Você está na página 1de 144

Biologia 1

Citologia

Capitulo 1
01. Existe uma srie de caractersticas que distinguem os seres vivos da matria bruta. Analise as caractersticas a seguir e, depois, assinale aquelas caractersticas que so exclusivas dos seres vivos: I. metabolismo; II. ausncia de molculas; III. reproduo; IV. material gentico. Esto corretas: a) apenas I e III d) II, III e IV b) I, II e IV e) Apenas III e IV c) I, III e IV 02. PUC-RS A chamada estrutura procaritica apresentada pelas bactrias nos indica que estes seres vivos so: a) destitudos de membrana plasmtica. b) no paresentam parede celular. c) dotados de organelas membranosas. d) constitudos por parasitas obrigatrios. e) desprovidos de membrana nuclear. 03. Uma clula bacteriana no possui: a) material hereditrio e carioteca. b) parede celular e centrolo. c) ribossomos e complexo golgiense. d) membrana plasmtica. e) nuclolo e carioteca. 04. Fuvest-SP Um pesquisador estudou uma clula ao microscpio eletrnico, vericando a ausncia de ncleo e de compartimentos membranosos. Com base nessas observaes, ele conclui que a clula pertence a: a) uma bactria. d) um fungo. b) uma planta. e) um vrus. c) um animal. 05. UEL-PR Observe o esquema a seguir. Ele representa: a) uma bactria. b) um protozorio. c) um fungo. d) uma clula animal. e) uma clula vegetal.

06. Analise o texto a seguir. Nas bactrias, o material gentico est organizado em uma ta contnua de __________ que ca localizado em uma rea chamada de ____________. Assinale a alternativa que completa corretamente o texto: a) cromossomos nucleossomo. b) DNA nucleossomo. c) Plasmdeo nucleide. d) DNA nucleide. e) RNA ncleo. 07. Em uma cianobactria no se encontra: a) clorola. b) membrana plasmtica. c) carioteca. d) material gentico. e) ribossomos. 08. Bactrias e cianobactrias so seres vivos unicelulares e procariontes porque: a) podem causar doenas no homem e nos animais, possuem membrana plasmtica e membrana nuclear. b) so constitudos por uma clula apenas, no possuem membrana plasmtica e possuem membrana nuclear. c) so constitudos por uma clula apenas, possuem membrana plasmtica e no possuem membrana nuclear. d) so constitudos por uma clula apenas e podem formar colnias. e) No formam colnias e podem causar doenas no homem e nos animais. 09. PUC-RS Um biologista, estudando a estrutura de uma clula bacteriana, iria encontrar, como uma organela deste tipo celular, o: a) cloroplasto. b) retculo endoplasmtico liso. c) centrolo. d) ribossomo. e) retculo endoplasmtico rugoso.
113

PV2D-06-BIO-14

10. Qual alternativa aponta uma estrutura encontrada em clulas procariontes e sua respectiva funo? a) Cloroplasto fotossntese b) Carioteca proteo do material gentico c) Parede celular liberao de energia d) Lisossomo digesto e) Ribossomos sntese de protenas 11. Mackenzie-SP Assinale a alternativa que apresenta estruturas encontradas em todos os tipos de clulas. a) Ncleo, mitocndrias e ribossomos. b) Parede celular, ribossomos e nuclolo. c) Centrolo, complexo de Golgi e ncleo. d) Ribossomos, membrana plasmtica e hialoplasma. e) Hialoplasma, carioteca e retculo endoplasmtico. 12. Correlacione a coluna 1 com a coluna 2. Coluna 1 1. Ribossomos 2. Parede celular 3. Membrana plasmtica 4. Mesossomo Coluna 2 ( ) permeabilidade seletiva ( ) sntese de protenas ( ) proteo ( ) contm enzimas envolvidas com a respirao celular bacteriana. A seqncia correta : a) b) c) d) e) 1, 2, 3, 4 4, 3, 2, 1 3, 1, 2, 4 3, 2, 4, 1 2, 1, 3, 4

15. Vunesp Os procariontes diferenciam-se dos eucariontes porque os primeiros, entre outras caractersticas: a) no possuem material gentico. b) possuem material gentico como os eucariontes, mas so anucleados. c) possuem ncleo, mas o material gentico encontra-se disperso no citoplasma. d) possuem material gentico disperso no citoplasma em estruturas organizadas denominadas mesossomos. e) possuem ncleo e material gentico organizado. 16. UFU-MG O desenho a seguir representa uma bactria. De acordo com ele e com base em seus conhecimentos sobre o assunto, resolva a questo.

a) A clula procaritica ou eucaritica? Justique. b) Quais so os nomes das estruturas numeradas e suas respectivas funes? 17. UFSCar-SP (modificado) A Escherichia coli um organismo procarionte. Isto signica que: a) um parasita intracelular obrigatrio. b) sua sntese protica depende do RER. c) so desprovidos de parede celular. d) os mesossomos participam da diviso celular e podem estar envolvidos com a respirao celular. e) possuem organizao celular complexa. 18. Sobre as bactrias e cianobactrias, incorreto armar que: a) so seres procariontes. b) apresentam ribossomos. c) o agelo bacteriano formado por centrolos. d) as cianobactrias so auttrofas fotossintetizantes. e) so desprovidas de nuclolo. 19. PUC-MG Sobre as cianobactrias, incorreto armar que: a) no possuem ncleo individualizado. b) possuem clorola como pigmento fotossintetizante. c) possuem cloroplastos. d) possuem ribossomos. e) no possuem organelas membranosas.

13. UFSCar-SP Toda clula viva possui: a) membrana plasmtica, mas pode no possuir ncleo organizado e mitocndrias. b) membrana plasmtica e mitocndrias, mas pode no possuir ncleo organizado. c) ncleo, mas pode no possuir membrana plasmtica e mitocndrias. d) ncleo e mitocndrias, mas pode no possuir membrana plasmtica. e) ncleo organizado, membrana plasmtica e mitocndrias. 14. Fuvest-SP Um estudante escreveu o seguinte em uma prova: As bactrias no tm ncleo nem DNA. Voc concorda com o estudante? Justique.
114

20. UFPI

A gura representa o desenho esquemtico de uma clula bacteriana. Como todo ser vivo, este tambm se reproduz e transmite as informaes genticas sua descendncia, atravs do seu DNA. A alternativa que cita os dois componentes celulares bacterianos que contm DNA : a) nucloide e mesossomo. b) parede celular e plasmdio. c) plasmdio e nucleide. d) mesossomo e ribossomo. e) membrana plasmtica e mesossomo. 21. UFPE Na gura est representada esquematicamente uma bactria. Sabendo-se que as enzimas relacionadas com a respirao nesses organismos esto ligadas face interna de uma determinada estrutura, assinale a alternativa que indica esta estrutura e o nmero que a representa na gura.

Segunda armao Em contraste com as clulas ditas eucariticas, as bactrias e as cianobactrias possuem caractersticas estruturais mais simples, destacando-se a ausncia do envoltrio nuclear e do retculo endoplasmtico. Assinale a alternativa: a) se as duas armaes forem verdadeiras e a segunda for uma justicativa da primeira. b) se as duas armaes forem verdadeiras e a segunda no for uma justicativa da primeira. c) se a primeira armao for verdadeira e a segunda armao for falsa. d) se a primeira armao for falsa e a segunda armao for verdadeira. e) se a primeira e a segunda armaes forem falsas. 24. Unimep-SP (modicado) Sobre a biologia celular, assinale a alternativa correta com relao s estruturas da clula. a) A membrana nuclear apenas observada nas clulas procariticas. b) O hialoplasma um recheio nuclear lquido das clulas eucariticas. c) Podemos encontrar mitocndrias nas clulas vegetais, protozorios e bactrias. d) O material gentico, constitudo de DNA, encontrado apenas nas clulas eucariticas. e) A membrana plasmtica de natureza lipoprotica encontrada em todas as clulas, sejam procariticas ou eucariticas. 25. UEL-PR As estruturas que podem estar aderidas ao retculo endoplasmtico so: a) os lisossomos. b) os ribossomos. c) os vacolos. d) as mitocndrias. e) os pinossomos. 26. UMC-SP Indispensvel ao trabalho celular a liberao de energia que se processa no(s) na(s): a) mitocndrias. b) complexo de Golgi. c) lisossomos. d) ribossomos. e) vacolos. 27. PUCCamp-SP Uma clula secretora apresenta, como organela mais desenvolvida, o retculo endoplasmtico liso. Pode-se concluir que esta clula produz: a) aminocidos. b) protenas. c) muco. d) glicoprotenas. e) lipdios.
115

a) b) c) d) e)

citoplasma (1). membrana plasmtica (2). ncleo (3). parede celular (4). cpsula (5).

22. Mackenzie-SP Nas bactrias, o mesossomo apresenta uma coleo enzimtica responsvel por um processo que tambm ocorre: a) nas lamelas dos cloroplastos. b) na membrana do retculo endoplasmtico rugoso. c) no nuclolo. d) no complexo de Golgi. e) nas cristas mitocondriais. 23. Cesgranrio-RJ Esta questo apresenta duas armaes, podendo a segunda ser uma razo para a primeira. Primeira armao As bactrias e as cianobactrias so designadas como clulas procariticas, porque,

PV2D-06-BIO-14

28. UFRJ Os lisossomos so estruturas celulares encarregadas do seguinte processo: a) secreo. b) transporte. c) reproduo. d) digesto. e) metabolismo energtico. 29. UFRN A gua oxigenada normalmente formada nas clulas como um subproduto de algumas reaes qumicas. Devido ser extremamente txica, deve ser rapidamente decomposta. Para neutralizar a ao da gua oxigenada, a clula utiliza-se da enzima X contida na organela Y. X e Y so respectivamente: a) catalase e peroxissomo. b) glicosidase e retculo endoplasmtico rugoso. c) peroxidase e lisossomo. d) catalase e complexo de Golgi. e) esngomielinase e lisossomo. 30. Unifor-CE A gura abaixo mostra uma clula animal:

a) I responsvel pela secreo de substncias que iro atuar no meio extracelular. b) As duas organelas apresentadas so constituintes de clulas eucariotas. c) O centro de armazenamento e empacotamento intracelular localiza-se em I. d) II rico em ribossomos, sendo responsvel pela sntese de protenas. 32. Fuvest-SP Alimento protico marcado com radioatividade foi fagocitado por paramcios. Poucos minutos depois, os paramcios foram analisados e a maior concentrao de radioatividade foi encontrada: a) nos centrolos. b) nas mitocndrias. c) na carioteca. d) no nuclolo. e) no retculo endoplasmtico. 33. Identique cada parte da clula e cite suas respectivas funes.

Mitocndrias e retculo endoplasmtico rugoso esto representados, respectivamente, por: a) I e IV b) II e I c) II e III d) III e V e) IV e I 31. O trabalho desenvolvido por uma determinada clula no nosso organismo resultado das funes de vrias de suas organelas. A gura abaixo representa duas organelas celulares. Observe-as.

34. FMU-SP Observe os desenhos das clulas A e B e assinale a alternativa correta.

I II De acordo com a gura apresentada e o assunto abordado, analise as armativas a seguir e assinale a alternativa correta.
116

a) A clula A de um protista, tal como uma bactria, e a B de um organismo includo no reino monera, tal como um vrus.

b) A clula A de um vegetal, enquanto a B de um animal. c) A clula A de uma alga; a B de uma planta superior, tal como um milho. d) A clula A tpica de um parasita, enquanto a B, mais complexa, de um ser de vida livre. e) A clula A de um procarionte, tal como uma bactria; a B de um eucarionte, podendo representar uma clula humana. 35. PUC-RS (modificado) Associe os nmeros das estruturas celulares assinaladas no desenho com os respectivos nomes da coluna a seguir do desenho. A seguir, assinale a opo em que a seqncia coincida com o que foi marcado na coluna.

38. UFRN A extremidade do axnio da clula nervosa apresenta grande atividade metablica durante a passagem do impulso nervoso para os dendritos da clula seguinte. Essa atividade metablica elevada possvel devido presena de um grande nmero de: a) mitocndrias. b) ribossomos. c) vacolos. d) lisossomos. 39. PUC-RS Responder questo relacionando as estruturas presentes na coluna I com as informaes presentes na coluna II. Coluna I ( ( ( ( ( ) mitocndrias ) centrolos ) DNA ) ribossomos ) protenas

( ) peroxissomos ( ) RNA Coluna II 1. presente apenas nas clulas eucariotas 2. presente apenas nas clulas procariotas 3. presente tanto em clulas eucariotas como em procariotas A ordem correta dos parnteses da coluna I, de cima para baixo, : a) 1 - 1 - 3 - 3 - 3 - 1 - 3. b) 1 - 2 - 3 - 1 - 1 - 2 - 1. c) 2 - 1 - 1 - 2 - 3 - 1 - 2. d) 2 - 2 - 3 - 3 - 3 - 2 - 3. e) 3 - 1 - 2 - 3 - 1 - 2 - 1. 40. UFU-MG Analise o seguinte texto: I. As clulas da mucosa intestinal secretam muco, que lubrica este rgo e facilita o transporte do alimento. II. As clulas da cauda do girino so, normalmente, reabsorvidas pelo processo de autlise, por ao de proteases liberadas na clula. III. Nas bras musculares estriadas, as organelas que liberam ATP para o trabalho muscular encontramse dispostas entre os feixes das miobrilas. Os itens I, II e III se referem a quais estruturas citoplasmticas? Justique. 41. UFV-MG Uma caracterstica das clulas eucariticas a presena de organelas, as quais delimitam compartimentos que desempenham funes especcas no metabolismo celular. Nesse sentido, a clula eucaritica pode ser comparada a uma fbrica organizada em sees de estoque, montagem, embalagem, produo, limpeza etc. Considerando esta analogia, assinale a alternativa incorreta:
117

( ) ( ) ( ) ( ) ( ) ( ) a) b) c) d) e)

Centrolo Retculo endoplasmtico Complexo de Golgi Nuclolo Carioteca Mitocndria 2, 1, 3, 5, 6, 4 2, 1, 3, 5, 4, 6 1, 6, 5, 3, 2, 4 6, 4, 3, 5, 1, 2 1, 2, 3, 4, 5, 6

36. Fuvest-SP a) Quais as diferenas existentes entre clulas procariontes e eucariontes quanto a ncleo e citoplasma? b) Em que grupos de organismos so encontradas as clulas procariontes? 37. PUC-MG (modificado) Os diversos tipos de organides celulares aparecem nas clulas com maior ou menor intensidade de acordo com seu metabolismo. Os osteoblastos so clulas sseas responsveis por grande produo de colgenos (protenas) para a matriz extracelular, sendo por isso ricos em: a) retculo endoplasmtico liso. b) retculo endoplasmtico rugoso. c) centrolo. d) lisossomos. e) cloroplastos.

PV2D-06-BIO-14

a) O nuclolo pode representar uma das sees de montagem, uma vez que produz subunidades ribossomais que vo atuar na sntese protica. b) O retculo endoplasmtico liso pode funcionar como seo de estoque, pois desempenha a funo de armazenar o cdigo gentico. c) O lisossomo pode representar a seo de limpeza, pois o responsvel pela digesto intracelular. d) O complexo de Golgi pode ser comparado com a seo de embalagem, pois empacota as substncias formando grnulos de secreo. e) O ergastoplasma pode representar a seo de produo, pois responsvel pela sntese de substncias. 42. Unioeste-PR A gura abaixo representa uma clula eucariota animal. Relativamente s estruturas e organelas, assinale a(s) alternativa(s) correta(s) e some-as.

Funes celulares 1. Sntese de protenas 2. Ao enzimtica 3. Transporte de substncias 4. Respirao celular 5. Sntese de lipdios 6. Digesto intracelular 7. Armazenamento de secrees Escolha a alternativa que relaciona corretamente organelas e funes celulares: a) I (2, 5); II (1, 4); IV (6, 3) b) I (4); III (2); IV (1) c) II (2, 1); IV (6, 7); V (6, 7) d) II (2, 5); IV (5, 6); V (2, 7) e) I (4); III (2); V (3, 5, 6, 7) 44. UEM-PR (modificado) Sobre as estruturas e funes celulares, assinale o que for correto. 01. Na clula, h movimentao de protenas, carboidratos e lipdios entre as organelas. Essa transferncia de molculas ocorre no interior do ergastoplasma. 02. O complexo de Golgi o principal local da clula onde ocorre digesto, ou seja, a degradao de macromolculas. 04. A membrana plasmtica e todas as membranas encontradas no interior da clula so lipoproticas. 08. Parede celular uma estrutura que envolve as clulas animais. 16. Nas clulas animais o DNA encontrado no ncleo e nas mitocndrias. 32. Nenhum tipo de bactria possui mitocndrias. Portanto, nenhuma bactria utiliza o oxignio para a respirao. 45. UFPR Das caractersticas apresentadas a seguir, selecione aquelas que so comuns tanto a bactrias como a clulas animais. 01. Presena de parede celular rgida. 02. Material gentico constitudo por DNA. 04. Presena de retculo endoplasmtico e complexo de Golgi. 08. Presena de membrana plasmtica. 16. Mitocndria como principal organela para obteno de energia qumica. 32. Presena de ribossomos. 64. Vida livre. D a soma dos itens corretos. 46. Mackenzie-SP

01. 1 representa o envelope nuclear e formado por duas membranas porosas. 02. 2 representa o centrolo e est envolvido na sntese de lisossomos. 04. 3 representa o retculo endoplasmtico rugoso, cuja membrana contnua com o envelope nuclear. 08. 4 representa os ribossomos, que so formados por RNAs e protenas e esto envolvidos com a sntese protica. 16. 5 representa um vacolo, responsvel pela degradao de protenas provenientes do meio extracelular. 32. 6 representa a mitocndria, organela responsvel pela quebra da glicose em H2O e CO2, processo este denominado respirao celular. 64. 7 representa os nuclolos, incapazes de autoduplicao e responsveis pela formao de microvilosidades. 43. Unioeste-PR (modificado) Numerando-se organelas com algarismos romanos e funes celulares com algarismos arbicos: Organelas I. Mitocndria II. Complexo de Golgi III. Lisossomos IV. Ribossomos V. Retculo endoplasmtico
118

Assinale a alternativa correta a respeito da organela representada ao lado. a) Sua principal funo a de armazenar substncias. b) Os grnulos observados em sua superfcie so responsveis pelo fornecimento de energia para o seu funcionamento. c) membranosa e apresenta relao ntima com a carioteca. d) Est presente em todos os tipos de clulas. e) Sua atividade no est relacionada ao funcionamento do ncleo. 47. UFMS Entre as organelas citoplasmticas que realizam mecanismo de sntese, armazenamento e transporte de macromolculas, pode-se citar o peroxissomo, que uma estrutura vesiculosa delimitada por membrana lipoprotica, cuja(s) principal(ais) funo(es) (so): 01. realizar o controle osmtico dos organismos em que esto presentes. 02. realizar o mecanismo de digesto intracelular atravs de suas enzimas hidrolisantes. 04. constituir formas de reservas celulares como gordura e glicognio. 08. desintoxicar os organismos do efeito do lcool, pela quebra do etanol. 16. sintetizar protenas em associao com o RNAm. 32. decompor gua oxigenada pela atividade da enzima catalase. D a soma das proposies corretas. 48. UFPR (modificado) Trs linhagens celulares distintas, estabelecidas em cultura (linhagens 1, 2 e 3), tiveram o contedo de suas membranas existentes em maior quantidade nas respectivas linhagens. Os resultados experimentais obtidos foram os seguintes: Linhagem celular Membranas do retculo endoplasmtico rugoso Membranas do Complexo de Golgi (%) Membranas do retculo endoplasmtico liso (%) Membranas do envoltrio nuclear (%) Membranas de mitocndrias (%) 1 32 14 1 7 3 2 8 7 53 6 8 3 60 1 1 6 7

49. Um aluno observou fotomicrograas de alguns tecidos animais e construiu a tabela abaixo: Tecido Muscular Conjuntivo frouxo Epitelial (mucosa) Epitlio do tbulo renal Epitlio intestinal sseo Representao simblica da quantidade de mitocndrias ++++++++ ++ +++ +++++++++ +++++ ++++

Aps a anlise, o aluno chegou a cinco concluses, mas apenas uma est correta; assinale-a. a) Quanto maior for a atividade biolgica de um tecido, maior ser o nmero de mitocndrias. b) O nmero de mitocndrias varia inversamente atividade do tecido. c) A atividade bioenergtica do tecido epitelial maior que a do epitlio do tbulo renal. d) O nmero de mitocndrias s interfere quando os tecidos esto em desenvolvimento. e) A atividade mitocondrial no interfere no metabolismo energtico dos diferentes tecidos. 50. Unifesp Nas bactrias, a cadeia respiratria encontra-se associada membrana plasmtica e os cidos nuclicos esto associados ao citoplasma. a) assim tambm em um protista, em um animal e em um vegetal? Justique. b) A clonagem de bactrias, comparada clonagem de animais, um processo mais complexo ou mais simples? Justique. 51. A pardia da clula Em um encontro internacional das clulas, muitas delas aproveitam o evento para discutir as novas descobertas no campo da medicina e para relembrarem os tempos ureos de sua juventude e vigor. Em um desses encontros, a clula A dizia que, quando era jovem, sua funo secretora era intensa e pelo fato de pertencer a um tecido avascular, lamentava ter uma vida curta quando comparada quela que vivia em um ambiente que a vascularizao era abundante. J a clula B dizia que ter uma vida longa sem a capacidade de se dividir, tinha o seu lado ruim. Trabalhava sem descanso e, como tudo que envelhece, passava a ter limitaes de funcionamento que incomodava a sua antiga virilidade. Dizia ela: Tive meus momentos de glria e hoje funciono limitadamente, pois uma enfermidade progressiva e sem cura me atingiu e prejudicou minha capacidade de armazenar informaes.
119

Com base nesses dados, julgue (V ou F): ( ) As clulas da linhagem 1 caracterizam-se por elevada taxa de respirao celular.
PV2D-06-BIO-14

( ) As caractersticas das clulas da linhagem 2 so compatveis com a produo de lipdios. ( ) A linhagem 3 representa clulas especializadas em secreo.

Muito inteirada no bate-papo, a clula C, muito jovem e envaidecida por estar na mdia, disse a elas: No se desanimem, esto descobrindo em mim funes que solucionaro muitos problemas. Em breve, minha linhagem ser capaz de resolver muitas frustaes de outras clulas e, at mesmo, substituir as funes daquelas que, por uma infelicidade do destino, jamais tiveram o prazer de funcionar adequadamente. Julgue (V ou F) os itens: (
Fbio Asmar - CBB/UCG

54. Comparando uma clula procaritica com clulas eucariticas vegetal e animal, em comum as trs apresentam: a) mitocndrias, centrolos e agelos. b) membrana plasmtica, ribossomos e cromatina. c) membrana esqueltica, ribossomos e cromatina. d) parede celular celulsica, membrana plamtica e lisossomos. e) membrana esqueltica, membrana plasmtica e cromatina. 55. Assinale a opo que contm as estruturas presentes tanto em clulas vegetais quanto em clulas animais. a) Membrana plasmtica, parede celular e citoplasma. b) Retculo endoplasmtico, mitocndrias e complexo de Golgi. c) Cloroplastos, lisossomos e centrolos . d) Vacolos, carioteca e lisossomos. e) Cromossomos, carioteca e cloroplastos. 56. UFC Qual das alternativas abaixo contm duas organelas citoplasmticas que so encontradas em clulas tanto de animais quanto de vegetais superiores? a) Plasto e vacolo. b) Centrolo e vacolo. c) Mitocndria e ribossomo. d) Mitocndria e centrolo. e) Lisossomo e plasto. 57. UFRJ Observe os esquemas abaixo, que reproduzem as caractersticas morfolgicas dos tipos celulares l e ll com as respectivas estruturas assinaladas.

) De acordo com a descrio acima, a clula A pertence ao tecido epitelial e apresenta um citoplasma rico em ribossomos e em retculo endoplasmtico rugoso ) A clula B um neurnio e apresenta um citoplasma rico em mitocndrias. ) A enfermidade progressiva qual se refere a clula B pode ser a doena de Alzheimer que acomete indivduos idosos e determina principalmente uma decincia no mecanismo de memria do indivduo.

( (

( ) A clula C uma clula tronco e apresenta uma grande capacidade de assumir mltiplas funes no organismo quando adequadamente manipulada. ( ) A incapacidade de se dividir, lamentada pela clula B, evidencia uma perda, ao longo do tempo, de sofrer meiose e originar clulas idnticas anatmicas e funcionalmente, para poder substitu-la em suas carncias de funcionamento. ) A cincia deposita hoje uma grande esperana de cura de doenas genticas atravs da utilizao teraputica das clulas C.

52. A carioteca (membrana nuclear ou envelope nuclear) faz parte de um conjunto amplo de estruturas limitadas por membranas de mesma natureza e que se encontram mergulhadas apenas no hialoplasma das clulas eucariticas. Fazem parte desse conjunto de organides membranosos: a) os cromossomos (DNA), as mitocndrias e o complexo de Golgi. b) retculo endoplasmtico, ribossomos e cloroplastos. c) mitocndria, cloroplasto e ergastoplasma. d) mitocndria, cloroplasto e ribossomos. e) ribossomos, cloroplasto e complexo de Golgi. 53. Derrubamos a grande barreira que soprava os reinos animal e vegetal: a clula a unidade da matria viva. Essa armativa foi feita por cientistas ao descobrirem, em 1839, aquilo que lrios, guas-vivas, gafanhotos, minhocas, samambaias e humanos tm em comum. Pode-se dizer que todas as clulas dos seres acima citados tm as seguintes caractersticas: a) Centrolo e lisossomo b) Parede celular e menossomo c) ncleo individualizado e mitocndria d) Material nuclear disperso e cloropasto
120

Nesses tipos celulares, pode-se armar que as estruturas que so tpicas da clula vegetal esto marcadas com os seguintes nmeros: a) 1 e 4 d) 6 e 7 b) 2 e 3 e) 8 e 10 c) 5 e 9

58. UFMT Quais so as respectivas organelas da clula vegetal responsveis pela respirao, regulao osmtica e sntese de protena? a) Mitocndria, complexo de Golgi e retculo endoplasmtico b) Mitocndria, vacolo e lisossomo c) Ribossomo, vacolo e complexo de Golgi d) Ribossomo, plasmalema e plasto e) Mitocndria, vacolo e ribossomo 59. UFU-MG Considerando uma clula vegetal tpica, d o nome de cada estrutura ou composto cuja funo respectivamente citada a seguir pelas letras de A a D. a) Organela fotossintetizante. b) Organela responsvel pela respirao celular. c) Organela na qual vrias substncias so armazenadas, porm nenhuma substncia ali produzida. Essa organela ocupa um grande espao intracelular. d) Principal constituinte da parede celular. 60. Dentre as vrias organelas presentes numa clula eucaritica, h algumas que apresentam DNA em seu interior (I) e algumas que no so membranosas (II). Constituem exemplos de I e II, respectivamente: a) lisossomos e centrolos. b) cloroplastos e ribossomos. c) mitocndrias e lisossomos. d) dictiossomos e ribossomos. e) mitocndrias e cloroplastos. 61. UFV-MG Com relao s caractersticas que diferenciam clula bacteriana, vegetal e animal, analise as armativas a seguir e assinale a alternativa incorreta: a) A clula vegetal se diferencia da animal por apresentar parede celulsica. b) A clula animal se diferencia da bacteriana por apresentar complexo de Golgi. c) A clula bacteriana se diferencia da vegetal por no apresentar cloroplastos. d) A clula vegetal se diferencia da animal por apresentar cloroplastos. e) A clula bacteriana se diferencia da animal por ter material gentico envolto por membrana. 62. Fuvest-SP As principais diferenas entre uma clula vegetal tpica e uma clula animal tpica so: a) presena de membrana plasmtica e ncleo nas clulas animais e ausncia dessas estruturas nas clulas vegetais. b) presena de mitocndrias e plastos nas clulas vegetais e ausncia dessas estruturas nas clulas animais. c) presena de complexo de Golgi e mitocndrias nas clulas animais e ausncia dessas estruturas nas clulas vegetais.

d) presena de plastos e parede celulsica nas clulas vegetais e ausncia dessas estruturas nas clulas animais. e) presena de mitocndrias e parede celulsica nas clulas vegetais e ausncia dessas estruturas nas clulas animais. Clula animal no apresenta parede celular e cloroplasto. 63. UFRGS-RS Observe, a seguir, o desenho de uma clula.

A partir da anlise do desenho, pode-se armar que se trata de uma clula ..................... . O nmero 1 representa ......................, o nmero 2 corresponde ............. e o nmero 3 refere-se estrutura responsvel por ............... . Assinale a alternativa que completa corretamente as lacunas da descrio anterior. a) vegetal o retculo endoplasmtico mitocndria proteger a clula b) animal o aparelho de Golgi ao cloroplasto armazenar gua e sais minerais c) animal o retculo endoplasmtico mitocndria digerir partculas celulares d) vegetal o retculo endoplasmtico ao cloroplasto organizar os ribossomos e) vegetal o aparelho de Golgi mitocndria realizar a sntese de protenas 64. Unicamp-SP A gura abaixo mostra o esquema do corte de uma clula, observado ao microscpio eletrnico.

PV2D-06-BIO-14

a) A clula proveniente do tecido animal ou vegetal? Justique. b) Se esta clula estivesse em intensa atividade de sntese protica, que organelas estariam mais desenvolvidas ou presentes em maior quantidade? Por qu?
121

65. UFPE As clulas eucariticas, animal e vegetal, embora guardem semelhanas estruturais e funcionais, apresentam importantes diferenas. Analise as proposies a seguir e assinale a alternativa correta. 1. O vacolo das clulas vegetais atua na digesto intracelular, visto que nestas clulas no h lisossomos como nas clulas animais. 2. O retculo endoplasmtico rugoso e o aparelho de Golgi esto presentes tanto em clulas animais quanto em clulas vegetais. 3. Os centrolos, estruturas relacionadas aos movimentos cromossmicos, so ausentes na maioria dos animais e amplamente difundidos entre os vegetais superiores. 4. Os cloroplastos bem como a parede celular esto presentes em clulas vegetais. 5. Nas clulas vegetais no h membrana plasmtica, uma vez que a parede celular existente j sucientemente forte. Esto corretas apenas: 1) 1, 3 e 5 4) 2 e 4 2) 1, 2 e 3 5) 1, 2, 3 e 4 3) 2, 3 e 4 66. Vunesp Comparando-se as colunas a seguir, verica-se que: Coluna I 1. Retculo endoplasmtico 2. Cloroplastos 3. Aparelhos de Golgi 4. Membrana plasmtica 5. Microtbulos Coluna II a Fotossntese b Fagocitose c Sntese de protenas d Citoesqueleto e Secreo celular A correlao correta para estrutura e funo : a) 1 a d) 4 d b) 2 c e) 3 e c) 5 b 67. UNA-MG Assinale a alternativa correta que relaciona os organides celulares s suas funes correspondentes.

68. UFR-RJ Um momento mgico de fora e embriaguez foi a mim proporcionado pela natureza brilhante das algas do gnero Noctiluca, quando coletava material para elaborao de minha dissertao. (...) Os organismos, mencionados no texto anterior, so muitas vezes considerados por zologos como animais e por botnicos como vegetais. Como podemos diferenciar esses dois grupos de organismos, segundo os critrios siolgico e celular?
(Brasil, A.C.S. 1995).

69. Unifesp Considerando a clula do intestino de uma vaca, a clula do parnquima foliar de uma rvore e uma bactria, podemos armar que todas possuem: a) DNA e membrana plasmtica, porm s as clulas do intestino e do parnquima foliar possuem ribossomos. b) DNA, ribossomos e mitocndrias, porm s a clula do parnquima foliar possui parede celular. c) DNA, membrana plasmtica e ribossomos, porm s a bactria e a clula do parnquima foliar possuem parede celular. d) membrana plasmtica e ribossomos, porm s a bactria possui parede celular. e) membrana plasmtica e ribossomos, porm s a clula do intestino possui mitocndrias. 70. PUC-MG Observe as estruturas a seguir.

correto armar que: a) a estrutura de nmero 1 responsvel pela produo de carboidratos. b) a estrutura de nmero 1 encontrada apenas nas clulas animais e responsvel pela produo de energia. c) a estrutura de nmero 2 est presente em todas as clulas e o local onde ocorre a fotossntese. d) a estrutura de nmero 3 formada no ncleo celular e tem a funo de armazenar substncias. e) a estrutura 2 pode ocorrer em procariontes e eucariontes. 71. Unifor-CE Fizeram-se as seguintes armaes sobre clulas animais e clulas vegetais superiores: I. Os dois tipos de clulas possuem membrana plasmtica, complexo de Golgi e vcuolo pulstil. II. As clulas vegetais fabricam substncias orgnicas a partir de compostos inorgnicos. III. Cloroplastos, vacolo e parede celular caracterizam as clulas vegetais, enquanto que nuclolo, ribossomos e retculo endoplasmtico so exclusivos de clulas animais.

122

IV. Tanto as clulas animais como as clulas vegetais apresentam peroxissomos e mitocndrias. Somente correto o que se armou em: a) I e II d) II e IV b) I e III e) III e IV c) II e III 72. Os avonides encontrados em vinhos tintos e no suco de uva tm recebido considervel ateno, devido observao de efeitos positivos no controle da taxa de colesterol no sangue. Essas substncias representam tipos de metablitos secundrios, presentes em algumas clulas vegetais. A gura a seguir representa uma clula vegetal. Observe-a.

74. Vunesp (modificado) Um aluno, aps ter estudado a organizao celular de seres eucariontes e procariontes, elaborou um quadro indicando com sinais (+) e (), respectivamente, a presena ou ausncia da estrutura em cada tipo de clula.

a) O aluno, ao construir o quadro, cometeu quatro erros. Quais foram os erros cometidos? b) A permeabilidade seletiva e a diviso celular esto relacionadas a quais estruturas no quadro? 75. Unicamp-SP Considere as caractersticas das clulas A, B e C indicadas na tabela adiante presena (+) ou ausncia () de alguns componentes e responda:

Considerando o assunto abordado, assinale a alternativa que indica o local da clula mais provvel de serem encontrados os avonides. a) I c) III b) IV d) II 73. UFSC (modificado) Considere os seres procariontes e eucariontes. Entre as combinaes seguintes, assinale aquela(s) que representa(m) correspondncia correta entre seus elementos e some-as.

a) Quais das clulas A, B e C so eucariticas e quais so procariticas? b) Qual clula (A, B ou C) caracterstica de cada um dos seguintes reinos: monera, animal e vegetal? Que componentes celulares presentes e ausentes os diferenciam? 76. Se fssemos comparar o funcionamento e organizao de uma clula eucarionte com o que ocorre em uma cidade, poderamos estabelecer determinadas analogias. Por exemplo, a membrana plasmtica seria o permetro urbano e o hialoplasma corresponderia ao espao ocupado pelos edifcios, ruas e casas com seus habitantes. As colunas renem algumas similaridades funcionais entre as cidades e a clula eucarionte.
123

PV2D-06-BIO-14

Cidade I. Ruas e avenidas II. Silos e armazns III. Central eltrica IV. Casas com aquecimento solar V. Restaurantes e lanchonetes Clula eucaritica 1. Mitocndria 2. Lisossomo 3. Retculo endoplasmtico 4. Complexo de Golgi 5. Cloroplasto Correlacione os locais da cidade com as principais funes correspondentes s organelas celulares e assinale a alternativa correta. a) I 3, II 4, III 1, IV 5 e V 2 b) I 4, II 3, III 2, IV 5 e V 1 c) I 3, II 4, III 5, IV 1 e V 2

d) I 1, II 2, III 3, IV 4 e V 5 e) I 5, II 4, III 1, IV 3 e V 2 77. UFRN Analise a ilustrao que segue.

Com base na ilustrao: a) indique o tipo de clula representado, respectivamente, por I, II e III; b) justique a declarao que I faz para II; c) apresente, sob o ponto de vista estrutural e funcional, as razes que levam III a supor que possui algum grau de parentesco com II.

Captulo 2
78. A(s) principal(is) substncia(s) inorgnica(s) que encontramos nas clulas dos seres vivos (so): a) a gua. d) sais. b) gorduras. e) vitaminas. c) protenas. 79. A quantidade de gua num organismo depende: a) de sua idade e atividade, mas no da espcie a que ele pertence. b) da espcie a que ele pertence e de sua atividade, mas no de sua idade. c) da espcie a que ele pertence e de sua idade, mas no de sua atividade. d) da espcie a que ele pertence, de sua idade e atividade. e) de sua idade, mas no da espcie a que ele pertence ou de sua atividade. 80. Cesesp-PE So funes da gua na clula: I. atuar como solvente da maioria das substncias. II. no atuar na manuteno do equilbrio osmtico dos organismos em relao ao meio ambiente. III. constituir o meio dispersante das substncias celulares. IV. participar das reaes de hidrlise. V. agir como ativador enzimtico. A alternativa que contm as funes verdadeiras : a) I, II, III b) III, IV, V
124

c) I, III, IV d) V, II, III e) III, II, I 81. Madonna, em sua estada em So Paulo, requisitou ao hotel em que estava hospedada o abastecimento de sua sute com determinada bebida chamada Gatorade, alegando perdas por transpirao. No processo de transpirao, alm da gua, ocorrem perdas de: a) sais minerais. b) lipdeos e aminocidos. c) carboidratos. d) protenas. e) aminocidos. 82. No correto armar que os sais minerais: a) esto, na maioria das vezes, no meio intracelular, dissociados em ons. b) na sua frmula integral, participam com funo estrutural da natureza de alguns tecidos, como por exemplo os sais de clcio no tecido sseo. c) tm papel importante no fenmeno da osmose. d) so responsveis pela respirao celular. e) ajudam a manter constante o pH da clula. 83. UFRN Elementos que fazem parte da constituio das molculas de ATP, clorola e hemoglobina, so, respectivamente: a) magnsio, ferro e fsforo. b) ferro, magnsio e fsforo.

c) fsforo, magnsio e ferro. d) magnsio, fsforo e ferro. e) fsforo, ferro e magnsio. 84. Assinale a alternativa falsa: a) O on de sdio est relacionado com a conduo de impulsos nervosos. b) O on clcio participa da contrao muscular. c) O iodo constituinte da molcula de tiroxina, hormnio sintetizado pela glndula tireide. d) O on magnsio est presente na molcula da clorola, pigmento fotossintetizante das plantas verdes. e) O on clcio faz parte da molcula da hemoglobina e dos citocromos da cadeia respiratria. 85. UFU-MG Os sais minerais possuem funes diversicadas, podendo existir, nos seres vivos, dissolvidos em gua, sob a forma de ons, ou imobilizados como componentes de esqueletos. Assim sendo, podemos dizer que, dos sais minerais encontrados sob a forma de on, a) o clcio est presente na clorola e indispensvel para que ocorra o processo de fotossntese. b) o sdio apresenta-se sempre em concentraes maiores dentro da clula do que fora dela. c) o ferro est presente na hemoglobina, molcula responsvel pelo transporte de oxignio no organismo. d) o magnsio um on indispensvel na transferncia de energia nos processos metablicos celulares. 86. Fuvest-SP Os adubos inorgnicos industrializados, conhecidos pela sigla NPK, contm sais de trs elementos qumicos: nitrognio, fsforo e potssio. Qual das alternativas indica as principais razes pelas quais esses elementos so indispensveis vida de uma planta? a) Nitrognio constituinte de cidos nuclicos e protenas; Fsforo constituinte de cidos nuclicos e protenas; Potssio constituinte de cidos nuclicos, glicdios e protenas. b) Nitrognio atua no equilbrio osmtico e na permeabilidade celular; Fsforo constituinte de cidos nuclicos; Potssio atua no equilbrio osmtico e na permeabilidade celular. c) Nitrognio constituinte de cidos nuclicos e protenas; Fsforo constituinte de cidos nuclicos; Potssio atua no equilbrio osmtico e na permeabilidade celular. d) Nitrognio constituinte de cidos nuclicos, glicdios e protenas; Fsforo atua no equilbrio osmtico e na permeabilidade celular; Potssio constituinte de protenas.

e) Nitrognio constituinte de glicdios; Fsforo constituinte de cidos nuclicos e protenas; Potssio atua no equilbrio osmtico e na permeabilidade celular. 87. Mackenzie-SP Um dos riscos de uma dieta exclusivamente vegetariana a ocorrncia de anemia. Assinale a alternativa que apresenta a relao correta entre esse tipo de dieta e a anemia. a) O excesso de bras vegetais provoca uma intoxicao alimentar conhecida como anemia. b) A falta de carne provoca carncia de vitamina D, acarretando anemia. c) A carne contm grandes quantidades de ferro, cuja falta provoca anemia. d) O excesso de vegetais na dieta provoca um aumento nos movimentos peristlticos, provocando perda de nutrientes. e) A falta de aminocidos, encontrados exclusivamente em animais, a causa da anemia. 88. Analise as frases seguintes e assinale a alternativa correta: I. A distribuio de cargas eltricas na molcula de gua lhe d caractersticas de uma substncia apolar. II. O grande poder de dissoluo da gua muito importante para os organismos, pois todas as reaes qumicas ocorrem no meio aquoso. III. O alto calor especco da gua impede mudanas bruscas de temperatura dentro das clulas. a) Apenas as frases I e II esto corretas. b) Apenas a frase I est correta. c) Apenas as frases II e III esto corretas. d) Todas as frases esto corretas. e) Todas as frases esto erradas. 89. UFSC A gua a substncia mais abundante na constituio dos mamferos. encontrada nos compartimentos extracelulares (lquido intersticial), intracelulares (no citoplasma) e transcelulares (dentro de rgos como a bexiga e o estmago). Sobre a gua e sua presena nos mamferos correto armar que: 01. a quantidade em que encontrada nos organismos invarivel de espcie para espcie. 02. com o passar dos anos, existe uma tendncia de aumentar seu percentual em um determinado tecido. 04. importante fator de regulao trmica dos organismos. 08. em tecidos metabolicamente ativos inexistente. 16. participa da constituio dos uidos orgnicos que transportam substncias dissolvidas por todo o corpo. 32. constitui meio dispersante para facilitar a realizao das reaes qumicas. D como resposta a soma dos nmeros dos tens corretos.
125

PV2D-06-BIO-14

90. Unifesp Um ser humano adulto tem de 40% a 60% de sua massa corprea constituda por gua. A maior parte dessa gua encontra-se localizada: a) no meio intracelular. b) no lquido linftico. c) nas secrees glandulares e intestinais. d) na saliva. e) no plasma sangneo. 91. PUC-SP O papel principal do on PO 4 na clula : a) manter o equilbrio osmtico. b) formar ligaes de alta energia. c) atuar como oxidante energtico. d) regular o equilbrio cido-base. e) atuar como catalisador em reaes metablicas. 92. A contrao muscular e a coagulao do sangue, apesar de serem processos metablicos bastante distintos, tm em comum a dependncia em relao: a) ao fosfato. d) ao clcio. b) ao potssio. e) ao sdio. c) ao glicognio. 93. UFOP-MG A composio qumica das clulas que constituem qualquer ser vivo revela a presena constante de certas substncias que podem ser divididas em dois grandes grupos: inorgnicos e orgnicos. Em relao composio qumica da clula, incorreto armar: a) O on Mg +2 (magnsio) tem papel importante na coagulao do sangue. b) Os ons fosfatos, alm de atuar como ons tampes, impedindo a acidicao ou a alcanilizao do protoplasma, tm relevante papel na formao molecular do DNA, do RNA e do ATP (composto que armazena energia dentro da clula. c) Entre as substncias orgnicas que constituem a clula, podem-se citar: carboidratos, lipdios, aminocidos, protenas e cidos nuclicos. d) Dos componentes inorgnicos presentes na clula, a gua o mais abundante, tendo como funo, entre outras, a de solvente de ons minerais e de muitas substncias orgnicas. 94. Fuvest-SP Observando plantas de milho, com folhas amareladas, um estudante de agronomia considerou que essa aparncia poderia ser devida decincia mineral do solo. Sabendo que a clorola contm magnsio, ele formulou a seguinte hiptese: As folhas amareladas aparecem quando h decincia de sais de magnsio no solo. Qual das alternativas descreve um experimento correto para testar tal hiptese? a) Fornecimento de sais de magnsio ao solo em que as plantas esto crescendo e observao dos resultados alguns dias depois. b) Fornecimento de uma mistura de diversos sais minerais, inclusive sais de magnsio, ao solo em que as plantas esto crescendo e observao dos resultados dias depois.
126

c) Cultivo de um novo lote de plantas, em solo suplementado com uma mistura completa de sais minerais, incluindo sais de magnsio. d) Cultivo de novos lotes de plantas, fornecendo metade deles, mistura completa de sais minerais, inclusive sais de magnsio, e outra metade, apenas sais de magnsio. e) Cultivo de novos lotes de plantas, fornecendo metade deles mistura completa de sais minerais, inclusive sais de magnsio, e outra metade, uma mistura com os mesmos sais, menos os de magnsio. 95. UFPE Na(s) questo(es) a seguir escreva nos parnteses a letra (V) se a armativa for verdadeira ou (F) se for falsa. Os sais minerais existem nos seres vivos de forma imobilizada ou dissociados em ons. Pequenas variaes nas porcentagens de ons podem modicar profundamente a permeabilidade, irritabilidade e viscosidade de clula. Analise as propostas apresentadas. ( ) Magnsio: presente na clorola e, portanto, necessrio fotossntese. ( ) Clcio: necessrio para a ao de certas enzimas em importantes processos siolgicos. ( ) Ferro: presente na hemoglobina, faz parte de pigmentos importantes na respirao. ( ) Fosfato: o principal ction extra e intracelular. ( ) Cloreto: importante ction presente tanto na hemoglobina quanto na clorola. ( ) Sdio: importante ction participante dos impulsos nervosos. ( ) Potssio: importante papel na coagulao sangnea. 96. UFMG Segundo estudo feito na Etipia, crianas que comiam alimentos preparados em panelas de ferro apresentaram uma reduo da taxa de anemia de 55% para 13%. Essa reduo pode ser explicada pelo fato de que o ferro, a) aquecido, ativa vitaminas do complexo B presentes nos alimentos prevenindo a anemia. b) contido nos alimentos, se transforma facilmente durante o cozimento e absorvido pelo organismo. c) oriundo das panelas, modica o sabor dos alimentos, aumentando o apetite das crianas. d) proveniente das panelas, misturado aos alimentos e absorvido pelo organismo. 97. UFRJ muito comum que as mulheres apresentem um quadro de anemia durante a gravidez. As mulheres anmicas queixam-se de cansao constante, alm de uma acentuada falta de ar. Essa condio em geral pode ser tratada por meio da ingesto de sais de ferro, ou de uma dieta rica em ferro. Explique de que forma a dose extra de ferro alivia os sintomas da falta de ar.

98. UFC-CE (modificado) As alternativas a seguir se referem qumica da clula viva. Escolha as corretas. 01. Das substncias orgnicas que constituem a clula, podemos citar: carboidratos, lipdios, protenas e cidos nuclicos. 02. Dos componentes inorgnicos presentes nas clulas, a gua o mais abundante, tendo como funo, entre outras, a de solvente de ons minerais e de muitas substncias orgnicas. 04. Alm de favorecer a ocorrncia de reaes qumicas, a gua indispensvel no transporte de substncias. 08. Os sais minerais existentes na clula esto sob duas formas: imobilizados como componentes de estruturas esquelticas e dissolvidos na gua em forma de ons. 16. O on sdio (Na+) importante na propagao de impulsos nervosos. D como resposta a soma dos itens corretos. 99. UFPE Os seres vivos apresentam em sua composio qumica tanto substncias orgnicas quanto inorgnicas. Tomando como referencial a distribuio ilustrada na gura a seguir, para a bactria Escherichia coli, assinale a alternativa que inclui as fraes representativas de gua, protenas e sais minerais, nesta ordem.

Proposta V. incrementar o consumo de frutas e verduras. Diante destas propostas, responda s questes: a) Qual delas traria maior benefcio populao, no combate anemia? Justique. b) Qual proposta que, pelo seu principal componente inico, poderia reduzir, tambm, os altos ndices de cries dentrias, de osteoporose e de hemorragias? Por qu? 101. UFC-CE Algumas reaes fragmentam molculas orgnicas complexas e ricas em energia, originando molculas mais simples e pobres em energia como dixido de carbono, gua e amnia. O conjunto dessas reaes caracteriza: a) o anabolismo como processo bsico. b) o catabolismo como processo bsico. c) o catabolismo como sntese de molculas variadas. d) a homeostase como processo de fragmentao de molculas. e) a homeostase como processo de sntese de molculas simples. 102. FEI-SP Qual dos alimentos a seguir tem funo basicamente energtica? a) mel d) sal b) bife e) ovo c) cenoura 103. A energia que usamos para realizar os movimentos provm da degradao dos alimentos que ingerimos. Entre os nutrientes que ingerimos, indique o mais utilizado na produo desta energia: a) protena. d) sais minerais. b) carboidrato. e) gua. c) lipdio.

a) 1, 2 e 3. b) 2, 3 e 6. c) 1, 2 e 6.

d) 2, 3 e 1. e) 3, 2 e 4.

PV2D-06-BIO-14

100. Vunesp Os mdicos de uma cidade do interior do estado de So Paulo, ao avaliarem a situao da sade de seus habitantes, detectaram altos ndices de anemia, de bcio, de crie dentria, de osteoporose e de hemorragias constantes atravs de sangramentos nasais. Vericaram a ocorrncia de carncia de alguns ons minerais e, para suprir tais decincias, apresentaram as propostas seguintes. Proposta I. distribuio de leite e derivados. Proposta II. adicionar or gua que abastece a cidade. Proposta III. adicionar iodo ao sal consumido na cidade, nos termos da legislao vigente. Proposta IV. incentivar os habitantes a utilizar panelas de ferro na preparao dos alimentos.

104. Mackenzie-SP As substncias que se destinam a fornecer energia, alm de serem responsveis pela rigidez de certos tecidos, sendo mais abundantes nos vegetais, so os ..., sintetizados pelo processo de ... . A alternativa que preenche corretamente os espaos : a) lipdios, fotossntese. b) cidos nuclicos, autoduplicao. c) cidos nuclicos, fotossntese. d) lcoois, fermentao. e) carboidratos, fotossntese. 105. UFRN Na maioria dos animais e vegetais, a armazenagem de carboidratos se d: a) respectivamente, na forma de glicognio e amido. b) respectivamente, na forma de amido e celulose. c) respectivamente, na forma de maltose e glicose. d) exclusivamente, na forma de amido. e) exclusivamente, na forma de glicognio.
127

106. PUC-RS O polissacardeo formado por unidades de glicose e que representa a principal forma de armazenamento intracelular de glicdios nos animais denominado: a) amido. d) celulose. b) colesterol. e) glicognio. c) ergosterol. 107. Unimep-SP (modificado) Sobre os carboidratos (acares), assinale a alternativa que contm a substncia de menor eccia para nosso organismo em termos de metabolismo energtico. a) glicose d) glicognio b) sacarose e) celulose c) amido 108. Qual das substncias no digerida pelo sistema digestrio humano: a) amido d) maltose b) celulose e) sacarose c) lactose 109. A quitina, substncia que forma o exoesqueleto dos artrpodes, classicada quimicamente como: a) monossacardio. d) esteride. b) lipdio simples. e) carotenide. c) polissacardio. 110. O dissacardio encontrado na cana-de-acar e o polissacardio que reveste as clulas vegetais so, respectivamente: a) celulose e glicose. b) sacarose e glicognio. c) frutose e celulose. d) amido e maltose. e) sacarose e celulose. 111. Indique os componentes resultantes da hidrlise dos seguintes carboidratos: a) sacarose b) lactose c) maltose 112. Cesgranrio-RJ O esquema a seguir representa uma das etapas do processo digestivo:

113. UFV-MG Utilizando seus conhecimentos sobre a vida do planeta Terra, responda: a) De onde provm todos os acares naturais utilizados pelos animais e vegetais? b) Por que se diz que, se a produo dos acares naturais acabasse, a vida na terra seria extinta? 114. UFBA (modificado) Um organismo vivo pode ser denido como um sistema que mantm e eventualmente expande suas estruturas ordenadas atravs de uma constante aquisio de energia externa. Na Terra, essa energia vem primariamente do Sol, como se destaca na ilustrao.
Cramer, p.17

a) Quais so os organismos capazes de transformar energia luminosa em energia qumica, que ca armazenada nas molculas de acares? b) Qual o principal acar produzido no fenmeno da fotossntese? Como esse acar ca armazenado nas clulas vegetais? 115. Em laboratrio, foram puricadas quatro substncias diferentes, cujas caractersticas so dadas a seguir: A. Polissacardeo de reserva encontrado em grande quantidade no fgado de vaca. B. Polissacardeo estrutural encontrado em grande quantidade na parede celular de clulas vegetais. C. Polmero de nucleotdeos compostos por ribose e encontrado no citoplasma. D. Polissacardeo encontrado no exoesqueleto dos artrpodes.

As substncias resultantes do processo representado so: a) amido e maltose. d) frutose e glicose. b) glicose e amido. e) frutose e lactose. c) lactose e galactose.
128

As substncias A, B, C e D so, respectivamente: a) glicognio, celulose, RNA, quitina. b) amido, celulose, RNA, quitina. c) amido, pectina, RNA, protena. d) glicognio, celulose, DNA, vitamina. e) glicognio, celulose, DNA, vitamina. 116. Vunesp Os acares complexos, resultantes da unio de muitos monossacardios, so denominados de polissacardios. a) Cite dois polissacardios de reserva energtica, sendo um de origem animal e outro de origem vegetal. b) Indique um rgo animal e um rgo vegetal onde cada um destes acares pode ser encontrado. 117. Originria da ndia, a banana uma das frutas h mais tempo consumida pelo homem (...) Rica em acares e vitamina C, foi chamada o alimento dos sbios. A banana tambm favorece a secreo dos neurotransmissores, sendo um alimento completo e de baixa caloria (...). A banana um excelente combustvel para os esportistas. Isto deve-se ao fato de essa fonte natural de energia (...) conter, em propores ideais, diversos carboidratos (...). Com base nessa informao, responda: Os carboidratos podem se apresentar, na banana, sob a forma de glicose, frutose e amido. Em relao a essas substncias, responda: a) Qual a classificao dos acares mencionados? b) Quais acares podem ser aproveitados diretamente? Qual precisa sofrer digesto? 118. PUC-RJ Algumas atividades fsicas demandam um grande gasto energtico. Assim, atletas, como Vanderlei de Souza, devem, antes de uma maratona, usufruir de uma refeio rica em: a) protenas. b) lipdios. c) sais minerais. d) carboidratos. e) vitaminas. 119. Unama-PA Sob o Sol forte, seu Manoel, romeiro nordestino que acompanhava o Crio seguro corda, suava muito, tinha a respirao ofegante e fraqueza muscular nas pernas. Nos intervalos de parada da procisso, para homenagear a Santa, seu Manoel comia um pedao de rapadura que levava no bolso. Sentindo melhora da fraqueza, retornava rmemente sua devoo. a) Explique como o consumo de rapadura, alimento rico em sacarose, melhorou a condio fsica de seu Manoel. b) Qual o papel biolgico do suor, eliminado por seu Manoel?
In: Tudo O livro do conhecimento, encarte da revista Isto.

120. UFMS (modificado) Uma das principais formas de armazenagem de glicose pelas clulas o polmero denominado glicognio. Sobre esse polissacardeo, correto armar: 01. Constitui a principal forma de armazenagem de glicose em clulas animais; em clulas vegetais, esse papel do amido. 02. Na verdade, corretamente, um monossacardeo com diversos ismeros, composto por uma nica molcula, cuja frmula : C6H12O6. 04. Constitui a principal forma de armazenagem em clulas vegetais e no-animais, sob a forma de um amido. 08. Pode ser armazenado no fgado e nos msculos, sob a forma de glicognio heptico e muscular, respectivamente. 16. Sua hidrlise, que pode ser estimulada pelos hormnios, provoca aumento da taxa de glicose no sangue. Soma os itens corretos. 121. UFC-CE Sobre as substncias que compem os seres vivos, correto armar que: 01. os carboidratos, os lipdios e as vitaminas so fontes de energia para os seres vivos. 02. a gua a substncia encontrada em maior quantidade nos seres vivos. 04. alm de sua funo energtica, os carboidratos esto presentes na formao de algumas estruturas dos seres vivos. 08. as gorduras constituem o principal componente estrutural dos seres vivos. 16. os seres vivos apresentam uma composio qumica mais complexa do que a matria bruta, sendo formados por substncias orgnicas, como as protenas, os lipdios, os carboidratos, as vitaminas e os cidos nucleicos. Soma os itens corretos. 122. Unifesp Uma dieta com consumo adequado de carboidratos, alm de prover energia para o corpo, ainda proporciona um efeito de preservao das protenas. A armao est correta porque: a) os carboidratos, armazenados sob a forma de gordura corprea, constituem uma barreira protetora das protenas armazenadas nos msculos. b) se as reservas de carboidratos estiverem reduzidas, vias metablicas, utilizaro as protenas para ns energticos. c) as enzimas que quebram os carboidratos interrompem a ao de outras enzimas que desnaturam protenas. d) o nitrognio presente nos aminocidos das protenas no pode ser inativado em presena de carboidratos. e) a energia liberada pela quebra de carboidratos desnatura enzimas que degradam protenas.
129

PV2D-06-BIO-14

123. Dos acares, cujas frmulas so representadas a seguir, um monossacardeo e o outro, dissacardeo:

C7H14 O7 Acar A

C 6H10 O 5 Acar B

A anlise do quadro permite identicar as molculas orgnicas em I, II e III como sendo, respectivamente: a) fosfolipdios, glicose e celulose. b) fosfolipdios, vitaminas e cidos nuclicos. c) glicoprotenas, vitaminas e lignina. d) sais minerais, glicose e protenas. e) cidos nuclicos, triglicrides e celulose. 129. UEL-PR Os esquemas a seguir mostram as quantidades relativas de protenas (P) e de lipdios (L) em diversos tipos de carnes.

a) Qual deles o monossacardeo? Por qu? b) Qual o dissacardeo? Como seriam as molculas que o originaram? 124. Em relao aos lipdios, so feitas vrias armaes corretas, exceto: a) servem como isolante trmico. b) podem ser encontrados armazenados nas clulas adiposas dos animais. c) so os principais combustveis energticos da clula. d) compem as membranas celulares. e) os vegetais podem estoc-los sob a forma de leo nas sementes. 125. Mackenzie-SP As substncias usadas pelos organismos vivos, como fonte de energia e como reserva energtica, so, respectivamente: a) gua e glicdios. b) gua e sais minerais. c) lipdios e sais minerais. d) glicdios e sais minerais. e) glicdios e lipdios. 126. Os lipdios mais comumente usados na nossa alimentao so integrantes do grupo dos: a) monoglicerdios. d) esterides. b) triglicerdios. e) lipdios complexos. c) cerdeos 127. FASP Que tipo de substncia impermeabiliza o tecido vegetal contra a perda excessiva de gua e fornece energia? a) cidos nuclicos. d) vitaminas. b) protenas. e) ons inorgnicos. c) lipdios. 128.

