Você está na página 1de 42

LISTO DE EXERCICIOS - GENETICA MOLECULAR CURSO DE BIOLOGIA - EDILSON SOARES

TEXTO PARA A PRXIMA QUESTO (Ufpe 96) Na(s) questo(es) a seguir escreva nos parnteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. 1. As proposies a seguir so relativas ao processo de sntese de protenas nas clulas vivas. ( ) A molcula de DNA transcreve no ncleo uma molcula de RNA mensageiro (RNAm) com vrias seqncias de trs bases - os cdons. ( ) Cada cdon do RNA mensageiro determinar a colocao de um aminocido especfico na cadeia polipeptdica. ( ) No local onde houver um ribossomo, pequenas molculas de RNA transportador (RNAt), ligadas a aminocidos, unem-se ao RNAm por uma seqncia de trs bases - o anticdon. ( ) O processo de sntese de protenas ao nvel do citoplasma tambm conhecido como transcrio gentica. ( ) Os diversos aminocidos unem-se atravs de ligaes do tipo ster, dando formao, ao final da leitura do RNAm, a uma protena funcional. TEXTO PARA A PRXIMA QUESTO (Ufrn 2002) Professor Astrogildo combinou com seus alunos visitar uma regio onde ocorria extrao de minrio a cu aberto, com a inteno de mostrar os efeitos ambientais produzidos por aquela atividade. Durante o trajeto, professor Astrogildo ia propondo desafios a partir das situaes do dia-a-dia vivenciadas ao longo do passeio. Algumas das questes propostas por professor Astrogildo esto apresentadas a seguir para que voc responda. 2. Aproveitando a pergunta de Zeca, o professor esquematizou o processo de sntese protica, em que os nmeros I, II, III e IV representam molculas de cidos nuclicos.

A partir do esquema, correto afirmar quea) I corresponde ao RNA que contm o cdigo gentico determinando a seqncia de aminocidos da protena.b) II corresponde ao RNA que catalisa a unio do I com o III, durante o processo de transcrio.c) III corresponde ao RNA que contm o anticdon complementar ao cdon existente em I.d) IV corresponde ao RNA que catalisa a ligao dos nucleotdeos com a desoxirribose. 3. (Unicamp 96) Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso.

4. (Ufpi 2003)

Analisando o desenho esquemtico que representa o ncleo de uma clula animal qualquer, podemos identificar que o componente responsvel pela sntese de RNA que forma o ribossomo assinalado pelo nmero:a) 1b) 2c) 3d) 4e) 5 5. (Puccamp 93) "Captura aminocidos que se encontram dissolvidos no citoplasma e carrega-os ao local da sntese de protenas".Essa funo desempenhada peloa) RNA mensageiro.b) RNA transportador.c) RNA ribossmico.d) ribossomo.e) DNA. 6. (Puccamp 99) Clulas vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram fixadas e submetidas autoradiografia, para comprovar os locais que possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa SOMENTE nosa) nuclolos.b) ribossomos.c) nuclolos e nas mitocndrias.d) ribossomos e nos cloroplastos.e) ribossomos, nos cloroplastos e nas mitocndrias. 7. (Ufpr 2004) Analisando a figura adiante, que representa um caritipo humano, correto afirmar que se trata do caritipo de um indivduo:

(01) (02) (04) (08) (16) (32) (64)

Do sexo masculino. Do sexo feminino. Com Sndrome de Down. Com Sndrome de Patau. Ccom Sndrome de Edwards. Com caritipo normal. Com uma anomalia numrica de autossomos. )

Soma (

8. (G2) As evidncias de que o DNA a substncia hereditria que determina as caractersticas dos seres vivos foram primeiramente observadas ema) vrus.b) protozorios.c) caros.d) liquens.e) bactrias.

9. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo fsforo radioativo (P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos bacterifagos formados estavam marcados radioativamente. Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas cultivadas sem a presena de fsforo radioativo. A marcao radioativa foi detectada dentro destas bactrias. a) Como se explica que o fsforo radioativo tenha passado para o bacterifago? b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham sido marcadas? c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (S) para marcao de protenas, os resultados seriam os mesmos? Justifique. 10. (Puccamp 98) O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacterifagos.

De acordo com o esquema, verifica-se quea) ocorre lise da bactria no fim do ciclo.b) o DNA viral se incorpora ao cromossomo bacteriano.c) o DNA viral destrudo pela bactria.d) as bactrias perdem a capacidade de se dividir.e) h grande multiplicao do DNA viral no interior da bactria. 11. (G2) Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e ribonuclico (RNA) pode-se afirmar quea) timina uma base nitrogenada exclusiva do RNA.b) uracila uma base nitrogenada exclusiva do DNA.c) ribose um acar que entra na composio qumica do RNA.d) cido fosfrico s entra na composio qumica do DNA.e) timina pareia com adenina no RNA. 12. (G2) Mencione duas diferenas de natureza molecular entre o DNA e o RNA. 13. (G2) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? 14. (G2) O DNA e o RNA quanto sua estrutura qumica, so classificados comoa) polipeptdeos.b) nucleoprotenas.c) polissacardeos.d) fosfatdeos.e) polinucleotdeos. 15. (G2) Os cidos nuclicos so macromolculas definidas como polinucleotdeos. a) Represente um nucleotdeo apontando seus trs constituintes moleculares. b) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? 16. (G2) Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e ribonuclico (RNA) NO se pode afirmar quea) timina uma base nitrogenada exclusiva do DNA.b) uracila uma base nitrogenada exclusiva do DNA.c) ribose um acar que entra na composio qumica do RNA.d) cido fosfrico entra na composio qumica do DNA e do RNA.e) timina pareia com adenina no DNA. 17. (Uel 94) Com relao composio qumica, as molculas de DNA e RNA diferem entre si quanto ao tipo dea) acar, apenas.b) base nitrogenada, apenas.c) base nitrogenada e de acar, apenas.d) base nitrogenada e de fosfato, apenas.e) base nitrogenada, de acar e de fosfato. 18. (Fuvest-gv 92) Um pesquisador que pretende estudar comparativamente a sntese de DNA e RNA em uma clula deve usar nucleotdios radiativos contendoa) timina e uracila.b) guanina e timina.c) citosina e guanina.d) adenina e timina.e) citosina e uracila.

19. (Uerj 99) Em clulas eucariotas mantidas em cultura, adicionou-se o nucleosdeo uridina marcado radioativamente com H ao meio de cultura. Aps algum tempo, as clulas foram transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro, fixadas e submetidas a auto-radiografia. Esse processo marca a posio aproximada do istopo dentro da clula, como representado no esquema a seguir.

a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta. b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado fosse a timidina e justifique sua resposta. 20. (Ufsm 2000) Numere a 2 coluna de acordo com a 1COLUNA 11- DNA 2- RNA COLUNA 2( ) dupla hlice( ) ribose( ) fita nica ou simples( ) desoxirribose( ) bases nitrogenadas: adenina, guanina, citosina, timina.( ) bases nitrogenadas: adenina, guanina, citosina, uracilaA seqncia correta a) 1 - 2 - 1 - 2 - 2 - 1.b) 2 - 1 - 1 - 2 - 2 - 2.c) 1 - 2 - 2 - 1 - 1 2.d) 2 - 1 - 2 - 1 - 1 - 2.e) 1 - 1 - 2 - 2 - 2 - 1. 21. (G2) Dada a seqncia de bases nitrogenadas de um segmento de DNA a seguir, responda aos itens adiante. TTT AAT GGG CAT a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 22. (G2) Para funcionar como material gentico o DNA apresenta duas propriedades fundamentais. So elas: I - AUTODUPLICAO II - TRANSCRIO Explique essas duas propriedades 23. (G2) Considere um segmento de DNA com a seguinte seqncia de bases nitrogenadas: ATT CTA CGC AAA GGC a) Quais so as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produo de RNA, qual ser a seqncia de bases desse RNA? 24. (G2) Considere a seqncia de bases nitrogenadas de um segmento de DNA: AAA GGC ATT, responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 25. (Uel 99) Em um segmento de cadeia ativa de DNA h 20 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar h 10 adeninas e 30 guaninas. Com base nesses dados, conclui-se que nos segmentos de RNA originrios desse DNA havera) 30 citosinas.b) 20 timinas.c) 15 guaninas.d) 10 uracilas.e) 10 adeninas.

26. (Ufrj 2001) No ADN, a transcrio dos genes no est restrita a somente uma das suas cadeias. Para alguns genes, a seqncia de nucleotdeos transcrita pode estar em uma cadeia, ao passo que a seqncia do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrio simultnea das duas cadeias de uma molcula de ADN. Tal evento inibiria o processo da traduo. Explique por que ocorreria a inibio da traduo se a transcrio de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrio da sua cadeia complementar, no mesmo trecho. 27. (G2) Que papis desempenham o RNA mensageiro e do RNA transportador no processo de sntese das protenas? 28. (G2) Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUU GUG CCC AACAssinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA.a) AAA CAC GGG TTGb) TTT CAC GGG UUGc) AAA CTC GGG TTGd) TTT GAG GGG TTGe) AAA CAC CCC UUG 29. (G2) Na figura a seguir que representa o modelo da molcula de RNA os nmeros 1, 2 e 3 indicam, respectivamentea) desoxirribose, cido fosfrico e base nitrogenada.b) cido fosfrico, desoxirribose e base nitrogenada.c) ribose, cido fosfrico e base nitrogenada.d) cido fosfrico, ribose e base nitrogenada.e) cido fosfrico, base nitrogenada e desoxirribose.

