfato. d) ao clcio. b) ao potssio. e) ao sdio. c) ao glicognio. 93. UFOP-MG A composio qumica das clulas que constituem qualquer ser vivo revela a presena constante de certas substncias que podem ser divididas em dois grandes grupos: inorgnicos e orgnicos. Em relao composio qumica da clula, incorreto armar: a) O on Mg +2 (magnsio) tem papel importante na coagulao do sangue. b) Os ons fosfatos, alm de atuar como ons tampes, impedindo a acidicao ou a alcanilizao do protoplasma, tm relevante papel na formao molecular do DNA, do RNA e do ATP (composto que armazena energia dentro da clula. c) Entre as substncias orgnicas que constituem a clula, podem-se citar: carboidratos, lipdios, aminocidos, protenas e cidos nuclicos. d) Dos componentes inorgnicos presentes na clula, a gua o mais abundante, tendo como funo, entre outras, a de solvente de ons minerais e de muitas substncias orgnicas.
118

94. Fuvest-SP Observando plantas de milho, com folhas amareladas, um estudante de agronomia considerou que essa aparncia poderia ser devida decincia mineral do solo. Sabendo que a clorola contm magnsio, ele formulou a seguinte hiptese: As folhas amareladas aparecem quando h decincia de sais de magnsio no solo. Qual das alternativas descreve um experimento correto para testar tal hiptese? a) Fornecimento de sais de magnsio ao solo em que as plantas esto crescendo e observao dos resultados alguns dias depois. b) Fornecimento de uma mistura de diversos sais minerais, inclusive sais de magnsio, ao solo em que as plantas esto crescendo e observao dos resultados dias depois. c) Cultivo de um novo lote de plantas, em solo suplementado com uma mistura completa de sais minerais, incluindo sais de magnsio. d) Cultivo de novos lotes de plantas, fornecendo metade deles, mistura completa de sais minerais, inclusive sais de magnsio, e outra metade, apenas sais de magnsio. e) Cultivo de novos lotes de plantas, fornecendo metade deles mistura completa de sais minerais, inclusive sais de magnsio, e outra metade, uma mistura com os mesmos sais, menos os de magnsio. 95. UFPE Na(s) questo(es) a seguir escreva nos parnteses a letra (V) se a armativa for verdadeira ou (F) se for falsa. Os sais minerais existem nos seres vivos de forma imobilizada ou dissociados em ons. Pequenas variaes nas porcentagens de ons podem modicar profundamente a permeabilidade, irritabilidade e viscosidade de clula. Analise as propostas apresentadas. ( ) Magnsio: presente na clorola e, portanto, necessrio fotossntese. ( ) Clcio: necessrio para a ao de certas enzimas em importantes processos siolgicos. ( ) Ferro: presente na hemoglobina, faz parte de pigmentos importantes na respirao. ( ) Fosfato: o principal ction extra e intracelular. ( ) Cloreto: importante ction presente tanto na hemoglobina quanto na clorola. ( ) Sdio: importante ction participante dos impulsos nervosos. ( ) Potssio: importante papel na coagulao sangnea. 96. PUC-SP (modificado) Dietas pobres em alimentos que so fontes de sais de ferro para o nosso organismo podero ocasionar: a) anemia. b) diculdade de coagulao do sangue. c) distrbios nervosos. d) sangramento. e) problemas sseos.

97. UFRJ muito comum que as mulheres apresentem um quadro de anemia durante a gravidez. As mulheres anmicas queixam-se de cansao constante, alm de uma acentuada falta de ar. Essa condio em geral pode ser tratada por meio da ingesto de sais de ferro, ou de uma dieta rica em ferro. Explique de que forma a dose extra de ferro alivia os sintomas da falta de ar. 98. UFC-CE (modificado) As alternativas a seguir se referem qumica da clula viva. Escolha as corretas. 01. Das substncias orgnicas que constituem a clula, podemos citar: carboidratos, lipdios, protenas e cidos nuclicos. 02. Dos componentes inorgnicos presentes nas clulas, a gua o mais abundante, tendo como funo, entre outras, a de solvente de ons minerais e de muitas substncias orgnicas. 04. Alm de favorecer a ocorrncia de reaes qumicas, a gua indispensvel no transporte de substncias. 08. Os sais minerais existentes na clula esto sob duas formas: imobilizados como componentes de estruturas esquelticas e dissolvidos na gua em forma de ons. 16. O on sdio (Na+) importante na propagao de impulsos nervosos. D como resposta a soma dos itens corretos. 99. UFPE Os seres vivos apresentam em sua composio qumica tanto substncias orgnicas quanto inorgnicas. Tomando como referencial a distribuio ilustrada na gura a seguir, para a bactria Escherichia coli, assinale a alternativa que inclui as fraes representativas de gua, protenas e sais minerais, nesta ordem.

Vericaram a ocorrncia de carncia de alguns ons minerais e, para suprir tais decincias, apresentaram as propostas seguintes. Proposta I. distribuio de leite e derivados. Proposta II. adicionar or gua que abastece a cidade. Proposta III. adicionar iodo ao sal consumido na cidade, nos termos da legislao vigente. Proposta IV. incentivar os habitantes a utilizar panelas de ferro na preparao dos alimentos. Proposta V. incrementar o consumo de frutas e verduras. Diante destas propostas, responda s questes: a) Qual delas traria maior benefcio populao, no combate anemia? Justique. b) Qual proposta que, pelo seu principal componente inico, poderia reduzir, tambm, os altos ndices de cries dentrias, de osteoporose e de hemorragias? Por qu? 101. UFC-CE Algumas reaes fragmentam molculas orgnicas complexas e ricas em energia, originando molculas mais simples e pobres em energia como dixido de carbono, gua e amnia. O conjunto dessas reaes caracteriza: a) o anabolismo como processo bsico. b) o catabolismo como processo bsico. c) o catabolismo como sntese de molculas variadas. d) a homeostase como processo de fragmentao de molculas. e) a homeostase como processo de sntese de molculas simples. 102. FEI-SP Qual dos alimentos a seguir tem funo basicamente energtica? a) mel d) sal b) bife e) ovo c) cenoura 103. A energia que usamos para realizar os movimentos provm da degradao dos alimentos que ingerimos. Entre os nutrientes que ingerimos, indique o mais utilizado na produo desta energia: a) protena. d) sais minerais. b) carboidrato. e) gua. c) lipdio. 104. Mackenzie-SP As substncias que se destinam a fornecer energia, alm de serem responsveis pela rigidez de certos tecidos, sendo mais abundantes nos vegetais, so os ..., sintetizados pelo processo de ... . A alternativa que preenche corretamente os espaos : a) lipdios, fotossntese. b) cidos nuclicos, autoduplicao. c) cidos nuclicos, fotossntese. d) lcoois, fermentao. e) carboidratos, fotossntese.
119

a) 1, 2 e 3. b) 2, 3 e 6. c) 1, 2 e 6.

d) 2, 3 e 1. e) 3, 2 e 4.

PV2D-07-BIO-14

100. Vunesp Os mdicos de uma cidade do interior do estado de So Paulo, ao avaliarem a situao da sade de seus habitantes, detectaram altos ndices de anemia, de bcio, de crie dentria, de osteoporose e de hemorragias constantes atravs de sangramentos nasais.

105. UECE Assinale a substncia de reserva existente nos animais e nos vegetais, respectivamente: a) amido e glicose. b) glicognio e frutose. c) glicognio e amido. d) protdeos e glicdeos. 106. PUC-RS O polissacardeo formado por unidades de glicose e que representa a principal forma de armazenamento intracelular de glicdios nos animais denominado: a) amido. d) celulose. b) colesterol. e) glicognio. c) ergosterol. 107. Unimep-SP (modificado) Sobre os carboidratos (acares), assinale a alternativa que contm a substncia de menor eccia para nosso organismo em termos de metabolismo energtico. a) glicose d) glicognio b) sacarose e) celulose c) amido 108. A quitina, substncia que forma o exoesqueleto dos artrpodes, classicada quimicamente como: a) monossacardio. d) esteride. b) lipdio simples. e) carotenide. c) polissacardio. 109. O dissacardio encontrado na cana-de-acar e o polissacardio que reveste as clulas vegetais so, respectivamente: a) celulose e glicose. b) sacarose e glicognio. c) frutose e celulose. d) amido e maltose. e) sacarose e celulose. 110. So exemplo de polissacardeos, dissacardeos e hexose, respectivamente: a) celulose, sacarose e amido. b) amido, glicose e frutose. c) quitina, galactose e maltose. d) glicognio, amido e celulose. e) quitina, sacarose e glicose. 111. A hidrlise de um dissacardeo fornece: a) duas molculas de outros dissacardeos. b) uma nova molcula do mesmo dissacardeo. c) uma molcula de aminocidos. d) uma molcula de um monossacardeo. e) duas molculas de monossacardeos.
120

112. Cesgranrio-RJ O esquema a seguir representa uma das etapas do processo digestivo:

As substncias resultantes do processo representado so: a) amido e maltose. d) frutose e glicose. b) glicose e amido. e) frutose e lactose. c) lactose e galactose. 113. UFV-MG Utilizando seus conhecimentos sobre a vida do planeta Terra, responda: a) De onde provm todos os acares naturais utilizados pelos animais e vegetais? b) Por que se diz que, se a produo dos acares naturais acabasse, a vida na terra seria extinta? 114. UFBA (modificado) Um organismo vivo pode ser denido como um sistema que mantm e eventualmente expande suas estruturas ordenadas atravs de uma constante aquisio de energia externa. Na Terra, essa energia vem primariamente do Sol, como se destaca na ilustrao.
Cramer, p.17

a) Quais so os organismos capazes de transformar energia luminosa em energia qumica, que ca armazenada nas molculas de acares? b) Qual o principal acar produzido no fenmeno da fotossntese? Como esse acar ca armazenado nas clulas vegetais?

115. Em laboratrio, foram puricadas quatro substncias diferentes, cujas caractersticas so dadas a seguir: A. Polissacardeo de reserva encontrado em grande quantidade no fgado de vaca. B. Polissacardeo estrutural encontrado em grande quantidade na parede celular de clulas vegetais. C. Polmero de nucleotdeos compostos por ribose e encontrado no citoplasma. D. Polissacardeo encontrado no exoesqueleto dos artrpodes. As substncias A, B, C e D so, respectivamente: a) glicognio, celulose, RNA, quitina. b) amido, celulose, RNA, quitina. c) amido, pectina, RNA, protena. d) glicognio, celulose, DNA, vitamina. e) glicognio, celulose, DNA, vitamina. 116. Vunesp Os acares complexos, resultantes da unio de muitos monossacardios, so denominados de polissacardios. a) Cite dois polissacardios de reserva energtica, sendo um de origem animal e outro de origem vegetal. b) Indique um rgo animal e um rgo vegetal onde cada um destes acares pode ser encontrado. 117. Originria da ndia, a banana uma das frutas h mais tempo consumida pelo homem (...) Rica em acares e vitamina C, foi chamada o alimento dos sbios. A banana tambm favorece a secreo dos neurotransmissores, sendo um alimento completo e de baixa caloria (...). A banana um excelente combustvel para os esportistas. Isto deve-se ao fato de essa fonte natural de energia (...) conter, em propores ideais, diversos carboidratos (...).
In: Tudo O livro do conhecimento, encarte da revista Isto.

Considerando a quantidade energtica dos alimentos e com base nos dados da tabela, assinale a alternativa que contm a dieta mais adequada para um jogador de futebol antes de uma competio. a) Arroz com farinha de mandioca b) Arroz com toucinho c) Carne seca com farinha de mandioca d) Carne seca com toucinho 119. Unama-PA Sob o Sol forte, seu Manoel, romeiro nordestino que acompanhava o Crio seguro corda, suava muito, tinha a respirao ofegante e fraqueza muscular nas pernas. Nos intervalos de parada da procisso, para homenagear a Santa, seu Manoel comia um pedao de rapadura que levava no bolso. Sentindo melhora da fraqueza, retornava rmemente sua devoo. a) Explique como o consumo de rapadura, alimento rico em sacarose, melhorou a condio fsica de seu Manoel. b) Qual o papel biolgico do suor, eliminado por seu Manoel? 120. UFMS (modificado) Uma das principais formas de armazenagem de glicose pelas clulas o polmero denominado glicognio. Sobre esse polissacardeo, correto armar: 01. Constitui a principal forma de armazenagem de glicose em clulas animais; em clulas vegetais, esse papel do amido. 02. Na verdade, corretamente, um monossacardeo com diversos ismeros, composto por uma nica molcula, cuja frmula : C6H12O6. 04. Constitui a principal forma de armazenagem em clulas vegetais e no-animais, sob a forma de um amido. 08. Pode ser armazenado no fgado e nos msculos, sob a forma de glicognio heptico e muscular, respectivamente. 16. Sua hidrlise, que pode ser estimulada pelos hormnios, provoca aumento da taxa de glicose no sangue. Some os itens corretos. 121. UFC-CE Sobre as substncias que compem os seres vivos, correto armar que: 01. os carboidratos, os lipdios e as vitaminas so fontes de energia para os seres vivos. 02. a gua a substncia encontrada em maior quantidade nos seres vivos. 04. alm de sua funo energtica, os carboidratos esto presentes na formao de algumas estruturas dos seres vivos. 08. as gorduras constituem o principal componente estrutural dos seres vivos. 16. os seres vivos apresentam uma composio qumica mais complexa do que a matria bruta, sendo formados por substncias orgnicas, como as protenas, os lipdios, os carboidratos, as vitaminas e os cidos nucleicos. Some os itens corretos.
121

Com base nessa informao, responda: Os carboidratos podem se apresentar, na banana, sob a forma de glicose, frutose e amido. Em relao a essas substncias, responda: a) Qual a classificao dos acares mencionados? b) Quais acares podem ser aproveitados diretamente? Qual precisa sofrer digesto? 118. UFMG Esta tabela mostra o teor de protenas, carboidratos e lpidios em alguns alimentos, expresso em gramas por 100 g de peso seco.

PV2D-07-BIO-14

122. Unifesp Uma dieta com consumo adequado de carboidratos, alm de prover energia para o corpo, ainda proporciona um efeito de preservao das protenas. A armao est correta porque: a) os carboidratos, armazenados sob a forma de gordura corprea, constituem uma barreira protetora das protenas armazenadas nos msculos. b) se as reservas de carboidratos estiverem reduzidas, vias metablicas, utilizaro as protenas para ns energticos. c) as enzimas que quebram os carboidratos interrompem a ao de outras enzimas que desnaturam protenas. d) o nitrognio presente nos aminocidos das protenas no pode ser inativado em presena de carboidratos. e) a energia liberada pela quebra de carboidratos desnatura enzimas que degradam protenas. 123. Dos acares, cujas frmulas so representadas a seguir, um monossacardeo e o outro, dissacardeo: C7H14O7 Acar A C6H10O5 Acar B

127. Ufla-MG (modificado) Os trs principais lipdios encontrados nas membranas celulares animais so: a) fosfolipdio, colesterol e glicolipdio. b) colesterol, glicolipdio e arginina. c) esngolipdio, celulose e peptdios. d) fosfolipdio, adenina e glicolipdio. e) fosfolipdio, cerdios e adenina. 128.

a) Qual deles o monossacardeo? Por qu? b) Qual o dissacardeo? Como seriam as molculas que o originaram? 124. So funes dos lipdios, exceto: a) atuarem como isolante trmico. b) serem componentes da membrana plasmtica. c) entrarem na composio de alguns hormnios esterides. d) servirem como reserva energtica. e) serem encontrados somente em animais. 125. Mackenzie-SP As substncias usadas pelos organismos vivos, como fonte de energia e como reserva energtica, so, respectivamente: a) gua e glicdios. b) gua e sais minerais. c) lipdios e sais minerais. d) glicdios e sais minerais. e) glicdios e lipdios. 126. Os lipdios mais comumente usados na nossa alimentao so integrantes do grupo dos: a) monoglicerdios. d) esterides. b) triglicerdios. e) lipdios complexos. c) cerdeos

A anlise do quadro permite identicar as molculas orgnicas em I, II e III como sendo, respectivamente: a) fosfolipdios, glicose e celulose. b) fosfolipdios, vitaminas e cidos nuclicos. c) glicoprotenas, vitaminas e lignina. d) sais minerais, glicose e protenas. e) cidos nuclicos, triglicrides e celulose. 129. UFRN (modificado) Embora seja visto como vilo, o colesterol muito importante para o organismo humano, porque ele : a) o precursor da sntese de hormnios sexuais. b) o agente oxidante dos carboidratos. c) o responsvel pela resistncia de cartilagens e tendes. d) o co-fator das reaes biolgicas. 130. UFC-CE O colesterol tem sido considerado um vilo nos ltimos tempos, uma vez que as doenas cardiovasculares esto associadas a altos nveis desse composto no sangue. No entanto, o colesterol desempenha importantes papis no organismo. Analise os itens a seguir. I. O colesterol importante para a integridade da membrana celular. II. O colesterol participa da sntese dos hormnios esterides. III. O colesterol participa da sntese dos sais biliares. Da anlise dos itens, correto armar que: a) somente I verdadeiro. b) somente II verdadeiro. c) somente III verdadeiro. d) somente I e II so verdadeiros. e) I, II e III so verdadeiros.

122

131. UEL-PR Os esquemas a seguir mostram as quantidades relativas de protenas (P) e de lipdios (L) em diversos tipos de carnes.

Uma pessoa com colesterol elevado no deve ingerir: a) frango e ganso. d) frango e coelho. b) frango e porco. e) porco e coelho. c) ganso e porco. 132. Fuvest-SP Para vericar a hiptese a lipase age sobre as gorduras, provocando a formao de cidos graxos, foi feita uma experincia, colocando-se em tubos de ensaio os seguintes materiais: Tubo I II III Substrato Leite Leite gua Indicador Rosa Rosa Rosa Lipase Presente Ausente Presente

135. Os lipdios so: a) substncias insolveis na gua, mas solveis nos chamados solventes orgnicos (lcool, ter, benzeno). b) os compostos energticos mais consumidos pelas clulas. c) apresentados como fosfolipdios no interior da clula, mas nunca na estrutura da membrana plasmtica. d) formados por ligaes peptdicas de cidos graxos com lcoois. e) mais abundantes na composio qumica dos vegetais do que na dos animais. 136. H alguns meses, foi lanado no mercado um novo produto alimentcio voltado para o consumidor vegetariano: uma bebida sabor iorgute feita base de leite de soja. poca, os comerciais informavam tratar-se do primeiro iorgute totalmente isento de produtos de origem animal. Sobre esse produto, pode-se dizer que isento de: a) colesterol e caboidratos. b) lactose e colesterol. c) protenas e colesterol. d) protenas e lactose. e) lactose e carboidratos. 137. UEL-PR O leo vegetal, componente do biodiesel, do grupo dos triglicerdios, podendo ser extrado de vrias fontes, como amendoim, mamona, algodo e girassol. Sobre os triglicerdios, correto armar: a) So substncias hidroflicas sintetizadas nos vaclos das clulas. b) So lipdios estruturais sintetizados nos cloroplastos das clulas. c) So lipdios que formam as membranas celulares. d) So lipdios de reserva energtica. e) So produtos diretos da fotossntese. 138. Os lipdios compreendem um grupo quimicamente variado de molculas que exercem inmeras funes em nosso organismo. Em relao aos lipdios, faa as associaes corretas. a) cera c) fosfolipdio b) esteride d) glicerdeo ( ) lipdio estrutural, presente nas membranas plasmticas dos seres vivos, que apresenta um grupo fosfato em sua constituio. ( ) lipdio complexo, constitudo basicamente por um conjunto de quatro anis. ( ) lipdio constituinte dos leos e gorduras. ( ) classe de lipdios constituda por uma longa molcula de cido graxo associado a uma longa molcula de lcool. Impermeabilizante de folhas e frutos.
123

Sabendo-se que o indicador usado passa de rosa a azul em meio cido, a hiptese car comprovada se a cor do indicador mudar apenas: a) no tubo I. d) nos tubos I e III. b) no tubo II. e) nos tubos II e III. c) nos tubos I e II. 133. UFSC Considere os compostos, apresentados na coluna superior, e as caractersticas, apresentadas na coluna inferior e, aps, assinale com V (verdadeiro) ou F (falso) as proposies adiante. I. gua II. sal mineral III. monossacardio IV. lipdio A. B. C. D. ( ) ( ) ( ) ( ) ( ) molcula mais abundante na matria viva composto orgnico composto inorgnico tipo de carboidrato III D II A III B IB IV B

134. UFV-MG Com relao s substncias qumicas dos seres vivos, resolva os itens a seguir: a) Qual a forma de armazenamento dos carboidratos nos tecidos animais e vegetais, respectivamente? b) Qual a unidade monomrica dos polissacardios? c) Em qual tipo de lipdio so classicados os leos e gorduras?

PV2D-07-BIO-14

139. PUC-MG (modificado) Os lipdios compreendem um grupo quimicamente variado de molculas orgnicas tipicamente hidrofbicas. Diferentes lipdios podem cumprir funes especcas em animais e vegetais. Assinale a alternativa incorreta. a) Os fosfolipdios so os principais constituintes das membranas biolgicas. b) Os esterides podem desempenhar papis regulatrios como, por exemplo, os hormnios sexuais. c) Os triglicerdeos podem atuar como isolantes trmicos ou reserva energtica em animais. d) O colesterol uma das principais fontes de energia para o fgado. 140. O colesterol um esteride que constitui um dos principais grupos de lipdios. Com relao a esse tipo particular de lipdio, correto armar que a) na espcie humana, o excesso de colesterol aumenta a ecincia da passagem do sangue no interior dos vasos sangneos, acarretando a arteriosclerose. b) o colesterol participa da composio qumica das membranas das clulas e precursor dos hormnios sexuais masculino (testosterona) e feminino (estrgeno). c) o colesterol encontrado em alimentos tanto de origem animal como vegetal (por ex: manteigas, margarinas, leos de soja, milho etc.) uma vez que derivado do metabolismo dos glicerdeos. d) nas clulas vegetais, o excesso de colesterol diminui a ecincia dos processos de transpirao celular da fotossntese. 141. UFC-CE Os esterides so lipdios bem diferentes dos glicerdeos e das ceras, apresentando uma estrutura composta por quatro anis de tomos de carbono interligados. O colesterol um dos esterides mais conhecidos, devido sua associao com as doenas cardiovasculares. No entanto, esse composto muito importante para o homem, uma vez que desempenha uma srie de funes. Cite: a) duas principais funes do colesterol; b) duas origens do colesterol sanguneo. 142. UFRGS-RS (modificado) Assinale com V (verdadeiro) ou F (falso) as seguintes consideraes o colesterol, um lipdio do grupo dos esterides. ( ) Ele participa da composio da membrana plasmtica das clulas animais. ( ) Ele sintetizado no pncreas, degradado no fgado e excretado na forma de sais biliares. ( ) Ele precursor dos hormnios sexuais masculino e feminino. ( ) As formas de colesterol HDL e LDL so determinadas pelo tipo de lipoprotena que transporta o colesterol.
124

A sequncia correta de preenchimento dos parnteses, de cima para baixo, : a) V F V V. d) F F V F. b) F V F V. e) V V F V. c) V V F F. 143. PUC-MG Lipoprotenas so protenas transportadoras de lipdios na corrente sangnea. O esquema adiante representa a captao heptica e o controle da produo dessas lipoprotenas que podem ser: de baixa densidade (LDL), de muito baixa densidade (VLDL), de densidade intermediria (IDL) e ainda a de alta densidade (HDL), que no est representada no desenho. Com base na gura e em seus conhecimentos, assinale a armativa incorreta. Dieta normal Dieta rica em colesterol (sem colesterol)

a) Altos nveis plasmticos de LDL favorecem a reduo dos riscos de enfarto do miocrdio. b) Em uma dieta rica em colesterol, o fgado ca repleto de colesterol, o que reprime os nveis de produo de receptores de LDL. c) A decincia do receptor, por origem gentica ou diettica, eleva os nveis plasmticos de LDL. d) Em uma dieta normal, a VLDL secretada pelo fgado e convertida em IDL nos capilares dos tecidos perifricos. 144. A(s) principal(is) substncia(s) orgnica(s) que encontramos nas clulas dos seres vivos animais (so): a) gua. d) sais. b) gorduras. e) vitaminas. c) protenas. 145. A protena formada a partir do encadeamento de molculas mais simples chamadas: a) nucleotdeos. b) aminocidos. c) nucleosdeos. d) glicdios. e) cidos graxos. 146. Dentre as afirmaes a seguir, assinale a(s) que caracteriza(m) corretamente as protenas. I. So essencialmente formadas por C, H, O, N. II. So macromolculas formadas pela unio sucessiva de carboidratos de diversos tipos.