Uma pessoa com colesterol elevado no deve ingerir: a) frango e ganso. d) frango e coelho. b) frango e porco. e) porco e coelho. c) ganso e porco. 130. Fuvest-SP Para vericar a hiptese a lipase age sobre as gorduras, provocando a formao de cidos graxos, foi feita uma experincia, colocando-se em tubos de ensaio os seguintes materiais: Tubo I II III Substrato Leite Leite gua Indicador Rosa Rosa Rosa Lipase Presente Ausente Presente

Sabendo-se que o indicador usado passa de rosa a azul em meio cido, a hiptese car comprovada se a cor do indicador mudar apenas: a) no tubo I. d) nos tubos I e III. b) no tubo II. e) nos tubos II e III. c) nos tubos I e II. 131. UFC-CE O colesterol tem sido considerado um vilo nos ltimos tempos, uma vez que as doenas cardiovasculares esto associadas a altos nveis desse composto no sangue. No entanto, o colesterol desempenha importantes papis no organismo. Analise os itens a seguir. I. O colesterol importante para a integridade da membrana celular. II. O colesterol participa da sntese dos hormnios esterides. III. O colesterol participa da sntese dos sais biliares. Da anlise dos itens, correto armar que: a) somente I verdadeiro. b) somente II verdadeiro. c) somente III verdadeiro. d) somente I e II so verdadeiros. e) I, II e III so verdadeiros.

130

132. UFSC Considere os compostos, apresentados na coluna superior, e as caractersticas, apresentadas na coluna inferior e, aps, assinale com V (verdadeiro) ou F (falso) as proposies adiante. I. gua II. sal mineral III. monossacardio IV. lipdio A. molcula mais abundante na matria viva B. composto orgnico C. composto inorgnico D. tipo de carboidrato ( ) III D ( )IB ( ) II A ( ) IV B ( ) III B 133. PUCCamp-SP Radicais livres, que se originam de reaes qumicas das quais o O2 participa, tm efeitos nocivos sobre as membranas biolgicas. Agindo sobre as duplas ligaes dos cidos graxos das lipoprotenas, comprometem as funes de tais membranas. Estrutura lipoprotica, portanto sujeita ao danosa do oxignio, est presente: a) somente na membrana plasmtica b) somente nas membranas mitocondriais. c) somente nas membranas plasmtica e nuclear. d) somente no retculo endoplasmtico e na membrana nuclear. e) em todo o sistema de membranas das clulas. 134. H alguns meses, foi lanado no mercado um novo produto alimentcio voltado para o consumidor vegetariano: uma bebida sabor iorgute feita base de leite de soja. poca, os comerciais informavam tratar-se do primeiro iorgute totalmente isento de produtos de origem animal. Sobre esse produto, pode-se dizer que isento de: a) colesterol e caboidratos. b) lactose e colesterol. c) protenas e colesterol. d) protenas e lactose. e) lactose e carboidratos. 135. UFV-MG Com relao s substncias qumicas dos seres vivos, resolva os itens a seguir: a) Qual a forma de armazenamento dos carboidratos nos tecidos animais e vegetais, respectivamente? b) Qual a unidade monomrica dos polissacardios? c) Em qual tipo de lipdio so classicados os leos e gorduras? 136. UEL-PR O leo vegetal, componente do biodiesel, do grupo dos triglicerdios, podendo ser extrado de vrias fontes, como amendoim, mamona, algodo e girassol. Sobre os triglicerdios, correto armar:
PV2D-06-BIO-14

a) So substncias hidroflicas sintetizadas nos vaclos das clulas. b) So lipdios estruturais sintetizados nos cloroplastos das clulas. c) So lipdios que formam as membranas celulares. d) So lipdios de reserva energtica. e) So produtos diretos da fotossntese. 137. UFF-RJ Os hormnios esterides substncias de natureza lipdica so secretados a partir de vesculas provenientes, diretamente, do: a) retculo endoplasmtico liso b) retculo de transio c) complexo de Golgi d) retculo endoplasmtico granular e) peroxissomo 138. Os lipdios compreendem um grupo quimicamente variado de molculas que exercem inmeras funes em nosso organismo. Em relao aos lipdios, faa as associaes corretas. a) cera b) esteride c) fosfolipdio d) glicerdeo ( ) lipdio estrutural, presente nas membranas plasmticas dos seres vivos, que apresenta um grupo fosfato em sua constituio. ( ) lipdio complexo, constitudo basicamente por um conjunto de quatro anis. Constituinte dos leos e gorduras. ( ) lipdio constituinte dos leos e gorduras. ( ) classe de lipdios constituda por uma longa molcula de cido graxo associado a uma longa molcula de lcool. Impermeabilizante de folhas e frutos. 139. PUC-MG (modificado) Os lipdios compreendem um grupo quimicamente variado de molculas orgnicas tipicamente hidrofbicas. Diferentes lipdios podem cumprir funes especcas em animais e vegetais. Assinale a alternativa incorreta. a) Os fosfolipdios so os principais constituintes das membranas biolgicas. b) Os esterides podem desempenhar papis regulatrios como, por exemplo, os hormnios sexuais. c) Os triglicerdeos podem atuar como isolantes trmicos ou reserva energtica em animais. d) O colesterol uma das principais fontes de energia para o fgado. 140. O colesterol um esteride que constitui um dos principais grupos de lipdios. Com relao a esse tipo particular de lipdio, correto armar que a) na espcie humana, o excesso de colesterol aumenta a ecincia da passagem do sangue no interior dos vasos sangneos, acarretando a arteriosclerose.
131

b) o colesterol participa da composio qumica das membranas das clulas e precursor dos hormnios sexuais masculino (testosterona) e feminino (estrgeno). c) o colesterol encontrado em alimentos tanto de origem animal como vegetal (por ex: manteigas, margarinas, leos de soja, milho etc.) uma vez que derivado do metabolismo dos glicerdeos. d) nas clulas vegetais, o excesso de colesterol diminui a ecincia dos processos de transpirao celular da fotossntese. 141. UFC-CE Os esterides so lipdios bem diferentes dos glicerdeos e das ceras, apresentando uma estrutura composta por quatro anis de tomos de carbono interligados. O colesterol um dos esterides mais conhecidos, devido sua associao com as doenas cardiovasculares. No entanto, esse composto muito importante para o homem, uma vez que desempenha uma srie de funes. Cite: a) duas principais funes do colesterol; b) duas origens do colesterol sanguneo. 142. UFRGS-RS (modificado) Assinale com V (verdadeiro) ou F (falso) as seguintes consideraes o colesterol, um lipdio do grupo dos esterides. ( ) Ele participa da composio da membrana plasmtica das clulas animais. ( ) Ele sintetizado no pncreas, degradado no fgado e excretado na forma de sais biliares. ( ) Ele precursor dos hormnios sexuais masculino e feminino. ( ) As formas de colesterol HDL e LDL so determinadas pelo tipo de lipoprotena que transporta o colesterol. A sequncia correta de preenchimento dos parnteses, de cima para baixo, : a) V F V V. d) F F V F. b) F V F V. e) V V F V. c) V V F F. 143. PUC-MG Lipoprotenas so protenas transportadoras de lipdios na corrente sangnea. O esquema adiante representa a captao heptica e o controle da produo dessas lipoprotenas que podem ser: de baixa densidade (LDL), de muito baixa densidade (VLDL), de densidade intermediria (IDL) e ainda a de alta densidade (HDL), que no est representada no desenho. Com base na gura e em seus conhecimentos, assinale a armativa incorreta. Dieta normal Dieta rica em colesterol (sem colesterol)

a) Altos nveis plasmticos de LDL favorecem a reduo dos riscos de enfarto do miocrdio. b) Em uma dieta rica em colesterol, o fgado ca repleto de colesterol, o que reprime os nveis de produo de receptores de LDL. c) A decincia do receptor, por origem gentica ou diettica, eleva os nveis plasmticos de LDL. d) Em uma dieta normal, a VLDL secretada pelo fgado e convertida em IDL nos capilares dos tecidos perifricos. 144. A(s) principal(is) substncia(s) orgnica(s) que encontramos nas clulas dos seres vivos animais (so): a) gua. d) sais. b) gorduras. e) vitaminas. c) protenas. 145. Marque a alternativa que indica o alimento mais rico em protenas: a) batata. d) carne. b) alface. e) arroz. c) cenoura. 146. FRNL-RJ A protena formada a partir do encadeamento de molculas mais simples chamadas: a) nucleotdeos. d) glicdios. b) aminocidos. e) cidos graxos. c) nucleosdeos. 147. Dentre as afirmaes a seguir, assinale a(s) que caracteriza(m) corretamente as protenas. I. So essencialmente formadas por C, H, O, N. II. So macromolculas formadas pela unio sucessiva de carboidratos de diversos tipos. III. Podem formar estruturas diferenciadas, denominadas primria, secundria, terciria ou quaternria. IV. Seu constituinte bsico o aminocido. a) I, II e III. b) II, III e IV. c) I, III e IV. d) II e IV. e) Apenas I. 148. PUC-RJ Chama-se aminocido essencial ao aminocido que: a) no sintetizado no organismo humano. b) sintetizado em qualquer organismo animal. c) s existe nos vegetais. d) tem funo semelhante das vitaminas. e) indispensvel ao metabolismo energtico. 149. Fatec-SP Alguns pacientes da UTI dos hospitais no podem alimentar-se por via oral, sendo, ento necessrio aliment-los injetando em suas veias soro com nutrientes variados.

132

Assinale a alternativa que contm somente nutrientes que podem ser injetados nas veias, pois sero assimilados pelas clulas do ser humano. a) Vitaminas e sacarose. b) Protenas e vitaminas. c) Aminocidos e monossacardeos. d) Protenas e aminocidos. e) DNA, RNA e protenas. 150. PUCCamp-SP Os fenilcetonricos tm falta de uma enzima do fgado responsvel pelo metabolismo do aminocido fenilalanina. Para que essa substncia no se acumule no sangue, sua dieta alimentar deve se restringir, dentre os nutrientes mencionados a seguir: a) as protenas apenas. b) os carboidratos apenas. c) as gorduras apenas. d) as gorduras e aos carboidratos. e) as gorduras e as protenas. 151. Fatec-SP Os nutrientes desempenham vrias funes no organismo humano: fornecem energia para todos os processos vitais; suprem o organismo de substncias que permitem o crescimento e regenerao das partes do corpo; regulam os processos siolgicos. A alternativa que relaciona a seqncia correta dos nutrientes com as funes anteriormente discriminadas : a) carboidratos; vitaminas; protenas. b) vitaminas; protenas; carboidratos. c) protenas; vitaminas; carboidratos. d) carboidratos; protenas; vitaminas. e) vitaminas; carboidratos; protenas. 152. PUC-RJ A gota um distrbio siolgico que causa dor e inchao nas articulaes, por acmulo de cido rico, um resduo metablico nitrogenado. Considerando-se a composio qumica dos diferentes nutrientes, que tipo de alimento um indivduo com gota deve evitar? a) O rico em gordura. b) O pobre em gordura. c) O pobre em protenas. d) O rico em sais de sdio. e) O rico em protenas. 153. FEI-SP Muitas estruturas do nosso organismo possuem em sua estrutura o colgeno. Quimicamente, o colgeno pertence ao grupo de: a) carboidratos b) lipdeos c) protenas d) glicdeos e) cidos nuclicos 154. Fuvest-SP Leia o texto a seguir, escrito por Jns Jacob Berzelius em 1828.

Existem razes para supor que, nos animais e nas plantas, ocorrem milhares de processos catalticos nos lquidos do corpo e nos tecidos. Tudo indica que, no futuro, descobriremos que a capacidade de os organismos vivos produzirem os mais variados tipos de compostos qumicos reside no poder cataltico de seus tecidos. A previso de Berzelius estava correta, e hoje sabemos que o poder cataltico mencionado no texto deve-se: a) aos cidos nuclicos. b) aos carboidratos. c) aos lipdios. d) s protenas. e) s vitaminas. 155. PUC-SP Considere as seguintes armativas. I. As protenas so substncias de grande importncia para os seres vivos. Muitas participam da construo da matria viva. II. As protenas chamadas enzimas facilitam reaes qumicas celulares. III. Os anticorpos, que tambm so protenas, funcionam como substncia de defesa. Assinale: a) se somente I estiver correta. b) se somente II estiver correta. c) se somente III estiver correta. d) se I e II estiverem corretas. e) se todas estiverem corretas. 156. Duas protenas sero consideradas iguais se apresentarem: a) Apenas o mesmo nmero de aminocidos. b) Apenas os mesmos tipos de aminocidos. c) Apenas a mesma seqncia de aminocidos. d) O mesmo nmero e tipos de aminocidos, mas no necessariamente a mesma seqncia. e) O mesmo nmero, tipos e seqncia de aminocidos. 157. UFSC-SC (modificado) Considere os compostos e as caractersticas apresentadas nas colunas abaixo e assinale a(s) proposio(es) que apresenta(m) correlao(es) correta(s). I. gua IV. Lipdio II. Sal mineral V. Protena III. Glicose A. Molcula orgnica presente na pele, ossos e cartilagens B. Molcula mais abundante na matria viva C. Composto orgnico energtico D. Composto inorgnico E. Reserva energtica como gordura e leo 01. III-E 16. IV-C 02. II-B 32. V-D 04. III-C 64. V-A 08. I-C
133

PV2D-06-BIO-14

158. EFOA-MG (modificado) As frmulas a seguir representam a unio entre dois aminocidos:

b) de que ele necessita mas no consegue sintetizar, tendo que receb-los em sua dieta. c) de que ele necessita apenas nas primeiras etapas de seu desenvolvimento. d) obtidos diretamente a partir de vegetais, que so os nicos organismos a sintetiz-los. e) resultantes da degradao de suas prprias protenas. 163. FMTM-MG Leia com ateno a charge:

Qual o nome da ligao que ser formada com a retirada dos grupos destacadas no tracejado? a) Ligao peptdica. b) Ligao aminopolipeptdica. c) Ligao cetnica. d) Ligao carboxlica. e) Ponte de hidrognio. 159. A partir da anlise do esquema abaixo, diga o que representam as letras A, B, C e D.

160. UniRio-RJ A puricao e anlise de uma molcula biolgica indicou a presena de nove diferentes monmeros. Podemos armar que se trata de um(a): a) cido nuclico. d) protena. b) glicerdio. e) vitamina. c) esteride. 161. PUCCamp-SP Uma amostra do contedo intestinal de uma pessoa apresentou-se rica em aminocidos e glicose. Pode-se concluir que a pessoa alimentou-se de: a) lipdios e protenas. b) lipdios e amido. c) lipdios e carboidratos. d) protenas e carboidratos. e) protenas e cidos graxos. 162. UEL-PR Consideram-se aminocidos essenciais para um determinado animal aqueles: a) de que ele necessita e sintetiza a partir de outras substncias.
134

Sabendo-se que triptofano e fenilalanina so dois aminocidos essenciais, assinale a alternativa correta. a) O predador precisa comer o rato para ingerir dois aminocidos essenciais que, dentre outros, iro garantir a sntese de suas protenas. b) Se o predador no comer o rato, no ter protenas de alto teor calrico, pois os compostos citados so molculas altamente energticas. c) Ao comer o rato, o predador estar ingerindo dois compostos fundamentais para a sntese de fosfolipdios e, com isso, garantindo a estabilidade das membranas celulares. d) O predador no necessita dos compostos citados, pois ele j capaz de sintetizar aqueles aminocidos denominados naturais. e) Ao comer o rato, o predador estar ingerindo dois compostos fundamentais para a sntese dos carboidratos de reserva. 164. Udesc Assinale a alternativa que completa corretamente as armativas a seguir: As____so protenas especiais que______reaes qumicas que ocorrem no_____das clulas. Quando o organismo aquecido demasiadamente, elas so______. a) gorduras; catalisam; interior; desnaturadas b) molculas; aceleram; exterior; recriadas c) enzimas; retardam; exterior; derretidas d) gorduras; alteram; limite; destrudas e) enzimas; catalisam; interior; desnaturadas 165. Unitau-SP As _______ so compostos formados por _______ unidos (as) por ligaes _______ e as _______ so _______ orgnicos, de natureza _______ sensveis s variaes de temperatura. Os termos que corretamente preenchem as lacunas so, respectivamente: a) gorduras protenas peptdicas enzimas acares lipdica. b) protenas aminocidos energticas gorduras compostos protica.

c) protenas aminocidos peptdicas enzimas catalisadores protica. d) enzimas aminocidos hdricas protenas catalizadores lipdica. e) protenas acares proticas enzimas acares enzimtica. 166. Quanto s protenas, principais componentes estruturais das clulas animais, podemos armar corretamente que: a) duas protenas que, por hidrlise, produzem os mesmos aminocidos, nas mesmas propores, podem no ser iguais. b) desnaturao signica ligao entre aminocidos e uma sntese por desidratao. c) a estrutura terciria de uma protena determina sua forma, mas no interfere em sua funo, ou especicidade. d) alm da funo plstica, as protenas tambm tm importante funo de reserva energtica alm da defesa. e) o colgeno e a elastina so as duas protenas contrteis dos msculos que deslizam, provocando os movimentos. 167. Fuvest-SP Um camundongo foi alimentado com uma rao contendo protenas marcadas com um istopo radioativo. Depois de certo tempo, constatou-se a presena de hemoglobina radioativa no sangue do animal. Isso aconteceu porque as protenas do alimento foram: a) absorvidas pelas clulas sangneas. b) absorvidas pelo plasma sangneo. c) digeridas e os aminocidos marcados foram utilizados na sntese de carboidratos. d) digeridas e os aminocidos marcados foram utilizados na sntese de lipdios. e) digeridas e os aminocidos marcados foram utilizados na sntese de protenas. 168. Se voc comer carne bovina, isso ir ajudar na construo de suas prprias protenas, porque: a) sendo ambos mamferos, o homem e o boi possuem protenas idnticas; assim, as protenas do boi (da carne) passam para a circulao humana com facilidade. b) uma vez digeridas, as protenas do boi fornecem aminocidos com os quais seu organismo construir as protenas humanas. c) as protenas da carne bovina sero utilizadas, nas clulas do seu organismo, como fonte de energia para sntese de protenas humanas. d) a carne do boi possui vitaminas essenciais para o bom funcionamento do organismo humano. e) a carne bovina apresenta alto teor de enzimas, importantes para o bom funcionamento celular do nosso organismo.

169. Uma protena retirada de clula epitelial humana possui: 10 VAL, 32 ALA, 14 TRE, 27 HIS, 49 GLI, 24 LIS. De clulas sangneas do mesmo indivduo, foi extrada outra protena, cuja hidrlise demonstrou ser formada de: 10 VAL, 32 ALA, 14 TRE, 27 HIS, 49 GLI, 24 LIS. Em face de tais informaes, correto concluir que: a) trata-se da mesma protena, pois em ambos encontramos o mesmo nmero de aminocidos. b) trata-se da mesma protena, pois a quantidade de cada aminocido igual em ambas. c) trata-se da mesma protena, pois ambas tm os mesmos aminocidos. d) trata-se de protenas diferentes, pois foram obtidas de clulas estrutural, embrionria e funcionalmente diferentes. e) pode-se tratar de protenas iguais ou diferentes, pois s a anlise da disposio dos aminocidos poder revelar a identidade ou a diferena entre elas. 170. UERJ Um estudante recebeu um quebra-cabea que contm peas numeradas de 1 a 6, representando partes de molculas.

Para montar a estrutura de uma unidade fundamental de uma protena, ele dever juntar trs peas do jogo na seguinte seqncia. a) 1, 5 e 3 c) 4, 2 e 3 b) 1, 5 e 6 d) 4, 2 e 6 171. Esquematize a formao de uma ligao peptdica entre os dois aminocidos cujas frmulas esto mostradas abaixo:

PV2D-06-BIO-14

135

VELOCIDADE DE REAO (unidade arbitrria)

172. UFRN A toxina produzida pelo gene introduzido na mangueira, alm de matar o nematide, tambm causava efeitos txicos nos seres humanos. Aps uma investigao, descobriu-se que, na forma de doces e compotas, as mangas poderiam ser consumidas sem risco para a sade. O consumo de mangas na forma de doces e compotas torna-se seguro porque, durante o processo de cozimento para a produo ocorre com a toxina: a) cristalizao. b) evaporao. c) desnaturao. d) dissoluo. 173. UFAL De acordo com as proposies a seguir referentes qumica celular, assinale a alternativa incorreta. a) Os sais minerais podem ser encontrados como constituintes de estruturas dos seres vivos, como por exemplo, o fosfato de clcio, abundante nos ossos e dentes. Quando dissolvidos em gua esses sais se dissociam em ons, fundamentais para o metabolismo celular. b) Os principais polissacardeos encontrados nos animais so o amido e o glicognio. c) O colesterol um esteride que participa da composio qumica das membranas celulares das clulas animais. d) Os aminocidos possuem, em suas molculas, um grupamento amina (NH2) e um grupamento carboxila (COOH). Esses grupamentos esto ligados a um mesmo tomo de carbono que, por sua vez, est ligado a um tomo de hidrognio e a um radical que varia de aminocido para aminocido. 174. Considere as armativas abaixo: I. Uma seqncia linear de aminocidos, unidos por ligaes peptdicas, denominada estrutura primria de uma protena. Essa seqncia a que determina sua funo biolgica. II. A estrutura linear de uma protena sofre um dobramento sobre si mesma, atravs de pontes de dissulfeto, formando uma estrutura secundria. A estrutura terciria ou quaternria de uma protena responsvel por sua atividade biolgica. III. Uma alterao irreversvel de uma protena denominada desnaturao. Isso acarreta uma destruio de sua estrutura quaternria, terciria e secundria. Esto corretas: a) I d) II e III b) I e II e) I, II e III c) I e III 175. UFRJ A glicoquinase e a hexoquinase so duas enzimas que reagem com o mesmo substrato, a glicose. Ambas so enzimas intracelulares que fosforilam a glicose formando glicose 6-fosfato (G6P).
136

Dependendo da enzima produtora, a G6P pode ser degradada na via da gliclise para gerar energia ou ento ser usada para sntese de glicognio. A gliclise ocorre nos tecidos em geral e a sntese de glicognio ocorre principalmente no fgado. A sntese do glicognio somente acontece quando existe excesso de glicose no sangue. Essa uma forma de armazenar esse acar. Observe a gura a seguir, que apresenta as velocidades de reao dessas duas enzimas em funo da concentrao da glicose. Nveis normais de glicose no sangue esto ao redor de 4mM.
10 9 8 7 6 5 4 3 2 1 0
HEXOQUINASE GLICOQUINASE

2,5

10

15

CONCENTRAO DE GLICOSE (m M)

Qual das duas enzimas gera G6P para sntese de glicognio heptico? Justique sua resposta. 176. Cesgranrio-RJ Nos laboratrios qumicos, a maneira mais freqente de ativar uma reao fornecendo calor, que funciona como energia de ativao. Nos seres vivos, isso no possvel, pois corre-se o risco de as protenas serem desnaturadas. A estratgia desenvolvida pelos seres vivos para superar a barreira inicial das reaes foi a utilizao de: a) ATP. d) glicose. b) enzimas. e) clorola. c) hormnios. 177. Assinale a alternativa que melhor se ajusta ao conceito de enzimas. a) Reagem irreversivelmente com o substrato. b) So consumidas durante os processos enzimticos. c) So biocatalisadores de origem orgnica. d) Atuam independentemente do pH do meio. e) S atuam em temperatura em torno de 25 C. 178. Cesgranrio-RJ Cerca de 27 milhes de brasileiros tm intolerncia ao leite por decincia na produo de uma enzima do intestino.
Folha de So Paulo

Sobre a enzima citada no artigo, e as enzimas em geral, podemos armar que: a) aumentam a energia de ativao necessria para as reaes. b) atuam de forma inversamente proporcional ao aumento da temperatura.

c) so altamente especcas em funo de sua forma terciria. d) so estimuladas pela variao do grau de acidez do meio. e) so consumidas durante o processo, no podendo realizar nova reao do mesmo tipo. 179. Mackenzie-SP Considerando-se a denio de enzimas, assinale a alternativa correta. I. So catalisadores orgnicos, de natureza protica, sensveis s variaes de temperatura. II. So substncias qumicas, de natureza lipdica, sendo consumidas durante o processo qumico. III. Apresentam uma regio chamada stio ativo, qual se adapta a molcula do substrato. a) Apenas a armativa I correta. b) Apenas as armativas II e III so corretas. c) Apenas as armativas I e III so corretas. d) Todas as armativas so corretas. e) Nenhuma armativa correta. 180. Nos exemplos de enzimas abaixo, todos so corretos, exceto: a) Pepsina. d) Amilase. b) Galactose. e) Maltase. c) Catalase. 181. UFRN

184. O esquema abaixo representa um processo de:


Temperatura

Enzima ativa

Enzima inativa

a) consumo da enzima durante a reao qumica. b) interferncia do pH do meio. c) desnaturao causada por elevao da temperatura. d) inativao da enzima por compostos qumicos. e) desnaturao causada por choques mecnicos. 185. Unifenas-MG O grco abaixo mostra a correlao entre a atividade enzimtica e a temperatura. O que indica o ponto assinalado pela seta? O que acontece com a enzima a partir desse ponto?

186. UFV-MG Assinale a opo que representa a velocidade das reaes enzimticas em relao temperatura: Para digerir o alimento normalmente obtido na boca do jacar, a ave necessitar principalmente de: a) endonucleases. c) peptidases. b) glicosidases. d) lipases. 182.
Indique o nome das enzimas que catalisam as seguintes reaes qumicas: a) Sacarose glicose+frutose b) Amido maltose c) Lipdios cido graxo+glicerol

183. Mackenzie-SP Para inibir a ao de uma enzima, pode-se fornecer clula uma substncia que ocupe o stio ativo dessa enzima. Para isso, essa substncia deve: a) estar na mesma concentrao da enzima. b) ter a mesma estrutura espacial do substrato da enzima. c) recobrir toda a molcula da enzima. d) ter a mesma funo biolgica do substrato da enzima. e) promover a desnaturao dessa enzima.

PV2D-06-BIO-14

187. UEM-PR Assinale o que for correto. a) O amido formado pela unio de milhares de molculas de frutose. b) A decomposio da gua oxigenada em gua e oxignio em um ferimento devida presena da enzima papana. c) A celulose armazenada no fgado e nos msculos representa uma forma de os animais armazenarem energia.
137

d) Os aminocidos que um organismo consegue produzir so denominados de aminocidos essenciais. e) A temperatura um dos fatores que pode afetar a atividade das enzimas. 188. Os organismos vivos possuem a capacidade de sintetizar milhares de molculas de diferentes tipos em precisas propores, a m de manterem o protoplasma funcional. Estas reaes de sntese e degradao de biomolculas, que compem o metabolismo celular, so catalisadas por um grupo de molculas denominadas enzimas. Estes importantes catalisadores biolgicos podem possuir algumas das seguintes caractersticas: I. Enzimas so a maior e mais especializada classe de lipdios. II. Enzimas possuem grande especicidade para seus substratos e freqentemente no atuam sobre molculas com pequena diferena em sua congurao. III. Enzimas aceleram as reaes qumicas, sem serem modicadas durante o processo. IV. Substratos so substncias sobre as quais as enzimas agem, convertendo-os em um ou mais produtos. Marque a alternativa correta. a) Esto corretas apenas as caractersticas I, II e III. b) Esto corretas apenas as caractersticas II, III e IV. c) Esto corretas apenas as caractersticas I, III e IV. d) Todas as caractersticas esto corretas. e) Todas as caractersticas esto incorretas. 189. Cesgranrio-RJ (modificado) Cear joga fora opo alimentar Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabea de lagosta no so aproveitadas sendo lanadas ao mar. O estudo sobre hidrlise enzimtica de desperdcio de lagosta, ttulo do pesquisador Gustavo Vieira, objetiva o uso de material de baixo custo para enriquecer a alimentao de populaes carentes. O processo consiste na degradao de molculas orgnicas complexas em simples por meio de um catalisador e na posterior liolizao. O p resultante de alto teor nutritivo, com baixa umidade e resiste, em bom estado de conservao, por longos perodos.
Jornal do Brasil

d) A hidrlise enzimtica de molculas orgnicas complexas realizada sempre por catalisador inorgnico em presena de gua. e) O alto teor nutritivo do produto devido ao fato de as molculas orgnicas simples obtidas serem sais minerais indispensveis ao desenvolvimento orgnico. 190. UFU-MG

O grco anterior ilustra uma reao enzimtica, onde a quantidade de enzimas mantida xa e a velocidade da reao depende da varivel x. Da anlise do grco e dos seus conhecimentos sobre enzimas, voc pode concluir que a varivel x refere-se: a) concentrao do substrato, e que, portanto, a velocidade de uma reao enzimtica aumenta com o aumento da concentrao do substrato at certo ponto, permanecendo constante a partir da. b) temperatura e que, portanto, quanto maior a temperatura, maior a velocidade da reao enzimtica. c) ao pH do meio e que, portanto, depois da enzima atingir seu pH timo de atuao, um aumento de pH no altera a velocidade de reao. d) concentrao de substrato e que, portanto, quanto menos substrato, mais rpida a reao enzimtica. e) ao pH ou temperatura, pois as enzimas possuem um pH e uma temperatura tima, onde sua atuao enzimtica a mxima. 191. UFES Se aquecermos uma enzima a 70 C durante uma hora e tentarmos utiliz-la para catalisar uma reao, o resultado ser: a) melhor porque o aumento de temperatura entre 50 e 70 C favorece as reaes enzimticas. b) inalterado porque as enzimas so muito estveis. c) nulo porque as enzimas s exercem a sua ao cataltica nos organismos vivos. d) nulo porque as enzimas so protenas e se desnaturam quando aquecidas a essa temperatura. e) nulo porque as enzimas s exercem ao cataltica na temperatura tima para a sua ao.

Com base nos processo descritos no artigo anterior, assinale a opo correta. a) As molculas orgnicas simples obtidas so glicerdeos que so utilizados pelo organismo com funo reguladora. b) As molculas orgnicas complexas empregadas so protenas que, ao serem digeridas em aminocidos, so utilizadas pelo organismo com funo estrutural. c) O catalisador do processo uma enzima capaz de degradar protenas em monossacardios essenciais liberao de energia para as atividades orgnicas.
138

192. UFPE As enzimas so protenas altamente especializadas que catalisam as mais diversas reaes qumicas. Em relao atividade dessas molculas, julgue (V ou F) os itens: ( ) quando a temperatura e a concentrao da enzima so constantes, e aumenta-se gradativamente a concentrao do substrato, observa-se um aumento da velocidade da reao at o mximo, independente do pH. ( ) um aumento da concentrao do substrato causa uma diminuio da velocidade da reao pois o substrato passa a inibir a ao da enzima. ( ) o aumento da temperatura provoca um aumento na velocidade da reao enzimtica at uma temperatura crtica, quando ocorre uma queda na atividade da enzima em conseqncia de sua desnaturao. ( ) a velocidade de uma determinada reao enzimtica est associada ao pH, sendo que cada enzima tem um pH timo de atuao. 193. Unifesp No tubo 1 existe uma soluo contendo clulas de fgado de boi. Em 2, h uma soluo de clulas extradas de folhas de bananeira.

c) a substncia N compete com Y para se ligar a Z. d) a substncia N molecularmente semelhante a X e por isso compete com este X para ligar-se a Y. e) a substncia N molecularmente semelhante a Y e por isso inibe a ao de X. 195. UFRN Uma prtica corriqueira na preparao de comida colocar um pouco de leite de mamo ou suco de abacaxi para amaciar a carne. Hoje em dia, os supermercados j vendem um amaciante de carne industrializado. a) Explique o amaciamento da carne promovido pelo componente presente no mamo, no abacaxi ou no amaciante industrializado e compare esse processo com a digesto. b) Se o amaciante, natural ou industrializado, for adicionado durante o cozimento, qual ser o efeito sobre a carne? Por qu? 196. UnB-DF Em diversas circunstncias, ocorre produo de gua oxigenada (H2O2) em nosso organismo. Na presena de ons Fe2+, a gua oxigenada d origem a um radical livre que ocasiona mutaes no DNA. Nesse processo, a enzima catalase importante, pois catalisa a produo de H2O e O2 a partir de H2O2. Para a vericao desse fato, realizou-se um experimento constitudo de vrios testes, nos quais, em tubos de ensaio contendo H2O2, acrescentaram-se diferentes materiais, conforme especicado na tabela adiante medindo-se a quantidade de O2 liberada. N. do teste I II III IV V VI Material acrescentado soluo de catalase 1 g de fgado bovino triturado 2 g de fgado bovino triturado 3 g de fgado bovino triturado um pedao de fgado bovino cozido Quantidade de O2 liberada (+) +++ ++ +++++ +++++

Voc deseja eliminar completamente todos os constituintes dos envoltrios celulares presentes em ambos os tubos. Para isso, dispe de trs enzimas digestivas diferentes: C: digere carboidratos em geral. L: digere lipdios. P: digere protenas. Para atingir seu objetivo gastando o menor nmero possvel de enzimas, voc deve adicionar a 1 e 2, respectivamente: a) 1 = C; 2 = P. b) 1 = L; 2 =C. c) 1 = C e P; 2 = C e L. d) 1 = C e P; 2 = C, L e P. e) 1 = L e P; 2 = C, L e P. 194. Uespi Dada a seguinte reao:
catalase H2O2 H2O + 1 2 O2 X Z M Y

PV2D-06-BIO-14

Hipoteticamente, se voc arranjasse uma substncia N, enzimaticamente competitiva com o substrato da reao acima, e a colocasse no meio, voc poderia armar que: a) a substncia N, sendo molecularmente semelhante a Z, inibe a ao de Y. b) a substncia N molecularmente semelhante a Y e por isso inibe a ao de Z.

Com base no experimento apresentado, julgue os seguintes itens. 0. O experimento evidencia a existncia da catalase do fgado. 1. Os testes mostraram que a liberao de O2 diretamente proporcional concentrao de enzima. 2. No teste VI, no ocorre liberao de O2 porque o calor desnatura e, conseqentemente, inativa as enzimas. 3. Os testes de III e VI podem ser considerados como sendo os testes realizados para o controle do experimento. 4. A liberao de O2 cessa aps um curto perodo de tempo por ocorrer consumo de enzima durante a reao.
139

197. Analise a seguinte experincia: Primeira etapa Procedimento: Em dois tubos de ensaio, numerados como I e II, acrescenta-se: Tubo I: gua oxigenada + dixido de mangans Tubo II: gua oxigenada + fgado Concluso: desprendimento de gs oxignio proveniente da decomposio da gua oxigenada devido ao dixido de mangans (Tubo I) e alguma substncia liberada pelo fgado (Tubo II). Segunda etapa Procedimento: adio de nova quantidade de gua oxigenada nos dois tubos da primeira etapa desta experincia. Resultado obtido: novo desprendimento de borbulhas (gs oxignio) nos dois tubos. Concluso: O dixido de mangans (Tubo I) e a substncia liberada pelo fgado (Tubo II) no foram consumidas nas reaes da primeira etapa experincia. Com base nessa experincia podemos concluir que o dixido de mangans e a substncia liberada pelo fgado so: a) enzimas. b) catalisadores. c) ionizadores. d) substncias orgnicas. e) substncias inorgnicas. 198. UFMG Observe a experincia, usando tubos de ensaio nos quais foram adicionados 5 ml de H2O2, acrescidos de:

v = velocidade de formao do produto C em mg/hora Baseado nos grcos, responda: a) Em que grupo de substncias pode ser classicado o polipeptdio E? b) D duas justicativas para sua classicao. 200. UEM-PR A gura a seguir mostra as velocidades de reao de duas enzimas: enzima humana (A) e de bactrias de fontes termais (B):

Sabendo-se que o fgado rico em catalase, que decompe a H2O2 em H2O e O2, o que deve ocorrer nos 5 tubos? 199. Os dois grcos a seguir referem-se velocidade da reao: A+BC+D que ocorre em animais de uma mesma espcie, quando suas temperaturas variam. O grco nmero 1 representa a reao em um indivduo que, alm dos reagentes A e B, possui o polipeptdio E, que no ocorre no indivduo do grco nmero 2.
140

Considerando os dados da gura e a ao da temperatura na atividade enzimtica, d como resposta a soma dos itens corretos. 01. A temperatura um fator importante para a atividade enzimtica. 02. Dentro de certos limites, a velocidade de uma reao enzimtica aumenta com o aumento da temperatura. 04. A partir de determinado ponto, o aumento de temperatura faz com que a velocidade de reao diminua bruscamente e cesse.

08. A temperatura tima para a atividade da enzima humana est em torno de 37C. 16. A temperatura tima para a atividade de enzimas de bactrias de fontes termais est em torno de 78C.

32. Para qualquer enzima, o aquecimento acima da temperatura tima provoca a desnaturao. 64. Para ambas as enzimas, se for ultrapassado a temperatura tima, a estrutura espacial da enzima se modica.

Captulo 3
201. UFSCar-SP O segmento de DNA humano que contm informao para a sntese da enzima pepsina um: a) caritipo. d) genoma. b) cromossomo. e) gene. c) cdon. 202. Fuvest-SP O anncio do seqenciamento do genoma humano, em 21 de junho de 2000, signica que os cientistas determinaram: a) a seqncia de nucleotdeos dos cromossomos humanos. b) todos os tipos de protena codicados pelo genes humanos. c) a seqncia de aminocidos de DNA humano. d) a seqncia de aminocidos de todas as protenas humanas. e) o nmero correto de cromossomos da espcie humana. 203. Considerando o modelo da estrutura molecular do DNA como representado na gura adiante, responda o que representam os componentes 1, 2, 3 e 4 respectivamente. b) O DNA faz parte da constituio dos cromossomos. c) A molcula de DNA possui a forma de uma dupla hlice. d) O DNA constitudo das bases nitrogenadas, adenina, timina, citosina, guanina. e) O DNA se constitui de 4 bases nitrogenadas, desoxirribose e cido fosfrico. 206. No modelo molecular do cido ribonuclico (RNA) representado adiante, os nmeros 1, 2 e 3 indicam, respectivamente:
3

Modelo proposto por J. Watson e F. Crick

a) b) c) d) e)

desoxirribose, cido fosfrico e base nitrogenada. cido fosfrico, desoxirribose e base nitrogenada. ribose, cido fosfrico e base nitrogenada. cido fosfrico, ribose e base nitrogenada. cido fosfrico, base nitrogenada e desoxirribose.

Modelo proposto por J. Watson e F. Crick

204. PUC-RS A seqncia de nucleotdeos ATGCACCT forma um segmento de DNA dupla hlice ao se ligar ta complementar: a) AUGCACCU d) TCCACGTA b) UACGUGGA e) ATGCACCT c) TACGTGGA
PV2D-06-BIO-14

207. Mackenzie-SP Considere as armaes abaixo a respeito dos cidos nuclicos. I. Nucleotdeos so unidades que os constituem. II. O RNA formado por uma seqncia simples de nucleotdeos. III. S o RNA apresenta uracila na sua formao. Ento: a) todas so verdadeiras. b) somente I e II so verdadeiras. c) somente I e III so verdadeiras. d) somente II e III so verdadeiras. e) apenas uma das armaes verdadeira. 208. Por que as mitocndrias e os cloroplastos apresentam vida relativamente independente dentro das clulas eucariticas? 209. PUCCamp-SP Clulas vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram xadas e submetidas auto-radiograa, para comprovar os
141

205. Em relao ao DNA, a alternativa incorreta : a) As molculas de DNA apresentam sempre a mesma ordem de nucleotdeos, diferindo apenas uma das outras pelo nmero deles.

locais que possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa somente nos: a) nuclolos. b) ribossomos. c) nuclolos e nas mitocndrias. d) ribossomos e nos cloroplastos. e) ribossomos, nos cloroplastos e nas mitocndrias. 210. UFSM-RS Numere a 2 coluna de acordo com a 1. Coluna 1 1. DNA 2. RNA Coluna 2 ( ) Dupla hlice ( ) Ribose ( ) Fita nica ou simples ( ) Desoxirribose ( ) Bases nitrogenadas: adenina, guanina, citosina, timina ( ) Bases nitrogenadas: adenina, guanina, citosina, uracila A seqncia correta : a) 1 2 1 2 2 1. b) 2 1 1 2 2 2. c) 1 2 2 1 1 2. d) 2 1 2 1 1 2. e) 1 1 2 2 2 1. 211. ENEM Um fabricante afirma que um produto disponvel comercialmente possui DNA vegetal, elemento que proporcionaria melhor hidratao dos cabelos. Sobre as caractersticas qumicas dessa molcula essencial vida, correto armar que o DNA

a) b) c) d)

apenas aminocidos fosfato, glicdio e bases nitrogenadas. glicdio, bases nitrogenadas e aminocidos. RNA transportador, RNA mensageiro e RNA ribossmico. e) tomos livres de carbono, nitrognio, oxignio, hidrognio e fsforo. 213. UFMS Considere as armaes abaixo. I. A unio da base nitrogenada com o acar forma um composto denominado nucleotdeo. II. Os dois lamentos que compem a molcula de DNA no so iguais e sim complementares. III. medida que o DNA se duplica, os cromossomos tambm se duplicam. IV. A duplicao do DNA a base da reproduo e da hereditariedade, pois a partir das divises celulares que se formam novos organismos. V. Os nucleotdeos so reconhecidos pela base nitrogenada que contm. Com relao estrutura do cido desoxirribonuclico (DNA), est(o) correta(s) a(s) alternativa(s): 01. I e II. 02. I, II e III. 04. I, IV e V. 08. I, III e IV. 16. II, III e V. 32. IV e V. 214. Se os nucleotdeos do lamento I, do esquema a seguir, tm uma base prica e os do lamento II tanto podem ser encontrados no RNA como no DNA, podemos armar que as bases nitrogenadas do lamento II podem ser:

II

a) de qualquer espcie serviria, j que tem a mesma composio. b) de origem vegetal diferente quimicamente dos demais pois possui clorola. c) das bactrias poderia causar mutaes no couro cabeludo. d) dos animais encontra-se sempre enovelado e de difcil absoro. e) de caractersticas bsicas assegura sua ecincia hidratante. 212. UFSCar-SP Em nosso intestino delgado, as molculas de DNA (cido desoxirribonuclico) presentes no alimento so digeridas e originam:
142

a) citosina e citosina. b) guanina e guanina. c) duas timinas ou duas citosinas. d) duas adeninas ou duas guaninas. e) impossvel determinar. 215. Os cidos nuclicos podem se diferenciar conforme a base nitrogenada e o acar que os compem. Na tabela abaixo esto representados os cidos nuclicos I e II.

I Tipo de acar Tipo de base nitrogenada desoxirribose adenina timina citosina guanina

II ribose adenina uracila citosina guanina

Assinale a alternativa correta: a) O DNA est representado em I e II b) O RNA est representado em I c) O DNA e o RNA podem ser representados tanto em I quanto em II d) O RNA est representado em II e) O DNA est representado em II 216. UFMS Os cidos nuclicos so as molculas mestras da vida. Elas so responsveis pela sntese de todas as enzimas que controlam, de alguma forma, a atividade celular. Relacione os cidos nuclicos com suas caractersticas. I. DNA II. RNA A. acar da molcula = desoxirribose B. acar da molcula = ribose C. presena de timina D. presena de uracila E. cadeia dupla F. cadeia simples G. capacidade de autoduplicao Est(o) correta(s) a(s) associao(es): 01. I A 16. I F 02. II B 32. II E 04. II G 64. II D 08. I C 217. Fuvest-SP A hiptese de que os cloroplastos e as mitocndrias tenham surgido atravs de uma associao simbitica de um eucarioto primitivo com, respectivamente, bactrias fotossintetizantes e bactrias aerbicas reforada pelo fato de aquelas organelas celulares: a) serem estruturas equivalentes, com grande superfcie interna. b) apresentarem DNA prprio. c) estarem envolvidas, respectivamente, na produo e consumo de oxignio. d) apresentarem tilacides e cristas como as bactrias. e) serem encontradas tanto em organismos superiores como inferiores. 218. Fuvest-SP Quando uma preparao de clulas de pncreas tratada com um corante bsico, certas estruturas do citoplasma cam fortemente coradas. Entretanto, quando se faz um tratamento prvio da preparao com a enzima ribonuclease, a colorao no ocorre. a) Qual a estrutura evidenciada pelo corante bsico? b) Por que o tratamento enzimtico impede a colorao?

219. Fuvest-SP Os bacterifagos so constitudos por uma molcula de DNA envolta em uma cpsula de protena. Existem diversas espcies, que diferem entre si quanto ao DNA e s protenas constituintes da cpsula. Os cientistas conseguem construir partculas virais ativas com DNA de uma espcie e cpsula de outra. Em um experimento, foi produzido um vrus contendo DNA do bacterifago T2 e cpsula do bacterifago T4. Pode-se prever que a descendncia desse vrus ter: a) cpsula de T4 e DNA de T2. b) cpsula de T2 e DNA de T4. c) cpsula e DNA, ambos de T2. d) cpsula e DNA, ambos de T4. e) mistura de cpsulas e DNA de T2 e de T4. 220. PUCCamp-SP O corante I especco para DNA e o corante II, para RNA. Um pesquisador usou esses dois corantes em clulas xadas e observou sua ao sobre algumas organelas citoplasmticas. Assinale, no quadro a seguir, a alternativa que representa os possveis resultados obtidos por esse pesquisador (o sinal + signica reao positiva e o sinal , negativa).

221. Numa molcula de DNA formada por uma dupla-hlice, a quantidade de: a) adenina igual de citosina. b) citosina igual de timina. c) adenina igual de uracila. d) citosina igual de adenina. e) guanina igual de citosina. 222. Molculas de DNA constitudas por duplo lamento helicoidal mantm as cadeias unidas entre si por: a) ligaes covalentes. b) ligaes inicas. c) pontes de hidrognio. d) pontes de nitrognio. e) ligao metlica. 223. PUC-SP A gura a seguir representa parte da estrutura molecular do cido desoxirribonuclico (DNA). Assinale a frase correta.
143

PV2D-06-BIO-14

a) A pentose pode ser ribose ou desoxirribose. b) As bases pirimdicas so idnticas s do cido ribonuclico (RNA). c) As bases pricas so a citosina e a timina. d) Os locais assinalados com os nmeros 1, 2, 3 e 4 podem ser substitudos por T, C, A e G, respectivamente. e) Os locais assinalados com os nmeros 1, 2, 3 e 4 podem ser substitudos por G, A, C e T, respectivamente. 224. Vunesp-SP A anlise qumica em amostras de cinco lminas com cidos nuclicos apresentou os seguintes resultados: 1 lmina: ribose; 2 lmina: uracila; 3 lmina: dupla hlice; 4 lmina: timina; 5 lmina: 15% de guanina e 25% de citosina. a) Entre estas lminas, quais se referem a DNA? b) Justique o resultado obtido com a 5 lmina. 225. Fatec-SP As tcnicas utilizadas pela Engenharia Gentica permitem que se atue em uma substncia presente em todas as clulas, procariontes e eucariontes, sendo responsvel pelo controle do seu metabolismo. Essa substncia se denomina: a) DNA, e formada por cadeias polipeptdicas que apresentam em sua composio os aminocidos adenina, uracila, citosina e guanina. b) DNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, citosina, guanina e timina. c) RNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, timina, citosina e guanina. d) polimerase, e formada por aminocidos que apresentam em sua composio a desoxirribose. e) transcriptase, e formada por aminocidos que apresentam em sua composio a ribose. 226. FGV-SP Considerando-se o total de bases nitrogenadas do DNA de uma espcie qualquer igual a 100, se nela existirem 15% de timina, qual ser a porcentagem das demais bases nitrogenadas?
144

227. PUC-RS Qual das alternativas abaixo apresenta a informao que nos permite armar que a replicao do DNA semiconservativa? a) Durante a diviso da molcula original somente uma das tas copiada; a outra permanece inativa. b) No incio do processo replicativo, forma-se um total de seis tas de DNA. c) As duas tas de DNA parental so copiadas, originando molculas-lhas com somente uma das tas. d) As enzimas que participam dos processos de replicao so somente de origem materna. e) No m da replicao, cada uma das molculas resultantes apresenta a metade do nmero de pontes de hidrognio. 228. UEL-PR Com relao composio qumica, as molculas de DNA e RNA diferem entre si quanto ao tipo de : a) acar, apenas. b) base nitrogenada, apenas c) base nitrogenada e de acar, apenas. d) base nitrogenada e de fosfato, apenas. e) base nitrogenada, de acar e de fosfato. 229. O segmento de molcula de RNA que se formar, tendo por molde um segmento de cadeia de DNA semelhante ao apresentado no esquema a seguir:

ter em I, II e III, respectivamente: a) ribose, guanina e uracila. b) ribose, adenina e citosina. c) ribose, uracila e citosina. d) desoxirribose, guanina e timina. e) desoxirribose, uracila e citosina. 230. UFRGS-RS Cinco amostras com cidos nuclicos foram analisadas quimicamente e apresentaram os seguintes resultados: I. 1 amostra: ribose; II. 2 amostra: timina; III. 3 amostra: dupla-hlice; IV. 4 amostra: uracila; V. 5 amostra: 20% de guanina e 30% de citosina.

Entre essas amostras, quais se referem a DNA? a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas II e IV. e) Apenas II e V.

231. UFPE Nos ltimos anos, a biologia molecular tem fornecido ferramentas teis para a produo de plantas e animais transgnicos. As informaes armazenadas nas molculas de DNA so traduzidas em protenas por meio de molculas intermedirias denominadas: a) proteases. d) tRNA. b) plasmdios. e) mRNA. c) rRNA. 232. Que papis desempenham o RNA mensageiro e o RNA transportador no processo de sntese das protenas? 233. UEL-PR A seguir est representado o lamento I de uma molcula de cido nuclico presente no interior do ncleo de uma clula vegetal. Qual seria a seqncia correta encontrada na molcula de RNA mensageiro, transcrita a partir do lamento II?

medicina forense, entre outros). Assinale a armao correta. a) A molcula de DNA constituda por uma ta nica e por vrios nucleotdeos que tm a transcrio como principal funo. b) A molcula de DNA nas bactrias se encontra na carioteca da clula. c) A molcula de DNA no capaz de produzir a molcula de RNA. d) A molcula de DNA tem funo de duplicao e constituda por uma ta dupla, sendo que cada lamento composto por vrios nucleotdeos. e) A molcula de DNA, nos organismos eucariontes, no se encontra no ncleo da clula. 236. Unisanta (modificado) Na hidrlise de cidos nuclicos, as bases pricas produzidas pelo DNA so: a) citosina e guanina. d) adenina e timina. b) adenina e guanina. e) citosina e uracila. c) citosina e timina. 237. Unioeste-PR (modificado) A dupla hlice como modelo de estrutura tri-dimensional do DNA foi proposta por Watson e Crick em 1953. Relativo a esta estrutura, correto armar: 01. que os dois lamentos de DNA esto unidos um ao outro por ligaes fosfodister. 02. que a quantidade de bases pricas igual quantidade de bases pirimdicas. 04. que a seqncia de nucleotdeos de um lamento sempre idntica seqncia de nucleotdeos do lamento complementar. 08. que, em uma dupla ta de DNA com 200 pares de nucleotdeos, encontram-se 400 desoxirriboses, 400 grupos fosfatos, 200 bases pricas e 200 bases pirimdicas. 16. que citosina e timina so bases pirimdicas; guanina e adenina so bases pricas. 238. Vunesp-SP A gura representa um segmento de uma molcula de cido nuclico.

a) b) c) d) e)

GAAGCUA GUUGCAU GUUGCUA CUUCCGA CAACCCA

234. Considere a seqncia de bases nitrogenadas de um segmento de DNA: AAA GGC ATT a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 235. FGV-SP Depois da descoberta da estrutura da molcula do cido desoxirribonuclico (DNA ou ADN), novos mtodos de diagnstico foram desenvolvidos e utilizados para inmeros ns (identicao de microrganismos patognicos, testes de paternidade, mapa gentico,
145

PV2D-06-BIO-14

As setas de 1 a 4 indicam, respectivamente: a) guanina, adenina, uracila e ribose. b) guanina, citosina, uracila e ribose. c) guanina, adenina, timina e desoxirribose. d) adenina, timina, guanina e desoxirribose. e) citosina, guanina, timina e desoxirribose. 239. Unirio-RJ A gura a seguir mostra um trecho da estrutura do cido desoxirribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na gura, A, C, G e T representam as bases adenina, citosina, guanina e timina, respectivamente.

241. Fuvest-SP No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Quais as porcentagens das outras bases desse DNA? Justique sua resposta. 242. Uespi Em um experimento, foi observado que, no DNA de um determinado organismo, o contedo de citosina era de 30%. Assinale na tabela abaixo a alternativa que indica corretamente os percentuais de guanina, adenina e timina. Guanina Adenina Timina

a) b) c) d) e)
243. UERJ

15% 20% 30% 10% 35%

35% 25% 20% 10% 25%

35% 25% 20% 10% 10%

As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justique a sua resposta. 1. ACTTTAAAGATATTTACTTAAA TGAAATTTCTATAAATGAATTT 2. GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 240. Vunesp A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases: Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode armar a respeito das semelhanas entre estas duas molculas de DNA? b) Justique sua resposta.
146

Clulas imortais contam aos cientistas histrias da evoluo da humanidade. Estas clulas formam um livro, conservado em tanques de nitrognio lquido, que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas.
Adaptado de O Globo

a) Explique por que o processo de autoduplicao do DNA d signicado hereditariedade, permitindo revelar a histria da evoluo da humanidade. b) ... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas podem ser estudados atravs de observaes de caractersticas morfolgicas e siolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e siolgicas da clula. 244. PUC-SP No interior de um blastmero, molculas de DNA polimerase produzidas no retculo endoplasmtico rugoso migraram para o ncleo, onde tiveram papel importante na duplicao dos cromossomos, o que levou a clula a se dividir. O trecho acima faz referncia aos processos de sntese de: a) protenas, sntese de DNA e mitose em uma clula embrionria. b) protenas, sntese de DNA e mitose em uma clula somtica. c) protenas, sntese de DNA e meiose em uma clula germinativa. d) lipdios, sntese de RNA e mitose em uma clula embrionria. e) lipdios, sntese de RNA e meiose em uma clula germinativa.

245. Unisanta Na hidrlise de cidos nuclicos, as bases pirimdicas produzidas pelo RNA so: a) citocina e guanina. b) adenina e uracila. c) citosina e timina. d) adenina e timina. e) citosina e uracila. 246. PUCCamp-SP Os itens a seguir referem-se estrutura, composio e funo dos cidos nuclicos. Estrutura: I. dupla-hlice II. cadeia simples Composio: 1. presena de uracila 2. presena de timina Funo: a. sntese de protenas b. transcrio gnica So caractersticas do cido ribonuclico: a) I - 1 - a b) I - 2 - b c) II - 1 - a d) II - 1 - b e) II - 2 - b 247. Mackenzie-SP

249. Fuvest-SP Um pesquisador que pretende estudar comparativamente a sntese de DNA e RNA em uma clula deve usar nucleotdeos radioativos contendo: a) timina e uracila. d) adenina e timina. b) guanina e timina. e) citosina e uracila. c) citosina e guanina. 250. Duas clulas A e B foram colocadas, respectivamente, em dois meios de cultura. Meio 1: contendo timina com istopos radioativos. Meio 2: contendo uracila com istopos radioativos. Atravs de sensores, observou-se que, na clula A, a radiao foi detectada no citoplasma, e, aps algum tempo, no ncleo, no sendo mais detectada no citoplasma. Na clula B, a radiao foi percebida no citoplasma, passou ao ncleo e, posteriormente, novamente foi detectada no citoplasma. Com bases em conhecimentos sobre bioqumica e siologia celular, como se pode explicar tais observaes? 251. UFMG Um laboratrio recebeu trs amostras de DNA para investigar se pertenciam a espcies diferentes. A quantidade e a relao entre as bases das amostras esto apresentadas nesta tabela: Amostras 1 2 3 Bases nitrogenadas A 30,9 25,0 47,3 G 19,9 24,0 2,7 C 19,8 33,0 2,7 T 29,4 18,0 47,3 Relaes molares A/T 1,05 1,39 1,00 G/C 1,01 0,73 1,00

Considerando o esquema acima, que representa um fragmento de cido nuclico, cuja funo transportar aminocidos, assinale a alternativa incorreta. a) A substncia representada em I obrigatoriamente ribose. b) Cada trinca de bases, representada em II, denominada anticdon. c) Esse cido nuclico produzido no ncleo e se dirige ao citoplasma, unindo-se aos aminocidos. d) II pode apresentar molculas de adenina. e) Se a ao desse cido for bloqueada, o processo de transcrio no ocorrer. 248. UEM-PR Muitas protenas so produzidas e eliminadas pelas clulas. Esses dois processos so conhecidos, respectivamente, por sntese de protenas e secreo celular e dependem de vrios componentes celulares: gene (DNA), RNA mensageiro (RNAm), RNA transportador (RNAt), ribossomos e retculo endoplasmtico granuloso (REG). Cite o papel de cada um dos componentes nesse processos.