30. (G2) Observe o esquema adiante e responda:

a) Quais so as molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do cido ribonuclico (RNA). b) Qual o nome dessa unidade estrutural? 31. (G2) Sobre o RNA, INCORRETO afirmar quea) possui a base nitrogenada uracila.b) participa da estrutura dos ribossomos.c) reproduz-se de modo semiconservativo.d) traduzido em protenas nos ribossomos.e) formado de simples cadeia com formato helicoidal. 32. (G2) Qual das seguintes bases nitrogenadas NO entra na composio qumica do RNA?a) Timina.b) Citosina.c) Adenina.d) Uracila.e) Guanina. 33. (G2) Qual das seguintes molculas NO entra na composio qumica do RNA?a) Ribose.b) Desoxirribose.c) cido fosfrico.d) Adenina.e) Guanina. 34. (G2) Uma cadeia de RNA tem 200 nucleotdeos. Quantos nucleotdeos tinha o DNA que originou esse RNA?

35. (G2) Um segmento de RNA mensageiro apresenta a seqncia de bases nitrogenadas a seguir: AAA UUC GGG GAU. a) Quais so as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotdeos existem no DNA que deu origem a essa molcula de RNA mensageiro? 36. (G2) No modelo molecular do cido ribonuclico (RNA) representado adiante, os nmeros 1, 2 e 3 indicam, respectivamente,a) desoxirribose, cido fosfrico e base nitrogenada.b) cido fosfrico, desoxirribose e base nitrogenada.c) ribose, cido fosfrico e base nitrogenada.d) cido fosfrico, ribose e base nitrogenada.e) cido fosfrico, base nitrogenada e desoxirribose.

37. (G2) Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUU GUG CCC AAU.Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA.a) AAA CAC GGG TTAb) TTT CAC GGG UUTc) AAA CTC GGG TTTd) TTT GAG GGG TTAe) AAA CAC CCC UUA 38. (G2) caracterstica do RNA:a) acar com quatro tomos de carbono.b) presena das bases nitrogenadas uracila, guanina, citosina e adenina.c) ausncia de cido fosfrico.d) polipeptdeo.e) ocorre nos lisossomos. 39. (Fei 94) O estudo do mecanismo da sntese de protenas no interior das clulas, confirma que:a) a transcrio gnica caracteriza-se pela autoduplicao do DNAb) trs tipos de RNA participam do processoc) os anticdons localizam-se no RNA-md) os cdons so trincas de bases nitrogenadas do RNA-te) no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado 40. (Puccamp 98) Os itens a seguir referem-se estrutura, composio e funo dos cidos nuclicos.- Estrutura:I. dupla hliceII. cadeia simples- Composio:1. presena de uracila2. presena de timina- Funo:a. sntese de protenasb. transcrio gnicaSo caractersticas do cido ribonuclicoa) I - 1 - ab) I - 2 - bc) II - 1 - ad) II - 1 - be) II - 2 - b 41. (Ufpe 2001) Nos ltimos anos, a biologia molecular tem fornecido ferramentas teis para a produo de plantas e animais transgnicos. As informaes armazenadas nas molculas de DNA so traduzidas em protenas por meio de molculas intermedirias denominadas:a) Proteases.b) Plasmdios.c) rRNA.d) tRNA.e) mRNA. 42. (Ufscar 2001) Um pesquisador, interessado em produzir em tubo de ensaio uma protena, nas mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas de rato, RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e aminocidos ativos de clulas de sapo. A protena produzida teria uma seqncia de aminocidos idntica doa) rato.b) sapo.c) coelho.d) macaco.e) macaco e do rato.

43. (Uerj 2004) A enzima poligalacturonase, que digere a parede celular de clulas vegetais, a principal responsvel pela maturao de frutos como o tomate. Para retardar o amadurecimento e evitar as perdas durante o armazenamento, utilizou-se uma tcnica na qual o gene que codifica a enzima citada foi inserido, de maneira invertida, no genoma de um tomateiro. O esquema adiante mostra os produtos da transcrio do gene normal da enzima e do gene inserido, ambos ativos nesse tomate geneticamente modificado.

a) Descreva a interao que ocorre entre os produtos da transcrio dos genes normal e inserido no tomate geneticamente modificado e indique a caracterstica dessas molculas que permite a interao. b) Explique por que haver um aumento no tempo de amadurecimento desse tomate geneticamente modificado. 44. (Fuvest 94) Um gene de bactria com 600 pares de bases nitrogenadas produzir uma cadeia polipeptdica com nmero de aminocidos aproximadamente igual aa) 200b) 300c) 600d) 1200e) 1800 45. (Fuvest 95) Considere a seguinte tabela que indica seqncias de bases do RNA mensageiro e os aminocidos por elas codificados.Com base na tabela fornecida e considerando um segmento hipottico de DNA, cuja seqncia de bases AAGTTTGGT, qual seria a seqncia de aminocidos codificada?a) Aspargina, leucina, valina.b) Aspargina, lisina, prolina.c) Fenilalanina, lisina, prolina.d) Fenilalanina, valina, lisina.e) Valina, lisina, prolina.

46. (Fuvest 92) De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas?

47. (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminocidos correspondentes.

Assinale a alternativa que apresenta a possvel seqncia de cdons para a formao do seguinte tetrapeptdeo: GLU - GLI - FEN - LEUa) GUU - GGU - UUU - CUC;b) GAA - GGC - TTT CTC;c) CTT - CCG - AAA - AAC;d) GAA - GGA - UUU - CUC;e) GUU - GGC - UUU - UUG. 48. (Puccamp 95) O quadro a seguir contm um segmento de DNA, os cdons e os anticdons correspondentes.

Para preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos, respectivamente, pora) GAC, TAA, AGT e CTGb) GTC, AUU, UCA e GUCc) GTC, ATT, TCA e GUCd) CTG, ATT, TCA e CUGe) CTG, AUU, UCA e CUG

49. (Fuvest 96) Uma doena gentica de herana dominante causada por mutaes em um gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de DNA desse gene, cuja seqncia normal est representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminocidos e considerando que a fita molde a ser transcrita aquela assinalada com a letra m, responda: a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e C? b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu? Seqncia normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

50. (Ufpe 96) OBSERVE:1. O cdigo gentico descreve a relao entre a seqncia de bases nitrogenadas e a seqncia de aminocidos, na protena que ele especifica.2. A seqncia de aminocidos que forma uma cadeia polipeptdica compreende a estrutura secundria de uma protena.3. Trs bases nitrogenadas adjacentes codificam um aminocido e formam um cdon.Est(o) correta(s):a) 1, apenasb) 1 e 3, apenasc) 3, apenasd) 1, 2 e 3e) 2, apenas 51. (Cesgranrio 92) A tabela a seguir mostra alguns aminocidos e as trincas de bases no DNA que os identificam:

Se um RNA mensageiro apresenta a seqncia de bases AUU AGA UGU GUU UUA, a seqncia de aminocidos no polipeptdeo correspondente ser, de acordo com a tabela anterior:a) Cis - Val Leu - Arg - Ileb) Leu - Val - Cis - Arg - Ilec) Arg - Ile - Val - Leu - Cisd) Ile - Arg - Cis - Val - Leue) Val - Cis - Arg - Ile - Leu

52. (Puccamp 94) O esquema a seguir representa a seqncia de aminocidos de um trecho de uma protena e os respectivos anticdons dos RNA transportadores.

Assinale a alternativa que contm a seqncia de cdons do RNA mensageiro que participou dessa traduo.a) UUU CGT TTG UGC GUCb) UUU CGA AAG UGC GUCc) TTT CGT TTC TGC GTCd) TTT CGA AAG TGC GTCe) CCC TAC CCA CAT ACT 53. (Puccamp 97) Com relao ao cdigo gentico, foram feitas as seguintes afirmaes:I. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminocido.II. O RNA ribossmico contm as informaes para as protenas que devem ser sintetizadas.III. O RNA mensageiro, de acordo com o anticdon que possui, liga-se a um aminocido especfico.IV. Diversos aminocidos so codificados por mais de uma trinca de nucleotdios.So verdadeiras APENAS as afirmaesa) I e IIb) I e IVc) II e IIId) II e IVe) I, III e IV 54. (Cesgranrio 98) Sobre o cdigo gentico so feitas as seguintes afirmaes:I - pode existir mais de um cdon para determinar um mesmo aminocido;II - em todos os seres vivos os cdons que codificam um respectivo aminocido so os mesmos;III - a traduo da seqncia de bases do RNA para a protena feita, a nvel citoplasmtico, nos ribossomos.Est(o) correta(s) afirmativa(s):a) II apenas.b) III apenas.c) I e II apenas.d) I, II e III.e) I e III apenas. 55. (Uel 98) Considere os seguintes cdons do RNA mensageiro e os aminocidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticdons do RNAt e os cdons do DNA relacionados com esses aminocidos.