III. Podem formar estruturas diferenciadas, denominadas primria, secundria, terciria ou quaternria. IV. Seu constituinte bsico o aminocido. a) I, II e III. d) II e IV. b) II, III e IV. e) Apenas I. c) I, III e IV. 147. Cesgranrio-RJ Os meios de comunicao, recentemente, divulgaram que a venda de carne para a populao caiu em 60%, sem haver aumento no consumo de aves e peixes. Este fato preocupante porque indica que foi reduzida a ingesto de nutrientes com funo plstica, que so: a) glicdios. b) lipdios. c) vitaminas. d) sais minerais. e) protenas. 148. PUC-RJ Chama-se aminocido essencial ao aminocido que: a) no sintetizado no organismo humano. b) sintetizado em qualquer organismo animal. c) s existe nos vegetais. d) tem funo semelhante das vitaminas. e) indispensvel ao metabolismo energtico. 149. Cesgranrio-RJ A margarina nlandesa que reduz o colesterol chega ao mercado americano no ano que vem.
Jornal do Brasil

151. PUCCamp-SP Os fenilcetonricos tm falta de uma enzima do fgado responsvel pelo metabolismo do aminocido fenilalanina. Para que essa substncia no se acumule no sangue, sua dieta alimentar deve evitar, dentre os nutrientes mencionados a seguir: a) as protenas apenas. b) os carboidratos apenas. c) as gorduras apenas. d) as gorduras e aos carboidratos. e) as gorduras e as protenas. 152. Fatec-SP Os nutrientes desempenham vrias funes no organismo humano: fornecem energia para todos os processos vitais; suprem o organismo de substncias que permitem o crescimento e regenerao das partes do corpo; regulam os processos siolgicos. A alternativa que relaciona a seqncia correta dos nutrientes com as funes anteriormente discriminadas : a) carboidratos; vitaminas; protenas. b) vitaminas; protenas; carboidratos. c) protenas; vitaminas; carboidratos. d) carboidratos; protenas; vitaminas. e) vitaminas; carboidratos; protenas. 153. PUC-RJ A gota um distrbio siolgico que causa dor e inchao nas articulaes, por acmulo de cido rico, um resduo metablico nitrogenado. Considerando-se a composio qumica dos diferentes nutrientes, que tipo de alimento um indivduo com gota deve evitar? a) O rico em gordura. b) O pobre em gordura. c) O pobre em protenas. d) O rico em sais de sdio. e) O rico em protenas. 154. FEI-SP Muitas estruturas do nosso organismo possuem em sua estrutura o colgeno. Quimicamente, o colgeno pertence ao grupo de: a) carboidratos d) glicdeos b) lipdeos e) cidos nuclicos c) protenas 155. Fuvest-SP Leia o texto a seguir, escrito por Jns Jacob Berzelius em 1828. Existem razes para supor que, nos animais e nas plantas, ocorrem milhares de processos catalticos nos lquidos do corpo e nos tecidos. Tudo indica que, no futuro, descobriremos que a capacidade de os organismos vivos produzirem os mais variados tipos de compostos qumicos reside no poder cataltico de seus tecidos. A previso de Berzelius estava correta, e hoje sabemos que o poder cataltico mencionado no texto deve-se: a) aos cidos nuclicos. d) s protenas. b) aos carboidratos. e) s vitaminas. c) aos lipdios.
125

O uso de albumina est sob suspeita.


O Globo

Lactose no degradada gera diculdades digestivas.


Imprensa Brasileira

As substncias em destaque nos artigos so, respectivamente, de natureza: a) lipdica, protica e glicdica. b) lipdica, glicdica e protica. c) glicdica, orgnica e lipdica. d) glicerdica, inorgnica e protica. e) glicerdica, protica e inorgnica. 150. Fatec-SP Alguns pacientes da UTI dos hospitais no podem alimentar-se por via oral, sendo, ento necessrio aliment-los injetando em suas veias soro com nutrientes variados. Assinale a alternativa que contm somente nutrientes que podem ser injetados nas veias, pois sero assimilados pelas clulas do ser humano. a) Vitaminas e sacarose. b) Protenas e vitaminas. c) Aminocidos e monossacardeos. d) Protenas e aminocidos. e) DNA, RNA e protenas.

PV2D-07-BIO-14

156. PUC-SP Considere as seguintes armativas. I. As protenas so substncias de grande importncia para os seres vivos. Muitas participam da construo da matria viva. II. As protenas chamadas enzimas facilitam reaes qumicas celulares. III. Os anticorpos, que tambm so protenas, funcionam como substncia de defesa. Assinale: a) se somente I estiver correta. b) se somente II estiver correta. c) se somente III estiver correta. d) se I e II estiverem corretas. e) se todas estiverem corretas. 157. Duas protenas sero consideradas iguais se apresentarem: a) Apenas o mesmo nmero de aminocidos. b) Apenas os mesmos tipos de aminocidos. c) Apenas a mesma seqncia de aminocidos. d) O mesmo nmero e tipos de aminocidos, mas no necessariamente a mesma seqncia. e) O mesmo nmero, tipos e seqncia de aminocidos. 158. EFOA-MG (modificado) As frmulas a seguir representam a unio entre dois aminocidos:

160. UniRio-RJ A puricao e anlise de uma molcula biolgica indicou a presena de nove diferentes monmeros. Podemos armar que se trata de um(a): a) cido nuclico. d) protena. b) glicerdio. e) vitamina. c) esteride. 161. PUCCamp-SP Uma amostra do contedo intestinal de uma pessoa apresentou-se rica em aminocidos e glicose. Pode-se concluir que a pessoa alimentou-se de: a) lipdios e protenas. b) lipdios e amido. c) lipdios e carboidratos. d) protenas e carboidratos. e) protenas e cidos graxos. 162. UEL-PR Consideram-se aminocidos essenciais para um determinado animal aqueles: a) de que ele necessita e sintetiza a partir de outras substncias. b) de que ele necessita mas no consegue sintetizar, tendo que receb-los em sua dieta. c) de que ele necessita apenas nas primeiras etapas de seu desenvolvimento. d) obtidos diretamente a partir de vegetais, que so os nicos organismos a sintetiz-los. e) resultantes da degradao de suas prprias protenas. 163. UFMS Os organismos animais conseguem sintetizar a maioria dos aminocidos. As reaes de sntese ocorrem nas clulas do parnquima heptico. Porm, alguns aminocidos no so sintetizados pelos animais. Em relao a essas molculas, assinale a alternativa incorreta. a) Os aminocidos naturais so aqueles produzidos no organismo. b) Os aminocidos essenciais so aqueles que devem ser obtidos atravs da alimentao. c) Nas protenas da carne, do leite e dos ovos, encontram-se todos os aminocidos essenciais, sendo, por isso, considerados alimentos completos. d) Os aminocidos so unidades dos polissacardeos. e) Um elevado nmero de aminocidos pode se originar por hidrlise de uma protena. 164. UFTM-MG Leia com ateno a charge:

Qual o nome da ligao que ser formada com a retirada dos grupos destacadas no tracejado? a) Ligao peptdica. b) Ligao aminopolipeptdica. c) Ligao cetnica. d) Ligao carboxlica. e) Ponte de hidrognio. 159. A partir da anlise do esquema abaixo, diga o que representam as letras A, B, C e D.

126

Sabendo-se que triptofano e fenilalanina so dois aminocidos essenciais, assinale a alternativa correta. a) O predador precisa comer o rato para ingerir dois aminocidos essenciais que, dentre outros, iro garantir a sntese de suas protenas. b) Se o predador no comer o rato, no ter protenas de alto teor calrico, pois os compostos citados so molculas altamente energticas. c) Ao comer o rato, o predador estar ingerindo dois compostos fundamentais para a sntese de fosfolipdios e, com isso, garantindo a estabilidade das membranas celulares. d) O predador no necessita dos compostos citados, pois ele j capaz de sintetizar aqueles aminocidos denominados naturais. e) Ao comer o rato, o predador estar ingerindo dois compostos fundamentais para a sntese dos carboidratos de reserva. 165. Unitau-SP As _______ so compostos formados por _______ unidos (as) por ligaes _______ e as _______ so _______ orgnicos, de natureza _______ sensveis s variaes de temperatura. Os termos que corretamente preenchem as lacunas so, respectivamente: a) gorduras protenas peptdicas enzimas acares lipdica. b) protenas aminocidos energticas gorduras compostos protica. c) protenas aminocidos peptdicas enzimas catalisadores protica. d) enzimas aminocidos hdricas protenas catalizadores lipdica. e) protenas acares proticas enzimas acares enzimtica. 166. Quanto s protenas, principais componentes estruturais das clulas animais, podemos armar corretamente que: a) duas protenas que, por hidrlise, produzem os mesmos aminocidos, nas mesmas propores, podem no ser iguais. b) desnaturao signica ligao entre aminocidos e uma sntese por desidratao. c) a estrutura terciria de uma protena determina sua forma, mas no interfere em sua funo, ou especicidade. d) alm da funo plstica, as protenas tambm tm importante funo de reserva energtica alm da defesa. e) o colgeno e a elastina so as duas protenas contrteis dos msculos que deslizam, provocando os movimentos.
PV2D-07-BIO-14

hemoglobina radioativa no sangue do animal. Isso aconteceu porque as protenas do alimento foram: a) absorvidas pelas clulas sangneas. b) absorvidas pelo plasma sangneo. c) digeridas e os aminocidos marcados foram utilizados na sntese de carboidratos. d) digeridas e os aminocidos marcados foram utilizados na sntese de lipdios. e) digeridas e os aminocidos marcados foram utilizados na sntese de protenas. 168. Se voc comer carne bovina, isso ir ajudar na construo de suas prprias protenas, porque: a) sendo ambos mamferos, o homem e o boi possuem protenas idnticas; assim, as protenas do boi (da carne) passam para a circulao humana com facilidade. b) uma vez digeridas, as protenas do boi fornecem aminocidos com os quais seu organismo construir as protenas humanas. c) as protenas da carne bovina sero utilizadas, nas clulas do seu organismo, como fonte de energia para sntese de protenas humanas. d) a carne do boi possui vitaminas essenciais para o bom funcionamento do organismo humano. e) a carne bovina apresenta alto teor de enzimas, importantes para o bom funcionamento celular do nosso organismo. 169. Uma protena retirada de clula epitelial humana possui: 10 VAL, 32 ALA, 14 TRE, 27 HIS, 49 GLI, 24 LIS. De clulas sangneas do mesmo indivduo, foi extrada outra protena, cuja hidrlise demonstrou ser formada de: 10 VAL, 32 ALA, 14 TRE, 27 HIS, 49 GLI, 24 LIS. Em face de tais informaes, correto concluir que: a) trata-se da mesma protena, pois em ambos encontramos o mesmo nmero de aminocidos. b) trata-se da mesma protena, pois a quantidade de cada aminocido igual em ambas. c) trata-se da mesma protena, pois ambas tm os mesmos aminocidos. d) trata-se de protenas diferentes, pois foram obtidas de clulas estrutural, embrionria e funcionalmente diferentes. e) pode-se tratar de protenas iguais ou diferentes, pois s a anlise da disposio dos aminocidos poder revelar a identidade ou a diferena entre elas. 170. UEM-PR A ligao peptdica resulta da unio entre o grupo: a) carboxila de um aminocido e o grupo carboxila do outro. b) carboxila de um aminocido e o grupo amina do outro. c) amina de um aminocido e amina de outro. d) amina de um aminocido e radical R do outro. e) carboxila de um aminocido e radical R do outro.
127

167. Fuvest-SP Um camundongo foi alimentado com uma rao contendo protenas marcadas com um istopo radioativo. Depois de certo tempo, constatou-se a presena de

171. Esquematize a formao de uma ligao peptdica entre os dois aminocidos cujas frmulas esto mostradas abaixo:

172. UMC-SP Para formar protenas, a clula une aminocidos, como est esquematizado entre dois deles nesta questo.

174. Considere as armativas abaixo: I. Uma seqncia linear de aminocidos, unidos por ligaes peptdicas, denominada estrutura primria de uma protena. Essa seqncia a que determina sua funo biolgica. II. A estrutura linear de uma protena sofre um dobramento sobre si mesma, atravs de pontes de dissulfeto, formando uma estrutura secundria. A estrutura terciria ou quaternria de uma protena responsvel por sua atividade biolgica. III. Uma alterao irreversvel de uma protena denominada desnaturao. Isso acarreta uma destruio de sua estrutura quaternria, terciria e secundria. Esto corretas: a) I d) II e III b) I e II e) I, II e III c) I e III 175. UFRJ A glicoquinase e a hexoquinase so duas enzimas que reagem com o mesmo substrato, a glicose. Ambas so enzimas intracelulares que fosforilam a glicose formando glicose 6-fosfato (G6P). Dependendo da enzima produtora, a G6P pode ser degradada na via da gliclise para gerar energia ou ento ser usada para sntese de glicognio. A gliclise ocorre nos tecidos em geral e a sntese de glicognio ocorre principalmente no fgado. A sntese do glicognio somente acontece quando existe excesso de glicose no sangue. Essa uma forma de armazenar esse acar. Observe a gura a seguir, que apresenta as velocidades de reao dessas duas enzimas em funo da concentrao da glicose. Nveis normais de glicose no sangue esto ao redor de 4mM.
VELOCIDADE DE REAO (unidade arbitrria)

a) Como se chama a ligao entre dois aminocidos? b) Qual o nome da molcula resultante desta ligao entre dois aminocidos? c) Qual o signicado de R1 e R2 nas molculas dos aminocios? 173. UFAL De acordo com as proposies a seguir referentes qumica celular, assinale a alternativa incorreta. a) Os sais minerais podem ser encontrados como constituintes de estruturas dos seres vivos, como por exemplo, o fosfato de clcio, abundante nos ossos e dentes. Quando dissolvidos em gua esses sais se dissociam em ons, fundamentais para o metabolismo celular. b) Os principais polissacardeos encontrados nos animais so o amido e o glicognio. c) O colesterol um esteride que participa da composio qumica das membranas celulares das clulas animais. d) Os aminocidos possuem, em suas molculas, um grupamento amina (NH2) e um grupamento carboxila (COOH). Esses grupamentos esto ligados a um mesmo tomo de carbono que, por sua vez, est ligado a um tomo de hidrognio e a um radical que varia de aminocido para aminocido.
128

10 9 8 7 6 5 4 3 2 1 0

HEXOQUINASE GLICOQUINASE

2,5

10

15

CONCENTRAO DE GLICOSE (m M)

Qual das duas enzimas gera G6P para sntese de glicognio heptico? Justique sua resposta. 176. Cesgranrio-RJ Nos laboratrios qumicos, a maneira mais freqente de ativar uma reao fornecendo calor, que funciona como energia de ativao. Nos seres vivos, isso no possvel, pois corre-se o risco de as protenas serem desnaturadas.

A estratgia desenvolvida pelos seres vivos para superar a barreira inicial das reaes foi a utilizao de: a) ATP. d) glicose. b) enzimas. e) clorola. c) hormnios. 177. Assinale a alternativa que melhor se ajusta ao conceito de enzimas. a) Reagem irreversivelmente com o substrato. b) So consumidas durante os processos enzimticos. c) So biocatalisadores de origem orgnica. d) Atuam independentemente do pH do meio. e) S atuam em temperatura em torno de 25 C. 178. Cesgranrio-RJ Cerca de 27 milhes de brasileiros tm intolerncia ao leite por decincia na produo de uma enzima do intestino. Sobre a enzima citada no artigo, e as enzimas em geral, podemos armar que: a) aumentam a energia de ativao necessria para as reaes. b) atuam de forma inversamente proporcional ao aumento da temperatura. c) so altamente especcas em funo de sua forma terciria. d) so estimuladas pela variao do grau de acidez do meio. e) so consumidas durante o processo, no podendo realizar nova reao do mesmo tipo. 179. Mackenzie-SP Considerando-se a denio de enzimas, assinale a alternativa correta. I. So catalisadores orgnicos, de natureza protica, sensveis s variaes de temperatura. II. So substncias qumicas, de natureza lipdica, sendo consumidas durante o processo qumico. III. Apresentam uma regio chamada stio ativo, qual se adapta a molcula do substrato. a) Apenas a armativa I correta. b) Apenas as armativas II e III so corretas. c) Apenas as armativas I e III so corretas. d) Todas as armativas so corretas. e) Nenhuma armativa correta. 180. O esquema a seguir representa os reagentes e os produtores de reaes qumicas existentes nas clulas.
Folha de So Paulo

Essa seqncia de reaes um modelo que mostra a: a) ao de uma enzima na sntese de uma substncia. b) produo de ADP a partir de ATP. c) formao de um nucleotdeo. d) digesto de uma protena. e) oxidao de uma molcula de glicose. 181. UFRN
NQUEL NUSEA Fernando Gonzales

www.niquel.com.br

Folha de S. Paulo

Para digerir o alimento normalmente obtido na boca do jacar, a ave necessitar principalmente de: a) endonucleases. c) peptidases. b) glicosidases. d) lipases. 182. Mackenzie-SP Para inibir a ao de uma enzima, pode-se fornecer clula uma substncia que ocupe o stio ativo dessa enzima. Para isso, essa substncia deve: a) estar na mesma concentrao da enzima. b) ter a mesma estrutura espacial do substrato da enzima. c) recobrir toda a molcula da enzima. d) ter a mesma funo biolgica do substrato da enzima. e) promover a desnaturao dessa enzima. 183. O esquema abaixo representa um processo de:

PV2D-07-BIO-14

a) consumo da enzima durante a reao qumica. b) interferncia do pH do meio. c) desnaturao causada por elevao da temperatura. d) inativao da enzima por compostos qumicos. e) desnaturao causada por choques mecnicos.
129

184. UFV-MG O grco a seguir representa a atividade enzimtica de uma determinada reao em funo da temperatura:

So verdadeiras as frases: a) I e III, apenas. b) III e IV, apenas. c) I e II, apenas. d) I, II e IV, apenas. e) I, II, III e IV. 187. As protenas so substncias fundamentais na constituio de qualquer ser vivo. Algumas protenas as enzimas tm importante papel como catalisadoras das reaes do metabolismo celular. No entanto, essas molculas so, em geral, extremamente suscetveis ao aumento da temperatura; a maioria delas deixa de funcionar corretamente a temperaturas superiores a 50 oC. Qual a explicao para esse fenmeno? a) Temperaturas muito altas desestabilizam certas ligaes da molcula da enzima, alterando sua forma. b) Temperaturas acima de 50 oC alteram o pH da clula, inativando a enzima. c) As enzimas s funcionam corretamente temperatura normal do corpo humano (cerca de 36 oC). d) Com o calor, as ligaes peptdicas se desfazem e, como resultado, os aminocidos cam livres. e) O calor altera a estrutura primria (seqncia dos aminocidos) da protena. 188. Os organismos vivos possuem a capacidade de sintetizar milhares de molculas de diferentes tipos em precisas propores, a m de manterem o protoplasma funcional. Estas reaes de sntese e degradao de biomolculas, que compem o metabolismo celular, so catalisadas por um grupo de molculas denominadas enzimas. Estes importantes catalisadores biolgicos podem possuir algumas das seguintes caractersticas: I. Enzimas so a maior e mais especializada classe de lipdios.

A seta indica o ponto: a) timo de temperatura para a atividade enzimtica. b) de desnaturao da enzima. c) de desnaturao do produto. d) mnimo da temperatura para a reao enzimtica. e) mximo de substrato obtido. 185. UFV-MG Assinale a opo que representa a velocidade das reaes enzimticas em relao temperatura: a) d)

b)

e)

c)

II. Enzimas possuem grande especicidade para seus substratos e freqentemente no atuam sobre molculas com pequena diferena em sua congurao. 186. UFSCar-SP Considere as quatro frases seguintes. I. Enzimas so protenas que atuam como catalisadores de reaes qumicas. II. Cada reao qumica que ocorre em um ser vivo, geralmente, catalisada por um tipo de enzima. III. A velocidade de uma reao enzimtica independe de fatores como temperatura e pH do meio. IV. As enzimas sofrem um enorme processo de desgaste durante a reao qumica da qual participam.
130

III. Enzimas aceleram as reaes qumicas, sem serem modicadas durante o processo. IV. Substratos so substncias sobre as quais as enzimas agem, convertendo-os em um ou mais produtos. Marque a alternativa correta. a) Esto corretas apenas as caractersticas I, II e III. b) Esto corretas apenas as caractersticas II, III e IV. c) Esto corretas apenas as caractersticas I, III e IV. d) Todas as caractersticas esto corretas. e) Todas as caractersticas esto incorretas.

189. Cesgranrio-RJ (modificado) Cear joga fora opo alimentar Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabea de lagosta no so aproveitadas sendo lanadas ao mar. O estudo sobre hidrlise enzimtica de desperdcio de lagosta, ttulo do pesquisador Gustavo Vieira, objetiva o uso de material de baixo custo para enriquecer a alimentao de populaes carentes. O processo consiste na degradao de molculas orgnicas complexas em simples por meio de um catalisador e na posterior liolizao. O p resultante de alto teor nutritivo, com baixa umidade e resiste, em bom estado de conservao, por longos perodos.
Jornal do Brasil

c) ao pH do meio e que, portanto, depois da enzima atingir seu pH timo de atuao, um aumento de pH no altera a velocidade de reao. d) concentrao de substrato e que, portanto, quanto menos substrato, mais rpida a reao enzimtica. e) ao pH ou temperatura, pois as enzimas possuem um pH e uma temperatura tima, onde sua atuao enzimtica a mxima. 191. UFES (modificado) Se aquecermos uma enzima humana a 70 C durante uma hora e tentarmos utiliz-la para catalisar uma reao, o resultado ser: a) melhor porque o aumento de temperatura entre 50 e 70 C favorece as reaes enzimticas. b) inalterado porque as enzimas so muito estveis. c) nulo porque as enzimas s exercem a sua ao cataltica nos organismos vivos. d) nulo porque as enzimas so protenas e se desnaturam quando aquecidas a essa temperatura. e) nulo porque as enzimas s exercem ao cataltica na temperatura tima para a sua ao. 192. UFPE As enzimas so protenas altamente especializadas que catalisam as mais diversas reaes qumicas. Em relao atividade dessas molculas, julgue (V ou F) os itens: ( ) quando a temperatura e a concentrao da enzima so constantes, e aumenta-se gradativamente a concentrao do substrato, observa-se um aumento da velocidade da reao at o mximo, independente do pH. ( ) um aumento da concentrao do substrato causa uma diminuio da velocidade da reao pois o substrato passa a inibir a ao da enzima. ( ) o aumento da temperatura provoca um aumento na velocidade da reao enzimtica at uma temperatura crtica, quando ocorre uma queda na atividade da enzima em conseqncia de sua desnaturao. ( ) a velocidade de uma determinada reao enzimtica est associada ao pH, sendo que cada enzima tem um pH timo de atuao. 193. Unifesp No tubo 1 existe uma soluo contendo clulas de fgado de boi. Em 2, h uma soluo de clulas extradas de folhas de bananeira.

Com base nos processo descritos no artigo anterior, assinale a opo correta. a) As molculas orgnicas simples obtidas so glicerdeos que so utilizados pelo organismo com funo reguladora. b) As molculas orgnicas complexas empregadas so protenas que, ao serem digeridas em aminocidos, so utilizadas pelo organismo com funo estrutural. c) O catalisador do processo uma enzima capaz de degradar protenas em monossacardios essenciais liberao de energia para as atividades orgnicas. d) A hidrlise enzimtica de molculas orgnicas complexas realizada sempre por catalisador inorgnico em presena de gua. e) O alto teor nutritivo do produto devido ao fato de as molculas orgnicas simples obtidas serem sais minerais indispensveis ao desenvolvimento orgnico. 190. UFU-MG

PV2D-07-BIO-14

O grco anterior ilustra uma reao enzimtica, onde a quantidade de enzimas mantida xa e a velocidade da reao depende da varivel x. Da anlise do grco e dos seus conhecimentos sobre enzimas, voc pode concluir que a varivel x refere-se: a) concentrao do substrato, e que, portanto, a velocidade de uma reao enzimtica aumenta com o aumento da concentrao do substrato at certo ponto, permanecendo constante a partir da. b) temperatura e que, portanto, quanto maior a temperatura, maior a velocidade da reao enzimtica.