Com base nas informaes dessa tabela e em outros conhecimentos sobre o assunto, incorreto armar que: a) as trs amostras so provenientes de diferentes espcies. b) a amostra 3 possui o mais alto contedo de pares de bases A e T. c) a amostra 2 apresenta DNA de ta simples. d) as amostras 1 e 3 apresentam alta homologia entre os seus DNAs. 252. Fuvest-SP Bactrias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de geraes. Dessa cultura, foram isoladas 100 bactrias e transferidas para um meio sem substncias radioativas. Essas bactrias sofreram trs divises no novo meio, produzindo 800 bactrias. A anlise dos cidos nuclicos mostrou que dessas 800 bactrias: a) 100 apresentavam o DNA marcado, mas no o RNA. b) 200 apresentavam o DNA marcado, mas no o RNA. c) 400 apresentavam o DNA marcado, mas no o RNA. d) 200 apresentavam o DNA e o RNA marcados. e) todas apresentavam o DNA e o RNA marcados.
147

PV2D-06-BIO-14

253. UFC-CE Tendo em vista a estrutura e a funo dos cidos nuclicos, correto armar que: a) todas as trincas da molcula do mRNA especicam algum aminocido. b) as molculas do cido ribonuclico (RNA) so hlices duplas de polirribonucleotdeos. c) em todos os organismos, s existe um gene para cada molcula de DNA. d) as estruturas espaciais e moleculares do DNA e RNA so diferentes. e) as duas metades de hlice dupla do DNA tm sequncias iguais de bases nitrogenadas. 254. Fuvest-SP Um gene de bactria com 600 pares de bases nitrogenadas produzir uma cadeia polipeptdica com nmero de aminocidos aproximadamente igual a: a) 200 d) 1.200 b) 300 e) 1.800 c) 600 255. PUC-SP Duas espcies (A e B) apresentam a seguinte diferena na poro terminal de uma dada protena, envolvendo trs aminocidos:

258. Cesgranrio-RJ Sobre o cdigo gentico so feitas as seguintes armaes: I. pode existir mais de um cdon para determinar um mesmo aminocido; II. em todos os seres vivos os cdons que codicam um respectivo aminocido so os mesmos; III. a traduo da seqncia de bases do RNA para a protena feita, a nvel citoplasmtico, nos ribossomos. Est(o) correta(s) armativa(s): a) II apenas. d) I,II e III. b) III apenas. e) I e III apenas. c) I e II apenas. 259. UFU-MG O aminocido leucina pode ser codicado por mais de uma trinca de nucleotdeos do DNA (AAT, GAA e outras). Assim sendo, podemos dizer que: I. o cdigo gentico degenerado, o que signica que um aminocido pode ser codicado por mais de uma trinca. II. um aminocido pode ser codicado por apenas uma trinca de nucleotdeos de DNA. III. assim como a leucina pode ser codicada por diferentes trincas, uma determinada trinca tambm pode codicar diferentes aminocidos. Esto corretas as armativas: a) apenas III. d) I e III. b) apenas II. e) nenhuma delas. c) apenas I. 260. UEL-PR Considere os seguintes cdons do RNA mensageiro e os aminocidos por eles especicados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamante os anticdons do RNAt e os cdons do DNA relacionados com esses aminocidos. RNAt Treonina a) b) c) d) e) TGT UGU UGU TGT ACA Valina CTT CUU CAA CTT CAA UGU UGU TGT TGT TGT DNA Treonina Valina CAA CUU CAA CAA GUU

Analisando o RNA mensageiro codicador dessa protena, pode-se supor que a espcie A se diferencie da B em relao a: a) 2 cdons. b) 3 cdons. c) 9 cdons. d) 3 bases nitrogenadas. e) 9 bases nitrogenadas. 256. UFRJ O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codica uma protena constituda por P aminocidos. Por que sempre encontramos N > P? 257. UEL-PR Uma protena formada por 20 aminocidos codicada por uma molcula de RNA de, no mnimo, nucleotdeos. Para completar corretamente a frase, os espaos I e II devem ser preenchidos, respectivamente, por: a) mensageiro e 20. d) mensageiro e 60. b) transportador e 30. e) transportador e 60. c) ribossmico e 30.
148

261. Unicamp-SP Determine a seqncia de bases do DNA que transcreve o RNA mensageiro do seguinte peptdeo: metionina-glicina-alanina-serina-arginina. Utilize os seguintes anticdons dos aminocidos: Alanina = CGA Glicina = CCU Arginina = GCG Metionina = UAC Serina = AGA

262. Fuvest-SP O cdigo gentico est todo decifrado, isto , sabe-se quais trincas de bases no DNA correspondem a quais aminocidos nas protenas que se formaro. Seqncia do DNA AGA CAA AAA CCG AAT GAA Aminocido serina valina fenilalanina glicina leucina leucina

d) o o do DNA complementar ao lamento dado TATGCT. e) essa seqncia codica 2 aminocidos. 265. UERJ Uma molcula de RNAm, composta pelas bases adenina (A) e citosina (C), foi sintetizada experimentalmente. Sua estrutura est representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a sntese de um peptdeo possa ser inicialmente a partir de qualquer um dos extremos dessa estrutura de RNAm, sem necessidade de cdigo de iniciao ou de terminao. Nestas condies, o nmero de diferentes tipos de aminocidos que podem ser encontrados no peptdeo formado ser: a) 4 c) 2 b) 3 d) 1 266. UMC-SP Um pesquisador submeteu sementes de uma planta a doses prolongadas de radiao. Aps plantar uma das sementes irradiadas, obteve um novo tipo de planta, idntica orignal, com exceo da cor de suas ores, uma vez que a nova planta possua uma or de colorao escura. Ao analisar essa ores, ele descobriu que a nova colorao era devida produo de um novo tipo de pigmento. Estudos posteriores revelaram que esse pigmento era sintetizado por uma enzima idntica a uma enzima presente na planta original, mas com cinco aminocidos a menos. A radiao deve, portanto, ter causado a deleo de: a) cinco genes. b) cinco aminocidos de seqncia do DNA. c) cinco aminocidos de seqncia do mRNA. d) quinze pares de nucleotdeos da seqncia do RNAm. e) quinze pares de nucleotdeos do DNA. 267. Cefet-PR Do melhoramento gentico passando pela engenharia gentica, processos de clonagem e transgnicos, os conhecimentos sobre os cidos nuclicos tm gerado tecnologias de grande utilidade para a humanidade. Assinale a alternativa que contm uma proposio incorreta acerca do funcionamento dos cidos nuclicos. a) Transcrio gnica o processo de fabricao de RNA a partir de um modelo de DNA. b) As molculas de DNA so capazes de se reproduzir por meio de um processo conhecido como duplicao semiconservativa. c) Se uma cadeia de DNA apresenta a seqncia de bases: ATTGCTGCGCATT, a outra cadeia apresenta na regio correspondente a seqncia complementar: TAACGACGCGTAA. d) O RNA diferencia-se do DNA principalmente por possuir como acar a ribose e a base nitrogenada uracila em lugar da timina. e) Cada aminocido codicado por um grupo de quatro bases chamado de cdon.
149

De acordo com a tabela: a) Se um RNA mensageiro tem seqncia de trincas UUA UUU CUU GUU UCU GGC, qual ser a seqncia dos aminocidos no polipeptdeo correspondente? b) Quais so os anticdons dos RNA transportadores de leucina? 263. UFRJ Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir de uma seqncia de nucleotdeos do seu gene, ou do RNAm correspondente.

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu. 264. PUC-MG Suponha uma extenso de molde de DNA , com a seguinte seqncia de desoxirribonucleotdeos: ATACGA. incorreto armar que: a) os cdons especicados por essa seqncia so UAUGCU. b) os anticdons complementares ao mRNA, produzidos por essa seqncia, so AUACGA. c) os ribonucleotdeos especicados por essa seqncia so TATGCT.

PV2D-06-BIO-14

268. PUCCamp-SP O quadro a seguir contm um segmento de DNA, os cdons e os anticdons correspondentes. DNA RNAm RNAt ATT TAA II UAA GAC I GAC IV TCA AGT III AGU

Para preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos, respectivamente, por: a) GAC, TAA, AGT e CTG. b) GTC, AUU, UCA e GUC. c) GTC, ATT, TCA e GUC. d) CTG, ATT, TCA e CUG. e) CTG, AUU, UCA e CUG.

269. UFSM-RS A tabela apresenta o cdigo gentico, com os cdons e os aminocidos correspondentes. SEGUNDA LETRA U C A
UAU Tyr UAC UAA parada UAG parada CAU His CAC CAA Glu CAG AAU Asn AAC AAA Lys AAG GAU Asp GAC GAA Glu GAG

G
UGU Cys UGC UGA parada UGG} Trp CGU CGC Arg CGA CGG AGU Ser AGC AGA Arg AGG GGU GGC Gly GGA GGG

UCU UUU U UUC Phe UCC Ser UUA Leu UCA UCG UUG

} }

U C A G TERCEIRA LETRA
AAU AAC AAA AAG GUU GUC GUA GUG

PRIMEIRA LETRA

CUU C CUC Leu CUA CUG


AUU A AUC Ileu AUA AUG} Met

CCU CCC Pr o CCA CCG


ACU ACC Thr ACA ACG

} }

U C A G U C A G U C A G

} } } }

} }

GUU G GUC Val GUA GUG

GCU GCC Ala GCA GCG

Lopes, Snia, Bio Volume nico. So Paulo: Saraiva, 1996.

Utilizando a tabela, determine a seqncia de aminocidos que corresponde seqncia de DNA TAC TGA TTG CTA a) b) c) d) e) met thr asn asp met glu his gly glu thr asp arg glu his gly arg gly cys glu thr

a) b) c) d) e)

GUU - GGU - UUU - CUC GAA - GGC - TTT - CTC CTT - CCG - AAA - AAC GAA - GGA - UUU - CUC GUU - GGC - UUU - UUG

271. Um pedao de molcula de DNA (gene) tem a seguinte seqncia de bases. A tabela a seguir mostra a relao cdon x aminocido.
UUU UUC UUA UUG CCU CCC CCA CCG fenilalanina leucina aspargina lisina

270. Fatec-SP A tabela a seguir relaciona trincas de bases do DNA aos aminocidos correspondentes. Bases do DNA AAC GAG CCG CCT CTT AAA Aminocidos Leucina (LEU) Leucina (LEU) Glicina (GLI) Glicina (GLI) cido Glutmico (GLU) Fenilalanina (FEN)

prolina

valina

Assinale a alternativa que apresenta a possvel seqncia de cdons para a formao do seguinte peptdeo: GLU - GLI - FEN - LEU
150

a) Qual a seqncia de bases do RNAm? b) Quantos cdons existem no RNAm produzido por este gene? c) Determine os anticdons dos RNAt que podem se encaixar nos cdons do RNAm. d) Quais so os aminocidos que vo fazer parte do polipeptdeo?

272. Unirio-RJ Supondo que o peso molecular mdio de um aminocido de 100 unidades, quantos nucleotdeos em mdia esto presentes em uma seqncia codicadora de ARN-m, responsvel pelo seqenciamento dos aminocidos em um peptdeo com peso molecular de 27.000 unidades? a) 810 d) 81.000 b) 300 e) 2.700 c) 270 273. PUCSP A tira de quadrinhos a seguir faz referncia manipulao de genes em laboratrio.

a) Quantos nucleotdeos so necessrios para codicar a seqncia de aminocidos nas espcies 1 e 2? Justique. b) Pode-se dizer que seqncias idnticas de aminocidos so sempre codicadas por seqncias idnticas de nucleotdeos? Justique. 276. Unicamp-SP Uma molcula de DNA sintetizada articialmente, com a seqncia TATCCGCCCTACCCG, foi utilizada para sintetizar a seguinte seqncia de cinco aminocidos (aa) representados pelos smbolos:

Se esse tipo de experimento realmente fosse concretizado, poder-se-ia armar que: a) o elefante e o vagalume so organismos transgnicos. b) apenas o vagalume um organismo transgnico. c) uma seqncia de RNA do vagalume foi transferida para clulas do elefante. d) o gene do vagalume controlou a produo de RNA e de protena no interior das clulas do elefante. e) uma seqncia de DNA do elefante sofreu mutao. 274. Unifesp O jornal Folha de S. Paulo noticiou que um cientista espanhol armou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconsquistar o DNA desses animais. a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justique. 275. Unicamp-SP Abaixo esto esquematizadas as seqncias de aminocidos de um trecho de uma protena homloga, em quatro espcies prximas. Cada letra representa um aminocido. espcie 1: M E N S L R C V W V P K LAF V L F GAS L L S AHLQ espcie 2: M E N S L R R V W V PALAF V L F GAS L L S AHLQ espcie 3: M E N S L R C V W V P K LAF V L F GAS L L S QLHA espcie 4: M E N S LR LAF V LF GAS LLSAH LQ

O Estado de So Paulo

A mesma molcula de DNA foi submetida a tratamento com substncia mutagnica, provocando alterao na 12 base da seqncia, que passou a ser uma timina. Represente, utilizando os mesmos smbolos anteriores, a seqncia de cinco aminocidos do segmento da cadeia polipeptdica. 277. PUCCamp-SP Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio sintetizado a partir dele: ATA GCA GTG ACA CCT Tirosina Arginina Histidina Cistena Glicina Aps a substituio de uma nica base nitrogenada no segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas. A seqncia de trincas no RNA mensageiro que pode ter codicado esse polipeptdeo alterado : a) CUC TGC TGC CGC GGU b) TUT CGT CGT TGT GGU c) CGT CGT CAC TGT GGA d) UAU CTU CAC CTU TTA e) UAU CGU CAC CGU GGA 278. Vunesp Os bilogos moleculares decifraram o cdigo gentico no comeo dos anos 60 do sculo XX. No modelo proposto, cdons constitudos por trs bases nitrogenadas no RNA, cada base representada por uma letra, codicam os vinte aminocidos. Considerando as quatro bases nitrogenadas presentes no RNA (A, U, C e G), responda: a) Por que foram propostos no modelo cdons de trs letras, ao invs de cdons de duas letras? b) Um dado aminocido pode ser codicado por mais de um cdon? Um nico cdon pode especicar mais de um aminocido? 279. Unicamp-SP O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de algumas dessas protenas, levando a mudanas no ciclo de vida da clula.
151

PV2D-06-BIO-14

a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica? 280. PUC-SP (...) De outro lado, o galardo de qumica cou com os inventores de ferramentas para estudar protenas, os verdadeiros atores do drama molecular da vida. verdade que a Fundao Nobel ainda fala no DNA como o diretor de cena a comandar a ao das protenas, mas talvez no seja pretensioso supor que foi um lapso e que o sinal emitido por essas premiaes aponta o verdadeiro futuro da pesquisa biolgica e mdica muito alm dos genomas e de seu seqenciamento (uma simples soletrao). (...) O autor refere-se s protenas como atores do drama molecular e ao DNA como diretor de cena. Essa referncia deve-se ao fato de: a) no ocorrer uma correlao funcional entre DNA e protenas no meio celular. b) o DNA controlar a produo de protenas e tambm atuar como catalisador de reaes qumicas celulares. c) o material gentico ser constitudo por protenas. d) as protenas no terem controle sobre o metabolismo celular. e) o DNA controlar a produo de protenas e estas controlarem a atividade celular. 281. Fuvest-SP De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas? 282. FEI-SP O estudo do mecanismo da sntese de protenas no interior das clulas conrma que: a) a transcrio gnica caracteriza-se pela autoduplicao do DNA. b) trs tipos de RNA participam do processo. c) os anticdons localizam-se no RNA-m. d) os cdons so trincas de bases nitrogenadas do RNA-t. e) no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado. 283. UFMS Em relao ao processo de sntese de protenas, assinale a(s) alternativa(s) correta(s). 01. No processo so formados o RNA-mensageiro (RNAm), o RNA-transportador (RNAt) e o RNAribossmico (RNAr). 02. A seqncia de aminocidos de uma protena determinada pela seqncia de bases da molcula de DNA. 04. O processo de transcrio corresponde cpia complementar do cdigo do DNA numa molcula de RNAm. 08. Esse processo pode ser dividido nas etapas de transcrio, transporte dos aminocidos e traduo.
152
LEITE, Marcelo. De volta ao seqenciamento. Folha de S. Paulo.

284. UFSCar-SP Um pesquisador, interessado em produzir, em tubo de ensaio, uma protena, nas mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas de rato, RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e aminocidos ativos de clulas de sapo. A protena produzida teria uma seqncia de aminocidos idntica do: a) rato. b) sapo. c) coelho. d) macaco.v e) macaco e do rato. 285. PUC-RS Responder questo com base na ilustrao e armativas a seguir:

I.

Durante o processo A, denominado replicao, o DNA se duplica. II. Durante o processo B, denominado transcrio, ocorre a sntese de RNA. III. Durante o processo C, denominado traduo, dse a sntese protica. IV. Nos eucariotos, os processos A, B e C ocorrem no interior do ncleo. Considerando os processos intracelulares, todas as armativas corretas encontram-se na alternativa: a) I, II e III. b) I, III e IV. c) I e IV. d) II e III. e) II, III e IV. 286. Vunesp O esquema resume parcialmente as relaes funcionais dos cidos nuclicos que ocorrem na maioria das clulas vivas.

Considerando-se apenas clulas eucariontes, as etapas que representam, respectivamente, transcrio, duplicao e traduo so: a) I, II e III. b) I, III e II. c) II, I e III. d) III, I e II. e) II, III e I. 287. Vunesp Considere o diagrama, que resume as principais etapas da sntese protica que ocorre numa clula eucarionte. Os processos assinalados como 1 e 2 e a organela representados no diagrama referem-se, respectivamente, a:

290. UFMG-MG Analise estes grcos. Efeito dos antibiticos A e B sobre a sntese de protenas em bactrias.

Considerando-se as informaes destes grcos, correto armar que: a) os mRNAs transcritos antes da adio do antibitico B so traduzidos. b) a queda da sntese de protena resulta da inibio da duplicao do DNA. c) os dois antibiticos A e B atuam sobre o mesmo alvo. d) o antibitico A impede a sntese de novas molculas de mRNA. 291. UnB-DF Analise a tabela abaixo e seus elementos.

a) transcrio, traduo e ribossomo. b) traduo, transcrio e lisossomo. c) duplicao, transcrio e ribossomo. d) transcrio, duplicao e lisossomo. e) traduo, duplicao e retculo endoplasmtico. 288. Fuvest-SP A composio qumica de uma protena pode ser alterada se: a) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma. b) durante sua sntese houver variao dos tipos de RNA transportadores. c) sua sntese ocorrer no retculo endoplasmtico liso e no no rugoso. d) ocorrer uma alterao no RNA mensageiro que a codica. e) o DNA no se duplicar durante a intrfase. 289. UFSCar-SP A droga cloranfenicol tem efeito antibitico por impedir que os ribossomos das bactrias realizem sua funo. O efeito imediato desse antibitico sobre as bactrias sensveis a ele inibir a sntese de: a) ATP.
PV2D-06-BIO-14

Julgue os itens que se seguem: ( ) I contm a informao gentica codicada em bases nitrogenadas. ( ) II e III so, respectivamente, protenas e RNA mensageiro. ( ) IV e V so polmeros e participam da sntese de aminocidos, respectivamente. ( ) A hemoglobina um exemplo de protena sinteti zada nos polirribossomos. 292. PUC-RJ Com relao ao cdigo gentico e sntese de protenas, assinale a armativa falsa. a) Na molcula de DNA, encontramos sempre desoxirribose e cinco tipos de bases: adenina, guanina, citosina, timina e uracila. b) Os cidos nuclicos podem aparecer livres na clula ou podem estar associados a protenas, compondo os cromossomos e ribossomos na forma de molculas complexas de nucleoprotenas.
153

b) DNA. c) protenas. d) RNA mensageiro. e) lipdios da parede bacteriana.

c) Duas grandes etapas esto envolvidas na sntese das protenas: a transcrio, que compreende a passagem do cdigo gentico do DNA para o RNA, e a traduo, que compreende o trabalho do RNA de organizao dos aminocidos na seqncia determinada pelo cdigo gentico. d) A mutao constitui uma alterao na seqncia de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiaes, por raios csmicos, por raios-X, ou mesmo por exposio aos raios ultravioleta do sol. e) Todas as clulas do corpo tm a mesma coleo de genes, mas, apesar disso, encontramos clulas com formas e funes diferentes. Este processo chama-se diferenciao celular. 293. Vunesp Na clula eucarionte, estabelecem-se trocas entre ncleo e citoplasma de substncias que, sintetizadas em um desses compartimentos, migram para o outro, a m de atender a suas necessidades. O esquema apresenta algumas dessas substncias. Assinale a resposta que d a direo correta de migrao das mesmas.

( ) O processo de sntese de protenas ao nvel do citoplasma tambm conhecido como transcrio gentica. ( ) Os diversos aminocidos unem-se atravs de ligaes do tipo ster, dando formao, ao nal da leitura do RNAm, a uma protena funcional. 296. Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com o processo de traduo, se ocorrer uma destruio do(s) nuclolo(s) de uma clula? 297. Os ribossomos so encontrados livres no citoplasma, associados superfcie do retculo endoplasmtico e dentro de mitocndrias e cloroplastos, desempenhando sempre a mesma funo bsica. a) Que funo essa? b) Por que alguns dos ribossomos se encontram associados ao retculo endoplasmtico? c) Por que as mitocndrias e cloroplastos tambm tm ribossomos em seu interior? 298. Vunesp Erros podem ocorrer, embora em baixa freqncia, durante os processos de replicao, transcrio e traduo do DNA. Entretanto, as conseqncias desses erros podem ser mais graves, por serem herdveis, quando ocorrem: a) na transcrio, apenas. b) na replicao, apenas. c) na replicao e na transcrio, apenas. d) na transcrio e na traduo, apenas. e) em qualquer um dos trs processos. 299. UFV-MG Sabe-se que o ncleo transmite a informao gentica nele armazenada em duas ocasies: quando a clula se reproduz e quando envia ao citoplasma cpias de sua informao acumulada no cido desoxirribonuclico, para a sntese protica. O esquema representa alguns dos passos necessrios para esta sntese, bem como as molculas e estruturas nela envolvidas.

a) A, D, F, G b) B, D, F, G c) B, D, F, H

d) A, D, E, G e) A, D, F, H

294. UFRJ Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto armar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justique sua resposta. 295. UFPE Na questo a seguir, escreva nos parnteses a letra (V) se a armativa for verdadeira ou (F) se for falsa. As proposies a seguir so relativas ao processo de sntese de protenas nas clulas vivas. ( ) A molcula de DNA transcreve no ncleo uma molcula de RNA mensageiro (RNAm) com vrias seqncias de trs bases os cdons. ( ) Cada cdon do RNA mensageiro determinar a colocao de um aminocido especco na cadeia polipeptdica. ( ) No local onde houver um ribossomo, pequenas molculas de RNA transportador (RNAt), ligadas a aminocidos, unem-se ao RNAm por uma seqncia de trs bases o anticdon.
154

a) Qual o nome da estrutura (corpsculo) I? b) Como denominada a etapa III? c) Como denominado o complexo resultante da unio de IV e V? d) Qual a funo desempenhada por VI? e) Qual a macromolcula representada no esquema que origina tanto IV quanto VI? 300. UFMT A partir da observao da gura abaixo, julgue os itens.

c) 2 - RNAm; 3 - RNAt; II - traduo; A - ncleo. d) 2 - gene; 3 - RNAt; II - transcrio; B - citoplasma. e) 3 - ribossomo; 4 - cido graxo; I - traduo; B - citoplasma. 302. Fatec-SP O esquema a seguir representa a seqncia das etapas da sntese de um trecho de uma protena a partir da molcula de DNA, num certo organismo.

( ) O fenmeno indicado pela seta 1 corresponde ao processo de duplicao onde so construdas cadeias de nucleotdeos. ( ) A seta 2 indica a formao de uma molcula de RNAm, responsvel pela captao e transporte dos aminocidos. ( ) O fenmeno indicado pela seta 3 corresponde ao processo de transcrio onde os ribossomos tm uma participao fundamental. ( ) A seta 4 indica a formao de uma cadeia polipeptdica onde o grupo amina de um aminocido perde um de seus hidrognios, enquanto o grupo carboxila do outro aminocido perde seu grupo hidroxila. Nessa reao, ocorre a formao de uma molcula de gua. 301. FMTM-MG O esquema representa a sntese protica em organismos eucariotos.

Sobre essa sntese, foram feitas as afirmaes abaixo. I. No esquema, os nmeros 1 e 2 correspondem, respectivamente, aos processos de traduo e transcrio, que ocorrem no ncleo das clulas eucariticas. II. A seqncia correta de bases nitrogenadas encontradas na molcula de RNA mensageiro, complementar ao segmento da hlice de DNA apresentada, UGGUUUGGCUCA. III. Para codicar a seqncia dos aminocidos do trecho da protena apresentada no esquema, so necessrios 24 nucleotdeos no RNA mensageiro. Deve-se concluir que: a) apenas II est correta. b) apenas I e II est correta. c) apenas II e III esto corretas. d) apenas I e III esto corretas. e) todas esto corretas. 303. Fuvest-SP O desenho mostra a sntese de um polipeptdeo a partir da molcula de DNA, num certo organismo.

PV2D-06-BIO-14

Nele, esto assinaladas algumas etapas, estruturas e regies da clula onde ocorrem etapas distintas. Assinale a alternativa que contm as associaes corretas. a) 1 - DNA; 3 - ribossomo; I - traduo; A - ncleo. b) 1 - gene; 4 - protena; I - transcrio; B - citoplasma.

Esse organismo um procarioto ou um eucarioto? Por qu?


155

304. UFOP-MG Com relao sntese de protenas em uma clula, incorreto armar: a) Todas as clulas sintetizam sempre os mesmos tipos de protenas, nas mesmas propores. b) A seqncia de bases nitrogenadas ao longo da molcula de RNAm determina a seqncia de aminocidos incorporados na cadeia polipeptdica. c) Para a formao da protena, no basta a atividade do RNAm; necessria a participao dos RNAt e dos ribossomos. d) Ao longo de um DNA, h segmentos que atuam diretamente na sntese de protenas, os xons, e os que parecem inativos nesse processo, os ntrons. 305. UFRJ Nos procariotos, o sinal para o incio da sntese das protenas (traduo) geralmente sinalizado no ARNm pelo cdon AUG, que corresponde ao aminocido metionina. No entanto, alm do cdigo AUG, existe uma seqncia curta de nucleotdeos que antecede esse cdon. Essa seqncia, que chamada de Shine-Dalgarno, em homenagem aos pesquisadores que a detectaram, permite que o stio correto de iniciao da traduo seja selecionado. O diagrama a seguir ilustra a localizao dessa seqncia. A seqncia de Shine-Dalgarno est em 1 e o cdon de iniciao, em 2 CUACCAGGAGCUAUUUAUGGCUUUA------- ARNm Explique a importncia desse duplo controle da iniciao para a traduo correta da mensagem contida no ARNm. 306. Fatec-SP Alguns antibiticos, como a eritromicina e o cloranfenicol, so utilizados no tratamento de doenas infecciosas, pois tm a capacidade de bloquear a sntese de protenas nas bactrias, sem interferir nas clulas afetadas ou contaminadas. Com base nestas informaes, correto concluir que esses antibiticos atuam nas bactrias a) provocando a plasmlise das clulas. b) impedindo a transcrio do DNA nuclear. c) impedindo a transcrio ou a traduo no hialoplasma. d) como agentes mutagnicos do DNA mitocondrial. e) impedindo que os ribossomos aderidos ao retculo endoplasmtico atuem na montagem das protenas. 307. Fuvest-SP Existe um nmero muito grande de substncias com funes antibiticas. Essas substncias diferem quanto maneira pela qual interferem no metabolismo celular. Assim, a tetraciclina liga-se aos ribossomos e impede a ligao do RNA transportador, a mitomicina inibe a ao da polimerase do DNA e a estreptomicina causa erros na leitura dos cdons do RNA mensageiro. Essas informaes permitem armar que: I. a tetraciclina impede a transcrio e leva a clula
156

bacteriana morte por falta de RNA mensageiro. II. a mitomicina, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana. III. a estreptomicina interfere na traduo e leva a clula bacteriana a produzir protenas defeituosas. Das armativas acima: a) Apenas I correta. b) Apenas I e II so corretas. c) Apenas II e III so corretas. d) Apenas I e III so corretas. e) I, II e III so corretas. 308. Vunesp Em um segmento da cadeia ativa de DNA, que servir de molde para a ta de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da ta complementar do DNA, h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda: a) Quantas uracilas e quantas guaninas comporo a ta do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipeptdeos que ser formada? Justique sua resposta. 309. FMTMMG Muitos antibiticos so capazes de inibir o processo de traduo durante a sntese protica. Para evidenciar tal efeito, bactrias so colocadas em meio de cultura contendo aminocidos marcados por istopos radioativos. Em seguida, so feitos testes para detectar a assimilao desses aminocidos na presena e na ausncia de substncias que sero usadas como possveis antibiticos. Um aparelho mede a quantidade de cintilaes correspondentes s emisses radioativas do material analisado no caso, bactrias e o resultado expresso em cpm/106 clulas (cpm = cintilaes por minuto). Seguindo esse protocolo, foram testadas cinco substncias, 1,2,3,4 e 5, para se avaliar a ecincia de cada uma delas como um possvel antibitico. Os resultados esto demonstrados no grco.

A partir das anlises dos dados, possvel concluir corretamente que o melhor resultado como antibitico dado pela substncia: a) 1 b) 2 c) 3 d) 4 e) 5

Captulo 4
310. Cite duas caractersticas da membrana plasmtica que reveste as clulas dos seres vivos. 311. Uespi O esquema abaixo ilustra a estrutura molecular da membrana, segundo o modelo do mosaico uido. Analise-o e assinale a alternativa que indica os componentes indicados em (I) e em (II), nesta ordem. componentes bsicos de cada estrutura considerada. 1. Membrana plasmtica 2. Parede celular a) (1) I e II, (2) III e IV d) (1) II, (2) II e III b) (1) I e III, (2) II e) (1) III, (2) I e III c) (1) I e IV, (2) II 315. Fuvest-SP Para exercerem suas funes de reabsoro, as clulas epiteliais dos tbulos renais apresentam: a) microvilosidades e muitas mitocndrias. b) superfcie lisa e muitas mitocndrias. c) desmossomos e poucas mitocndrias. d) superfcie lisa e poucas mitocndrias. e) grandes vacolos. 316. Em qual dos rgos deve-se encontrar uma maior quantidade de microvilosidades? a) Fgado d) Intestino b) Estmago e) Corao c) Bexiga a) b) c) d) e) protena e lipdio. lipdio e carboidrato. carboidrato e protena. lipdio e protena. polissacardeo e hidratos de carbono. 317. PUC-SP As microvilosidades presentes nas clulas do epitlio intestinal tm a funo de: a) aumentar a aderncia entre uma clula e outra. b) produzir grande quantidade de ATP, necessria ao intenso metabolismo celular. c) sintetizar enzimas digestivas. d) secretar muco. e) aumentar a superfcie de absoro. 318. UFC-CE Que processo, provavelmente, estaria ocorrendo em grande extenso, em clulas cuja membrana celular apresentasse microvilosidade? a) Detoxicao de drogas. b) Secreo de esterides. c) Sntese de protenas. d) Catabolismo. e) Absoro. 319. Unirio-RJ A membrana plasmtica apresenta algumas transformaes, que procedem como especializaes destinadas a aumentar o poder de absoro da clula ou a permitir o seu deslocamento. So exemplos dessas especializaes, respectivamente: a) desmossomos e interdigitaes. b) vacolos e plastos. c) cariomembrana e peroxissomos. d) microvilosidades e clios. e) interdigitaes e glioxissomos.
157

312. Quais os dois principais componentes das membranas celulares? a) Lipdios e acares b) Acares e protenas c) cidos nucleicos e lipdios d) Lipdios e protenas e) gua e sais minerais 313. UELPR Hemcias humanas possuem em sua membrana plasmtica protenas e glicdeos que atuam no processo de reconhecimento celular dos diferentes tipos de sangue pertencentes ao sistema ABO. Tais molculas vo ajudar a compor uma regio denominada: a) glicoclix. d) microvilosidade. b) citoesqueleto. e) parede celular. c) desmossomo. 314. UELPR Considere os seguintes componentes qumicos: I. lipdios II. acares III. protenas IV. cidos nuclicos Assinale, a alternativa que identica corretamente os

PV2D-06-BIO-14

320. UFU-MG Os desmossomos so especializaes da membrana plasmtica e tm como funo: a) aumentar a rea de absoro celular. b) secretar enzimas. c) rmar ligaes intercelulares. d) promover movimentao celular. e) permitir troca de citoplasma entre clulas vizinhas. 321. UFPI A estrutura da membrana celular, no modelo de Singer e Nicholson, formada por uma: a) bicapa lipdica contnua, dentro da qual so encontradas intercaladas as protenas integrais da membrana. b) bicapa protica contnua, dentro da qual so encontrados intercalados os lipdios da membrana. c) camada central lipdica bimolecular e molculas proticas sobre as duas faces desse folheto. d) camada central protica e molculas lipdicas sobre as duas faces dessa camada. e) bicapa protica e molculas lipdicas na periferia das duas faces da bicapa. 322. O esquema a seguir representa o modelo de organizao molecular da membrana plasmtica.

Assinale: a) se somente as armativas I, II e III esto corretas. b) se somente as armativas II, III e IV esto corretas. c) se somente as armativas I, III e IV esto corretas. d) se somente as armativas I, II e IV esto corretas. e) e se todas as armativas esto corretas. 324. Cesgranrio-RJ Todas as clulas possuem uma membrana plasmtica, ou plasmalema, que separa o contedo protoplasmtico ou meio intracelular do meio ambiente. A existncia e integridade da membrana so importantes porque: a) regulam as trocas entre a clula e o meio, s permitindo a passagem de molculas de fora para dentro da clula e impedindo a passagem no sentido inverso. b) possibilitam clula manter a composio intracelular diversa da do meio ambiente. c) impedem a penetrao de substncias existentes em excesso no meio ambiente. d) exigem sempre consumo energtico para a captao de alimento do meio externo. e) impedem a sada de gua do citoplasma. 325. Unirio-RJ As clulas animais apresentam um revestimento externo especco, que facilita sua aderncia, assim como reaes a partculas estranhas, como, por exemplo, as clulas de um rgo transplantado. Esse revestimento denominado: a) membrana celulsica. d) interdigitaes. b) glicoclix. e) desmossomos. c) microvilosidade. 326. Fatec-SP Durante a embriognese, ocorre o processo de diferenciao celular, no qual cada clula se especializa para o desempenho de determinada funo. Clulas com funo de secreo, adeso e absoro, todas em intensa atividade metablica, devem apresentar, respectivamente: a) desmossomos, microvilosidades, abundncia de complexos de Golgi e mitocndrias. b) abundncia de complexos de Golgi, desmossomos, microvilosidades e maior nmero de mitocndrias. c) abundncia de complexos de Golgi, microvilosidades, desmossomos e muitas mitocndrias. d) microvilosidades, desmossomos, abundncia de mitocndrias e de retculos endoplasmticos rugosos. e) abundncia de mitocndrias, desmossomos, microvilosidades e extensa rede de microlamentos.

Assinale a alternativa incorreta. a) Esta organizao de membrana comum para as clulas dos seres vivos. b) 1 indica camada de fosfolipdios. c) 2 indica protena. d) Trata-se da membrana de uma clula eucariota, j que nas clulas procariotas h apenas uma camada de fosfolipdios. e) Em protozorios esta estrutura, alm de delimitar o meio celular, uma estrutura de proteo para o organismo. 323. FTESM-RJ O esquema abaixo representa um modelo da membrana plasmtica feito por um aluno. Em relao ao modelo, so feitas as seguintes armativas: I. As lminas de isopor representam protenas brilares. II. As folhas do rabanete representam polissacardeos. III. A face B interna. IV. As peras representam protenas integrais.
158

327. Unicamp-SP A seguir esto representados trs modelos de biomembranas:

04. O nmero 3 indica uma protena que facilita a passagem de ons pela membrana. 08. O nmero 4 indica uma molcula de glicdio que faz parte do glicoclix. 16. O nmero 5 indica uma protena que diculta a passagem de gases pela membrana. 32. Os nmeros 1 e 2 indicam regies hidroflica e hidrofbica de lipdios, respectivamente. 329. Desmossomos e microvilosidades so importantes adaptaes de membrana plasmtica de clulas de determinados tecidos. A respeito dessas estruturas, responda: a) Quais so suas funes, respectivamente? b) Cite um tipo celular onde se podem encontrar as microvilosidades. 330. FURG-RS A membrana plasmtica pode apresentar modicaes ligadas ao aumento da adeso celular. Assinale a alternativa que apresente exemplos destas modicaes nas clulas epiteliais animais. a) glicoclix e plasmodesmos b) desmossomos e interdigitaes c) plasmodesmos e microvilosidades d) desmossomos e vilosidades e) znula de ocluso e trama terminal 331. Uespi Em algumas clulas, a membrana plasmtica apresenta diferenciaes mostradas em (I), (II) e (III), nesta ordem.

a) A que constituintes da membrana se referem as letras a, b e c? b) Qual dos modelos anteriores atualmente aceito para explicar a estrutura das biomembranas? c) Que caracterstica do modelo escolhido lhe confere vantagem do ponto de vista de transporte atravs da biomembrana? 328. Unioeste-PR O modelo a seguir representa a estrutura molecular da membrana plasmtica, segundo Singer e Nicholson (1972). Observando-o, leia as armativas propostas e assinale a(s) correta(s):

a) microvilosidade, desmossomo e interdigitao. 01. O nmero 1 indica a parte hidrofbica dos fosfolipdios que controlam o transporte pela membrana. 02. O nmero 2 indica as protenas que formam barreiras para substncias hidrossolveis. b) interdigitao, desmossomo, microvilosidade. c) desmossomo, microvilosidade, interdigitao. d) fragmoplasto, microvilosidade, desmossomo. e) microvilosidade, fragmoplasto, placa glandular.

PV2D-06-BIO-14

159

332. Fuvest-SP Em que clulas do corpo humano podemos encontrar as estruturas a seguir e quais so as suas funes? a) Microvilosidades b) Clios c) Flagelos d) Pseudpodes 333. UFRGS-RS O quadro abaixo refere-se aos envoltrios celulares e a algumas de suas especializaes. Assinale a alternativa que associa corretamente a estrutura celular com as suas caractersticas.
Nome Microvilosidades Funo Aderncia entre as clulas Proteo da superfcie celular contra leses mecnicas e qumicas Controle de trocas entre a clula e o meio externo Sustentao e manuteno da forma da clula Aumento da superfcie da membrana Presena Presena em clulas em clulas vegetais animais no sim

b) Qual a composio da macromolcula ao nal do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso. 335. Em relao a estrutura e propriedades da membrana plasmtica, faa associaes corretas. I. II. Modelo mosaico uido Membrana semipermevel

III. Permeases IV. Permeabilidade seletiva a) Protenas presentes na membrana plasmtica, que auxilia no transporte de substncias, sem gasto de energia. b) Mecanismo exercido pela membrana plasmtica, que controla a entrada e a sada de substncias da clula. c) Caracterstica da membrana plasmtica, que permite a entrada e a sada de substncias das clulas. d) Modelo proposto para explicar a estrutura da membrana plasmtica. Tem como caracterstica a movimentao e a maleabilidade entre as molculas. a) I a - II c - III d - IV b b) I b - II c - III a - IV b c) I d - II a - III c - IV b

a)

b)

Glicoclix

no

sim

c)

Membrana plasmtica

no

sim

d)

Parede celular

sim

sim

d) I d - II c - III a - IV b e) I c - II d - III a - IV b 336. A membrana plasmtica, devido sua permeabilidade seletiva, controla a entrada e a sada de substncias da clula. Uma substncia ir se difundir para o meio externo quando: a) sua concentrao externa estiver maior. b) sua concentrao externa estiver igual interna. c) sua concentrao interna estiver maior. d) sua concentrao interna estiver menor. e) tiver energia disponvel para o transporte. 337. Fuvest -SP Para a ocorrncia de osmose, necessrio que: a) as concentraes de soluto dentro e fora da clula sejam iguais. b) as concentraes de soluto dentro e fora da clula sejam diferentes. c) haja ATP disponvel na clula para fornecer energia ao transporte de gua. d) haja um vacolo no interior da clula no qual o excesso de gua acumulado.

e)

Desmossomos

sim

sim

334. Unicamp-SP Um certo tipo de macromolcula destinada membrana plasmtica celular depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

a) Por que essas etapas comeam no ncleo?


160

e) haja uma parede celulsica envolvendo a clula, o que evita sua ruptura.

338. Uespi Quando se faz o salgamento de carnes, sabe-se que os microorganismos que tentarem se instalar morrero por desidratao. Conclui-se, assim, que essas carnes constituem um meio: a) isotnico. b) hipotnico. c) hipertnico. d) lipdico. e) plasmolisado. 339. UFAM Complete a armao abaixo. A presso osmtica depende da concentrao de partculas de soluto na soluo. Quando duas solues apresentam concentraes diferentes de soluto, a mais concentrada chamada de ___________ e a mais diluda __________, respectivamente. a) soluo plasmtica soluo hipertnica b) soluo hipotnica soluo hipertnica c) soluo aquosa soluo hipotnica d) soluo hipertnica soluo hipertnica e) soluo hipertnica soluo hipotnica 340. PUC-PR Na gura abaixo, as duas solues de concentraes diferentes esto separadas por uma membrana que, atravs da osmose, tende a igualar suas concentraes. Os nmeros 1, 2 e 3 representam, respectivamente:
1 2

342. UERGS-RS Quando o feijo cozido em gua com sal, observa-se que ele murcha, pois: a) o gro perde gua por osmose. b) os sais do gro passam para a gua por difuso. c) o calor estimula o transporte das protenas da gua para o gro. d) o transporte passivo das protenas ocorre do gro para a gua. e) o gro perde protenas por osmose. 343. Descascou-se uma mexerica, retirando-lhe, em seguida, um gomo e a pelcula que o recobre, deixando expostos os favos. A seguir, colocou-se uma pitada de sal sobre os favos. Aps 5 minutos, observou-se o surgimento de um lquido nesta regio. A partir desse resultado, assinale a alternativa correta. a) Houve a passagem do lquido do meio hipotnico para o meio hipertnico. b) O lquido foi ativamente transportado do meio hipertnico para o meio hipotnico. c) As clulas vegetais da mexerica apresentam membranas permeveis, que permitem o livre trnsito de substncias dissolvidas, como protenas e lipdios. d) Por diferenas de concentrao do meio, ocorreu a deplasmlise da clula vegetal, fazendo surgir o lquido. 344. Fatec-SP prtica comum salgarmos os palitos de batata aps terem sido fritos, mas nunca antes, pois, se assim for, eles murcharo. E murcharo porque: a) as clulas dos palitos de batata cam mais concentradas que o meio externo a elas e, assim, ganham gua por osmose. b) as clulas dos palitos da batata cam mais concentradas que o meio externo a ela e, assim, ganham gua por transporte ativo. c) as clulas dos palitos da batata cam mais concentradas que o meio externo a elas e, assim, perdem gua por transporte ativo. d) o meio externo aos palitos da batata ca mais concentrado que as clulas deles, que, assim, perdem gua por osmose. e) o meio externo aos palitos de batata ca menos concentrado que as clulas deles, que, assim, ganham gua por pinocitose. 345. Mackenzie-SP Hemcias humanas foram colocadas em um tubo de ensaio que continha um meio lquido. Aps algum tempo, o lquido tornou-se avermelhado. Um estudante chegou s seguintes concluses: I. O meio em que as clulas estavam era hipotnico. II. O fenmeno observado causado pela entrada de gua nas clulas, provocando sua ruptura.
161

H2O

Solvente

Soluto

a) soluo hipotnica, soluo hipertnica e membrana semipermevel. b) soluo isotnica, soluo hipertnica e membrana impermevel. c) soluo hipertnica, soluo hipotnica e membrana permevel. d) soluo hipotnica, soluo isotnica e membrana impermevel. e) soluo hipertnica, soluo isotnica e membrana impermevel. 341. FEI-SP Quando temperamos a salada com sal, vinagre e azeite, depois de algum tempo, observamos que as folhas esto murchas. Esse processo denominado: a) diapedese. b) dilise. c) osmose. d) hemlise. e) difuso.

PV2D-06-BIO-14

III. A hemoglobina, presente no citoplasma das hemcias, misturou-se ao meio, tornando-o vermelho. IV. O fenmeno conhecido como osmose e envolve gasto de ATP. O estudante est correto: a) em todas as suas concluses. b) somente nas concluses I e II. c) somente nas concluses II e IV. d) somente nas concluses II e III. e) somente nas concluses I, II e III. 346. UFRGS-RS Num experimento, uma ameba de gua doce e uma hemcia de um ser humano foram colocadas em um meio hipotnico. Depois de algum tempo, vericouse que a ameba sobreviveu, enquanto a hemcia foi destruda por hemlise. Assinale a alternativa que apresenta uma adaptao que possibilitou a sobrevivncia da ameba. a) Permeases que impedem a entrada de gua na clula. b) Pseudpodes que realizam a expulso da gua excedente que penetra na clula. c) Um citoplasma hipotnico em relao ao seu hbitat. d) Uma parede celular praticamente impermevel passagem de gua. e) Um vacolo pulstil para expelir o excesso de gua que entra na clula por osmose. 347. A membrana plasmtica, atravs de sua permeabilidade seletiva, controla a entrada e a sada de substncia na clula. Em relao aos mecanismos de transporte, julgue os itens a seguir, assinalando V ou F. ( ) A difuso um processo de transporte atravs da membrana plasmtica, onde o soluto se desloca do meio mais concentrado para o meio menos concentrado, sem gasto de energia e a favor do gradiente de concentrao. ( ) A osmose um processo de transporte atravs da membrana plasmtica, onde o solvente se desloca do meio mais concentrado para o meio menos concentrado, sem gasto de energia e a favor do gradiente de concentrao. ( ) A difuso facilitada um processo em que h a participao de protenas transportadoras que auxiliam o processo de transporte. um transporte a favor do gradiente de concentrao, porm com gasto de energia. ( ) Osmose, difuso simples e facilitada so tipos de transporte passivo, onde o solvente e o soluto, respectivamente, so tansportados a favor do gradiente de concentrao, e sem gasto de energia. 348. UEL-PR Durante uma aula prtica de Biologia, alunos de uma escola testaram o efeito da tonicidade do meio sobre eritrcitos de mamferos, cuja osmolaridade do plasma era de 300 mOsm/L H2O. Para isso, colocaram as clulas em solues com diferentes concentraes osmticas, como representado a seguir.
162

Aps a realizao do teste, correto armar: a) Na situao A, as clulas caram trgidas e, em B e C, as clulas no se alteraram. b) Nas situaes A e C, as clulas caram trgidas e, em B, as clulas no se alteraram. c) Nas situaes A e B, as clulas no se alteraram e, em C, as clulas murcharam. d) Na situao A, as clulas no se alteraram e, em B e C, as clulas caram trgidas. e) Na situao A, as clulas caram tgidas; em B, as clulas murcharam; e em C, no se alteraram. 349. Mackenzie-SP

Assinale a explicao correta para o fenmeno observado acima. a) O sal provoca a desintegrao das membranas celulares do caramujo. b) O sal se dissolve no muco que recobre o corpo do caramujo, tornando-se uma soluo hipertnica, o que provoca a sada de gua do corpo por osmose. c) A pele do caramujo reage com o sal, formando um composto instvel que rompe as clulas. d) O sal absorvido pelas clulas da pele do caramujo, cujo citoplasma se torna mais concentrado, provocando perda de gua pelas clulas. e) O sal provoca uma reao alrgica no caramujo, resultando na sua desintegrao. 350. Unicamp-SP Uma certa quantidade de gua de lagoa com amebas foi colocada em frascos numerados de 1 a 5. Foram adicionadas quantidades crescentes de sais a partir do frasco 2 at o 5. Observando-se, em seguida, as amebas ao microscpio, constatou-se uma gradual diminuio na velocidade de formao de vacolos pulsteis a partir do frasco 2. No frasco 5, no se formavam esses vacolos. a) Qual a principal funo do vacolo pulstil? b) O que aconteceria se as amebas do frasco 1 no tivessem a capacidade de formar vacolos? Por qu? c) Por que no frasco 5 no se formaram vacolos?

351. Fuvest-SP As bananas mantidas temperatura ambiente deterioram-se em conseqncia da proliferao de microorganismos. O mesmo no acontece com a bananada, conserva altamente aucarada produzida com essas frutas. a) Explique, com base no transporte de substncias atravs da membrana plasmtica, por que bactrias e fungos no conseguem proliferar em conservas com alto teor de acar. b) D exemplos de outro mtodo de conservao de alimentos que tenha por base o mesmo princpio siolgico. 352. Cesgranrio-RJ No desenho abaixo, observamos trs tubos de ensaio contendo solues de diferentes concentraes de NaCl e as modicaes sofridas pelas hemcias presentes no seu interior. Em relao a este desenho, assinale a alternativa correta.

1. Qual a tonicidade relativa da soluo em que a clula foi mergulhada? 2. Qual o nome do fenmeno que explica os resultados apresentados no grco? a) Hipotnica, osmose d) Hipertnica, difuso b) Hipotnica, difuso e) Isotnica, osmose c) Hipertnica, osmose 354. Cefet-PR A clula viva corresponde a uma poro microscpica e isolada do meio por uma na pelcula que se encarrega de selecionar o que deve entrar e sair do contedo citoplasmtico. Com relao membrana plasmtica, seus envoltrios e processos de troca, analise as armaes propostas e marque a alternativa incorreta. a) A membrana plasmtica composta por uma bicamada fosfolipdica e protenas que cam aderidas de forma supercial membrana ou totalmente mergulhadas na estrutura fosfolipdica. b) Para manter as diferenas entre as concentraes interna e externa de determinados ons como Na+ e K+, a clula no gasta energia, pois se utiliza da difuso facilitada, recebendo ajuda de permeases. c) As clulas animais podem apresentar um revestimento externo ligado membrana plasmtica. Esse revestimento constitudo por glicoprotenas e glicolipdios, sendo chamado de glicoclix. Pode desempenhar a funo de reter enzimas responsveis pela digesto de alguns compostos como protenas, alm do reconhecimento celular. d) A pinocitose um tipo de endocitose, ocorrendo, neste caso, o englobamento de pequenas pores de substncias lquidas. e) No transporte ativo, enzimas podem agir como transportadoras de molculas, tais como acar, ou ons. 355. O quadro abaixo mostra o comportamento de duas clulas expostas a diferentes solues.

a) Em 1, a soluo isotnica em relao hemcia; em 2, a soluo hipertnica em relao hemcia; e em 3, a soluo hipotnica em relao hemcia. b) As hemcias em 1 sofreram alterao de volume, porm em 2 ocorreu plasmlise e, em 3, turgescncia. c) Considerando a concentrao isotnica de NaCl = 0,9%, a soluo 2 certamente possui uma concentrao de NaCl inferior a 0,9% e a soluo 3, uma concentrao de NaCl superior a 0,9%. d) As hemcias do tubo 2 sofreram perda de gua para a soluo, enquanto as do tubo 3 aumentaram seu volume, depositando-se no fundo. e) A plasmlise sofrida pelas hemcias do tubo 2 ocorreu em razo da perda de NaCl para o meio. 353. Fuvest-SP Uma clula animal foi mergulhada em soluo aquosa de concentrao desconhecida. Duas alteraes ocorridas na clula encontram-se registradas no grco abaixo.

Os processos que ocorreram em A e B so, respectivamente: a) osmose e difuso. b) difuso e transporte ativo. c) osmose e difuso facilitada. d) difuso e osmose. e) transporte ativo e difuso facilitada. 356. UFMS (modificado) Entre os tipos de transporte existentes na clula, est o que se chama difuso facilitada, associada com a doena fatal chamada brose cstica, que gentica e relacionada com a difuso facilitada do on cloro (Cl).
163

PV2D-06-BIO-14

Analise os itens abaixo e assinale a(s) alternativa(s) correta(s). 01. Permeases so protenas de transporte que auxiliam a passagem de determinadas substncias, impedidas de entrar na clula pela camada de lipdios. 02. No processo, somente participam as protenas (permeases) que transportam substncias do meio em que esto mais concentradas para o meio em que esto menos concentradas, caso tido como passivo, isto , sem gasto de energia. 04. No processo h gasto de energia metablica durante o transporte de substncias. 08. O processo particularmente importante para ons como cloro (Cl-), sdio (Na+) e potssio (K+) e para substncias lipossolveis. 16. O processo particularmente importante para ons como cloro (Cl-), sdio (Na+) e potssio (K+) e para substncias como aminocidos e glicose. 357. O transporte de Na+ e K+ atravs da membrana plasmtica, com gasto de nergia, caracterizado como: a) transporte ativo. b) transporte passivo. c) difuso facilitada. d) difuso simples. e) osmose. 358. Uma clula mantm uma diferena na concentrao de alguns ons, em relao ao meio externo, por um mecanismo especco de transporte. Essa diferena entre o meio externo pode se igualar caso o mecanismo citado seja prejudicado.Qual o mecanismo em questo e do que depende seu bom funcionamento? 359. Considerando os glbulos vermelhos, verica-se que a concentrao de K+ muito maior no interior que no exterior da clula. O mesmo no acontece com os ons Na+, cuja concentrao maior no exterior que no interior da clula. A entrada de K+ e a sada de Na+ dos glbulos vermelhos podem ocorrer por: a) b) c) d) transporte passivo. hemlise. difuso. transporte ativo.

O contrrio acontece com os ons K+. ons de Na+ so capturados do citoplasma para o meio extracelular, e ons de potssio (K+) so capturados do meio extracelular para o meio intracelular, como mostrado na gura adiante. Este processo conhecido como:

a) b) c) d) e)

difuso facilitada por permeases intracelulares. osmose em meio hipertnico. difuso simples transporte ativo. transporte por poros da membrana plasmtica.

361. UFBA As clulas de nosso organismo utilizam a glicose como fonte de energia, queimando-a atravs de reaes de oxidao. Para tanto, o consumo de glicose grande, e j se observou que, freqentemente, a clula absorve essa substncia, mesmo quando a sua concentrao intracelular maior que a extracelular; portanto, contra um gradiente de concentrao. Isso, porm, exige algum dispndio de energia pela clula uma espcie de investimento de energia. Identicamos nesse enunciado um caso de: a) dufuso simples. b) equilbrio osmtico. c) transporte ativo. d) transporte passivo. e) absoro direta pela membrana plasmtica. 362. UFRJ As guras abaixo representam duas situaes, I e II, em que os compartimentos A e B contm uma soluo siolgica e esto separados, um do outro, por uma membrana biolgica M. Nessas duas situaes, acrescentou-se soluto no compartimento A. Os solutos so transportados atravs da membrana. Aps o tempo t, vericou-se uma nova distribuio do soluto, entre A e B, como mostram as guras.

e) nenhuma das anteriores. 360. UFPE Medindo-se a concentrao de dois importantes ons, Na+ e K+, observa-se maior concentrao de ons Na+ no meio extracelular do que no meio intracelular.
164

A explicao para o fenmeno : a) o potssio entrou na clula por osmose. b) uma enzima lisossmica rompeu a membrana da clula por uma frao de segundo, e o potssio entrou nela. c) houve transporte ativo de gua para o interior da clula, e esta arrastou o potssio. d) houve transporte passivo de potssio para o interior da clula, deslocando gua para fora da mesma. e) houve transporte ativo de potssio para o interior da clula. Qual das duas situaes representa um transporte ativo? Justique sua resposta. 363. UFBA Os esquemas representam clulas nas quais h passagem de substncias atravs de suas membranas: 365. Unicamp-SP A concentrao de um determinado on X vinte vezes maior no interior de uma clula do que no meio extracelular. a) Explique o tipo de mecanismo que mantm essa diferena inica entre a clula e seu meio. b) O que aconteceria com a situao descrita acima, se fosse bloqueado o processo respiratrio dessa clula? 366. A concentrao de ons Na+ no meio extracelular maior do que no meio intracelular. O oposto observado na concentrao de ons K+, como ilustrado a seguir. Essa diferena de concentrao mantida por transporte ativo. Todavia h tambm deslocamento desses ons do local onde esto em maior concentrao para o de menor concentrao, por um processo de:

Os fenmenos representados em A, B, C so, respectivamente: a) fagocitose, pinocitose, transporte ativo. b) pinocitose, difuso, transporte ativo. c) difuso, transporte ativo, osmose. d) osmose, trasporte ativo, difuso e) pinocitose, fagocitose, difuso. 364. Fatec-SP Analise os esquemas:

a) clasmocitose. b) fagocitose. c) osmose.

d) difuso. e) pinocitose.

PV2D-06-BIO-14

Uma clula animal foi mergulhada na soluo de cloreto de potssio cuja concentrao semelhante do plasma sangneo (esquema 1). Aps um certo tempo, a concentrao de potssio na clula tornou-se vinte vezes maior que a da soluo, e o volume da mesma no se alterou (esquema 2).

367. Fuvest-SP Pesquisadores norte-americanos produziram uma variedade de tomate transgnico que sobrevive em solos at 50 vezes mais salinos do que os tolerados pelas plantas normais. Essas plantas geneticamente modificadas produzem maior quantidade de uma protena de membrana que bombeia ons sdio para o interior do vacolo. Com base em tais informaes, pode-se concluir que plantas normais no conseguem sobreviver em solos muito salinos porque, neles, as plantas normais: a) absorvem gua do ambiente por osmose. b) perdem gua para o ambiente por osmose. c) absorvem sal do ambiente por difuso. d) perdem sal para o ambiente por difuso. e) perdem gua e absorvem sal por transporte ativo.
165

368. UFU-MG Todas as clulas so revestidas pela membrana plasmtica (MP), uma estrutura que seletivamente, entre outras funes, controla a troca de substncias entre o citoplasma e o meio extracelular. Com relao a essa troca de substncias, assinale com (V) as armativas verdadeiras e com (F) as falsas. 1. Molculas pequenas e/ou lipossolveis, como oxignio, gs carbnico e gua, atravessam a camada lipdica da MP, por difuso simples. 2. A difuso facilitada, como, por exemplo, o transporte de glicose para o interior da clula, auxiliada pelas protenas transportadoras presentes na MP. 3. ons de sdio (Na+) so transportados ativamente do citoplasma para o meio extracelular, sem gasto de energia. 4. A difuso facilitada e o bombeamento de sdio (Na+) do citoplasma para o meio extracelular so transportes ativos, uma vez que consomem energia da clula. 369. A membrana plasmtica depende de alguns fatores internos e externos para controlar a entrada e sada de substncias. Dentre eles a concentrao das substncias no meio intracelular e extracelular. Assinale os itens corretos. 01. A difuso um processo de transporte atravs da membrana plasmtica, onde no h gasto de energia e o soluto se desloca a favor do gradiente de concentrao. 02. Soluo hipertnica aquela em a concentrao de solutos maior em relao uma soluo isotnica. 04. Transporte ativo um tipo de transporte onde h gasto de energia e sua ocorrncia observada quando o soluto se desloca de um meio hipotnico para um meio hipertnico. 08. Difuso simples e facilitada so tipos de transporte passivo, onde o soluto transportado de um meio hipotnico para um meio hipertnico, sem gasto de energia. 16. A osmose um processo de transporte, onde o solvente se desloca do meio hipertnico para o meio hipotnico, sem gasto de energia e a favor do gradiente de concentrao. 370. Cesgranrio-RJ Na coluna da direita esto descritas trs formas de transporte de substncias atravs de membranas e na coluna da esquerda os termos com que essas formas de tranporte so conhecidas. Correlacione-as. 1. Transporte passivo I. Determinadas substncias so transportadas atravs da membrana plasmtica mesmo contra um gradiente osmtico, havendo neste caso um grande consumo energtico por parte da clula.