56. (Ufrj 97) O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos. Por que sempre encontramos N > P ?

57. (Unb 98) Um trecho de fita de DNA com a sequncia... TACACCTCTCGT... responsvel pela incorporao respectiva dos seguintes aminocidos: metionina, triptofano, arginina e alanina. Considerando as informaes apresentadas, julgue os itens que se seguem. (1) Os cdons do mRNA, para os aminocidos mencionados, so, respectivamente, UAC ACC UCU CGU. (2) A molcula de DNA referente ao trecho apresentado tem 20% de adenina. (3) A perda de um nucleotdeo do DNA implicar a alterao dos aminocidos da cadeia polipeptdica. (4) A fumaa do cigarro, os raios X e a luz ultravioleta podem produzir mutaes na molcula de DNA. 58. (Ufrj 99) Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de nucleotdeos do seu gene, ou do RNA-m correspondentes.

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu. 59. (Puccamp 99) Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio sintetizado a partir dele: ATA - GCA - GTG - ACA - CCTTIROSINA - ARGININA - HISTIDINA CISTENA - GLICINAAps a substituio de uma nica base nitrogenada no segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas.A seqncia de trincas no RNA mensageiro que pode ter codificado esse polipeptdio alterado a) CUC - TGC - TGC - CGC - GGUb) TUT - CGT - CGT - TGT - GGUc) CGT - CGT - CAC - TGT - GGAd) UAU - CTU - CAC - CTU - TTAe) UAU CGU - CAC - CGU - GGA 60. (Ufsm 99) A tabela apresenta o cdigo gentico, com os cdons e os aminocidos correspondentes.

phe = FENILALANINA; leu = LEUCINA; ileu = ISOLEUCINA; met = METIONINA; val = VALINA; ser = SERINA; pro = PROLINA; thr = TREONINA; ala = ALANINA; tyr = TIROSINA; his = HISTIDINA;glu = GLUTAMINA; asn = ASPARAGINA; lys = LISINA; asp = ASPARTATO; cys = CISTENA; trp = TRIPTOFANO;arg = ARGININA; gly = GLICINA LOPES, Snia. Bio Volume nico. So Paulo: Saraiva, 1996.Utilizando a tabela, determine a seqncia de aminocidos que corresponde seqncia de DNA TAC TGA TTG CTAa) metionina - treonina - asparagina - aspartatob) metionina - glutamina - histidina - glicinac) glutamina - treonina - aspartato - argininad) glutamina - histidina - glicina - argininae) glicina - cistena - glutamina - treonina 61. (Mackenzie 99) Os cdons UGC, UAU, GCC e AGC codificam, respectivamente os aminocidos cistena, tirosina, alanina e serina; o cdon UAG terminal, ou seja, indica a interrupo da traduo. Um fragmento de DNA, que codifica a seqncia serina - cistena - tirosina - alanina, sofreu a perda da 9 base nitrogenada. Assinale a alternativa que descreve o que acontecer com a seqncia de aminocidos.a) O aminocido tirosina ser substitudo por outro aminocido.b) O aminocido tirosina no ser traduzido, resultando numa molcula com 3 aminocidos.c) A seqncia no ser traduzida, pois essa molcula de DNA alterada no capaz de comandar esse

processo.d) A traduo ser interrompida no 2 aminocido.e) A seqncia no sofrer prejuzo, pois qualquer modificao na fita de DNA imediatamente corrigida. 62. (Ufu 99) O aminocido leucina pode ser codificado por mais de uma trinca de nucleotdios do DNA (AAT, GAA e outras). Assim sendo, podemos dizer queI - o cdigo gentico degenerado, o que significa que um aminocido pode ser codificado por mais de uma trinca.II - um aminocido pode ser codificado por apenas uma trinca de nucleotdios de DNA.III - assim como a leucina pode ser codificada por diferentes trincas, uma determinada trinca tambm pode codificar diferentes aminocidos.Esto corretas afirmativas:a) apenas III.b) apenas II.c) apenas I.d) I e III.e) nenhuma delas. 63. (Ufv 2000) Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com os aminocidos correspondentes, para resolver os itens seguintes:

a) Determine a seqncia de bases do RNAm que foi utilizado para sintetizar o polipeptdeo esquematizado abaixo da tabela. b) Se ocorresse uma substituio, por uma purina, na 3 base do cdigo correspondente ao 6 aminocido do polipeptdeo, qual seria o aminocido da tabela a ser incorporado? c) Qual anticdon correspondente ao novo aminocido incorporado? 64. (Uerj 2001) Uma molcula de RNAm, composta pelas bases adenina-A e citosina-C, foi sintetizada experimentalmente.Sua estrutura est representada no esquema abaixo:C-A-C-A-C-AC-A-C-A-C-A-C-A-C-A-C-ASuponha que a sntese de um peptdeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm, sem necessidade de cdigo de iniciao ou de terminao. Nestas condies, o nmero de diferentes tipos de aminocidos encontrados nos peptdeos formados ser:a) 4b) 3c) 2d) 1 65. (Uff 2001) A determinao da seqncia de aminocidos de todas as protenas da espcie humana e de outros seres vivos de extrema importncia.A partir da seqncia de aminocidos de uma protena, podem-se identificar as possveis seqncias de DNA que a originaram.Considere o quadro:

Com base no quadro apresentado, assinale a opo que indica a seqncia do DNA responsvel pela sntese do peptdeo mostrado a seguir: Met - Asn - Glu - Cys - Tyr - Phea) ATG - AAT GAA - TGT - TAC - TTTb) ATG - AAC - GAA - TTC - TAC - TTTc) ATC - AAT - GAA - TGT - TAC - TTTd) ATG - AAT - GCC - TGT - TAC - TTCe) ATC - AAT - GAA - TGT - TAC - TTC 66. (Puc-rio 2001) Em 1987, foi oficialmente fundado o Projeto Genoma, que visa decifrar e mapear o cdigo gentico humano. Indique a alternativa ERRADA relativa ao cdigo gentico e sntese de protenas:a) Os genes so formados por cido desoxirribonucleico e controlam a produo de protenas da clula, determinando as caractersticas de um ser vivo.b) Todas as clulas do corpo tm a mesma coleo de genes, mas, apesar disto, encontramos clulas com formas e funes diferentes.c) A mutao uma alterao do cdigo gentico de um organismo e pode ser provocada por radiaes ou substncias qumicas.d) As mudanas na programao gentica de um organismo no alteram a produo de protenas, nem as suas caractersticas.e) A Engenharia Gentica, que uma tcnica de manipulao dos genes, pode corrigir defeitos no

cdigo gentico de um organismo. 67. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya constitudo pelos mesmos 4 tipos de bases dos seres vivos terrestres. J o cdigo gentico desses organismos determinado por cdons de 2 bases. a) As protenas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente, 13, 16 e 19 tipos diferentes de aminocidos. Explique a possibilidade da ocorrncia dessas trs protenas nos seres de Zbohrnya. b) Sabendo que a vida em Zbohrnya e na Terra existe h 3,5 bilhes de anos, faa uma comparao entre a diversidade dos organismos encontrados nesses dois planetas. c) Se o gene de uma protena respiratria de um organismo zbohrniano for introduzido numa bactria terrestre, a protena produzida pela expresso desse gene ser idntica da espcie zbohrniana? Justifique sua resposta. 68. (Ufrn 2000) Observe as seqncias de nucleotdeos de um vrus de RNA:5' GCA UCA CAC CUC AUU GCG UAG 3'Considerando que esse segmento de RNA codifica um determinado peptdeo, correto afirmar:a) Os cdons dessa seqncia sinalizam os mesmos aminocidos em seres humanos.b) A insero de um nucleotdeo entre a 4 e a 5 base no altera o cdigo gentico.c) Os cdons GCA e GCG so degenerados porque codificam aminocidos diferentes.d) Os anticdons do 1 do 2 cdon dessa seqncia so, respectivamente, GCA e UGA. 69. (Ufpi 2000) Se uma protena possui 100 aminocidos, quantos cdons, que especificam esses aminocidos, devem estar presentes no seu mRNA?a) 100b) 33c) 99d) 300e) 500 70. (Puc-rio 2000) Com relao ao cdigo gentico e sntese de protenas, assinale a afirmativa FALSA.a) Na molcula de DNA, encontramos sempre desoxirribose e cinco tipos de bases: adenina, guanina, citosina, timina e uracil.b) Os cidos nuclicos podem aparecer livres na clula ou podem estar associados a protenas, compondo os cromossomos e ribossomos na forma de molculas complexas de nucleoprotenas.c) Duas grandes etapas esto envolvidas na sntese das protenas: a transcrio, que compreende a passagem do cdigo gentico do DNA para o RNA, e a traduo, que compreende o trabalho do RNA de organizao dos aminocidos na seqncia determinada pelo cdigo gentico.d) A mutao constitui uma alterao na seqncia de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiaes, por raios csmicos, por raios-X, ou mesmo por exposio aos raios ultravioleta do sol.e) Todas as clulas do corpo tm a mesma coleo de genes, mas, apesar disso, encontramos clulas com formas e funes diferentes. Este processo chama-se diferenciao celular. 71. (Pucsp 2004) Organismos so ditos transgnicos quando, por tcnica de engenharia gentica, recebem e incorporam genes de outra espcie, os quais podem ser transmitidos aos seus descendentes. Exemplos desses organismos so as plantas transgnicas, receptoras de um gene de outro organismo (doador) que lhes confere resistncia a certos herbicidas. Para que ocorra a sntese da protena codificada pelo gene inserido no genoma da espcie receptora, diversas condies devem ser observadas. Entretanto, fundamentalmente, essa tcnica possvel porquea) cada organismo apresenta seu prprio cdigo gentico.b) o cdigo gentico comum a todos os seres vivos.c) o cdigo gentico degenerado.d) a tcnica permite trocar o cdigo gentico do organismo doador do gene.e) a tcnica permite trocar o cdigo gentico do organismo receptor do gene.