131

Voc deseja eliminar completamente todos os constituintes dos envoltrios celulares presentes em ambos os tubos. Para isso, dispe de trs enzimas digestivas diferentes: C: digere carboidratos em geral. L: digere lipdios. P: digere protenas. Para atingir seu objetivo gastando o menor nmero possvel de enzimas, voc deve adicionar a 1 e 2, respectivamente: a) 1 = C; 2 = P. b) 1 = L; 2 =C. c) 1 = C e P; 2 = C e L. d) 1 = C e P; 2 = C, L e P. e) 1 = L e P; 2 = C, L e P. 194. Uespi Dada a seguinte reao:
catalase H2O2 H2O + 1/2 O2

N. do teste I II III IV V VI

Material acrescentado soluo de catalase 1 g de fgado bovino triturado 2 g de fgado bovino triturado 3 g de fgado bovino triturado um pedao de fgado bovino cozido

Quantidade de O2 liberada (+) +++ ++ +++++ +++++

( X)

(Y)

( Z)

(M)

Hipoteticamente, se voc arranjasse uma substncia N, enzimaticamente competitiva com o substrato da reao acima, e a colocasse no meio, voc poderia armar que: a) a substncia N, sendo molecularmente semelhante a Z, inibe a ao de Y. b) a substncia N molecularmente semelhante a Y e por isso inibe a ao de Z. c) a substncia N compete com Y para se ligar a Z. d) a substncia N molecularmente semelhante a X e por isso compete com este X para ligar-se a Y. e) a substncia N molecularmente semelhante a Y e por isso inibe a ao de X. 195. UFRN Uma prtica corriqueira na preparao de comida colocar um pouco de leite de mamo ou suco de abacaxi para amaciar a carne. Hoje em dia, os supermercados j vendem um amaciante de carne industrializado. a) Explique o amaciamento da carne promovido pelo componente presente no mamo, no abacaxi ou no amaciante industrializado e compare esse processo com a digesto. b) Se o amaciante, natural ou industrializado, for adicionado durante o cozimento, qual ser o efeito sobre a carne? Por qu? 196. UnB-DF Em diversas circunstncias, ocorre produo de gua oxigenada (H2O2) em nosso organismo. Na presena de ons Fe2+, a gua oxigenada d origem a um radical livre que ocasiona mutaes no DNA. Nesse processo, a enzima catalase importante, pois catalisa a produo de H2O e O2 a partir de H2O2. Para a vericao desse fato, realizou-se um experimento constitudo de vrios testes, nos quais, em tubos de ensaio contendo H2O2, acrescentaram-se diferentes materiais, conforme especicado na tabela adiante medindo-se a quantidade de O2 liberada.
132

Com base no experimento apresentado, julgue os seguintes itens. 0. O experimento evidencia a existncia da catalase do fgado. 1. Os testes mostraram que a liberao de O2 diretamente proporcional concentrao de enzima. 2. No teste VI, no ocorre liberao de O2 porque o calor desnatura e, conseqentemente, inativa as enzimas. 3. Os testes de III e VI podem ser considerados como sendo os testes realizados para o controle do experimento. 4. A liberao de O2 cessa aps um curto perodo de tempo por ocorrer consumo de enzima durante a reao. 197. Analise a seguinte experincia: Primeira etapa Procedimento: Em dois tubos de ensaio, numerados como I e II, acrescenta-se: Tubo I: gua oxigenada + dixido de mangans Tubo II: gua oxigenada + fgado Concluso: desprendimento de gs oxignio proveniente da decomposio da gua oxigenada devido ao dixido de mangans (Tubo I) e alguma substncia liberada pelo fgado (Tubo II). Segunda etapa Procedimento: adio de nova quantidade de gua oxigenada nos dois tubos da primeira etapa desta experincia. Resultado obtido: novo desprendimento de borbulhas (gs oxignio) nos dois tubos. Concluso: O dixido de mangans (Tubo I) e a substncia liberada pelo fgado (Tubo II) no foram consumidas nas reaes da primeira etapa experincia. Com base nessa experincia podemos concluir que o dixido de mangans e a substncia liberada pelo fgado so: a) enzimas. b) catalisadores. c) ionizadores. d) substncias orgnicas. e) substncias inorgnicas.

198. UFMG Observe a experincia, usando tubos de ensaio nos quais foram adicionados 5 ml de H2O2, acrescidos de:

Sabendo-se que o fgado rico em catalase, que decompe a H2O2 em H2O e O2, o que deve ocorrer nos 5 tubos? 199. Os dois grcos a seguir referem-se velocidade da reao: A+BC+D que ocorre em animais de uma mesma espcie, quando suas temperaturas variam. O grco nmero 1 representa a reao em um indivduo que, alm dos reagentes A e B, possui o polipeptdio E, que no ocorre no indivduo do grco nmero 2.

v = velocidade de formao do produto C em mg/ hora Baseado nos grcos, responda: a) Em que grupo de substncias pode ser classicado o polipeptdio E? b) D duas justicativas para sua classicao.

200. UEM-PR A gura a seguir mostra as velocidades de reao de duas enzimas: enzima humana (A) e de bactrias de fontes termais (B):

Considerando os dados da gura e a ao da temperatura na atividade enzimtica, d como resposta a soma dos itens corretos. 01. A temperatura um fator importante para a atividade enzimtica. 02. Dentro de certos limites, a velocidade de uma reao enzimtica aumenta com o aumento da temperatura. 04. A partir de determinado ponto, o aumento de temperatura faz com que a velocidade de reao diminua bruscamente e cesse. 08. A temperatura tima para a atividade da enzima humana est em torno de 37C. 16. A temperatura tima para a atividade de enzimas de bactrias de fontes termais est em torno de 78C. 32. Para qualquer enzima, o aquecimento acima da temperatura tima provoca a desnaturao. 64. Para ambas as enzimas, se for ultrapassado a temperatura tima, a estrutura espacial da enzima se modica.

PV2D-07-BIO-14

133

Captulo 3
201. UFSCar-SP O segmento de DNA humano que contm informao para a sntese da enzima pepsina um: a) caritipo. d) genoma. b) cromossomo. e) gene. c) cdon. 202. Fuvest-SP O anncio do seqenciamento do genoma humano, em 21 de junho de 2000, signica que os cientistas determinaram: a) a seqncia de nucleotdeos dos cromossomos humanos. b) todos os tipos de protena codicados pelo genes humanos. c) a seqncia de aminocidos de DNA humano. d) a seqncia de aminocidos de todas as protenas humanas. e) o nmero correto de cromossomos da espcie humana. 203. O que representa o desenho a seguir? Qual o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que se trata da unidade estrutural do cido desoxirribonuclico (DNA)? c) A molcula de DNA possui a forma de uma dupla hlice. d) O DNA constitudo das bases nitrogenadas, adenina, timina, citosina, guanina. e) O DNA se constitui de 4 bases nitrogenadas, desoxirribose e cido fosfrico. 206. (modificado) No modelo molecular do cido ribonuclico (RNA) representado adiante, os nmeros 1, 2 e 3 indicam, respectivamente:

Modelo proposto por J. Watson e F. Crick

a) b) c) d) e)

desoxirribose, cido fosfrico e base nitrogenada. cido fosfrico, desoxirribose e base nitrogenada. ribose, cido fosfrico e base nitrogenada. cido fosfrico, ribose e base nitrogenada. cido fosfrico, base nitrogenada e desoxirribose.

204. Considerando o modelo da estrutura molecular do DNA como representado na gura adiante, responda o que representam os componentes 1, 2, 3 e 4 respectivamente.

207. Mackenzie-SP Considere as armaes abaixo a respeito dos cidos nuclicos. I. Nucleotdeos so unidades que os constituem. II. O RNA formado por uma seqncia simples de nucleotdeos. III. S o RNA apresenta uracila na sua formao. Ento: a) todas so verdadeiras. b) somente I e II so verdadeiras. c) somente I e III so verdadeiras. d) somente II e III so verdadeiras. e) apenas uma das armaes verdadeira. 208. FEP-PA O DNA e o RNA so constitudos de muitas unidades, os nucleotdeos. Cada nucleotdeo constitudo por um grupo fosfato, uma pentose e uma base nitrogenada. A diferena entre DNA e RNA est: a) na pentose e nas bases nitrogenadas. b) no fosfato e nas bases nitrogenadas. c) na pentose e no fosfato. d) na pentose, nas bases nitrogenadas e no fosfato. e) apenas nas bases nitrogenadas. 209. Por que as mitocndrias e os cloroplastos apresentam vida relativamente independente dentro das clulas eucariticas?

Modelo proposto por J. Watson e F. Crick

205. Em relao ao DNA, a alternativa incorreta : a) As molculas de DNA apresentam sempre a mesma ordem de nucleotdeos, diferindo apenas uma das outras pelo nmero deles. b) O DNA faz parte da constituio dos cromossomos.
134

210. PUCCamp-SP Clulas vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram xadas e submetidas auto-radiograa, para comprovar os locais que possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa somente nos: a) nuclolos. b) ribossomos. c) nuclolos e nas mitocndrias. d) ribossomos e nos cloroplastos. e) ribossomos, nos cloroplastos e nas mitocndrias. 211. UFSM-RS Numere a 2 coluna de acordo com a 1. Coluna 1 1. DNA 2. RNA Coluna 2 ( ) Dupla hlice ( ) Ribose ( ) Fita nica ou simples ( ) Desoxirribose ( ) Bases nitrogenadas: adenina, guanina, citosina, timina ( ) Bases nitrogenadas: adenina, guanina, citosina, uracila A seqncia correta : a) 1 2 1 2 2 1. d) 2 1 2 1 1 2. b) 2 1 1 2 2 2. e) 1 1 2 2 2 1. c) 1 2 2 1 1 2. 212. Os cidos nuclicos so macromolculas denidas como polinucleotdeos. a) Represente um nucleotdeo apontando seus trs constituintes moleculares. b) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? 213. UFSCar-SP Em nosso intestino delgado, as molculas de DNA (cido desoxirribonuclico) presentes no alimento so digeridas e originam: a) apenas aminocidos b) fosfato, glicdio e bases nitrogenadas. c) glicdio, bases nitrogenadas e aminocidos. d) RNA transportador, RNA mensageiro e RNA ribossmico. e) tomos livres de carbono, nitrognio, oxignio, hidrognio e fsforo. 214. UFMS Considere as armaes abaixo. I. A unio da base nitrogenada com o acar forma um composto denominado nucleotdeo. II. Os dois lamentos que compem a molcula de DNA no so iguais e sim complementares.

III. medida que o DNA se duplica, os cromossomos tambm se duplicam. IV. A duplicao do DNA a base da reproduo e da hereditariedade, pois a partir das divises celulares que se formam novos organismos. V. Os nucleotdeos so reconhecidos pela base nitrogenada que contm. Com relao estrutura do cido desoxirribonuclico (DNA), est(o) correta(s) a(s) alternativa(s): 01. I e II. 02. I, II e III. 04. I, IV e V. 08. I, III e IV. 16. II, III e V. 32. IV e V. 215. Se os nucleotdeos do lamento I, do esquema a seguir, tm uma base prica e os do lamento II tanto podem ser encontrados no RNA como no DNA, podemos armar que as bases nitrogenadas do lamento II podem ser:

a) citosina e citosina. b) guanina e guanina. c) duas timinas ou duas citosinas. d) duas adeninas ou duas guaninas. e) impossvel determinar. 216. Os cidos nuclicos podem se diferenciar conforme a base nitrogenada e o acar que os compem. Na tabela abaixo esto representados os cidos nuclicos I e II. I Tipo de acar Tipo de base nitrogenada desoxirribose adenina timina citosina guanina II ribose adenina uracila citosina guanina

PV2D-07-BIO-14

Assinale a alternativa correta: a) O DNA est representado em I e II b) O RNA est representado em I c) O DNA e o RNA podem ser representados tanto em I quanto em II d) O RNA est representado em II e) O DNA est representado em II
135

217. Fuvest-SP A hiptese de que os cloroplastos e as mitocndrias tenham surgido atravs de uma associao simbitica de um eucarioto primitivo com, respectivamente, bactrias fotossintetizantes e bactrias aerbicas reforada pelo fato de aquelas organelas celulares: a) serem estruturas equivalentes, com grande superfcie interna. b) apresentarem DNA prprio. c) estarem envolvidas, respectivamente, na produo e consumo de oxignio. d) apresentarem tilacides e cristas como as bactrias. e) serem encontradas tanto em organismos superiores como inferiores. 218. Fuvest-SP Quando uma preparao de clulas de pncreas tratada com um corante bsico, certas estruturas do citoplasma cam fortemente coradas. Entretanto, quando se faz um tratamento prvio da preparao com a enzima ribonuclease, a colorao no ocorre. a) Qual a estrutura evidenciada pelo corante bsico? b) Por que o tratamento enzimtico impede a colorao? 219. Fuvest-SP Os bacterifagos so constitudos por uma molcula de DNA envolta em uma cpsula de protena. Existem diversas espcies, que diferem entre si quanto ao DNA e s protenas constituintes da cpsula. Os cientistas conseguem construir partculas virais ativas com DNA de uma espcie e cpsula de outra. Em um experimento, foi produzido um vrus contendo DNA do bacterifago T2 e cpsula do bacterifago T4. Pode-se prever que a descendncia desse vrus ter: a) cpsula de T4 e DNA de T2. b) cpsula de T2 e DNA de T4. c) cpsula e DNA, ambos de T2. d) cpsula e DNA, ambos de T4. e) mistura de cpsulas e DNA de T2 e de T4. 220. O quadro a seguir apresenta algumas diferenas entre DNA e RNA. Foram cometidos alguns erros. Identique-os:

221. Numa molcula de DNA formada por uma dupla-hlice, a quantidade de: a) adenina igual de citosina. b) citosina igual de timina. c) adenina igual de uracila. d) citosina igual de adenina. e) guanina igual de citosina. 222. Molculas de DNA constitudas por duplo lamento helicoidal mantm as cadeias unidas entre si por: a) ligaes covalentes. b) ligaes inicas. c) pontes de hidrognio. d) pontes de nitrognio. e) ligao metlica. 223. UFPE Considerando que na gura a seguir tem-se uma representao plana de um segmento da molcula de DNA, analise as proposies a seguir.

1. Um nucleotdeo formado por um grupo fosfato (I), uma molcula do acar desoxirribose (II) e uma molcula de base nitrogenada. 2. Um nucleotdeo de Timina (T) de uma cadeia ligase a um nucleotdeo com Adenina (A) de outra cadeia. 3. Um nucleotdeo com Guanina (G) de uma cadeia liga-se a um nucleotdeo de Citosina (C) em outra cadeia. 4. Pontes de hidrognio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G. Est(o) correta(s): a) 1 apenas. b) 2 e 3 apenas. c) 1, 2 e 3 apenas. d) 2, 3 e 4 apenas. e) 1, 2, 3 e 4.

224. PUC-SP A gura a seguir representa parte da estrutura molecular do cido desoxirribonuclico (DNA). Assinale a frase correta.

136

a) A pentose pode ser ribose ou desoxirribose. b) As bases pirimdicas so idnticas s do cido ribonuclico (RNA). c) As bases pricas so a citosina e a timina. d) Os locais assinalados com os nmeros 1, 2, 3 e 4 podem ser substitudos por T, C, A e G, respectivamente. e) Os locais assinalados com os nmeros 1, 2, 3 e 4 podem ser substitudos por G, A, C e T, respectivamente. 225. Fatec-SP As tcnicas utilizadas pela Engenharia Gentica permitem que se atue em uma substncia presente em todas as clulas, procariontes e eucariontes, sendo responsvel pelo controle do seu metabolismo. Essa substncia se denomina: a) DNA, e formada por cadeias polipeptdicas que apresentam em sua composio os aminocidos adenina, uracila, citosina e guanina. b) DNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, citosina, guanina e timina. c) RNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, timina, citosina e guanina. d) polimerase, e formada por aminocidos que apresentam em sua composio a desoxirribose. e) transcriptase, e formada por aminocidos que apresentam em sua composio a ribose. 226. FGV-SP Considerando-se o total de bases nitrogenadas do DNA de uma espcie qualquer igual a 100, se nela existirem 15% de timina, qual ser a porcentagem das demais bases nitrogenadas? 227. PUC-RS Qual das alternativas abaixo apresenta a informao que nos permite armar que a replicao do DNA semiconservativa? a) Durante a diviso da molcula original somente uma das tas copiada; a outra permanece inativa. b) No incio do processo replicativo, forma-se um total de seis tas de DNA. c) As duas tas de DNA parental so copiadas, originando molculas-lhas com somente uma das tas. d) As enzimas que participam dos processos de replicao so somente de origem materna. e) No m da replicao, cada uma das molculas resultantes apresenta a metade do nmero de pontes de hidrognio.

228. UEL-PR Com relao composio qumica, as molculas de DNA e RNA diferem entre si quanto ao tipo de : a) acar, apenas. b) base nitrogenada, apenas c) base nitrogenada e de acar, apenas. d) base nitrogenada e de fosfato, apenas. e) base nitrogenada, de acar e de fosfato. 229. O segmento de molcula de RNA que se formar, tendo por molde um segmento de cadeia de DNA semelhante ao apresentado no esquema a seguir:

ter em I, II e III, respectivamente: a) ribose, guanina e uracila. b) ribose, adenina e citosina. c) ribose, uracila e citosina. d) desoxirribose, guanina e timina. e) desoxirribose, uracila e citosina. 230. UFRGS-RS Cinco amostras com cidos nuclicos foram analisadas quimicamente e apresentaram os seguintes resultados: I. 1 amostra: ribose; II. 2 amostra: timina; III. 3 amostra: dupla-hlice; IV. 4 amostra: uracila; V. 5 amostra: 20% de guanina e 30% de citosina. Entre essas amostras, quais se referem a DNA? a) Apenas I e II. d) Apenas II e IV. b) Apenas I e III. e) Apenas II e V. c) Apenas II e III. 231. UFPE Nos ltimos anos, a biologia molecular tem fornecido ferramentas teis para a produo de plantas e animais transgnicos. As informaes armazenadas nas molculas de DNA so traduzidas em protenas por meio de molculas intermedirias denominadas: a) proteases. d) tRNA. b) plasmdios. e) mRNA. c) rRNA.

PV2D-07-BIO-14

137

232. UFU-MG As molculas de DNA formam, pelo menos, 3 tipos diferentes de RNA, cujas funes so de grande importncia para a clula viva. Quais so eles e que papel desempenham no metabolismo celular? 233. UFMT (modificado) Watson e Crick, que deduziram a estrutura tridimensional da molcula de DNA em 1953, apresentaram um modelo do processo molecular de quebra do DNA, anlogo a um zper que se abre a partir de uma de suas pontas, permitindo que os dois lamentos desenrolados exponham as suas bases isoladas. Esse processo culmina com a:

a) b) c) d) e)

GAAGCUA GUUGCAU GUUGCUA CUUCCGA CAACCCA

235. PUC-MG O maior projeto do nal do sculo , sem dvida, o Projeto Genoma Humano, que tem por objetivo seqenciar todos os genes dos 23 cromossomos que compem a espcie humana. Uma reportagem recente mostrou um gene totalmente seqenciado com o seguinte trecho: AAA AAT CAA GTA Baseado em seus conhecimentos, identique o segmento de RNA mensageiro formado a partir desse lamento. a) UUU UUA GUU CAU b) UUU UUT GUU CTU c) AAA AAU CAA GUA d) TTT TTA GTT CAT e) TTT UUA GUU CAT 236. FGV-SP Depois da descoberta da estrutura da molcula do cido desoxirribonuclico (DNA ou ADN), novos mtodos de diagnstico foram desenvolvidos e utilizados para inmeros ns (identicao de microrganismos patognicos, testes de paternidade, mapa gentico, medicina forense, entre outros). Assinale a armao correta. a) A molcula de DNA constituda por uma ta nica e por vrios nucleotdeos que tm a transcrio como principal funo. b) A molcula de DNA nas bactrias se encontra na carioteca da clula. c) A molcula de DNA no capaz de produzir a molcula de RNA. d) A molcula de DNA tem funo de duplicao e constituda por uma ta dupla, sendo que cada lamento composto por vrios nucleotdeos. e) A molcula de DNA, nos organismos eucariontes, no se encontra no ncleo da clula. 237. Unisanta-SP Na hidrlise de cidos nuclicos, as bases pricas produzidas pelo DNA so: a) citosina e guanina. b) adenina e guanina. c) citosina e timina. d) adenina e timina. e) citosina e uracila. 238. Unioeste-PR (modificado) A dupla hlice como modelo de estrutura tri-dimensional do DNA foi proposta por Watson e Crick em 1953. Relativo a esta estrutura, correto armar: 01. que os dois lamentos de DNA esto unidos um ao outro por ligaes fosfodister. 02. que a quantidade de bases pricas igual quantidade de bases pirimdicas.

a) mutao. b) duplicao. c) transcrio.

d) traduo. e) diviso celular.

234. UEL-PR A seguir est representado o lamento I de uma molcula de cido nuclico presente no interior do ncleo de uma clula vegetal. Qual seria a seqncia correta encontrada na molcula de RNA mensageiro, transcrita a partir do lamento II?

138

04. que a seqncia de nucleotdeos de um lamento sempre idntica seqncia de nucleotdeos do lamento complementar. 08. que, em uma dupla ta de DNA com 200 pares de nucleotdeos, encontram-se 400 desoxirriboses, 400 grupos fosfatos, 200 bases pricas e 200 bases pirimdicas. 16. que citosina e timina so bases pirimdicas; guanina e adenina so bases pricas. 239. Vunesp A gura representa um segmento de uma molcula de cido nuclico.

calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justique a sua resposta. 1. ACTTTAAAGATATTTACTTAAA TGAAATTTCTATAAATGAATTT 2. GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 241. Vunesp A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases: Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode armar a respeito das semelhanas entre estas duas molculas de DNA? b) Justique sua resposta. 242. Fuvest-SP No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Quais as porcentagens das outras bases desse DNA? Justique sua resposta. 243. Uespi Em um experimento, foi observado que, no DNA de um determinado organismo, o contedo de citosina era de 30%. Assinale na tabela abaixo a alternativa que indica corretamente os percentuais de guanina, adenina e timina. Guanina a) b) c) d) e) 15% 20% 30% 10% 35% Adenina 35% 25% 20% 10% 25% Timina 35% 25% 20% 10% 10%

As setas de 1 a 4 indicam, respectivamente: a) guanina, adenina, uracila e ribose. b) guanina, citosina, uracila e ribose. c) guanina, adenina, timina e desoxirribose. d) adenina, timina, guanina e desoxirribose. e) citosina, guanina, timina e desoxirribose. 240. Unirio-RJ A gura a seguir mostra um trecho da estrutura do cido desoxirribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na gura, A, C, G e T representam as bases adenina, citosina, guanina e timina, respectivamente.

PV2D-07-BIO-14

As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por

244. Para funcionar como material gentico, o cido desoxirribonuclico (DNA) apresenta a capacidade de autoduplicao. Utilizando seus conhecimentos sobre o material gentico, responda: a) Qual a importncia de o DNA se autoduplicar? b) Por que essa replicao semiconservativa?
139

245. UERJ Clulas imortais contam aos cientistas histrias da evoluo da humanidade. Estas clulas formam um livro, conservado em tanques de nitrognio lquido, que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas.
Adaptado de O Globo

249. Mackenzie-SP

a) Explique por que o processo de autoduplicao do DNA d signicado hereditariedade, permitindo revelar a histria da evoluo da humanidade. b) ... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas podem ser estudados atravs de observaes de caractersticas morfolgicas e siolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e siolgicas da clula. 246. PUC-SP No interior de um blastmero, molculas de DNA polimerase produzidas no retculo endoplasmtico rugoso migraram para o ncleo, onde tiveram papel importante na duplicao dos cromossomos, o que levou a clula a se dividir. O trecho acima faz referncia aos processos de sntese de: a) protenas, sntese de DNA e mitose em uma clula embrionria. b) protenas, sntese de DNA e mitose em uma clula somtica. c) protenas, sntese de DNA e meiose em uma clula germinativa. d) lipdios, sntese de RNA e mitose em uma clula embrionria. e) lipdios, sntese de RNA e meiose em uma clula germinativa. 247. Unisanta-SP Na hidrlise de cidos nuclicos, as bases pirimdicas produzidas pelo RNA so: a) citocina e guanina. d) adenina e timina. b) adenina e uracila. e) citosina e uracila. c) citosina e timina. 248. PUCCamp-SP Os itens a seguir referem-se estrutura, composio e funo dos cidos nuclicos. Estrutura: I. dupla-hlice II. cadeia simples Composio: 1. presena de uracila 2. presena de timina Funo: a. sntese de protenas b. transcrio gnica So caractersticas do cido ribonuclico: a) I 1 a d) II 1 b b) I 2 b e) II 2 b c) II 1 a
140

Considerando o esquema acima, que representa um fragmento de cido nuclico, cuja funo transportar aminocidos, assinale a alternativa incorreta. a) A substncia representada em I obrigatoriamente ribose. b) Cada trinca de bases, representada em II, denominada anticdon. c) Esse cido nuclico produzido no ncleo e se dirige ao citoplasma, unindo-se aos aminocidos. d) II pode apresentar molculas de adenina. e) Se a ao desse cido for bloqueada, o processo de transcrio no ocorrer. 250. Fuvest-SP Um pesquisador que pretende estudar comparativamente a sntese de DNA e RNA em uma clula deve usar nucleotdeos radioativos contendo: a) timina e uracila. d) adenina e timina. b) guanina e timina. e) citosina e uracila. c) citosina e guanina. 251. Duas clulas A e B foram colocadas, respectivamente, em dois meios de cultura. Meio 1: contendo timina com istopos radioativos. Meio 2: contendo uracila com istopos radioativos. Atravs de sensores, observou-se que, na clula A, a radiao foi detectada no citoplasma, e, aps algum tempo, no ncleo, no sendo mais detectada no citoplasma. Na clula B, a radiao foi percebida no citoplasma, passou ao ncleo e, posteriormente, novamente foi detectada no citoplasma. Com bases em conhecimentos sobre bioqumica e siologia celular, como se pode explicar tais observaes? 252. Fuvest-SP Bactrias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de geraes. Dessa cultura, foram isoladas 100 bactrias e transferidas para um meio sem substncias radioativas. Essas bactrias sofreram trs divises no novo meio, produzindo 800 bactrias. A anlise dos cidos nuclicos mostrou que dessas 800 bactrias: a) 100 apresentavam o DNA marcado, mas no o RNA. b) 200 apresentavam o DNA marcado, mas no o RNA. c) 400 apresentavam o DNA marcado, mas no o RNA. d) 200 apresentavam o DNA e o RNA marcados. e) todas apresentavam o DNA e o RNA marcados.