2. Transporte ativo

II. A velocidade de penetrao de certas substncias atravs da membrana plasmtica acelerada pela presena de molculas transportadoras. III. A penetrao de vrias substncias atravs da membrana plasmtica se d devido a um gradiente osmtico, sendo este um processo fsico de difuso

3. Difuso facilitada

a) b) c) d) e)

1 - I; 2 - I; 3 - III. 1 - I; 2 - III; 3 - II. 1 - II; 2 - I; 3 -I. 1 - III; 2 - II; 3 - I. 1 - III; 2 - I; 3 - II.

371. Em um organismo, as clulas apresentam composio variada, conseguindo manter no seu citoplasma substncias em concentrao muito diferente do meio externo. O principal responsvel por isso a membrana plasmtica, que conta com diferentes tipos de transporte, esquematizados na gura abaixo.

Com o auxlio da gura, julgue os seguintes itens. I. A pode representar uma substncia lipossolvel. II. Para o transporte da substncia B, a sua concentrao deve ser maior no exterior do que no interior da clula. III. A energia indicada no esquema , em geral, proveniente da quebra de ATP. IV. Protenas como a C tem importante papel no equilbrio osmtico da clula. So corretos: a) I, II e III d) I, III e IV b) I, II e IV e) I, II, III e IV c) I e III 372. O transporte de substncia entre o meio intracelular e o meio intersticial dependem de algumas condies para a sua ocorrncia. Em relao aos mecanismos de transporte e a essas condies, assinale a alternativa incorreta.

166

a) O transporte de substncias atravs da membrana, sem gasto de energia e a favor do gradiente de concentrao, denominado transporte passivo. b) So considerados mecanismos passivos a difuso simples e difuso facilitada, no transporte de solutos, e a osmose, no transporte de solventes. c) A energia necessria para a ocorrncia do transporte ativo liberada da hidrlise de ATP. d) Para que ocorra o transporte ativo nas clulas deve existir uma diferena na concentrao das substncia. O transporte ocorre do meio mais concentrado para o meio menos concentrado, com gasto de energia. e) O exemplo mais comum de transporte ativo a bomba de sdio e potssio, que mantm uma diferena importante para o funcionamento dos neurnios. 373. Unioeste-PR O atual modelo para a estrutura da membrana plasmtica foi elaborado por Singer e Nicholson (1972). A partir deste modelo correto armar: 01. que substncias hidrofbicas como CO2 so solveis em lipdios e passam rapidamente atravs da membrana. 02. que o transporte passivo do soluto por difuso tende a ocorrer do meio menos concentrado para o mais concentrado 04. que osmose um exemplo de transporte ativo de substncias que ocorre com a participao de protenas de transmembranas. 08. que, na difuso facilitada, o transporte do soluto ocorre em direo ao maior gradiente de concentrao com gasto de ATP. 16. que a caracterstica anptica da membrana plasmtica devida dupla camada de protenas que a constitui. 32. que o transporte ativo ocorre por bombas de soluto em direo ao maior gradiente de concentrao. 64. que, na bomba Na+/K+, Na+ bombeado para fora da clula e K+ bombeado para dentro da clula. 374. UFPR Medindo-se as concentraes de ons sdio e potssio no interior e no exterior de certas clulas em funo do tempo, foi possvel construir dois grcos. Nesses grcos, a linha cheia representa a concentrao extracelular e a linha pontilhada, a concentrao intracelular. Nas duas experincias, o metabolismo celular foi inibido num determinado momento (assinalado pela seta), pela adio de um bloqueador respiratrio, como o cianeto.
300 250 200 150 100 50 0 2 1 Tempo (mn.) 300 250 200 150 100 50 0 2 1 Tempo (mn.)

Com base em seus conhecimentos sobre transporte de ons e de pequenas molculas atravs das membranas, analise os grcos e responda: em condies normais, qual o mecanismo responsvel pela manuteno da diferena entre as concentraes inicas dentro e fora da clula exemplicada? a) Transporte ativo, atravs do qual os ons atravessam a membrana com gasto de ATP. b) Difuso simples, atravs da qual os ons podem atravessar a membrana com o auxlio de protenas transportadoras. c) Osmose, atravs da qual a gua atravessa a membrana a favor do gradiente de concentrao. d) Fagocitose, atravs da qual a clula captura ons e outras partculas slidas. e) Difuso facilitada, atravs da qual os ons so transportados contra seus gradientes de concentrao. 375. UFF-RJ A membrana basal das clulas tireoidianas tem a capacidade especca de bombear iodeto para o interior da clula. Isto chamado de seqestro de iodeto. Na glndula normal, a bomba de iodeto capaz de concentrar o iodeto at cerca de 30 vezes sua concentrao no sangue. Quando a glndula tireide est em sua atividade mxima, a proporo entre as concentraes pode chegar a um valor de at 250 vezes. (...) O retculo endoplasmtico e o complexo de Golgi sintetizam e secretam para dentro dos folculos uma grande molcula glicoprotica chamada de tireoglobulina.

Adaptado de GUYTON, A. C. e HALL, J. E. Tratado de Fisiologia Mdica. Rio de Janeiro, Guanabara Koogan, 1997, pp. 859-860.

A partir da anlise do texto e da gura, responda s questes propostas. a) Que tipo de transporte utilizado para manter as concentraes altas de iodeto no interior da clula? b) De que forma o retculo endoplasmtico rugoso e o complexo de Golgi participam na produo de tireoglobulina? 376. Abaixo, pode-se observar a representao esquemtica de uma membrana plasmtica celular e de um gradiente de concentrao de uma pequena molcula X ao longo dessa membrana.
167

[Na+] mM

PV2D-06-BIO-14

[K+] mM

Pela observao feita, podemos armar que as solues 1 e 2 eram, respectivamente: a) hipertnica e hipotnica. b) hipotnica e hipertnica. c) ambas hipotnicas. d) ambas hipertnicas. e) isotnica e hipertnica. Com base nesse esquema, considere as seguintes armativas: I. A molcula X pode se movimentar por difuso simples, atravs dos lipdios, caso seja uma molcula apolar. II. A difuso facilitada da molcula X acontece quando ela atravessa a membrana com o auxlio de protenas carreadoras, que a levam contra seu gradiente de concentrao. III. Se a molcula X for um on, ela poder atravessar a membrana com o auxlio de uma protena carreadora. IV. O transporte ativo da molcula X ocorre do meio extracelular para o citoplasma. Assinale a alternativa correta. a) Somente as armativas I e III so verdadeiras. b) Somente as armativas I e II so verdadeiras. c) Somente as armativas II e IV so verdadeiras. d) Somente as armativas I, III e IV so verdadeiras. e) Somente a armativa III verdadeira. 377. Duas clulas, designadas por A e B, foram mergulhadas em meios diferentes. Logo aps, notou-se que a clula A apresentou considervel aumento de volume vacuolar, enquanto a clula B apresentou retrao de seu vacolo e de seu citoplasma. A partir desses resultados, pode-se armar que as clulas A e B foram megulhadas em solues, respectivamente, a) isotnica e hipertnica. b) isotnica e hipotnica. c) hipotnica e isotnica. d) hipotnica e hipertnica. e) hipertnica e hipotnica. 378. Mackenzie-SP No laboratrio, um aluno preparou uma lmina com clulas vegetais. Em seguida, colocou uma soluo 1 e observou ao microscpio. Depois, trocou a primeira soluo por uma soluo 2 e, novamente, observou ao microscpio. A seguir, temos a situao das clulas com as duas solues. 379. Fuvest Uma clula vegetal retirada de uma soluo isotnica 1, mergulhada em uma soluo hipertnica 2, e a seguir colocada em uma soluo 3, que apresenta concentrao idntica inicial 1.

a) O que acontece com a clula em 2? b) E em 3? 380. Quando uma clula colocada em meio hipertnico, ela perde sua turgescncia. O fenmeno , especicamente, denominado: a) clasmocitose. d) emeicitose. b) endocitose. e) plasmlise. c) deplasmlise. 381. Assinale a alternativa correta. Colocando-se uma alga de gua doce na gua salgada: a) ela absorver maior quantidade de gua que na gua doce. b) ela perder gua para o novo meio. c) ela absorver igual quantidade de gua que na gua doce. d) ela se adaptar facilmente ao novo ambiente. e) ela ultrapassar seu limite de turgescncia, rompendo a sua parede celular. 382. UFU-MG

O esquema acima representa uma clula vegetal que foi isolada e colocada em uma soluo. Interpretandose o fenmeno ocorrido, incorreto armar que:
168

a) a soluo hipertnica em relao ao suco vacuolar. b) ocorreu sada de gua do vacolo. c) a membrana plasmtica permevel gua. d) a clula sofreu plasmlise e a membrana plasmtica afastou-se da parede clular. e) a clula pode voltar ao normal se colocada em soluo isotnica. 383. O desenho abaixo representa uma clula normal colocada em 3 meios distintos, que denominamos A, B e C. Durante a sua passagem por esses meios naquela ordem, ocorrem 2 fenmenos conhecidos, respectivamente, como:

mantiveram o seu tamanho normal. Qual a concluso do estudante quanto: a) concentrao das solues salinas nos recipientes I e II, em relao ao suco celular desse tecido? b) o que signica dizer que, em I, as clulas estavam plasmolisadas? 386. UFJF-MG Observando ao microscpio clulas animais (hemcias) e clulas vegetais mantidas em meio hipotnico, percebe-se que somente as primeiras sofrem ruptura da membrana plasmtica. Essa diferena explicada pela presena nas clulas vegetais de: a) mitocndrias. d) ribossomos. b) parede celular. e) cromossomos. c) complexo golgiense. 387. Considere uma clula vegetal mergulhada em uma soluo aquosa. Considere os seguintes valores iniciais: PO = 1 atm e PT = 0,3 atm a) Qual o valor da DPD? b) Qual a tonicidade da soluo em que a clula foi mergulhada? c) At que momento haver entrada de gua na clula? d) Em qual estado a clula se encontra no nal do processo? 388. Unifor-CE A seqncia de guras abaixo representa o processo de plasmlise e deplasmlise em uma clula vegetal.

a) b) c) d) e)

turgescncia e plasmlise. plasmlise e osmose. plasmlise e deplasmlise. osmose e hemlise. deplasmlise e turgescncia.

384. Fuvest-SP Clulas vegetais, como as representadas na gura A, a seguir, foram colocadas numa determinada soluo e, no m do experimento, tinham aspecto semelhante ao da gura B. Comparando as concentraes do interior da clula na situao inicial (I), da soluo externa (II) e do interior da clula na situao nal (III), podemos dizer que:

a) I maior que II. b) I maior que III. c) I menor que II.

d) I igual a III. e) III maior que II.

As situaes I, II e III podem ocorrer quando a clula colocada, respectivamente, em: a) soluo hipertnica, soluo hipotnica e gua pura. b) soluo hipertnica, gua pura e soluo hipotnica. c) soluo hipotnica, gua pura e soluo hipertnica. d) soluo hipotnica, soluo hipertnica e gua pura. e) gua pura, soluo hipotnica e soluo hipertnica. 389. De um pimento, retiram-se 4 fatias as quais foram pesadas e mergulhadas em 4 solues A, B, C e D, de diferentes concentraes de glicose. Assim, cada fatia permaneceu mergulhada em sua respectiva soluo por cerca de 30 minutos. Aps esse perodo, as fatias foram novamente pesadas. O grco representa as variaes na massa das fatias do pimento.
169

385. Vunesp Um estudante colocou dois pedaos recm-cortados de um tecido vegetal em dois recipientes, I e II, contendo soluo salina. Depois de algumas horas, vericou que, no recipiente I, as clulas do tecido vegetal estavam plasmolisadas. No recipiente II, as clulas

PV2D-06-BIO-14

I.

Conclui-se, a partir dos resultados do experimento, que: a) as solues A e B so hipertnicas em relao ao meio interno das clulas do pimento. b) as solues A e C fazem com que as clulas do pimento percam gua. c) as solues B e D so hipotnicas em relo ao meio interno das clulas do pimento. d) a soluo C apresenta concentrao igual das clulas do pimento. e) a soluo C uma soluo isotnica e faz com que o pimento perca gua. 390. Vunesp Um pesquisador colocou clulas de raiz de cebola, hemcias humanas e alguns paramcios, separadamente, em trs tubos de ensaio numerados e tendo gua destilada. Tubo I. clulas de raiz de cebola. Tubo II. hemcias humanas. Tubo III. paramcios. Algum tempo depois, foi observado que no tubo I, as clulas tiveram seus volumes aumentados; no tubo II, as hemcias tiveram suas membranas plasmticas rompidas e a gua cou ligeiramente avermelhada; no tubo III, o volume celular dos paramcios permaneceu inalterado. Pergunta-se: a) Por que no houve alterao no volume celular dos paramcios? b) Qual a estrutura celular presente nas clulas da raiz de cebola (e ausente nas hemcias), que evitou a ruptura dessas clulas? Por que o tubo que continha hemcias cou avermelhado aps a ruptura das membranas plasmticas? 391. UFPE (modificado) Analise as consideraes sobre os processos osmticos representados nas guras abaixo:

Enquanto as clulas 1 e 4 esto em meio isotnico, a clula 2 est em meio hipotnico. II. As clulas 3, 5 e 6 esto em meio hipertnico. III. A clula 6 est em meio hipotnico e apresenta-se turgida em relao clula 4. IV. Os processos de osmose representados em todas as guras acima dependem da concentrao do meio externo, da concentrao da clula e da resistncia da parede celular. Est(o) correta(s) apenas: a) I. b) II e III. c) I e IV d) III e IV. e) III. 392. UEL-PR Clulas vegetais foram mantidas, por algum tempo, em soluo isotnica e, em seguida, transferidas para solues de NaCI de concentraes desconhecidas (frascos 1 e 2). Os grcos a seguir representam as variaes de volume encontradas nessas clulas:

De acordo com os dois grcos acima, foram feitas as seguintes armativas: I. As solues e NaCI dos frascos 1 e 2 so, respectivamente, hipotnica e hipertnica em relao s clulas vegetais. II. A presso de turgor em T2 menor nas clulas imersas no frascos 1 do que nas clulas imersas no frasco 2. III. Ocorre um aumento crescente na presso de turgor a partir do momento em que as clulas so mergulhadas no frasco 2. IV. Ocorre um aumento crescente da resistncia da parede celular no momento em que as clulas so mergulhadas no frasco 1 a) I e II. b) II e III. c) III e IV. d) I, II e III. e) I, III e IV.

170

393. O esquema abaixo mostra o comportamento de uma clula vegetal submetida a duas condies osmticas diferentes.

Sc = suco celular (capacidade de a clula ganhar gua); Si = suco interna (tendncia entrada de gua devido suco osmtica exercida pelo vacolo); M = resistncia da membrana celulsica, que equivale tendncia de sada de gua da clula. Em relao a essas variveis, pode-se dizer que, quando: a) em meio hipotnico, em relao ao suco celular, o valor de M diminui e a clula torna-se trgida. b) em meio isotnico, em relao ao suco celular, o valor de M diminui e a clula murcha. c) em meio hipertnico, em relao ao suco celular, o valor de M aumenta e a clula torna-se plasmolisada. d) a clula est trgida, deixa de absorver gua, pois a concentrao do vacolo se iguala do meio: Si = 0 e Sc = M. e) a clula est trgida, deixa de absorver gua e M = Si. 396. Unicamp-SP Foi feito um experimento utilizando a epiderme de folha de uma planta e uma suspenso de hemcias. Esses dois tipos celulares foram colocados em gua destilada e em soluo salina concentrada. Observouse ao microscpio que as hemcias, em presena de gua destilada, estouravam e, em presena de soluo concentrada, murchavam. As clulas vegetais no se rompiam em gua destilada, mas em soluo salina concentrada notou-se que o contedo citoplasmtico encolhia. a) A que tipo de transporte celular o experimento est relacionado? b) Em que situao ocorre esse tipo de transporte? c) A que se deve a diferena de comportamento da clula vegetal em relao clula animal? Explique a diferena de comportamento, considerando as clulas em gua destilada e em soluo concentrada. 397. UFRJ Na membrana citoplasmtica existe uma protena que faz o transporte tivo (com gasto de ATP) de Na+ para fora da clula. Outro tipo de protena funciona como uma espcie de porto que pode abrir ou fechar, permitindo ou no a passagem de Na+. Com o porto fechado, o Na+ acumula-se do lado de fora da clula, o que aumenta a presso osmtica externa, compensando a grande concentrao de soluto orgnico no citoplasma. Isso evita a entrada excessiva de gua por osmose. a) Que estrutura celular torna menos importante essa funo de equilbrio osmtico do Na+ nas clulas vegetais? Justique sua resposta. b) Entre as duas protenas descritas, qual delas permite o movimento do Na+ a favor do seu gradiente de concentrao? Justique.
171

a) Em que situao se encontram as clulas A e B? b) Se, no caso da clula A, o valor de PO de 12 atmosferas, qual o valor esperado, em atmosferas, de DPD e PT para essa clula? c) O que impede a clula A de sofrer lise ao ser colocada no meio I? 394. UFF-RJ O esquema abaixo representa o aspecto morfolgico de uma clula vegetal submetida a condies normais.

Caso esta clula seja exposta a solues com diferentes concentraes de soluto, sero observadas alteraes em sua morfologia, como est representado nas situaes 1 e 2, ao lado.

Classique o tipo de soluo a que a clula foi exposta nas situaes 1 e 2, e explique os fenmenos que ocorreram nos dois casos. 395. Vunesp Em clulas vegetais em meio aquoso, citoplasma e membrana plasmtica funcionam como uma membrana semipermevel. As trocas de gua ocorrem entre a soluo externa e o vacolo. A equao que relaciona as variveis que interferem na osmose em clulas vegetais : Sc = Si M, na qual

PV2D-06-BIO-14

Captulo 05
398. UFSC (modificado) Uma descoberta fundamental para a cincia biomdica completou 100 anos. Em abril de 1898, o mdico citologista italiano Camilo Golgi revelou a existncia, dentro das clulas nervosas, de uma estrutura at ento desconhecida... Esta estrutura foi denominada, quase meio sculo depois, complexo de Golgi, em homenagem a seu descobridor. Com relao a esta estrutura, correto armar que: 01. no foi observada, ainda, em nenhum outro tipo de clula, alm das clulas nervosas citadas no texto. 02. sua funo concentrar, modificar e eliminar secrees. 04. nela, as duas subunidades do ribossomo se acoplam. 08. um local onde ocorre alta sntese de lipdios. 16. formada por vrios conjuntos interligados de sculos achatados. 399. PUC-MG (modificado) Sobre a organela representada a seguir, incorreto armar que:
Cincia Hoje, vol. 25, 145, 1998, p. 74.

a) Retculo endoplasmtico granular e complexo de Golgi. b) Retculo endoplasmtico granular e lisossomos. c) Complexo de Golgi e mitocndrias. d) Mitocndrias e lisossomos. e) Retculo endoplasmtico liso e complexo de Golgi. 402. F.M. Jundia-SP As clulas utilizam leucina para produzir material de secreo. Assim, se uma clula absorver leucina radiativa, depois de algum tempo haver radiatividade, principalmente: a) na membrana. b) nos vacolos. c) nas mitocndrias. d) no complexo de Golgi. e) nos lisossomos. 403. Mackenzie-SP Na clula representada a seguir, a produo, o armazenamento e a secreo de protenas so funes exercidas, respectivamente, pelas organelas:

a) est presente em clulas eucariticas animais e vegetais. b) est relacionada com o processo de secreo celular. c) pode formar vesculas de secreo com protenas produzidas no retculo endoplasmtico rugoso. d) sintetiza protenas e as armazena no lisossomo. e) bem desenvolvida em estruturas glandulares. 400. Unip-SP Uma clula que apresenta grande quantidade de mitocndrias e ribossomos, retculo endoplasmtico e complexo de Golgi bem desenvolvidos especializada em: a) absorver alimentos. b) secretar protenas. c) digerir alimentos. d) eliminar excretas. e) transmitir impulsos nervosos. 401. UFV-MG Assinale a alternativa que contm as organelas celulares relacionadas com a sntese e a secreo de protenas, respectivamente.
172

a) I, III e V. b) I, II e IV. c) II, III e V.

d) I, IV e V. e) II, III e IV.

404. UFU-MG (modificado) A insulina comea a ser sintetizada (I) em uma rede de tbulos membranosos interligados; transferida para o interior de cisternas empilhadas, onde sofre modicaes (II), e, em seguida, secretada (III). Todos esses processos so dependentes de energia da respirao (IV). A correspondncia correta entre processo e organela : a) (I) retculo endoplasmtico liso, (II) lisossomo e (III) mitocndria. b) (II) mitocndria, (III) lisossomo e (IV) retculo endoplasmtico liso. c) (I) retculo endoplasmtico rugoso, (III) lisossomo e (IV) complexo de Golgi. d) (II) complexo de Golgi, (III) retculo endoplasmtico rugoso e (IV) lisossomo. e) (I) retculo endoplasmtico rugoso, (II) complexo de Golgi e (IV) mitocndria.

405. UFU As clulas dos cinos pancreticos so responsveis pela produo das enzimas digestivas do suco pancretico. Todo o processo de produo e secreo dessas enzimas pode ser acompanhado por meio de aminocidos marcados com trtio (istopo radioativo de hidrognio). O esquema abaixo mostra uma clula pancretica, onde o caminho percorrido por aminocidos marcados com esse istopo radioativo est assinalado com os nmeros 1,2 e 3.

Com bases nesses dados, pode-se armar que o caminho percorrido pelos aminocidos radioativos foi a) VS, CG, REG. d) VS, REG, CG. b) CG, VS, REG. e) REG, VS, CG. c) REG, CG, VS. 407. PUCCamp-SP Clulas endodrmicas indiferenciadas e totipotentes da gstrula dos vertebrados podem originar clulas altamente especializadas, como o caso das clulas dos cinos pancreticos que secretam enzimas digestivas. Os grnulos de secreo dessas clulas so liberados a partir: a) do retculo endoplasmtico. b) do sistema golgiense. c) das mitocndrias. d) dos lisossomos. e) dos ribossomos. 408. UFAL Em animais mantidos em jejum, clulas do gado digerem parte de suas prprias estruturas para sobreviverem. Essa atividade desempenhada: a) pelos ribossomos. b) pelos lisossomos. c) pelas mitocndrias. d) pelo complexo de Golgi. e) pelo retculo endoplasmtico. 409. UEL-PR Considere o texto a seguir: As clulas caliciformes do intestino secretam muco que constitudo, fundamentalmente, por glicoprotenas. A parte protica do muco sintetizada _________ (I) e a polissacardica, _______ (II). Para completar o texto corretamente, I e II devem ser substitudos, respectivamente, por: a) nos ribossomos e nas mitocndrias. b) nas mitocndrias e no complexo de Golgi. c) no complexo de Golgi e nas mitocndrias. d) no retculo endoplasmtico rugoso e no complexo de Golgi. e) no retculo endoplasmtico rugoso e nas mitocndrias. 410. PUCCamp-SP O esquema abaixo representa um espermatozide humano.

Adaptado de LOPES, S. BIO. So Paulo: Saraiva, v.I,2002

a) o que acontece na estrutura assinalada com o nmero 1? b) o que representam as estruturas assinaladas com os nmeros 2 e 3? c) o que acontece com a estrutura assinalada com o nmero 3? 406. Um grupo de ratos recebeu injeo endovenosa de uma soluo contendo aminocidos radioativos. Aps cinco minutos, os ratos foram anestesiados e, em intervalos de tempo diferentes, as clulas do pncreas foram removidas, xadas e coradas com sais de prata que revelam a localizao dos aminocidos radioativos no interior da clula por meio de microscpio eletrnico. A tabela a seguir mostra a porcentagem de aminocidos radioativos por componente celular em cada intervalo de tempo. Componente celular Minutos aps a injeo 5 10 15 40 50 10 20 35 40 25 30 25 25 50 40 60 20 20 60 18 10 72

Retculo endoplasmtico 100 50 granular (REG) Complexo de Golgi (CG)


PV2D-06-BIO-14

0 0

50 0

Vesculas de secreo (VS) Total

100 100 100 100 100 100 100

Os centrolos e o complexo de Golgi participam, respectivamente, na formao das estruturas a) IV e I d) II e IV b) V e III e) III e V c) I e II
173

411. PUC-PR De acordo com a nova nomenclatura anatmica, a organela celular, complexo de Golgi, passou a ser tambm conhecida por Sistema Golgiense. Esta estrutura est relacionada com as funes: I. Armazenamento de protenas produzidas no retculo endoplasmtico rugoso. II. Liberao de bolsas contendo substncias secretadas na clula. III. Produo de lisossomos, estruturas contendo enzimas digestivas. IV. Formao do acrossomo, localizado na cabea do espermatozide. So verdadeiras: a) apenas I, II e III. d) apenas II, III e IV. b) I, II, III e IV. e) apenas I e IV. c) apenas I, II e IV. 412. UFPA O aspecto comum do complexo de Golgi, em clulas animais, deduzido atravs de observaes ao microscpio eletrnico, de: a) vesculas formadas por dupla membrana, sendo a interna sem granulaes e com dobras voltadas para o interior. b) membranas granulosas delimitando vesculas e sacos achatados que se dispem paralelamente. c) um complexo de membranas formando tubos anastomosados, com dilataes em forma de disco. d) sacos e vesculas achatados, formados por membrana dupla em que a interna, cheia de grnulos, emite prolongamento para o interior em forma de dobras. e) membranas lisas, delimitando vesculas e sacos achatados, que se dispem paralelamente. 413. PUC-SP A estrutura representada no desenho abaixo :

c) armazenamento de secrees e fermentao. d) cadeia respiratria e sntese de protenas. e) fermentao e sntese de glicdios. 415. UFR-RJ Os processos de secreo celular so feitos na seqncia: a) aparelho de Golgi, retculo endoplasmtico granular, retculo endoplasmtico agranular, vesculas de transferncia. b) vesculas de transferncia, retculo endoplasmtico agranular, aparelho de Golgi, grnulos de secreo. c) retculo endoplasmtico granular, vesculas de transferncia, aparelho de Golgi, grnulos de secreo. d) aparelho de Golgi, vesculas de transferncia, retculo endoplasmtico granular, grnulos de secreo. e) retculo endoplasmtico agranular, grnulos de secreo, aparelho de Golgi, vesculas de transferncia. 416. FGVSP (modificado) No pncreas, existem estruturas glandulares chamadas cinos nas quais, a partir de aminocidos, so produzidas as enzimas digestivas do suco pancretico. Em um experimento, utilizaram-se aminocidos com istopos radioativos para se vericar o trajeto desses aminocidos nas clulas secretoras do pncreas. Nas clulas dos cinos, os aminocidos constituintes das enzimas digestivas percorreram o seguinte trajeto: a) gros de zimognio, complexo golgiense, peroxissomos. b) ergastoplasma, complexo golgiense, gros de zimognio. c) citoplasma, retculo endoplasmtico liso, complexo golgiense. d) retculo endoplasmtico liso, complexo golgiense, gros de zimognio. e) complexo golgiense, ergastoplasma, gros de zimognio. 417. Fuvest-SP O esquema adiante representa um corte de clula acinosa do pncreas, observado ao microscpio eletrnico de transmisso.

a) o complexo de Golgi, corpsculo rico em cidos nuclicos, presente no ncleo de clulas secretoras. b) o complexo de Golgi, responsvel pela sntese de enzimas da cadeia respiratria, presente no citoplasma dos vegetais inferiores. c) a mitocndria, orgnulo responsvel pela respirao celular. d) o complexo de Golgi, que tem por uma das funes a secreo celular. e) a mitocndria, orgnulo rico em RNA, DNA e enzimas, presente tanto no ncleo como no citoplasma das clulas secretoras. 414. UEL-PR No complexo de Golgi pode ocorrer: a) armazenamento de secrees e cadeia respiratria. b) armazenamento de secrees e sntese de glicoprotenas.
174

a) Identique as estruturas apontadas pelas setas A, B, e C e indique suas respectivas funes no metabolismo celular. b) Por meio da ordenao das letras indicadoras das estruturas celulares, mostre o caminho percorrido pelas enzimas componentes do suco pancretico desde seu local de sntese at sua secreo pela clula acinosa.

418. FMTMMG Clulas de um certo tecido animal foram isoladas e mantidas em meio de cultura. Em seguida, as clulas foram igualmente distribudas em 3 frascos (I, II e III), contendo iguais quantidades de meio de cultura acrescido de um aminocido marcado com o istopo radioativo 35S. De cada um dos frascos, foram retiradas algumas amostras para anlise em microscpio. As clulas retiradas do frasco I evidenciaram grande acmulo do material radioativo no retculo endoplasmtico rugoso. J as do frasco II mostravam acmulo do material radioativo em vesculas de secreo. As clulas do frasco III apresentavam maior acmulo do material radioativo no aparelho de Golgi. a) Qual dos trs frascos permaneceu por menos tempo em cultura? b) Justique sua resposta. 419. UFPE Coloque V (verdadeiro) ou F (falso) As clulas dos cinos pancreticos produzem as enzimas necessrias para a digesto dos alimentos que chegam ao duodeno; para isso, devemos encontrar nessas clulas: ( ) um retculo endoplasmtico liso bem desenvolvido, uma vez que este retculo essencial para a sntese de lipdios. ( ) um sistema de canalculos que permite a estocagem das enzimas na forma ativa sem destruir a clula. ( ) um retculo endoplasmtico rugoso bem desenvolvido, responsvel pela sntese de protenas. ( ) abundantes grnulos de secreo, resultantes do empacotamento das protenas no aparelho de Golgi. ( ) ausncia de grnulos secretores, pois as enzimas so sintetizadas e liberadas imediatamente. 420. UnicampSP Cortes de clulas do pncreas foram incubados durante trs minutos em meio contendo leucina tritiada (aminocido radioativo). Aps vrios intervalos de tempo, esse material foi submetido a uma tcnica que revela a localizao do aminocido radioativo na clula pela deposio de grnulos de prata. O estudo do material ao microscpio eletrnico permitiu a construo da gura seguinte:

421. PUCCamp-SP Considere os seguintes eventos numa clula produtora de mucopolissacardios. I. Sntese de polipeptdios. II. Combinao de acares com polipeptdios. III. Formao dos gros de secreo. O complexo de Golgi responsvel apenas por: a) I. d) I e II. b) II. e) II e III. c) III. 422. Fuvest-SP (modificado) O esquema representa um espermatozide humano e algumas das estruturas que o compem.

a) Qual a importncia de cada uma das estruturas numeradas de 1 a 4 para a reproduo? b) Quais organelas esto envolvidas com a origem de 1 e 4? 423. Vunesp Foram coletadas trs amostras de espermatozides de um rato adulto apto para reproduo e colocadas separadamente em trs tubos de ensaio. Cada uma destas amostras foi submetida a uma situao experimental: Tubo 1: Todos os espermatozides tiveram um determinado tipo de organide extrado do citoplasma atravs de uma microagulha. Tubo 2: Todos os espermatozides tiveram outro tipo de organide citoplasmtico extrado. Tubo 3: Todos os espermatozides foram mantidos intactos e utilizados como controle. Em seguida, as trs amostras foram introduzidas, cada uma separadamente, nos colos uterinos de trs ratazanas em condies de serem fertilizadas. Durante o experimento, vericou-se que: os espermatozides do tubo 1 se aproximaram dos vulos, mas nenhum deles conseguiu perfurar suas membranas plasmticas; os espermatozides do tubo 2 no foram alm do colo uterino e sofreram um processo degenerativo aps 48 horas; os espermatozides do tubo 3 caminharam at os vulos e todos foram fertilizados. a) Quais foram os organides extrados dos espermatozides dos tubos 1 e 2? b) Quais as funes desses organides? 424. Fuvest-SP O esquema representa uma clula secretora de enzimas em que duas estruturas citoplasmticas esto indicadas por letras (A e B). Aminocidos radioativos incorporados por essa clula concentram-se inicialmente na regio A. Aps algum tempo, a radioatividade passa a se concentrar na regio B e, pouco mais tarde, pode ser detectada fora da clula.
175

PV2D-06-BIO-14

A partir desses resultados, descreva o trajeto percorrido pelo aminocido radioativo no interior da clula e explique por que a leucina segue esta rota.

a) clasmocitose b) pinocitose c) fagocitose

d) exocitose e) citocinese

428. FCC-SP Observe o esquema abaixo.

a) Explique, em termos funcionais, a concentrao inicial de aminocidos radioativos na estrutura celular A. b) Como se explica a deteco da radioatividade na estrutura B e, em seguida, fora da clula? 425. UFSC Estudos preliminares em mineiros da regio carbonfera de Cricima tm apresentado resultados preocupantes com relao pneumoconiose, que uma afeco pulmonar, provocada pela inalao de poeira do carvo e de outros minrios. Essa uma doena ligada leso da membrana lisossmica. Com relao aos lisossomos, assinale a(s) alternativa(s) correta(s). 01. So estruturas nucleares. 02. Originam-se a partir do complexo de Golgi. 04. So ricos em enzimas. 08. So os responsveis pela digesto intracelular. 16. Em clulas vegetais auxiliam o processo fotossinttico. 32. Ao unirem-se aos fagossomos, formam vacolos digestivos. 426. PUC-SP No interior da clula, o ATP produzido em um processo (I) utilizado na sntese de enzimas digestivas (II) e no mecanismo de digesto de partculas fagocitadas (III).Trs componentes celulares relacionados direta e respectivamente com I, II e III so: a) mitocndria, ribossomo e lisossomo. b) mitocndria, cromossomo e lisossomo. c) cloroplasto, cromossomo e lisossomo. d) cloroplasto, lisossomo e ribossomo. e) cromossomo, mitocndria e ribossomo. 427. PUC-RJ O processo representado na gura, que mostra um organismo unicelular eucarioto durante o processo de alimentao, denominado:

O processo representado chama-se: a) clasmocitose. d) osmose. b) fagocitose. e) difuso. c) pinocitose. 429. Fuvest-SP D duas diferenas entre os processos de pinocitose e fagocitose. 430. As clulas internalizam substncias pelos processos de endocitose, conhecidos como fagocitose e pinocitose. Os vacolos formados, respectivamente, por fagocitose e pinocitose so: a) pinossomos e fagossomos. b) vacolos digestivos. c) fagossomos e pinossomos. d) vacolos residuais. e) pseudpodes e canal pinoctico. 431. Fuvest-SP Clulas animais, quando privadas de alimento, passam a degradar partes de si mesmas como fonte de matria-prima para sobreviver. A organela citoplasmtica diretamente responsvel por essa degradao : a) o aparelho de Golgi. b) o centrolo. c) o lisossomo. d) a mitocndria. e) o ribossomo. 432.

De acordo com o esquema acima e seus conhecimentos, marque a alternativa falsa.


176

a) b) c) d) e)

A representa o retculo endoplasmtico granular. B representa o complexo golgiense. C representa o retculo endoplasmtico agranular. 1 pode ser os lisossomos. 2 a secreo celular.

436. Unifor-CE A gura a seguir representa uma ameba em diferentes etapas da sua alimentao.

433. UnB-DF A gura adiante representa a fagocitose de uma bactria e alguns eventos celulares subseqentes. Em I e II so mostrados, respectivamente, os processos de: a) clasmocitose e pinocitose. b) fagocitose e pinocitose. c) pinocitose e fagocitose. d) clasmocitose e fagocitose. e) fagocitose e clasmocitose. Com base na gura, julgue os seguintes itens: 1. A estrutura lipoprotica das membranas celulares permite-lhe grande mobilidade e eventos como invaginao e fuso. 2. I representa um lisossomo primrio e III, um lisossomo secundrio. 3. II uma organela rica em proteases, nucleases e lipases. 4. No interior de IV, encontram-se aminocidos, acares e nucleotdeos provenientes da lise da bactria. 434. O esquema abaixo representa uma clula, onde esto numeradas algumas estruturas (I, II, III e IV) e alguns processos (A, B, C) importantes na digesto intracelular. Descreva a relao entre as estruturas e os processos esquematizados. 437. PUC-MG A modelagem dos dedos do embrio humano ocorre por destruio da membrana que une os dedos e que semelhante inicialmente ao p de um pato, muito til no processo de natao. Esse processo de destruir essa membrana, que ocorre pela ao dos lisossomos, denominado: a) hemlise. d) autofagia. b) plasmlise. e) heterofagia. c) autlise. 438. Durante a metamorfose dos anfbios, a cauda desaparece ao mesmo tempo em que os seus constituintes celulares so digeridos e seus produtos so utilizados no desenvolvimento do animal, como representado no grco a seguir:

PV2D-06-BIO-14

435. FESP Na digesto intracelular, os lisossomos fundem-se com o fagossomo, originando o vacolo digestivo do material ingerido. Aps a absoro das partculas teis, restaro, no interior do vacolo digestivo, partculas que sero eliminadas para o meio externo atravs do processo denominado: a) clasmocitose. b) fagocitose. c) pinocitose. d) ultrafagocitose. e) plasmlise.

A organela celular que participa ativamente desse processo : a) o lisossomo. d) o plasto. b) o peroxissomo. e) o centrolo. c) a mitocndria.
177

439. Os lisossomos so organelas membranosas, com formato esfrico presentes no citoplasma das clulas. Eventualmente so chamados de bolsas suicidas. Essa denominao pode estar correta, pois: a) esto presentes apenas nas clulas eucariticas. b) apresentam enzimas digestivas. c) participam da diviso celular. d) sintetizam protenas que atuam na morte celular. e) impedem a respirao celular. 440. Unicamp-SP No citoplasma das clulas so encontradas diversas organelas, cada uma com funes especcas, mas interagindo e dependendo das outras para o funcionamento celular completo. Assim, por exemplo, os lisossomos esto relacionados ao complexo de Golgi e ao retculo endoplasmtico rugoso, e todos s mitocndrias. a) Explique que relao existe entre lisossomos e complexo de Golgi. b) Qual a funo dos lisossomos? c) Por que todas as organelas dependem das mitocndrias? 441. Fuvest-SP Certas doenas hereditrias decorrem da falta de enzimas lisossmicas. Nesses casos, substncias orgnicas complexas acumulam-se no interior dos lisossomos e formam grandes incluses que prejudicam o funcionamento das clulas. a) O que so lisossomos e como eles contribuem para o bom funcionamento de nossas clulas? b) Como se explica que as doenas lisossmicas sejam hereditrias se os lisossomos no so estruturas transmissveis de pais para lhos? 442. UFC-CE Suponha que voc esteja trabalhando com uma suspenso de clulas animais, a partir da qual voc deseje isolar uma protena. Durante a preparao, vrios lisossomos sofrem ruptura. Como conseqncia disso, ocorreria: a) liberao de cidos nuclicos, que dicultariam o isolamento da macromolcula que voc est tentando obter. b) liberao de ATP, que facilitaria o processo de isolamento da macromolcula de seu interesse. c) liberao de enzimas, que poderiam digerir a macromolcula que voc est tentando isolar. d) liberao de macromolculas proticas recmsintetizadas nos lisossomos, o que aumentaria a quantidade da protena a ser obtida. e) interrupo da sntese de protenas enzimticas nos lisossomos, diminuindo a quantidade da protena a ser obtida.
178

443. UFSC (modificado) Os lisossomos so organides membranosos, com formato esfrico, que contm enzimas digestivas. Em relao a essa estrutura citoplasmtica, assinale a(s) proposio(es) correta(s). 01. Os lisossomos desempenham a importante funo de digesto intracelular. 02. As enzimas lisossmicas so fabricadas no retculo endoplasmtico liso, passando em seguida para o sistema de Golgi, que as empacota e as libera sob a forma de lisossomos secundrios. 04. A funo heterofgica dos lisossomos refere-se digesto de substncias que so englobadas pela clula por fagocitose ou pinocitose. 08. O lisossomo secundrio formado pela fuso do vacolo alimentar, que contm o alimento englobado por pinocitose ou fagocitose, com o lisossomo primrio, que contm as enzimas digestivas. 16. Juntamente com as mitocndrias, os lisossomos so responsveis por uma reciclagem de molculas e organides inativos. 32. A origem dos lisossomos est relacionada com a atividade do complexo de Golgi a partir da formao de vesculas de secreo, que contm enzimas digestivas produzidas no retculo endoplasmtico rugoso. 444. Assinale a alternativa incorreta: a) A difuso simples um tipo de transporte passivo atravs da membrana plasmtica que ocorre quando existem condies de gradiente de concentrao sem haver gasto de energia. b) A difuso facilitada utiliza protenas carreadoras para o transporte de aucares simples e aminocidos atravs da membrana constituindo, por essa razo, um processo de transporte ativo. c) A membrana plasmtica formada por uma camada bimolecular de fosfolipdeos onde esto dispersas molculas de protenas dispostas como um mosaico. d) Qualquer processo de captura por meio de envolvimento de partculas chamado de endocitose. e) Na fagocitose a clula engloba partculas slidas atravs da emisso de pseudpodes que as englobam formando um vacolo alimentar denominado fagossomo. 445. Vunesp O que acontece com: a) substncias estranhas fagocitadas pelas clulas? b) estruturas celulares em processo de degenerao?

446. OSECSP Dados os dois processos citolgicos a seguir, correto armar:

a) Os lisossomos (1) so pequenas vesculas que contm enzimas responsveis pela digesto intracelular. b) A autofagia (2) pode representar um meio de reciclagem do material celular. c) Os vacolos digestivos (3) originam-se da fuso de lisossomos com fagossomos ou pinossomos. d) Os vacolos residuais (4) so bolsas membranosas onde se processa a digesto autofgica. e) Clasmocitose (5) o processo de eliminao de resduos resultantes da digesto intracelular para o exterior da clula. 449. Vunesp No esquema esto representadas etapas, numeradas de 1 a 3, de um importante processo que ocorre no interior das clulas, e algumas organelas envolvidas direta ou indiretamente com esse processo.

a) Ambos so destinados absoro de gotculas. b) O processo A prprio para englobar bactrias e o processo B para absorver gotculas. c) O processo A emite pseudpodos e o processo B engloba bactrias. d) O processo A invagina a membrana e o processo B emite pseudpodos. e) Ambos os processos so utilizados para englobar bactrias. 447. Fuvest-SP Sabemos que, quando substncias estranhas s clulas so englobadas por elas, atravs de fenmenos de endocitose, essas substncias podero funcionar como alimentos. Se isso ocorrer, vai iniciar-se o ciclo de digesto intracelular, que envolve o aparecimento dos seguintes eventos, sucessivamente: a) fagossomo, vacolo digestivo, corpo residual e defecao celular. b) vacolo digestivo, fagossomo, defecao celular e corpo residual. c) endocitose, digesto intracelular, fagossomo e defecao celular. d) vacolo autofgico, ataque lisossmico e defecao celular. e) digesto intracelular, acmulo de reservas no Golgi e produo de fagossomo. 448. UFPE Como mostrado na gura a seguir, substncias capturadas do meio externo, assim como partes componentes da prpria clula, sofrem digesto intracelular.

As etapas que correspondem a 1, 2 e 3, respectivamente, e algumas organelas representadas no esquema esto corretamente listadas em: a) absoro de aminocidos, sntese protica e exportao de protenas; retculo endoplasmtico, lisossomo e mitocrndria. b) fagocitose de macromolculas, digesto celular e egesto de resduos; retculo endoplasmtico, Complexo de Golgi e lisossomos. c) fagocitose de sais minerais, fotossntese e exportao de compostos orgnicos; cloroplastos e vacolos. d) absoro de oxignio, respirao celular e eliminao de dixido de carbono; mitocndrias e vacolos. e) fagocitose de macromolculas, digesto celular e exportao de protenas; mitocndrias e lisossomos. 450. PUC-MG Autofagia e autlise: a) so denominaes diferentes para o mesmo fenmeno. b) so fenmenos diferentes, sendo que, no primeiro, a clula capta partculas nutritivas do meio extracelular. c) so fenmenos diferentes, sendo que, no segundo, a clula destruda pela ruptura dos lisossomos. d) constituem o mesmo tipo de fenmeno, em que a clula busca alimento no meio extracelular.

PV2D-06-BIO-14

Com relao aos processos ilustrados, assinale a alternativa incorreta.

e) constituem o mesmo tipo de fenmeno, sendo que o primeiro corresponde fagocitose e o segundo, pinocitose.
179

451. CesgranrioRJ Os lisossomos participam de processos intracelulares que podem ser resumidos da seguinte maneira: I. partculas provenientes do meio externo, includas em fagossomos, so desdobradas em substncias utilizveis pelas clulas. II. Na ausncia de nutrio adequada, algumas estruturas, como as mitocndrias e componentes do retculo endoplasmtico, so digeridas e o seu material aproveitado em outras funes essencialmente vitais. III. Pelo estmulo de substncias ou aes lesivas, os lisossomos podem ser rompidos, havendo destruio e morte celular. Os trs processos acima descritos so, respectivamente, denominados: a) fagocitose, autofagia e autlise. b) c) d) e) fagocitose, digesto intracelular e autofagia. autofagia, necrose e autlise. autlise, autofagia e hidrlise. digesto intracelular, necrose e digesto extracelular.

452. Unicamp-SP comum, nos dias de hoje, ouvirmos dizer: estou com o colesterol alto no sangue. A presena de colesterol no sangue, em concentrao adequada, no problema, pois um componente importante ao organismo. Porm, o aumento das partculas LDL (lipoprotena de baixa densidade), que transportam o colesterol no plasma sangneo, leva formao de placas aterosclerticas nos vasos, causa freqente de infarto do miocrdio. Nos indivduos normais, a LDL circulante internalizada nas clulas atravs de pinocitose e chega aos lisossomos. O colesterol liberado da partcula LDL e passa para o citosol para ser utilizado pela clula. a) O colesterol liberado da partcula LDL no lisossomo. Que funo essa organela exerce na clula? b) A pinocitose um processo celular de internalizao de substncias. Indique outro processo de internalizao encontrado nos organismos e explique no que difere da pinocitose. c) Cite um processo no qual o colesterol utilizado.

Captulo 6
453. Cesgranrio-RJ 454. Fatec-SP O ciclo a seguir esquematizado envolve duas importantes estruturas celulares I e II.

Sobre o esquema anterior, so feitas as seguintes armativas: I. a formao de molculas de protenas uma reao de degradao;

II. atravs de reaes de sntese que o ser vivo consegue energia para a sua vida; III. o conjunto das reaes de sntese e degradao constituem o metabolismo. A(s) armativa(s) correta(s) (so): a) apenas a I. b) apenas a II. c) apenas a III. d) apenas a I e a II. e) apenas a II e a III. correto armar que: a) as estruturas celulares I e II ocorrem apenas nos vegetais. b) as estruturas celulares I e II ocorrem nos animais e vegetais. c) a estrutura celular I ocorre apenas nos vegetais, e a II, apenas nos animais. d) a estrutura celular I ocorre apenas nos vegetais, e a II ocorre nos animais e vegetais. e) a estrutura celular I ocorre nos animais e vegetais, e a II ocorre apenas nos vegetais.
180

455. PUC-SP Os esquemas a seguir representam aspectos ultraestruturais de dois orgnulos presentes no citoplasma de uma clula vegetal.

458. E.E. Mau-SP Cite os produtos nais da fotossntese e da respirao aerbica. 459. Fatec-SP Considere o esquema abaixo:

a) Identique esses orgnulos. b) Qual a relao funcional existente entre eles? 456. Fuvest-SP Em artigo publicado no suplemento Mais!, do jornal Folha de So Paulo, Jos Reis relata que pesquisadores canadenses demonstraram que a alga unicelular Cryptomonas resulta da fuso de dois organismos, um dos quais englobou o outro ao longo da evoluo. Isso no novidade no mundo vivo. Como relata Jos Reis: [...] hoje corrente em Biologia, aps haver sido muito contestada inicialmente, a noo de que certas organelas [...] so remanescentes de clulas que em tempos idos foram ingeridas por clula mais desenvolvida. D-se a esta o nome de hospedeira e o de endossimbiontes s organelas que outrora teriam sido livres. So exemplos de endossimbiontes em clulas animais e em clulas de vegetais, respectivamente: a) aparelho de Golgi e centrolos. b) centrolos e vacolos. c) lisossomos e cloroplastos. d) mitocndrias e vacolos. e) mitocndrias e cloroplastos. 457. FGVSP (modificado) Os processos de respirao e fotossntese so complementares e fundamentais para os seres vivos. Assinale as correspondncias de letras (da tabela) e nmeros (do esquema) que demonstram esta interao.

Se o nmero 2 representa H2O e CO2, tem-se: A


a) b) c) d) e) respirao fotossntese respirao fotossntese fotossntese

B
fotossntese respirao fotossntese respirao respirao

1
C6H12O6 e O2 C6H12O6 e O2 C6H12O6 e CO2 CO2 e O2 H3PO4 e O2

460. Unifor-CE Considere os seguintes processos: I. Sntese de glicose a partir de gua e gs carbnico. II. Transformao da glicose em demais substncias orgnicas. III. Degradao da glicose para liberao da energia. Assinale a alternativa da tabela que indica corretamente os organismos onde eles ocorrem. Auttrofos a) b) c) d) e) I / II / III I / II / III I / II I / II I Hetertrofos I / II / III II / III II / III III II / III

a) luz b) ATP c) H2O


PV2D-06-BIO-14

d) glicose e) CO2 f) O2

461. PUCCamp-SP (modificado) Protenas, carboidratos e lipdios so fontes de energia para os organismos. Durante o metabolismo das protenas e carboidratos, a energia liberada na oxidao dessas substncias usada diretamente na: a) sntese de molculas de AMP. b) sntese de molculas de ATP. c) degradao de molculas de ADP. d) oxidao de molculas de ATP. e) reduo de molculas de CO2. 462. A molcula do ATP constituda por: a) uma adenina, uma ribose e trs fosfatos. b) uma adenina, trs riboses e um fosfato. c) trs adeninas, uma ribose e um fosfato. d) uma adenina, trs riboses e trs fosfatos. e) trs adeninas, uma ribose e trs fosfatos.
181

a) b) c) d) e)

I a; II d; III c; IV f; V e; VI b. I a; II d; III c; IV e; V b; VI f. I f; II d; III a; IV b; V e; VI c. I b; II a; III c; IV f; V e; VI d. I a; II e; III c; IV d; V b; VI f.

463. Uespi O ATP funciona dentro da clula como uma moeda energtica que pode ser gasta em qualquer momento, quando a clula necessitar. Analise a gura e assinale a alternativa que responde corretamente a questo. 1. Em A tem-se um nucleotdeo. 2. Em B tem-se um nucleosdeo. 3. Em C tem-se um nucleosdeo monofosfatado. 4. Em D tem-se uma molcula de adenosina trifosfato. Est(o) correta(s) apenas:

466. Fuvest-SP Um automvel, movido a gasolina ou a lcool, est, em ltima anlise, utilizando luz solar. Justique essa armao. 467. UFPI A fotossntese fundamental para reciclagem do carbono, oxignio e gua na biosfera porque: a) os autotrcos fotossintticos utilizam a luz, CO2 e H2O para formao de compostos orgnicos que, quando utilizados pelos heterotrcos, liberaro CO2 e H2O. b) os autotrcos fotossintticos utilizam a luz, compostos orgnicos e O2 para formao de CO2 e H2O, que sero utilizados pelos heterotrcos para formao de compostos orgnicos. c) a reciclagem de energia necessria sntese de molculas simples ocorre atravs da captao da luz pelos heterotrcos. d) a liberao de CO2, O2 e H2O das macromolculas orgnicas se deve luz captada pelos organismos fotossintticos. e) a gua absorvida pelos organismos fotossintticos reage com o CO2 para formar carboidratos, que, quando utilizados pelos heterotrcos, liberaro O2. 468. UFBA Respirao e fotossntese so processos opostos de vital importncia para os seres vivos. O processo de respirao pode ser representado por: C6H12O6 + 6 O2 6 CO2 + 6 H2O + Energia Com base nas informaes anteriores, pode-se armar: 01. Respirao uma reao de combusto. 02. Na fotossntese, as plantas usam dixido de carbono do ar atmosfrico para produzir acares, entre outras substncias. 04. A fotossntese uma reao de oxidao. 08. Durante a respirao, um mol de oxignio forma seis mols de dixido de carbono. 16. A respirao um processo exotrmico. Some os itens corretos. 469. Fuvest-SP Considere os esquemas a seguir, nos quais as setas indicam absoro ou eliminao de gs.

a) 2, 3 e 4 b) 1 e 2 c) 2 e 3 464.

d) 1 e) 4

A respeito das organelas A e B, presentes em clulas vegetais, so feitas as armaes: I. Os produtos do processo realizado pela organela A servem de reagentes para o processo realizado pela organela B. II. Todos os seres vivos possuem essas organelas. III. Ambas so capazes de autoduplicao e de produzir suas protenas. Assinale: a) se somente a armao I estiver correta. b) se somente as armaes I e III estiverem corretas. c) se somente as armaes II e III estiverem corretas. d) se todas as armaes estiverem corretas. e) se somente a armao III estiver correta. 465. Fuvest-SP Responda: a) Que processos ocorrem, respectivamente, nos cloroplastos e nas mitocndrias de uma clula? b) Como esses processos se relacionam?
182

Que alternativa que identica corretamente a substncia absorvida ou eliminada?

d) pela base nitrogenada adenina, por trs molculas de desoxirribose e por um radical fosfato. e) pela base nitrogenada adenina, por uma ribose e trs radicais fosfatos. 473. Mackenzie-SP ATP ADP Pi
I II

470. Fuvest-SP Complete a tabela a seguir, comparando a fotossntese respirao aerbica em um mesmo organismo. Fotossntese Formas de armazenamento de energia Gs consumido Gs liberado Organelas onde ocorre o processo Clulas onde ocorre o processo 471. UFRJ Dois grupos de ratos, A e B, foram colocados em cmaras de vidro transparente. No grupo A, cada cmara continha uma planta verde separada do rato por uma tela (gura a seguir). No grupo B no havia planta verde. Respirao aerbica

A respeito das reaes I e II, assinale a alternativa correta. a) A nica organela capaz de realizar I a mitocndria. b) Ambas ocorrem em todas as clulas vivas. c) Essas reaes esto envolvidas em processos como a absoro de O2 pelas clulas alveolares. d) I ocorre somente em clulas aerbicas. e) Com a reao II, a energia ca disponvel para uso da clula. 474. PUC-RS (modificado) Responda questo com base nas armativas a seguir, sobre o trifosfato de adenosina (ATP). I. O ATP um composto de armazenamento que opera como fonte de energia. II. Todas as clulas vivas precisam de ATP para captao, transferncia e armazenagem da energia livre utilizada para seu trabalho qumico. III. O ATP gerado pela hidrlise de adenosina monofosfato (AMP + Pi + energia livre). IV. O ATP sintetizado a partir da molcula de glicose, por fermentao ou atravs da respirao celular. Pela anlise das armativas, conclui-se que: a) somente I e II esto corretas. b) somente II e III esto corretas. c) somente III e IV esto corretas. d) somente I, II e IV esto corretas. e) I, II, III e IV esto corretas. 475. UFES

As cmaras foram, ento, hermeticamente fechadas e colocadas em ambiente iluminado. Aps algum tempo, os ratos de um dos grupos haviam morrido, enquanto os ratos do outro grupo resistiram por mais tempo. Qual dos dois grupos de ratos sobreviveu por mais tempo? Qual a explicao para esse fato? 472. O ATP (trifosfato de adenosina), principal molcula implicada nos processos energticos dos seres vivos, um composto constitudo: a) por protenas ligadas a agrupamentos de alta energia. b) pela protena albumina, por uma ribose e trs radicais fosfatos. c) pelas protenas actina e miosina, pela desoxirribose e por trs radicais fosfatos.

PV2D-06-BIO-14

A estrutura anterior, na forma como est representada, refere-se a a) um aminocido essencial com funo enzimtica na clula. b) um nucleotdeo que participa da estrutura qumica dos cidos nuclicos. c) um nucleosdeo estvel que participa da estrutura qumica dos cidos nuclicos. d) um carboidrato no hidrolisvel que atua no metabolismo celular. e) um nucleotdeo que participa de reaes bioqumicas como fornecedor de energia.
183

476. Ufla-MG Os organismos vivos requerem energia para o crescimento e manuteno do seu metabolismo. Molculas orgnicas como a apresentada no esquema a seguir conservam a energia que utilizada para a biossntese dos componentes celulares, a partir de precursores simples. Analise a gura e marque a alternativa que descreve a composio molecular deste importante transportador de energia.