72. (Uff 2004) O fumo est relacionado ao aumento de risco para o cncer de pulmo. O hbito de fumar expe os fumantes a substncias com atividade carcinognica. O Benzo[a]pireno, um dos principais agentes carcinognicos presentes na fumaa do cigarro, tem a capacidade de promover mutaes no DNA levando a mudana da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presena do Benzo[a]pireno, em um dos dois stios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alteraes que ocorrero na sntese da protena X quando a mutao for localizada nos diferentes stios, justificando cada resposta com a utilizao do cdigo gentico da figura 2:

73. (Ufrrj 2004) As unidades hereditrias que contm a informao para especificar um aminocido so denominadasa) ADN.b) cdons.c) nuclolos.d) acrossomos.e) ribossomos. 74. (Ufv 2004) A tabela adiante representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um aminocido.

Analise a tabela e faa o que se pede: a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b) Cite a seqncia do anticdon correspondente ao cdon de iniciao. c) Qual a seqncia de aminocidos que resultar da traduo da molcula de RNA mensageiro? Ver figura anterior. d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA, aps uma deleo do TERCEIRO nucleotdeo?

75. (Uerj 2005) A mutao em um gene, por conseqncia da substituio de uma nica base na estrutura do DNA, pode acarretar modificaes importantes na atividade biolgica da protena codificada por esse gene.Considere que a estrutura normal de um RNA mensageiro de um peptdio e sua estrutura alterada em virtude da troca de uma nica base no gene correspondente so:5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal)5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada)A tabela a seguir identifica alguns codons.

Observe que:- o codon da metionina tambm o do incio da traduo;- os codons de trmino da traduo so UAA, UAG e UGA.O aminocido encontrado no peptdio normal e aquele que o substituiu no peptdio mutante so, respectivamente:a) lisina e cistenab) treonina e triptofanoc) alanina e cido glutmicod) fenil alanina e cido asprtico 76. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstituir o DNA desses animais. a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justifique. 77. (Fuvest 2005) A seguir est representada a seqncia dos 13 primeiros pares de nucleotdios da regio codificadora de um gene. --- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas esquerda, corresponde ao aminocido metionina. A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos codificados por cada um deles.

a) Escreva a seqncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de cdigo gentico fornecida, indique a seqncia dos trs aminocidos seguintes metionina, no polipeptdio codificado por esse gene. c) Qual seria a seqncia dos trs primeiros aminocidos de um polipeptdio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotdios (ou seja, a deleo do par de bases T = A)?

78. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqncia de bases: GTA GCC TAG e responda: a) Qual ser a seqncia do RNAm transcrito a partir deste DNA? b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar? Explique. 79. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqncia de bases TAC TCC GCT TAG e, em sua cadeia complementar, a seqncia ATG AGG CGA ATC, quais so as seqncias de bases de RNAm por ele produzido? 80. (G2) Dado um segmento de RNA mensageiro com a seguinte seqncia de bases: AAU GUA GGC pergunta-se: a) Qual a seqncia de bases do DNA que deu origem a esse RNA? b) Quantos aminocidos ter o polipeptdeo traduzido, no ribossomo, a partir desse RNA? 81. (G2) Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma destruio do(s) nuclolo(s) de uma clula?. 82. (G2) Dado um segmento de RNA com a seguinte seqncia de bases nitrogenadas: UUA UUU GGC UCC,pode-se dizer que o segmento de DNA que deu origem a esse RNA eraa) TTA AAA CCG AGG.b) AAT AAA GGC UCC.c) AAT AAA CCG AGG.d) TTA TTT CCG AGG.e) AAU AAA CCG AGG. 83. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqncia de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as seqncias de bases do RNA por ele produzido? 84. (G2) Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUU GUG CCC AAA. Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA.a) AAA CAC GGG TTTb) TTT CAC GGG UUUc) AAA CTC GGG TTTd) TTT GAG GGG TTTe) AAA CAC CCC UUT 85. (Uel 96) O segmento CGATAGACT de uma fita de DNA, aps o processo de transcrio, origina a cadeiaa) GUTATUTGAb) GCUAUCUGAc) GCTUTCTGUd) UCTATCTUAe) GCTATCTGA 86. (Uel 95) Os processos de transcrio e traduo gnicas resultam na sntese, respectivamente, dea) protenas e de RNA.b) RNA e de protenas.c) DNA e de protenas.d) RNA e de DNA.e) DNA e de RNA. 87. (Fatec 93) Uma cadeia de DNA apresenta a seguinte seqncia de bases numa certa regio de sua hlice: ATA CCG TAT; sua cadeia complementar e o tipo de RNAm que poder ser formado a partir das bases da hlice original so, respectivamente:a) TAT GGC ATA; UAU GGC AUA.b) UAU GGC UAU; TAT GGC ATA.c) TAT GGC ATA; TUT GGC UTU.d) ATA GGC TAT; UTU GGC UTU.e) TAT GGC UTU; TAT GGC ATA.

88. (Mackenzie 97) O esquema a seguir representa dois processos observados numa clula eucaritica.

Assinale a alternativa correta.a) O processo 1 somente observado no ncleo da clula, sendo inexistente em todas as outras organelas.b) Para interromper o processo 2, necessrio bloquear o funcionamento de todo o retculo endoplasmtico dessa clula.c) O processo 2 ocorre principalmente no perodo S da intrfase.d) Um dos mais importantes locais de ocorrncia do processo 1 o nuclolo.e) As molculas produzidas no processo 2 podero ser utilizadas como catalisadoras, mas nunca sero constituintes de outras organelas. 89. (Faap 97) Um fragmento de DNA de uma espcie de organismo procarionte apresenta a seguinte seqncia de bases: AAT ATT CGA GTC TAA AGA.Indique qual a seqncia de mRNA transcrito a partir deste segmento DNA::a) TTA TAA GCT CAG ATT TCTb) TTA TTA GCT CAG ATT TCTc) UUA UUU GGU CAG AUU UGUd) UUA UAA GCU CAG AUU UCUe) AAT ATT CGA GTC TAA AGA 90. (Ufrs 96) Considere as seguintes etapas da sntese de protenas.I - Transcrio do cdigo gentico do DNA em cdons do RNA mensageiro.II - Ligao dos cdons de RNA mensageiro aos anticdons correspondentes dos RNAs transportadores.III - Fixao do RNA mensageiro aos ribossomos.Qual a seqncia correta dessas etapas durante o processo?a) I - II - III.b) I - III - II.c) II - III - I.d) III - II - Ie) III - I - II. 91. (Ufrj 97) Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justifique sua resposta 92. (Fuvest 99) Existe um nmero muito grande de substncias com funes antibiticas. Essas substncias diferem quanto maneira pela qual interferem no metabolismo celular. Assim, a TETRACICLINA liga-se aos ribossomos e impede a ligao do RNA transportador; a MITOMICINA inibe a ao da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos cdons do RNA mensageiro. Essas informaes permitem afirmar queI - a TETRACICLINA impede a transcrio e leva a clula bacteriana morte por falta de RNA mensageiro.II - a MITOMICINA, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana.III - a ESTREPTOMICINA interfere na traduo e leva a clula bacteriana a produzir protenas defeituosas.Assinale a alternativa que rene as afirmaes corretas.a) apenas I correta.b) apenas I e II so corretas.c) apenas II e III so corretas.d) apenas I e III so corretas.e) I, II e III so corretas. 93. (Unesp 99) O esquema resume parcialmente as relaes funcionais dos cidos nucleicos que ocorrem na maioria das clulas vivas.

Considerando-se apenas clulas eucariontes, as etapas que representam, respectivamente, transcrio, duplicao e traduo so:a) I, II e III.b) I, III e II.c) II, I e III.d) III, I e II.e) II, III e I.