253. UFC-CE Tendo em vista a estrutura e a funo dos cidos nuclicos, correto armar que: a) todas as trincas da molcula do mRNA especicam algum aminocido. b) as molculas do cido ribonuclico (RNA) so hlices duplas de polirribonucleotdeos. c) em todos os organismos, s existe um gene para cada molcula de DNA. d) as estruturas espaciais e moleculares do DNA e RNA so diferentes. e) as duas metades de hlice dupla do DNA tm sequncias iguais de bases nitrogenadas. 254. UFAM As molculas de RNAm contm seqncias de trincas de nucleotdeos, que indicam a ordem que os aminocidos devem ser ligados para fabricar determinada protena. Cada trinca do RNAm que especica um aminocido chamada de: a) cdon. d) ntron. b) stio. e) ction. c) xon. 255. Fuvest-SP Um gene de bactria com 600 pares de bases nitrogenadas produzir uma cadeia polipeptdica com nmero de aminocidos aproximadamente igual a: a) 200 d) 1.200 b) 300 e) 1.800 c) 600 256. UEL-PR Uma protena formada por 20 aminocidos codicada por uma molcula de RNA ___I___ de, no mnimo, ___II___ nucleotdeos. Para completar corretamente a frase, os espaos I e II devem ser preenchidos, respectivamente, por: a) mensageiro e 20. d) mensageiro e 60. b) transportador e 30. e) transportador e 60. c) ribossmico e 30. 257. Fuvest-SP A substituio de uma nica base nitrogenada na molcula de DNA leva necessariamente substituio de um aminocido no polipeptdeo correspondente? Sim ou no? Por qu? 258. Cesgranrio-RJ Sobre o cdigo gentico so feitas as seguintes armaes: I. pode existir mais de um cdon para determinar um mesmo aminocido; II. em todos os seres vivos os cdons que codicam um respectivo aminocido so os mesmos; III. a traduo da seqncia de bases do RNA para a protena feita, a nvel citoplasmtico, nos ribossomos. Est(o) correta(s) armativa(s): a) II apenas. d) I,II e III. b) III apenas. e) I e III apenas. c) I e II apenas.

259. UFU-MG O aminocido leucina pode ser codicado por mais de uma trinca de nucleotdeos do DNA (AAT, GAA e outras). Assim sendo, podemos dizer que: I. o cdigo gentico degenerado, o que signica que um aminocido pode ser codicado por mais de uma trinca. II. um aminocido pode ser codicado por apenas uma trinca de nucleotdeos de DNA. III. assim como a leucina pode ser codicada por diferentes trincas, uma determinada trinca tambm pode codicar diferentes aminocidos. Esto corretas as armativas: a) apenas III. d) I e III. b) apenas II. e) nenhuma delas. c) apenas I. 260. UEL-PR Considere os seguintes cdons do RNA mensageiro e os aminocidos por eles especicados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamante os anticdons do RNAt e os cdons do DNA relacionados com esses aminocidos. RNAt Treonina a) b) c) d) e) TGT UGU UGU TGT ACA Valina CTT CUU CAA CTT CAA UGU UGU TGT TGT TGT DNA Treonina Valina CAA CUU CAA CAA GUU

261. Unicamp-SP Determine a seqncia de bases do DNA que transcreve o RNA mensageiro do seguinte peptdeo: metionina-glicina-alanina-serina-arginina. Utilize os seguintes anticdons dos aminocidos: Alanina = CGA Glicina = CCU Arginina = GCG Metionina = UAC Serina = AGA 262. Fuvest-SP Considere a seguinte tabela que indica seqncias de bases do RNA mensageiro e os aminocidos por elas codicados.

PV2D-07-BIO-14

141

Com base na tabela fornecida e considerando-se um segmento hipottico de DNA, cuja seqncia de bases AAG TTT GGT, qual seria a seqncia de aminocidos codicada? a) Aspargina leucina valina. b) Aspargina lisina prolina. c) Fenilalanina lisina prolina. d) Fenilalanina valina lisina. e) Valina lisina prolina. 263. UFRJ Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir de uma seqncia de nucleotdeos do seu gene, ou do RNAm correspondente.

264. PUC-MG Suponha uma extenso de molde de DNA, com a seguinte seqncia de desoxirribonucleotdeos: ATACGA. incorreto armar que: a) os cdons especicados por essa seqncia so UAUGCU. b) os anticdons complementares ao mRNA, produzidos por essa seqncia, so AUACGA. c) os ribonucleotdeos especicados por essa seqncia so TATGCT. d) o o do DNA complementar ao lamento dado TATGCT. e) essa seqncia codica 2 aminocidos. 265. PUCCamp-SP O quadro a seguir contm um segmento de DNA, os cdons e os anticdons correspondentes. DNA RNAm RNAt ATT TAA II UAA GAC I GAC IV TCA AGT III AGU

Para preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos, respectivamente, por: a) GAC, TAA, AGT e CTG. Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu. b) GTC, AUU, UCA e GUC. c) GTC, ATT, TCA e GUC. d) CTG, ATT, TCA e CUG. e) CTG, AUU, UCA e CUG.

266. UFSM-RS A tabela apresenta o cdigo gentico, com os cdons e os aminocidos correspondentes. SEGUNDA LETRA U C A G
UGU Cys UGC UGA parada UGG} Trp UCU UAU Tyr UUU U UUC Phe UCC Ser UAC UCA UAA parada UUA Leu UCG UAG parada UUG

} }

U C A G TERCEIRA LETRA U C A G U C A G U C A G

PRIMEIRA LETRA

CUU C CUC Leu CUA CUG

CCU CCC Pr o CCA CCG

AUU ACU A AUC Ileu ACC Thr AUA ACA ACG AUG} met

GUU G GUC Val GUA GUG

GCU GCC Ala GCA GCG

} CAA Glu CAG} AAU Asn AAC} AAA Lys AAG} GAU Asp GAC} GAA Glu GAG}
CAU His CAC

CGU CGC Arg CGA CGG


AGU Ser AGC AGA Arg AGG

} }

GGU GGC Gly GGA GGG

Lopes, Snia, Bio Volume nico. So Paulo: Saraiva, 1996.

142

Utilizando a tabela, determine a seqncia de aminocidos que corresponde seqncia de DNA TAC TGA TTG CTA a) met thr asn asp b) met glu his gly c) glu thr asp arg d) glu his gly arg e) gly cys glu thr

267. Fatec-SP A tabela a seguir relaciona trincas de bases do DNA aos aminocidos correspondentes. Bases do DNA AAC GAG CCG CCT CTT AAA Aminocidos Leucina (LEU) Leucina (LEU) Glicina (GLI) Glicina (GLI) cido Glutmico (GLU) Fenilalanina (FEN)

270. Unirio-RJ Supondo que o peso molecular mdio de um aminocido de 100 unidades, quantos nucleotdeos em mdia esto presentes em uma seqncia codicadora de ARN-m, responsvel pelo seqenciamento dos aminocidos em um peptdeo com peso molecular de 27.000 unidades? a) 810 b) 300 c) 270 d) 81.000 e) 2.700 271. PUC-SP Organismos so ditos transgnicos quando, por tcnica de engenharia gentica, recebem e incorporam genes de outra espcie, os quais podem ser transmitidos aos seus descendentes. Exemplos desses organismos so as plantas transgnicas, receptoras de um gene de outro organismo (doador) que lhes confere resistncia a certos herbicidas. Para que ocorra a sntese da protena codicada pelo gene inserido no genoma da espcie receptora, diversas condies devem ser observadas. Entretanto, fundamentalmente, essa tcnica possvel porque: a) cada organismo apresenta seu prprio cdigo gentico. b) o cdigo gentico comum a todos os seres vivos. c) o cdigo gentico degenerado. d) a tcnica permite trocar o cdigo gentico do organismo doador do gene. e) a tcnica permite trocar o cdigo gentico do organismo receptor do gene. 272. PUCSP A tira de quadrinhos a seguir faz referncia manipulao de genes em laboratrio.

Assinale a alternativa que apresenta a possvel seqncia de cdons para a formao do seguinte peptdeo: GLU GLI FEN LEU a) b) c) d) e) GUU GGU UUU CUC GAA GGC TTT CTC CTT CCG AAA AAC GAA GGA UUU CUC GUU GGC UUU UUG

268. Um pedao de molcula de DNA (gene) tem a seguinte seqncia de bases.

A tabela a seguir mostra a relao cdon x aminocido.


UUU UUC UUA UUG CCU CCC CCA CCG fenilalanina leucina AAU AAC AAA AAG GUU GUC GUA GUG aspargina lisina

prolina

valina

a) Qual a seqncia de bases do RNAm? b) Quantos cdons existem no RNAm produzido por este gene? c) Determine os anticdons dos RNAt que podem se encaixar nos cdons do RNAm. d) Quais so os aminocidos que vo fazer parte do polipeptdeo? 269. A lisozima uma protena de massa molecular 12.000. Considerando a massa molecular mdia dos aminocidos igual a 120, podemos concluir que o pedao de hlice de DNA que codica esta protena deve ter: a) 100 nucleotdeos. d) 10 6 nucleotdeos. b) 1.000 nucleotdeos. e) 300 nucleotdeos. c) 12.000 nucleotdeos.

PV2D-07-BIO-14

Se esse tipo de experimento realmente fosse concretizado, poder-se-ia armar que: a) o elefante e o vagalume so organismos transgnicos. b) apenas o vagalume um organismo transgnico. c) uma seqncia de RNA do vagalume foi transferida para clulas do elefante. d) o gene do vagalume controlou a produo de RNA e de protena no interior das clulas do elefante. e) uma seqncia de DNA do elefante sofreu mutao.
143

O Estado de So Paulo

273. UMC-SP Um pesquisador submeteu sementes de uma planta a doses prolongadas de radiao. Aps plantar uma das sementes irradiadas, obteve um novo tipo de planta, idntica orignal, com exceo da cor de suas ores, uma vez que a nova planta possua uma or de colorao escura. Ao analisar essa ores, ele descobriu que a nova colorao era devida produo de um novo tipo de pigmento. Estudos posteriores revelaram que esse pigmento era sintetizado por uma enzima idntica a uma enzima presente na planta original, mas com cinco aminocidos a menos. A radiao deve, portanto, ter causado a deleo de: a) cinco genes. b) cinco aminocidos de seqncia do DNA. c) cinco aminocidos de seqncia do mRNA. d) quinze pares de nucleotdeos da seqncia do RNAm. e) quinze pares de nucleotdeos do DNA. 274. Cefet-PR Do melhoramento gentico passando pela engenharia gentica, processos de clonagem e transgnicos, os conhecimentos sobre os cidos nuclicos tm gerado tecnologias de grande utilidade para a humanidade. Assinale a alternativa que contm uma proposio incorreta acerca do funcionamento dos cidos nuclicos. a) Transcrio gnica o processo de fabricao de RNA a partir de um modelo de DNA. b) As molculas de DNA so capazes de se reproduzir por meio de um processo conhecido como duplicao semiconservativa. c) Se uma cadeia de DNA apresenta a seqncia de bases: ATTGCTGCGCATT, a outra cadeia apresenta na regio correspondente a seqncia complementar: TAACGACGCGTAA. d) O RNA diferencia-se do DNA principalmente por possuir como acar a ribose e a base nitrogenada uracila em lugar da timina. e) Cada aminocido codicado por um grupo de quatro bases chamado de cdon. 275. Unifesp O jornal Folha de S. Paulo noticiou que um cientista espanhol armou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconsquistar o DNA desses animais. a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justique. 276. Unicamp-SP A seguir esto esquematizadas as seqncias de aminocidos de um trecho de uma protena homloga, em quatro espcies prximas. Cada letra representa um aminocido.
144

espcie 1: M E N S LR C V W V P K LAF V LF GAS LLSA HLQ espcie 2: M E N S LR R V W V PALAF V LF GAS LLSA HLQ espcie 3: M E N S LR C V W V P K LAF V LF GAS LLS Q LHA espcie 4: M E N S LR LAF V LF GAS LLSAH LQ a) Quantos nucleotdeos so necessrios para codicar a seqncia de aminocidos nas espcies 1 e 2? Justique. b) Pode-se dizer que seqncias idnticas de aminocidos so sempre codicadas por seqncias idnticas de nucleotdeos? Justique. 277. PUCCamp-SP Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio sintetizado a partir dele: ATA GCA GTG ACA CCT Tirosina Arginina Histidina Cistena Glicina Aps a substituio de uma nica base nitrogenada no segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas. A seqncia de trincas no RNA mensageiro que pode ter codicado esse polipeptdeo alterado : a) CUC TGC TGC CGC GGU b) TUT CGT CGT TGT GGU c) CGT CGT CAC TGT GGA d) UAU CTU CAC CTU TTA e) UAU CGU CAC CGU GGA 278. Vunesp Os bilogos moleculares decifraram o cdigo gentico no comeo dos anos 60 do sculo XX. No modelo proposto, cdons constitudos por trs bases nitrogenadas no RNA, cada base representada por uma letra, codicam os vinte aminocidos. Considerando as quatro bases nitrogenadas presentes no RNA (A, U, C e G), responda: a) Por que foram propostos no modelo cdons de trs letras, ao invs de cdons de duas letras? b) Um dado aminocido pode ser codicado por mais de um cdon? Um nico cdon pode especicar mais de um aminocido? 279. Unicamp-SP O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de algumas dessas protenas, levando a mudanas no ciclo de vida da clula. a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica?

280. PUC-SP (...) De outro lado, o galardo de qumica cou com os inventores de ferramentas para estudar protenas, os verdadeiros atores do drama molecular da vida. verdade que a Fundao Nobel ainda fala no DNA como o diretor de cena a comandar a ao das protenas, mas talvez no seja pretensioso supor que foi um lapso e que o sinal emitido por essas premiaes aponta o verdadeiro futuro da pesquisa biolgica e mdica muito alm dos genomas e de seu seqenciamento (uma simples soletrao). (...)
LEITE, Marcelo. De volta ao seqenciamento. Folha de S. Paulo.

04. O processo de transcrio corresponde cpia complementar do cdigo do DNA numa molcula de RNAm. 08. Esse processo pode ser dividido nas etapas de transcrio, transporte dos aminocidos e traduo. 284. UFSCar-SP Um pesquisador, interessado em produzir, em tubo de ensaio, uma protena, nas mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas de rato, RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e aminocidos ativos de clulas de sapo. A protena produzida teria uma seqncia de aminocidos idntica do: a) rato. d) macaco. b) sapo. e) macaco e do rato. c) coelho. 285. PUC-RS Responder questo com base na ilustrao e armativas a seguir:

O autor refere-se s protenas como atores do drama molecular e ao DNA como diretor de cena. Essa referncia deve-se ao fato de: a) no ocorrer uma correlao funcional entre DNA e protenas no meio celular. b) o DNA controlar a produo de protenas e tambm atuar como catalisador de reaes qumicas celulares. c) o material gentico ser constitudo por protenas. d) as protenas no terem controle sobre o metabolismo celular. e) o DNA controlar a produo de protenas e estas controlarem a atividade celular. 281. UFRGS-RS Considere as seguintes etapas da sntese de protenas. I. Transcrio do cdigo gentico do DNA em cdons do RNA mensageiro. II. Ligao dos cdons de RNA mensageiro aos anticdons correspondentes dos RNAs transportadores. III. Fixao do RNA mensageiro aos ribossomos. Qual a seqncia correta dessas etapas durante o processo? a) I II III d) III II I b) I III II e) III I II c) II III I 282. FEI-SP O estudo do mecanismo da sntese de protenas no interior das clulas conrma que: a) a transcrio gnica caracteriza-se pela autoduplicao do DNA. b) trs tipos de RNA participam do processo. c) os anticdons localizam-se no RNA-m. d) os cdons so trincas de bases nitrogenadas do RNA-t. e) no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado. 283. UFMS Em relao ao processo de sntese de protenas, assinale a(s) alternativa(s) correta(s). 01. No processo so formados o RNA-mensageiro (RNAm), o RNA-transportador (RNAt) e o RNAribossmico (RNAr). 02. A seqncia de aminocidos de uma protena determinada pela seqncia de bases da molcula de DNA.

I.

Durante o processo A, denominado replicao, o DNA se duplica. II. Durante o processo B, denominado transcrio, ocorre a sntese de RNA. III. Durante o processo C, denominado traduo, dse a sntese protica. IV. Nos eucariotos, os processos A, B e C ocorrem no interior do ncleo. Considerando os processos intracelulares, todas as armativas corretas encontram-se na alternativa: a) I, II e III. d) II e III. b) I, III e IV. e) II, III e IV. c) I e IV. 286. Vunesp O esquema resume parcialmente as relaes funcionais dos cidos nuclicos que ocorrem na maioria das clulas vivas.

PV2D-07-BIO-14

145

Considerando-se apenas clulas eucariontes, as etapas que representam, respectivamente, transcrio, duplicao e traduo so: a) I, II e III. b) I, III e II. c) II, I e III. d) III, I e II. e) II, III e I. 287. UFSM-RS Na gura, o nmero:

289. UFSCar-SP A droga cloranfenicol tem efeito antibitico por impedir que os ribossomos das bactrias realizem sua funo. O efeito imediato desse antibitico sobre as bactrias sensveis a ele inibir a sntese de: a) ATP. b) DNA. c) protenas. d) RNA mensageiro. e) lipdios da parede bacteriana. 290. UFMG Analise estes grcos. Efeito dos antibiticos A e B sobre a sntese de protenas em bactrias.

a) 2 representa o RNA mensageiro que contm os cdons para a sntese protica. b) 3 representa a protena carregada pelo RNA mensageiro. c) 4 representa o RNA transportador que carrega a mensagem. d) 1 representa a mitocndria onde ocorre o processo de traduo. e) 4 representa o RNA mensageiro que est sendo carregado pelo RNA transportador, representado pelo nmero 1. 288. Vunesp Considere o diagrama, que resume as principais etapas da sntese protica que ocorre numa clula eucarionte. Os processos assinalados como 1 e 2 e a organela representados no diagrama referem-se, respectivamente, a:

Considerando-se as informaes destes grcos, correto armar que: a) os mRNAs transcritos antes da adio do antibitico B so traduzidos. b) a queda da sntese de protena resulta da inibio da duplicao do DNA. c) os dois antibiticos A e B atuam sobre o mesmo alvo. d) o antibitico A impede a sntese de novas molculas de mRNA. 291. UnB-DF Analise a tabela abaixo e seus elementos.

a) transcrio, traduo e ribossomo. b) traduo, transcrio e lisossomo. c) duplicao, transcrio e ribossomo. d) transcrio, duplicao e lisossomo. e) traduo, duplicao e retculo endoplasmtico.

Julgue os itens que se seguem: ( ) I contm a informao gentica codicada em bases nitrogenadas. ( ) II e III so, respectivamente, protenas e RNA mensageiro. ( ) IV e V so polmeros e participam da sntese de aminocidos, respectivamente. ( ) A hemoglobina um exemplo de protena sinteti zada nos polirribossomos.

146

292. Assinale a alternativa que, no quadro exposto, indica os compartimentos celulares em que ocorrem a sntese de RNA e a sntese de protenas, em animais e em bactrias. Animais
Sntese de RNA a) b) c) d) e) ncleo ncleo ncleo citoplasma citoplasma Sntese de protenas citoplasma ncleo citoplasma ncleo citoplasma

Bactrias
Sntese de RNA ncleo citoplasma citoplasma citoplasma citoplasma Sntese de protenas citoplasma citoplasma citoplasma ncleo citoplasma

293. Vunesp Na clula eucarionte, estabelecem-se trocas entre ncleo e citoplasma de substncias que, sintetizadas em um desses compartimentos, migram para o outro, a m de atender a suas necessidades. O esquema apresenta algumas dessas substncias. Assinale a resposta que d a direo correta de migrao das mesmas.

( ) No local onde houver um ribossomo, pequenas molculas de RNA transportador (RNAt), ligadas a aminocidos, unem-se ao RNAm por uma seqncia de trs bases o anticdon. ( ) O processo de sntese de protenas ao nvel do citoplasma tambm conhecido como transcrio gentica. ( ) Os diversos aminocidos unem-se atravs de ligaes do tipo ster, dando formao, ao nal da leitura do RNAm, a uma protena funcional. 296. Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com o processo de traduo, se ocorrer uma destruio do(s) nuclolo(s) de uma clula? 297. Os ribossomos so encontrados livres no citoplasma, associados superfcie do retculo endoplasmtico e dentro de mitocndrias e cloroplastos, desempenhando sempre a mesma funo bsica. a) Que funo essa? b) Por que alguns dos ribossomos se encontram associados ao retculo endoplasmtico? c) Por que as mitocndrias e cloroplastos tambm tm ribossomos em seu interior? 298. Vunesp Erros podem ocorrer, embora em baixa freqncia, durante os processos de replicao, transcrio e traduo do DNA. Entretanto, as conseqncias desses erros podem ser mais graves, por serem herdveis, quando ocorrem: a) na transcrio, apenas. b) na replicao, apenas. c) na replicao e na transcrio, apenas. d) na transcrio e na traduo, apenas. e) em qualquer um dos trs processos.
147

a) b) c) d) e)

A, D, F, G B, D, F, G B, D, F, H A, D, E, G A, D, F, H

294. UFRJ Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto armar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justique sua resposta. 295. UFPE Na questo a seguir, escreva nos parnteses a letra (V) se a armativa for verdadeira ou (F) se for falsa. As proposies a seguir so relativas ao processo de sntese de protenas nas clulas vivas. ( ) A molcula de DNA transcreve no ncleo uma molcula de RNA mensageiro (RNAm) com vrias seqncias de trs bases os cdons. ( ) Cada cdon do RNA mensageiro determinar a colocao de um aminocido especco na cadeia polipeptdica.

PV2D-07-BIO-14

299. UFV-MG Sabe-se que o ncleo transmite a informao gentica nele armazenada em duas ocasies: quando a clula se reproduz e quando envia ao citoplasma cpias de sua informao acumulada no cido desoxirribonuclico, para a sntese protica. O esquema representa alguns dos passos necessrios para esta sntese, bem como as molculas e estruturas nela envolvidas.

301. UFTM-MG O esquema representa a sntese protica em organismos eucariotos.

Nele, esto assinaladas algumas etapas, estruturas e regies da clula onde ocorrem etapas distintas. Assinale a alternativa que contm as associaes corretas. a) 1 - DNA; 3 - ribossomo; I - traduo; A - ncleo. b) 1 - gene; 4 - protena; I - transcrio; B - citoplasma. c) 2 - RNAm; 3 - RNAt; II - traduo; A - ncleo. d) 2 - gene; 3 - RNAt; II - transcrio; B - citoplasma. e) 3 - ribossomo; 4 - cido graxo; I - traduo; B - citoplasma. 302. Fatec-SP O esquema a seguir representa a seqncia das etapas da sntese de um trecho de uma protena a partir da molcula de DNA, num certo organismo.

a) Qual o nome da estrutura (corpsculo) I? b) Como denominada a etapa III? c) Como denominado o complexo resultante da unio de IV e V? d) Qual a funo desempenhada por VI? e) Qual a macromolcula representada no esquema que origina tanto IV quanto VI? 300. UFMT A partir da observao da gura abaixo, julgue os itens.

( ) O fenmeno indicado pela seta 1 corresponde ao processo de duplicao onde so construdas cadeias de nucleotdeos. ( ) A seta 2 indica a formao de uma molcula de RNAm, responsvel pela captao e transporte dos aminocidos. ( ) O fenmeno indicado pela seta 3 corresponde ao processo de transcrio onde os ribossomos tm uma participao fundamental. ( ) A seta 4 indica a formao de uma cadeia polipeptdica onde o grupo amina de um aminocido perde um de seus hidrognios, enquanto o grupo carboxila do outro aminocido perde seu grupo hidroxila. Nessa reao, ocorre a formao de uma molcula de gua.
148

Sobre essa sntese, foram feitas as afirmaes abaixo. I. No esquema, os nmeros 1 e 2 correspondem, respectivamente, aos processos de traduo e transcrio, que ocorrem no ncleo das clulas eucariticas. II. A seqncia correta de bases nitrogenadas encontradas na molcula de RNA mensageiro, complementar ao segmento da hlice de DNA apresentada, UGGUUUGGCUCA. III. Para codicar a seqncia dos aminocidos do trecho da protena apresentada no esquema, so necessrios 24 nucleotdeos no RNA mensageiro.

Deve-se concluir que: a) apenas II est correta. b) apenas I e II est correta. c) apenas II e III esto corretas. d) apenas I e III esto corretas. e) todas esto corretas. 303. Fuvest-SP O desenho mostra a sntese de um polipeptdeo a partir da molcula de DNA, num certo organismo.