II. O ATP formado retm energia utilizvel pelas clulas. III. As mitocndrias participam deste fenmeno. IV. Ocorre tanto nos organismos aerbios como nos anaerbios. V. Ocorre nos organismos heterotrcos e raramente nos autotrcos. Esto corretas as armaes: a) apenas I, II, III e IV. b) apenas II, III e IV. c) apenas I, II e III. d) apenas II, III, IV e V. e) I, II, III, IV e V. 478. MackenzieSP A respeito dos processos de produo de ATP, assinale a alternativa incorreta. a) Podem produzir cido lctico ou lcool como resduos. b) Podem ocorrer na ausncia de O2. c) Podem ocorrer sem a participao das mitocndrias. d) Ocorrem sempre a partir de molculas de glicose. e) Existem em todos os tipos de clulas vivas. 479. FCMSCSP Dos organismos abaixo, os que consomem maior quantidade de glicose para sintetizar 100 molculas de ATP so os: a) hetertrofos em geral. b) auttrofos em geral. c) aerbicos facultativos. d) aerbicos. e) anaerbicos. 480. PUC-MG Num experimento simples para demonstrar a fermentao, adiciona-se fermento biolgico a uma soluo de acar ou, mesmo, caldo de cana, obtendo-se, como produto nal, lcool, CO2 e gua. O fermento biolgico contm: a) algas. b) bactrias fotossintetizantes. c) cido carbnico em p. d) fungos. e) cianobactrias. 481. O fermento biolgico usado na fabricao de pes provoca o aumento do volume da massa como conseqncia da produo de: a) CO2, a partir da gua acrescentada massa do po. b) CO2, a partir da fermentao do acar acrescentado massa do po. c) O2, a partir da fermentao do amido existente na farinha do po. d) N2, a partir da fermentao do acar acrescentado massa do po. e) O2, a partir da respirao do acar acrescentando massa do po.

a) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: alta 5 cido nuclico: desoxirribonuclico b) 1 Base nitrogenada: adenina 2 Acar: desoxirribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: alta 5 cido nuclico: ribonuclico c) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: nitrato 4 Energia de ligao: alta 5 cido nuclico: ribonuclico d) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: baixa 5 cido nuclico: ribonuclico e) 1 Base nitrogenada: adenina 2 Acar: ribose 3 Constituinte inorgnico: fosfato 4 Energia de ligao: alta 5 cido nuclico: ribonuclico 477. PUC-PR A seguinte equao resume um dos mais importantes fenmenos biolgicos:

Em relao a este fenmeno, podemos armar: I. O composto orgnico, reagente, libera grande quantidade de energia.
184

482. PUC-SP

O processo acima esquematizado representa: a) fermentao em clulas musculares. b) fermentao realizada por lvedos. c) respirao aerbica em clulas em geral. d) gliclise em animais em geral. e) quimiossntese em bactrias. 483. Qual o processo biolgico esquematizado a seguir e qual sua importncia para a indstria humana?
gs carbnico + lcool etlico + energia

486. UFMG Na fabricao de iogurtes e coalhadas, utilizam-se iscas, isto , colnias de microorganismos que realizam a fermentao do leite. Em relao a esse processo, correto armar que: a) consiste em respirao aerbica. b) realizado por vrus anaerbicos lticos. c) resulta da liberao de cido ltico e energia. d) resulta na formao de cido actico e CO2. 487. UFPE Quando, em exerccios musculares extenuantes, o organismo consome O2 mais rapidamente do que os sistemas respiratrio e circulatrio podem liberar, ocorre a fadiga muscular. O produto txico liberado pelas clulas musculares dos mamferos em anaerobiose, nessas condies, corresponde a: a) cido pirvico. d) NADP. b) cido actico. e) cido ltico. c) glicose. 488. Fuvest-SP Um atleta, participando de uma corrida de 1.500 m, desmaiou depois de ter percorrido cerca de 800 m, devido oxigenao deciente de seu crebro. Sabendo-se que as clulas musculares podem obter energia por meio da respirao aerbica ou da fermentao, nos msculos do atleta desmaiado deve haver acmulo de: a) glicose. b) glicognio. c) monxido de carbono. d) cido ltico. e) etanol. 489. Unicamp-SP Aps a realizao de esforo muscular intenso, a musculatura pode car colorida e enrijecida por alguns dias (fadiga muscular). Isso se deve basicamente ao acmulo de uma substncia nas clulas musculares submetidas a esforo. a) Qual esta substncia? b) Considerando os processos bioqumicos que ocorrem na clula muscular, explique qual a razo desse acmulo. 490. Fuvest-SP Uma das causas de dor e sensao de queimao nos msculos, decorrentes de esforo fsico intenso, a presena de muito cido ltico nas clulas musculares. Isso ocorre quando essas clulas: a) realizam intensa respirao celular, com produo de cido ltico. b) recebem suprimento insuciente de gs oxignio e realizam fermentao. c) realizam intensa respirao celular produzindo excesso de ATP. d) recebem estmulos nervosos sucessivos e acumulam neurotransmissores. e) utilizam o acar lactose como fonte de energia.
185

glicose

cido pirvico

484. CesgranrioRJ Indique a alternativa correta para o fenmeno apresentado de forma muito simplicada.

Fenmeno a) b) c) d) e) Respirao celular Fermentao bacteriana Fermentao alcolica Respirao aerbica Fermentao lctica

Caracterstica Realiza-se em presena de O2 Produz pouco acar Produo baixa de ATP Mais eciente em produzir ATP Degradao completa da glicose

PV2D-06-BIO-14

485. Fuvest-SP A fabricao de vinho e po depende dos produtos liberados pelas leveduras durante sua atividade fermentativa. Quais os produtos que interessam mais diretamente fabricao do vinho e do po, respectivamente? a) lcool etlico, gs carbnico. b) Gs carbnico, cido ltico. c) cido actico, cido ltico. d) lcool etlico, cido actico. e) cido ltico, lcool etlico.

491. Cesgranrio-RJ 6000 a.C.: babilnios e sumrios utilizam lvedo para produzir cerveja. 4000 a.C.: egpcios descobrem como fazer po fermentado. Ainda na Antigidade: transformao do leite em iogurte e uso do mofo na elaborao de queijo. As informaes contidas no artigo anterior envolvem um processo biolgico fundamental para os seres vivos que o realizam. Todas as opes apresentam conceitos corretos sobre esse processo, exceto uma. Assinale-a. a) Na fabricao do iogurte e queijo o produto formado o cido lctico. b) Na fabricao de cerveja e po os produtos formados so etanol e gs carbnico. c) Nesse processo ocorre a formao de uma molcula orgnica denominada cido pirvico. d) O saldo energtico obtido, nos dois processos, de 2 ATP. e) Os seres que realizam este processo objetivam conseguir matria-prima para sua nutrio. 492. UflaMG O esquema abaixo representa um processo bioqumico utilizado na fabricao de pes, vinhos, cervejas e outros produtos de grande importncia para o ser humano.
cido lctico
Glicose
Fonte: Folha de S. Paulo

ao fundo. Depois de algum tempo a bolinha sobe superfcie do copo, indicando que a massa est pronta para ser levada ao forno. Com relao receita, correto armar que: a) a farinha constituda de polissacardeos, utilizados diretamente na fermentao. b) a manteiga e os ovos so os principais alimentos para os microrganismos do fermento. c) a subida da bolinha superfcie do copo se deve a um processo anaerbico. d) os microrganismos do fermento so protozorios aerbicos. 495. ENEM No processo de fabricao de po, os padeiros, aps prepararem a massa utilizando fermento biolgico, separam uma poro de massa em forma de bola e a mergulham num recipiente com gua, aguardando que ela suba, como pode ser observado, respectivamente, em I e II do esquema abaixo. Quando isso acontece, a massa est pronta para ir ao forno.

cido pirvico

lcool etlico cido actico

a) Que processo bioqumico est representado no esquema? b) Qual o papel desse processo no funcionamento das clulas que so capazes de realiz-lo? c) Em clulas musculares, qual a conseqncia da ocorrncia da fermentao? 493. UFPI Relacionando-se o processo metablico com produo de energia, pode-se armar, corretamente, que: a) os processos anaerbicos e de fermentao liberam menos energia do que os aerbicos. b) o processo anaerbico s ocorre em seres superiores, com alta demanda energtica. c) o processo anaerbico s ocorre nos organismos procariontes, com baixa demanda energtica. d) o processo anaerbico produz ATP somente em tecidos desprovidos de mitocndrias. e) os processos fermentativos formam molculas orgnicas pequenas sem nenhum valor energtico. 494. UFMG Uma receita de po caseiro utiliza farinha, leite, manteiga, ovos, sal, acar e fermento. Esses ingredientes so misturados e sovados e formam a massa que colocada para descansar. A seguir, uma bolinha dessa massa colocada num copo com gua e vai
186

I II Um professor de Qumica explicaria esse procedimento da seguinte maneira: A bola de massa torna-se menos densa que o lquido e sobe. A alterao da densidade deve-se fermentao, processo que pode ser resumido pela equao: C6H12O6 C2H5OH + 2 CO2 + energia glicose lcool gs comum carbnico

Considere as armaes a seguir. I. A fermentao dos carboidratos da massa de po ocorre de maneira espontnea e no depende da existncia de qualquer organismo vivo. II. Durante a fermentao, ocorre produo de gs carbnico, que se vai acumulando em cavidades no interior da massa, o que faz a bola subir. III. A fermentao transforma a glicose em lcool. Como o lcool tem maior densidade do que a gua, a bola de massa sobe. Dentre as armativas, apenas: a) I est correta. b) II est correta. c) I e II esto corretas. d) II e III esto corretas. e) III est correta. 496. FMU-SP Dois processos biolgicos relacionados com a produo de lcool combustvel so: a) fotossntese e fermentao. b) fermentao e respirao. c) transpirao e evaporao. d) sntese de protenas e respirao. e) sntese de cidos nuclicos e fermentao.

497. PUC-RJ O Pr-lcool, programa de produo de combustvel etanol no Brasil, baseia-se na obteno de um produto resultante de: a) respirao aerbica do acar da cana-de-acar por bactrias. b) respirao anaerbica do amido da cana-de-acar por protozorios. c) fermentao do acar da cana-de-acar por leveduras. d) acidicao do amido de sementes da cana-deacar. e) oxidao completa do acar da cana-de-acar. 498. UnimontesMG A gura abaixo representa uma via alternativa utilizada pelo msculo, durante o exerccio fsico, para produzir energia. Analise-a.

04. Iogurtes e queijos so produzidos a partir da fermentao ltica. 08. A cachaa e o lcool combustvel so obtidos pela fermentao dos acares presentes na cana. 16. O trifosfato de adenosina (ATP), liberado durante a fermentao da farinha de trigo, faz com que o po cresa. D, como resposta, a soma dos itens corretos. 500. FuvestSP As leveduras podem viver tanto na presena quanto na ausncia de gs oxignio. a) Que processos de obteno de energia as leveduras realizam em cada uma dessas situaes? b) Em qual das situaes a atividade metablica das leveduras mais alta? Por qu? 501.UnicampSP Uma mistura feita com 2 g de fermento Fleischmann, 3 g de acar e 150 ml de gua colocada em 2 tubos de ensaio, cada um tampado na parte superior com uma bexiga de borracha (de aniversrio) vazia. Um desses tubos colocado na estufa (a 30 C), e outro na geladeira (de 5 a 10 C) durante cerca de 6 horas. O que dever acontecer com cada uma das bexigas? Por qu? Qual o processo bioqumico envolvido? 502.

Glicose

Enzima
2 ATP

2 cido pirvico

Enzima
C O H

gua de cal

Precipitado de carbonato de clcio observado ao final do experimento

2 cido lctico

De acordo com a gura e com o assunto abordado por ela, analise as armativas a seguir e assinale a alternativa correta. a) Na falta de oxignio, o cido pirvico funcionar como aceptor de hidrognio, reduzindo-se a cido ltico. b) A cadeia respiratria car inoperante, devido ausncia de NADH2, diminuindo o rendimento energtico. c) Interrompendo-se o exerccio fsico, ocorrer diminuio de oxignio e acmulo do cido ltico no msculo. d) Na situao apresentada, haver liberao de gs carbnico, gua e ATP. 499. UnBDF A fermentao um dos processos biolgicos que a humanidade utiliza h mais tempo na preparao de alimentos. Sobre esse tema, julgue os itens a seguir. 01. A fermentao um tipo de respirao que consome oxignio livre. 02. Vrus e protozorios so usados freqentemente na fermentao industrial.

O esquema representa uma montagem para se demonstrar a fermentao em leveduras. Ao nal desse experimento, observa-se a formao de um precipitado no frasco 2, como indicado. Para que tal processo ocorra, suciente que o frasco 1 contenha, alm da levedura: a) glicose e oxignio. b) gs carbnico e oxignio. c) glicose e gs carbnico. d) glicose. e) oxignio. 503. Unirio-RJ (modificado) Alm do cido ltico, as bactrias geram vrios produtos importantes atravs da fermentao. O queijo suo, por exemplo, fabricado pela fermentao de uma bactria que forma cido propinico e gs carbnico. Esse gs forma as bolhas que se transformam nos famosos buracos do queijo suo. Outra bactria forma cido actico, fermentando a sidra (vinho da ma) ou vinho da uva, produzindo vinagre. O rano da manteiga se deve ao cido butrico, que tambm produto da fermentao de bactrias. O lcool usado como combustvel e como solvente, alm de outros
187

PV2D-06-BIO-14

solventes como a acetona e o lcool isoproplico, tambm produto da fermentao.


Linhares, Srgio e Gewandsnajder, Fernando. Biologia Hoje.

e identique a alternativa que indica a denominao deste processo representado por (X).

A origem dos diversos resduos da fermentao, como os citados no texto, depende da: a) variao de temperatura em que ocorrem as reaes do processo. b) quantidade de energia produzida na forma de ATP ao longo da reao. c) forma de devoluo dos hidrognios capturados pelo NAD ao cido pirvico, formando diferentes compostos orgnicos. d) natureza qumica da molcula utilizada como matria-prima na reao. e) disponibilidade de gua como aceptor nal de hidrognios. 504. UFRJ Em uma espcie de levedura (fungo) utilizada na produo de cerveja, foi identicada uma linhagem mutante, denominada petit (do francs pequeno). A linhagem petit no apresentava atividade mitocondrial. O grco relaciona as taxas de crescimento das linhagens original e petit concentrao de oxignio no meio de cultura. Ambos os eixos utilizam unidades arbitrrias.
60 50 Petit Original

So Paulo, Editora tica, 1997. Volume 1, p. 166.

a) Fermentao ltica d) Fotossntese b) Respirao celular e) Quimiossntese c) Fermentao alcolica 507. O que respirao celular aerbica? Em que organide citoplasmtico ocorre? 508. Unifor-CE O esquema abaixo mostra de modo simplicado um tipo de reao celular metablica.

Taxa de crescimento

40 30 20 10 0 0 1 2 3 4 5 6 7 8 9 10

[O2]

Explique as causas das diferenas entre as taxas de crescimento das duas linhagens. 505. UFRJ A produo de vinho um dos processos mais antigos da biotecnologia. O livro do Gnesis j nos fala da embriaguez de No. Embora vrios fatores devam ser levados em conta na produo de um bom vinho como a cor, o aroma, o sabor, etc. o processo depende essencialmente da degradao do suco das uvas por leveduras anaerbias facultativas, presentes na casca do fruto. Na fermentao, nome dado a esse processo, o acar da uva degradado a lcool etlico (etanol). Explique por que se evita, na produo de vinho, o contato do suco de uva com o ar. 506. UFPE A seguir tem-se uma representao simplicada de um processo biolgico celular, exergnico. Analise a gura
188

O processo representado : a) respirao anaerbica. b) respirao aerbica. c) quimiossntese. d) fotossntese. e) gliclise. 509. Fuvest-SP A respirao aerbica fornece como produtos nais: a) cido pirvico e gua. b) cido pirvico e oxignio. c) gs carbnico e gua. d) oxignio e gua. e) oxignio e gs carbnico. 510. PUC-SP O estudo das atividades qumicas de uma clula permite vericar que ela apresenta a formao de gua e gs carbnico a partir de molculas de glicose. Esse fato j indcio de que essa clula deve apresentar entre suas estruturas citoplasmticas: a) mitocndrias. d) complexo de Golgi. b) microtbulos. e) lisossomos. c) centrossomos.

511. UflaMG O componente celular em que se forma maior nmero de molculas de ATP durante a converso de uma molcula de glicose em gua e gs carbnico a) o peroxissomo. d) o ribossomo. b) a mitocndria. e) o complexo de Golgi. c) o cloroplasto. 512. PUC-MG (modificado) No uma caracterstica associada mitocndria: a) envolvida por unidade de membrana dupla. b) Tem capacidade de autoduplicao. c) encontrada em clulas eucariotas animais e vegetais. d) Tem funo de obteno de energia. e) No possui DNA em sua matriz. 513. Unip-SP Considere a seguinte atividade celular:

b) c) d) e)

Ciclo de Krebs Gliclise Replicao Transcrio

516. UERJ A cincia da siologia do exerccio estuda as condies que permitem melhorar o desempenho de um atleta, a partir das fontes energticas disponveis. A tabela a seguir mostra as contribuies das fontes aerbia e anaerbia para gerao de energia total utilizada por participantes de competies de corrida, com durao variada e envolvimento mximo do trabalho dos atletas. Contribuio percentual para gerao de energia total em competies de corrida Corrida Tipo 100 m 400 m 800 m Durao*
(segundos)

Fonte de energia Aerbia 10% 30% 60% Anaerbia 90% 70% 40% *

9,84 43,29 100,00

Tempos aproximados referentes aos recordes mundiais para homens, em abril de 1997

Qual o organide celular relacionado com essa atividade? a) Centrolo d) Cloroplasto b) Lisossomo e) Complexo de Golgi c) Mitocndria 514. UECE O esquema a seguir resume o consumo (X) e a produo (Y) de ATP, na gliclise, por molcula de glicose oxidada:

Observe o esquema abaixo, que resume as principais etapas envolvidas no metabolismo energtico muscular.

Ao nal da corrida de 400 m, a maior parte da energia total dispendida por um recordista dever originar-se da atividade metablica ocorrida nas etapas de nmero: a) 1 e 3 c) 2 e 4 b) 1 e 4 d) 2 e 5 517. FEPA-SP A respirao a nvel intracelular o processo de obteno de energia atravs da degradao de um substrato e que ocorre em vrias etapas. Esta degradao pode ainda se realizar na presena ou no de oxignio. O esquema abaixo representa um das etapas deste processo. Observe-o e responda:

Os valores de X e Y so, respectivamente: a) 2 e 4 c) 2 e 8 b) 4 e 2 d) 8 e 4 515. UFRGS-RS As hemcias humanas foram selecionadas ao longo da evoluo de modo a que desempenhassem hoje em dia suas funes de maneira eciente. Durante este processo evolutivo, as mitocndrias e os ncleos foram perdidos na fase madura. Quais dos processos biolgicos a seguir continuam a ocorrer, nas hemcias maduras, apesar desta adaptao? a) Cadeia transportadora de eltrons a) b) c) d) Qual a etapa em foco? Em que regio da clula ocorre esta etapa? Em que consiste a referida etapa? Para esta etapa, faz-se necessrio o oxignio? Justique. e) Quantas molculas de ATP so produzidas e quantas so consumidas nesta etapa?
189

PV2D-06-BIO-14

518. UFJF-MG No esquema abaixo, os algarismos I e II indicam, respectivamente:

( ) A estrutura II encontrada em grande quantidade nas clulas do pncreas endcrino. ( ) As estruturas I e III contm DNA. ( ) A etapa do processo representado em b ocorre sem a participao de enzimas. 521. UERJ O grco mostra o resultado de um experimento em que se avaliou o consumo de oxignio de uma soluo, pela mitocndria, em presena de adenosina difosfato (ADP), adenosina trifosfato (ATP) e glicose.

a) b) c) d) e)

fermentao e respirao. respirao e fotossntese. fotossntese e respirao. respirao e quimiossntese. quimiossntese e fermentao. A partir desse resultado, podemos armar que, em relao taxa de consumo de oxignio, ocorre: a) aumento pela adio de ATP e produo de ADP. b) aumento pela adio de ADP e produo de ATP. c) diminuio pela adio de ATP e produo de ADP. d) diminuio pela adio de ADP e produo de ATP. 522. UFPR Um feixe de clulas musculares estriadas, mantido em cultura com todas as condies ideais, foi submetido a vrias sries de contraes e relaxamentos (exerccio) por vrios dias consecutivos, seguido de um perodo de repouso (sem exerccio) de tambm alguns dias. Durante esses perodos, quanticou-se o nmero de mitocndrias por clula, possibilitando a elaborao do grco a seguir:

519. PUCCamp-SP As mitocndrias so organelas encontradas em todas as clulas eucariticas e que tm a funo de transformar a energia qumica dos metablitos em energia facilmente acessvel, uma vez que ca acumulada em molculas de ATP. A energia dos metablitos no pode ser usada diretamente porque a clula a) no oxida apenas carboidratos na respirao. b) dispe de poucas enzimas capazes de catalisar a oxidao completa do substrato. c) precisaria oxidar uma quantidade muito maior de glicose. d) liberaria de uma s vez grande quantidade de energia trmica, o que imcompatvel com a vida. e) armazenaria uma pequena quantidade de energia, perdendo a maior parte. 520. UnBDF (modificado) Os esquemas seguintes representam aspectos ultraestruturais de trs organelas (I a III) presentes no citoplasma de uma determinada clula e dois processos (A e B) executados pelas clulas.

Valendo-se das informaes dadas, julgue os seguintes itens. ( ) O processo representado em A ocorre na estrutura III de clulas vegetais. ( ) A matria orgnica produzida no processo representado em b utilizada na estrutura II.
190

A partir desse grco e de conhecimentos sobre o assunto enfocado, correto armar: 01. O nmero de mitocndrias por clula aumenta durante o exerccio porque a clula precisa de muito ATP, e a mitocndria que o produz. 02. H um nmero mnimo necessrio de mitocndrias por clula para manter o metabolismo desta, mesmo quando em repouso. 04. Se fosse sempre mantida a mesma carga de exerccios, o nmero de mitocndrias por clula aumentaria indenidamente.

08. O nmero de mitocndrias aumenta nas clulas porque elas so fagocitadas do meio de cultura. 16. Quando cessa o exerccio, o excesso de mitocndrias removido pela digesto intracelular dessas organelas. 32. Se fosse tambm medido o consumo de oxignio destas clulas, o grco seria semelhante ao obtido para o nmero de mitocndrias. D a soma dos itens corretos. 523. Unicamp-SP Nas clulas, a glicose quebrada e a maior parte da energia obtida armazenada principalmente no ATP (adenosina trifosfato) por curto tempo. a) Qual a organela envolvida na sntese de ATP nas clulas animais? b) Quando a clula gasta energia, a molcula de ATP quebrada. Que parte da molcula quebrada? c) Mencione dois processos bioqumicos celulares que produzem energia na forma de ATP. 524. UFV-MG Enquanto os organismos superiores utilizam a respirao aerbia para obter energia, algumas bactrias e fungos utilizam a fermentao. Esses processos compreendem um conjunto de reaes enzimticas, nos quais compostos orgnicos so degradados em molculas mais simples. As armativas a seguir esto relacionadas a esses processos. I. A gliclise o processo inicial da respirao e fermentao. II. As leveduras fermentam acares para produzir lcool etlico. III. A fermentao mais eciente em rendimento energtico do que a respirao. Com relao s armativas, assinale a alternativa correta. a) I e II so verdadeiras. b) II e III so verdadeiras. c) I, II e III so verdadeiras. d) I e III so verdadeiras. e) Apenas a II verdadeira. 525. Unioeste-PR (modificado) Com relao energtica da clula, correto armar que: 01. uma clula muscular passa a transformar cido pirvico em cido ltico em condies anaerbicas. 02. o processo que permite s clulas retirarem a energia acumulada nos compostos orgnicos a respirao celular. 04. tanto o processo de respirao aerbica como a fermentao tm o mesmo saldo energtico. 08. lipdios e protenas no so utilizados como combustvel pela clula, mesmo na ausncia de glicose. 16. a gliclise e o ciclo de Krebs ocorrem no interior das mitocndrias.

526. UFRJ Interessado em demonstrar um determinado fenmeno, um grupo de alunos realizou o experimento esquematizado a seguir:

Os trs frascos foram fechados de tal forma a s permitir a entrada e sada de ar pelos tubos. Nos frascos A e B, foi colocada uma soluo de hidrxido de brio e, no frasco I, uma poro de sementes em germinao. Ao se fazer circular o ar, como indicado pelas setas, o hidrxido de brio do frasco A reteve todo o CO2 do ar, deixando passar para o frasco I apenas o O2. No frasco B, ao nal de algum tempo, pode-se observar a formao de um precipitado branco de carbonato de brio, obtido segundo a reao a seguir: Ba(OH)2 + CO2 BaCO3 + H2O
hidrxido de brio carbonato de brio

Essa experincia permitiu aos alunos demonstrarem, indiretamente, o seguinte fenmeno: a) transpirao. b) fotossntese. c) respirao. d) reproduo. e) nutrio. 527. Fuvest-SP H um sculo, Louis Pasteur, investigando o metabolismo do lvedo, um organismo anaerbico facultativo, observou que, em soluo de gua e acar, esse microrganismo se multiplicava. Observou tambm que a multiplicao era maior quando a soluo era aerada. a) Explique a importncia do acar para o lvedo. b) Justique a diferena de crescimento nas condies aerbica e anaerbica. 528. UFRJ A cachaa obtida pela fermentao da cana-de-acar por uma levedura. O produto nal uma mistura que contm fragmentos do glicdio inicial, como o lcool etlico, o metanol e outras substncias. Quando essa mistura mal destilada, a cachaa pode causar intoxicaes graves nos consumidores, devido presena de metanol. Considerando os tipos de degradao de glicdios nos seres vivos, explique por que a degradao de glicose nas nossas clulas no produz metanol. 529. UERJ Usando-se uma preparao de mitocndrias isoladas, incubada em condies adequadas, foram medidas as taxas de consumo do oxignio e do substrato e a taxa de produo de ATP, em duas situaes: I. ausncia de cianeto; II. presena de cianeto.
191

PV2D-06-BIO-14

Observe o grco que representa o resultado desse experimento.

d) a partir de acares, protenas e gorduras. e) a partir de substncias inorgnicas. 532. UFCCE A mitocndria, que uma das mais importantes organelas celulares, possui DNA, RNA e ribossomos, o que a torna apta sntese protica. Dentre as alternativas a seguir, assinale as que exemplicam outros processos que ocorrem na mitocndria. 01. Ciclo de Krebs. 02. Intercmbio de substncias entre a clula e o meio. 04. Gliclise. 08. Fosforilao oxidativa. 16. Regulao osmtica da clula.

Indique a ao do cianeto na cadeia respiratria mitocondrial. 530. UFBA Foi Louis Pasteur quem observou, pela primeira vez, na dcada de 1860, que, quando o oxignio introduzido em uma suspenso de clulas que esto consumindo glicose em alta velocidade, em anaerobiose, essa velocidade diminui signicativamente, medida que o oxignio passa a ser consumido. Ao mesmo tempo, cessa o acmulo de lactato. O efeito Pasteur, descrito anteriormente, relaciona-se a aspectos da siologia e da estrutura celular, tais como: 01. A utilizao da glicose para obteno de energia em clulas anaerbicas facultativas. 02. A exigncia de organelas celulares especializadas para o metabolismo aerbico da glicose. 04. A sntese de lactato como produto nal do metabolismo energtico mais rentvel. 08. O consumo do oxignio no processo de degradao completa da molcula de glicose. 16. A dependncia de membranas celulares para sntese de ATP, no processo aerbico de produo de energia. 32. O bloqueio da gliclise pela presena de oxignio nas clulas aerbicas. 64. A relao entre o mecanismo bioenergtico utilizado e a quantidade de glicose consumida. Some os itens corretos. 531. PUC-SP

Some os itens corretos. 533. A respirao aerbica pode ser em trs etapas: gliclise, ciclo de Krebs e cadeia respiratria. Com relao aos locais das clulas onde ocorrem estas reaes, podemos dizer: a) as trs ocorrem no interior das mitocndrias. b) apenas o ciclo de Krebs e a gliclise ocorrem no interior das mitocndrias. c) apenas a cadeia respiratria e a gliclise ocorrem no interior das mitocndrias. d) apenas o ciclo de Krebs e a cadeia respiratria ocorrem no interior das mitocndrias. e) apenas o ciclo de Krebs ocorre no interior das mitocndrias. 534. Mackenzie-SP Uma vez no citoplasma, a glicose participar do processo de respirao celular, resultando, no nal, gs carbnico, gua e liberao de energia sob a forma de ATP. Essa transformao ocorre primeiramente no citoplasma e posteriormente no interior de uma organela citoplasmtica. O nome da organela e a seqncia completa dos acontecimentos, incluindo o que ocorre no citoplasma, correspondem a: a) ribossomo, ciclo de Krebs, cadeia respiratria, gliclise. b) complexo de Golgi, cadeia respiratria, ciclo de Krebs, gliclise. c) mitocndria, gliclise, ciclo de Krebs, cadeia respiratria. d) lisossomo, gliclise, cadeia respiratria, ciclo de Krebs. e) ribossomo, gliclise, fermentao, ciclo de Krebs. 535. UFRGS (modificado) As clulas animais, para a produo de energia, necessitam de oxignio, enzimas e substrato. Em relao ao processo de produo de energia, considere as informaes seguintes. I. A fosforilao oxidativa ocorre nas mitocndrias. II. Na fase aerbica, ocorre alta produo de ATP. III. A gliclise exclusiva do processo respiratrio anaerbico. Quais esto corretas? a) Apenas I. d) Apenas II e III. b) Apenas II. e) I, II e III. c) Apenas I e II.

Pela anlise do esquema, prev-se que a energia pode ser obtida por um organismo: a) somente a partir de acares. b) somente a partir de protenas c) somente a partir de gorduras.
192

536. Mackenzie-SP C6H12O6 2 C3H4O3 + ATP (glicose) (c. pirvico) A respeito da equao, que representa uma das etapas da produo de energia em uma clula, correto armar que: a) essa etapa ocorre no hialoplasma das clulas, tanto em processos aerbicos como anaerbicos. b) trata-se da cadeia respiratria. c) a produo aerbica de ATP, na etapa seguinte a esta, no depende da existncia de mitocndrias. d) nessa etapa, ocorre a maior produo de energia. e) se o cido pirvico se depositar em clulas musculares, ocorre o fenmeno conhecido por fadiga muscular. 537. UFMS A equao Glicose + 6 O2 6 CO2 + H2O + Energia (36 ATP) representa a) o processo aerbico que ocorre no cloroplasto e realizado por vegetais, leveduras, bactrias e clulas musculares. b) o processo de reaes qumicas do metabolismo energtico que ocorre nas mitocndrias das clulas procariontes. c) o processo aerbico liberador de energia para a utilizao celular que ocorre no hialoplasma e na mitocndria. d) o processo da gliclise realizado pelos organismos produtores de alimento orgnico nos ecossistemas. e) o processo de fermentao que ocorre no interior das clulas, visando produo de energia. 538. Osec-SP O esquema abaixo mostra as etapas da degradao da glicose no interior das clulas para obteno de energia.

539. Fuvest-SP Em uma situao experimental, camundongos respiraram ar contendo gs oxignio constitudo pelo istopo 18O . A anlise de clulas desses animais dever de2 tectar a presena de istopo 18O2, primeiramente: a) no ATP. d) no gs carbnico. b) na glicose. e) na gua. c) no NADH. 540. UnimontesMG Os seres vivos adquirem ou utilizam energia livre por meio de um processo denominado metabolismo, o qual pode ser realizado por diversas organelas celulares. A tabela abaixo relaciona organelas e funes metablicas presentes em clulas eucariotas. Observe-a. Organela Mitocndria II Ncleo Peroxissomas IV Funo I Gliclise III Reaes oxidativas Digesto enzimtica

Considerando a tabela apresentada e o assunto abordado, analise as alternativas a seguir e assinale a que representa a relao incorreta entre organela e funo. a) IV lisossomos b) II ncleo c) I ciclo do cido ctrico d) III replicao de DNA 541. UFPE Quando o oxignio no est disponvel, alguns organismos obtm energia por um processo chamado: a) respirao. b) fermentao. c) gliclise. d) ciclo de Krebs. e) cadeia respiratria. 542. FM. ABC-SP Considere o seguinte esquema simplicado de uma seqncia de reaes do metabolismo da glicose, em meio aerbio, de certo organismo.

Os fenmenos assinalados como 1, 2, 3 e 4 correspondem, respectivamente, a: a) gliclise fermentao cadeia respiratria ciclo de Krebs. b) fermentao gliclise cadeia respiratria ciclo de Krebs. c) gliclise fermentao ciclo de Krebs cadeia respiratria. d) fermentao gliclise ciclo de Krebs cadeia respiratria. e) gliclise ciclo de Krebs fermentao cadeia respiratria.

Na ausncia de oxignio e mantendo todas as demais condies inalteradas, a seqncia das reaes, a partir da glicose, processar-se-ia at a formao de: a) frutose 6-P. d) acetil-CoA. b) gliceraldedo 3-P. e) CO2 + H2O. c) cido pirvico.
193

PV2D-06-BIO-14

543. UnBDF A glicose o acar mais usado pelas clulas vivas na obteno de energia. Seu metabolismo pode seguir, entre outros, os seguintes processos: I. Glicose cido pirvico cido ltico. II. Glicose cido pirvico acetil coenzima A ciclo de Krebs. Considerando os processos anteriormente apresentados, julgue os itens a seguir. ( ) I e II ocorrem nas clulas musculares. ( ) I ocorre exclusivamente no hialoplasma. ( ) O rendimento energtico obtido em I maior do que o obtido em II. ( ) Em termos evolutivos, II anterior a I. 544. UFPE O maior rendimento energtico do processo de respirao aerbica (acoplada cadeia transportadora de eltrons) sobre a gliclise principalmente devido : a) maior atividade especca das enzimas envolvidas. b) maior difuso das enzimas no meio da reao. c) muito menor energia da ativao requerida. d) completa oxidao de glicose a CO2 e H2O. e) compartimentao e ordenao das enzimas envolvidas. 545. FatecSP Considere as armaes apresentadas a seguir. I. O rendimento energtico total de cada molcula de glicose degradada at 6 CO2 e 6 H2O de 38 ATP (dois na gliclise e trinta e seis nos processos mitocondriais). II. A utilizao do oxignio se d nas cristas mitocondriais, como aceptor nal de hidrognios. III. Em alguns microrganismos,o piruvato, proveniente da glicose, posteriormente metabolizado para produzir molculas de etanol. Com relao fermentao, pode-se armar que, das armaes, apenas a) a I est correta. b) a II est correta. c) a III est correta. d) a I e a III esto corretas. e) a II e a III esto corretas. 546. Unimontes-MG A gura a seguir ilustra uma organela citoplasmtica e alguns de seus principais componentes.

Com base nessa gura e em seus conhecimentos, analise as armativas abaixo e assinale a correta. a) As enzimas responsveis pela degradao da glicose em cido pirvico, processo conhecido como gliclise, ocorrem especialmente em 1. b) A estrutura 4 contm os componentes da cadeia transportadora de eltrons, responsveis pela quebra do cido pirvico. c) A organela representada pertence a uma clula procariota, fato evidenciado pela presena de DNA circular. d) A presena de 2 e 3 sugere que essa organela capaz de sintetizar protenas e autoduplicar-se. 547. UFPB O esquema a seguir representa as principais etapas da respirao celular.

Analisando-o, correto armar que a(s) etapa(s): a) I ocorre na matriz mitocondrial. b) II ocorre no citoplasma celular. c) III ocorre nas cristas mitocondriais. d) I e II ocorrem no citoplasma celular. e) I, II e III ocorrem nas mitocndrias. 548. UFPE No ciclo de Krebs (ciclo oxidativo geral ou ciclo do cido ctrico): ( ) geram-se as molculas de ATP, carregadoras de energia para os processos endergnicos do sistema biolgico. ( ) forma-se a matria-prima para a sntese de aminocidos, nucleotdeos e gorduras. ( ) geram-se ons H +, que iro para a cadeia transportadora de eltrons. ( ) participam molculas provenientes do catabolismo dos aminocidos, hexoses e triacilgliceris (triglicerdeos). ( ) todas as etapas so enzimaticamente catalisadas. 549. EFOAMG Para uma hemcia se manter viva, a taxa interna de Na+ deve ser bem mais baixa do que a do plasma e o inverso deve ocorrer com o K+. Hemcias humanas foram expostas ao cianeto. O que deve acontecer com a concentrao de Na e K dentro e fora da clula (hemcia)? Justique.

194

550. PUC-MG Considere o esquema a seguir, referente ao processo respiratrio de uma clula eucariota:
Glicose (I) cido Pirvico (II) Acetil CoA (III) Ciclo de Krebs (IV) Cadeia respiratria (V)

c) fermentao encontrada na maioria dos seres vivos unicelulares. d) formao de ATP na cadeia respiratria s ocorre na respirao. e) formao de cido pirvico exclusiva da respirao. 553. UFRJ Em 1949, enquanto estudavam o metabolismo energtico, Eugene Kennedy e Albert Lehninger realizaram uma experincia na qual separaram, por centrifugao, os diferentes componentes celulares. Em seguida, os pesquisadores colocaram cada uma das fraes contendo os diferentes componentes em solues compostas dos nutrientes adequados e mediram o consumo de oxignio (O2) em cada uma das fraes. Em outro conjunto de frascos, testou-se a produo de trifosfato de adenosina (ATP) pelas diferentes fraes. A tabela a seguir mostra alguns dos resultados possveis em uma experincia deste tipo.

Assinale a armativa incorreta: a) Para que I se transforme em II, necessrio o gasto de ATP. b) As fases I e II ocorrem fora da mitocndria. c) Na converso de II em III, no h produo local de ATP. d) Em IV, ocorre liberao de CO2 e formao local de ATP. e) Em V, h quebra da molcula de gua, com liberao de oxignio. 551. FEI-SP A respirao, que se processa em trs etapas distintas (gliclise, ciclo de Krebs e cadeia respiratria), um processo de liberao de energia atravs da quebra de complexas molculas orgnicas. Das armativas a seguir, relacionadas respirao, indique a que esteja correta: a) Na gliclise h converso do cido pirvico em compostos intermedirios, H2O e CO2. b) Na cadeia respiratria, h transporte de hidrognio com formao de cido pirvico. c) No ciclo de Krebs, h transporte de hidrognio, consumo de oxignio molecular e produo de gua. d) Na gliclise h converso de glicose em cido pirvico. e) No ciclo de Krebs, h converso de glicose em cido pirvico. 552. Cesgranrio-RJ

Com base nos resultados da tabela, identique qual das fraes deve corresponder s mitocndrias. Justique sua resposta. 554. Fatec-SP Observe os esquemas a seguir.

Comparando o esquema dos dois processos metablicos anteriormente representados, podemos armar que o(a): a) aceptor nal de hidrognios, na fermentao, o oxignio. b) molcula de glicose totalmente degradada, na fermentao.

PV2D-06-BIO-14

Assinale a alternativa que explica corretamente a diferena de rendimento energtico entre os processos 1 e 2. a) O processo 1 pode ser uma das etapas da fotossntese, produzindo lcool etlico, enquanto o processo 2 a respirao aerbica e libera muita energia na forma de ATP. b) O processo 1 pode ser uma das etapas da respirao aerbica, produzindo lcool etlico, enquanto o processo 2 a fotossntese e libera muita energia na forma de ATP. c) O processo 1 anaerbico, e parte da energia ca no lcool etlico, enquanto o processo 2 aerbico, e a energia vem da glicose decomposta em gua e gs carbnico. d) O processo 1 aerbico, e parte da energia ca no lcool etlico, enquanto o processo 2 anaerbico, e a energia vem da degradao da glicose em gua e gs carbnico. e) O processo 1 um tipo de fermentao com baixa produo de ATP, cando a energia no gs carbnico liberado, enquanto o processo 2 uma fermentao completa, liberando energia na forma de 38 ATP.
195

555. FMTMMG

O esquema mostra as relaes energticas que ocorrem nos seres vivos. Sobre o esquema foram feitas as armaes: I. II. III. IV. V. as molculas de ATP, cedendo um ou dois fosfatos,liberam a energia armazenada para a realizao de trabalho celular; difuso, transporte ativo e sntese protica so exemplos de atividades celulares que utilizam a enegia liberada pelo ATP; ADP, AMP e ATP so molculas altamente energticas, capazes de fornecer energia para atividade celular; a glicose, ao ser degradada parcial ou totalmente, libera energia para a adio de grupo fosfato ao ADP ou AMP; a degradao parcial da glicose gera outros fragmentos combustveis, como o lcool ou cido ltico.

III. A energia liberada no processo do metabolismo energtico armazenada nas molculas do ATP. IV. No processo de fermentao, no existe uma cadeia de aceptores de hidrognio que est presente na respirao aerbica. V. Na respirao aerbica, o ltimo aceptor de hidrognios o oxignio. VI. Na fermentao, a energia liberada nas reaes de degradao armazenada em 38 ATPs, enquanto na respirao aerbica armazenada em 2 ATPs. Esto corretas apenas as armativas: a) I, III, IV, V. d) I, III, V, VI. b) I, IV, V, VI. e) I, II, IV, V. c) I, II, III, IV. 558. Fuvest-SP A maior parte da massa de matria orgnica de uma rvore provm de: a) gua do solo. b) gs carbnico do ar. c) gs oxignio do ar. d) compostos nitrogenados do solo. e) sais minerais do solo. 559. Vunesp Uma diferena bsica entre plantas e animais a capacidade que as plantas apresentam para: a) digerir carboidratos. b) concentrar o CO2. c) realizar a respirao. d) adaptar-se a ambientes. e) resistir s doenas. 560. UERJ Florestas para combater poluio de combustveis A indstria de automveis Toyota revelou que pretende plantar ao redor de suas fbricas na Gr-Bretanha rvores manipuladas geneticamente para absorver os gases poluentes emitidos pelos motores que queimam combustveis fsseis.
O Globo

Est correto o contido apenas em a) I, II e III. d) II, III e V. b) I, II e IV. e) II, IV e V. c) I, IV e V 556. UFF-RJ A cadeia respiratria parte de um mecanismo funcional que, devido s alteraes a que est sujeito, capaz de exercer inuncia sobre a vida e a morte da clula e do indivduo. a) Onde ocorre a fase aerbica da respirao celular? b) No bito por asxia ou por envenenamento por cianeto, o que acontece com a produo de ATP? c) A inutilizao dos citocromos e a falta de aceptor nal conduzem a que tipos de morte? d) Por que a falta de oxignio leva morte por asxia? e) Como podemos denominar o NAD (nicotinamida adenina dinucleotdeo), o FAD (avina adenina dinucleotdeo) e o oxignio, com relao ao hidrognio, em funo do papel que desempenham na respirao celular? 557. FatecSP Analise as armaes a seguir, relativas ao processo do metabolismo energtico: I. Fermentao e respirao aerbica so processos de degradao das molculas orgnicas em compostos mais simples, liberando energia. II. Todos os processos de obteno de energia ocorrem na presena de oxignio.
196

A estratgia antipoluente imaginada por essa empresa se baseia no fato de o dixido de carbono produzido pelos motores que usam combustvel fssil ser absorvido pelas plantas. O dixido de carbono participa da elaborao do seguinte produto e respectivo evento metablico: a) acar fermentao b) carboidrato fotossntese c) oxignio respirao aerbica d) protena respirao anaerbica 561. FCC-SP Qual das alternativas da tabela abaixo representa corretamente algumas das condies essenciais para a realizao da fotossntese? (+ fator essencial; fator no essencial)

Gs carbnico a) b) c) d) e) + + + +

gua + + +

Oxignio + +

566. Mackenzie-SP (modificado) A respeito da organela representada anteriormente, assinale a alternativa incorreta.

562. UFPE Relacione as colunas abaixo: 1. Processo de liberao de energia atravs da quebra de molculas orgnicas. 2. Processo de incorporao de energia atravs da sntese de molculas orgnicas. ( ) Fermentao ( ) Fotossntese ( ) Respirao aerbica A seqencia correta : a) 1, 1, 1 d) 2, 2, 1 b) 1, 2, 1 e) 2, 1, 2 c) 1, 1, 2 563. UFPE Os vegetais apresentam a capacidade de realizar fotossntese e respirao celular. Das situaes apresentadas, indique qual corresponde ocorrncia desses dois processos siolgicos simultaneamente: Fotossntese a) b) c) d) e) apenas na ausncia de luz apenas na presena de luz com e sem luz apenas na presena de luz com e sem luz Respirao com e sem luz apenas na presena de luz apenas na ausncia de luz com e sem luz com e sem luz

a) b) c) d)

Est presente em todos os organismos auttrofos. A estrutura 2 o tilacide e apresenta clorola. A regio 1 o estroma. Essa organela pode sofrer autoduplicao e possui DNA. e) O processo energtico que ocorre nesta organela dependente da luz. 567. UELPR O macronutriente essencial ao desenvolvimento das plantas por fazer parte da molcula de clorola o: a) ferro. d) magnsio. b) cobre. e) mangans. c) zinco. 568. UFV-MG Na fotossntese, a energia luminosa absorvida principalmente pela clorofila e, posteriormente, transformada em energia qumica que viabiliza as reaes que levam a planta a consumir _________ e ________ para produzir ___________ e liberar ______________. Considerando o texto acima, a seqncia correta de preenchimento dos espaos : a) dixido de carbono, gua, glicose e oxignio. b) gua, oxignio, glicose e dixido de carbono. c) glicose, oxignio, dixido de carbono e gua. d) gua, glicose, oxignio e dixido de carbono. e) dixido de carbono, glicose, gua e oxignio. 569. PUC-SP O grco a seguir mostra o espectro de absoro de luz pelas clorolas a e b em funo dos diferentes comprimentos de onda que compem a luz branca:

564. Unicamp-SP Compare fotossntese com respirao em relao aos seguintes aspectos: a) perodo do dia em que ocorrem; b) substncias consumidas; c) substncias produzidas. 565. UFPA As reaes: I. II. 6CO2 + 12H2O C6H12O6 + 6H2O + 6O2 C6H12O6 + 6O2 6CO2 + 6H2O + 36 ATP

ocorrem no interior das clulas de eucariontes e tem como sede, respectivamente: a) cloroplastos e mitocndrias. b) glioxissomos e cloroplastos. c) peroxissomos e mitocndrias. d) peroxissomos e mesossomos. e) mesossomos e glioxissomos.

PV2D-06-BIO-14

390 430 violeta 430 470 azul 470 540 verde

540 600 amarela 600 650 laranja 650 760 vermelha


197

Trs plantas da mesma espcie so colocadas em um mesmo ambiente e passam pelo seguinte tratamento luminoso: planta I: recebe exclusivamente luz verde; planta II: recebe exclusivamente luz vermelha; planta III: recebe exclusivamente luz amarela. Com relao a essas plantas, pode-se prever que: a) I produzir mais oxignio que II e III. b) II produzir mais oxignio que I e III. c) III produzir mais oxignio que I e II. d) apenas a planta III produzir oxignio. e) I, II e III produziro a mesma quantidade de oxignio. 570. Fuvest-SP Em 1881, Engelman disps um lamento de alga verde Cladophora sobre o espectro luminoso. Bactrias aerbicas presentes no meio concentram-se em determinadas regies do lamento, como pode ser visto no esquema a seguir:

572. Ufla-MG Se plantas que tm pigmentos fotossintticos forem colocadas na presena da luz solar, durante o dia ou, na sua ausncia, noite, pode-se armar em relao aos fenmenos de fotossntese e respirao que a) durante o dia, ocorre fotossntese e, durante a noite, respirao. b) durante o dia, ocorrem respirao e fotossntese e, durante a noite, respirao. c) durante o dia, ocorre respirao e, durante a noite, fotossntese. d) durante o dia, ocorrem respirao e fotossntese e, durante a noite, nenhum destes fenmenos. e) durante o dia, no ocorre nenhum destes fenmenos e, durante a noite, ambos. 573. Considere a tabela a seguir: Fotossntese Organela celular onde ocorre total ou parcialmente Matria-prima usada I III Respirao II IV

Ela ser corretamente completada, se substituirmos I, II, III e IV, respectivamente, por: a) cloroplasto mitocndria glicose CO2 e H2O. b) cloroplasto mitocndria CO2 e H2O glicose. Esse experimento permite inferir que a atividade: a) fotossinttica da alga maior nas faixas do azul, do verde e do amarelo. b) fotossinttica da alga maior nas faixas do violeta, do laranja e do vermelho. c) fotossinttica da alga no varia nas diferentes faixas do espectro luminoso. d) respiratria da alga maior nas faixas do azul, do verde e do amarelo. e) respiratria da alga maior nas faixas do violeta, do laranja e do vermelho. 571. Unifesp As sumamas, grandes rvores da oresta amaznica que atingem at 60 metros de altura, possuem 95% de sua massa seca (o peso seco) correspondente matria orgnica de seus tecidos. Toda essa matria proveio basicamente de a) nutrientes e gua do solo. b) nutrientes inorgnicos do solo e matria orgnica decomposta. c) matria orgnica de folhas decompostas no solo da mata. d) ar atmosfrico e nutrientes do solo. e) ar atmosfrico e gua do solo.
198

c) mitocndria cloroplasto CO2 e H2O glicose. e) cloroplasto mitocndria CO2 e H2O CO2 e H2O.

d) mitocndria cloroplasto glicose CO2 e H2O. 574. Vunesp Com relao s equaes que descrevem dois importantes processos biolgicos I. 12H2O + 6CO2 C6H12O6 + 6O2 + 6H2O II. C6H12O6 + 6O2 6H2O + 6CO2 pode-se armar que: a) I ocorre nos cloroplastos, apenas em clulas vegetais, e II ocorre nas mitocndrias, apenas em clulas animais. b) I ocorre nas mitocndrias, tanto em clulas animais quanto vegetais, e II ocorre nos cloroplastos, apenas em clulas vegetais. c) I ocorre nas mitocndrias, apenas em clulas animais, e II ocorre nos cloroplastos, apenas em clulas vegetais. d) I ocorre nos cloroplastos, apenas em clulas vegetais, e II ocorre nas mitocndrias, tanto em clulas animais quanto vegetais. e) I ocorre nos cloroplastos e mitocndrias, apenas em clulas vegetais, e II ocorre nas mitocndrias, apenas em clulas animais.

575. O cloroplasto, organela citoplasmtica na qual ocorre a fotossntese, apresenta duas membranas que o envolvem e inmeras bolsas membranosas. A respeito do cloroplasto representado na gura, analise as armativas a seguir.

578. UFES A fotossntese ocorre por meio da absoro da energia luminosa pelos pigmentos contidos nos cloroplastos. No entanto, os pigmentos absorvem a energia luminosa em diferentes comprimentos de onda, como pode ser observado no grco a seguir.

1. envolto por duas membranas de constituio lipoprotica (A) e possui internamente um elaborado sistema de bolsas membranosas, interligadas, cada uma chamada tilacide (B). 2. Apresenta estruturas que lembram pilhas de moedas, sendo cada pilha denominada granum (C). 3. Contm molculas de clorola organizadas nos tilacides (B) e, no espao interno do cloroplasto, ca o estroma (D). Est(o) correta(s): a) 1 apenas b) 1 e 2 apenas c) 1, 2 e 3 d) 2 e 3 apenas e) 3 apenas

Em relao a esse processo, incorreto armar que: a) os vegetais expostos ao comprimento de onda de 500 nm, cor verde, apresentam uma baixa taxa fotossinttica. b) as clorolas so pigmentos que apresentam a cor verde, devido reexo desse comprimento de onda. c) o comprimento de onda que apresenta maior absoro corresponde ao azul. d) as plantas expostas ao comprimento de onda 650 nm (vermelho escuro) apresentam taxa de fotossntese igual a zero. e) a integrao funcional dos vrios pigmentos permite maior ecincia na captao de energia luminosa. 579. UFMG (modificado) Vericou-se, atravs de um experimento, que a concentrao de bactrias aerbicas heterotrcas ao redor de um lamento de Spirogyra (Chlorophyta), exposto luz vermelha, era maior que a concentrao ao redor da mesma alga quando exposta luz verde. Baseando-se no grco ao lado, no resultado desse experimento relatado e em seus prprios conhecimentos, responda:

576. Certas plantas utilizadas como ornamento possuem folhas vermelhas. Estes vegetais realizam a fotossntese? Explique. 577. UFMT Na fotossntese, substncias pouco energticas (CO2 e H2O) so transformadas em substncias ricas em energia (como glicose), por meio da transformao da energia luminosa em energia qumica de ligao. A luz utilizada nesse processo absorvida por uma srie de pigmentos. Em relao fotossntese, podese armar: a) Cada pigmento absorve determinados comprimentos de onda, mas tende a reeti-los igualmente em todo o espectro eletromagntico. b) Durante a fotossntese, a clorola absorve totalmente luz verde e emite CO2. c) A clorola, durante a fotossntese, absorve luz predominantemente no comprimento de onda do violeta, azul e vermelho, reetindo no verde, sendo as folhas, por isso, verdes.
PV2D-06-BIO-14

d) A clorola necessita absorver o mximo de energia luminosa, por isso absorve luz em todos os comprimentos de onda com a mesma ecincia. e) A clorola, durante a fotossntese, absorve luz com comprimento de onda na faixa do verde e emite O2.

a) Por que as bactrias se concentram ao redor da alga? b) Por que se deve esperar uma maior concentrao das bactrias ao redor da Spirogyra se ela for submetida luz azul?
199

580. O esquema mostra uma alga lamentosa Spirogyra iluminada com diferentes comprimentos de onda de luz. Bactrias aerbicas crescem de formas diferentes ao longo da alga.

a) Explique por que as bactrias se acumulam nas reas indicadas na gura. b) Se a Spirogyra fosse iluminada diretamente por um feixe de luz branca, o que aconteceria com a distribuio das bactrias? Justique sua resposta. 581. UFRJ Duas experincias esto sendo realizadas. Na primeira, como mostram as guras abaixo, dois feixes de luz, um verde e outro azul, atravessam uma soluo de clorola e incidem sobre uma clula fotoeltrica que transforma energia luminosa em corrente eltrica. A clula est ligada a um aparelho que mede a intensidade da corrente eltrica. Na segunda experincia, duas caixas de vidro fechadas contm, cada uma, um animal e uma planta. Uma caixa recebe um feixe de luz azul e a outra, um feixe de luz verde.

a) A qual processo metablico das plantas o poeta est se referindo? b) Que estruturas e molculas orgnicas devem estar presentes nas clulas desses organismos e que so indispensveis para realizar este processo? c) Qual a equao geral deste processo e que comparao pode-se fazer com a equao geral da respirao celular aerbica? d) Que diferena ocorre com este processo, quando o mesmo realizado pelas sulfobactrias, microrganismos que vivem em ambientes especcos? e) Se voc tivesse que escolher entre duas lmpadas, uma azul e outra verde, para iluminar as plantas de um aqurio, qual seria a escolha correta, objetivando-se uma maior ecincia do processo cujo nome solicitado no item A desta questo? Por qu? 583. Unifesp Primeiro, o suco obtido de uvas esmagadas juntado a fungos do gnero Saccharomyces em tonis fechados. Depois de certo tempo, o fungo retirado e o lquido resultante ltrado e consumido como vinho. As uvas podem ser colhidas mais cedo (menor exposio ao sol) ou mais tardiamente (maior exposio) ao longo da estao. Um produtor que deseje obter um vinho mais seco (portanto, menos doce) e com alto teor alcolico deve colher a uva a) ainda verde e deixar o fungo por mais tempo na mistura. b) ainda verde e deixar o fungo por menos tempo na mistura. c) mais tarde e deixar o fungo por menos tempo na mistura. d) mais tarde e deixar o fungo por mais tempo na mistura. e) mais cedo e deixar o fungo por menos tempo na mistura. 584. Vunesp Observe o esquema.

Explique por que o animal da caixa iluminada com o feixe azul pode manter maior atividade que o da outra caixa. 582. UFC-CE Leia os versos a seguir e responda ao que se pergunta. Luz do sol, Que a folha traga e traduz. Em verde novo, Em folha, em graa, em vida, Em fora, em luz.
Caetano Veloso

Um bilogo, ao analisar esse esquema hipottico, observou que as mitocndrias e cloroplastos originaram-se de um ancestral procarionte e se associaram a determinados tipos de clulas. As mitocndrias esto presentes no citoplasma de clulas animais, clulas vegetais e nos fungos, enquanto os cloroplastos so encontrados em clulas fotossintetizantes, estabelecendo-se entre eles relaes harmnicas de mutualismo.

200

Tendo-se como referncia estas informaes e o esquema, responda: a) Que vantagens as mitocndrias oferecem s clulas hospedeiras e o que elas proporcionam s organelas? b) Quais as vantagens proporcionadas ao meio ambiente pelos cloroplastos? 585. FEI-SP Os fatores externos limitantes da fotossntese so: a) concentrao de O2. b) concentrao de dixido de carbono, gua, oxignio e luz. c) concentrao de O2, gua, oxignio, luz e temperatura. d) concentrao de dixido de carbono, gua, luz e temperatura. e) concentrao de poluentes, gua e luz. 586. UEL-PR Pode-se esperar que uma planta com decincia de magnsio apresente: a) folhas de cor verde-escura. b) clulas meristemticas mortas. c) frutos e sementes imaturos. d) clulas incapazes de realizar transporte ativo. e) folhas plidas, amareladas ou esbranquiadas. 587. Cesgranrio-RJ Qual dos grcos a seguir relaciona corretamente a quantidade de oxignio liberado pela fotossntese (O2) com a intensidade luminosa? a)

588. UEL-PR Certas plantas desenvolvem-se bem em lugares sombrios ou no interior de residncias, provavelmente porque a) so muito competitivas em relao luz solar. b) tm pequeno porte e so rasteiras. c) tm baixo ponto de compensao. d) a superfcie de sua folhas grande e delicada. e) so caractersticas de campos cerrados. 589. Vunesp-SP Considere a armao: Para que ocorra o crescimento da vegetao, as plantas necessitam ser submetidas, pelo menos algumas horas do dia, a intensidades luminosas que permitam que elas ultrapassem seu ponto de compensao luz. a) A frase falsa ou verdadeira? b) Justique sua resposta. 590. Mackenzie-SP

b)

c)

O grco mostra as variaes das velocidades de dois processos A e B que ocorrem nos vegetais. Assinale a alternativa correta. a) A e B s se vericam na presena de luz. b) A luz o nico fator que interfere na realizao de A. c) B pode ocorrer na ausncia de luz. d) Aumentando a intensidade luminosa, a velocidade do processo A tambm aumenta indenidamente. e) Diminuindo a intensidade luminosa, a velocidade do processo B tambm diminui. 591. Observando-se as reaes de uma planta iluminao, em condies experimentais, foi possvel construir um grco, onde a linha pontilhada representa a respirao e a linha cheia, a fotossntese.

d)

e)
PV2D-06-BIO-14

A anlise do grco permite concluir que a tendncia da planta : a) desenvolver fototropismo.


201

b) c) d) e)

reproduzir-se. acumular reservas nutritivas. denhar por falta de alimento disponvel. crescer.