94. (Ufrj 98) Suponha um gene de um eucarioto responsvel pela sntese de uma protena. Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na protena em questo. As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de transcrio. A figura a seguir representa o resultado de uma experincia de hibridao do ARN mensageiro com a cadeia de ADN que lhe deu origem.

A figura mostra cinco regies, identificadas por nmeros de 1 a 5. Quais dessas regies correspondem aos ntrons? Justifique sua resposta. 95. (Mackenzie 2002) O esquema a seguir representa fragmentos de cidos nuclicos no ncleo de uma clula.

Observando o esquema, INCORRETO afirmar que:a) 1 uma molcula de uracila.b) 2 representa nucleotdeos de DNA.c) 3 representa nucleotdeos de RNA.d) a clula encontra-se em metfase.e) trata-se do processo de transcrio.

96. (Uel 2001) Abaixo est representado o filamento I de uma molcula de cido nuclico presente no interior do ncleo de uma clula vegetal. Qual seria a seqncia correta encontrada na molcula de RNA mensageiro, transcrita a partir dofilamento II?a) G - A - A - G - C - Ub) G - U - U - G - C - Ac) G - U - U - G - C - Ud) C - U - U - C - G - Ae) C - A - A - C - G - U

97. (Pucrs 99) A molcula de RNA sintetizada ___________ fita de DNA que lhe deu origem e ___________ outra fita de DNA, sendo as _______________ substitudas pelas uracilas.a) idntica complementar - adeninasb) complementar - complementar - guaninasc) idntica - idntica citosinasd) complementar - complementar - adeninase) complementar - idntica - timinas 98. (Ufsm 2002) Analise as afirmativas a seguir.I. Nas clulas eucariontes, a informao gentica transmitida do citoplasma, onde est o DNA, para o ncleo, onde sero produzidas as protenas.II. Nas bactrias, transcrio e traduo ocorrem no mesmo local porque as clulas procariontes no possuem sistema de endomembranas.III. Durante a transcrio, uma fita de DNA serve como molde para a produo do RNA que ter uma seqncia de nucleotdeos complementar fita-molde.Est(o) correta(s)a) apenas I.b) apenas II.c) apenas III.d) apenas I e III.e) apenas II e III. 99. (Unirio 2002) Atualmente os genes podem ser desmembrados em trs classes diferentes: os genes que expressam mRNA que codificam polipeptdios diversos; os genes reguladores que codificam protenas que regulam outros genes; e uma terceira classe de genes que no codificam polipeptdios. Qual o produto final da classe de genes que no codificam polipeptdios? 100. (Uerj 2004) Analisando o genoma de alguns tipos de vrus formados por fita simples de RNA, encontramos aqueles que so RNA (-), como o do resfriado comum, e os que so RNA (+), como o da poliomielite. Observe que: - nos vrus RNA (-), apenas o RNA complementar a seu genoma capaz de funcionar como mensageiro na clula infectada; - nos vrus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vrus necessitam, para sua replicao, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA; - o gene da enzima RNA replicase est presente no genoma dos dois tipos de vrus, mas a enzima s encontrada nas partculas virais RNA (-). a) Explique por que necessrio, para sua replicao, que os vrus RNA (-) j contenham a enzima RNA replicase, enquanto os RNA (+) no precisam armazenar esta enzima. b) Apresente um argumento contrrio hiptese de que os vrus, devido simplicidade de sua estrutura, foram precursores das primeiras clulas.

101. (Unesp 2006) Algumas clulas de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. Posteriormente, essas clulas foram transferidas para um meio sem essa substncia. Aps 3 minutos, algumas clulas foram fixadas e radioautografadas. Esse procedimento se repetiu aps 15 e aps 90 minutos. Os esquemas representam as clulas radioautografadas nos trs momentos, revelando a distribuio do precursor radioativo nas mesmas.

Esses resultados ocorrem porque a) o RNA transportador leva o istopo at o nuclolo e posteriormente ao ncleo e citoplasma celular. b) a substncia, ao ser deixada em situao de desequilbrio osmtico em relao cultura sem istopo, dirige-se gradativamente para o citoplasma celular, buscando a situao de equilbrio. c) a sntese de RNA, que se intensifica aos 90 minutos, esgota toda a substncia presente no ncleo, restando apenas no citoplasma. d) a produo de RNA, que ocorre inicialmente no ncleo celular, prossegue posteriormente no citoplasma da clula. e) a sntese de RNA ocorre no ncleo, sendo que posteriormente o RNA a produzido migra para o citoplasma celular. 102. (G2) Os cdons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminocidos arginina, leucina e treonina. Escreva esses aminocidos na ordem correspondente seqncia TGA - TCT - GAC de um segmento de DNA. 103. (G2) A seqncia de aminocidos de uma protena determinada pela seqncia dea) pentoses da molcula de DNA.b) pentoses da molcula de RNA - mensageiro.c) bases da molcula de DNA.d) bases da molcula de RNA - transportador.e) bases da molcula de RNA - ribossmico 104. (Unicamp 2002) O esquema a seguir representa a seqncia de reaes que levam formao do pigmento da pelagem de uma espcie animal. Os genes autossmicos A, B e C so responsveis pela produo das enzimas A, B e C que atuam nesse processo metablico. Mutaes nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

a) Do ponto de vista gentico, quantos tipos de albinismo podem ocorrer nessa espcie? Por qu? b) Demonstre o fentipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. c) possvel ocorrer uma mutao em um gene sem que se altere a enzima correspondente? Justifique. 105. (Fuvest 93) O que so cidos nuclicos? Como atuam na sntese de protenas? 106. (G2) Griffth em 1928 descobriu que pneumococos sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias.

Nesse extrato o agente transformante eraa) o cido ribonuclico.b) o cido indolilactico.c) o cido desoxirribonuclico.d) uma enzima.e) uma protena. 107. (G2) Em 1928 Griffth descobriu que pneumococos (bactrias) sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias. Nesse extrato o agente capaz de transformar bactrias no patognicas em patognicas eraa) o cido ribonuclico.b) o cido indolilactico.c) o cido desoxirribonuclico.d) uma enzima.e) uma protena. 108. (G2) Griffth em 1928 descobriu que bactrias pneumococos sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluram que o agente capaz de transformar as bactrias eraa) o RNA.b) o AIA.c) o DNA.d) uma enzima.e) uma protena. 109. (G2) A experincia do "liquidificador" realizada por Hersey e Chase demonstrou que a substncia que determinava a destruio de bactrias parasitadas pelos vrus bacterifagos eraa) uma protena viral.b) uma enzima viral.c) o RNA viral.d) o DNA viral.e) um lpide viral. 110. (G2) O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruio de bactrias. Os organismos que podem infectar bactrias soa) fungos.b) vrus.c) algas.d) caros.e) protozorios. 111. (G2) Bacterifagos soa) protozorios de vida livre.b) lquenes parasitas.c) vermes parasitas.d) vrus.e) vermes de vida livre. 112. (G2) A experincia do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou quea) o material gentico formado por protenas.b) o material gentico formado de RNA.c) o material gentico formado de lipdios.d) o material gentico formado por acares.e) o material gentico formado de DNA. 113. (G2) Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformao" de bactrias pneumococos sem cpsula, no patognicas, em pneumococos com cpsula patognicas. 114. (G2) Como que os cientistas O. Avery, M. Mac Leod e M. Mac Carthy chegaram concluso em 1944 que o "agente transformante" capaz de permitir o desenvolvimento da cpsula em pneumococos no capsulados era o cido desoxirribonuclico? 115. (G2) O que so bacterifagos? Qual sua importncia na identificao do DNA como material gentico? 116. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S) e de fsforo (P) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir deste trabalho. 117. (G2) A bactria 'Pneumococo pneumoniae' pode possuir uma cpsula que lhe permitea) sofrer mutaes.b) desenvolver flagelos.c) resistir s defesas dos hospedeiros.d) ficar imune s defesas dos hospedeiros.e) sobreviver em ambientes sem gua. 118. (Ufrs 98) Sabendo que o DNA dos vrus bacterifagos contm fsforo e que a cpsula protica contm enxofre, Hersey e Chase, em 1952, cultivaram vrus em meio contendo istopos de fsforo (P) e de enxofre (S). Esses pesquisadores observaram, ao introduzir os vrus marcados em meio contendo bactrias, que os istopos de fsforo (P) apareciam no interior das bactrias e que os istopos de enxofre (S) permaneciam fora das clulas. Observaram tambm que, aps lavarem a superfcie das bactrias, retirando o enxofre (S), continuava ocorrendo a replicao dos vrus. Com esse experimento, eles puderam concluir quea) a informao gentica necessria para a sntese de novos vrus est contida no DNA viral.b) as capas proticas dos vrus contm parte importante da informao gentica necessria sntese de novos vrus.c) o DNA viral precisa estar associado integralmente s capas proticas para poder se replicar no interior das bactrias.d) a capa protica protege o DNA viral da ao de endonucleases no interior do organismo hospedeiro.e) os vrus bacterifagos contm DNA como material gentico, e essa molcula muito rica em enxofre. 119. (Pucsp 2000) "O sculo XX proporcionou uma srie de pesquisas na rea gentica.Em 1928, Griffith realizou um importante experimento que envolvia transformaes em bactrias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molcula formadora do material gentico.Nos anos 50, Watson e Crick apresentaram o modela da dupla-hlice dessa molcula, abrindo caminho para que, na dcada seguinte, se demonstrasse como o gene, atravs de sua seqncia de bases nitrogenadas, controla a produo de protenas.Nas duas ltimas dcadas, o avano biotecnolgico permitiu aos cientistas a manipulao do material gentico e a transferncia de um gene de uma espcie para outra."Considere os itens abaixo:I. estrutura da molcula do DNA;II. descoberta do cdigo gentico;III. DNA como molcula constituinte do gene;IV. obteno de organismos transgnicos.O texto faz refernciaa) apenas aos itens I, II e III.b) apenas aos itens I, II e IV.c) apenas aos itens I, III e IV.d) apenas aos itens II, III e IV.e) a todos os itens considerados.