Com base nestas informaes, correto concluir que esses antibiticos atuam nas bactrias a) provocando a plasmlise das clulas. b) impedindo a transcrio do DNA nuclear. c) impedindo a transcrio ou a traduo no hialoplasma. d) como agentes mutagnicos do DNA mitocondrial. e) impedindo que os ribossomos aderidos ao retculo endoplasmtico atuem na montagem das protenas. 307. Fuvest-SP Existe um nmero muito grande de substncias com funes antibiticas. Essas substncias diferem quanto maneira pela qual interferem no metabolismo celular. Assim, a tetraciclina liga-se aos ribossomos e impede a ligao do RNA transportador, a mitomicina inibe a ao da polimerase do DNA e a estreptomicina causa erros na leitura dos cdons do RNA mensageiro. Essas informaes permitem armar que: I. a tetraciclina impede a transcrio e leva a clula bacteriana morte por falta de RNA mensageiro. II. a mitomicina, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana. III. a estreptomicina interfere na traduo e leva a clula bacteriana a produzir protenas defeituosas. Das armativas acima: a) Apenas I correta. b) Apenas I e II so corretas. c) Apenas II e III so corretas. d) Apenas I e III so corretas. e) I, II e III so corretas. 308. Vunesp Em um segmento da cadeia ativa de DNA, que servir de molde para a ta de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da ta complementar do DNA, h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda: a) Quantas uracilas e quantas guaninas comporo a ta do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipeptdeos que ser formada? Justique sua resposta. 309. UFTMMG Muitos antibiticos so capazes de inibir o processo de traduo durante a sntese protica. Para evidenciar tal efeito, bactrias so colocadas em meio de cultura contendo aminocidos marcados por istopos radioativos. Em seguida, so feitos testes para detectar a assimilao desses aminocidos na presena e na ausncia de substncias que sero usadas como possveis antibiticos. Um aparelho mede a quantidade de cintilaes correspondentes s emisses radioativas do material analisado no caso, bactrias e o resultado expresso em cpm/106 clulas (cpm = cintilaes por minuto). Seguindo esse protocolo, foram testadas cinco
149

Esse organismo um procarioto ou um eucarioto? Por qu? 304. UFOP-MG Com relao sntese de protenas em uma clula, incorreto armar: a) Todas as clulas sintetizam sempre os mesmos tipos de protenas, nas mesmas propores. b) A seqncia de bases nitrogenadas ao longo da molcula de RNAm determina a seqncia de aminocidos incorporados na cadeia polipeptdica. c) Para a formao da protena, no basta a atividade do RNAm; necessria a participao dos RNAt e dos ribossomos. d) Ao longo de um DNA, h segmentos que atuam diretamente na sntese de protenas, os xons, e os que parecem inativos nesse processo, os ntrons. 305. UFSC Um dos processos metablicos mais importantes que ocorre em nvel celular a sntese de protenas. Com relao a esse processo, correto armar que: 01. ele ocorre nos ribossomos, no interior do ncleo. 02. dele participam trs molculas de RNA: o ribossmico, o mensageiro e o transportador. 04. o RNA transportador tem como funo levar as protenas produzidas no ncleo para o citoplasma. 08. o ordenamento dos aminocidos na protena formada d-se em funo da seqncia de bases nitrogenadas, presente no RNA mensageiro. 16. o cdigo gentico degenerado, isto , diferentes cdons sempre especicam diferentes aminocidos na cadeia polipeptdica. Some os itens corretos. 306. Fatec-SP Alguns antibiticos, como a eritromicina e o cloranfenicol, so utilizados no tratamento de doenas infecciosas, pois tm a capacidade de bloquear a sntese de protenas nas bactrias, sem interferir nas clulas afetadas ou contaminadas.

PV2D-07-BIO-14

substncias, 1,2,3,4 e 5, para se avaliar a ecincia de cada uma delas como um possvel antibitico. Os resultados esto demonstrados no grco.

A partir das anlises dos dados, possvel concluir corretamente que o melhor resultado como antibitico dado pela substncia: a) 1 b) 2 c) 3 d) 4 e) 5

Captulo 4
310. Cite duas caractersticas da membrana plasmtica que reveste as clulas dos seres vivos. 311. Uespi O esquema abaixo ilustra a estrutura molecular da membrana, segundo o modelo do mosaico uido. Analise-o e assinale a alternativa que indica os componentes indicados em (I) e em (II), nesta ordem. pertencentes ao sistema ABO. Tais molculas vo ajudar a compor uma regio denominada: a) glicoclix. b) citoesqueleto. c) desmossomo. d) microvilosidade. e) parede celular. 314. UELPR Considere os seguintes componentes qumicos: I. lipdios II. acares III. protenas IV. cidos nuclicos Assinale, a alternativa que identica corretamente os componentes bsicos de cada estrutura considerada. 1. Membrana plasmtica 2. Parede celular a) (1) I e II, (2) III e IV b) (1) I e III, (2) II c) (1) I e IV, (2) II d) (1) II, (2) II e III e) (1) III, (2) I e III 315. Fuvest-SP Para exercerem suas funes de reabsoro, as clulas epiteliais dos tbulos renais apresentam: a) microvilosidades e muitas mitocndrias. b) superfcie lisa e muitas mitocndrias. c) desmossomos e poucas mitocndrias. d) superfcie lisa e poucas mitocndrias. e) grandes vacolos. 316. UEL-PR As diferenciaes da membrana plasmtica, cuja funo aumentar a superfcie celular, so denominadas: a) desmossomos. b) poros hidroflicos. c) plasmodesmos. d) microvilosidades. e) interdigitaes.

a) b) c) d) e)

protena e lipdio. lipdio e carboidrato. carboidrato e protena. lipdio e protena. polissacardeo e hidratos de carbono.

312. Quais os dois principais componentes das membranas celulares? a) Lipdios e acares b) Acares e protenas c) cidos nucleicos e lipdios d) Lipdios e protenas e) gua e sais minerais 313. UELPR Hemcias humanas possuem em sua membrana plasmtica protenas e glicdeos que atuam no processo de reconhecimento celular dos diferentes tipos de sangue
150

317. PUC-SP As microvilosidades presentes nas clulas do epitlio intestinal tm a funo de: a) aumentar a aderncia entre uma clula e outra. b) produzir grande quantidade de ATP, necessria ao intenso metabolismo celular. c) sintetizar enzimas digestivas. d) secretar muco. e) aumentar a superfcie de absoro. 318. UFC-CE Que processo, provavelmente, estaria ocorrendo em grande extenso, em clulas cuja membrana celular apresentasse microvilosidade? a) Detoxicao de drogas. b) Secreo de esterides. c) Sntese de protenas. d) Catabolismo. e) Absoro. 319. Unirio-RJ A membrana plasmtica apresenta algumas transformaes, que procedem como especializaes destinadas a aumentar o poder de absoro da clula ou a permitir o seu deslocamento. So exemplos dessas especializaes, respectivamente: a) desmossomos e interdigitaes. b) vacolos e plastos. c) cariomembrana e peroxissomos. d) microvilosidades e clios. e) interdigitaes e glioxissomos. 320. PUC-SP As estruturas apontadas pelas setas na gura a seguir representam uma formao:

b) bicapa protica contnua, dentro da qual so encontrados intercalados os lipdios da membrana. c) camada central lipdica bimolecular e molculas proticas sobre as duas faces desse folheto. d) camada central protica e molculas lipdicas sobre as duas faces dessa camada. e) bicapa protica e molculas lipdicas na periferia das duas faces da bicapa. 322. O esquema a seguir representa o modelo de organizao molecular da membrana plasmtica.

Assinale a alternativa incorreta. a) Esta organizao de membrana comum para as clulas dos seres vivos. b) 1 indica camada de fosfolipdios. c) 2 indica protena. d) Trata-se da membrana de uma clula eucariota, j que nas clulas procariotas h apenas uma camada de fosfolipdios. e) Em protozorios esta estrutura, alm de delimitar o meio celular, uma estrutura de proteo para o organismo. 323. FTESM-RJ O esquema abaixo representa um modelo da membrana plasmtica feito por um aluno. Em relao ao modelo, so feitas as seguintes armativas: I. As lminas de isopor representam protenas brilares. II. As folhas do rabanete representam polissacardeos. III. A face B interna. IV. As peras representam protenas integrais.

a) importante para a movimentao celular. b) importante para aumentar a superfcie celular, facilitando a absoro de substncias do meio externo. c) denominada vescula pinocittica. d) importante para manter a aderncia entre uma clula e outra. e) que contm grande quantidade de enzimas. 321. UFPI A estrutura da membrana celular, no modelo de Singer e Nicholson, formada por uma: a) bicapa lipdica contnua, dentro da qual so encontradas intercaladas as protenas integrais da membrana. Assinale: a) se somente as armativas I, II e III esto corretas. b) se somente as armativas II, III e IV esto corretas. c) se somente as armativas I, III e IV esto corretas. d) se somente as armativas I, II e IV esto corretas. e) e se todas as armativas esto corretas.
151

PV2D-07-BIO-14

324. Cesgranrio-RJ Todas as clulas possuem uma membrana plasmtica, ou plasmalema, que separa o contedo protoplasmtico ou meio intracelular do meio ambiente. A existncia e integridade da membrana so importantes porque: a) regulam as trocas entre a clula e o meio, s permitindo a passagem de molculas de fora para dentro da clula e impedindo a passagem no sentido inverso. b) possibilitam clula manter a composio intracelular diversa da do meio ambiente. c) impedem a penetrao de substncias existentes em excesso no meio ambiente. d) exigem sempre consumo energtico para a captao de alimento do meio externo. e) impedem a sada de gua do citoplasma. 325. Unirio-RJ As clulas animais apresentam um revestimento externo especco, que facilita sua aderncia, assim como reaes a partculas estranhas, como, por exemplo, as clulas de um rgo transplantado. Esse revestimento denominado: a) membrana celulsica. b) glicoclix. c) microvilosidade. d) interdigitaes. e) desmossomos. 326. Fatec-SP Durante a embriognese, ocorre o processo de diferenciao celular, no qual cada clula se especializa para o desempenho de determinada funo. Clulas com funo de secreo, adeso e absoro, todas em intensa atividade metablica, devem apresentar, respectivamente: a) desmossomos, microvilosidades, abundncia de complexos de Golgi e mitocndrias. b) abundncia de complexos de Golgi, desmossomos, microvilosidades e maior nmero de mitocndrias. c) abundncia de complexos de Golgi, microvilosidades, desmossomos e muitas mitocndrias. d) microvilosidades, desmossomos, abundncia de mitocndrias e de retculos endoplasmticos rugosos. e) abundncia de mitocndrias, desmossomos, microvilosidades e extensa rede de microlamentos. 327. Unicamp-SP A seguir esto representados trs modelos de biomembranas:

a) A que constituintes da membrana se referem as letras a, b e c? b) Qual dos modelos anteriores atualmente aceito para explicar a estrutura das biomembranas? c) Que caracterstica do modelo escolhido lhe confere vantagem do ponto de vista de transporte atravs da biomembrana? 328. Unioeste-PR O modelo a seguir representa a estrutura molecular da membrana plasmtica, segundo Singer e Nicholson (1972). Observando-o, leia as armativas propostas e assinale a(s) correta(s):

01. O nmero 1 indica a parte hidrofbica dos fosfolipdios que controlam o transporte pela membrana. 02. O nmero 2 indica as protenas que formam barreiras para substncias hidrossolveis. 04. O nmero 3 indica uma protena que facilita a passagem de ons pela membrana. 08. O nmero 4 indica uma molcula de glicdio que faz parte do glicoclix. 16. O nmero 5 indica uma protena que diculta a passagem de gases pela membrana. 32. Os nmeros 1 e 2 indicam regies hidroflica e hidrofbica de lipdios, respectivamente. 329. Desmossomos e microvilosidades so importantes adaptaes de membrana plasmtica de clulas de determinados tecidos. A respeito dessas estruturas, responda: a) Quais so suas funes, respectivamente? b) Cite um tipo celular onde se podem encontrar as microvilosidades.

152

330. FURG-RS A membrana plasmtica pode apresentar modicaes ligadas ao aumento da adeso celular. Assinale a alternativa que apresente exemplos destas modicaes nas clulas epiteliais animais. a) glicoclix e plasmodesmos b) desmossomos e interdigitaes c) plasmodesmos e microvilosidades d) desmossomos e vilosidades e) znula de ocluso e trama terminal 331. Uespi Em algumas clulas, a membrana plasmtica apresenta diferenciaes mostradas em (I), (II) e (III), nesta ordem. 332. A membrana plasmtica lipoprotica. Aponte dois componentes que podem ser encontrados com freqncia na sua formao. a) Fosfolipdios e colesterol b) Celulose e ceras c) Lipoprotenas e lactose d) Glicoprotenas e miosina e) Quitina e queratina

a) b) c) d) e)

microvilosidade, desmossomo e interdigitao. interdigitao, desmossomo, microvilosidade. desmossomo, microvilosidade, interdigitao. fragmoplasto, microvilosidade, desmossomo. microvilosidade, fragmoplasto, placa glandular.

333. UFRGS-RS O quadro abaixo refere-se aos envoltrios celulares e a algumas de suas especializaes. Assinale a alternativa que associa corretamente a estrutura celular com as suas caractersticas.
Nome a) b) c) d) e) Microvilosidades Glicoclix Membrana plasmtica Parede celular Desmossomos Funo Aderncia entre as clulas Proteo da superfcie celular contra leses mecnicas e qumicas Controle de trocas entre a clula e o meio externo Sustentao e manuteno da forma da clula Aumento da superfcie da membrana Presena em clulas vegetais no no no sim sim Presena em clulas animais sim sim sim sim sim

334. Unicamp-SP Um certo tipo de macromolcula destinada membrana plasmtica celular depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

PV2D-07-BIO-14

a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso.

153

335. Em relao a estrutura e propriedades da membrana plasmtica, faa associaes corretas. I. Modelo mosaico uido II. Membrana semipermevel III. Permeases IV. Permeabilidade seletiva a) Protenas presentes na membrana plasmtica, que auxilia no transporte de substncias, sem gasto de energia. b) Mecanismo exercido pela membrana plasmtica, que controla a entrada e a sada de substncias da clula. c) Caracterstica da membrana plasmtica, que permite a entrada e a sada de substncias das clulas. d) Modelo proposto para explicar a estrutura da membrana plasmtica. Tem como caracterstica a movimentao e a maleabilidade entre as molculas. a) I a II c III d IV b b) I b II c III a IV b c) I d II a III c IV b d) I d II c III a IV b e) I c II d III a IV b 336. A membrana plasmtica, devido sua permeabilidade seletiva, controla a entrada e a sada de substncias da clula. Uma substncia ir se difundir para o meio externo quando: a) sua concentrao externa estiver maior. b) sua concentrao externa estiver igual interna. c) sua concentrao interna estiver maior. d) sua concentrao interna estiver menor. e) tiver energia disponvel para o transporte. 337. Fuvest -SP Para a ocorrncia de osmose, necessrio que: a) as concentraes de soluto dentro e fora da clula sejam iguais. b) as concentraes de soluto dentro e fora da clula sejam diferentes. c) haja ATP disponvel na clula para fornecer energia ao transporte de gua. d) haja um vacolo no interior da clula no qual o excesso de gua acumulado. e) haja uma parede celulsica envolvendo a clula, o que evita sua ruptura. 338. Uespi Quando se faz o salgamento de carnes, sabe-se que os microorganismos que tentarem se instalar morrero por desidratao. Conclui-se, assim, que essas carnes constituem um meio: a) isotnico. b) hipotnico. c) hipertnico. d) lipdico. e) plasmolisado.
154

339. UFSM-RS

Hemcias humanas foram colocadas em um meio com concentraes diferentes. Pelo formato das clulas I, II e III, sabe-se que os meios se classicam, respectivamente, como: a) hipertnico, isotnico, hipotnico. b) hipotnico, hipertnico, isotnico. c) hipotnico, isotnico, hipertnico. d) isotnico, hipotnico, hipertnico. e) isotnico, hipertnico, hipotnico. 340. UFU-MG Numa experincia em laboratrio, foi montado um osmmetro, conforme mostra a gura. Na bexiga de celofane, foi colocada uma soluo concentrada de sacarose e, no copo, gua destilada. Inicialmente, o que deve ter ocorrido?

a) A gua saiu da bexiga, atravessando o celofane e fazendo descer o nvel da soluo no tubo de vidro graduado. b) O nvel da soluo no tubo graduado subiu porque entrou gua na bexiga, atravs do celofane. c) O nvel da soluo no subiu nem desceu no tubo graduado, porque o celofane impermevel gua. d) O nvel da soluo no tubo graduado desceu no incio, mas logo tornou a subir. e) O nvel da soluo desceu no tubo graduado pela ao da gravidade. 341. PUC-MG As trocas entre as clulas e o meio podem ocorrer sob diversas modalidades como, por exemplo, por difuso simples e difuso facilitada. O que distingue a difuso facilitada da simples?

342. UERGS-RS Quando o feijo cozido em gua com sal, observa-se que ele murcha, pois: a) o gro perde gua por osmose. b) os sais do gro passam para a gua por difuso. c) o calor estimula o transporte das protenas da gua para o gro. d) o transporte passivo das protenas ocorre do gro para a gua. e) o gro perde protenas por osmose. 343. Descascou-se uma mexerica, retirando-lhe, em seguida, um gomo e a pelcula que o recobre, deixando expostos os favos. A seguir, colocou-se uma pitada de sal sobre os favos. Aps 5 minutos, observou-se o surgimento de um lquido nesta regio. A partir desse resultado, assinale a alternativa correta. a) Houve a passagem do lquido do meio hipotnico para o meio hipertnico. b) O lquido foi ativamente transportado do meio hipertnico para o meio hipotnico. c) As clulas vegetais da mexerica apresentam membranas permeveis, que permitem o livre trnsito de substncias dissolvidas, como protenas e lipdios. d) Por diferenas de concentrao do meio, ocorreu a deplasmlise da clula vegetal, fazendo surgir o lquido. 344. Fatec-SP prtica comum salgarmos os palitos de batata aps terem sido fritos, mas nunca antes, pois, se assim for, eles murcharo. E murcharo porque: a) as clulas dos palitos de batata cam mais concentradas que o meio externo a elas e, assim, ganham gua por osmose. b) as clulas dos palitos da batata cam mais concentradas que o meio externo a ela e, assim, ganham gua por transporte ativo. c) as clulas dos palitos da batata cam mais concentradas que o meio externo a elas e, assim, perdem gua por transporte ativo. d) o meio externo aos palitos da batata ca mais concentrado que as clulas deles, que, assim, perdem gua por osmose. e) o meio externo aos palitos de batata ca menos concentrado que as clulas deles, que, assim, ganham gua por pinocitose. 345. Mackenzie-SP Hemcias humanas foram colocadas em um tubo de ensaio que continha um meio lquido. Aps algum tempo, o lquido tornou-se avermelhado. Um estudante chegou s seguintes concluses: I. O meio em que as clulas estavam era hipotnico.

II. O fenmeno observado causado pela entrada de gua nas clulas, provocando sua ruptura. III. A hemoglobina, presente no citoplasma das hemcias, misturou-se ao meio, tornando-o vermelho. IV. O fenmeno conhecido como osmose e envolve gasto de ATP. O estudante est correto: a) em todas as suas concluses. b) somente nas concluses I e II. c) somente nas concluses II e IV. d) somente nas concluses II e III. e) somente nas concluses I, II e III. 346. UFRGS-RS Num experimento, uma ameba de gua doce e uma hemcia de um ser humano foram colocadas em um meio hipotnico. Depois de algum tempo, vericouse que a ameba sobreviveu, enquanto a hemcia foi destruda por hemlise. Assinale a alternativa que apresenta uma adaptao que possibilitou a sobrevivncia da ameba. a) Permeases que impedem a entrada de gua na clula. b) Pseudpodes que realizam a expulso da gua excedente que penetra na clula. c) Um citoplasma hipotnico em relao ao seu hbitat. d) Uma parede celular praticamente impermevel passagem de gua. e) Um vacolo pulstil para expelir o excesso de gua que entra na clula por osmose. 347. A membrana plasmtica, atravs de sua permeabilidade seletiva, controla a entrada e a sada de substncia na clula. Em relao aos mecanismos de transporte, julgue os itens a seguir, assinalando V ou F. ( ) A difuso um processo de transporte atravs da membrana plasmtica, onde o soluto se desloca do meio mais concentrado para o meio menos concentrado, sem gasto de energia e a favor do gradiente de concentrao. ( ) A osmose um processo de transporte atravs da membrana plasmtica, onde o solvente se desloca do meio mais concentrado para o meio menos concentrado, sem gasto de energia e a favor do gradiente de concentrao. ( ) A difuso facilitada um processo em que h a participao de protenas transportadoras que auxiliam o processo de transporte. um transporte a favor do gradiente de concentrao, porm com gasto de energia. ( ) Osmose, difuso simples e facilitada so tipos de transporte passivo, onde o solvente e o soluto, respectivamente, so tansportados a favor do gradiente de concentrao, e sem gasto de energia.

PV2D-07-BIO-14

155

348. UEL-PR Durante uma aula prtica de Biologia, alunos de uma escola testaram o efeito da tonicidade do meio sobre eritrcitos de mamferos, cuja osmolaridade do plasma era de 300 mOsm/L H2O. Para isso, colocaram as clulas em solues com diferentes concentraes osmticas, como representado a seguir.

351. Fuvest-SP As bananas mantidas temperatura ambiente deterioram-se em conseqncia da proliferao de microorganismos. O mesmo no acontece com a bananada, conserva altamente aucarada produzida com essas frutas. a) Explique, com base no transporte de substncias atravs da membrana plasmtica, por que bactrias e fungos no conseguem proliferar em conservas com alto teor de acar. b) D exemplos de outro mtodo de conservao de alimentos que tenha por base o mesmo princpio siolgico. 352. Cesgranrio-RJ No desenho abaixo, observamos trs tubos de ensaio contendo solues de diferentes concentraes de NaCl e as modicaes sofridas pelas hemcias presentes no seu interior. Em relao a este desenho, assinale a alternativa correta.

Aps a realizao do teste, correto armar: a) Na situao A, as clulas caram trgidas e, em B e C, as clulas no se alteraram. b) Nas situaes A e C, as clulas caram trgidas e, em B, as clulas no se alteraram. c) Nas situaes A e B, as clulas no se alteraram e, em C, as clulas murcharam. d) Na situao A, as clulas no se alteraram e, em B e C, as clulas caram trgidas. e) Na situao A, as clulas caram tgidas; em B, as clulas murcharam; e em C, no se alteraram. 349. Mackenzie-SP

Assinale a explicao correta para o fenmeno observado acima. a) O sal provoca a desintegrao das membranas celulares do caramujo. b) O sal se dissolve no muco que recobre o corpo do caramujo, tornando-se uma soluo hipertnica, o que provoca a sada de gua do corpo por osmose. c) A pele do caramujo reage com o sal, formando um composto instvel que rompe as clulas. d) O sal absorvido pelas clulas da pele do caramujo, cujo citoplasma se torna mais concentrado, provocando perda de gua pelas clulas. e) O sal provoca uma reao alrgica no caramujo, resultando na sua desintegrao. 350. Unicamp-SP Uma certa quantidade de gua de lagoa com amebas foi colocada em frascos numerados de 1 a 5. Foram adicionadas quantidades crescentes de sais a partir do frasco 2 at o 5. Observando-se, em seguida, as amebas ao microscpio, constatou-se uma gradual diminuio na velocidade de formao de vacolos pulsteis a partir do frasco 2. No frasco 5, no se formavam esses vacolos. a) Qual a principal funo do vacolo pulstil? b) O que aconteceria se as amebas do frasco 1 no tivessem a capacidade de formar vacolos? Por qu? c) Por que no frasco 5 no se formaram vacolos?
156

a) Em 1, a soluo isotnica em relao hemcia; em 2, a soluo hipertnica em relao hemcia; e em 3, a soluo hipotnica em relao hemcia. b) As hemcias em 1 sofreram alterao de volume, porm em 2 ocorreu plasmlise e, em 3, turgescncia. c) Considerando a concentrao isotnica de NaCl = 0,9%, a soluo 2 certamente possui uma concentrao de NaCl inferior a 0,9% e a soluo 3, uma concentrao de NaCl superior a 0,9%. d) As hemcias do tubo 2 sofreram perda de gua para a soluo, enquanto as do tubo 3 aumentaram seu volume, depositando-se no fundo. e) A plasmlise sofrida pelas hemcias do tubo 2 ocorreu em razo da perda de NaCl para o meio. 353. Fuvest-SP Uma clula animal foi mergulhada em soluo aquosa de concentrao desconhecida. Duas alteraes ocorridas na clula encontram-se registradas no grco abaixo.

1. Qual a tonicidade relativa da soluo em que a clula foi mergulhada? 2. Qual o nome do fenmeno que explica os resultados apresentados no grco? a) Hipotnica, osmose b) Hipotnica, difuso c) Hipertnica, osmose d) Hipertnica, difuso e) Isotnica, osmose 354. O quadro abaixo mostra o comportamento de duas clulas expostas a diferentes solues.