Se o teor baixo, o cresol perde CO2 para o meio, torna-se alcalino e adquire a cor roxa. A gura reproduz um experimento realizado na presena e, depois, na ausncia de luz e em um mesmo intervalo de tempo.

592. PUCCamp-SP Num experimento realizado em presena de luz, dois organismos clorolados foram colocados em recipientes distintos (1 e 2) que continham inicialmente igual taxa de O2 e CO2 dissolvidos. Aps algum tempo, o recipiente 1 continuava a apresentar a mesma taxa desses gases e o recipiente 2 tinha muito mais CO2 do que O2. Considere as armaes a seguir. I. A taxa de fotossntese do organismo do recipiente 1 foi maior do que a de respirao. II. As taxas de fotossnteses e de respirao do organismo do recipiente 1 foram iguais. III. A taxa de respirao do organismo do recipiente 2 foi maior do que a de fotossntese. IV. As taxas de fotossntese e de respirao do organismo do recipiente 2 foram iguais. Com base nos dados obtidos no experimento, possvel aceitar como verdadeiras apenas as armaes a) I e II d) II e III b) I e III e) III e IV c) I e IV 593. UFSCar-SP Trs tubos de ensaio identicados como I, II e III receberam, cada um, uma folha recm-cortada de um arbusto. Os tubos foram fechados hermeticamente e colocados a distncias diferentes de uma mesma fonte de luz. Aps duas horas, vericou-se que: a concentrao de CO2 no interior do tubo I diminuiu; no interior do tubo II, a concentrao de CO2 manteve-se inalterada; no interior do tubo III, a concentrao de CO2 duplicou. Tais resultados permitem concluir que a folha do tubo: a) I cou exposta a uma intensidade luminosa inferior a seu ponto de compensao ftico. b) II cou exposta a uma intensidade luminosa superior a seu ponto de compensao ftico. c) III cou exposta a uma intensidade luminosa superior a seu ponto de compensao ftico. d) III cou exposta a uma intensidade luminosa inferior a seu ponto de compensao ftico. e) II cou exposta a uma intensidade luminosa superior a seu ponto de compensao ftico. 594. FMTM-MG O cresol uma mistura de cor rosa, indicadora de pH que, em soluo, tem a propriedade de permanecer em equilbrio com o teor de CO2 do meio em que se encontra. Se o teor alto, o cresol absorve o CO2 do meio, torna-se mais cido e adquire a cor amarela.
202

O resultado observado foi: a) a soluo adquiriu a cor arroxeada aps car no escuro, pois a folha eliminou CO2 para o ar. b) a soluo adquiriu a cor amarela aps car exposta ao sol, pois a folha absorveu CO2 do ar. c) a soluo adquiriu a cor amarela aps car no escuro, pois a folha eliminou CO2 para o ar. d) a soluo adquiriu a cor arroxeada aps car exposta ao sol, pois aumentou o teor de CO2 do ar. e) a soluo adquiriu a cor amarela aps car no escuro, pois diminuiu o teor de CO2 do ar. 595. UEL-PR Analise a gura a seguir.

Qual das curvas sugeridas, na gura, representa a variao da xao de CO2 em relao temperatura para uma planta submetida a uma intensidade luminosa constante? a) A d) D b) B e) E c) C 596. Unicamp-SP Em um experimento, foram obtidos dados que permitiram a construo do grco abaixo. Interprete o grco, explicando o signicado do ponto x e das reas destacadas A e B.

597. UFAL O grco adiante mostra as taxas da fotossntese e da respirao em diferentes intensidades luminosas. Aps a anlise do grco, zeram-se as seguintes armaes:

a) morre rapidamente, pois no consegue o suprimento energtico de que necessita. b) continua crescendo, pois mantm a capacidade de retirar gua e alimento do solo. c) continua crescendo, pois mantm a capacidade de armazenar o alimento que sintetiza. d) continua viva, mas no cresce, pois consome todo o alimento que produz. e) Continua viva, mas no cresce, pois perde a capacidade de retirar do solo os nutrientes de que necessita. 600. Fuvest-SP Em seus estudos sobre fotossntese, um bilogo colocou uma planta em um sistema fechado, sujeito a diferentes intensidades luminosas. Medindo a variao do teor de oxignio, obteve valores que lhe permitiram construir o grco abaixo. Qual o signicado biolgico das setas A, B e C assinaladas no grco?

I.

Em intensidades luminosas menores do que X, a planta consome mais do que produz. II. Em intensidades luminosas maiores do que X, a planta tem condies de armazenar substncias de reserva. III. Em qualquer intensidade luminosa, a taxa da fotossntese maior do que a da respirao. Apenas correto o que se arma em: a) I d) I e II b) II e) II e III c) III 598. Cesgranrio-RJ

601. UFC-CE A fotossntese e a respirao so dois processos que ocorrem simultaneamente nas plantas verdes. Construa um grco mostrando a produo de O2 e a de CO2, durante um perodo de 24h, por uma planta adequadamente suprida de gua e submetida s condies normais de iluminao de nossa regio, onde o sol nasce s 6 horas da manh e se pe s 6 horas da tarde. O eixo Y representa a produo dos dois gases e o eixo X o perodo de 24 horas. No necessrio atribuir unidades s produes de O2 e CO2. 602. Fatec-SP Com base no ponto de compensao ftico, as plantas so classicadas em plantas de sol e plantas de sombra. Assim, correto armar que: a) As plantas de sombra possuem ponto de compensao ftico baixo e vivem em locais de alta luminosidade. b) As plantas de sol e as plantas de sombra possuem ponto de compensao ftico alto, mas as plantas de sol vivem em locais de alta luminosidade, e as plantas de sombra, em locais de baixa luminosidade. c) As plantas de sol possuem ponto de compensao ftico baixo e vivem em locais de baixa luminosidade. d) As plantas de sol possuem ponto de compensao ftico alto e vivem em locais de alta luminosidade. e) As plantas de sombra vivem em locais iluminados articialmente.
203

O grco anterior ilustra a inuncia da luz na velocidade da fotossntese. A anlise do grco s no nos permite armar que no ponto: a) 1, a planta est no escuro. b) 1, a planta no produz O2. c) 2, a quantidade de O2 que a planta consome igual a quantidade produzida. d) 2, a fotossntese atingiu uma velocidade igual da respirao. e) 3, a luz passa a atuar como fator limitante do processo. 599. Fuvest-SP Em determinada condio de luminosidade (ponto de compensao ftico), uma planta devolve para o ambiente, na forma de gs carbnico, a mesma quantidade de carbono que xa, na forma de carboidrato, durante a fotossntese. Se o ponto de compensao ftico mantido por certo tempo, a planta:

PV2D-06-BIO-14

603. Fatec-SP Observe o grco a seguir, que representa o ponto de compensao ftico (PCF) de duas plantas, A e B, de espcies diferentes, que se encontram no mesmo ambiente.

605. UFPE As taxas de fotossntese e de respirao podem ser calculadas em funo da relao entre a quantidade de oxignio produzido ou consumido em um tempo determinado. Analise o grco abaixo e indique o que ocorre quando h variao na intensidade luminosa.

correto armar que: a) o PCF o mesmo para as plantas A e B. b) a taxa respiratria varia para as plantas A e B. c) a planta A, para poder crescer, precisa receber luz em intensidade abaixo do seu PCF. d) a planta B , provavelmente, uma planta de sol (helila) e, para poder crescer, precisa receber luz em intensidade igual do seu PCF. e) as plantas A e B, para poderem crescer, precisam receber luz em intensidade superior aos seus PCFs. 604. UFSCar-SP O grco representa as taxas fotossintticas e de respirao para duas diferentes plantas, uma delas umbrta (planta de sombra) e a outra helita (planta de sol). Considere que a taxa respiratria constante e igual para as duas plantas.

0. Na intensidade luminosa 2, a planta est gastando suas reservas e consumindo oxignio. 1. Na intensidade luminosa 3, o volume de oxignio produzido na fotossntese igual ao volume consumido. 2. Se a planta for mantida na intensidade luminosa 6, ela no ir conseguir produzir matria orgnica. 3. A produo de glicose no depende da variao de intensidade da luz e, portanto, ser a mesma se a planta estiver na intensidade 2 ou 6. 4. A fotossntese depende do equilbrio entre o consumo e a produo de oxignio e, portanto, ocorre na intensidade luminosa 3. 606. UFPR (modificado) Estudando dois processos bioqumicos realizados por uma determinada planta, um pesquisador obteve os resultados registrados no grco abaixo.

Pode-se concluir que: a) no intervalo X-Y, cada uma das plantas consome mais oxignio do que aquele produzido na sua fotossntese. b) a partir do ponto Y, cada uma das plantas consome mais oxignio do que aquele produzido na sua fotossntese. c) as plantas A e B so, respectivamente, umbrta e helita. d) no intervalo X-Y, cada uma das plantas produz mais oxignio do que aquele consumido na sua respirao. e) no ponto X, a planta A consome mais oxignio do que aquele produzido na sua fotossntese, e a planta B produz a mesma quantidade de oxignio que aquela consumida na sua respirao.
204

Com base no grco e no conhecimento sobre o assunto, assinale verdadeira (V) ou falsa (F) para cada frase a seguir. 01. Resultados semelhantes poderiam ser obtidos se a pesquisa fosse realizada com animais. 02. A organela envolvida no processo da fotossntese em clulas vegetais est igualmente presente nas cianobactrias. 04. No ponto A, a planta produz menos glicose pela fotossntese do que a que consome na respirao celular. 08. Na intensidade luminosa B, a quantidade de CO2 eliminada na respirao celular igual consumida pela fotossntese.

16. A partir do ponto B, a planta tem condies de armazenar reservas energticas. 32. Sob intensidade luminosa elevada, como em (C), a planta libera menos O2 do que consome e capta mais CO2 do que produz. 64. Se a intensidade luminosa correspondente ao ponto C fosse mantida constante, um decrscimo de concentrao de CO2 no ambiente provocaria um aumento na taxa da fotossntese. 607. UEPG-PR A respeito da fotossntese, assinale o que for correto. 01. Do espectro eletromagntico da luz branca, a clorola capaz de absorver apenas as radiaes componentes do chamado espectro visvel, que compreende as radiaes cujos comprimentos de onda esto entre 390 e 760 m. 02. O ponto de compensao luminoso corresponde taxa de luz em que a atividade fotossintetizante igual atividade respiratria. Isso signica que, nesse ponto, a planta consome, na respirao, uma quantidade de O2 equivalente produzida na fotossntese; ou que consome na fotossntese uma quantidade de CO2 equivalente liberada pela respirao. 04. Uma planta encontra-se acima do ponto de compensao quando a intensidade luminosa tal que a fotossntese supera a respirao. Por outro lado, est abaixo do ponto de compensao quando a atividade respiratria supera a atividade fotossintetizante, devido carncia de luz. 08. Uma planta no sobreviver se for mantida indenidamente no ponto de compensao ou abaixo dele. Nestas circunstncias, no ir dispor de alimento suciente para garantir a manuteno de suas atividades vitais. 16. O oxignio produzido na fotossntese vem do CO2 absorvido pelas plantas. 608. Unifesp O jornal Folha de S.Paulo (28.07.2004) noticiou que o aumento do dixido de carbono (CO2) atmosfrico pode induzir rvores da Amaznia a crescerem mais rapidamente. O aumento do CO2 global e, no entanto, o fenmeno vericado na Amaznia e no nas orestas temperadas da Europa. Para explicar tal fenmeno, quatro armaes foram feitas. I. O aumento do CO2 promove aquecimento, porm bloqueia parte dos raios solares que chegam ao solo. Esse bloqueio, associado s noites mais longas, faz com que as orestas temperadas sejam menos ecientes na fotossntese. II. As orestas temperadas esto sujeitas a um inverno mais longo e, portanto, a menor quantidade de luz. Como as plantas fazem fotossntese de dia e respiram noite, a taxa de respirao maior que a de fotossntese. III. A maior quantidade de CO2 disponvel, associada s altas temperaturas presentes na Amaznia, permite uma elevao da taxa fotossinttica, o que promove maior crescimento das plantas. IV. As temperaturas mais baixas, a menor biomassa por rea e a menor incidncia de luz nas orestas temperadas fazem com que, ali, o fenmeno seja menos evidente que na Amaznia.

Entre as quatro armaes apresentadas, esto corretas somente: a) I e II. d) II e IV. b) I e III. e) III e IV. c) II e III. 609. Vunesp Um grupo de estudantes montou o seguinte experimento: quatro tubos de ensaio foram etiquetados, cada um com um nmero, 1, 2, 3 e 4. Uma planta de egria (planta aqutica) foi colocada nos tubos 1 e 2. Os tubos 1 e 3 foram cobertos com papel alumnio, de modo a criar um ambiente escuro, e outros dois foram deixados descobertos. Dentro de cada tubo foi colocada uma substncia indicadora da presena de gs carbnico, que no altera o metabolismo de planta. Todos os tubos foram fechados com rolha mantidos por 24 horas em ambiente iluminado e com temperatura constante. A gura representa a montagem do experimento.

Sabendo-se que a soluo indicadora tem originalmente cor vermelho-clara, a qual muda para amarela quando aumenta a concentrao de gs carbnico dissolvido, e para vermelho-escura quando a concentrao desse gs diminui, pode-se armar que as cores esperadas ao nal do experimento para as solues dos tubos 1, 2, 3 e 4 so, respectivamente, a) amarela, vermelho-clara, vermelho-clara e vermelho-escura. b) amarela, vermelho-escura, vermelho-clara e vermelho-clara. c) vermelho-escura, vermelho-escura, amarela e amarela. d) amarela, amarela, amarela e amarela. e) vermelho-escura, vermelho-clara, vermelho-escura e amarela. 610. Unifesp O vermelho de cresol uma substncia que serve como indicadora do pH. Em meio alcalino, torna-se roxa e, em meio cido, amarela. Num estudo sobre taxa de fotossntese, foi realizado o seguinte experimento:

PV2D-06-BIO-14

205

Sabendo que o vermelho de cresol absorve o CO2 do meio e permanece em soluo na forma de cido carbnico (H2CO3), responda: a) Em qual tubo, A ou B, houve maior taxa de fotossntese? Justique a resposta. b) Explique o que ocorreu no outro tubo com relao siologia da planta que ali se encontra. 611. Unicamp-SP Uma alterao climtica muito noticiada o efeito estufa, que se atribui ao aumento da concentrao de gases como o CO2 na atmosfera. Segundo algumas previses, esse fenmeno poder causar um aumento de 3 C na temperatura mdia do planeta nos prximos 100 anos. A gura abaixo mostra o crescimento relativo de duas espcies de plantas em funo da temperatura ambiente.

Em relao ao experimento descrito: a) cite o nmero do tubo representado na gura I em que a taxa de fotossntese for maior, relacionandoo com a gura II. b) cite o fenmeno que est representado pelo ponto B na gura II. Justique sua resposta. c) determine a intensidade luminosa, I, II e III, na qual a planta viveria menos tempo. Justique sua resposta. d) cite o nmero do tubo e a letra, indicados nas guras I e II, que representam a relao entre fotossntese e respirao numa comunidade vegetal da oresta Amaznica. 613. PUC-MG Nas clulas eucariotas vegetais, o cloroplasto responsvel pela: a) fotossntese e respirao celular. b) fotossntese, apenas. c) respirao celular, apenas. d) sntese de protenas e lipdios e) sntese de cidos nuclicos.

a) Em um local com temperatura mdia de 20C convivem as espcies A e B. Qual das duas espcies seria beneciada pelo aumento previsto de temperatura? Explique. b) Por que a concentrao de CO2 inuencia o crescimento das plantas? c) A escassez de gua no solo afeta negativamente o crescimento da planta. Por qu? 612. UFMG As guras I e II mostram um experimento para o estudo da fotossntese na planta aqutica eldea. Na gura I, ramos de igual tamanho foram colocados em tubos, hermeticamente fechados, contendo gua e azul de bromotimol, soluo indicadora que apresenta colorao verde em meio neutro, amarela em meio cido e azul em meio bsico. Na gura II, est indicada a variao das taxas de fotossntese e respirao dessa planta em funo da intensidade luminosa.

614. UEL-PR Nas clulas dos eucariontes auttrofos, as enzimas que atuam no processo da fotossntese esto: a) em invaginaes da membrana plasmtica. b) dispersas no citoplasma fundamental. c) no suco celular do vacolo. d) no interior dos cloroplastos. e) no interior das mitocndrias. 615. PUC-MG O processo fotossinttico de uma clula eucariota ATP-dependente e ocorre mesmo quando o cloroplasto isolado da clula. Esse ATP diretamente proveniente da: a) quebra da molcula de gua. b) atividade mitocondrial. c) reduo das molculas de CO2. d) fotofosforilao cclica e acclica. 616. Mackenzie-SP O processo de fotossntese considerado em duas etapas: a fotoqumica, ou fase de claro, e a qumica, ou fase de escuro. Na primeira fase no ocorre: a) produo de ATP. b) produo de NADPH2. c) produo de O2. d) fotlise da gua. e) utilizao do CO2.

206

617. UEL-PR O que indicam, respectivamente, as letras A, B, C e D na tabela abaixo? Organela Mitocndria B Lisossomo D Reao Sntese de ATP Fotlise de gua Hidrlise Oxidao Processo A Fotossntese C Detoxicao celular

a) Respirao celular, ribossomo, detoxicao celular, cloroplasto. b) Respirao anaerbica, cloroplasto, sntese de nucleotdeos, ribossomo. c) Respirao celular, cloroplasto, digesto intracelular, peroxissomo. d) Sntese de protenas, peroxissomo, digesto intracelular, ribossomo. e) Fermentao, cloroplasto, sntese de lipdios, lisossomo. 618. FCMSC-SP Escrevendo-se que durante a etapa fotoqumica da fotossntese houve: I. Fotlise da gua II. Reduo do NADP a NADPH2 IV. Desprendimento de oxignio Foi cometido erro: a) na I e na II. b) na II, na III e na IV. c) na II, apenas. d) na III, apenas. e) na II e na III. 619. PUC-SP (modificado) Se, no mecanismo fotossintetizante, uma molcula de gua for absorvida por um cloroplasto, seu tomo de oxignio: a) ser eliminado para o ar, como parte de uma molcula de oxignio. b) ser incorporado numa molcula de cido pirvico. c) agir como aceptador de hidrognio na fosforilao. d) tornar-se- parte de uma molcula de glicose. e) Nenhuma das anteriores. 620. UFBA
PV2D-06-BIO-14

a) b) c) d) e)

a funo da clorola na sntese orgnica. a origem do oxignio desprendido na fotossntese. o mecanismo de formao dos carboidratos. a importncia do CO2 para os seres clorolados. a importncia da luz para a sntese de glicose.

III. Fotofosforilao do ATP que passa a ADP

621. UFV-MG A liberao de oxignio pelas plantas verdes foi o primeiro fato, relacionado com a fotossntese. Posteriormente, descobriu-se que a fotossntese praticamente o nico meio importante de produo de oxignio atmosfrico. Entretanto, por algum tempo, questionou-se a origem deste oxignio durante as reaes fotossintticas. Qual das substncias relacionadas a seguir, conforme cou comprovado, utilizada pelas plantas como fonte deste oxignio? a) CO2 d) C6H12O6 b) H2O e) NADP c) ATP 622. UFPI Analise as duas reaes a seguir:

A ilustrao representa o experimento em que um fragmento de Elodea colocado em gua pesada (H2O18). Na planta estudada, essas experincia evidencia:

Atravs da anlise das reaes acima, podemos armar que: a) a reao I est correta, conrmando que o O2 proveniente do CO2. b) a reao II est correta, conrmando que o O2 proveniente da H2O. c) as reaes I e II esto corretas, pois o O2 provm tanto do CO2 como da H2O. d) as reaes I e II no fornecem informaes sucientes para se concluir a origem do O2 liberado. e) as reaes I e II esto erradas, pois o O2 liberado proveniente da molcula de clorola.

207

623. F.M. ABC-SP Algumas sulfobactrias fotossintetizantes utilizam cido sulfdrico, ao invs de gua (H2O), como fonte de eltrons (hidrognio). Nesse tipo de processo fotossinttico no ocorre: a) liberao de oxignio molecular (O2). b) utilizao de CO2 como fonte de carbono. c) formao de carboidratos como produto. d) utilizao de luz como fonte de energia. e) formao de gua (H2O) como produto. 624. UFRN Certas bactrias usam H2S na fotossntese, em lugar de gua. Sabendo que as etapas do processo so as mesmas que ocorrem nos vegetais, a equao geral para a fotossntese dessas bactrias : a) CO2 + 2 H2S (CH2O) + H2O + 2 S. b) CO2 + 2 H2S (CH2O) + S + 0,5 O2. c) CO2 + 2 H2S (CH2O) + SO. d) CO2 + 2 H2S (CH2) + SO2. e) CO2 + 2 H2S CS + H2O + 0,5 O2. 625. Cesgranrio-RJ (modificado)

b) que so captados pelo sistema de citocromos e armazenados sob a forma de fosfogliceraldedo. c) transferindo diretamente a energia luminosa ao ADP, que se transforma em ATP. d) que passam por transportadores de eltrons e retornam clorola. e) nenhuma das anteriores. 627. Fatec-SP (modificado) Abaixo esto descritos dois processos metablicos: I A gliclise ocorre no hialoplasma, durante a respirao celular. Nesse processo, uma molcula de glicose transforma-se em duas molculas de cido pirvico, com um lucro lquido de 2 ATP. II. A fotlise da gua ocorre nos cloroplastos. Nesse processo, na presena de luz, ocorre quebra de molculas de gua, liberando-se O2 e produzindo NADPH2. Assinale a alternativa que relaciona corretamente os processos metablicos descritos com os organismos nos quais eles ocorrem. Mamferos a) b) c) d) e) Apenas I Apenas II I e II Apenas I Apenas I Plantas I e II Apenas I Apenas II Apenas II I e II Algas I e II I e II Fungos Apenas I I e II

Apenas I Apenas II I e II I e II

Apenas II Apenas I

Observe o esquema anterior e analise as seguintes armaes. I. A transferncia de eltrons para os aceptores permite a transformao de energia luminosa em energia qumica. II. Na ausncia de aceptores de eltrons, poderia haver a ocorrncia do fenmeno conhecido como uorescncia, caracterizado como a liberao de energia na forma de luz. III. Quando excitada pela luz, a clorofila absorve principalmente luz verde. A(s) armao(es) correta(s) (so): a) apenas a I. b) apenas a II. c) apenas a I e a II. d) apenas a I e a III. e) apenas a II e a III. 626. UA-AM Durante a fotofosforilao cclica, h produo de ATP quando, aps absoro de energia luminosa, as molculas de clorola emitem eltrons: a) que cindem molculas de gua e depois retornam clorola.
208

Amabis e Martho. Biologia, vol.2.

628. Unicamp-SP Por muitos anos pensou-se erroneamente que o oxignio produzido na fotossntese viesse do CO2, absorvido pelas plantas. a) De que substncia se origina o O2, liberado no processo fotossinttico? b) Indique a equao geral da fotossntese para os vegetais clorolados. c) Qual o destino do O2 produzido? d) Qual a funo da clorola na fotossntese? 629. Fuvest-SP Um pesquisador forneceu a uma cultura de algas gs carbnico marcado com o istopo 18O do oxignio. A uma segunda cultura de algas foi fornecida gua com esse mesmo istopo. As culturas foram mantidas iluminadas por um certo tempo, aps o que as substncias qumicas presentes no meio e nas clulas das algas foram analisadas. a) Alm de gs carbnico, que outra substncia apresenta o istopo 18O na primeira cultura? Justique sua resposta. b) Alm da gua, que outra substncia apresenta o istopo 18O na segunda cultura? Justique sua resposta.

630. UFRJ Em 1931, desejando estudar a fotossntese, Cornelius van Niel observou que bactrias fotossintetizadoras usavam H2S e geravam enxofre como produto. A equao a seguir mostra as reaes fotossintticas dessas bactrias:

c) Ambos os processos so inuenciados pela temperatura. d) O processo I utiliza como reagentes os produtos do processo II. e) Para ambos os processos existem organelas especializadas no citoplasma das clulas eucariotas. 633. Mackenzie-SP Uma das folhas de uma planta foi parcialmente coberta com uma tira de papel alumnio, como mostra a gura a seguir. Durante alguns dias, essa planta foi exposta luz uniforme. A respeito desse experimento, so feitas as seguintes armativas:

Comparando essa equao com a da fotossntese das plantas, o que podemos deduzir a respeito da origem do oxignio gerado pelas plantas que realizam fotossntese? 631. UFMG Observe esta figura em que esto representados subprodutos de dois processos I e II:

I.

Considerando-se as informaes dessa gura, incorreto armar que, a) em ambientes agrcolas e esturios marinhos, o processo I responsvel pela maior taxa de O2 presente na atmosfera. b) no processo I, h formao de compostos energticos e, no processo II, se verica liberao de energia. c) no processo I, o produto eliminado produzido aps a fotlise da gua e, no processo II, o produto que se elimina formado aps a oxidao da glicose. d) nos campos e orestas, o processo II apresenta maior taxa no perodo noturno. 632. Mackenzie-SP Relativamente ao grco a seguir, referente a dois processos celulares, assinale a alternativa falsa.

A regio coberta torna-se amarelada devido ausncia da clorola. II. As regies no cobertas da folha apresentaro maior quantidade de amido que a poro coberta. III. Na regio coberta, os processos prejudicados so a quebra da molcula de gua e a produo de ATP. Assinale: a) se todas forem corretas. b) se somente I e II forem corretas. c) se somente II e III forem corretas. d) se somente I for correta. e) se somente II for correta. 634. FMTM-MG Os esquemas a seguir reproduzem as estruturas internas de um cloroplasto e de uma mitocndria, ambos presentes nas clulas dos vegetais superiores.

a) No processo II o oxignio liberado provm da molcula de CO2. b) O ponto A representa o ponto de compensao ftico, no qual no h excedente de O2.

Em relao a essas organelas e suas funes, pode-se armar que: a) na organela I s ocorrem reaes que liberam energia, enquanto na organela II todas as reaes consomem energia. b) na organela II o O2 produzido proveniente da quebra do CO2 no ciclo das pentoses, e na organela I este gs usado na cadeia respiratria como aceptor de eltrons.
209

PV2D-06-BIO-14

c) as enzimas que catalisam as reaes de produo de compostos orgnicos ricos em energia encontram-se nas regies A e C. d) a gua a substncia fornecedora de eltrons na organela I e aceptora de eltrons na organela II. e) em ambas ocorre produo de ATP por meio do processo de fosforilao na presena de uma cadeia de transportadores de eltrons. 635. Fuvest-SP Clulas de certos organismos possuem organelas que produzem ATPs e os utilizam na sntese de substncia orgnica a partir de dixido de carbono. Essas organelas so: a) os lisossomos b) os mitocndrios c) os cloroplastos d) o sistema de Golgi e) os nuclolos 636. Unirio-RJ A fase luminosa e a fase escura da fotossntese ocorrem, respectivamente: a) nas lamelas e no estroma dos cloroplastos. b) no estroma e nas lamelas dos cloroplastos. c) nas lamelas dos cloroplastos e no citoplasma. d) no estroma dos cloroplastos e no citoplasma. e) no citoplasma e nas lamelas dos cloroplastos. 637. FCC-SP A fotossntese compreende duas seqncias de reaes, que constituem a etapa fotoqumica e a etapa qumica. Na etapa qumica ocorre: a) transformao do gs carbnico em glicose. b) transformao da energia luminosa em energia qumica. c) transformao dos acares em protenas. d) liberao de oxignio. e) ionizao das molculas de gua. 638. FAAP-SP (modificado) Costuma-se dividir a fotossntese em duas etapas: a fotoqumica e a qumica. Responda: a) A incorporao do CO2 ocorre em que etapa? b) A quebra da molcula da gua ocorre em que etapa? c) A produo do O2 ocorre em que etapa? d) Quais os reagentes e produtos que envolvidos nas duas etapas? 639. PUC-RJ Analise as reaes: I. II. III.
210

A respirao aerbica, a fase qumica da fotossntese e a fase fotoqumica da fotossntese esto representadas, respectivamente, em: a) III, II, I. d) I, II, III. b) I, III, II. e) II, III, I. c) III, I, II. 640. Cesgranrio-RJ A equao a seguir uma generalizao do processo da fotossntese: CO2+ 2H2A (CH2O) n + H2O + 2A Sobre esse processo so feitas as seguintes armaes: I. Se H2A for gua, esse composto ser a fonte exclusiva da liberao de O2. II. A fase escura desse processo ocorre no hialoplasma. III. A substncia H2A pode funcionar como fonte de eltrons. IV. Na fase do processo chamada fotoqumica, a clorola absorve energia qumica. So corretas as seguintes armaes: a) apenas I e III. b) apenas II e III. c) apenas I, II e IV. d) apenas II, III e IV. e) todas. 641. PUC-MG Leia as armativas a seguir referentes ao processo da fotossntese nos cloroplastos: I. Ocorre reduo de CO2 at a formao da glicose. II. O oxignio da fotossntese oriundo do processo de fotlise da gua. III. A fotofosforilao cclica e a acclica produzem energia para o processo. A armao est correta em: a) I, II e III. d) II apenas. b) II e III apenas.e) III apenas. c) I e III apenas. 642. UFV-MG Com relao fotossntese das plantas superiores, qual das alternativas a seguir incorreta? a) O CO2 liberado para o ambiente. b) um processo realizado nos cloroplastos. c) A luz a fonte doadora de energia. d) O O2 liberado resultante da quebra da gua. e) A glicose o produto nal. 643. Makenzie-SP Assinale a alternativa incorreta a respeito da fotossntese. a) Se a gua fornecida para uma planta contiver oxignio radioativo, toda a radioatividade ser encontrada nas molculas de glicose. b) um processo que ocorre principalmente nas plantas, mas pode ser observado tambm em bactrias.

glicose + O2 CO2 + H2O + ATP NADP + ADP + H2O NADPH2 + ATP + O2 NADPH2 + ATP + CO2 glicose + ADP + NADP

c) Temperaturas muito altas podero reduzir a velocidade desse processo, bem como concentraes muito baixas de CO2. d) Uma das etapas desse processo independente de luz. e) Na etapa dependente de luz, h produo de ATP que ser utilizado na sntese de glicose. 644. Fuvest-SP Dois importantes processos metablicos so: I. ciclo de Krebs, ou ciclo do cido ctrico, no qual molculas orgnicas so degradadas e seus carbonos, liberados como gs carbnico (CO2); II. ciclo de Calvin-Benson, ou ciclo das pentoses, no qual os carbonos do gs carbnico so incorporados em molculas orgnicas. Que alternativa indica corretamente os ciclos presentes nos organismos citados? a) b) c) d) e) 645. A que substncia ou fator corresponde cada nmero no esquema abaixo? Humanos Plantas Algas Lvedo I e II I e II I e II apenas I I e II apenas II apenas II I e II I e II I e II I e II I e II apenas I I e II I e II apenas I apenas I apenas II apenas II apenas I

a) 1, 2, 4, 3 b) 2, 3, 1, 4

c) 3, 1, 2, 4 d) 4, 2, 3, 1

647. PUC-PR A fotossntese o processo nutritivo fundamental dos seres vivos, que ocorre em algas e nos vegetais com a produo de molculas orgnicas a partir de gs carbnico e gua e a utilizao da energia luminosa. Realiza-se em duas fases: a fase luminosa e a fase escura.

Analise as armaes referentes a essas fases: I. Na fase luminosa ocorre a absoro da luz e a transformao da energia luminosa em energia de ATP. II. Na fase luminosa tambm ocorre a quebra das molculas de gua em hidrognio e oxignio, sendo este ltimo liberado pela planta. III. A fase escura ocorre na tilacide do cloroplasto e compreende a construo de glicdios a partir de molculas de CO2 do ambiente. Est correta ou esto corretas: a) apenas III. b) apenas II. c) apenas I. d) apenas II e III. e) apenas I e II. 648. PUC-RJ O esquema abaixo representa uma organela celular relacionada a um processo vital para os seres vivos.

646. UERJ O esquema a seguir representa as duas principais etapas da fotossntese em um cloroplasto. O sentido das setas 1 e 4 indica o consumo e o sentido das setas 2 e 3 indica a produo das substncias envolvidas no processo.

Adaptado de ALBERTS et alii. Molecular biology of the cell.

Os nmeros das setas que correspondem, respectivamente, s substncias CO2, O2, acares e H2O so:

New York: Garland Publishing, 1986.

Com base no esquema acima, indique: I. a fonte exclusiva de oxignio liberado; II. o local de ocorrncia da fase luminosa; III. local de ocorrncia da sntese nal de glicdios; IV. a substncia que entra na fase escura. Assinale a opo que apresenta indicao correta: a) I: H2O, II: granum, III: estroma, IV: CO2 b) I: H2O, II: estroma, III: granum, IV: CO2 c) I: H2O, II: granum, III: estroma, IV: O2
211

PV2D-06-BIO-14

d) I: CO2, II: estroma, III: granum, IV: H2O e) I: CO2, II: granum, III: estroma, IV: H2O 649. UFF-RJ As clulas vegetais requerem luz para suas atividades metablicas. Aps algum tempo em ausncia de luz: a) a nica fonte geradora de ATP passa a ser a mitocndria. b) ocorre um aumento compensatrio do nmero de cloroplastos. c) a clula interrompe o anabolismo, mantendo apenas o catabolismo. d) a cadeia respiratria passa a funcionar em sentido inverso, para formar compostos ricos em energia. e) a clula passa a utilizar a energia armazenada em forma de calor. 650. Fuvest-SP Foram os trabalhos de Calvin, Bassham e Benson, empreendidos desde 1946, que permitiram conhecer as diversas etapas de reduo do CO2 a glicdios. Estes pesquisadores trabalharam com algas verdes unicelulares, s quais forneceram CO2 marcado com C14 (carbono radiativo), demonstrando que o primeiro composto estvel que aparece o cido fosfoglicrico, j que um de seus carbonos era radiativo. A que fenmeno biolgico corresponde esta descrio? a) fotofosforilao cclica b) fase clara da fotossntese c) fase escura da fotossntese d) fotofosforilao acclica e) fotlise da gua 651. UFV-MG A fotossntese divide-se em fases fotoqumica e qumica. Pode-se dizer que na fase: a) fotoqumica h produo de ATP, NADPH2, fotlise de H2O e produo de O2 livre. b) qumica os cloroplastos utilizam toda a energia que chega superfcie da planta. c) qumica h produo apenas de ATP e fotlise de H2O. d) fotoqumica ocorre a combinao de CO2 com H2O e pentose para a formao de hexose. e) fotoqumica a radiao de cor verde mais absorvida nas lamelas e nos grana. 652. Cesgranrio-RJ Em seu conjunto, as transformaes qumicas derivadas da fotossntese podem ser essencialmente resumidas dizendo-se que a energia solar permite s plantas verdes a sntese de carboidratos, com desprendimento de oxignio, a partir de gua e CO2. Tendo em vista as etapas do processo, considere as armativas abaixo. I. Na primeira etapa, a clorola ativada pela ao de ftons fornecendo energia para a decomposio da gua. II. Numa segunda etapa, que se realiza mesmo na ausncia de luz (reao da fase escura), o CO2 reduzido incorporando-se em molculas de glicose.
212

III. durante a reao da fase escura que ocorre o desprendimento de O2. Assinale: a) se apenas I e II forem corretas. b) se apenas I e III forem corretas. c) se apenas II e III forem corretas. d) se todas forem corretas. e) se todas forem incorretas. 653. UFV-MG Na fotossntese, a energia da luz absorvida pelos pigmentos excita os eltrons para nveis mais elevados de energia. Os eltrons energizados so transferidos dos centros de reaes dos fotossistemas para formar intermedirios ricos em energia. Uma simplicao da seqncia deste uxo de eltrons est representada abaixo. Assinale a alternativa com a seqncia correta: a) NADPH O2 CO2 b) H2O NADPH ciclo de Calvin c) NADPH fotossistema-II ciclo de Calvin d) Fotossistema-I fotossistema-II H2O e) NADP O2 cadeia de transporte de eltrons 654. PUC-SP Os trechos I e II referem-se ao processo de fotossntese. I. Em 1937, Robin Hill, da Universidade de Cambridge, trabalhou com cloroplastos isolados em lugar de plantas intactas. Forneceu s organelas mantidas in vitro gua, luz e um aceptor de hidrognio. II. Na dcada de 1940, Melvin Calvin, da Universidade da Califrnia, forneceu a uma alga gs carbnico marcado com o istopo 14. Esse carbono radioativo foi encontrado em molculas orgnicas 30 segundos aps iniciada a fotossntese. Ao ler atentamente os trechos indicados por I e II, um estudante fez cinco armaes. Assinale a nica incorreta. a) Em I temos resumida uma etapa denominada fotlise da gua. b) Em I descreve-se uma etapa onde h desprendimento de oxignio. c) Em II descreve-se uma etapa onde h produo de glicose. d) Em I e II temos resumidas etapas da fotossntese que obrigatoriamente se realizam em presena de luz. e) Em I e II temos resumidamente etapas que correm no interior de cloroplastos. 655. UFF-RJ Certa experincia realizada em duas etapas consecutivas com uma amostra de algas verdes em um meio de cultivo aquoso est relatada a seguir. 1 etapa: A amostra de algas verdes foi, inicialmente, colocada em presena de luz e ausncia de CO2. 2 etapa: Em determinado instante, apagou-se a luz e, simultaneamente, adicionou-se CO2 marcado radioativamente (14CO2), que foi mantido em concentrao constante at o nal da experincia.

O grco a seguir mostra um dos aspectos observados durante essa experincia.

Com relao velocidade de incorporao de 14C glicose dessas algas, explique seu aumento no incio da 2 etapa, bem como seu posterior decrscimo. 656. Relacione as duas colunas abaixo, associando algumas reaes do metabolismo energtico (coluna I) com o local de sua ocorrncia (coluna II): Coluna I Coluna II 1. Etapa fotoqumica ( ) nos grana da fotossntese. ( ) no hialoplasma 2. Etapa qumica ( ) na matriz mitocondrial da fotossntese ( ) no estroma do cloroplasto 3. Ciclo de Krebs ( ) nas cristas mitocondriais A sequncia correta de nmeros de cima para baixo na coluna II : a) 1, _, 3, 2_. d) 2, _, _, 1, 3. b) 1, _, _, 2, 3. e) 2, _, 3, 1, _. c) 1, 3, _, 2, _. 657. UECE comum aos processos de fotossntese e respirao: a) a utilizao de citocromos como transportadores de eltrons b) o oxignio como aceptor nal de eltrons c) o NADPH2 reduzir o oxignio d) a glicose ser o agente redutor do CO2 658. UFPE Observe a gura a seguir onde se mostra, de forma esquemtica e simplicada, o processo da fotossntese. Com base nesse esquema, analise as proposies apresentadas assinalando as corretas.

0. Na 1 etapa, chamada fotoqumica, ocorre a fotlise da gua, sendo o hidrognio das molculas de gua capturados pelo NADP, que ca ento reduzido. 1. Na 1 etapa, denominada fase qumica, ocorre a formao de ATP, a partir de ADP e fosfato inorgnico, independentemente da presena de luz, num processo denominado fosforilao oxidativa. 2. A 2 etapa, fase qumica, ocorre nas regies cloroladas chamadas grana. Nesta etapa a glicose oxidada pela ferridoxina, que transfere os eltrons aos citocromos. 3. Na 2 etapa, no h necessidade de luz e so utilizados os ATP e NADPH2 formados na etapa fotoqumica (1), sendo os hidrognios necessrios reduo do CO2 glicose, cedidos pelo NADPH2 e a energia transferida pelo ATP. 4. Clulas vegetais verdes, mesmo no escuro, podero continuar fazendo glicose, caso lhes sejam fornecidos ATP, NADPH2 e CO2. 659. UFCE-CE Relativo ao processo fotossinttico, indique as opes corretas: 01. A fotossntese tem como objetivo a sntese de compostos ricos em energia. 02. As reaes de claro da fotossntese ocorrem nas zonas cloroladas do cloroplasto. 04. A fase de escuro do processo fotossinttico est na dependncia dos produtos da fase clara. 08. Um dos compostos fundamentais para que ocorra a fotossntese a substncia H2O e dela que sai o oxignio liberado para a atmosfera. 16. A temperatura e a intensidade luminosa no afetam a taxa fotossinttica. D como resposta a soma dos nmeros das opes corretas. 660. UFSC A fotossntese o processo nutritivo mais importante para os seres vivos e consiste na converso de energia luminosa em energia qumica. A respeito das fases, local de ocorrncia e fatores que interferem no processo, correto armar que: 01. na fase luminosa, ocorre liberao de O2. 02. na fase escura, ocorre a formao de carboidratos. 04. as clorolas A e B absorvem principalmente as radiaes na faixa do verde e conseqentemente, para esse comprimento de onda, a taxa de fotossntese mais elevada. 08. entre os fatores externos que inuem na fotossntese podemos citar o CO2, a temperatura e a luz. 16. nos grana dos cloroplastos, pela presena de clorola, ocorrem as reaes da fase clara. 32. as reaes da fase escura ocorrem no estroma do cloroplasto, desprovido de clorola. 64. a fotossntese mais intensa medida que a temperatura se eleva, chegando a um timo rendimento quando so ultrapassados os 50 C, que ativam o processo enzimtico. D como resposta a soma dos nmeros das opes corretas.
213

PV2D-06-BIO-14

661. Fuvest-SP Mediu-se a taxa de fotossntese em plantas submetidas a diferentes condies de temperatura e de luz. Foram utilizadas duas intensidades luminosas: uma baixa, prxima ao ponto de compensao ftico (representada nos grcos por linha interrompida) e outra alta, bem acima do ponto de compensao ftico (representada nos grcos por linha contnua). Qual dos grcos representa melhor os resultados obtidos?

a) uma estrutura anablica em virtude da produo de O2. b) a construo de molculas de orgnicas ocorre nas lamelas. c) a formao de molculas de ATP independe da ao da luz. d) as molculas de CO2 funcionam como aceptores nais de hidrognio. e) as reaes de escuro ocorrem nos tilacides, regies ricas em clorola. 663. As reaes que ocorrem na etapa qumica da fotossntese, as quais compem o ciclo das pentoses, so dependentes de NADP e ATP, gerados na etapa fotoqumica. Com relao a esse assunto, podemos armar que: ( ) O ciclo de Calvin, que ocorre no estroma dos cloroplastos, iniciado com a incorporao de seis molculas de gs carbnico, as quais reagem com seis molculas de H2O. ( ) NADP participa da etapa qumica da fotossntese como redutor, isto , como fornecedor de tomos de hidrognio. ( ) As seis molculas de gs carbnico funcionam como aceptores finais de hidrognios, sendo convertidas em uma molcula de glicose, processo esse que recebe energia qumica. ( ) A fase de escuro assim denominada por no depender direta ou indiretamente da luz. Todas as reaes ocorrem durante a noite, sendo fundamental apenas a presena de gs carbnico. ( ) O processo fotossinttico depende de fatores externos para sua ocorrncia, tais como temperatura, concentrao de gs carbnico, quantidade de gua, alm de fatores internos, como pigmentos fotossintetizantes e enzimas.

662. Cesgranrio-RJ Sobre a organela representada a seguir podemos armar que:

Captulo 7
664. FEI-SP Uma clula procarionte se diferencia de uma clula eucarionte pela ausncia de: a) DNA. b) carioteca. c) citoplasma. d) membrana plasmtica. e) ribossomos. 665. UFV-MG Todos os nomes relacionados abaixo correspondem a estruturas ou a constituintes nucleares, exceto:
214

a) b) c) d) e)

envoltrio nuclear. cromatina. centrolo. nuclolo. cromossomos.

666. FCC-BA Nas clulas em interfase, o material gentico aparece na forma de: a) carioteca. d) cromatina. b) fuso acromtico. e) cariolinfa. c) nuclolo.

667. UFRGS-RS O desenho abaixo representa um cromossomo da espcie humana. Como se chama a regio indicada pela seta? De que substncia ela formada?

a) b) c) d) e)

Cromtide DNA. Centrmero RNA. Cromtide RNA. Cromossomos RNA. Centrmero DNA.

673. UFSM-RS (modificado) Associe as colunas. Coluna 1 1. cromatina 2. nuclolo 3. cromossomo simples Coluna 2 ( ) Sntese de RNAr. ( ) Estrutura formada por uma nica molcula de DNA, muito longa, associada a protenas, visvel durante a diviso celular. ( ) Conjunto de material gentico que se apresenta descondensado durante a intrfase. A seqncia correta : a) 1 2 3 d) 3 2 4 b) 2 3 1 e) 3 4 1 c) 2 4 1 674. Unaerp-SP Considere as estruturas celulares a seguir, relacione-as com as funes propostas e depois escolha a opo correta. 1. Cromossomos 2. Nuclolos 3. Complexo de Golgi 4. Cloroplastos 5. Vacolos A. B. C. D. E. Produo de oxignio Regulao osmtica Informao gentica Reservatrio de RNAr Formao de lisossomos

668. Unicamp-SP Comente a frase: Cromossomos e cromatina so dois estados morfolgicos dos mesmos componentes celulares de eucariotos. 669. FGV-SP Os cromossomos humanos podem ser estudados em clulas do sangue. Essa anlise pode ser feita tanto em glbulos brancos como em hemcias? Por qu? 670. Fuvest-SP Em um organismo, clulas musculares e clulas nervosas diferem principalmente por: a) possurem genes diferentes. b) possurem ribossomos diferentes. c) possurem cromossomos diferentes. d) expressarem genes diferentes. e) utilizarem cdigo gentico diferente. 671. O nuclolo relaciona-se diretamente com a formao de: a) ribossomos. d) mitocndrias. b) lisossomos. e) cloroplastos. c) cromossomos. 672. UFMS Considere as armaes a seguir sobre o nuclolo. I. Encontra-se nas clulas de todos os seres vivos. II. Pode haver mais de um em uma clula. III. Apresenta-se delimitado por uma membrana. IV. Desaparece durante a diviso celular. So verdadeiras apenas: a) I e II. d) I, II e III. b) I e III. e) II, III e IV. c) II e IV.

A relao correta : a) 1C 2E 3D 4A 5B b) 1B 2C 3E 4D 5A c) 1A 2B 3C 4D 5E d) 1C 2D 3E 4A 5B e) 1D 2C 3E 4B 5A 675. PUC-SP A retirada do ncleo de uma clula resulta, depois de algum tempo, na parada de uma funo que especicamente por ele regulada. Essa funo: a) a respirao. b) a digesto. c) a sntese protica. d) so os movimentos citoplasmticos. e) so as trocas de substncias com o meio exterior. 676. UEL-PR A Acetabularia uma alga unicelular que pode atingir 5 cm de altura. O esquema a seguir identica as trs partes (I, II e III) em que algumas dessas algas foram cortadas em um experimento feito para vericar sua capacidade de regenerao.

PV2D-06-BIO-14

215

Com base no que se conhece sobre metabolismo celular, lgico supor que, aps os cortes: a) nenhuma parte sobreviva. b) as trs partes cresam e regenerem novos organismos. c) somente I sobreviva por algum tempo. d) somente II cresa, divida-se e origine novas algas. e) somente III sobreviva normalmente e regenere as partes perdidas. 677. PUC-PR A ilustrao a seguir procura representar experimentos realizados em amebas e demonstram a importncia do ncleo no controle das atividades celulares.

A passagem destas macromolculas pelo envoltrio nuclear possvel porque: a) ocorre um mecanismo especco de endocitose que permite a passagem de certas macromolculas. b) o envoltrio nuclear possui poros que permitem a passagem de macromolculas. c) ocorre um mecanismo especco de pinocitose que permite o englobamento de algumas macromolculas. d) existe, neste envoltrio, um mecanismo de transporte simultneo e oposto de cido ribonuclico e protenas. e) existem transportadores nas membranas externa e interna do envoltrio nuclear que realizam o transporte das macromolculas, passando pelo lmen do envoltrio. 679. Mackenzie-SP Algumas clulas apresentam material nuclear bastante desespiralizado, e metabolismo muito alto. Essas caracteristicas podem indicar: a) pouca atividade do DNA e, como consequncia, pouco desenvolvimento das organelas celulares. b) intensa traduo, exigindo a presena de grande desenvolvimento de retculo endoplasmtico liso. c) intensa transcrio e traduo, exigindo a presena de retculo endoplasmtico rugoso muito desenvolvido. d) intensa duplicao do material gentico, demonstrando alta taxa de diviso celular e organelas pouco desenvolvidas. e) intensa transcrio, exigindo grande desenvolvimento do complexo de Golgi, responsvel pela traduo. 680. UEL-PR Considere as seguintes armaes relativas ao nuclolo. I. uma regio de intensa sntese de RNA ribossmico. II. No nuclolo, as molculas de RNA ribossmico associam-se a protenas formando as subunidades que comporo os ribossomos. III. A organizao do nuclolo independe dos cromossomos que compem o ncleo. Dessas armaes, apenas: a) I verdadeira. b) II verdadeira. c) III verdadeira. d) I e II so verdadeiras. e) II e III so verdadeiras. 681. PUC-SP Na aula de Biologia, o professor fez a seguinte armao: A produo de ribossomos depende, indiretamente, da atividade dos cromossomos. Em seguida pediu a seus alunos que analisassem a armao e a explicassem. Foram obtidas cinco explicaes diferentes, que se encontram a seguir citadas. Assinale a nica armao correta.

Analise as armativas. I. Uma ameba, com ncleo transplantado, incapaz de se dividir. II. O transplante do ncleo para o fragmento de uma ameba anucleada regenera as funes vitais da ameba. III. A poro nucleada da ameba cresce e vive normalmente. IV. A poro nucleada da ameba capaz de se dividir normalmente. V. A poro anucleada de uma ameba seccionada degenera. Esto corretas: a) I, II, III, IV e V. b) Apenas I, II, III e IV. c) Apenas I, II, III e V. d) Apenas II, III, IV e V. e) Apenas II, III e IV. 678. UFF-RJ Diversas protenas, como as histonas e vrias enzimas, embora sintetizadas no citoplasma, so encontradas no ncleo.
216

a) Os cromossomos so constitudos essencialmente por RNA ribossmico e protenas, material utilizado na produo de ribossomos. b) Os cromossomos so constitudos essencialmente por RNA mensageiro e protenas, material utilizado na produo de ribossomos. c) Os cromossomos contm DNA; este controla a sntese de ribonucleoprotenas que formaro o nuclolo e que, posteriormente, faro parte dos ribossomos. d) Os cromossomos so constitudos essencialmente por RNA transportador e protenas, material utilizado na produo de ribossomos. e) Os cromossomos, produzidos a partir do nuclolo, fornecem material para a organizao dos ribossomos. 682. UEM-PR Assinale o que for correto. 01. A membrana plasmtica constituda por uma bicamada de lipdios associados s molculas de protenas distribudas irregularmente entre essas camadas. 02. Nas clulas acinosas do pncreas, o complexo de Golgi libera vesculas de secreo contendo as enzimas do suco pancretico. 04. O ncleo celular est presente nas clulas eucariontes e procariontes, diferindo apenas na forma em que se apresenta nessas clulas. 08. A cromatina pode ser visualizada ao microscpio ptico, em forma de lamentos individualizados, denominados cromossomos, durante a diviso celular. 16. Os ribossomos so estruturas cilndricas, compostos basicamente de DNA e protenas, nos quais ocorre a sntese protica. D a soma dos itens corretos. 683. Fuvest-SP Quando armamos que o metabolismo da clula controlado pelo ncleo celular, isso signica que a) todas as reaes metablicas so catalisadas por molculas e componentes nucleares. b) o ncleo produz molculas que, no citoplasma, promovem a sntese de enzimas catalisadoras das reaes metablicas. c) o ncleo produz e envia, para todas as partes da clula, molculas que catalisam as reaes metablicas. d) dentro do ncleo, molculas sintetizam enzimas catalisadoras das reaes metablicas. e) o contedo do ncleo passa para o citoplasma e atua diretamente nas funes celulares, catalisando as reaes metablicas. 684. UFRJ Num laboratrio, o ncleo de uma clula de espcie A foi retirado e implantado numa clula-ovo da espcie B, cujo ncleo havia sido previamente removido. Caso essa clula-ovo se desenvolvesse at a formao de um novo indivduo, ele teria as caractersticas da espcie A ou as da espcie B? Justique sua resposta.

685. UFSC O ncleo uma estrutura que coordena e comanda todas as funes celulares. Assinale a(s) proposio(es) que apresenta(m) relaes corretas entre as estruturas nucleares, sua ocorrncia e caractersticas qumicas ou funcionais. 01. Ao observarmos o ncleo interfsico em microscpio ptico, vericamos a total compactao da cromatina, que passa a chamar-se cromossomo. 02. A carioteca corresponde ao uido onde esto mergulhados os cromossomos e as estruturas que formam o nuclolo. 04. A membrana nuclear apresenta poros ou annuli, atravs dos quais ocorrem importantes trocas de macromolculas entre ncleo e citoplasma. 08. O nuclolo, mergulhado no nucleoplasma, est sempre presente nas clulas eucariticas, podendo haver mais de um por ncleo. 16. O nuclolo uma regio de intensa sntese de RNA ribossmico (RNAr). 32. A cromatina formada por uma nica e longa molcula de RNA, associada a vrias molculas de glicoprotenas. 686. Unicap-PE Julgue (V ou F) o que segue: ( ) Podemos armar que o nuclolo uma mistura intracelular, visvel apenas na microscopia eletrnica, presente em clulas em diviso. ( ) O centrmero uma estrutura cromossmica que se aloja na constrio secundria. ( ) A regio do cromossomo responsvel pela sua movimentao durante a diviso celular o satlite. ( ) Os organides responsveis pelas funes de digesto celular, secreo e respirao so, respectivamente: lisossomo, complexo de Golgi e cloroplasto. ( ) O pncreas uma glndula que apresenta cinos cujas clulas secretam enzimas digestivas. O organide citoplasmtico diretamente relacionado a essa funo o peroxissomo. 687. UFMS (modificado) Inmeras experincias j provaram que o ncleo nas clulas desempenha o papel de portador dos fatores hereditrios e controlador das atividades metablicas. Assinale a(s) alternativa(s) correta(s) referente(s) ao tema e some-as. 01. Durante o processo de espiralizao dos cromonemas, as regies denominadas de heterocromticas so as que mais sofrem alteraes, ou seja, correspondem s regies do DNA em que os genes esto vivos. 02. A condensao dos lamentos de cromatina em cromossomos facilita o movimento e a distribuio eqitativa do material gentico para as clulaslhas durante a diviso celular. 04. O gene uma poro de DNA que contm em sua seqncia de bases a informao especca para a sntese de uma cadeia polipeptdica.
217

PV2D-06-BIO-14

08. Os genes podem ser facilmente visualizados ao microscpio ptico nas clulas em diviso. 16. As regies da eucromatina correspondem a genes inativos ou desligados. 688. Unicamp-SP O processo de regenerao pode ocorrer tanto em organismos unicelulares como pluricelulares, conforme j demonstrado em vrios experimentos. O resultado de um desses experimentos pode ser observado na gura A, que mostra a regenerao de apenas um fragmento da alga unicelular Acetabularia. A gura B mostra a regenerao de todos os fragmentos de uma planria (platelminto).

b) Uma nica molcula de DNA com informao gentica para algumas protenas. c) Um segmento de molcula de DNA com informao para uma cadeia polipeptdica. d) Uma nica molcula de RNA com informao para uma cadeia polipeptdica. e) Uma seqncia de trs bases nitrogenadas do RNA mensageiro correspondente a um aminocido na cadeia polipeptdica. 691. UEL-PR A gura abaixo representa cromossomos em uma clula somtica que est sofrendo diviso celular. Com base nessa informao, assinale a alternativa que contm o nmero correto de molculas de DNA, cromtides e cromossomos presentes nesta clula.

a) b) c) d) e)

DNA 4 4 8 4 8

Cromtides 8 4 8 4 8

Cromossomos 4 8 8 4 4

a) Por que no experimento com Acetabularia no houve regenerao de todos os segmentos? b) Explique por que o processo de regenerao das planrias difere daquele que ocorre na Acetabularia. 689. Udesc Durante o processo de diviso celular, o material gentico sofre ____________, dando origem aos ____________. Essas estruturas apresentam uma constrio primria denominada ___________, em que se ligam as bras do fuso. Assinale a alternativa que preenche CORRETAMENTE as lacunas do texto acima. a) espiralizao; cromossomos; centrmero; b) diluio; centrmero; cinetcoro; c) empacotamento; nuclolos; cromtide-irm; d) desespiralizao; cromossomos; cinetcoro; e) compactao; centrmeros; cromossomos. 690. Fuvest-SP Qual das alternativas se refere a um cromossomo? a) Um conjunto de molculas de DNA com todas as informaes genticas da espcie.
218

692. Unirio-RJ A reproduo da maioria dos seres vivos envolve um processo sexual em que se alternam os fenmenos de meiose e fecundao. No homem, a meiose gamtica, a fecundao reconstitui a diploidia. Qual dos pares de gametas representados abaixo poder originar um zigoto que desenvolver um embrio normal do sexo masculino?

693. UFSM-RS Associe as colunas. Coluna 1

1 genoma 2 gene 3 cromossomo 4 caritipo Coluna 2 ( ) Segmento de DNA que contm instruo para a formao de uma protena. ( ) Estrutura formada por uma nica molcula de DNA, muito longa, associada a protenas, visvel durante a diviso celular. ( ) Conjunto de genes de uma espcie. A seqncia correta : a) 1 2 3 b) 2 3 1 c) 2 4 1 d) 3 2 4 e) 3 4 1 694. Metacntricos, submetacntricos e acrocntricos so tipos de: a) mutaes cromossmicas e estruturais. b) mutaes cromossmicas numricas. c) cromossomos quanto posio dos satlites. d) cromossomos quanto posio do centrmero. e) nuclolos. 695. Quanto posio do centrmero, os cromossomos, representados abaixo, so respectivamente:

697. PUC-SP Aps observar atentamente os esquemas abaixo, poderamos dizer que a clula I haplide em relao II porque tem:

a) b) c) d) e)

nmero mpar de cromossomos. pelo menos um par de cromossomos. cromossomos homlogos. um representante de cada par de homlogos. pareamento de cromossomos homlogos.