120. (Ufrs 2004) No incio da dcada de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacterifago foi marcado radiativamente com enxofre e outro, com fsforo. Esses bacterifagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactria, e o outro foi retirado da parede da mesma, por agitao. A cultura foi, ento, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

Sobre o resultado do experimento, correto afirmar quea) o DNA do bacterifago marcado com fsforo encontra-se no depsito bacteriano.b) as protenas do bacterifago marcadas com enxofre encontram-se no depsito bacteriano.c) o DNA do bacterifago marcado com enxofre encontra-se em suspenso.d) as protenas do bacterifago marcadas com fsforo encontram-se em suspenso.e) o DNA do bacterifago marcado com enxofre encontra-se no depsito bacteriano. 121. (Ufrj 2004) Aps tratar culturas de bactrias com doses de um agente mutagnico capaz de induzir uma nica mutao pontual (que afeta apenas um nucleotdeo por clula), analisou-se a seqncia de aminocidos de uma determinada protena em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada protena que diferia da original pela ausncia de 35 aminocidos em uma das extremidades da cadeia peptdica. Explique como essa nica mutao pontual pode fazer com que a sntese da protena seja interrompida prematuramente. 122. (G2) A estrutura qumica de uma protena poder ser modificada sea) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma celular.b) durante sua sntese houver variao dos tipos de RNA transportadores.c) sua sntese ocorrer no complexo de Golgi e no no retculo endoplasmtico rugoso.d) uma base prica substituir uma pirimdica no RNA mensageiro que a codifica.e) o DNA no se duplicar durante a intrfase. TEXTO PARA A PRXIMA QUESTO (Uerj 2001) A enzima transcriptase reversa encontrada em retrovrus. Muitos pesquisadores, atualmente, procuram descobrir novas substncias que sejam inibidoras especficas dessa enzima. 123. Descreva a funo da transcriptase reversa no mecanismo de replicao do vrus da Aids. 124. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fmea) e o burro (exemplar macho) so hbridos estreis que apresentam grande fora e resistncia. So o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a gua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos tm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produo de gametas, explique por que o burro e a mula so estreis.

125. (Fuvest 2004) Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em um meio de cultura na qual toda a fonte de nitrognio era o istopo pesado N. De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma tcnica de centrifugao que permite separar molculas de DNA de acordo com sua densidade. O restante das bactrias foi transferido para um meio de cultura em que todo o nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B), quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra (amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias das amostras B e C foi tambm extrado e centrifugado.

A figura mostra o resultado da centrifugao do DNA das trs amostras de bactrias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediria entre o que constitudo apenas por N e o que contm apenas N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que quantidade de DNA h na faixa superior? 126. (G2) Quais so as duas propriedades fundamentais do DNA que permitem a essa substncia desempenhar o papel de material gentico? 127. (G2) Porque o processo de replicao do DNA chamada semiconservativa? 128. (G2) Dada a seqncia de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 129. (Ufrj 2004) Estudos recentes compararam as seqncias completas de DNA mitocondrial de indivduos de vrias regies geogrficas do planeta. Os resultados revelaram que a variabilidade gentica no DNA mitocondrial de indivduos africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses resultados foram importantes para corroborar a idia de que o ancestral comum mais recente do 'Homo sapiens' viveu na frica h cerca de 200.000 anos. Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do 'Homo sapiens'. 130. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molcula de ADN igual a 58% do total de bases presentes. a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molcula. b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro codificado por esse trecho de ADN. 131. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma nica pgina na revista inglesa Nature intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o cdigo gentico determinante para a sntese protica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimos" e os "degraus" dessa escada. b) Que relao existe entre DNA, RNA e sntese protica? c) Como podemos diferenciar duas protenas?

132. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servir de molde para a fita de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda. a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipepitdeos que ser formada? Justifique sua resposta. 133. (Uerj 2006) Para investigar possveis efeitos de uma determinada droga, utilizou-se uma cultura de clulas, qual foram adicionadas quantidades adequadas das seguintes substncias, marcadas com istopos: uridina C, timidina H e leucina N. Aps algum tempo, a droga foi tambm introduzida no meio de cultura. Ao longo do experimento, amostras das clulas foram coletadas a intervalos regulares. A incorporao dos istopos foi medida em uma preparao que contm os cidos nuclicos e as protenas da clula. Os resultados do experimento esto mostrados no grfico a seguir.

a) Considere as etapas de replicao, transcrio e traduo nas clulas analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As protenas, aps sintetizadas, adquirem uma conformao tridimensional. Cite duas ligaes ou interaes que atuam na manuteno da estrutura enovelada das protenas. 134. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminocidos de uma protena, um grupo de pesquisadores desenvolveu o seguinte experimento: - Sintetizaram uma cadeia de DNA com trs nucleotdeos repetidos muitas vezes em uma seqncia conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de clulas, porm no qual haviam todos os componentes necessrios sntese protica, incluindo os diferentes aminocidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma protena com um nico tipo de aminocido. Diferentes repeties do experimento demonstraram que at trs protenas diferentes poderiam ser produzidas, cada uma delas com um nico tipo de aminocido: serina ou alanina ou glutamina. a) Por que as protenas obtidas possuam apenas um tipo de aminocido? b) Por que foram obtidos 3 tipos de protenas? 135. (Unifesp 2006) Uma fita de DNA tem a seguinte seqncia de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a seqncia de bases da fita complementar? b) Se a fita complementar for usada durante a transcrio, qual ser a seqncia de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas? 136. (G2) Qualquer alterao no DNA pode modificar o funcionamento de uma clula? Justifique. TEXTO PARA A PRXIMA QUESTO (Ufsm 2003) Notcia de algum jornal do futuro... INICIA A CAMPANHA NACIONAL DE VACINAO CONTRA SARAMPO E TUBERCULOSE. O destaque da campanha de vacinao, neste ano, a utilizao de cerejas coloridas, sem sementes. Segundo a biloga Josefa da Silva, responsvel pela equipe que desenvolveu os novos frutos, tcnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgnicas, resultando na obteno de plantas triplides (3n = 72), incapazes de produzir sementes. Apesar de passar por todas as etapas do ciclo reprodutivo, no h a formao de endosperma, e o processo cessa nas primeiras divises celulares do zigoto. As novas cores (amarela, verde, roxa e branca) haviam sido obtidas, anteriormente, por mutao no gene responsvel pela produo de pigmento na casca do fruto. As formas mutantes para esse loco, diz a pesquisadora, no interferem na eficincia das plantas transgnicas como produtoras de vacinas. Elas continuam apresentando, nos frutos, as substncias que, depois de liberadas pela digesto, ligam-se membrana plasmtica dos linfcitos e sofrem endocitose, determinando o desenvolvimento da resposta imunolgica. Outra inovao dessas cerejas a resistncia s moscas Anastrepha fraterculus que, nos ltimos anos, estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. Da mesma forma,

as plantas apresentam resistncia aos nematides que atacavam a raiz principal do sistema axial desses vegetais. Com o cultivo das novas variedades de cerejas resistentes, espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas, por algum tempo. 137. Se as cerejeiras referidas no texto so transgnicas, ento no .......... das clulas dessas plantas, em algum cromossomo, existe uma .......... que foi introduzida para ser transcrita e originar um .......... que, ao ser traduzido, resulta em produto que determinara o desenvolvimento da resposta imunolgica.Assinale a alternativa que completa as lacunas de modo correto.a) ncleo - protena - RNA mensageirob) citoplasma - seqncia de aminocidos - RNA transportadorc) ncleo - seqncia de aminocidos - RNA mensageirod) ncleo - seqncia de nucleotdeos - RNA mensageiroe) citoplasma - protena - RNA transportador TEXTO PARA A PRXIMA QUESTO (Fgv 2005) O tipo selvagem do fungo Neurospora capaz de crescer em um meio de cultura simples, constitudo de gua, sais minerais, acar e uma vitamina. O fungo utiliza esses elementos como precursores para a sntese de vrios compostos, tal como na via biossinttica representada na figura 1. Os compostos X, Y e Z correspondem citrulina, arginina e ornitina, no necessariamente nessa ordem. Um pesquisador obteve trs diferentes linhagens desse fungo, cada uma delas deficiente em uma das enzimas participantes dessa via biossinttica. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura. O sinal + indica que houve crescimento do fungo, o sinal - indica que no houve crescimento. A linhagem D o tipo selvagem, no deficiente em qualquer uma das enzimas. 138.