Analisando a gura e o grco, responda s questes. a) A que tubo de ensaio correspondem os resultados apresentados no grco e qual a tonicidade relativa da soluo em que as clulas esto mergulhadas? b) Em qual tubo de ensaio a tonicidade relativa da soluo isotnica? Justique. 356. UFMS (modificado) Entre os tipos de transporte existentes na clula, est o que se chama difuso facilitada, associada com a doena fatal chamada brose cstica, que gentica e relacionada com a difuso facilitada do on cloro (Cl). Analise os itens abaixo, assinale e some a(s) armativa(s) correta(s). 01. Permeases so protenas de transporte que auxiliam a passagem de determinadas substncias, impedidas de entrar na clula pela camada de lipdios. 02. No processo, somente participam as protenas (permeases) que transportam substncias do meio em que esto mais concentradas para o meio em que esto menos concentradas, caso tido como passivo, isto , sem gasto de energia. 04. No processo h gasto de energia metablica durante o transporte de substncias. 08. O processo particularmente importante para ons como cloro (Cl), sdio (Na+) e potssio (K+) e para substncias lipossolveis. 16. O processo particularmente importante para ons como cloro (Cl), sdio (Na+) e potssio (K+) e para substncias como aminocidos e glicose. 357. O transporte de Na+ e K+ atravs da membrana plasmtica, com gasto de nergia, caracterizado como: a) transporte ativo. b) transporte passivo. c) difuso facilitada. d) difuso simples. e) osmose. 358. Considerando os glbulos vermelhos, verica-se que a concentrao de K+ muito maior no interior que no exterior da clula. O mesmo no acontece com os ons Na+, cuja concentrao maior no exterior que no interior da clula. A entrada de K+ e a sada de Na+ dos glbulos vermelhos podem ocorrer por: a) transporte passivo. b) hemlise. c) difuso. d) transporte ativo. e) nenhuma das anteriores.

Os processos que ocorreram em A e B so, respectivamente: a) osmose e difuso. b) difuso e transporte ativo. c) osmose e difuso facilitada. d) difuso e osmose. e) transporte ativo e difuso facilitada. 355. UFSCar-SP A gura mostra trs tubos de ensaio (1, 2 e 3) contendo solues de diferentes concentraes de NaCl e as modicaes sofridas, aps algum tempo, por clulas animais presentes em seu interior. O grco, abaixo dos tubos de ensaio, corresponde a duas alteraes ocorridas nas clulas de um dos trs tubos de ensaio.

PV2D-07-BIO-14

157

359. UFPE Medindo-se a concentrao de dois importantes ons, Na+ e K+, observa-se maior concentrao de ons Na+ no meio extracelular do que no meio intracelular. O contrrio acontece com os ons K+. ons de Na+ so capturados do citoplasma para o meio extracelular, e ons de potssio (K+) so capturados do meio extracelular para o meio intracelular, como mostrado na gura adiante. Este processo conhecido como:

Identicamos nesse enunciado um caso de: a) dufuso simples. b) equilbrio osmtico. c) transporte ativo. d) transporte passivo. e) absoro direta pela membrana plasmtica. 361. Urca-CE Analise os dois eventos nos esquemas a seguir e identique os processos envolvidos.

a) b) c) d) e)

(I) Difuso simples e (II) osmose (I) Osmose e (II) difuso facilitada (I) Osmose e (II) transporte ativo (I) Transporte ativo e (II) difuso simples (I) Difuso simples e (II) transporte ativo

a) b) c) d) e)

difuso facilitada por permeases intracelulares. osmose em meio hipertnico. difuso simples transporte ativo. transporte por poros da membrana plasmtica.

362. UFRJ As guras abaixo representam duas situaes, I e II, em que os compartimentos A e B contm uma soluo siolgica e esto separados, um do outro, por uma membrana biolgica M. Nessas duas situaes, acrescentou-se soluto no compartimento A. Os solutos so transportados atravs da membrana. Aps o tempo t, vericou-se uma nova distribuio do soluto, entre A e B, como mostram as guras.

360. UFBA As clulas de nosso organismo utilizam a glicose como fonte de energia, queimando-a atravs de reaes de oxidao. Para tanto, o consumo de glicose grande, e j se observou que, freqentemente, a clula absorve essa substncia, mesmo quando a sua concentrao intracelular maior que a extracelular; portanto, contra um gradiente de concentrao. Isso, porm, exige algum dispndio de energia pela clula uma espcie de investimento de energia.

Qual das duas situaes representa um transporte ativo? Justique sua resposta.

158

363. UFBA Os esquemas representam clulas nas quais h passagem de substncias atravs de suas membranas:

366. A concentrao de ons Na+ no meio extracelular maior do que no meio intracelular. O oposto observado na concentrao de ons K+, como ilustrado a seguir. Essa diferena de concentrao mantida por transporte ativo. Todavia h tambm deslocamento desses ons do local onde esto em maior concentrao para o de menor concentrao, por um processo de:

a) clasmocitose. b) fagocitose. c) osmose.

d) difuso. e) pinocitose.

Os fenmenos representados em A, B, C so, respectivamente: a) fagocitose, pinocitose, transporte ativo. b) pinocitose, difuso, transporte ativo. c) difuso, transporte ativo, osmose. d) osmose, trasporte ativo, difuso e) pinocitose, fagocitose, difuso. 364. Fuvest-SP A tabela a seguir compara a concentrao de certos ons nas clulas de Nitella e na gua do lago onde vive essa alga. Concentrao de ons em mg/L Na+ Clulas gua do lago 1.980 28 K+ 2.400 2 Mg2+ 260 36 Ca2+ 380 26 Cl 3.750 35

367. Mackenzie-SP Considere as seguintes situaes. I. Uma clula da raiz de um vegetal absorvendo gua do solo. II. Uma clula da folha de uma alface, temperada com sal e vinagre. III. Uma hemcia em um capilar do pulmo. Assinale a alternativa que apresenta o tipo de transporte que cada clula realiza, em cada caso. Situao I a) transporte ativo b) c) d) osmose osmose osmose Situao II difuso difuso difuso osmose osmose Situao III difuso osmose transporte ativo difuso osmose

e) transporte ativo

Os dados permitem concluir que as clulas dessa alga absorvem: a) esses ons por difuso. b) esses ons por osmose. c) esses ons por transporte ativo. d) alguns desses ons por transporte ativo e outros por osmose. e) alguns desses ons por difuso e outros por osmose. 365. Unicamp-SP A concentrao de um determinado on X vinte vezes maior no interior de uma clula do que no meio extracelular. a) Explique o tipo de mecanismo que mantm essa diferena inica entre a clula e seu meio. b) O que aconteceria com a situao descrita acima, se fosse bloqueado o processo respiratrio dessa clula?

PV2D-07-BIO-14

368. UFU-MG Todas as clulas so revestidas pela membrana plasmtica (MP), uma estrutura que seletivamente, entre outras funes, controla a troca de substncias entre o citoplasma e o meio extracelular. Com relao a essa troca de substncias, assinale com (V) as armativas verdadeiras e com (F) as falsas. 1. Molculas pequenas e/ou lipossolveis, como oxignio, gs carbnico e gua, atravessam a camada lipdica da MP, por difuso simples. 2. A difuso facilitada, como, por exemplo, o transporte de glicose para o interior da clula, auxiliada pelas protenas transportadoras presentes na MP. 3. ons de sdio (Na+) so transportados ativamente do citoplasma para o meio extracelular, sem gasto de energia. 4. A difuso facilitada e o bombeamento de sdio (Na+) do citoplasma para o meio extracelular so transportes ativos, uma vez que consomem energia da clula.
159

369. A membrana plasmtica depende de alguns fatores internos e externos para controlar a entrada e sada de substncias. Dentre eles a concentrao das substncias no meio intracelular e extracelular. Assinale os itens corretos. 01. A difuso um processo de transporte atravs da membrana plasmtica, onde no h gasto de energia e o soluto se desloca a favor do gradiente de concentrao. 02. Soluo hipertnica aquela em a concentrao de solutos maior em relao uma soluo isotnica. 04. Transporte ativo um tipo de transporte onde h gasto de energia e sua ocorrncia observada quando o soluto se desloca de um meio hipotnico para um meio hipertnico. 08. Difuso simples e facilitada so tipos de transporte passivo, onde o soluto transportado de um meio hipotnico para um meio hipertnico, sem gasto de energia. 16. A osmose um processo de transporte, onde o solvente se desloca do meio hipertnico para o meio hipotnico, sem gasto de energia e a favor do gradiente de concentrao. 370. Cesgranrio-RJ Na coluna da direita esto descritas trs formas de transporte de substncias atravs de membranas e na coluna da esquerda os termos com que essas formas de tranporte so conhecidas. Correlacione-as. 1. Transporte passivo I. Determinadas substncias so transportadas atravs da membrana plasmtica mesmo contra um gradiente osmtico, havendo neste caso um grande consumo energtico por parte da clula. II. A velocidade de penetrao de certas substncias atravs da membrana plasmtica acelerada pela presena de molculas transportadoras. III. A penetrao de vrias substncias atravs da membrana plasmtica se d devido a um gradiente osmtico, sendo este um processo fsico de difuso

371. Em um organismo, as clulas apresentam composio variada, conseguindo manter no seu citoplasma substncias em concentrao muito diferente do meio externo. O principal responsvel por isso a membrana plasmtica, que conta com diferentes tipos de transporte, esquematizados na gura abaixo.

Com o auxlio da gura, julgue os seguintes itens. I. A pode representar uma substncia lipossolvel. II. Para o transporte da substncia B, a sua concentrao deve ser maior no exterior do que no interior da clula. III. A energia indicada no esquema , em geral, proveniente da quebra de ATP. IV. Protenas como a C tem importante papel no equilbrio osmtico da clula. So corretos: a) I, II e III d) I, III e IV b) I, II e IV e) I, II, III e IV c) I e III 372. O transporte de substncia entre o meio intracelular e o meio intersticial dependem de algumas condies para a sua ocorrncia. Em relao aos mecanismos de transporte e a essas condies, assinale a alternativa incorreta. a) O transporte de substncias atravs da membrana, sem gasto de energia e a favor do gradiente de concentrao, denominado transporte passivo. b) So considerados mecanismos passivos a difuso simples e difuso facilitada, no transporte de solutos, e a osmose, no transporte de solventes. c) A energia necessria para a ocorrncia do transporte ativo liberada da hidrlise de ATP. d) Para que ocorra o transporte ativo nas clulas deve existir uma diferena na concentrao das substncia. O transporte ocorre do meio mais concentrado para o meio menos concentrado, com gasto de energia. e) O exemplo mais comum de transporte ativo a bomba de sdio e potssio, que mantm uma diferena importante para o funcionamento dos neurnios.

2. Transporte ativo

3. Difuso facilitada

a) b) c) d) e)

1 I; 2 I; 3 III. 1 I; 2 III; 3 II. 1 II; 2 I; 3 I. 1 III; 2 II; 3 I. 1 III; 2 I; 3 II.

160

373. Unioeste-PR O atual modelo para a estrutura da membrana plasmtica foi elaborado por Singer e Nicholson (1972). A partir deste modelo correto armar: 01. que substncias hidrofbicas como CO2 so solveis em lipdios e passam rapidamente atravs da membrana. 02. que o transporte passivo do soluto por difuso tende a ocorrer do meio menos concentrado para o mais concentrado 04. que osmose um exemplo de transporte ativo de substncias que ocorre com a participao de protenas de transmembranas. 08. que, na difuso facilitada, o transporte do soluto ocorre em direo ao maior gradiente de concentrao com gasto de ATP. 16. que a caracterstica anptica da membrana plasmtica devida dupla camada de protenas que a constitui. 32. que o transporte ativo ocorre por bombas de soluto em direo ao maior gradiente de concentrao. 64. que, na bomba Na+/K+, Na+ bombeado para fora da clula e K+ bombeado para dentro da clula. 374. UFPR Medindo-se as concentraes de ons sdio e potssio no interior e no exterior de certas clulas em funo do tempo, foi possvel construir dois grcos. Nesses grcos, a linha cheia representa a concentrao extracelular e a linha pontilhada, a concentrao intracelular. Nas duas experincias, o metabolismo celular foi inibido num determinado momento (assinalado pela seta), pela adio de um bloqueador respiratrio, como o cianeto.

Com base em seus conhecimentos sobre transporte de ons e de pequenas molculas atravs das membranas, analise os grcos e responda: em condies normais, qual o mecanismo responsvel pela manuteno da diferena entre as concentraes inicas dentro e fora da clula exemplicada? a) Transporte ativo, atravs do qual os ons atravessam a membrana com gasto de ATP. b) Difuso simples, atravs da qual os ons podem atravessar a membrana com o auxlio de protenas transportadoras. c) Osmose, atravs da qual a gua atravessa a membrana a favor do gradiente de concentrao. d) Fagocitose, atravs da qual a clula captura ons e outras partculas slidas. e) Difuso facilitada, atravs da qual os ons so transportados contra seus gradientes de concentrao. 375. UFF-RJ A membrana basal das clulas tireoidianas tem a capacidade especca de bombear iodeto para o interior da clula. Isto chamado de seqestro de iodeto. Na glndula normal, a bomba de iodeto capaz de concentrar o iodeto at cerca de 30 vezes sua concentrao no sangue. Quando a glndula tireide est em sua atividade mxima, a proporo entre as concentraes pode chegar a um valor de at 250 vezes. (...) O retculo endoplasmtico e o complexo de Golgi sintetizam e secretam para dentro dos folculos uma grande molcula glicoprotica chamada de tireoglobulina.

Adaptado de GUYTON, A. C. e HALL, J. E. Tratado de Fisiologia Mdica. Rio de Janeiro, Guanabara Koogan, 1997, pp. 859-860.

PV2D-07-BIO-14

A partir da anlise do texto e da gura, responda s questes propostas. a) Que tipo de transporte utilizado para manter as concentraes altas de iodeto no interior da clula? b) De que forma o retculo endoplasmtico rugoso e o complexo de Golgi participam na produo de tireoglobulina?

161

376. Abaixo, pode-se observar a representao esquemtica de uma membrana plasmtica celular e de um gradiente de concentrao de uma pequena molcula X ao longo dessa membrana.

378. UFG-GO Uma clula vegetal colocada em determinada soluo. Aps trs horas, a clula apresenta-se como na gura.

Com base nesse esquema, considere as seguintes armativas: I. A molcula X pode se movimentar por difuso simples, atravs dos lipdios, caso seja uma molcula apolar.

Podemos dizer que a soluo era: a) hipotnica e a clula sofreu plasmlise. b) hipotnica e a clula sofreu deplasmlise. c) hipertnica e a clula sofreu deplasmlise. d) hipertnica e a clula sofreu plasmlise. e) isotnica e a clula cou trgida. 379. Fuvest Uma clula vegetal retirada de uma soluo isotnica 1, mergulhada em uma soluo hipertnica 2, e a seguir colocada em uma soluo 3, que apresenta concentrao idntica inicial 1.

II. A difuso facilitada da molcula X acontece quando ela atravessa a membrana com o auxlio de protenas carreadoras, que a levam contra seu gradiente de concentrao. III. Se a molcula X for um on, ela poder atravessar a membrana com o auxlio de uma protena carreadora. IV. O transporte ativo da molcula X ocorre do meio extracelular para o citoplasma. Assinale a alternativa correta. a) Somente as armativas I e III so verdadeiras. b) Somente as armativas I e II so verdadeiras. c) Somente as armativas II e IV so verdadeiras. d) Somente as armativas I, III e IV so verdadeiras. e) Somente a armativa III verdadeira. 377. PUC-SP Uma clula vegetal cida foi colocada em um determinado meio e adquiriu o seguinte aspecto:

a) O que acontece com a clula em 2? b) E em 3? 380. Quando uma clula colocada em meio hipertnico, ela perde sua turgescncia. O fenmeno , especicamente, denominado: a) clasmocitose. d) emeicitose. b) endocitose. e) plasmlise. c) deplasmlise. 381. Assinale a alternativa correta. Colocando-se uma alga de gua doce na gua salgada: a) ela absorver maior quantidade de gua que na gua doce. b) ela perder gua para o novo meio. c) ela absorver igual quantidade de gua que na gua doce. d) ela se adaptar facilmente ao novo ambiente. e) ela ultrapassar seu limite de turgescncia, rompendo a sua parede celular.

A clula est: a) trgida e foi colocada em meio hipotnico. b) trgida e foi colocada em meio hipertnico. c) plasmolisada e foi colocada em meio hipotnico. d) plasmolisada e foi colocada em meio hipertnico. e) murcha e foi colocada em meio hipotnico.

162

382. UFU-MG

385. Vunesp Um estudante colocou dois pedaos recm-cortados de um tecido vegetal em dois recipientes, I e II, contendo soluo salina. Depois de algumas horas, vericou que, no recipiente I, as clulas do tecido vegetal estavam plasmolisadas. No recipiente II, as clulas mantiveram o seu tamanho normal. Qual a concluso do estudante quanto: a) concentrao das solues salinas nos recipientes I e II, em relao ao suco celular desse tecido? b) o que signica dizer que, em I, as clulas estavam plasmolisadas? 386. UFJF-MG Observando ao microscpio clulas animais (hemcias) e clulas vegetais mantidas em meio hipotnico, percebe-se que somente as primeiras sofrem ruptura da membrana plasmtica. Essa diferena explicada pela presena nas clulas vegetais de: a) mitocndrias. d) ribossomos. b) parede celular. e) cromossomos. c) complexo golgiense. 387. Considere uma clula vegetal mergulhada em uma soluo aquosa. Considere os seguintes valores iniciais: PO = 1 atm e PT = 0,3 atm a) Qual o valor da DPD? b) Qual a tonicidade da soluo em que a clula foi mergulhada? c) At que momento haver entrada de gua na clula? d) Em qual estado a clula se encontra no nal do processo? 388. Unifor-CE A seqncia de guras abaixo representa o processo de plasmlise e deplasmlise em uma clula vegetal.

O esquema acima representa uma clula vegetal que foi isolada e colocada em uma soluo. Interpretandose o fenmeno ocorrido, incorreto armar que: a) a soluo hipertnica em relao ao suco vacuolar. b) ocorreu sada de gua do vacolo. c) a membrana plasmtica permevel gua. d) a clula sofreu plasmlise e a membrana plasmtica afastou-se da parede clular. e) a clula pode voltar ao normal se colocada em soluo isotnica. 383. O desenho abaixo representa uma clula normal colocada em 3 meios distintos, que denominamos A, B e C. Durante a sua passagem por esses meios naquela ordem, ocorrem 2 fenmenos conhecidos, respectivamente, como:

a) b) c) d) e)

turgescncia e plasmlise. plasmlise e osmose. plasmlise e deplasmlise. osmose e hemlise. deplasmlise e turgescncia.

PV2D-07-BIO-14

384. UFV-MG Uma clula vegetal, quando colocada em soluo hipotnica, recebe gua, j que a concentrao osmtica do seu meio interno maior do que a do meio externo. Por isso, o seu volume pode aumentar, mas at um certo limite, apesar de as concentraes externa e interna continuarem diferentes. Responda ao que se pede: a) O que impede o rompimento da clula vegetal, quando colocada em soluo hipotnica? b) O que permite gua penetrar na clula vegetal?

As situaes I, II e III podem ocorrer quando a clula colocada, respectivamente, em: a) soluo hipertnica, soluo hipotnica e gua pura. b) soluo hipertnica, gua pura e soluo hipotnica. c) soluo hipotnica, gua pura e soluo hipertnica. d) soluo hipotnica, soluo hipertnica e gua pura. e) gua pura, soluo hipotnica e soluo hipertnica.
163

389. De um pimento, retiram-se 4 fatias as quais foram pesadas e mergulhadas em 4 solues A, B, C e D, de diferentes concentraes de glicose. Assim, cada fatia permaneceu mergulhada em sua respectiva soluo por cerca de 30 minutos. Aps esse perodo, as fatias foram novamente pesadas. O grco representa as variaes na massa das fatias do pimento.

391. UFPE (modificado) Analise as consideraes sobre os processos osmticos representados nas guras abaixo:

I.

Conclui-se, a partir dos resultados do experimento, que: a) as solues A e B so hipertnicas em relao ao meio interno das clulas do pimento. b) as solues A e C fazem com que as clulas do pimento percam gua. c) as solues B e D so hipotnicas em relo ao meio interno das clulas do pimento. d) a soluo C apresenta concentrao igual das clulas do pimento. e) a soluo C uma soluo isotnica e faz com que o pimento perca gua. 390. Vunesp Um pesquisador colocou clulas de raiz de cebola, hemcias humanas e alguns paramcios, separadamente, em trs tubos de ensaio numerados e tendo gua destilada. Tubo I. clulas de raiz de cebola. Tubo II. hemcias humanas. Tubo III. paramcios. Algum tempo depois, foi observado que no tubo I, as clulas tiveram seus volumes aumentados; no tubo II, as hemcias tiveram suas membranas plasmticas rompidas e a gua cou ligeiramente avermelhada; no tubo III, o volume celular dos paramcios permaneceu inalterado. Pergunta-se: a) Por que no houve alterao no volume celular dos paramcios? b) Qual a estrutura celular presente nas clulas da raiz de cebola (e ausente nas hemcias), que evitou a ruptura dessas clulas? Por que o tubo que continha hemcias cou avermelhado aps a ruptura das membranas plasmticas?

Enquanto as clulas 1 e 4 esto em meio isotnico, a clula 2 est em meio hipotnico. II. As clulas 3, 5 e 6 esto em meio hipertnico. III. A clula 6 est em meio hipotnico e apresenta-se turgida em relao clula 4. IV. Os processos de osmose representados em todas as guras acima dependem da concentrao do meio externo, da concentrao da clula e da resistncia da parede celular. Est(o) correta(s) apenas: a) I. b) II e III. c) I e IV d) III e IV. e) III. 392. UEL-PR Clulas vegetais foram mantidas, por algum tempo, em soluo isotnica e, em seguida, transferidas para solues de NaCI de concentraes desconhecidas (frascos 1 e 2). Os grcos a seguir representam as variaes de volume encontradas nessas clulas:

164

De acordo com os dois grcos anteriores, foram feitas as seguintes armativas: I. As solues e NaCI dos frascos 1 e 2 so, respectivamente, hipotnica e hipertnica em relao s clulas vegetais. II. A presso de turgor em T2 menor nas clulas imersas no frascos 1 do que nas clulas imersas no frasco 2. III. Ocorre um aumento crescente na presso de turgor a partir do momento em que as clulas so mergulhadas no frasco 2. IV. Ocorre um aumento crescente da resistncia da parede celular no momento em que as clulas so mergulhadas no frasco 1 a) I e II. b) II e III. c) III e IV. d) I, II e III. e) I, III e IV.

Classique o tipo de soluo a que a clula foi exposta nas situaes 1 e 2, e explique os fenmenos que ocorreram nos dois casos. 395. Vunesp Em clulas vegetais em meio aquoso, citoplasma e membrana plasmtica funcionam como uma membrana semipermevel. As trocas de gua ocorrem entre a soluo externa e o vacolo. A equao que relaciona as variveis que interferem na osmose em clulas vegetais : Sc = Si M, na qual Sc = suco celular (capacidade de a clula ganhar gua); Si = suco interna (tendncia entrada de gua devido suco osmtica exercida pelo vacolo); M = resistncia da membrana celulsica, que equivale tendncia de sada de gua da clula. Em relao a essas variveis, pode-se dizer que, quando: a) em meio hipotnico, em relao ao suco celular, o valor de M diminui e a clula torna-se trgida. b) em meio isotnico, em relao ao suco celular, o valor de M diminui e a clula murcha. c) em meio hipertnico, em relao ao suco celular, o valor de M aumenta e a clula torna-se plasmolisada. d) a clula est trgida, deixa de absorver gua, pois a concentrao do vacolo se iguala do meio: Si = 0 e Sc = M. e) a clula est trgida, deixa de absorver gua e M = Si. 396. Unicamp-SP Foi feito um experimento utilizando a epiderme de folha de uma planta e uma suspenso de hemcias. Esses dois tipos celulares foram colocados em gua destilada e em soluo salina concentrada. Observouse ao microscpio que as hemcias, em presena de gua destilada, estouravam e, em presena de soluo concentrada, murchavam. As clulas vegetais no se rompiam em gua destilada, mas em soluo salina concentrada notou-se que o contedo citoplasmtico encolhia. a) A que tipo de transporte celular o experimento est relacionado? b) Em que situao ocorre esse tipo de transporte? c) A que se deve a diferena de comportamento da clula vegetal em relao clula animal? Explique a diferena de comportamento, considerando as clulas em gua destilada e em soluo concentrada.
165

393. O esquema abaixo mostra o comportamento de uma clula vegetal submetida a duas condies osmticas diferentes.

a) Em que situao se encontram as clulas A e B? b) Se, no caso da clula A, o valor de PO de 12 atmosferas, qual o valor esperado, em atmosferas, de DPD e PT para essa clula? c) O que impede a clula A de sofrer lise ao ser colocada no meio I? 394. UFF-RJ O esquema abaixo representa o aspecto morfolgico de uma clula vegetal submetida a condies normais.

Caso esta clula seja exposta a solues com diferentes concentraes de soluto, sero observadas alteraes em sua morfologia, como est representado nas situaes 1 e 2, ao lado.

PV2D-07-BIO-14

397. UFRJ Na membrana citoplasmtica existe uma protena que faz o transporte tivo (com gasto de ATP) de Na+ para fora da clula. Outro tipo de protena funciona como uma espcie de porto que pode abrir ou fechar, permitindo ou no a passagem de Na +. Com o porto fechado, o Na + acumula-se do lado de fora da clula, o que aumenta a presso osmtica externa, compensan-

do a grande concentrao de soluto orgnico no citoplasma. Isso evita a entrada excessiva de gua por osmose. a) Que estrutura celular torna menos importante essa funo de equilbrio osmtico do Na+ nas clulas vegetais? Justique sua resposta. b) Entre as duas protenas descritas, qual delas permite o movimento do Na+ a favor do seu gradiente de concentrao? Justique.