698. UFC-CE As clulas somticas e os gametas apresentam, respectivamente, os cromossomos homlogos na forma: a) haplide e triplide. d) diplide e diplide. b) triplide e haplide. e) triplide e diplide. c) diplide e haplide. 699. Fuvest-SP Quantos cromossomos existem em cada um dos seguintes tipos de clulas humanas normais: muscular, nervosa, espermatozide e zigoto? Justique a resposta. 700. Fuvest-SP Em determinada espcie animal, o nmero diplide de cromossomos 22. Nos espermatozides, nos vulos e nas clulas epidrmicas dessa espcie sero encontrados, respectivamente: a) 22, 22 e 44 cromossomos. b) 22, 22 e 22 cromossomos. c) 11, 11 e 22 cromossomos. d) 44, 44 e 22 cromossomos. e) 11, 22 e 22 cromossomos. 701. Vunesp Galinhas poedeiras de granja so mantidas em connamento e sob condies ambientais que estimulam a postura de ovos para a comercializao. Nas granjas, os machos so descartados, pois no tm valor comercial. Porm, no stio, galos e galinhas caipiras so mantidos soltos no terreno, e os ovos, quando chocados, eclodem em novos pintinhos. Sabendo-se que nas clulas somticas de uma galinha (Gallus gallus) h 76 cromossomos e que na superfcie da gema do ovo h uma regio chamada blastodisco, a partir da qual se desenvolve o embrio, os nmeros de cromossomos no blastodisco de ovos de galinhas de granja e de ovos fertilizados de galinhas caipiras so, respectivamente: a) 38 e 76. d) 76 e 152. b) 38 e 152. e) 152 e 76. c) 76 e 76.
219

a) b) c) d) e)

I metacntrico; II acrocntrico; I metacntrico; II submetacntrico; I submetacntrico; II acrocntrico; I telocntrico; II metacntrico; I acrocntrico; II telocntrico.

696. PUC-SP A gura abaixo representa um cromossomo:

a) acrocntrico, com duas cromtides irms. b) submetacntrico, com quatro cromtides irms. c) submetacntrico, com duas cromtides homlogas. d) metacntrico, com duas cromtides irms. e) metacntrico, com quatro cromtides irms.

PV2D-06-BIO-14

702. Considerando uma espcie de mamfero com 2n = 78 cromossomos, correto armar: a) Um gameta apresentar 34 cromossomos. b) Um vulo dessa espcie ter o mesmo nmero de cromossomos de uma clula muscular. c) Todos os indivduos da espcie apresentaro os mesmos tipos e nmeros de cromossomos sexuais. d) Machos sero XY e fmeas XX. e) Machos e fmeas no tero o mesmo nmero de pares de cromossomos homlogos. 703. PUC-RS Para fazer o estudo de um caritipo, qual a fase da mitose que seria mais adequada usar, tendo em vista a necessidade de se obter a maior nitidez dos cromossomos, em funo do seu maior grau de espiralizao? a) b) c) d) e) Prfase Pr-Metfase Anfase Telfase Metfase

a) b) c) d) e)

o nmero 1 indica a constrico secundria. ele do tipo metacntrico. o nucleotdeo est indicado pelo nmero 2. o nmero 3 indica o telmero. o centrmero est indicado pelo nmero 4.

706. Udesc Observe a gura a seguir, que representa um cromossomo, e depois responda s questes propostas.

704. Unirio-RJ

Baseado na gura, responda ao que se pede. a) Qual a classicao, quanto posio do centrmero, desse cromossomo? Justique sua resposta. b) Qual o nome das partes do cromossomo representadas pelas letras A e B? 707. PUCCamp-SP Os cromossomos das clulas somticas de um dado animal foram esquematizados como mostra a gura abaixo.

A gura anterior representa os diferentes tipos de cromossomos humanos. Os autossomos esto numerados de 1 a 22, e os cromossomos sexuais, designados por X e Y. Sendo assim, uma clula somtica do corpo de uma mulher apresenta: a) 22 autossomos + Y b) 22 autossomos + XX c) 22 autossomos + XY d) 44 autossomos + X e) 44 autossomos + XX 705. UFU-MG Com respeito ao cromossomo esquematizado, sabemos que:

A partir desse esquema, foram feitas as seguintes dedues sobre esse animal: I. Suas clulas diplides possuem 2n = 16 cromossomos. II. Suas clulas haplides apresentam n = 8 cromossomos. III. Seu caritipo formado por 4 cromossomos metacntricos, 2 cromossomos submetacntricos e 2 cromossomos acrocntricos.

220

Dessas armaes: a) apenas I verdadeira. b) apenas II verdadeira. c) apenas III verdadeira. d) apenas I e II so verdadeiras. e) I, II e III so verdadeiras. 708. UFC-CE Sabendo-se que uma determinada espcie de vertebrado possui nmero cromossmico 2n = 50, assinale a alternativa que associa corretamente o tipo de clula sua quantidade de cromossomos. a) Hepatcito 25 d) Fibra muscular 25 b) Macrfago 25 e) vulo 50 c) Neurnio 50 709. PUC-SP Considere a quantidade normal de DNA do ncleo de uma clula da mucosa duodenal humana igual a 2C. A partir dessa informao, pode-se prever que: a) essa mesma quantidade seja encontrada no ncleo de um linfcito normal. b) essa mesma quantidade seja encontrada no ncleo de um espermatozide normal. c) uma quantidade igual a C seja encontrada no ncleo de um neurnio normal. d) uma quantidade igual a C/2 seja encontrada no ncleo de um vulo normal. e) uma quantidade igual a 4C seja encontrada no ncleo de um blastmero que apresente 46 os de cromatina. 710. UFSCar-SP Um pesquisador vericou que o ncleo celular dos vulos de uma certa espcie de formiga tem 4 cromossomos e uma quantidade X de DNA. Considerando-se que os machos de formiga desenvolvem-se por partenognese e so haplides, que quantidade de DNA e de cromossomos se espera encontrar no ncleo dos espermatozides dessa espcie? a) 2X de DNA e 8 cromossomos. b) 2X de DNA e 4 cromossomos. c) X de DNA e 4 cromossomos. d) X de DNA e 2 cromossomos. e) 1/2 X de DNA e 2 cromossomos. 711. Unicamp-SP (modificado) As abelhas vivem em colnias constitudas por indivduos de trs castas: a rainha, os zanges e as operrias. Sabendo-se que as fmeas frteis de Apis mellifera tm 32 cromossomos, indique o nmero cromossmico dos indivduos de cada uma das castas. 712. PUCCamp-SP Observe os cromossomos a seguir esquematizados. As guras que representam, respectivamente, um conjunto diplide e o conjunto haplide correspondente so:

a) I e III. b) I e IV. c) II e III.

d) II e IV. e) V e I.

713. UFRJ A tabela apresenta o contedo total mdio de DNA, em 1012 g ncleo, encontrado nos ncleos de vrios tipos de clulas de diversos animais. animais Boi Galinha Sapo Carpa espermatozide 3,42 1,26 3,70 1,64 clulas a 6,80 2,58 7,33 3,49 b 7,05 2,65 7,45 3,33 c 6,63 2,28 7,50 3,30

Explique por que existe mais DNA por ncleo nas clulas a, b e c do que nos espermatozides. 714. Observe a gura abaixo e avalie as proposies.

0. Representao de uma clula haplide durante a metfase. 1. Estruturas constitudas de DNA, protenas, e ons. 2. Os cromossomos do grupo C possuem constrices primrias e secundrias, constitudas de heterocromatina. 3. O cromossomo y e os cromossomos dos grupos A e B so, respectivamente, telocntrico, metacntrico e submetacntrico. 4. Representao do genoma de um clula sexual. 715. UFSC (modificado) O caritipo consiste na montagem fotogrca, em seqncia, de cada um dos tipos cromossmicos. Ele nos permite saber qual o nmero e qual a forma dos cromossomos de uma espcie, bem como estabelece o seu padro cromossmico normal. A partir da anlise da gura a seguir, e em relao a esse estudo, correto armar que:
221

PV2D-06-BIO-14

Quanto tempo necessrio para que essas clulas dupliquem o seu DNA? a) b) c) d) e) 2 horas e 30 minutos 3 horas 4 horas 6 horas e 30 minutos 9 horas

01. O caritipo o quadro cromossmico das clulas haplides de cada espcie. 02. Na espcie humana, os cromossomos so classicados em 7 grupos, compreendendo 22 pares de cromossomos autossmicos, e mais um par de cromossomos sexuais que, no homem, XY e, na mulher, XX. 04. Para a obteno do caritipo, so utilizadas clulas de leuccitos em anfase meitica. 08. A partir da anlise de caritipos, informaes valiosas podem ser obtidas, tais como a existncia de cromossomos extras ou de quebras cromossmicas, auxiliando no diagnstico de certas anomalias genticas. 716. Unicamp-SP A interfase um perodo em que as clulas esto em repouso. Voc concorda? Justique sua resposta. 717. FEI-SP Se a quantidade de DNA de uma clula somtica em diviso 2X, as clulas do mesmo tecido, nas fases G1 e G2, apresentam, respectivamente, as seguintes quantidades de DNA: a) X e X d) X e X/2 b) X/2 e X e) X e 2X c) X/2 e 2X 718. Mackenzie-SP Logo aps a fecundao, o zigoto dos animais sofre mitoses sucessivas. Nessa fase, logo aps uma diviso, as clulas entram imediatamente na fase S do ciclo celular e se dividem, novamente, assim que a fase S termina. Esse fato nos permite concluir que, nessas clulas, est ausente: a) o perodo G1. b) a duplicao do DNA. c) a sntese de ATP. d) a citocinese. e) a duplicao do centrolo. 719. Unirio-RJ A gura representa o ciclo celular e um diagrama da durao das diferentes etapas desse ciclo em determinadas clulas.

720. Fuvest-SP Um cromossomo formado por uma longa molcula de DNA associada a protenas. Isso permite armar que o ncleo de uma clula somtica humana em __________ A __________ possui ________ B _________ molculas de DNA. Qual das alternativas indica os termos que substituem corretamente as letras A e B? a) b) c) d) e) A = incio de intrfase (G1); B = 46. A = m de intrfase (G2); B = 23. A = incio da mitose (prfase); B = 46. A = m de mitose (telfase); B = 23. A = qualquer fase do ciclo celular; B = 92.

721. Cesgranrio-RJ O ciclo celular corresponde ao processo bsico de formao de novas clulas. Assim, ele inclui a mitose e a intrfase. Assinale a opo que indica corretamente a seqncia natural dos perodos do ciclo celular. 1. Perodo G1 (intensa sntese de RNA e aumento do citoplasma) 2. Diviso celular 3. Perodo S (duplicao do contedo de DNA) 4. Perodo G 2 (discreta sntese de protenas e RNA) a) 4, 3, 1, 2 b) 2, 3, 1, 4 c) 4, 2, 1, 3 d) 1, 3, 4, 2 e) 1, 2, 3, 4 722. Mackenzie-SP Uma clula somtica com 2n cromossomos divide-se por mitose, originando: a) sempre quatro clulas com 2n cromossomos. b) sempre duas clulas com n cromossomos. c) uma clula com 2n cromossomos e outra com n cromossomos. d) quatro clulas com n cromossomos. e) duas clulas com 2n cromossomos.

222

723. PUC-RS (modificado) Uma clula somtica com 8 cromossomos durante a fase G1 da intrfase, ao entrar na diviso mittica, apresentar ____________ cromossomos, cada um com ______________. a) 4 1 cromtide b) 4 2 cromtides c) 8 1 cromtide d) 8 2 cromtides e) 16 2 cromtides 724. UCS-RS O processo de diviso celular de uma clula somtica humana dar origem a: a) duas clulas de 48 cromossomos. b) quatro clulas de 23 cromossomos. c) duas clulas de 23 cromossomos. d) quatro clulas de 46 cromossomos. e) duas clulas de 46 cromossomos. 725. FEI-SP No processo de mitose: a) a partir de uma clula diplide originam-se duas novas clulas diplides. b) a partir de uma clula diplide originam-se quatro novas clulas diplides. c) a partir de uma clula haplide originam-se duas novas clulas diplides. d) a partir de uma clula haplide originam-se quatro novas clulas diplides. e) a partir de uma clula diplide originam-se quatro novas clulas haplides. 726. PUCCamp-SP Uma pessoa com cncer foi submetida a um tratamento quimioterpico, aps o qual no houve formao de novas clulas tumorais. Considerando-se somente essa informao, possvel inferir que, nas clulas tumorais, os agentes quimioterpicos atuam sobre: a) a membrana plasmtica tornando-as impermeveis a qualquer substncia. b) as mitocndrias impedindo que realizem respirao aerbica. c) os peroxissomos bloqueando a produo de catalase. d) algum ponto do ciclo celular fazendo cessar as mitoses. e) o ciclo celular acelerando as mitoses. 727. Mackenzie-SP Assinale a alternativa incorreta a respeito do ciclo celular. a) Uma vez que o processo de diviso iniciado, no poder mais ser interrompido. b) A duplicao do DNA e a interrupo de parte das funes celulares ocorrem durante o perodo S da intrfase. c) A durao da diviso celular pode variar para cada tipo de clula.

d) A intrfase pode ser denida como o perodo em que a clula exerce suas funes normais e se prepara para a diviso. e) O perodo G1 pode ter durao varivel, dependendo do tipo de clula considerado. 728. Vunesp O ciclo celular corresponde alternncia de mitoses e intrfases. Antigamente, a intrfase era chamada repouso celular. Esta designao errnea porque na intrfase que: a) ocorre o desaparecimento do nuclolo e da membrana nuclear. b) ocorre a condensao dos cromossomos c) ocorrem as maiores mudanas metablicas na clula, envolvendo sntese de DNA, RNA e protenas. d) ocorrem muitos movimentos celulares, especialmente dos centrolos e cromossomos. e) ocorrem mudanas na forma das clulas. 729. UFRGS-RS Observe o diagrama, apresentado, que representa o ciclo de vida de uma clula somtica humana.

Em relao a esse ciclo, correto armar que existem: a) 23 molculas de DNA em G1. b) 23 molculas de DNA em S. c) 92 molculas de DNA em G2. d) 46 molculas de DNA na prfase de mitose. e) 23 molculas de DNA na telfase de mitose. 730. Udesc Analise o esquema a seguir e depois responda s questes propostas.

PV2D-06-BIO-14

223

a) Como se denomina o estgio do ciclo celular representado pela letra A? b) Como se denomina o processo de diviso representado pela letra B? c) Quantos cromossomos existem na fase representada pela letra C? Justique sua resposta. 731. FMI-MG Estudando mitose em clulas de raiz de Bellevalia, Taylor calculou que a intrfase dura mais ou menos 20 horas. O perodo inicial da intrfase, chamado G1 , dura de 6 a 8 horas e nele no h diviso de cromossomos ou duplicao de DNA. Segue um perodo chamado S, no qual ocorre duplicao do DNA. Ao perodo S segue o perodo G2 , que dura 6 horas, e ento uma nova diviso celular se inicia. Do texto podemos armar que: a) na raiz de Bellevalia, todas as clulas entram em diviso imediatamente aps o perodo G1. b) no perodo S, cada cromtide j formou um novo cromossomo. c) o tempo que uma clula da raiz de Bellevalia gasta para dar origem a 2 novas clulas de 20 horas. d) no nal de G2 , cada cromossomo tem duas cromtides. e) durante a metfase h duplicao de DNA. 732. UFF-RJ (modificado) Examine as seguintes armativas referentes ao ciclo celular. I. Quando uma clula sai da subfase S da intrfase, apresenta o dobro de DNA. II. Se a clula no estiver em processo de diviso, ocorre pouca atividade metablica no ncleo interfsico. III. Diviso celular um processo que sempre d origem a duas clulas geneticamente iguais. IV. Durante a intrfase o ncleo apresenta elevada atividade metablica. V. As clulas somticas sofrem mitose. As armativas verdadeiras so as indicadas por: a) I e II. b) I e III. c) I, IV e V. d) II e III. e) II, III e V. 733. FMTM-MG Observe o desenho:

A diviso celular representada poder ser observada durante a: a) produo de gametas a partir de uma clula 2n = 6 em uma espcie animal. b) regenerao do tecido epitelial de uma espcie animal 2n = 6. c) regenerao de tecido vegetal em uma espcie 2n = 12. d) produo de gametas de uma clula-me n = 3. e) regenerao de tecido animal onde 2n = 12. 734. Mackenzie-SP O esquema a seguir representa dois processos observados numa clula eucaritica.

Assinale a alternativa correta. a) O processo 1 somente observado no ncleo da clula, sendo inexistente em todas as outras organelas. b) Para interromper o processo 2, necessrio bloquear o funcionamento de todo o retculo endoplasmtico dessa clula. c) O processo 2 ocorre principalmente no perodo S da intrfase. d) Um dos mais importantes locais de ocorrncia do processo 1 o nuclolo. e) As molculas produzidas no processo 2 podero ser utilizadas como catalisadoras, mas nunca sero constituintes de outras organelas. 735. Fuvest-SP Uma clula somtica, em incio de intrfase, com quantidade de DNA nuclear igual a X, foi colocada em cultura para multiplicar-se. Considere que todas as clulas resultantes se duplicaram sincronicamente e que no houve morte celular. a) Indique a quantidade total de DNA nuclear ao nal da 1, da 2 e da 3 diviso mittica. b) Indique a quantidade de DNA por clula na fase inicial de cada mitose. 736. Fuvest-SP Em certa linhagem celular, o intervalo de tempo entre o m de uma mitose e o m da mitose seguinte de 24 horas. Uma clula dessa linhagem gasta cerca de 12 horas, desde o incio do processo de duplicao dos cromossomos at o incio da prfase. Do m da fase de duplicao dos cromossomos at o m da telfase, a clula gasta 3 horas e, do incio da prfase at o m da telfase, ela gasta 1 hora. Com base nessas informaes, determine a durao de cada uma das etapas do ciclo celular (G1, S, G2 e mitose) dessas clulas.

224

737. Unifor-CE Nos seres eurariontes, por ocasio da diviso celular, a carioteca desaparece na: a) intrfase. b) prfase. c) metfase. d) anfase. e) telfase. 738. FESP Em que fase da mitose se encontra uma clula somtica com as seguintes caractersticas: encurtamento dos cromossomos, sntese e organizao das protenas do fuso, desaparecimento do nuclolo e rompimento da carioteca? a) intrfase. b) prfase. c) metfase. d) anfase. e) telfase. 739. PUC-MG Na mitose, a prfase constitui a fase: a) terminal, em que a clula se divide. b) inicial, em que os cromossomos se duplicam e a clula armazena energia para o processo de duplicao. c) intermediria, em que os cromossomos atingem o grau de condensao mximo. d) inicial, em que a carioteca e o nuclolo desaparecem e se forma o fuso mittico. e) intermediria, em que os centrmeros se dividem e as cromtides irms migram para o plo da clula. 740. UEL-PR A condensao mxima dos cromossomos ocorre na: a) intrfase. b) prfase. c) metfase. d) anfase. e) telfase. 741. Fuvest-SP Uma clula somtica que tem quatro cromossomos, ao se dividir, apresenta na metfase: a) quatro cromossomos distintos, cada um com uma cromtide. b) quatro cromossomos distintos, cada um com duas cromtides. c) quatro cromossomos, pareados dois a dois, cada um com duas cromtides. d) dois cromossomos, cada um com duas cromtides. e) dois cromossomos, cada um com uma cromtide.
PV2D-06-BIO-14

Adaptado de Carl P. Swanson. The cell. Foundations of Modern

De acordo com esses dados, a etapa mais rpida aquela em que ocorre: a) fragmentao da carioteca. b) afastamento das cromtides-irms. c) reorganizao dos ncleos. d) duplicao das molculas de DNA. e) alinhamento dos cromossomos na placa equatorial. 743. UFRGS-RS No esquema exposto est apresentada uma clula em anfase da mitose. Observando-a, pode-se concluir que pertence a um organismo cujas clulas somticas e gametas possuem, respectivamente:

Biology. New Jersey: Prentice-Hall lnc. p.52

a) b) c) d) e)

12 e 6 cromossomos. 6 e 12 cromossomos. 6 e 3 cromossomos. 3 e 6 cromossomos. 24 e 12 cromossomos.

744. UFPI Filmagens de divises celulares feitas atravs do microscpio revelam que a mitose um processo contnuo de durao de aproximadamente uma hora. Assinale a alternativa que mostra a seqncia correta dos eventos nesse tipo de diviso celular: a) Telfase Anfase Metfase Prfase b) Prfase Anfase Telfase Metfase c) Anfase Prfase Metfase Telfase d) Anfase Metfase Telfase Prfase e) Prfase Metfase Anfase Telfase 745. Unirio-RJ 1. Telfase 2. Prfase 3. Metfase 4. Intrfase ( ) cromossomos na placa equatorial ( ) formao do fuso mittico
225

742. UEL-PR O esquema a seguir mostra a durao das fases da mitose em clulas de embrio de gafanhoto, mantidas a 38C.

( ) desaparecimento da membrana nuclear ( ) duplicao do DNA ( ) citocinese A associao correta, de cima para baixo, entre as fases da mitose e os fenmenos que nelas ocorrem : a) 3, 1, 2, 4, 4 d) 4, 4, 3, 2, 1 b) 1, 2, 4, 3, 3 e) 1, 3, 2, 1, 2 c) 3, 2, 2, 4, 1 746. Udesc Assinale a alternativa incorreta. a) Durante a mitose, ocorre duplicao de cromossomos e sua distribuio para as clulas-lhas. b) Os cromossomos so formados por lamentos de DNA e protenas. c) Os cromossomos derivam de pores da cromatina que se condensaram formando partculas de forma e nmero bem denidos para cada espcie. d) Mitose o processo pelo qual as clulas dos seres eucariontes distribuem, em partes iguais, o DNA que foi duplicado durante a intrfase para as duas pores do citoplasma que se dividiu. e) A mitose realizada por meio de duas divises sucessivas. 747. Unifor-CE Considere as fases do ciclo celular e os eventos a seguir: I. intrfase II. anfase mittica III. metfase mittica a) duplicao do DNA b) disposio dos cromossomos na regio mediana da clula c) separao das cromtides-irms que migram para plos opostos A alternativa que associa corretamente essas fases com esses eventos : a) I-a ; II-b ; III-c b) I-a ; II-c ; III-b c) I-b ; II-a ; III-c d) I-b ; II-c ; III-a e) I-c ; II-b ; III-a 748. Fuvest-SP Analise os eventos mitticos relacionados a seguir: I. II. Desaparecimento da membrana nuclear Diviso dos centrmeros

749. FAAP-SP A que fase da mitose corresponde, respectivamente, cada gura numerada de 1 a 4?

750. PUC-MG Observe o esquema apresentado e depois responda s questes.

a) Que fenmeno biolgico est ilustrado no esquema? b) Quantos cromossomos so encontrados em 1? c) Quantas cromtides so encontradas em 2 ? d) Em 5 existem duas clulas. So haplides ou diplides? Considere que na clula 1 existem dois pares homlogos. 751. UFR-RJ O tecido heptico do esquema apresentado possui uma clula binucleada. Isso decorre de um processo mittico incompleto.

Adaptado de Linhares, S.& Gewandsnadjer, F. Biologia hoje, So

Identique o evento da diviso celular que no ocorreu. Justique. 752. O esquema representa uma clula animal vista ao microscpio eletrnico, na qual algumas estruturas foram numeradas de 1 a 9.

Paulo, tica, 1998, p.36

III. Migrao dos cromossomos para os plos do fuso Posicionamento dos cromossomos na regio mediana do fuso Qual das alternativas indica corretamente sua ordem temporal? a) IV I II III d) I IV II III b) I IV III II e) IV I III II c) I II VI III
226

Com relao s estruturas indicadas no esquema, incorreto armar que: a) 1, 5 e 6 sofrem intensas modicaes na diviso celular. b) 2, 3 e 7 sintetizam e/ou armazenam substncias orgnicas. c) 4 e 9 realizam digesto celular com produo de energia e liberao de CO2. d) 5 e 9 so desprovidos de membrana lipoprotica. 753. Osec-SP Quando se inicia a mitose, os cromossomos comeam a se condensar: a) j estando duplicados desde a intrfase precedente, sendo que o mximo de condensao observado na metfase. b) duplicam-se durante a metfase, separando-se na anfase. c) a condensao mxima na telfase. d) a condensao termina na metfase, ocorrendo a duplicao dos mesmos na anfase. e) duplicam-se na intrfase, apresentando um mximo de condensao no perodo G. 754. Acafe-SC Em relao mitose, so feitas as seguintes armativas. I. A espiralizao gradual da cromatina que culmina com a formao dos cromossomos caracteriza a prfase. II. A disposio dos cromossomos numa placa na zona equatorial da clula caracteriza a metfase. III. Aps a diviso longitudinal dos cromossomos e a migrao dos cromossomos-lhos para os plos da clula, haver reconstruo dos envoltrios nucleares durante a anfase. Assinale a) se somente I e II estiverem corretas. b) se somente II e III estiverem corretas. c) se somente I e III estiverem corretas. d) se somente II estiver correta. e) se I, II e III estiverem corretas. 755. UFJF-MG A gura representa um corte longitudinal da regio de crescimento de uma raiz. As clulas dessa regio sofrem mitoses contnuas, que garantem o crescimento desse rgo.

Se fosse necessrio fazer uma fotograa dos cromossomos para estudo, a fase escolhida, sem dvida, seria a de nmero: a) 6 d) 3 b) 12 e) 9 c) 7 756. Fuvest-SP (modificado) A vimblastina um quimioterpico usado no tratamento de pacientes com cncer. Sabendo-se que essa substncia impede a formao do fuso mittico, pode-se concluir que sua interferncia no processo de multiplicao celular ocorre na: a) condensao dos cromossomos. b) descondensao dos cromossomos. c) duplicao dos cromossomos. d) migrao dos cromossomos. e) reorganizao dos nuclolos. 757. Fuvest-SP A gura mostra modicaes na forma do cromossomo durante o ciclo celular. Quais fases do ciclo tm cromossomos como os que esto representados em 1 e 3, respectivamente?

a) b) c) d) e)

Intrfase e metfase Intrfase e anfase Intrfase e telfase Prfase e anfase Prfase e telfase

758. UFRN A recuperao da pele queimada ocorre em funo da maior proliferao das clulas epiteliais. Uma caracterfstica da multiplicao dessas clulas : a) o nmero de cromossomos ser reduzido com o aumento do nmero de clulas. b) a diviso do citoplasma ocorrer por estrangulamento da membrana plasmtica. c) a formao do fuso mittico no inuenciar na migrao dos cromossomos. d) o contedo de DNA da clula ser aumentado durante a fase G1 da intrfase. 759. UEL-PR Considere as seguintes fases da mitose: I. telfase II. metfase III. anfase Considere tambm os seguintes eventos: a) As cromtides-irms movem-se para os plos opostos da clula. b) Os cromossomos alinham-se no plano equatorial da clula. c) A carioteca e o nuclolo reaparecem.
227

PV2D-06-BIO-14

Assinale a alternativa que relaciona corretamente cada fase ao evento que a caracteriza. a) I a ; II b ; III c b) I a ; II c ; III b c) I b ; II a ; III c d) I c ; II a ; III b e) I c ; II b ; III a 760. PUC-PR (modificado) As guras apresentam algumas fases de uma diviso celular, contudo no esto na ordem seqencial. Analisando as guras, conclui-se que:

762. Fuvest-SP A gura a seguir representa o tecido meristemtico de uma planta, onde podem ser observadas clulas em diferentes fases de diviso. Qual das alternativas corresponde seqncia do processo mittico?

a) a b c d e f b) c f e a b d c) f b a e d c d) e f c a b d a) se trata de uma mitose vegetal devido presena dos centrmeros e do tipo de citocinese. b) a seqncia correta II, IV, I e III. c) se trata de uma meiose que precede a formao do gameta nos vegetais. d) na ilustrao I, temos a citocinese. e) so fases da ovulognese animal em que II indica a prfase I da meiose. 761. PUCCamp-SP O esquema a seguir representa os cromossomos de uma clula somtica de um organismo com alguns genes simbolizados por letras. e) f e c b d a 763. Fuvest-SP (modificado) A seqncia de eventos cromossmicos que ocorrem na duplicao de uma clula somtica animal est representada nos desenhos abaixo.

a) Em qual das fases representadas ocorre a duplicao do DNA? b) Identique as fases da diviso representadas de A a E. 764. Unicap-PE (modificado) Observe as guras abaixo e assinale os itens corretos:

A partir desse esquema, foram feitas as seguintes consideraes. I. O organismo apresenta um nmero diplide de 4 cromossomos. II. Na clula h dois pares de cromossomos homlogos. III. No conjunto de cromossomos representados, h 2 pares de alelos. IV. Se a clula estiver em metfase, haver 8 cromtides. verdadeiro o que se arma apenas em: a) I e III d) I, II e III b) II e IV e) I, II e IV c) III e IV
228

0. A gura exposta representa a clula animal eucariota em processo de diviso celular por mitose. 1. O desenvolvimento de seres multicelulares depende da morte programada de certas clulas. Tal fenmeno conhecido como apoptose. 2. As mitocndrias de clulas vegetais sofrem mitose.

3. Em relao ao cdigo gentico, podemos concluir que a informao para a sntese de polipeptdeos est codicada no DNA. 4. No caritipo de um indivduo, pode-se saber, alm do nmero, o tamanho e a forma dos cromossomos. 765. UFPE Observe as guras expostas e analise as proposies.

a) Quais so as clulas que esto em intrfase? b) Qual a clula que representa a fase seguinte quela esquematizada na clula nmero 5? c) Que clula encontra-se em fase mais adiantada da diviso: a nmero 1 ou a nmero 6? d) Em qual clula a mitose est terminando? 767. Vunesp Sabe-se que o alcalide colchicina um inibidor da diviso mittica, cuja ao impede a formao das bras do fuso. Com base nessas informaes, responda s questes ao lado. a) At que fase a mitose se processaria normalmente em uma clula diplide tratada com a colchicina? Justique sua resposta. b) Nesse caso, qual seria o nmero cromossmico resultante do processo de diviso? Justique sua resposta. 768. UFSCar-SP Clulas eucariticas diplides em intrfase foram colocadas para se dividir em um tubo de ensaio contendo meio de cultura, no qual os nucleotdeos estavam marcados radioativamente. Essas clulas completaram todo um ciclo mittico, ou seja, cada uma delas originou duas clulas-lhas. As clulas-lhas foram transferidas para um novo meio de cultura, no qual os nucleotdeos no apresentavam marcao radioativa, porm o meio de cultura continha colchicina, que interrompe as divises celulares na fase de metfase. Desconsiderando eventuais trocas entre segmentos de cromtides de um mesmo cromossomo ou de cromossomos homlogos, a marcao radiativa nessas clulas poderia ser encontrada: a) em apenas uma das cromtides de apenas um cromossomo de cada par de homlogos. b) em apenas uma das cromtides de ambos cromossomos de cada par de homlogos. c) em ambas as cromtides de apenas um cromossomo de cada par de homlogos. d) em ambas as cromtides de ambos cromossomos de cada par de homlogos. e) em ambas as cromtides de ambos cromossomos de cada par de homlogos, porm em apenas 50% das clulas em metfase. 769. UFC-CE Um animal comum na caatinga nordestina o lagarto Tropidurus hispidus, comumente conhecido como calango. Seu caritipo, determinado por geneticistas do Departamento de Biologia da UFC, evidencia 18 pares de cromossomos, com cada cromossomo contendo um centrmero. O conhecimento do caritipo um passo inicial para decifrar o genoma do animal. Pergunta-se: a) Quantos cromossomos so encontrados no espermatozide desse animal? Justifique sua resposta. b) Quais as duas principais categorias de substncias qumicas que formam cada cromossomo deste animal?
229

0. Representa as diversas fases do processo mittico de uma clula vegetal, uma vez que no h centrolos e que, na hora da diviso, no ocorreu estrangulamento do citoplasma, mas o aparecimento de uma parede no equador da clula. 1. A seqncia correta em que essas fases ocorrem 4, 1, 2, 3, 5. 2. A gura 1 representa a metfase, onde ocorre o pareamento dos cromossomos homlogos denominados sinapse. 3. A quantidade de DNA por clula, durante todo processo de diviso celular no a mesma, embora o nmero e a quantidade de cromossomos da clula me sejam mantidos nas clulas-lhas. 4. As guras 4 e 5 representam clulas em intrfase. 766. Vunesp A gura a seguir representa o esquema de um corte longitudinal da regio de crescimento de uma raiz. As clulas dessa regio sofrem mitoses sucessivas que garantem o crescimento do rgo.

PV2D-06-BIO-14

Baseando-se na gura, responda s questes propostas.

c) Qual o nmero de cromtides em uma clula da pele deste animal que se encontra em metfase mittica? d) Qual o nmero mnimo de cromossomos de uma clula somtica deste animal que deve ser usado para decifrar o genoma completo da espcie? Justique. 770. Fuvest-SP (modificado) O quadro apresentado destaca dois conceitos biolgicos: cncer e sistema respiratrio de insetos.

a) b) c) d) e)

mitose. fecundao. esporulao. poliploidia. poliembrionia.

775. UERGS-RS Os gametas humanos, ao serem formados, passam por um perodo de crescimento e maturao, quando as clulas diplides (2n) formam as clulas haplides (n). Em tal perodo, ocorre o processo de: a) fecundao. d) germinao. b) fertilizao. e) meiose. c) mitose. 776. FMU-SP Os gametas humanos tm 23 cromossomos. Na prfase II da meiose de uma clula que origina esses gametas, encontram-se: a) 23 pares de homlogos. b) 46 pares de homlogos. c) 23 cromossomos simples. d) 46 cromossomos simples. e) 23 cromossomos duplos. 777. Em relao meiose, responda ao que se pede. a) Em que tipos celulares ocorrem esse fenmeno de diviso nos animais e nos vegetais, respectivamente? b) Qual a importncia desse processo para esses organismos? 778. FCC-SP Crossing-over : a) a troca de partes entre cromossomos homlogos. b) a ligao de genes que cam no mesmo cromossomo. c) a mistura de material gentico de duas espcies. d) a formao de poliplides. e) o cruzamento entre espcies diferentes. 779. Em relao ao fenmeno cromossmico representado na gura adiante, responda ao que se pede.

Faa uma breve descrio de como o nefasto hbito de fumar est associado ao desenvolvimento de cncer de pulmo, garantindo que em seu texto apaream, de forma relacionada, os seguintes conceitos: tumor, mutao, fumo, proliferao celular descontrolada, genes reguladores da diviso celular. 771. UCPR Quando uma clula conclui a sua primeira diviso meitica, resultam: a) 2 clulas diplides. b) 4 clulas diplides. c) 4 clulas haplides. d) 2 clulas haplides. e) 2 clulas somticas. 772. Uma clula com 16 cromossomos, ao sofrer meiose, produz: a) 4 clulas com 16 cromossomos. b) 2 clulas com 8 cromossomos. c) 2 clulas com 16 cromossomos. d) 4 clulas com 8 cromossomos. e) 8 clulas com 16 cromossomos. 773. UEL-PR Meiose o processo de diviso celular atravs do qual, via de regra, uma clula ...I... origina clulas ...II... com um nmero ...III... de cromossomos. Para completar corretamente a frase, os espaos I, II e III devem ser substitudos, respectivamente, por: a) diplide haplides n. b) diplide haplides 2n. c) diplide diplides 2n. d) haplide diplides 2n. e) haplide diplides n. 774. FCC-SP A meiose um fenmeno biolgico que contrabalana ou representa o oposto ao fenmeno da:
230

a) Em que processo de diviso celular ocorre? Em qual fase do processo? b) Qual a sua importncia para os seres vivos?

780. UFMS A seqncia representa etapas da diviso celular (meiose).

III. A mitose o processo pelo qual clulas diplides originam clulas haplides para a formao de gametas. Est(o) correta(s): a) apenas I. b) apenas II. c) apenas I e II. d) apenas I e III. e) apenas II e III. 784. UEL-PR Com relao diviso celular, podemos armar que: a) a mitose s ocorre em organismos com reproduo sexuada. b) a mitose permite variabilidade gentica, principal diferena do processo em relao meiose. c) na meiose, no h associao de cromossomos homlogos com troca de partes entre eles, fato que s ocorre na mitose. d) na meiose, no ocorre segregao de genes. e) o objetivo do processo mittico o crescimento do organismo, e do processo meitico a formao de gametas. 785. O nmero dos cromossomos nas clulas do cavalo (I) 64 e no trigo (II) 42. Quando esses organismos passam pelos processos de mitose e meiose, respectivamente, seus nmeros cromossmicos sero: a) (I) 32 e 64, (II) 42 e 21 b) (I) 128 e 32, (II) 84 e 21 c) (I) 64 e 32, (II) 42 e 21 d) (I) 32 e 16, (II) 42 e 21 e) O nmero de cromossomos no sofre modicaes. 786. UFV-MG Uma amostra celular foi retirada de certo organismo diplide e sem anormalidades cromossmicas para estudo do seu caritipo. Entre as clulas observadas, a representada pelo desenho a seguir foi a nica obtida com os cromossomos bem visveis. Com base neste desenho, assinalte a armativa mais provvel.

a) Indique o fenmeno que est ocorrendo em a, b e c. b) Em que tipo de clulas essa modalidade de diviso celular ocorre? c) Qual a importncia, em nvel gentico, do fenmeno indicado em b? 781. UFMG Analise estas guras:

A partir dessa anlise, incorreto armar que a variabilidade gentica observada: a) em II se explica por mutao e recombinao. b) em I decorre da troca de material gentico. c) em II possibilita a sobrevivncia em vrios ambientes. d) em I resulta de um processo de mutao. 782. Assinale a alternativa correta. a) Ao nal da mitose, h reduo da ploidia da clula. b) A meiose apresenta uma diviso celular para cada duplicao do material gentico. c) A meiose apresenta duas divises celulares para uma duplicao do material gentico. d) Na mitose, no h duplicao do material gentico. e) Na meiose, as clulas-lhas so necessariamente idnticas clula-me. 783. UFSM-RS Analise as armativas a seguir. I. No m da meiose, as clulas-lhas so idnticas clula-me, pois possuem o mesmo nmero cromossmico. II. Na intrfase, ocorre a duplicao do material gentico.

PV2D-06-BIO-14

a) Trata-se de uma clula somtica com dois pares de cromossomos homlogos. b) Trata-se de uma clula gamtica em meiose I. c) Trata-se de uma clula somtica com nmero haplide de cromossomos. d) Trata-se de uma clula mittica no incio da metfase. e) Trata-se de uma clula germinativa em meiose II.
231

787. Cefet-MG O fenmeno que ocorre na meiose e que, em conjugao com a fecundao, fundamental para a constncia do nmero de cromossomos da espcie : a) a separao das cromtides-irms. b) o crossing-over. c) a duplicao dos ribossomos. d) a separao dos cromossomos homlogos. e) a dupla diviso e a separao dos centrolos. 788. Fuvest-SP Os dois processos que ocorrem na meiose, responsveis pela variabilidade gentica dos organismos que se reproduzem sexuadamente, so: a) duplicao dos cromossomos e pareamento dos cromossomos homlogos. b) segregao independente dos pares de cromossomos homlogos e permutao entre os cromossomos homlogos. c) separao da dupla-hlice da molcula de DNA e replicao de cada uma das tas. d) duplicao dos cromossomos e segregao independente dos pares de cromossomos homlogos. e) replicao entre os cromossomos homlogos. 789. Cesgranrio-RJ Ao compararmos mitose com meiose, podemos concluir que: a) a meiose est associada reproduo de animais pluricelulares, e a mitose, ao seu crescimento. b) a meiose divide metade o nmero de cromossomos de uma clula, e a mitose o duplica. c) a meiose est associada reproduo de animais unicelulares, e a mitose, ao seu crescimento. d) a mitose garante o nmero cromossomial da espcie, e a meiose no. e) a mitose s acontece em clulas reprodutoras, e a meiose s em clulas haplides. 790. Fuvest-SP A gura mostra etapas da segregao de um par de cromossomos homlogos em uma meiose em que no ocorreu permuta.

No incio da intrfase, antes da duplicao cromossmica que precede a meiose, um dos representantes de um par de alelos mutou por perda de uma seqncia de pares de nucleotdeos. Considerando as clulas que se formam no nal da primeira diviso (B) e no nal da segunda diviso (C), encontraremos o alelo mutante em: a) uma clula em B e nas quatro em C. b) uma clula em B e em duas em C. c) uma clula em B e em uma em C. d) duas clulas em B e em duas em C. e) duas clulas em B e nas quatro em C. 791. Qual dos seguintes processos ocorre exclusivamente na meiose? a) Diviso do centrmero b) Duplicao dos cromossomos c) Migrao dos cromossomos d) Pareamento dos cromossomos e) Espiralizao dos cromossomos 792. FAAP-SP No processo de meiose, h um fenmeno importante e responsvel pela evoluo das espcies com reproduo sexuada. O nome do processo e a fase em que ocorre: a) o crossing over e a fase a prfase I. b) o crossing over e a fase a prfase II. c) a mutao e a fase a metfase I. d) a mutao e a fase a metfase II. e) a recombinao gentica e a fase a anfase I. 793. PUC-PR Durante a meiose, o pareamento dos cromossomos homlogos importante, porque garante: a) a formao de clulas-lhas geneticamente idnticas clula-me. b) a menor variabilidade dos gametas. c) a separao dos cromossomos no homlogos. d) a duplicao do DNA, indispensvel a esse processo. e) a possibilidade de permuta gnica. 794. UFC-CE (modificado) Dois tipos de diviso nuclear, mitose e meiose, so caractersticos da maioria das clulas animais e de plantas. A mitose est regularmente associada diviso nuclear de clulas reprodutivas nas espcies de reproduo assexuada.
Burns, 1983

Com relao a esses dois processos de diviso celular, responda ao que se pede: a) Que fenmeno acontece na prfase meitica, o qual possibilita a ocorrncia de crossing over e conseqente formao de quiasmas? b) Que diferena existe quanto ao nmero de cromossomos nas clulas resultantes da mitose e da meiose?
232

795. UFPE Na meiose, para a formao das clulas reprodutoras, observa-se o emparelhamento de cromossomos homlogos na: a) metfase II. d) anfase I. b) metfase I. e) anfase II. c) prfase II. 796. Cesesp-PE Na anfase I, os cromossomos que migram para os plos opostos da clula so: a) homlogos, cada um com duas cromtides. b) irmos, cada um com duas cromtides. c) irmos, cada um com uma cromtide. d) homlogos, cada um com uma cromtide. e) homlogos, sem cromtides. 797. FCC-SP Na anfase, os cromossomos se deslocam em direo aos plos do fuso devido: a) diferena de cargas eltricas. b) cintica prpria dos cromossomos. c) ao encurtamento das bras do fuso. d) espiralizao das bras do fuso. e) a um corpo impulsor que empurra os cromossomos. 798. IUESO-GO O movimento cromossmico abaixo esquematizado ocorre:

801. Cesgranrio-RJ Considerando clulas isoladas da linhagem germinativa de um indivduo que possui dois pares de cromossomos, assinale a alternativa que representa a anfase da segunda diviso meitica.

802. Considere os seguintes eventos: I. Permutao ou crossing-over II. Disjuno de cromtides-irms III. Pareamento de cromossomos homlogos IV. Disjuno de cromossomos homlogos A ordem em que esses eventos ocorrem no processo de meiose : a) I II III IV b) II I III IV c) III I IV II d) III IV I II e) IV III II I 803. Unirio-RJ A meiose o processo pelo qual clulas diplides podem originar clulas haplides, objetivando a formao de clulas destinadas reproduo da espcie. A meiose consiste em duas etapas consecutivas, cada uma com vrias subfases sucessivas. Correlacione as etapas da meiose com suas principais caractersticas. I. Zigteno da prfase I II. Metfase I III. Anfase II IV. Telfase A. B. C. D. Reconstituio nuclear e citocinese Sinapse cromossmica Formao da placa equatorial dupla Participao dos centrmeros e separao das cromtides

a) b) c) d) e)

na anfase I da mitose. na anfase II da mitose. na anfase I da meiose. na anfase II da meiose. em qualquer anfase da mitose ou meiose.

799. Vunesp Cromossomos que migram para os plos da clula, sendo que cada cromossomo est formado por duas cromtides unidas pelo centrmero... Esse texto refere-se : a) anfase da mitose. b) anfase II da meiose. c) metfase da mitose. d) anfase I da meiose. e) telfase da mitose. 800. PUC-SP Certa espcie animal tem nmero diplide de cromossomos igual a 8 (2n = 8). Uma clula de um indivduo dessa espcie encontra-se em diviso e apresenta 4 cromossomos simples sendo puxados para cada plo. A partir dessa informao, pode-se armar que a referida clula se encontra: a) na metfase da mitose. b) na anfase da mitose. c) na metfase da 1 diviso da meiose. d) na anfase da 1 diviso da meiose. e) na anfase da 2 diviso da meiose.

A associao correta : a) I B, II C, III A, IV D b) I C, II D, III B, IV A c) I D, II B, III C, IV A d) I B, II C, III D, IV A e) I A, II B, III C, IV D 804. PUC-SP Sinapse, ou atrao e pareamento de homlogos, ocorre: a) na mitose. b) nas prfases I ou II da meiose.
233

PV2D-06-BIO-14

c) na segunda diviso da meiose. d) na prfase I, estgio de leptteno. e) no zigteno. 805. As subfases da prfase da primeira diviso meitica, em seqncia correta, so: a) paquteno, leptteno, diplteno, diacinese. b) paquteno, diacinese, leptteno, zigteno, diplteno. c) leptteno, zigteno, paquteno, diplteno, diacinese. d) leptteno, paquteno, zigteno, diacinese, diplteno. e) diacinese, zigteno, leptteno, paquteno, diplteno. 806. Fuvest-SP Um pesquisador fez o seguinte desenho de uma clula observada ao microscpio ptico.

809. Nos processos de diviso celular, o posicionamento dos cromossomos na metfase e anfase importante porque garante: a) distribuio eqitativa dos cromossomos pelas clulas-lhas. b) pareamento cromossmico para a ocorrncia do crossing-over. c) duplicao de DNA indispensvel continuidade do processo. d) formao de cromossomos homlogos e independentes. e) alinhamento de cromossomos necessrio formao de sinapses. 810. FCC-SP A gura a seguir representa uma clula em diviso meitica.

Pode tratar-se de uma clula de: a) ovrio. b) sangue. c) linfa. d) medula ssea. e) pele. 807. Uma espcie de pernilongo possui 2n = 6 cromossomos. A seguir esto representados fenmenos meiticos pelos quais passam as clulas gamticas desse pernilongo. Marque a alternativa que contm a seqencia correta dos eventos meiticos

a) Trata-se de uma clula animal ou vegetal? Justique. b) Em que fase do processo de diviso est a clula? c) As clulas-lhas resultantes tero quantos cromossomos? d) Quantos cromossomos tinha a clula-me? 811. Um grupo de clulas de mesmo tecido est em processo de diviso. Algumas fases desse processo esto representadas a seguir.

a) A, B, C, D, E b) E, A, D, C, B c) C, E, A, D, B

d) B, D, A, C, E e) D, A, C, E, B

808. Fuvest-SP Considere um animal com nmero cromossmico diplide igual a 4 (2n = 4). Esquematize uma clula desse animal na anfase I da meiose e na anfase II da meiose, supondo que no ocorreu permutao.
234

a) Que tipo de diviso celular est ocorrendo? Justique sua resposta. b) Qual seqncia de nmeros indica a ordem em que acontecem as etapas sucessivas no processo da diviso? c) Em que etapa(s) est(o) ocorrendo o(s) evento(s) que promove(m) variabilidade gentica? Justique sua resposta.

812. Um organismo possui um par de cromossomos metacntricos e um par de cromossomos acrocntricos em suas clulas diplides. Esquematize uma clula desse organismo em anfase I e uma em metfase II da meiose. 813. PUCCamp-SP As guras apresentadas mostram fases de um tipo de diviso celular.

Coluna I Fases 1. zigteno ( )

Coluna II Fenmenos migrao dos cromossomos homlogos para os plos pareamento dos homlogos migrao dos cromossomos-irmos para os plos visualizao dos quiasmas

2. paquteno 3. diplteno

( (

) )

4. anfase I 5. anfase II

( (

) )

ocorrncia do crossingover ou permuta entre cromtides-homlogas A seqncia correta, de cima para baixo, na coluna II : a) 4, 1, 2, 3, 5 b) 4, 1, 5, 2, 3 c) 4, 1, 5, 3, 2 d) 4, 1, 3, 2, 5 e) 4, 2, 5, 1, 3 Assinale a alternativa que identica corretamente o tipo de diviso e a seqncia correta na qual essas fases ocorrem. a) Mitose: II I III IV V b) Mitose: III IV II V I c) Meiose: III II IV V I d) Meiose: IV III II V I e) Meiose: V I IV II III 814. UNICAP-PE Analise a gura abaixo, a m de julgar as proposies: 816. UFSC A meiose caracteriza-se pela ocorrncia de apenas uma duplicao do material gentico para cada duas divises nucleares, e responsvel pela formao de clulas haplides a partir de clulas diplides. Em relao a esse tipo de diviso celular, assinale com V (verdadeiro) ou F (falso) as proposies adiante. 01. O crossing over ocorre na prfase da meiose I e caracteriza-se pela permuta entre os segmentos das cromtides-irms do mesmo cromossomo. 02. A reduo, pela metade, do nmero cromossmico confere meiose uma importncia fundamental na manuteno do nmero constante de cromossomos da espcie. 04. A meiose ocorre durante o processo de produo das clulas reprodutivas e possibilita o aumento da variabilidade gentica dos seres vivos que a realizam. 08. A primeira diviso meitica reducional, enquanto a segunda equacional, j que a partir delas so formadas duas clulas diplides e quatro clulas haplides, respectivamente. 16. Na anfase I, ocorre a separao dos pares de homlogos, havendo a migrao polar dos cromossomos duplicados. 32. As anfases I e II so semelhantes entre si, medida que os centrmeros se dividem e as cromtides de cada par migram para os plos da clula. 64. Na metfase I, os pares de cromossomos homlogos duplicados encontram-se na placa equatorial da clula. 817. UFU-MG (modificado) Com relao aos dois tipos fundamentais de diviso celular que ocorrem nos animais, faa o que se pede:
235

0. A gura 1 representa uma clula com tetraplidia. 1. A gura 2 representa uma clula com incio de uma citocinese centrfuga. 2. A gura 4 representa uma clula eucaritica animal em metfase. 3. O pareamento dos cromossomos um processo exclusivamente de ocorrncia na meiose. 4. Uma clula somtica com quatro cromossomos, ao se dividir, apresenta, na metfase, quatro cromossomos distintos, cada um com duas cromtides.
PV2D-06-BIO-14

815. UFG-GO Relacione as fases meiticas (coluna I) com os respectivos fenmenos (coluna II).

a) Apresente as diferenas relacionadas ao local de ocorrncia, quantidade de DNA nas clulas-lhas e a possibilidade, ou no, de recombinao gnica para cada um desses processos de diviso celular. b) Mencione para a meiose o nome das fases e sua seqncia correta. 818. Fatec-SP A gura A representa uma clula que no est em processo de diviso. Baseando-se nessa gura, determine em que fase da diviso celular se encontra a clula representada na gura B.

821. Fuvest-SP Os desenhos a seguir representam clulas em diviso, pertencentes a rgos de um mesmo animal, cujo nmero diplide de cromossomos 4 (2n=4). Identique o tipo de diviso e a fase do processo em que cada uma das clulas se encontra.

a) b) c) d) e)

Telfase I na meiose Telfase da mitose Anfase II da meiose Anfase da mitose Anfase I da meiose

819. Observe o seguinte esquema de uma clula em diviso:

822. Unicap-PE Responda presente questo de acordo com o seguinte cdigo: a) se apenas a I estiver correta. b) se apenas a II estiver correta. c) se apenas a III estiver correta. d) se apenas a I e a II estiverem corretas. e) se apenas a II e a III estiverem corretas. I. A meiose caracteriza-se pelo fato de uma clula 2n, atravs de duas divises consecutivas, originar quatro clulas haplides, que podem ser geneticamente distintas entre si. II. Na mitose, a duplicao das cromtides ocorre na intrfase. III. A prfase mittica e a prfase I meitica tm em comum o fato de serem longas; mas, nesse perodo, quase nenhum evento ocorre com os cromossomos. 823. As proposies a seguir dizem respeito diviso celular. Julgue-as. ( ) Durante a prfase mittica, os cromossomos homlogos emparelham-se. ( ) Uma clula-me, aps dividir-se por mitose, origina quatro clulas geneticamente idnticas. ( ) A reproduo assexuada por cissiparidade ocorre em conseqncia da mitose. ( ) Durante a metfase I meitica, pode ocorrer o fenmeno da permutao entre cromtides homlogas. ( ) No ciclo de reproduo sexuada, a meiose de fundamental importncia para manter constante o nmero de cromossomos de uma espcie. 824. PUC-SP Nos esquemas expostos, so mostradas separaes cromossmicas que ocorrem na anfase das divises celulares.

correto armar que ele representa uma clula em: a) meiose, j que est ocorrendo migrao dos cromossomos homlogos para plos opostos. b) meiose, dada a migrao das cromtides-irms para plos opostos. c) mitose, porque os cromossomos homlogos esto emparelhados. d) mitose, por existirem duas cpias de cada cromossomo. e) mitose, devido presena de duas cromtides em cada cromossomo. 820. PUCCamp-SP Assinale a alternativa, na tabela abaixo que identica corretamente os cromossomos que migram para plos opostos da clula durante as anfases da meiose e da mitose. Meiose I a) b) c) d) e)
236

Meiose II homlogos homlogos irmos irmos irmos

Mitose irmos homlogos irmos homlogos homlogos

irmos irmos homlogos homlogos irmos

a) Em que processo(s) de diviso celular encontrado I? Justique. b) Em que processo(s) de diviso celular encontrado II? Justique. 825. UFSM-RS Considerando o desenho apresentado, analise as armativas a seguir.

827. UCB-DF O grco exposto representa a quantidade de DNA por clula em funo do tempo, em um grupo de clulas embrionrias cultivadas in vitro. Partindo-se de uma nica clula no incio do processo mittico em (t1) no instante t2 o nmero de ciclos celulares completados e o nmero de clulas-lhas sero, respectivamente:

A e C representam clulas em metfase; B e D representam clulas em anfase. II. A representa uma clula em mitose, pois possvel observar os cromossomos homlogos pareados. III. D representa a separao das cromtides-irms, fenmeno que ocorre durante a meiose II e na mitose. Est(o) correta(s): a) apenas I. d) apenas III. b) apenas II. e) I, II e III. c) apenas I e III. I.

a) b) c) d) e)

1e2 2e4 4e8 4 e 16 16 e 32

826. Cesgranrio-RJ Os esquemas 1 e 2 mostrados a seguir representam estgios funcionais do ncleo celular e esto relacionados com a diviso celular; eles nos permitem armar o seguinte:

828. Vunesp No grco exposto, relativo ao ciclo celular, a mitose propriamente dita est representada pelo intervalo de:

a) 1 a 2 b) 2 a 3 c) 1 a 3 829. UEL-PR Analise o grco a seguir:

d) 3 a 4 e) 4 a 5

I.

PV2D-06-BIO-14

O processo 1 ocorre s na mitose, e o processo 2 ocorre na meiose. II. Tanto o processo 1 quanto o processo 2 ocorrem na meiose, enquanto o processo 2 no se encontra na mitose. III. Os processos 1 e 2 ocorrem tanto na meiose quanto na mitose. Assinale: a) se somente I for verdadeira. b) se somente II for verdadeira. c) se somente III for verdadeira. d) se somente I e II forem verdadeiras. e) se somente I e III forem verdadeiras.

O momento em que a clula-me acabou de se dividir e cada clula-lha tem um conjunto de cromossomos idntico ao da original : a) 1 d) 4 b) 2 e) 5 c) 3
237

830. Uespi Sobre o ciclo celular representado, so feitas algumas armativas:

Mitose a) Na prfase, os cromossomos esto duplicados. Na anfase, cada cromossomo tem quatro cromtides. Formam-se duas clulas-lhas ao nal do processo. Na metfase, os cromossomos homlogos esto emparelhados. As clulas-lhas formadas no so idnticas clulame.

Meiose Na prfase I, os cromossomos no esto duplicados. Na anfase II, cada cromossomo tem duas cromtides. Formam-se quatro clulas-lhas ao nal do processo. Na metfase I, os cromossomos homlogos no esto emparelhados. As clulas-lhas formadas so idnticas clula-me.

b)

c) 1. x simboliza a quantidade de DNA por clula durante o ciclo celular. 2. O tipo celular representa um gameta em meiose. 3. O tipo celular representado uma clula somtica. 4. II indica meiose. 5. x representa a quantidade de sntese protica durante o ciclo celular. 6. I indica intrfase. Assinale a armativa correta: a) 1 2 5 b) 1 2 4 c) 3 5 6 d) 1 3 6 e) 2 4 6

d)

e)

833. Unirio-RJ (modificado) Nas guras apresentadas, as clulas A e B, respectivamente, encontram-se em processo de diviso celular.

831. Cefet-PR Sobre o processo da intrfase, mitose e meiose, analise as proposies seguintes e marque a alternativa correta. I. Durante a intrfase, os lamentos cromossmicos permanecem descondensados e distribudos no interior do ncleo, constituindo a cromatina. II. Desprezando-se pequenas diferenas dentro de pares de cromossomos de tamanhos diferentes, esperado que, aps a primeira diviso meitica, as clulas-lhas contenham a mesma quantidade de DNA nuclear que a clula-me, antes da duplicao do DNA. III. Durante a anfase II da meiose II no h separao de centrmeros; por isso, os cromossomos voltam aos plos com duas cromtides. IV. O crossing over ocorre na prfase da meiose I e caracteriza-se pela permuta entre os segmentos das cromtides-irms do mesmo cromossomo. Assinale: a) se I e II estiverem corretas. b) se II e III estiverem corretas. c) se III e IV estiverem corretas. d) se I, III e IV estiverem corretas. e) se todas estiverem corretas. 832. Fatec-SP O quadro a seguir apresenta algumas diferenas entre mitose e meiose. Assinale a alternativa correta.

Identifique, entre as opes apresentadas, a que caracteriza as fases do processo de diviso celular e o tipo de clula, se animal ou vegetal, referentes s respectivas guras A e B. a) Anfase I de meiose da clula animal; metfase de mitose de clula vegetal. b) Anfase I de meiose de clula vegetal; anfase de mitose ou anfase II da meiose em clula animal. c) Metfase I de meiose em clula vegetal; anfase I de meiose em clula vegetal. d) Telfase II de clula animal; anfase de mitose em clula animal. e) Intrfase de clula vegetal; anfase de clula animal. 834. Fuvest-SP a) A clula de um animal, esquematizada a seguir, encontra-se na anfase da primeira diviso da meiose. O que permite essa concluso?