As letras X, Y e Z correspondem, respectivamente, aos compostos a) ornitina, arginina e citrulina. b) ornitina, citrulina e arginina. c) citrulina, ornitina e arginina. d) citrulina, arginina e ornitina. e) arginina, citrulina e ornitina. 139. (Fuvest 2003) Qual das alternativas se refere a um cromossomo?a) Um conjunto de molculas de DNA com todas as informaes genticas da espcie.b) Uma nica molcula de DNA com informao gentica para algumas protenas.c) Um segmento de molcula de DNA com informao para uma cadeia polipeptdica.d) Uma nica molcula de RNA com informao para uma cadeia polipeptdica.e) Uma seqncia de trs bases nitrogenadas do RNA mensageiro correspondente a um aminocido na cadeia polipeptdica.

140. (Puc-mg 2006) Analise o esquema a seguir, o qual mostra o mecanismo de ao de algumas drogas antimitticas que inibem a progresso a partir dos pontos indicados.

Assinale a afirmativa INCORRETA. a) A puromicina no tem qualquer efeito sobre o crescimento ou multiplicao celular. b) A mitomicina no permite a ocorrncia da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na sntese protica. d) Nem todos os tipos de nucleotdeos sofrem ao da droga arabinosilcitosdeo. 141. (Fatec 2006) O metabolismo celular depende de uma srie de reaes qumicas controladas por enzimas, isto , protenas que atuam como catalisadores e que podem sofrer mutaes genticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os cidos nuclicos, a ocorrncia de mutaes e as conseqentes mudanas do ciclo de vida da clula. a) O DNA constitudo por cdons, que determinam a seqncia de bases do RNA mensageiro, necessria formao dos anticdons, responsveis pela produo das protenas. b) No caso de uma mutao acarretar a transformao de um cdon em outro relacionado ao mesmo aminocido, no haver alterao na molcula protica formada, nem no metabolismo celular. c) A mutao altera a seqncia de aminocidos do DNA, acarretando alteraes na seqncia de bases do RNA mensageiro e, conseqentemente, na produo das protenas. d) As mutaes atuam diretamente sobre as protenas, provocando a desnaturao dessas molculas e, conseqentemente, a inativao delas. e) Quando algumas protenas so alteradas por mutaes, suas funes no metabolismo celular passam a ser realizadas pelos aminocidos.

142. (Puccamp 2005)

A clula muscular cardaca e a esqueltica tm a mesma origem porm so diferentes, tanto do ponto de vista estrutural como funcional. Ao longo do processo de diferenciao das clulas do mesmo organismo ocorre a) duplicao de alguns genes. b) perda dos genes no expressos. c) expresso diferencial dos genes. d) induo de mutaes especficas. e) recombinao entre genes ativados. 143. (Pucrs 2005) A seqncia de nucleotdeos ATGCACCT forma um segmento de DNA dupla hlice ao se ligar fita complementar a) AUGCACCU. b) UACGUGGA. c) TACGTGGA. d) TCCACGTA. e) ATGCACCT. 144. (Uerj 2004) como se em cada quarto de um imenso prdio existisse uma estante contendo os planos do arquiteto para todo o prdio. (...) No homem, os planos do arquiteto montam 46 volumes.Nessa analogia, proposta por Richard Dawkins no livro "O gene egosta", cada pgina de cada volume contm um texto formado por uma seqncia de:a) fentiposb) aminocidosc) cromossomosd) bases nitrogenadas 145. (Ufc 2004) Analise as afirmativas a seguir, acerca dos elementos constituintes do ncleo celular eucaritico.I. Cada cromossomo possui uma nica molcula de DNA.II. Histonas so protenas relativamente pequenas que se ligam fortemente ao RNA.III. Os nuclolos podem atuar na sntese de carboidratos que migram do ncleo para o citoplasma.Pode-se afirmar, de modo correto, que:a) somente I verdadeira.b) somente II verdadeira.c) somente I e II so verdadeiras.d) somente I e III so verdadeiras.e) somente II e III so verdadeiras. 146. (Ufsc 2004) Neste ano de 2003, so comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA. Com relao s caractersticas dessa molcula, ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida CORRETO afirmar que: (01) formada por duas fileiras de nucleotdeos torcidas juntas em forma de hlice. (02) Em sua composio possvel encontrar quatro bases nitrogenadas diferentes: a adenina, a citosina, o aminocido e a protena. (04) Ela tem a capacidade de se autoduplicar. (08) Nela est contida a informao gentica necessria para a formao de um organismo. (16) A mensagem nela contida pode ser transcrita para uma outra molcula denominada RNA. (32) Nos organismos procariontes, ela fica estocada dentro do ncleo das clulas. (64) Em alguns organismos primitivos, ela apresenta apenas uma fileira de nucleotdeos. 147. (Ufv 2004) Este ano comemorou-se 50 anos da publicao do trabalho de Francis Crick e James Watson, que estabeleceu o modelo da estrutura da molcula de cido desoxirribonuclico (DNA). Dentre as afirmativas abaixo, assinale a alternativa CORRETA:a) Uma cadeia simples de DNA constituda de nucleotdeos, compostos por uma desoxirribose ligada a um fosfato e a um aminocido.b) A polimerizao de uma fita simples de DNA dita semiconservativa, pois independe da existncia de uma fita molde.c) Os nucleotdeos so polimerizados por meio de ligaes fosfodister entre o fosfato e a base nitrogenada.d) Duas cadeias simples de DNA formam uma dupla-hlice, por meio da formao de pontes de hidrognio entre as bases nitrogenadas.e) As duas cadeias de uma dupla-hlice possuem a mesma orientao, e suas seqncias de bases so complementares. 148. (Unesp 2004) Erros podem ocorrer, embora em baixa freqncia, durante os processos de replicao, transcrio e traduo do DNA. Entretanto, as conseqncias desses erros podem ser mais graves, por serem herdveis, quando ocorrema) na transcrio, apenas.b) na replicao, apenas.c) na replicao e na transcrio, apenas.d) na transcrio e na traduo, apenas.e) em qualquer um dos trs processos.

149. (Enem 2004) A identificao da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. Na dcada de 1950, um estudo pioneiro determinou a proporo das bases nitrogenadas que compem molculas de DNA de vrias espcies.

A comparao das propores permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formama) pares de mesmo tipo em todas as espcies, evidenciando a universalidade da estrutura do DNA.b) pares diferentes de acordo com a espcie considerada, o que garante a diversidade da vida.c) pares diferentes em diferentes clulas de uma espcie, como resultado da diferenciao celular.d) pares especficos apenas nos gametas, pois essas clulas so responsveis pela perpetuao das espcies.e) pares especficos somente nas bactrias, pois esses organismos so formados por uma nica clula. 150. (Pucpr 2003) Os itens abaixo se referem aos cidos nuclicos:Estrutura I. Cadeia simples II. Dupla hliceComposio 1. Com Timina 2. Com Uracila Funoa. Transcriob. Sntese proticaSo caractersticas do cido desoxirribonuclico (DNA):a) II - 1 - bb) I - 1 - ac) II - 1 - ad) II - 2 - ae) I - 2 b 151. (Pucrs 2003) Supondo que ocorra um evento gentico raro em que dois cromossomos nohomlogos, de uma mesma clula, quebram-se e voltam a se soldar, porm com os segmentos trocados, estaramos verificando a ocorrncia dea) crossing-over.b) duplicao.c) translocao.d) inverso.e) deleo. 152. (Uel 2006) Considere que um cientista esteja, em um laboratrio, tentando reproduzir "in vitro" a sntese de molculas de DNA. Com base nos conhecimentos sobre o tema, assinale a alternativa que indica, corretamente, as molculas imprescindveis que ele deve utilizar para que possa atingir o seu objetivo. a) Quatro diferentes tipos de nucleotdeos, contendo as bases nitrogenadas adenina, timina, citosina e guanina; a enzima DNA polimerase e DNA. b) Os nucleotdeos contendo as bases nitrogenadas timina, guanina, adenina e citosina; a enzima RNA polimerase; RNA mensageiro e DNA. c) As enzimas RNA e DNA polimerase; os trs tipos de RNA (mensageiro, transportador e ribossmico) e DNA. d) A enzima DNA polimerase; os vinte tipos diferentes de aminocidos, DNA e RNA. e) As enzimas RNA e DNA polimerase; vinte tipos diferentes de aminocidos; DNA e RNA. 153. (Ufpe 2003) Considerando que na figura a seguir tem-se uma representao plana de um segmento da molcula de DNA, analise as proposies a seguir.