Captulo 5
398. a) b) c) d) e) absorver alimentos. secretar protenas. digerir alimentos. eliminar excretas. transmitir impulsos nervosos.

A estrutura acima est envolvida com quais processos abaixo? I. Sntese de protena II. Secreo celular III. Liberao de energia IV. Formao do acrossomo dos espermatozides V. Formao dos lisossomos Esto corretos: a) I, II e III. b) V, IV e III. c) II, IV e V. d) I, III e V. e) III, IV e V.

401. UFV-MG Assinale a alternativa que contm as organelas celulares relacionadas com a sntese e a secreo de protenas, respectivamente. a) Retculo endoplasmtico granular e complexo de Golgi. b) Retculo endoplasmtico granular e lisossomos. c) Complexo de Golgi e mitocndrias. d) Mitocndrias e lisossomos. e) Retculo endoplasmtico liso e complexo de Golgi. 402. F. M. Jundia-SP As clulas utilizam leucina para produzir material de secreo. Assim, se uma clula absorver leucina radiativa, depois de algum tempo haver radiatividade, principalmente: a) na membrana. d) no complexo de Golgi. b) nos vacolos. e) nos lisossomos. c) nas mitocndrias. 403. Mackenzie-SP Na clula representada a seguir, a produo, o armazenamento e a secreo de protenas so funes exercidas, respectivamente, pelas organelas:

399. UFSC (modificado) Uma descoberta fundamental para a cincia biomdica completou 100 anos. Em abril de 1898, o mdico citologista italiano Camilo Golgi revelou a existncia, dentro das clulas nervosas, de uma estrutura at ento desconhecida...
Cincia Hoje, vol. 25, 145, 1998, p. 74.

Esta estrutura foi denominada, quase meio sculo depois, complexo de Golgi, em homenagem a seu descobridor. Com relao a esta estrutura, correto armar que: 01. no foi observada, ainda, em nenhum outro tipo de clula, alm das clulas nervosas citadas no texto. 02. sua funo concentrar, modificar e eliminar secrees. 04. nela, as duas subunidades do ribossomo se acoplam. 08. um local onde ocorre alta sntese de lipdios. 16. formada por vrios conjuntos interligados de sculos achatados. 400. Uma clula que apresenta grande quantidade de mitocndrias e ribossomos, retculo endoplasmtico e complexo de Golgi bem desenvolvidos especializada em:
166

a) I, III e V. b) I, II e IV. c) II, III e V.

d) I, IV e V. e) II, III e IV.

404. UFU-MG (modificado) A insulina comea a ser sintetizada (I) em uma rede de tbulos membranosos interligados; transferida para o interior de cisternas empilhadas, onde sofre modicaes (II), e, em seguida, secretada (III). Todos esses processos so dependentes de energia da respirao (IV). A correspondncia correta entre processo e organela : a) (I) retculo endoplasmtico liso, (II) lisossomo e (III) mitocndria. b) (II) mitocndria, (III) lisossomo e (IV) retculo endoplasmtico liso. c) (I) retculo endoplasmtico rugoso, (III) lisossomo e (IV) complexo de Golgi. d) (II) complexo de Golgi, (III) retculo endoplasmtico rugoso e (IV) lisossomo. e) (I) retculo endoplasmtico rugoso, (II) complexo de Golgi e (IV) mitocndria. 405. UFU-MG As clulas dos cinos pancreticos so responsveis pela produo das enzimas digestivas do suco pancretico. Todo o processo de produo e secreo dessas enzimas pode ser acompanhado por meio de aminocidos marcados com trtio (istopo radioativo de hidrognio). O esquema abaixo mostra uma clula pancretica, onde o caminho percorrido por aminocidos marcados com esse istopo radioativo est assinalado com os nmeros 1, 2 e 3.

eletrnico. A tabela a seguir mostra a porcentagem de aminocidos radioativos por componente celular em cada intervalo de tempo. Componente celular Minutos aps a injeo 5 10 15 40 50 10 20 35 40 25 30 25 25 50 40 60 20 20 60 18 10 72

Retculo endoplasmtico 100 50 granular (REG) Complexo de Golgi (CG) Vesculas de secreo (VS) Total 0 0 50 0

100 100 100 100 100 100 100

Com bases nesses dados, pode-se armar que o caminho percorrido pelos aminocidos radioativos foi a) VS, CG, REG. d) VS, REG, CG. b) CG, VS, REG. e) REG, VS, CG. c) REG, CG, VS. 407. PUCCamp-SP Clulas endodrmicas indiferenciadas e totipotentes da gstrula dos vertebrados podem originar clulas altamente especializadas, como o caso das clulas dos cinos pancreticos que secretam enzimas digestivas. Os grnulos de secreo dessas clulas so liberados a partir: a) do retculo endoplasmtico. b) do sistema golgiense. c) das mitocndrias. d) dos lisossomos. e) dos ribossomos. 408. UFAL Em animais mantidos em jejum, clulas do gado digerem parte de suas prprias estruturas para sobreviverem. Essa atividade desempenhada: a) pelos ribossomos. b) pelos lisossomos. c) pelas mitocndrias. d) pelo complexo de Golgi. e) pelo retculo endoplasmtico.

Adaptado de LOPES, S. BIO. So Paulo: Saraiva, v.I,2002

a) o que acontece na estrutura assinalada com o nmero 1? b) o que representam as estruturas assinaladas com os nmeros 2 e 3? c) o que acontece com a estrutura assinalada com o nmero 3? 406. Um grupo de ratos recebeu injeo endovenosa de uma soluo contendo aminocidos radioativos. Aps cinco minutos, os ratos foram anestesiados e, em intervalos de tempo diferentes, as clulas do pncreas foram removidas, xadas e coradas com sais de prata que revelam a localizao dos aminocidos radioativos no interior da clula por meio de microscpio

409. UEL-PR Considere o texto a seguir: As clulas caliciformes do intestino secretam muco que constitudo, fundamentalmente, por glicoprotenas. A parte protica do muco sintetizada _________ (I) e a polissacardica, _______ (II). Para completar o texto corretamente, I e II devem ser substitudos, respectivamente, por: a) nos ribossomos e nas mitocndrias. b) nas mitocndrias e no complexo de Golgi. c) no complexo de Golgi e nas mitocndrias. d) no retculo endoplasmtico rugoso e no complexo de Golgi. e) no retculo endoplasmtico rugoso e nas mitocndrias.
167

PV2D-07-BIO-14

410. PUC-SP

A estrutura apontada pela seta 1 derivada: a) do conjunto de lisossomos. b) da membrana nuclear. c) do complexo de Golgi. d) das mitocndrias. e) do centrolo. 411. PUC-PR De acordo com a nova nomenclatura anatmica, a organela celular, complexo de Golgi, passou a ser tambm conhecida por Sistema Golgiense. Esta estrutura est relacionada com as funes: I. Armazenamento de protenas produzidas no retculo endoplasmtico rugoso. II. Liberao de bolsas contendo substncias secretadas na clula. III. Produo de lisossomos, estruturas contendo enzimas digestivas. IV. Formao do acrossomo, localizado na cabea do espermatozide. So verdadeiras: a) apenas I, II e III. b) I, II, III e IV. c) apenas I, II e IV. d) apenas II, III e IV. e) apenas I e IV. 412. UFPA O aspecto comum do complexo de Golgi, em clulas animais, deduzido atravs de observaes ao microscpio eletrnico, de: a) vesculas formadas por dupla membrana, sendo a interna sem granulaes e com dobras voltadas para o interior. b) membranas granulosas delimitando vesculas e sacos achatados que se dispem paralelamente. c) um complexo de membranas formando tubos anastomosados, com dilataes em forma de disco. d) sacos e vesculas achatados, formados por membrana dupla em que a interna, cheia de grnulos, emite prolongamento para o interior em forma de dobras. e) membranas lisas, delimitando vesculas e sacos achatados, que se dispem paralelamente. 413. PUC-SP A estrutura representada no desenho abaixo :

a) o complexo de Golgi, corpsculo rico em cidos nuclicos, presente no ncleo de clulas secretoras. b) o complexo de Golgi, responsvel pela sntese de enzimas da cadeia respiratria, presente no citoplasma dos vegetais inferiores. c) a mitocndria, orgnulo responsvel pela respirao celular. d) o complexo de Golgi, que tem por uma das funes a secreo celular. e) a mitocndria, orgnulo rico em RNA, DNA e enzimas, presente tanto no ncleo como no citoplasma das clulas secretoras. 414. UEL-PR No complexo de Golgi pode ocorrer: a) armazenamento de secrees e cadeia respiratria. b) armazenamento de secrees e sntese de glicoprotenas. c) armazenamento de secrees e fermentao. d) cadeia respiratria e sntese de protenas. e) fermentao e sntese de glicdios. 415. UFR-RJ Os processos de secreo celular so feitos na seqncia: a) aparelho de Golgi, retculo endoplasmtico granular, retculo endoplasmtico agranular, vesculas de transferncia. b) vesculas de transferncia, retculo endoplasmtico agranular, aparelho de Golgi, grnulos de secreo. c) retculo endoplasmtico granular, vesculas de transferncia, aparelho de Golgi, grnulos de secreo. d) aparelho de Golgi, vesculas de transferncia, retculo endoplasmtico granular, grnulos de secreo. e) retculo endoplasmtico agranular, grnulos de secreo, aparelho de Golgi, vesculas de transferncia. 416. FGVSP (modificado) No pncreas, existem estruturas glandulares chamadas cinos nas quais, a partir de aminocidos, so produzidas as enzimas digestivas do suco pancretico. Em um experimento, utilizaram-se aminocidos com istopos radioativos para se vericar o trajeto desses aminocidos nas clulas secretoras do pncreas. Nas clulas dos cinos, os aminocidos constituintes das enzimas digestivas percorreram o seguinte trajeto: a) gros de zimognio, complexo golgiense, peroxissomos. b) ergastoplasma, complexo golgiense, gros de zimognio. c) citoplasma, retculo endoplasmtico liso, complexo golgiense. d) retculo endoplasmtico liso, complexo golgiense, gros de zimognio. e) complexo golgiense, ergastoplasma, gros de zimognio.

168

417. Fuvest-SP O esquema adiante representa um corte de clula acinosa do pncreas, observado ao microscpio eletrnico de transmisso.

420. UnicampSP Cortes de clulas do pncreas foram incubados durante trs minutos em meio contendo leucina tritiada (aminocido radioativo). Aps vrios intervalos de tempo, esse material foi submetido a uma tcnica que revela a localizao do aminocido radioativo na clula pela deposio de grnulos de prata. O estudo do material ao microscpio eletrnico permitiu a construo da gura seguinte:

a) Identique as estruturas apontadas pelas setas A, B, e C e indique suas respectivas funes no metabolismo celular. b) Por meio da ordenao das letras indicadoras das estruturas celulares, mostre o caminho percorrido pelas enzimas componentes do suco pancretico desde seu local de sntese at sua secreo pela clula acinosa. 418. UFTMMG Clulas de um certo tecido animal foram isoladas e mantidas em meio de cultura. Em seguida, as clulas foram igualmente distribudas em 3 frascos (I, II e III), contendo iguais quantidades de meio de cultura acrescido de um aminocido marcado com o istopo radioativo 35S. De cada um dos frascos, foram retiradas algumas amostras para anlise em microscpio. As clulas retiradas do frasco I evidenciaram grande acmulo do material radioativo no retculo endoplasmtico rugoso. J as do frasco II mostravam acmulo do material radioativo em vesculas de secreo. As clulas do frasco III apresentavam maior acmulo do material radioativo no aparelho de Golgi. a) Qual dos trs frascos permaneceu por menos tempo em cultura? b) Justique sua resposta. 419. UFPE Coloque V (verdadeiro) ou F (falso) As clulas dos cinos pancreticos produzem as enzimas necessrias para a digesto dos alimentos que chegam ao duodeno; para isso, devemos encontrar nessas clulas: ( ) um retculo endoplasmtico liso bem desenvolvido, uma vez que este retculo essencial para a sntese de lipdios. ( ) um sistema de canalculos que permite a estocagem das enzimas na forma ativa sem destruir a clula. ( ) um retculo endoplasmtico rugoso bem desenvolvido, responsvel pela sntese de protenas. ( ) abundantes grnulos de secreo, resultantes do empacotamento das protenas no aparelho de Golgi. ( ) ausncia de grnulos secretores, pois as enzimas so sintetizadas e liberadas imediatamente.

A partir desses resultados, descreva o trajeto percorrido pelo aminocido radioativo no interior da clula e explique por que a leucina segue esta rota. 421. PUCCamp-SP Considere os seguintes eventos numa clula produtora de mucopolissacardios. I. Sntese de polipeptdios. II. Combinao de acares com polipeptdios. III. Formao dos gros de secreo. O complexo de Golgi responsvel apenas por: a) I. d) I e II. b) II. e) II e III. c) III. 422. O esquema a seguir refere-se formao da lamela mdia.

PV2D-07-BIO-14

169

A organela envolvida com a formao dessa estrutura (so) o(os): a) lisossomos. b) complexo de Golgi. c) centrolos. d) peroxissomos. e) retculo endoplasmtico liso. 423. Vunesp Foram coletadas trs amostras de espermatozides de um rato adulto apto para reproduo e colocadas separadamente em trs tubos de ensaio. Cada uma destas amostras foi submetida a uma situao experimental: Tubo 1: Todos os espermatozides tiveram um determinado tipo de organide extrado do citoplasma atravs de uma microagulha. Tubo 2: Todos os espermatozides tiveram outro tipo de organide citoplasmtico extrado. Tubo 3: Todos os espermatozides foram mantidos intactos e utilizados como controle. Em seguida, as trs amostras foram introduzidas, cada uma separadamente, nos colos uterinos de trs ratazanas em condies de serem fertilizadas. Durante o experimento, vericou-se que: os espermatozides do tubo 1 se aproximaram dos vulos, mas nenhum deles conseguiu perfurar suas membranas plasmticas; os espermatozides do tubo 2 no foram alm do colo uterino e sofreram um processo degenerativo aps 48 horas; os espermatozides do tubo 3 caminharam at os vulos e todos foram fertilizados. a) Quais foram os organides extrados dos espermatozides dos tubos 1 e 2? b) Quais as funes desses organides? 424. Fuvest-SP O esquema representa uma clula secretora de enzimas em que duas estruturas citoplasmticas esto indicadas por letras (A e B). Aminocidos radioativos incorporados por essa clula concentram-se inicialmente na regio A. Aps algum tempo, a radioatividade passa a se concentrar na regio B e, pouco mais tarde, pode ser detectada fora da clula.

425. UFSC Estudos preliminares em mineiros da regio carbonfera de Cricima tm apresentado resultados preocupantes com relao pneumoconiose, que uma afeco pulmonar, provocada pela inalao de poeira do carvo e de outros minrios. Essa uma doena ligada leso da membrana lisossmica. Com relao aos lisossomos, assinale a(s) armativa(s) correta(s). 01. So estruturas nucleares. 02. Originam-se a partir do complexo de Golgi. 04. So ricos em enzimas. 08. So os responsveis pela digesto intracelular. 16. Em clulas vegetais auxiliam o processo fotossinttico. 32. Ao unirem-se aos fagossomos, formam vacolos digestivos. 426. PUC-SP No interior da clula, o ATP produzido em um processo (I) utilizado na sntese de enzimas digestivas (II) e no mecanismo de digesto de partculas fagocitadas (III).Trs componentes celulares relacionados direta e respectivamente com I, II e III so: a) mitocndria, ribossomo e lisossomo. b) mitocndria, cromossomo e lisossomo. c) cloroplasto, cromossomo e lisossomo. d) cloroplasto, lisossomo e ribossomo. e) cromossomo, mitocndria e ribossomo. 427. PUC-RJ O processo representado na gura, que mostra um organismo unicelular eucarioto durante o processo de alimentao, denominado:

a) b) c) d) e)

clasmocitose pinocitose fagocitose exocitose citocinese

428. FCC-SP Observe o esquema abaixo.

a) Explique, em termos funcionais, a concentrao inicial de aminocidos radioativos na estrutura celular A. b) Como se explica a deteco da radioatividade na estrutura B e, em seguida, fora da clula?
170

O processo representado chama-se: a) clasmocitose. d) osmose. b) fagocitose. e) difuso. c) pinocitose. 429. As clulas internalizam substncias pelos processos de endocitose, conhecidos como fagocitose e pinocitose. Os vacolos formados, respectivamente, por fagocitose e pinocitose so: a) pinossomos e fagossomos. b) vacolos digestivos. c) fagossomos e pinossomos. d) vacolos residuais. e) pseudpodes e canal pinoctico. 430. Fuvest-SP A gura a seguir indica as diversas etapas do processo que uma ameba realiza para obter alimento.

a) ergastoplasma, fagossomo e vacolo digestivo. b) retculo endoplasmtico liso, complexo de Golgi e vacolo digestivo. c) retculo endoplasmtico liso, ergastoplasma e complexo de Golgi. d) ribossomos, ergastoplasma e fagossomo. e) ergastoplasma, complexo de Golgi e vacolo digestivo. 433. UnB-DF A gura adiante representa a fagocitose de uma bactria e alguns eventos celulares subseqentes.

Com base na gura, julgue os seguintes itens: 1. A estrutura lipoprotica das membranas celulares permite-lhe grande mobilidade e eventos como invaginao e fuso. 2. I representa um lisossomo primrio e III, um lisossomo secundrio. 3. II uma organela rica em proteases, nucleases e lipases. 4. No interior de IV, encontram-se aminocidos, acares e nucleotdeos provenientes da lise da bactria. 434. UFU-MG (modificado) Analisando o esquema a seguir, responda:

A organela que se funde ao fagossomo contm: a) produtos nais da digesto. b) enzimas que sintetizam carboidratos. c) enzimas digestivas. d) enzimas da cadeia respiratria. e) reservas energticas. 431. Fuvest-SP Clulas animais, quando privadas de alimento, passam a degradar partes de si mesmas como fonte de matria-prima para sobreviver. A organela citoplasmtica diretamente responsvel por essa degradao : a) o aparelho de Golgi. d) a mitocndria. b) o centrolo. e) o ribossomo. c) o lisossomo. 432. O esquema a seguir representa basicamente o processo da digesto intracelular. As estruturas numeradas 1, 2 e 3 representam, respectivamente:

a) O que representam os nmeros I, II e III? b) Qual a origem da estrutura representada por II? 435. O esquema abaixo representa uma clula, onde esto numeradas algumas estruturas (I, II, III e IV) e alguns processos (A, B, C) importantes na digesto intracelular. Descreva a relao entre as estruturas e os processos esquematizados.

PV2D-07-BIO-14

171

436. Unifor-CE (modificado) A gura a seguir representa uma ameba em diferentes etapas da sua alimentao.

A organela celular que participa ativamente desse processo : a) o lisossomo. b) o peroxissomo. c) a mitocndria. d) o plasto. e) o centrolo. 439. Os lisossomos so organelas membranosas, com formato esfrico presentes no citoplasma das clulas. Eventualmente so chamados de bolsas suicidas. Essa denominao pode estar correta, pois: a) esto presentes apenas nas clulas eucariticas. b) apresentam enzimas digestivas. c) participam da diviso celular. d) sintetizam protenas que atuam na morte celular. e) impedem a respirao celular. 440. Unicamp-SP No citoplasma das clulas so encontradas diversas organelas, cada uma com funes especcas, mas interagindo e dependendo das outras para o funcionamento celular completo. Assim, por exemplo, os lisossomos esto relacionados ao complexo de Golgi e ao retculo endoplasmtico rugoso, e todos s mitocndrias. a) Explique que relao existe entre lisossomos e complexo de Golgi. b) Qual a funo dos lisossomos? c) Por que todas as organelas dependem das mitocndrias? 441. Mackenzie-SP A silicose uma doena que ocorre quando cristais de slica so inalados e atingem os pulmes. As clulas dos alvolos fagocitam essas partculas, mas no conseguem digeri-las. Os vacolos digestivos acabam sendo perfurados e a clula morre. A morte dessas clulas deve-se: a) ao derramamento de enzimas digestivas, provocando a destruio da clula. b) interrupo da sntese protica causada pelo acmulo de slica no citoplasma. c) diminuio da taxa de respirao celular. d) ao excessiva dos anticorpos produzidos pelas clulas do pulmo. e) ao depsito de toxinas provenientes do metabolismo da slica. 442. Fuvest-SP Certas doenas hereditrias decorrem da falta de enzimas lisossmicas. Nesses casos, substncias orgnicas complexas acumulam-se no interior dos lisossomos e formam grandes incluses que prejudicam o funcionamento das clulas. a) O que so lisossomos e como eles contribuem para o bom funcionamento de nossas clulas? b) Como se explica que as doenas lisossmicas sejam hereditrias se os lisossomos no so estruturas transmissveis de pais para lhos?

Em I e II so mostrados, respectivamente, os processos de: a) clasmocitose e pinocitose. b) fagocitose e pinocitose. c) pinocitose e fagocitose. d) clasmocitose e fagocitose. e) fagocitose e clasmocitose. 437. PUC-MG A modelagem dos dedos do embrio humano ocorre por destruio da membrana que une os dedos e que semelhante inicialmente ao p de um pato, muito til no processo de natao. Esse processo de destruir essa membrana, que ocorre pela ao dos lisossomos, denominado: a) hemlise. b) plasmlise. c) autlise. d) autofagia. e) heterofagia. 438. Durante a metamorfose dos anfbios, a cauda desaparece ao mesmo tempo em que os seus constituintes celulares so digeridos e seus produtos so utilizados no desenvolvimento do animal, como representado no grco a seguir:

172

443. UFC-CE Suponha que voc esteja trabalhando com uma suspenso de clulas animais, a partir da qual voc deseje isolar uma protena. Durante a preparao, vrios lisossomos sofrem ruptura. Como conseqncia disso, ocorreria: a) liberao de cidos nuclicos, que dicultariam o isolamento da macromolcula que voc est tentando obter. b) liberao de ATP, que facilitaria o processo de isolamento da macromolcula de seu interesse. c) liberao de enzimas, que poderiam digerir a macromolcula que voc est tentando isolar. d) liberao de macromolculas proticas recmsintetizadas nos lisossomos, o que aumentaria a quantidade da protena a ser obtida. e) interrupo da sntese de protenas enzimticas nos lisossomos, diminuindo a quantidade da protena a ser obtida. 444. UFSC (modificado) Os lisossomos so organides membranosos, com formato esfrico, que contm enzimas digestivas. Em relao a essa estrutura citoplasmtica, assinale a(s) proposio(es) correta(s). 01. Os lisossomos desempenham a importante funo de digesto intracelular. 02. As enzimas lisossmicas so fabricadas no retculo endoplasmtico liso, passando em seguida para o sistema de Golgi, que as empacota e as libera sob a forma de lisossomos secundrios. 04. A funo heterofgica dos lisossomos refere-se digesto de substncias que so englobadas pela clula por fagocitose ou pinocitose. 08. O lisossomo secundrio formado pela fuso do vacolo alimentar, que contm o alimento englobado por pinocitose ou fagocitose, com o lisossomo primrio, que contm as enzimas digestivas. 16. Juntamente com as mitocndrias, os lisossomos so responsveis por uma reciclagem de molculas e organides inativos. 32. A origem dos lisossomos est relacionada com a atividade do complexo de Golgi a partir da formao de vesculas de secreo, que contm enzimas digestivas produzidas no retculo endoplasmtico rugoso. 445. Assinale a alternativa incorreta: a) A difuso simples um tipo de transporte passivo atravs da membrana plasmtica que ocorre quando existem condies de gradiente de concentrao sem haver gasto de energia. b) A difuso facilitada utiliza protenas carreadoras para o transporte de aucares simples e aminocidos atravs da membrana constituindo, por essa razo, um processo de transporte ativo.

c) A membrana plasmtica formada por uma camada bimolecular de fosfolipdeos onde esto dispersas molculas de protenas dispostas como um mosaico. d) Qualquer processo de captura por meio de envolvimento de partculas chamado de endocitose. e) Na fagocitose a clula engloba partculas slidas atravs da emisso de pseudpodes que as englobam formando um vacolo alimentar denominado fagossomo. 446. UnisaSP Dados os dois processos citolgicos a seguir, correto armar:

a) Ambos so destinados absoro de gotculas. b) O processo A prprio para englobar bactrias e o processo B para absorver gotculas. c) O processo A emite pseudpodos e o processo B engloba bactrias. d) O processo A invagina a membrana e o processo B emite pseudpodos. e) Ambos os processos so utilizados para englobar bactrias. 447. Fuvest-SP Sabemos que, quando substncias estranhas s clulas so englobadas por elas, atravs de fenmenos de endocitose, essas substncias podero funcionar como alimentos. Se isso ocorrer, vai iniciar-se o ciclo de digesto intracelular, que envolve o aparecimento dos seguintes eventos, sucessivamente: a) fagossomo, vacolo digestivo, corpo residual e defecao celular. b) vacolo digestivo, fagossomo, defecao celular e corpo residual. c) endocitose, digesto intracelular, fagossomo e defecao celular. d) vacolo autofgico, ataque lisossmico e defecao celular. e) digesto intracelular, acmulo de reservas no Golgi e produo de fagossomo.