238

b) Represente duas clulas desse animal: uma em anfase II da meiose, e a outra em anfase da mitose. 835. UFPE Uma evidente diferena entre a anfase da mitose e as anfases I e II da meiose que os cromossomos em migrao para os plos celulares so: a) irmos nas anfases I e II e homlogos na anfase da mitose. b) homlogos nas anfases I e II e irmos na anfase da mitose. c) homlogos na anfase I e irmos na anfase II e na anfase da mitose. d) irmos na anfase I e anfase da mitose e homlogos na anfase II. e) irmos nas anfases I e II e anfase da mitose. 836. FCMSC-SP Considere os esquemas expostos, que representam ncleos de 6 clulas com seus cromossomos, pertencentes a uma mesma espcie de ser vivo.

838. UFRJ-RJ Um pesquisador determinou as variaes nas concentraes de ADN ao longo do tempo, em clulas do ovrio e do epitlio intestinal de um animal. As variaes na quantidade de ADN em cada clula nos dois casos, esto registradas nas guras 1 e 2. Qual das guras (1 ou 2) corresponde s clulas do ovrio e qual corresponde ao epitlio intestinal? Justique.

839.

Qual das alternativas indica, respectivamente, clula diplide resultante de mitose e clula haplide resultante de meiose? a) I e II d) IV e V b) II e III e) V e VI c) III e IV| 837. Unicamp-SP Os esquemas A, B e C abaixo representam fases do ciclo de uma clula que possui 2n = 4 cromossomos.

PV2D-06-BIO-14

a) A que fases correspondem as guras A, B e C? Justique. b) Qual a funo da estrutura cromossmica indicada pela seta na gura D?

01. A mitose responsvel pelos fenmenos de regenerao, renovao tecidual e crescimento dos organismos. 02. Nos vegetais superiores, a mitose denominada de anastral em razo de suas clulas no possurem centro celular. 04. A principal diferena entre a anfase mittica e a anfase I da meiose que, nesta ltima, no h diviso dos centrmeros, ocorrendo apenas separao dos homlogos, indo um deles para um dos plos da clula e o outro para a extremidade oposta. 08. O esquema demonstra que a distribuio dos membros de cada par de homlogos ocorre ao acaso. 16. A permuta gentica e a formao de quiasma no so eventos raros, e a sua freqncia varia de acordo com a espcie e com o tamanho dos cromossomos.

239

840. UFMS-MS Um estudante elaborou as seguintes anotaes sobre os processos de diviso celular mitose e meiose: Mitose Nmero cromossomtico das clulas-lhas idntico clula-me. Considerar perodos G1, S e G2 antes do incio da diviso. Ocorre a duplicao do centrmero durante a diviso. Cromtides irms so separadas ou centrfuga. Meiose Reduo do nmero de cromossomos nas clulaslhas. Clulas-lhas distintas entre si. Ocorre crossing-over durante o processo. Ocorre a duplicao do centrmero durante a diviso. Lotes cromossmicos separados na anfase I e II. Com o objetivo de melhorar as informaes contidas no esquema acima, voc poderia acrescentar: 01. G1, S e G2 referem-se duplicao do DNA, estando esse evento restrito ao perodo G2, que antecede a diviso propriamente dita. 02. as cromtides-irms de cada cromossomo so levadas para plos opostos da clula, durante a anfase da mitose e a anfase I da meiose. 04. na anfase I da meiose, ocorre a separao dos cromossomos homlogos, sem que haja duplicao dos centrmeros. 08. A meiose pode ser gamtica, esprica ou zigtica. 16. na meiose, as cromtides-irms de cada cromossomo so mantidas unidas at a anfase I. 841. UFMS-MS (modificado) Mitose e meiose so processos de diviso celular que ocorrem de forma distinta e tm resultados diversos. Guardam em comum uma srie de eventos, envolvendo principalmente modicaes pelas quais passam os cromossomos. Na seqncia de alternativas, que fazem referncia a determinados momentos desses dois processos, assinale a(s) armaco(es) correta(s). 01. Entre o nal de uma mitose e o incio da seguinte, a clula passa pela intrfase, perodo em que se nutre, cresce e sintetiza substncias. 02. Na prfase da mitose, cada cromossomo j est duplicado e suas cromtides permanecem unidas pelo centrmero at o nal da telfase, embora sofram um processo de espiralizao independente.

04. A anfase I da meiose e a anfase da mitose so idnticas no tocante ao comportamento dos cromossomos, ou seja, esse o perodo em que acontece a duplicao dos centrmeros e a separao das cromtides. 08. Na anfase I da meiose, as cromtides-irms permanecem unidas pela regio do centrmero, havendo to somente a separao dos cromossomos homlogos. 16. A duplicao dos cromossomos homlogos, na intrfase compreendida entre as duas divises da meiose (MI e MII), o mecanismo responsvel pela manuteno do nmero cromossmico da espcie. Some os itens corretos. 842. UFSC-SC A mitose e a meiose so importantes processos biolgicos, pois permitem que o nmero de cromossomos de uma clula permanea igual ou seja reduzido, para possibilitar sua restaurao numrica aps a fecundao. Com relao aos eventos e aos resultados desses dois processos, correto armar que: 01. ao contrrio da mitose, que ocorre em todas as clulas, a meiose restringe-se quelas da linha germinativa, que produziro gametas. 02. nos dois processos, ocorre a compactao da cromatina, fenmeno este que, alm de facilitar a diviso correta dos cromossomos, impede que o material gentico seja atacado por enzimas, presentes no citoplasma, que destroem o DNA. 04. uma mutao que ocorra dentro das cromtides de uma clula somtica ser transmitida a todas as suas clulas-lhas, atravs da diviso mittica. 08. a mitose o sistema de reproduo dos organismos nos quais no existe a presena de sexo nem a formao de clulas germinativas. 16. se considerarmos, em uma mesma espcie, duas clulas-lhas, uma originada por mitose e a outra por meiose, a primeira conter metade do nmero de cromossomos e o dobro da quantidade de DNA da segunda. 32. na meiose, existe a possibilidade de ocorrer o fenmeno de recombinao, que a troca de segmentos entre quaisquer dois cromossomos, gerando, com isso, alta variabilidade gentica para os indivduos envolvidos. 64. a meiose compreende duas etapas de diviso cromossmica, sendo que, aps a primeira, o nmero de cromossomos das clulas-lhas metade do das clulas-mes. Some o que for correto.

240

Biologia 1 Gabarito
01. C 04. A 07. C 10. E 13. A 14. No. Bactrias so seres procariontes, desprovidos de ncleo organizado, porm possuem como material gentico o DNA. 15. C 16. a) Procaritica Ausncia de carioteca (envoltrio nuclear) e organelas membranosas. b) 1 membrana plasmtica permeabilidade seletiva. 2 material gentico (DNA) comando das funes celulares. 3 ribossomo sntese de protenas 4 parede celular proteo 17. D 20. C 23. A 26. A 29. A 32. E 33. a) Mitocndria - respirao celular - energia. b) Complexo golgiense - secreo celular. c) Retculo endoplasmtico granular - sntese de protena. d) Retculo endoplsmatico agranular - sntese de lipdios. 34. E 36. a) Quanto ao ncleo: os procariontes no apresentam ncleo organizado, notando-se a ausncia de carioteca. A cromatina ca dispersa pelo citoplasma. Nos eucariontes, existe ncleo organizado, com carioteca e nuclolos. Quanto ao citoplasma: os procariontes no apresentam organelas envolvidas por membrana, enquanto os eucariontes as apresentam. 35. B 18. C 21. B 24. E 27. E 30. B 19. C 22. E 25. B 28. D 31. B 02. E 05. A 08. C 11. D 03. E 06. D 09. D 12. C b) As clulas procariontes so encontradas nas bactrias, e nas cianobactrias. 37. B 40. I. Complexo golgiense: responsvel pela secreo celular. II. Lisossomo: responsvel pela disgesto intracelular. III. Mitocndria: responsvel pela oxigenao da glicose e liberao de energia. 41. B 42. 45 (01 + 04 + 08 + 32) 43. B 44. Corretas: 01, 04, 16. 45 . 42 (02 + 08 + 32) 46. C 47. 40 (08 + 32) 48. F, V, F 49. A 50. a) No. Em protistas, animais e vegetais a cadeia respiratria encontra-se associada s cristas mitocondriais. Nesses organismos o DNA encontra-se no ncleo, ocorrendo tambm no interior de cloroplastos (vegetais e alguns protistas) e de mitocndrias. b) A clonagem das bactrias mais simples por estas serem organismos unicelulares. Animais so pluricelulares e dotados de grupos diferenciados de clulas. 51. V, V, V, V, F, V 52. C 55. B 58. E 59. a) cloroplasto b) mitocndria c) vacolo d) celulose 60. B 63. D 64. a) Vegetal, pois apresenta cloroplastos e grandes vacolos. 61. E 62. D 53. C 56. C 54. B 57. A 38. A 39. A b) Ribossomos livres e/ou retculo endoplasmtico granular, pois realizam a sntese de protenas e mitocndria para liberar energia para o trabalho celular. 65. D 68. A diferena siolgica bsica est no fato de os vegetais realizarem fotossntese. Quanto ao critrio celular, podemos diferenci-los pela presena de centrolos e lisossomos (clula animal) e de cloroplastos e parede celular (clula vegetal). 69. C 72. B 73. 29 (01 + 04 + 08 + 16) 74. a) Erro 1: ausncia de membrana plasmtica em seres procariontes. Justicativa: Todas as clulas, eucariticas e procariticas, possuem membrana plasmtica. Erro 2: ausncia de complexo golgiense em clula animal. Justicativa: Toda clula eucaritica possui complexo golgiense, exercendo a funo de secreo celular. Erro 3: presena de centrolo em clula vegetal. Justicativa: A maioria dos vegetais superiores no possui centrolos em suas clulas. Erro 4: ausncia de mitocndria em clula vegetal. Justicativa: As clulas vegetais realizam respirao aerbica, processo realizado nas mitocndrias. b) A permeabilidade seletiva est relacionada com a membrana plasmtica. A diviso celular est relacionada com os centrolos nas clulas animais, e com o material gentico. 75. a) A clula procaritica C, pois no apresenta envoltrio nuclear, nem organelas com sistemas de membranas, como complexo golgiense, mitocndrias e cloropastos.
241

66. E

67. E

70. A

71. D

PV2D-06-BIO-14

Clulas eucariticas: so as clulas A e B, pois possuem envoltrio nuclear e organelas membranosas, como complexo golgiense e mitocndria. b) Reino Monera: clula C, presena de parede celular e ribossomos, ausncia de organelas membranosas e carioteca ou envoltrio nuclear (procaritica). Reino animal: clula A, ausncia de parede celular e cloroplastos e presena de organelas membranosas (eucaritica). Reino vegetal: clula B, presena de parede celular, cloroplastos e organelas membranosas (eucaritica). 76. A 77. a) I. clula eucaritica animal II. clula eucaritica vegetal III. clula procaritica b) As clulas animais utilizam o O2 produzido pelas clulas vegetais atravs da fotossntese. c) Clulas procariticas e vegetais apresentam parede celular. 78. A 79. D 80. C 81. A 82. D 83. C 84. E 85. C 86. C 87. C 88. C 89. 52 (04 + 16 + 32) 90. A 91. B 92. D 93. A 94. E 95. V, V, V, F, F, V, F 96. D 97. A mulher grvida possui uma demanda maior de oxignio devido presena do feto. Uma dieta rica em ferro aumenta a disponibilidade do complexo ferro-hemoglobina e, portanto, permite o transporte de mais oxignio, o que reduz a sensao de falta de ar. 98. 31 (01 + 02 + 04 + 08 + 16) 99. C 100. a) Proposta IV. O ferro essencial para a produo de hemoglobina pigmento vermelho presente nas hemcias , que realiza o transporte de oxignio dos pulmes aos tecidos do corpo.
242

b) Proposta I. O clcio presente no leite e seus derivados fundamental para os processos de calcicao ssea, mineralizao dos dentes e coagulao sangnea. 101. B 104. E 107. E 110. E 111. a) Glicose + Frutose b) Glicose + Galactose c) Glicose + Glicose 112. D 113. a) Fotossntese b) Porque so a principal fonte de energia e todos os seres vivos dependem deles para a sua sobrevivncia. Alm disso, entram na composio de molculas essenciais, como os cidos nuclicos. 114. a) Organismos fotossintetizantes. b) O principal acar produzido no fenmeno da fotossntese a glicose, que ca armazenado na forma de amido. 115. A 116. a) Animal : glicognio Vegetal : amido b) Animal : fgado e msculos Vegetal : raiz 117. a) Glicose e frutose - monossacardios, amido - polissacardio. b) Os monossacardios podem ser absorvidos diretamente, enquanto os polissacardios devem ser digeridos. 118. D 119. a) A sacarose (dissacardeo), quando digerida, fornece glicose e frutose, que sero usadas como fonte de energia. b) A gua do suor ao evaporar absorve calor do corpo auxiliando a regulao da temperatura corporal. 102. A 105. A 108. B 103. B 106. E 109. C

120. 25 (01 + 08 + 16) 121. 22 (02 + 04 + 16) 122. B 123. a) Acar A. Segue a frmula CnH2nOn(n = 7). b) Acar B. C6H10O5 C3H6O3 + C3H6O3 124. C 125. E 127. C 128. A 130. A 131. E 132. V, F, V, F, V 133. E 134. B 135. a) Animais: glicognio Vegetais: amido b) Monossacardios c) Glicerdeos 136. D 138. c, b, d, a 139. D 141. a) As duas principais funes do colesterol so: participar da composio estrutural das membranas dos animais e ser precursor de hormnios sexuais (estrgenos, andrgenos e progesterona). b) O colesterol sangneo tem origem endgena ou exgena, produzido pelo fgado ou proveniente da alimentao. 142. A 143. A 145. D 146. B 148. A 149. C 151. D 152. E 154. D 155. E 157. Corretas: 04, 16, 64. 158. A 159. A = Aminocido B = Aminocido C = Ligao peptdica D = Dipeptdeo 160. D 161. D 163. A 164. E 166. A 167. E 169. E 170. D 144. C 147. C 150. A 153. C 156. E 140. B 137. C C6H10O5 + H2O 126. B 129. C

162. B 165. C 168. B

171.

172. C 173. B 174. D 175. A hexoquinase possui uma grande anidade pela glicose, ou seja, ela atinge a velocidade mxima com uma concentrao muito pequena de glicose. A glicoquinase exibe uma afinidade bem menor, pois somente atinge sua velocidade mxima em concentraes bem mais altas do substrato. Logo, a enzima que contribui para a formao de glicognio heptico a glicoquinase, pois esta somente produz G6P com mxima ecincia quando h excesso de glicose no sangue. 176. B 177. C 178. C 179. C 180. B 181. C 182. a) Sacarase b) Amilase c) Lipase 183. B 184. C 185. O ponto assinalado pela seta representa o mximo de atividade de uma enzima, que corresponde a uma temperatura tima (aproximadamente 30C). medida que h um aumento da temperatura, a enzima, como substrato orgnico, sofre uma desnaturao, perdendo sua funo biolgica. 186. B 187. E 188. B 189. B 190. A 191. D 192. F, F, V, V 193. E 194. D 195. a) O amaciamento da carne corresponde hidrlise das protenas das bras da carne devido ao das proteases presentes no mamo (papana), no abacaxi (bromelina) ou no amaciante industrializado.

Os amaciantes atuam como enzimas presentes no trato digestrio (pepsinas, tripsinas etc.). b) O calor provocaria a desnaturao das enzimas, que perderiam a funo amaciante. 196. Itens corretos: 0 e 2. 197. B 198. 1. Nada (sem catalase). 2. Liberao de O2 (catalase ativa). 3. Liberao lenta de O2 (baixa temperatura inativa a catalase). 4. Liberao intensa de O2 (devido a maior superfcie de contato). 5. Nada (a fervura causa a desnaturao da catalase). 199. a) O polipeptdio E pode ser classicado como enzima. b) Analisando o grco 1, pode-se perceber que h uma inuncia da temperatura na atividade enzimtica (ponto timo em torno de 36C) e comparando com o grco 2, h uma maior velocidade na reao quando na presena de E. 200. 95 (01 + 02 + 04 + 08 + 16 + 64) 201. E 203. 1. Grupamento fosfato. 2. Pentose (desoxirribose). 3. Base nitrogenada. 4. Pontes de hidrognio. 204. C 205. A 206. C 207. A 208. Cloroplastos e mitocndrias so organelas que possuem seu prprio DNA, RNA e ribossomos. Por essa razo, podem sintetizar protenas (enzimas), alm de se autoduplicarem. 209. E 210. C 211. A 212. B 213. Corretas: 16 e 32 214. A 215. D 216. Corretas: 01, 02, 08 e 64 217. B 218. a) Ribossomos. b) Por degradar as molculas de RNAr que formam os ribossomos. 202. A

219. C 222. C 224.

220. D 223. D

221. E

a) 3 e 4. A anlise da lmina 3 identificou uma dupla hlice, caracterstica da molcula de DNA. Na lmina 4, a presena de timina tambm identica a molcula de DNA. b) Propores diferentes entre guanina e citosina podem representar uma ta simples de DNA ou uma ta de RNA. 225. B 226. T = 15%, A = 15%, C = 35%, G = 35% 227. C 230. C 232. RNA mensageiro: determina a ordem dos aminocidos na cadeia polipeptdica. RNA transportador: transporte de aminocidos para os ribossomos. 233. D 234. a) TTT CCG TAA b) UUU CCG UAA 235. D 236. B 237. Corretas: 02, 08 e 16. 238. C 239. Na 2, pois h maior quantidade de pares C G. Devido a esse fato, maior o nmero de pontes de hidrognio a serem rompidas, o que justica a necessidade de uma temperatura de desnaturao mais elevada. 240. a) A nica armao possvel face aos dados que as duas molculas possuem as mesmas propores de bases nitrogenadas. b) Somente seriam idnticas se a ordenao das bases fosse exatamente a mesma nas duas molculas. 241. C = 18%, G = 18%, A = 32%, T = 32%. No DNA, A = T e G = C. Alm disso, A + T + G + C = 100%. 242. C 243. a) Porque a autoduplicao produz cpias idnticas do DNA.
243

228. C 231. E

229. B

PV2D-06-BIO-14

b) Atravs da sntese protica, produzindo enzimas que controlam o metabolismo celular. 244. A 245. E 246. C 247. E 248. DNA (gene): seqncia de nucleotdeos responsvel por uma informao biolgica. RNAm: seqncia de nucleotdeos, transcrito a partir do DNA, responsvel por levar a informao a ser traduzida. RNAt: responsvel por carregar os aminocidos especicados pelos cdons do RNAm at os ribossomos, onde ocorre a traduo. Ribossomos: organelas presentes em clulas procariticas e eucariticas, responsveis pela traduo no processo de sntese protica. Retculo endoplasmtico granular (REG): conjunto de canais interligados que participam do transporte de substncias, alm do processo de sntese protica, devido aos ribossomos aderidos s suas membranas. 249. A 250. A timina do meio 1 foi incorporada ao DNA que est concentrado no ncleo da clula. A uracila do meio 2 foi incorporada ao RNA que formado no ncleo e participa da sntese de protenas no citoplasma da clula. 251. D 252. B 253. D 254. A 255. A 256. Porque so necessrios 3 nucleotdeos para codicar um aminocido. 257. D 258. D 259. C 260. C 261. TAC CCT CGA AGA GCC 262. a) Leucina - fenilalanina - leucina - valina - serina - glicina. b) AAU e GAA. 263. Pelo fato de o cdigo gentico ser degenerado, a partir de uma seqncia de aminocidos no se pode armar com certeza a seqncia de bases do DNA, uma vez que podem existir cdons diferentes para o mesmo aminocido. 264. C 265. C 266. E 267. E 268. E 269. A 270. D
244

271. a) RNAm: AAG CCU UUG UUC b) 4 cdons c) UUC GGA AAC AAG d) Lisina prolina leucina fenilalanina. 272. A 273. D 274. transcrio traduo RNAm Pr otena. a) DNA b) No, porque o cdigo gentico degenerado e assim, diferentes trincas de nucleotdeos codicam o mesmo aminocido. 275. a) So necessrios pelo menos 84 nucleotdeos, pois cada aminocido de uma protena codicado por uma trinca de nucleotdeos, sendo que as duas seqncias possuem 28 aminocidos. b) No, devido degenerao do cdigo gentico, um aminocido pode ser codicado por mais do que uma trinca de nucletdeos. 276.

277. E 278. a) Existem 20 tipos diferentes de aminocidos que podem formar as protenas dos seres vivos. Se duas letras (2 bases nitrogenadas) fossem utilizadas para codicar um aminocido, seria possvel codicar menos aminocidos do que os existentes. Com 3 bases correspondendo a um cdon, possvel formar mais de 20 cdons, sendo, assim, possvel codicar os 20 aminocidos. b) Um aminocido pode ser codicado por mais de um cdon (cdigo gentico degenerado). No entanto, um mesmo cdon no pode codicar mais de um aminocido (cdigo gentico no ambguo). 279. a) Gene um segmento do DNA localizado nos cromossomos. Possui um cdigo qumico representado por seqncia de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases capaz de codicar um

aminocido de uma protena. A seqncia de trincas determinar a seqncia dos aminocidos de um polipeptdeo (protena). b) Mutaes so modicaes na seqncia ou na composio das bases do DNA (gene), que podem causar a produo de uma protena alterada, ou mesmo a no produo da protena. c) A substituio de uma base nitrogenada no DNA pode no causar nenhuma alterao na protena produzida pela clula porque o cdigo gentico degenerado, ou seja, um mesmo aminocido pode ser codicado por diferentes trincas de bases. 280. E 281. O DNA determina a seqncia de aminocidos das molculas de protenas por meio do processo de sntese de RNA de diversos tipos: RNA mensageiro, RNA transportador e RNA ribossmico. Atravs da transcrio do cdigo gentico e da posterior traduo do mesmo, estabelece-se a seqncia de aminocidos que constituiro a molcula protica. 282. B 283. Todas as afirmaes esto corretas. 284. D 287. A 290. A 293. A 294. No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que contm. Assim, a diferenciao dos tecidos resulta principalmente da transcrio de genes diferentes, o que naturalmente produz uma composio de RNAm qualitativamente diferente de tecido para tecido. 295. V, V, V, F, F. 296. a) O processo de transcrio ocorre no ncleo celular e a traduo, nos ribossomos livres no citoplasma ou associados ao ergastoplasma. 285. A 288. D 286. A 289. C

291. V, F, F, V 292. A

b) O nuclolo rico em RNAr, que, associado a protenas, forma os ribossomos. A destruio do nuclolo prejudicaria a formao de ribossomos. 297. a) Sntese de protenas. b) Algumas protenas so distribudas pela clula ou so levadas diretamente para o complexo golgiense, via retculo endoplasmtico. Essa ligao torna o processo mais eciente. c) Mitocndrias e cloroplastos demonstram uma certa independncia em relao clula, possuem capacidade de autoduplicao e sntese de protenas. 298. B a) Nuclolo b) Transcrio c) Polissomo ou polirribossomo d) Transporte de aminocidos e) II (DNA) 300. V, F, F, V 301. B 302. A 303. Procarioto. Note que a transcrio e a traduo esto ocorrendo concomitantemente, mostrando que no h uma compartimentalizao do citoplasma. A ausncia de compartimentos internos caracteriza um ser procarionte. 304. A 305. Como o ARNm pode conter outros cdons AUG, alm do cdon de iniciao, a iniciao da traduo poderia ocorrer em qualquer regio onde houvesse um outro cdon AUG, o que geraria peptdeos truncados ou incompletos. A traduo s inicia onde a sequncia de Shine-Dalgarno e o cdon AUG esto presentes. 306. C 307. C 308. a) 12 uracilas e 10 guaninas. b) Se o RNAm tem 72 nucleotdeos (30 A + 20 C + 12 U + 10 G), ou seja, 24 cdons, o polipeptdeo formado dever ter 24 aminocidos. 309. D 310. Permeabilidade seletiva e composio lipoprotica. 299. A

311. A 312. D 313. A 314. B 315. A 316. D 317. E 318. E 319. D 320. C 321. A 322. D 323. B 324. B 325. B 326. B 327. a) a - fosfolipdios, b - protenas e c - glicoclix b) Modelo I c) Possui canais fisiolgicos e dinmicos que explicam o transporte de substncias atravs da membrana plasmtica. 328. Corretas: 04, 08, 32 329. a) Desmossomos - botes de adeso celular que ocorrem na membrana plasmtica das clulas epiteliais. Microvilosidades - evaginaes em forma de dedo-de-luva, formadas pela membrana plasmtica, que aumentam a capacidade de absoro das clulas que revestem o intestino. b) Clulas intestinais. 330. B 331. A 332. a) Microvilosidades: epitlio intestinal - absoro. b) Clios: epitlio da traquia - remoo de resduos. c) Flagelos: espermatozides - locomoo. d) Pseudpodos: glbulos brancos - fagocitose. 333. B 334. a) O ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA. b) Percurso I: protenas. Percurso II: glicoprotenas. As protenas sintetizadas nos ribossomos ou no retculo endoplasmtico granular (REG) so direcionadas diretamente membrana plasmtica (I), ou so associadas a acares no complexo golgiense, formando glicoprotenas (II), que vo para a membrana plasmtica compor o glicoclix.

335. D 336. C 337. B 338. C 339. E 340. A 341. C 342. A 343. A 344. D 345. E 346. E 347. V, F, F, V 348. D 349. B 350. a) Eliminar o excesso de gua que entra por osmose na clula. b) A gua da lagoa hipotnica em relao ao interior das amebas, fazendo com que elas ganhem gua por osmose. Sem o vacolo pulstil, elas sofrem lise. c) Possivelmente, com a adio de sais, os meios tornaram-se isotnicos, no alterando o volume celular. 351. a) A bananada, devido ao alto teor de acar, constitui um meio hipertnico em relao aos organismos decompositores, fazendo com que eles percam gua por osmose e desidratem. b) Alto teor de sal, como na carneseca e no bacalhau. 352. C 353. A 354. B 355. D 356. 19 (01 + 02 + 16) 357. A 358. O mecanismo citado que mantm uma diferena na concentrao dos ons o transporte ativo, que depende de um bom suprimento de ATP para sua ocorrncia. 359. D 360. C 361. C 362. Situao II. Note que, aps o tempo t, os meios permanecem desiguais, ocorrendo um transporte no sentido de desigualar os meios (contra um gradiente de concentrao), portanto, transporte ativo. Na situao I, os meios caram iguais (a favor de um gradiente de concentrao), transporte passivo. 363. D 364. E 365. a) Transporte ativo: contra um gradiente de concentrao e com gasto de energia. b) Sem a respirao celular cessa a liberao de energia (ATP) e o transporte ativo, fazendo com que os dois meios se igualem por difuso.
245

PV2D-06-BIO-14

366. D 367. B 368. 1 e 2 so verdadeiras. 369. 01, 02 e 04 so corretos. 370. E 371. E 372. D 373. Corretas: 01, 32 e 64. 374. A 375. a) Transporte ativo que ocorre com gasto de energia. b) O retculo endoplasmtico granular (REG) o responsvel pela sntese da poro protica da tireoglobulina. O complexo golgiense realiza a associao das partes protica e glicdica na formao da tireoglobulina iodada. 376. A 377. D 378. A 379. a) Em 2, meio hipertnico, a clula perde gua por osmose, tornando-se plasmolisada. b) Em 3, meio isotnico como na situao 1 e hipotnico em relao a 2, faz com que a clula ganhe gua por osmose, voltando ao volume inicial (deplasmlise). 380. E 381. B 382. E 383. C 384. C 385. a) I = soluo hipertnica II = soluo isotnica b) Houve perda de gua da clula por osmose com retrao da membrana plasmtica. 386. B 387. a) 0,7 atm b) Meio hipotnico, pois ocorre ganho de gua pela clula. c) At o momento em que PO = PT e, portanto, DPD = O. d) Trgida. 388. D 389. D 390. a) Em meio hipotnico(gua destilada), as clulas tendem a ganhar gua. Os paramcios eliminam o excesso de gua atravs de seu vacolo pulstil. b) Em clulas vegetais, a parede celular permite uma maior resistncia, evitando o rompimento. O tubo ficou avermelhado aps a ruptura das hemcias
246

devido hemoglobina que se difundiu. 391. E 393. a) A = Trgida B = Plasmolisada b) DPD = PO PT Na turgescncia, PT = PO = 12 atm, portanto DPD = 0 c) A parede celular 394. Na primeira situao, ocorre plasmlise da clula (perda de gua), pois esta se encontra em meio hipertnico. Na segunda situao, ocorre turgescncia (ganho de gua pela clula), pois a clula encontra-se em meio hipotnico. 395. E 396. a) O transporte celular a osmose, um tipo de transporte passivo. b) A osmose ocorre quando h duas solues de diferentes concentraes, separadas por uma membrana semipermevel. c) Nas duas solues, a diferena de comportamento das clulas devese presena de uma parede celular nas clulas vegetais e a sua ausncia nas clulas animais. Em meio hipotnico (gua destilada), ocorre entrada de gua nas duas clulas, causando o rompimento da membrana plasmtica nas hemcias (hemlise), mas no nas clulas vegetais, pois a parede celular impede o rompimento. J no meio hipertnico (soluo salina), h perda de gua nas duas clulas, com reduo do contedo citoplasmtico; porm, na clula vegetal, a membrana plasmtica ca aderida em alguns pontos na parede celular. 397. 392. B

b) A segunda protena na situao descrita. O Na+ acumulado no meio extracelular pode entrar na clula a favor do gradiente de concentrao (difuso). 398. Corretos: 02 e 16. 399. D 402. D 405. a) A estrutura nmero 1 o retculo endoplasmtico granular, local onde ocorre a sntese de protenas. b) As estruturas nmeros 2 e 3 so respectivamente complexo golgiense e vesculas de secreo. c) Mediante um estmulo adequado, as vesculas de secreo presentes no citoplasma da clula secretora, lanam seu contedo no meio extracelular. 406. C 409. D 412. E 407. B 410. B 413. D 408. B 411. B 414. B 400. B 403. B 401. A 404. E

415. C 416. B 417. a) As estruturas indicadas pelas setas so: A. Retculo endoplasmtico granular: transporte, amazenamento e sntese de protenas. B. Mitocndrias: produo de ATP atravs da respirao celular. C. Complexo golgiense: armazenamento e secreo celular. b) A C D. As enzimas (que so protenas) componentes do suco pancretico so sintetizadas no retculo endoplasmtico granular (A), transferidas para o sistema golgiense (C), que as eliminam na forma de vesculas de secreo (D). 418.

a) A parede celular permite uma a) Frasco I maior resistncia membrana b) A sntese de protenas e a secreplasmtica, atuando no equilbrio o celular podem ser resumidas osmtico da clula, evitando a em etapas: entrada excessiva de gua. Etapa 1 Incorporao dos Nesse mecanismo, o momento aminocidos radioem que a presso osmtica (PO) ativos e sntese de se iguala presso de turgescnprotenas no retcucia (PT), atinge-se um equilbrio lo endoplasmtico osmtico, onde DPD = 0. granular

Etapa 2 Transformao e empacotamento da substncia no complexo golgiense. Etapa 3 Formao das vesculas de secreo. 419. F, F, V, V, F 420. O aminocido radioativo localiza-se inicialmente no retculo endoplasmtico granular, onde ser utilizado na sntese de uma protena. As protenas sintetizadas so enviadas ao complexo golgiense, que as empacotam em vesculas de secreo. 421. E 422. a) 1. Acrossomo: contm enzimas que sero necessrias para a penetrao do espermatozide no vulo. 2. Ncleo: contm material gentico necessrio ao desenvolvimento do embrio e, futuramente, do adulto. 3. Mitocndrias: liberam a energia (ATP) necessria para a locomoo do espermatozide. 4. Flagelo: responsvel pela movimentao do espermatozide, contribuindo para seu deslocamento em direo ao vulo. b) 1. Acrossomo: complexo golgiense. 4. Flagelo: centrolo. 423. a) 1. complexo golgiense - acrossomo 2. mitocndria b) O acrossomo formado a partir do complexo golgiense e contm enzimas especcas necessrias fecundao. As mitocndrias fornecem energia para o deslocamento dos espermatozides. 424. a) A estrutura A o retculo endoplasmtico granular, responsvel pela sntese de protenas na clula. Para a sntese de protenas so utilizados aminocidos como matria-prima, o que explica a sua alta concentrao inicial nessa regio. b) As protenas sintetizadas so transferidas para a estrutura B,

o complexo golgiense, onde so processadas e concentradas em vesculas de secreo, que colocam as protenas para fora da clula. 425. Corretas: 02, 04, 08 e 32. 426. A 427. C 428. C 429. Fagocitose: captura de partculas slidas atravs de emisso de pseudpodes. Pinocitose: captura de gotculas de lquidos ou partculas slidas muito pequenas atravs de invaginaes da membrana. 430. C 431. C 432. C 433. Corretos:1, 3 e 4. 434. O esquema representa o processo de digesto intracelular. O retculo endoplasmtico granular (I) responsvel pela sntese das enzimas digestivas. Essas so transportadas at o complexo golgiense (II), que as empacotam formando os lisossomos (IV). Na digesto heterofgica, as partculas so ingeridas por fagocitose ou pinocitose (A), formando os vacolos alimentares (III). Esses vacolos unidos aos lisossomos, formam os vacolos digestivos, onde ocorre a digesto e o aproveitamento das substncias (B). Os resduos so eliminados por clasmocitose (C). 435. A 436. E 437. C 438. A 439. B 440. a) O complexo golgiense est envolvido com a formao dos lisossomos. b) Realizar a digesto intracelular. c) As mitocndrias liberam a energia (ATP) para as atividades da clula. 441. a) Os lisossomos so bolsas membranosas repletas de enzimas digestivas que participam da digesto intracelular e na reciclagem de componentes celulares inativos. b) As enzimas presentes nos lisossomos so sintetizadas a partir de uma informao gentica (DNA). Uma alterao nessa informao pode ser transmitida

de pai para lho, caracterizando a doena como hereditria. 442. C 443. Esto corretas as proposies 01, 04, 08 e 32. 444. B 445. a) As substncias fagocitadas pelas clulas sofrero ao das enzimas dos lisossomos no ciclo da digesto intracelular. Inicialmente forma-se o vacolo alimentar, que se funde com o lisossomo originando o vacolo digestivo. Ocorre a ao das enzimas e a absoro do que pode ser aproveitado pela clula. b) As estruturas celulares em degenerao sofrem ao das enzimas do lisossomo quando formado o vacolo autofgico (lisossomo + estrutura celular). 446. B 447. A 448. D 449. B 450. C 451. A 452. a) O lisossomo exerce a funo de digesto intracelular. b) A fagocitose outro processo de internalizao de substncias. Na fagocitose, ocorre o englobamento de partculas slidas, atravs de evaginaes da membrana plasmtica (emisso de pseudpodes). Na pinocitose, ocorre a captura de pequenas gotculas atravs de invaginaes da membrana plasmtica. c) O colesterol constituinte de hormnios esterides, sais biliares e membrana plasmtica animal. 453. C 454. E 455. a) 1. Cloroplasto 2. Mitocndria b) Os cloroplastos so responsveis, atravs da fotossntese, pela produo de glicose e oxignio, substratos essenciais para a respirao aerbica que ocorre nas mitocndrias. As mitocndrias, por sua vez, so responsveis pela liberao de CO2 e H2O, produtos da respirao aerbica, importantes reagentes da fotossntese.
247

PV2D-06-BIO-14

456. E 457. A 458. Fotossntese: Glicose + O2 Respirao aerbia: CO2 + H2O + ATP 459. B 460. B 461. B 462. A 463. E 464. B 465. a) Cloroplastos = fotossntese Mitocndrias = respirao aerbica b) Os produtos da fotossntese so reagentes para a respirao aerbica e vice-versa. 6 CO2 + 6 H2O C6H12O6 + 6 O2 (fotossntese) C6H12O6 + 6 O2 6 CO2 + 6 H2O (respirao aerbica) 466. A energia qumica da gasolina ou do lcool, armazenada nas molculas orgnicas, vem primariamente da transformao da energia solar no processo de fotossntese. 467. A 468. 19 (01 + 02 + 16) 469. C 470.
Fotossntese Amido CO2 O2 Cloroplastos Respirao aerbica ATP O2 CO2 Mitocndrias Clulas de organismos aerbicos eucariontes

Cloroladas

471. Os ratos do grupo A, em que estava presente a planta verde, sobreviveram por mais tempo. A planta, em ambiente iluminado, realiza o processo de fotossntese, disponibilizando oxignio para os ratos. Os ratos do grupo B, onde no havia a planta, morreram porque consumiram todo o oxignio do ambiente, no havendo reposio. 472. E 475. E 476. E 479. E
248

482. B 483. O processo biolgico a fermentao alcolica, que utilizada pela indstria na produo de lcool combustvel, cervejas, vinhos e tambm na produo de pes. 484. C 485. A 486. C 487. E 488. D 489. a) cido ltico b) Durante a realizao de esforo muscular intenso, h dbito de O 2 no msculo, ocorrendo a fermentao ltica. Neste processo a glicose convertida em cido pirvico e, em seguida, transformada em cido ltico. 490. B 491. E 492. a) Fermentao b) A fermentao um processo de obteno de energia. c) Pode ocorrer a fadiga muscular, com produo de cido ltico 493. A 494. C 495. B 496. A 497. C 498. A 499. 12 (04 + 08) 500. a) Ausncia de O2 fermentao; presena de O2 respirao aerbica b) Na presena de O2, as leveduras produziro maior quantidade de energia por meio da respirao aerbica, com maior nmero de reaes metablicas. Na ausncia de O2, a produo de energia menor, ocorrendo menor nmero de reaes metablicas. 501. A bexiga do tubo colocado na estufa ir acumular mais CO2 do que a do tubo colocado na geladeira, porque o processo bioqumico envolvido, a fermentao alcolica, depende de enzimas cuja atividade mais intensa a 30 C do que em temperaturas menores. 502. D 503. C 504. Sem atividade mitocondrial, a linhagem petit incapaz de realizar respirao celular, obtendo ATP (energia) atravs da fermentao. Como a fermentao gera um menor saldo

de ATP do que a respirao celular, o crescimento desta linhagem mais lento e no inuenciado pela concentrao de O2. 505. A produo de vinho um processo fermentativo; assim sendo, ocorre sem oxignio. As leveduras que realizam a fermentao, sendo anaerbicas facultativas, para realizar a fermentao, precisam estar em um ambiente sem O2; caso contrrio, param de realizar fermentao e realizam respirao aerbica, cujos produtos nais so CO2 e H2O. 506. B 507. Oxidao de compostos orgnicos para a liberao de energia necessria s atividades celulares. Ocorre nas mitocndrias. 508. B 511. B 509. C 512. E 510. A 513. C

514. A 515. C 516. A 517. a) A etapa representada a gliclise. Note que C6H12O6 (glicose) gera C3H4O3 (cido pirvico). b) A gliclise ocorre no hialoplasma da clula. c) A gliclise corresponde ao incio do processo de respirao aerbica, no qual a glicose quebrada, gerando dois cidos pirvicos. Essa etapa inicial tambm ocorre na fermentao. d) No. O oxignio participa no nal do processo aerbico como aceptor nal de hidrognios. e) So produzidas nesse processo 4 molculas de ATP, em que 2 delas so consumidas, resultando um saldo positivo de 2 molculas. 518. A 521. B 522. 51 (01 + 02 + 16 + 32) 523. a) Mitocndria. b) Ligao entre fosfatos. c) Respirao celular, em que ocorre a fosforilao oxidativa, e fotossntese, em que se observa a fotofosforilao. 519. D 520. F, F, V, V, F

473. B 477. C 480. D

474. D 478. D 481. B

524. A 525. Corretas: 01 e 02. 526. C 527. a) O acar fonte de energia para o metabolismo. b) Em condies aerbicas, existir mais energia disponvel para a levedura, pois estar ocorrendo a respirao, que produz mais ATP (38) em oposio fermentao (2 ATP), que ocorre em condies anaerbicas. 528. Nas nossas clulas, a degradao da glicose, por respirao aerbica, completa e, por isso, no se formam fragmentos orgnicos como o metanol. 529. O cianeto liga-se fortemente com as molculas transportadoras de eltrons da cadeia respiratria, impedindo o uxo de eltrons. Isso provoca reduo na liberao de energia. 530. 91 (01 + 02 + 08 + 16 + 64) 531. D 532. 09 (01 + 08) 533. D 534. C 535. C 536. A 537. C 538. C 539. E 540. B 541. B 542. C 543. V, V, F, F 544. D 545. C 546. D 547. C 548. Todas esto corretas. 549. O cianeto atua como um inibidor da cadeia respiratria, cessando a produo do ATP. Na ausncia de ATP, o transporte ativo que mantinha a diferena de concentrao cessa. A concentrao dos ons se iguala por difuso. 550. E 551. D 552. D 553. A frao A corresponde s mitocndrias, pois foram produzidos 38 ATPs e houve consumo maior de O2, o que caracterstico da respirao aerbica que ocorre nessas organelas. 554. C 555. C 556. a) No interior das mitocndrias. b) Bloqueio na produo de ATP por interrupo no uxo de eltrons na cadeia respiratria.

c) Asxia e envenenamento por cianeto. d) Os citocromos das cadeias respiratrias cam saturados de eltrons e cessa a produo de ATP (asxia celular). e) NAD e FAD so transportadores de hidrognio. O oxignio o aceptor nal de hidrognios na cadeia respiratria. 557. A 558. B 559. B 560. B 561. B 562. B 563. D 564. a) Respirao durante o dia e noite, fotossntese durante o perodo iluminado do dia. b) Glicose e oxignio na respirao; gs carbnico e gua na fotossntese. c) Gs carbnico e gua na respirao e oxignio e glicose na fotossntese. 565. A 566. A 567. D 568. A 569. B 570. B 571. E 572. B 573. B 574. D 575. C 576. Plantas com folhas vermelhas possuem clorola e pigmentos acessrios, como a eritrola. Realizam normalmente a fotossntese. O pigmento vermelho mascara a clorola verde. 577. C 578. D 579. a) A alga realiza fotossntese, libera o gs oxignio, que atrai as bactrias aerbicas. b) Pela anlise do grco, observase maior taxa de fotossntese na faixa do espectro da luz correspondente ao azul, em relao s outras cores. 580. a) As bactrias acumulam-se nas reas em que a clula recebe luz azul e luz vermelha; so os comprimentos de onda melhor aproveitados pela clorola, liberando, portanto, maior quantidade de O2. b) A fotossntese seria homognea ao longo da alga, levando a uma distribuio uniforme das bactrias. 581. O pigmento clorola da planta absorve mais luz azul do que luz verde. Assim, ocorre mais fotossntese e,

conseqentemente, maior liberao de oxignio. Com maior quantidade de oxignio o animal pode liberar, pela respirao aerbica, mais energia para a sua atividade. 582. a) Fotossntese. b) Cloroplastos, clorofilas, CO 2, H2O, enzimas. c) 6 CO2 + 12 H2O C6H12O6 + 6 H2O + 6 O2 A fotossntese pode ser considerada um fenmeno inverso respirao aerbica. d) Nas sulfobactrias a substncia doadora de hidrognio o H2S, em vez da H2O. e) A ecincia do processo fotossinttico maior se o vegetal for iluminado com luz azul. Neste comprimento de onda ocorre maior converso de energia luminosa em energia qumica pelas clorolas envolvidas no processo. 583. D 584. a) As mitocndrias fornecem energia para o metabolismo celular, e as clulas fornecem um meio favorvel para o funcionamento das mitocndrias, como gua e oxignio utilizando compostos orgnicos. b) Os cloroplastos realizam fotossntese, processo que proporciona diversas vantagens ao meio ambiente, como: produo de matria orgnica, usada nas cadeias alimentares; liberao de oxignio para a atmosfera, empregado em processos de respirao aerbica; absoro de gs carbnico, contribuindo para a reduo do efeito estufa. 585. D 586. E 587. B 588. C 589. a) Verdadeira b) Acima do PCF a fotossntese maior do que a respirao, sobrando substncias orgnicas que podem ser utilizadas no seu desenvolvimento (crescimento). 590. C 591. D 592. D 593. D 594. C 595. D
249

PV2D-06-BIO-14

596. Ponto x = ponto em que a velocidade da fotossntese igual da respirao. Para que isso ocorra, necessria uma intensidade luminosa I, chamada de ponto de compensao ftico (PCF). rea A VF < VR (abaixo do ponto de compensao). O vegetal consome mais glicose e O2 do que produz. rea B VF > VR (acima do ponto de compensao). O vegetal produz mais glicose e O2 do que consome. 597. D 598. E 599. D 600. A. A planta est no escuro, realizando somente repirao aerbica; por isso, consome O2 do ambiente. B. A planta est iluminada de acordo com o ponto de compensao ftico; como a taxa de fotossntese igual de repirao, o saldo de liberao de O2 zero. C. A planta, intensamente iluminada, tem taxa de fotossntese maior que a de respirao, liberando O2 para o ambiente. 601.

611. a) Segundo os dados fornecidos pelo grco, o aumento da temperatura para 23 C benecia a espcie B, ao mesmo tempo que prejudica a espcie A. b) O gs carbnico matria-prima utilizada pelo vegetal para sintetizar matria orgnica atravs da fotossntese. c) Agua essencial para o crescimento e desenvolvimento dos vegetais, pois est envolvida na fotossntese, respirao celular, atividade enzimtica, transporte de substncias, regulao trmica etc. 612. a) Tubo 3 trecho C do grco. Fotossntese maior do que a respirao, ocorrendo maior consumo de CO2, tornando o meio bsico. b) No ponto B ocorre equilbrio entre a respirao e a fotossntese da planta. Para que isso ocorra, necessria uma intensidade luminosa chamada ponto de compensao ftico. c) Intensidade III. Ocorre maior liberao de CO2, que reage com a gua, formando cido carbnico, tornando o meio cido. Para que isso ocorra, a taxa de respirao maior do que a fotossntese, obrigando a planta a consumir suas reservas. d) Floresta Amaznica uma comunidade clmax, estando prxima de B e da intensidade II. Quase tudo que produzido pela oresta consumido por ela mesma, apresentando produtividade lquida baixa. 613. B 616. E 619. A 622. B 625. C 628. a) gua. b) c) utilizado na respirao celular aerbica e o excedente eliminado pelo vegetal. 614. D 617. C 620. B 623. A 626. D 615. D 618. D 621. B 624. A 627. A

d) Absoro de energia luminosa. 629. a) O istopo 18 O aparecer na glicose, pois o CO2 a matriaprima para a produo desta substncia. b) Observa-se o istopo no oxignio liberado pela alga, j que todo o oxignio produzido na fotossntese derivado da gua. 630. A equao apresentada poderia representar a fotossntese das plantas, bastando para tal substituir o tomo de enxofre pelo tomo de oxignio. Ento, por analogia, o oxignio gerado pelas plantas seria cedido pela gua. 631. D 634. E 632. A 635. C 633. A 636. A

602. D

603. E

604. E

605. Corretas: 0 e 1. 606. F, F, V, V, V, F, F 607. Corretas: 01, 02, 04 e 08 608. E 610. a) No tubo A. A maior proximidade da fonte luminosa intensica o processo fotossinttico. Nessa situao h um maior consumo de CO2 da soluo, resultando uma colorao arroxeada (pH alcalino). b) No tubo B, a maior distncia da fonte luminosa diminui o processo fotossinttico. A respirao se torna superior, liberando CO2. Dessa forma, gera-se gs carbnico, acidicando o meio, tornando-o amarelo.
250

609. B

637. A 638. a) Qumica b) Fotoqumica c) Fotoqumica d) Fotoqumica: reagentes: H2O, NADP e ADP + P produtos: NADPH2, O2 e ATP Qumica: reagentes: CO2, NADPH2 e ATP produtos: CH2, NADP e ADP + P 639. B 640. A 641. A 642. A 643. A 644. D 645. 1. luz; 2. H2O; 3. O2; 4. NADP; 5. NADPH2; 6. ADP + P; 7. ATP; 8. CO2; 9. H2O; 10. glicose. 646. D 647. E 648. A 649. A 650. C 651. A 652. A 653. B 654. D 655. Na 1 etapa ocorreu apenas a fase luminosa da fotossntese, quando so produzidos ATP e NADPH 2 necessrios xao do CO2 em glicose. Na ausncia do CO 2 o ATP e o NADPH2 acumularam-se e foram utilizados no incio da 2 etapa, aps a adio de 14CO2. Como o ATP e o NADPH2 no so sintetizados pelo cloroplasto, na ausncia de luz, observou-se posterior decrscimo na velocidade de xao do 14CO2.

PV2D-06-BIO-14

656. A 657. A 658. Corretas: 0, 3 e 4. 659. Corretas: 01, 02, 04 e 08 660. 59 (01 + 02 + 08 + 16 + 32) 661. E 662. D 663. F, V, V, F e V 664. B 665. C 666. D 667. A 668. Os termos cromossomo e cromatina referem-se ao material gentico, ou seja, aos lamentos formados por DNA e protenas que ocorrem no ncleo. Designa-se como cromossomo o lamento duplicado e condensado que pode ser observado durante o processo de diviso celular. Cromatina o conjunto de lamentos descondensados no ncleo da clula que no est se dividindo, em intrfase. 669. No, porque as hemcias humanas no possuem ncleo. 670. D 671. A 672. C 673. B 674. D 675. C 676. E 677. D 678. B 679. C 680. D 681. C 682. 11 (01 + 02 + 08) 683. B 684. O indivduo apresentar as caractersticas da espcie A, pois o ncleo que comanda as atividades celulares e a hereditariedade. 685. Corretas: 04, 08 e 16 686. F, F, F, F, F 687. 06 (02 + 04) 688. a) Os mecanismos de regenerao esto sob o comando do material gentico, presente no ncleo da clula, que comanda a sntese de protenas. Assim, na Acetabularia, apenas o fragmento que contm o ncleo tem capacidade de regenerao. b) A planria pluricelular. Os fragmentos do animal apresentam clulas nucleadas, dotadas de capacidade de diviso e diferenciao. Isso permite que cada parte possa gerar um novo indivduo. 689. A 690. B 691. E 692. B 693. B 694. D 695. A 696. D 697. D 698. C

699. As clulas muscular, nervosa e ovo ou zigoto so somticas, portanto possuem 2n = 46 cromossomos. Os espermatozides so gametas, portanto possuem n = 23 cromossomos. 700. C 701. A 702. D 703. E 704. E 705. A 706. a) Acrocntrico, pois apresenta centrmero bem prximo regio terminal (subterminal). b) A. satlite ou zona SAT e B. brao do cromossomo. 707. C 708. C 709. A 710. C 711. Rainha (2n) = 32 cromossomos Operria (2n) = 32 cromossomos Zango (n) = 16 cromossomos O zango se desenvolve por partenognese, sendo, portanto, haplide. 712. B 713. Os espermatozides, por serem gametas, formaram-se pelo processo de meiose que reduz pela metade a quantidade de DNA da clula inicial. 714. Corretas: 1, 2 e 3 715. So corretos: 02 e 08. 716. No. A intrfase um perodo em que a clula est se preparando para sofrer a diviso celular, sintetizando RNA e protenas, duplicando o DNA e aumentando o volume do citoplasma com intensa atividade metablica. 717. E 718. A 719. C 720. A 721. D 722. E 723. D 724. E 725. A 726. D 727. A 728. C 729. C 730. a) Intrfase (perodo S). b) So as fases da mitose. c) 1 cromossomo duplicado, pois o material gentico apresenta-se constitudo por duas cromtidesirms. 731. D 732. C 733. B 734. D 735. a) Sempre X para cada clula-lha originada. Se considerarmos o total de clulas geradas nas trs divises temos: 2X, 4X e 8X.

b) 2X. Antes da mitose, ainda na intrfase, o material gentico se duplica (perodo S), passando a apresentar o dobro do inicial. 736. G1 11 horas, S 10 horas, G2 2 horas e mitose 1 hora 737. B 738. B 739. D 740. C 741. B 742. B 743. C 744. E 745. C 746. E 747. B 748. D 749. Anfase, telfase, prfase e metfase. 750. a) Mitose b) 4 c) 8 d) As duas clulas so diplides (2n = 4), pois, na diviso de mitose, a ploidia da clula mantida constante. 751. A diviso mittica apresenta eventos marcantes responsveis pelas alteraes ocorridas nas clulas. Um dos eventos da mitose, a telfase, caracterizado pela separao dos ncleos resultantes do processo atravs do estrangulamento do citoplasma (citocinese). Nas clulas do tecido heptico no ocorreu a citocinese, caracterizando uma diviso incompleta, originando clulas binucleadas. 752. C 753. A 754. D 755. D 756. D 757. B 758. B 759. E 760. B 761. E 762. B 763. a) A duplicao do DNA ocorre no perodo S da intrfase indicada por A. b) A. intrfase B. prfase C. metfase D. anfase E. telfase 764. Corretas: 1, 3 e 4. 765. Corretas 0, 1, 3 e 4. 766. a) As clulas 3 e 4. Note que aparentemente no h evidncias da diviso celular. A cromatina ainda se encontra descondensada.
251

b) A clula 8. A clula 5 representa a anfase. Na clula 8, h formao da lamela mdia e reaparecimento da carioteca, caracterizando a telfase. c) A clula 6. Note que j houve a separao das cromtides irms. d) A clula 8. Final da telfase. Reaparecimento da carioteca e citocinese. 767. a) At a metfase. A colchicina impede a formao das bras do fuso, impedindo a separao das cromtides irms na anfase. a) O dobro do inicial. Sem a separao das cromtides irms e a citocinese, todos os cromossomos irmos caro na mesma clula, duplicando o nmero de cromossomos. 768. B 769. a) Por serem clulas sexuais, os espermatozides resultam de diviso meitica, portanto, 18 cromossomos apenas, o que corresponde ao nmero haplide, presente neste tipo de clula. b) Protenas e DNA so as principais substncias formadoras dos cromossomos. c) O nmero de cromtides pode ser calculado como segue. Nmero diplide x 2 (cromtides). Ou seja, 36 x 2 = 72 cromtides. As clulas em metfase mittica apresentam cada cromossomo com duas cromtides. d) O nmero mnimo de cromossomos que contm um representante de cada par homlogo 18, ou seja, s ser possvel identicar todos os genes desse organismo se a seqncia de pelo menos um dos homlogos de cada par for denticada. 770. O fumo apresenta em sua composio diversas substncias cancergenas que podem provocar, nas clulas dos pulmes, mutaes que alteram os genes reguladores da diviso celular. Isso pode acarretar em uma proliferao celular descontrolada, gerando um tumor maligno (cncer).
252

771. D 774. B 777.

772. D 775. E

773. A 776. E

809. A 810. a) Clula animal porque apresenta centrolos e ster. b) Anfase II. c) 3. d) 6. 811. a) Meiose. Em 1 ocorre a separao dos cromossomos homlogos, em 2 ocorre crossing over, caractersticos da meiose. b) 2 (Prfase I) 3 (metfase I) 1 (anfase I) 4 (anfase II). c) 1 e 2. 1 Segregao independente dos cromossomos homlogos. 2 Crossing over 812.

a) Em animais, a meiose ocorre nas clulas germinativas das gnadas (testculos e ovrios). Nos vegetais, a diviso reducional ocorre nas clulas-me de esporos. b) Crossing-over e segregao independentedoscromossomoshomlogosso eventosmeiticosqueacarretamemum aumento da variabilidade gentica. 778. A 779. a) Meiose, na prfase I. b) Produz variaes na descendncia, pois se trata de uma recombinao gnica ou crossing-over. 780. a) a. duplicao do contedo cromossmico. b. crossing-over. c. anfase I b) Nos animais nas clulas germinativas, nos vegetais na formao de esporos. c) Acarreta em um aumento da variabilidade gentica dos seres vivos. 781. B 784. E 787. D 790. B 793. E 794. a) Pareamento (sinapse) dos cromossomos homlogos. b) Clulas produzidas por mitose so 2n (diplides), enquanto as que so resultantes da meiose so n (haplides). 795. B 798. C 801. D 804. E 807. B 808. 796. A 799. D 802. C 805. C 797. C 800. E 803. D 806. A 782. C 785. C 788. B 791. D 783. B 786. E 789. A 792. A

813. C 814. Corretas: 2, 3, 4 815. B 816. F, V, V, F, V, F, V 817. a)


Ocorrncia Mitose Meiose qualquer clula clulas germinativas Quantidade de DNA nas clulas-lhas idntica clula-me metade da clula-me Recombinao gentica no ocorre crossing-over

b) Prfase I, Metfase I, Anfase I, Telfase I, Prfase II, Metfase II, Anfase II e Telfase II. 818. E 821. Clula A: meiose prfase I Clula B: mitose prfase 822. D 823. F, F, V, F, V. 824. a) Meiose I Anfase I, pois est representando a separao de cromossomos homlogos. 819. A 820. C

b) Mitose e meiose II Anfase e Anfase II, pois est representando a separao das cromtides-irms. 825. C 828. E 831. A 834. a) O esquema mostra a separao dos pares de cromossomos homlogos, que caracterstica da anfase I da meiose. b) 826. B 829. E 832. C 827. D 830. D 833. B

835. C 837.

836. D

a) A: metfase da mitose, pois os quatro cromossomos duplicados e no pareados encontram-se na regio equatorial da clula. B: metfase II da meiose, pois apenas dois cromossomos duplicados e no pareados encontram-se na regio equatorial da clula. C: metfase I da meiose, pois os quatro cromossomos duplicados e pareados 2 a 2 encontram-se na regio equatorial da clula. b) A estrutura indicada pela seta na gura D o centrmero, regio onde se prendem as bras do fuso, pelas quais os cromossomos deslocam-se para plos opostos durante a anfase. 838. A 839. 31 (01 + 02 + 04 + 08 + 16) 840. Corretas: 04 e 08 841. 09 (01 + 08) 842. 75 (01 + 02 + 08 + 64)

PV2D-06-BIO-14

253

254

PV2D-06-BIO-14

255

256