PV2D-07-BIO-14

173

448. UFPE Como mostrado na gura a seguir, substncias capturadas do meio externo, assim como partes componentes da prpria clula, sofrem digesto intracelular.

450. PUC-MG Autofagia e autlise: a) so denominaes diferentes para o mesmo fenmeno. b) so fenmenos diferentes, sendo que, no primeiro, a clula capta partculas nutritivas do meio extracelular. c) so fenmenos diferentes, sendo que, no segundo, a clula destruda pela ruptura dos lisossomos. d) constituem o mesmo tipo de fenmeno, em que a clula busca alimento no meio extracelular. e) constituem o mesmo tipo de fenmeno, sendo que o primeiro corresponde fagocitose e o segundo, pinocitose. 451. CesgranrioRJ Os lisossomos participam de processos intracelulares que podem ser resumidos da seguinte maneira: I. partculas provenientes do meio externo, includas em fagossomos, so desdobradas em substncias utilizveis pelas clulas. II. Na ausncia de nutrio adequada, algumas estruturas, como as mitocndrias e componentes do retculo endoplasmtico, so digeridas e o seu material aproveitado em outras funes essencialmente vitais. III. Pelo estmulo de substncias ou aes lesivas, os lisossomos podem ser rompidos, havendo destruio e morte celular. Os trs processos acima descritos so, respectivamente, denominados: a) fagocitose, autofagia e autlise. b) c) d) e) fagocitose, digesto intracelular e autofagia. autofagia, necrose e autlise. autlise, autofagia e hidrlise. digesto intracelular, necrose e digesto extracelular.

Com relao aos processos ilustrados, assinale a alternativa incorreta. a) Os lisossomos (1) so pequenas vesculas que contm enzimas responsveis pela digesto intracelular. b) A autofagia (2) pode representar um meio de reciclagem do material celular. c) Os vacolos digestivos (3) originam-se da fuso de lisossomos com fagossomos ou pinossomos. d) Os vacolos residuais (4) so bolsas membranosas onde se processa a digesto autofgica. e) Clasmocitose (5) o processo de eliminao de resduos resultantes da digesto intracelular para o exterior da clula. 449. Vunesp No esquema esto representadas etapas, numeradas de 1 a 3, de um importante processo que ocorre no interior das clulas, e algumas organelas envolvidas direta ou indiretamente com esse processo.

452. Unicamp-SP comum, nos dias de hoje, ouvirmos dizer: estou com o colesterol alto no sangue. A presena de colesterol no sangue, em concentrao adequada, no problema, pois um componente importante ao organismo. Porm, o aumento das partculas LDL (lipoprotena de baixa densidade), que transportam o colesterol no plasma sangneo, leva formao de placas aterosclerticas nos vasos, causa freqente de infarto do miocrdio. Nos indivduos normais, a LDL circulante internalizada nas clulas atravs de pinocitose e chega aos lisossomos. O colesterol liberado da partcula LDL e passa para o citosol para ser utilizado pela clula. a) O colesterol liberado da partcula LDL no lisossomo. Que funo essa organela exerce na clula? b) A pinocitose um processo celular de internalizao de substncias. Indique outro processo de internalizao encontrado nos organismos e explique no que difere da pinocitose. c) Cite um processo no qual o colesterol utilizado.

As etapas que correspondem a 1, 2 e 3, respectivamente, e algumas organelas representadas no esquema esto corretamente listadas em: a) absoro de aminocidos, sntese protica e exportao de protenas; retculo endoplasmtico, lisossomo e mitocrndria. b) fagocitose de macromolculas, digesto celular e egesto de resduos; retculo endoplasmtico, complexo de Golgi e lisossomos. c) fagocitose de sais minerais, fotossntese e exportao de compostos orgnicos; cloroplastos e vacolos. d) absoro de oxignio, respirao celular e eliminao de dixido de carbono; mitocndrias e vacolos. e) fagocitose de macromolculas, digesto celular e exportao de protenas; mitocndrias e lisossomos.
174

Captulo 6
453. Cesgranrio-RJ a) I respirao celular; II fotossntese; III cloroplastos; IV autoduplicarem. b) I digesto celular; II sntese protica; III ribossomos; IV autodigerirem. c) I respirao celular; II fermentao; III cloroplastos; IV autodigerirem. d) I secreo celular; II pinocitose; III complexo de Golgi; IV autoduplicarem. e) I sntese protica; II digesto celular; III lisossomos; IV autodigerirem. 456. Fuvest-SP Em artigo publicado no suplemento Mais!, do jornal Folha de So Paulo, Jos Reis relata que pesquisadores canadenses demonstraram que a alga unicelular Cryptomonas resulta da fuso de dois organismos, um dos quais englobou o outro ao longo da evoluo. Isso no novidade no mundo vivo. Como relata Jos Reis: [...] hoje corrente em Biologia, aps haver sido muito contestada inicialmente, a noo de que certas organelas [...] so remanescentes de clulas que em tempos idos foram ingeridas por clula mais desenvolvida. D-se a esta o nome de hospedeira e o de endossimbiontes s organelas que outrora teriam sido livres. So exemplos de endossimbiontes em clulas animais e em clulas de vegetais, respectivamente: a) aparelho de Golgi e centrolos. b) centrolos e vacolos. c) lisossomos e cloroplastos. d) mitocndrias e vacolos. e) mitocndrias e cloroplastos. 457. FGVSP (modificado) Os processos de respirao e fotossntese so complementares e fundamentais para os seres vivos. Assinale as correspondncias de letras (da tabela) e nmeros (do esquema) que demonstram esta interao. correto armar que: a) as estruturas celulares I e II ocorrem apenas nos vegetais. b) as estruturas celulares I e II ocorrem nos animais e vegetais. c) a estrutura celular I ocorre apenas nos vegetais, e a II, apenas nos animais. d) a estrutura celular I ocorre apenas nos vegetais, e a II ocorre nos animais e vegetais. e) a estrutura celular I ocorre nos animais e vegetais, e a II ocorre apenas nos vegetais. 455. Fatec-SP Assinale a alternativa cujos termos preenchem corretamente a frase seguinte: As mitocndrias esto imersas no hialoplasma e tm por funo a ...(I)..., fenmeno este que no seu aspecto geral oposto ...(II)... Esta ocorre no interior dos ...(III)... . Ambos os organides so capazes de se ...(IV)....

Sobre o esquema anterior, so feitas as seguintes armativas: I. a formao de molculas de protenas uma reao de degradao; II. atravs de reaes de sntese que o ser vivo consegue energia para a sua vida; III. o conjunto das reaes de sntese e degradao constituem o metabolismo. A(s) armativa(s) correta(s) (so): a) apenas a I. e) apenas a II e a III. b) apenas a II. d) apenas a I e a II. c) apenas a III. 454. Fatec-SP O ciclo a seguir esquematizado envolve duas importantes estruturas celulares I e II.

a) luz b) ATP c) H2O a) b) c) d) e)

d) glicose e) CO2 f) O2

PV2D-07-BIO-14

I a; II d; III c; IV f; V e; VI b. I a; II d; III c; IV e; V b; VI f. I f; II d; III a; IV b; V e; VI c. I b; II a; III c; IV f; V e; VI d. I a; II e; III c; IV d; V b; VI f.


175

458. Fatec-SP Considere o esquema abaixo:

b) A fase 2 pode ser efetuada tanto por seres auttrofos como por seres hetertrofos. c) As substncias de b so mais ricas em energia do que as de a. d) As substncias de a so orgnicas e resultantes de processo de sntese a partir de b. e) Respirao, fotossntese, fermentao e quimiossntese so processos que podem estar envolvidos no esquema representado. 461. PUCCamp-SP (modificado) Protenas, carboidratos e lipdios so fontes de energia para os organismos. Durante o metabolismo das protenas e carboidratos, a energia liberada na oxidao dessas substncias usada diretamente na: a) sntese de molculas de AMP. b) sntese de molculas de ATP. c) degradao de molculas de ADP. d) oxidao de molculas de ATP. e) reduo de molculas de CO2. 462. Uesc-BA Observe o seguinte esquema.

Se o nmero 2 representa H2O e CO2, tem-se: A a) b) c) d) e)


respirao fotossntese respirao fotossntese fotossntese

B
fotossntese respirao fotossntese respirao respirao

1
C6H12O6 e O2 C6H12O6 e O2 C6H12O6 e CO2 CO2 e O2 H3PO4 e O2

459. Unifor-CE Considere os seguintes processos: I. Sntese de glicose a partir de gua e gs carbnico. II. Transformao da glicose em demais substncias orgnicas. III. Degradao da glicose para liberao da energia. Assinale a alternativa da tabela que indica corretamente os organismos onde eles ocorrem. Auttrofos a) b) c) d) e) 460. UFMG I / II / III I / II / III I / II I / II I Hetertrofos I / II / III II / III II / III III II / III

Essa a estrutura de um composto qumico denominado: a) ADP. b) ATP. c) AMP. d) NADP. e) NADPH2. 463. Uespi O ATP funciona dentro da clula como uma moeda energtica que pode ser gasta em qualquer momento, quando a clula necessitar. Analise a gura seguinte e assinale a alternativa que responde corretamente a questo. 1. Em A tem-se um nucleotdeo. 2. Em B tem-se um nucleosdeo. 3. Em C tem-se um nucleosdeo monofosfatado. 4. Em D tem-se uma molcula de adenosina trifosfato.

Em relao ao esquema, qual a alternativa errada? a) A fase 1 pode ser efetuada por alguns indivduos que no so capazes de realizar fotossntese.
176

b) os autotrcos fotossintticos utilizam a luz, compostos orgnicos e O2 para formao de CO2 e H2O, que sero utilizados pelos heterotrcos para formao de compostos orgnicos. c) a reciclagem de energia necessria sntese de molculas simples ocorre atravs da captao da luz pelos heterotrcos. d) a liberao de CO2, O2 e H2O das macromolculas orgnicas se deve luz captada pelos organismos fotossintticos. e) a gua absorvida pelos organismos fotossintticos reage com o CO2 para formar carboidratos, que, quando utilizados pelos heterotrcos, liberaro O2. 468. UFBA Respirao e fotossntese so processos opostos de vital importncia para os seres vivos. O processo de respirao pode ser representado por: C6H12O6 + 6 O2 6 CO2 + 6 H2O + Energia Com base nas informaes anteriores, pode-se armar: 01. Respirao uma reao de combusto. 02. Na fotossntese, as plantas usam dixido de carbono do ar atmosfrico para produzir acares, entre outras substncias. 04. A fotossntese uma reao de oxidao. 08. Durante a respirao, um mol de oxignio forma seis mols de dixido de carbono. 16. A respirao um processo exotrmico. Some os itens corretos. 469. Fuvest-SP Considere os esquemas a seguir, nos quais as setas indicam absoro ou eliminao de gs.

Est(o) correta(s) apenas: a) 2, 3 e 4 d) 1 b) 1 e 2 e) 4 c) 2 e 3 464.

A respeito das organelas A e B, presentes em clulas vegetais, so feitas as armaes: I. Os produtos do processo realizado pela organela A servem de reagentes para o processo realizado pela organela B. II. Todos os seres vivos possuem essas organelas. III. Ambas so capazes de autoduplicao e de produzir suas protenas. Assinale: a) se somente a armao I estiver correta. b) se somente as armaes I e III estiverem corretas. c) se somente as armaes II e III estiverem corretas. d) se todas as armaes estiverem corretas. e) se somente a armao III estiver correta. 465. Fuvest-SP Responda: a) Que processos ocorrem, respectivamente, nos cloroplastos e nas mitocndrias de uma clula? b) Como esses processos se relacionam? 466. Fuvest-SP Um automvel, movido a gasolina ou a lcool, est, em ltima anlise, utilizando luz solar. Justique essa armao. 467. UFPI A fotossntese fundamental para reciclagem do carbono, oxignio e gua na biosfera porque: a) os autotrcos fotossintticos utilizam a luz, CO2 e H2O para formao de compostos orgnicos que, quando utilizados pelos heterotrcos, liberaro CO2 e H2O.

Que alternativa que identica corretamente a substncia absorvida ou eliminada? I a) b) c) d) e) O2 O2 O2 CO2 CO2 II O2 CO2 CO2 CO2 O2 III O2 CO2 O2 CO2 CO2 IV CO2 CO O2 O2 O2
177

PV2D-07-BIO-14

470. Fuvest-SP Complete a tabela a seguir, comparando a fotossntese respirao aerbica em um mesmo organismo. Fotossntese Formas de armazenamento de energia Gs consumido Gs liberado Organelas onde ocorre o processo Clulas onde ocorre o processo 471. UFRJ Dois grupos de ratos, A e B, foram colocados em cmaras de vidro transparente. No grupo A, cada cmara continha uma planta verde separada do rato por uma tela (gura a seguir). No grupo B no havia planta verde. Respirao aerbica

b) Ambas ocorrem em todas as clulas vivas. c) Essas reaes esto envolvidas em processos como a absoro de O2 pelas clulas alveolares. d) I ocorre somente em clulas aerbicas. e) Com a reao II, a energia ca disponvel para uso da clula. 474. PUC-RS (modificado) Responda questo com base nas armativas a seguir, sobre o trifosfato de adenosina (ATP). I. O ATP um composto de armazenamento que opera como fonte de energia. II. Todas as clulas vivas precisam de ATP para captao, transferncia e armazenagem da energia livre utilizada para seu trabalho qumico. III. O ATP gerado pela hidrlise de adenosina monofosfato (AMP + Pi + energia livre). IV. O ATP sintetizado a partir da molcula de glicose, por fermentao ou atravs da respirao celular. Pela anlise das armativas, conclui-se que: a) somente I e II esto corretas. b) somente II e III esto corretas. c) somente III e IV esto corretas. d) somente I, II e IV esto corretas. e) I, II, III e IV esto corretas. 475. UFES

As cmaras foram, ento, hermeticamente fechadas e colocadas em ambiente iluminado. Aps algum tempo, os ratos de um dos grupos haviam morrido, enquanto os ratos do outro grupo resistiram por mais tempo. Qual dos dois grupos de ratos sobreviveu por mais tempo? Qual a explicao para esse fato? 472. O ATP (trifosfato de adenosina), principal molcula implicada nos processos energticos dos seres vivos, um composto constitudo: a) por protenas ligadas a agrupamentos de alta energia. b) pela protena albumina, por uma ribose e trs radicais fosfatos. c) pelas protenas actina e miosina, pela desoxirribose e por trs radicais fosfatos. d) pela base nitrogenada adenina, por trs molculas de desoxirribose e por um radical fosfato. e) pela base nitrogenada adenina, por uma ribose e trs radicais fosfatos. 473. Mackenzie-SP

A estrutura anterior, na forma como est representada, refere-se a a) um aminocido essencial com funo enzimtica na clula. b) um nucleotdeo que participa da estrutura qumica dos cidos nuclicos. c) um nucleosdeo estvel que participa da estrutura qumica dos cidos nuclicos. d) um carboidrato no hidrolisvel que atua no metabolismo celular. e) um nucleotdeo que participa de reaes bioqumicas como fornecedor de energia. 476. Ufla-MG Os organismos vivos requerem energia para o crescimento e manuteno do seu metabolismo. Molculas orgnicas como a apresentada no esquema a seguir conservam a energia que utilizada para a biossntese dos componentes celulares, a partir de precursores simples. Analise a gura e marque a alternativa que descreve a composio molecular deste importante transportador de energia.

A respeito das reaes I e II, assinale a alternativa correta. a) A nica organela capaz de realizar I a mitocndria.
178

478. MackenzieSP A respeito dos processos de produo de ATP, assinale a alternativa incorreta. a) Podem produzir cido lctico ou lcool como resduos. b) Podem ocorrer na ausncia de O2. c) Podem ocorrer sem a participao das mitocndrias. d) Ocorrem sempre a partir de molculas de glicose. e) Existem em todos os tipos de clulas vivas. a) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: alta 5 cido nuclico: desoxirribonuclico b) 1 Base nitrogenada: adenina 2 Acar: desoxirribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: alta 5 cido nuclico: ribonuclico c) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: nitrato 4 Energia de ligao: alta 5 cido nuclico: ribonuclico d) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: baixa 5 cido nuclico: ribonuclico e) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: alta 5 cido nuclico: ribonuclico 477. PUC-PR A seguinte equao resume um dos mais importantes fenmenos biolgicos: 479. FCMSCSP Dos organismos abaixo, os que consomem maior quantidade de glicose para sintetizar 100 molculas de ATP so os: a) hetertrofos em geral. b) auttrofos em geral. c) aerbicos facultativos. d) aerbicos. e) anaerbicos. 480. PUC-MG Num experimento simples para demonstrar a fermentao, adiciona-se fermento biolgico a uma soluo de acar ou, mesmo, caldo de cana, obtendo-se, como produto nal, lcool, CO2 e gua. O fermento biolgico contm: a) algas. b) bactrias fotossintetizantes. c) cido carbnico em p. d) fungos. e) cianobactrias. 481. O fermento biolgico usado na fabricao de pes provoca o aumento do volume da massa como conseqncia da produo de: a) CO2, a partir da gua acrescentada massa do po. b) CO2, a partir da fermentao do acar acrescentado massa do po. c) O2, a partir da fermentao do amido existente na farinha do po. d) N2, a partir da fermentao do acar acrescentado massa do po. e) O2, a partir da respirao do acar acrescentando massa do po. 482. PUC-SP

PV2D-07-BIO-14

Em relao a este fenmeno, podemos armar: I. O composto orgnico, reagente, libera grande quantidade de energia. II. O ATP formado retm energia utilizvel pelas clulas. III. As mitocndrias participam deste fenmeno. IV. Ocorre tanto nos organismos aerbios como nos anaerbios. V. Ocorre nos organismos heterotrcos e raramente nos autotrcos. Esto corretas as armaes: a) apenas I, II, III e IV. d) apenas II, III, IV e V. b) apenas II, III e IV. e) I, II, III, IV e V. c) apenas I, II e III.

O processo acima esquematizado representa: a) fermentao em clulas musculares. b) fermentao realizada por lvedos. c) respirao aerbica em clulas em geral. d) gliclise em animais em geral. e) quimiossntese em bactrias.
179

483. Unimontes-MG Para a realizao de um experimento, foi dissolvido fermento biolgico fresco em gua. A soluo resultante foi dividida em dois frascos. Em cada frasco, foi adicionada uma soluo saturada de sacarose e, em seguida, adaptado um balo nos gargalos. O frasco I foi colocado em banho-maria com temperatura controlada de 37 C e o frasco II foi colocado em gua fervendo. Observou-se, aps algum tempo, que, em I, o balo aumentava de tamanho e, em II, o balo continuava vazio.

diretamente fabricao do vinho e do po, respectivamente? a) lcool etlico, gs carbnico. b) Gs carbnico, cido ltico. c) cido actico, cido ltico. d) lcool etlico, cido actico. e) cido ltico, lcool etlico. 486. UFMG Na fabricao de iogurtes e coalhadas, utilizam-se iscas, isto , colnias de microorganismos que realizam a fermentao do leite. Em relao a esse processo, correto armar que: a) consiste em respirao aerbica. b) realizado por vrus anaerbicos lticos. c) resulta da liberao de cido ltico e energia. d) resulta na formao de cido actico e CO2. 487. Cesgranrio-RJ No exerccio muscular intenso, torna-se insuciente o suprimento de oxignio. A liberao de energia pelas clulas processa-se, desta forma, em condies relativas de anaerobiose, a partir da glicose. O produto principalmente acumulado nessas condies o: a) cido pirvico. d) etanol. b) cido lctico. e) cido ctrico. c) cido acetoactico. 488. PUC-SP Correr na So Silvestre uma atividade vigorosa e prolongada, que requer grande quantidade de energia. a) Alm da quebra de substncia orgnica na presena do oxignio, que outro processo pode ser utilizado pelos msculos para se obter energia? b) Qual o produto desse processo que, ao se acumular no msculo, traz a fadiga? 489. Unicamp-SP Aps a realizao de esforo muscular intenso, a musculatura pode car colorida e enrijecida por alguns dias (fadiga muscular). Isso se deve basicamente ao acmulo de uma substncia nas clulas musculares submetidas a esforo. a) Qual esta substncia? b) Considerando os processos bioqumicos que ocorrem na clula muscular, explique qual a razo desse acmulo. 490. Fuvest-SP Uma das causas de dor e sensao de queimao nos msculos, decorrentes de esforo fsico intenso, a presena de muito cido ltico nas clulas musculares. Isso ocorre quando essas clulas: a) realizam intensa respirao celular, com produo de cido ltico. b) recebem suprimento insuciente de gs oxignio e realizam fermentao. c) realizam intensa respirao celular produzindo excesso de ATP.

Considerando as informaes dadas, ocorre: a) em II, liberao de oxignio gasoso. b) em II, fermentao da sacarose. c) em I, vaporizao da sacarose. d) em I, liberao de dixido de carbono. 484. CesgranrioRJ Indique a alternativa correta para o fenmeno apresentado de forma muito simplicada.

Fenmeno a) b) c) d) e) Respirao celular Fermentao bacteriana Fermentao alcolica Respirao aerbica Fermentao lctica

Caracterstica Realiza-se em presena de O2 Produz pouco acar Produo baixa de ATP Mais eciente em produzir ATP Degradao completa da glicose

485. Fuvest-SP A fabricao de vinho e po depende dos produtos liberados pelas leveduras durante sua atividade fermentativa. Quais os produtos que interessam mais
180

d) recebem estmulos nervosos sucessivos e acumulam neurotransmissores. e) utilizam o acar lactose como fonte de energia. 491. Cesgranrio-RJ 6000 a.C.: babilnios e sumrios utilizam lvedo para produzir cerveja. 4000 a.C.: egpcios descobrem como fazer po fermentado. Ainda na Antigidade: transformao do leite em iogurte e uso do mofo na elaborao de queijo.
Fonte: Folha de S. Paulo

As informaes contidas no artigo anterior envolvem um processo biolgico fundamental para os seres vivos que o realizam. Todas as opes apresentam conceitos corretos sobre esse processo, exceto uma. Assinale-a. a) Na fabricao do iogurte e queijo o produto formado o cido lctico. b) Na fabricao de cerveja e po os produtos formados so etanol e gs carbnico. c) Nesse processo ocorre a formao de uma molcula orgnica denominada cido pirvico. d) O saldo energtico obtido, nos dois processos, de 2 ATP. e) Os seres que realizam este processo objetivam conseguir matria-prima para sua nutrio. 492. UflaMG O esquema abaixo representa um processo bioqumico utilizado na fabricao de pes, vinhos, cervejas e outros produtos de grande importncia para o ser humano.

494. UFMG Uma receita de po caseiro utiliza farinha, leite, manteiga, ovos, sal, acar e fermento. Esses ingredientes so misturados e sovados e formam a massa que colocada para descansar. A seguir, uma bolinha dessa massa colocada num copo com gua e vai ao fundo. Depois de algum tempo a bolinha sobe superfcie do copo, indicando que a massa est pronta para ser levada ao forno. Com relao receita, correto armar que: a) a farinha constituda de polissacardeos, utilizados diretamente na fermentao. b) a manteiga e os ovos so os principais alimentos para os microrganismos do fermento. c) a subida da bolinha superfcie do copo se deve a um processo anaerbico. d) os microrganismos do fermento so protozorios aerbicos. 495. ENEM No processo de fabricao de po, os padeiros, aps prepararem a massa utilizando fermento biolgico, separam uma poro de massa em forma de bola e a mergulham num recipiente com gua, aguardando que ela suba, como pode ser observado, respectivamente, em I e II do esquema abaixo. Quando isso acontece, a massa est pronta para ir ao forno.

a) Que processo bioqumico est representado no esquema? b) Qual o papel desse processo no funcionamento das clulas que so capazes de realiz-lo? c) Em clulas musculares, qual a conseqncia da ocorrncia da fermentao? 493. UFPI Relacionando-se o processo metablico com produo de energia, pode-se armar, corretamente, que: a) os processos anaerbicos e de fermentao liberam menos energia do que os aerbicos. b) o processo anaerbico s ocorre em seres superiores, com alta demanda energtica. c) o processo anaerbico s ocorre nos organismos procariontes, com baixa demanda energtica. d) o processo anaerbico produz ATP somente em tecidos desprovidos de mitocndrias. e) os processos fermentativos formam molculas orgnicas pequenas sem nenhum valor energtico.

Um professor de Qumica explicaria esse procedimento da seguinte maneira: A bola de massa torna-se menos densa que o lquido e sobe. A alterao da densidade deve-se fermentao, processo que pode ser resumido pela equao: C6H12O6 C2H5OH + 2 CO2 + energia glicose lcool gs comum carbnico Considere as armaes a seguir. I. A fermentao dos carboidratos da massa de po ocorre de maneira espontnea e no depende da existncia de qualquer organismo vivo. II. Durante a fermentao, ocorre produo de gs carbnico, que se vai acumulando em cavidades no interior da massa, o que faz a bola subir. III. A fermentao transforma a glicose em lcool. Como o lcool tem maior densidade do que a gua, a bola de massa sobe. Dentre as armativas, apenas: a) I est correta. b) II est correta. c) I e II esto corretas. d) II e III esto corretas. e) III est correta.

PV2D-07-BIO-14

181