1) Um nucleotdeo formado por um grupo fosfato (I), uma molcula do acar desoxirribose (II) e uma molcula de base nitrogenada.2) Um nucleotdeo com Timina (T) em uma cadeia pareia com um nucleotdeo com Adenina (A) em outra cadeia.3) Um nucleotdeo com Guanina (G) em uma cadeia pareia com um nucleotdeo com Citosina (C) em outra cadeia. 4) Pontes de hidrognio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G. Est(o) correta(s).a) 1 apenasb) 2 e 3 apenasc) 1, 2 e 3 apenasd) 2, 3 e 4 apenase) 1, 2, 3 e 4

154. (Ufrs 2004) Leia o texto abaixo.A entrada na era da genmica possibilitou ao norteamericano Eugene V. Koonin investigar qual seria o nmero mnimo de genes capazes de sustentar o funcionamento de uma clula. Para isso, ele comparou 21 genomas completos de representantes das trs linhagens primrias da vida: as eubactrias, as arqueobactrias e os eucariontes. O resultado da pesquisa mostrou que o nmero de genes deve situar-se em torno de 150. Esse enfoque interessante, pois permite imaginar os primeiros sistemas genticos surgidos por ocasio da origem da vida.Adaptado de SALZANO, F.M. "Cincia Hoje", v. 29, n. 173, jul. 2001.Considere as seguintes afirmaes.I - No cdigo gentico, a cada cdon deve corresponder mais de um aminocido.II - Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais.III - Os genes envolvidos na replicao, transcrio e traduo do material gentico devem fazer parte do conjunto mnimo de genes.Quais delas poderiam ter embasado o raciocnio de Koonin?a) Apenas I.b) Apenas II.c) Apenas III.d) Apenas II e III.e) I, II e III. 155. (Unesp 2003) A partir dos anos 1900, uma srie de observaes e experimentos indicaram uma correlao entre o comportamento dos cromossomos na clula em diviso e as leis mendelianas.Analise cada uma das afirmaes seguintes.I. Na meiose I, a segregao dos homlogos de um par cromossmico corresponde, em efeito, 1 lei de Mendel.II. Na meiose I, a segregao dos homlogos dos diferentes pares cromossmicos correspondem, em efeito, 2 lei de Mendel.III. Na meiose I, a segregao de cromossomos homlogos que apresentam os mesmos alelos resulta nas propores da gerao F2 dos experimentos de Mendel.IV. Na meiose II, a segregao das cromtides dos diferentes pares cromossmicos corresponde, em efeito, 2 lei de Mendel.V. Genes localizados em regies prximas de um mesmo cromossomo implicam em distores das propores mendelianas.So afirmaes corretas:a) I, II, III, IV e V.b) I, II, III e V, apenas.c) I, II, IV e V, apenas.d) I, II e IV, apenas.e) II e V, apenas. 156. (Ufsc 2006) H na mdia uma grande quantidade de notcias envolvendo o DNA: testes de paternidade, engenharia gentica, transgnicos, clonagem teraputica e reprodutiva, terapia gnica, farmacogenmica etc. Para compreender essas notcias, necessrio conhecer a estrutura da molcula de DNA e entender seu funcionamento. Analise os dados dos quadros a seguir, e assinale a(s) proposio(es) CORRETA(S).

(01) Em I, observa-se que o pareamento das bases nitrogenadas do DNA aleatrio. (02) O quadro I mostra uma molcula de DNA cuja duplicao ocorre de forma semiconservativa, pois cada uma das fitas originais em I serve de molde para uma nova fita, gerando duas novas duplas hlices. (04) Em II, est indicado o processo de transcrio, atravs do qual formam-se molculas que contm as mesmas bases nitrogenadas presentes no DNA. (08) Em III, est indicado o processo de traduo, que resulta na formao de polipeptdios, cuja seqncia de aminocidos est codificada numa molcula de cido nuclico. (16) A deleo de um dos pares de bases na seqncia mostrada em I no alteraria significativamente a seqncia de aminocidos em III.

157. (Fatec 2003) O esquema a seguir representa a seqncia das etapas da sntese de um trecho de uma protena a partir da molcula de DNA, num certo organismo.

Sobre essa sntese foram feitas as afirmaes abaixo:I. No esquema, os nmeros 1 e 2 correspondem, respectivamente aos processos de traduo e transcrio, que ocorrem no ncleo das clulas eucariticas.II. A seqncia correta de bases nitrogenadas encontradas na molcula de RNA mensageiro, complementar ao segmento da hlice de DNA apresentada UGGUUUGGCUCA.III. Para codificar a seqncia dos aminocidos do trecho da protena apresentada no esquema so necessrios 24 nucleotdeos no RNA mensageiro.Deve-se concluir quea) apenas II est correta.b) apenas I e II esto corretas.c) apenas II e III esto corretas.d) apenas I e III esto corretas.e) todas esto corretas. 158. (Uel 2006) "Desenvolvimento significa, em grande parte, clulas tornando-se diferentes de maneira ordenada [...]. Muitos animais desenvolvem-se ao longo de eixos cartesianos, sendo os padres especificados independentemente ao longo de cada um. Uma maneira de produzir padres dar s clulas informao posicional, como em um sistema coordenado, e as clulas ento interpretam esses valores de maneiras diferentes. A importante implicao disto que no existe relao entre o padro inicial e o observado. Uma outra caracterstica comum parece ser a gerao de estruturas peridicas como segmentos, vrtebras, penas e dentes, que so construdas segundo o modelo bsico modificado pela informao posicional. Todas as interaes ocorrem a curta distncia - raramente ultrapassam mais que 30 dimetros de clula - e a maior parte da formao de padres acontece localmente, de forma que os embries so logo divididos em regies que essencialmente se dividem de maneira independente". (WOLPERT, Lewis. In: MURPHY, M. P; O'NEILL, L.A.J. "O Que vida? 50 anos depois". So Paulo: UNESP, 1997. p. 74.) Com base no texto e nos conhecimentos sobre o tema, correto afirmar: a) As clulas diferenciam-se de acordo com um padro intrnseco, contido no material gentico, que induzido a se expressar em resposta a fatores extrnsecos. b) O desenvolvimento envolve a expresso diferencial do material gentico e independe do microambiente em que a clula est localizada. c) O desenvolvimento das diferentes regies de um organismo deve-se propriedade de interao clula-clula e da quantidade de informaes que a clula capaz de processar. d) A diferenciao caracteriza-se pela manuteno do padro morfolgico e pela alterao do padro funcional do tecido. e) O desenvolvimento ocorre como um domin, em que a diferenciao de um tipo celular induz outro tipo a se diferenciar.

159. (Ufmg 2004) Analise este grfico, em que est representada a produo de diferentes tipos de cadeias polipeptdicas - , , e - determinadas pela ao de diferentes genes e que vo compor as hemoglobinas em vrias fases do desenvolvimento humano:

Com base nas informaes contidas nesse grfico e em outros conhecimentos sobre o assunto, INCORRETO afirmar quea) a ativao do gene responsvel pela sntese da cadeia polipeptdica ocorre dias antes do nascimento.b) a sntese da cadeia polipeptdica permanece constante durante a mudana de produo das cadeias e .c) o gene responsvel pela sntese da cadeia polipeptdica aumenta sua atividade a partir do terceiro ms da concepo.d) os quatro tipos de cadeias polipeptdicas - , , e - estaro presentes no indivduo adulto. 160. (Unesp 2003) Considere o diagrama, que resume as principais etapas da sntese protica que ocorre numa clula eucarionte.

Os processos assinalados como 1 e 2 e a organela representados no diagrama referem-se, respectivamente, aa) transcrio, traduo e ribossomo.b) traduo, transcrio e lisossomo.c) duplicao, transcrio e ribossomo.d) transcrio, duplicao e lisossomo.e) traduo, duplicao e retculo endoplasmtico.

GABARITO
1. V V V F F 2. [A] 3. a) O ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA. b) Protenas e Glicoprotenas porque os ribossomos produzem as protenas que so associadas aos acares no Complexo de Golgi. 4. [C] 5. [B] 6. [E] 7. 01 + 04 + 64 = 69 8. [E] 9. a) Os bacterifagos utilizam nucleotdeos que contm P da bactria para construir seu material gentico (DNA). b) Os bacterifagos injetam seu DNA com P no interior da bactria hospedeira, deixando-a marcada com radioatividade. c) No. Os vrus no injetam sua capa protica na clula bacteriana. O S radioativo entra na composio de protenas e no no DNA introduzido pelo vrus. 10. [B] 11. [C] 12. O DNA um polinucleotdeo formado por uma dupla hlice, contm a pentose desoxirribose e Timina como base pirimidica exclusiva. No RNA observa-se uma hlice simples contendo nucleotdeos com ribose e como base pirimidica exclusiva encontramos a Uracila. 13. DNA - Desoxirribose (pentose) e Timina (base nitrogenada exclusiva) RNA - Ribose (pentose) e Uracil (base nitrogenada exclusiva) 14. [E] 15. a) Observe a figura a seguir:

b) DNA - desoxirribose e timina RNA - ribose e uracila 16. [B] 17. [C] 18. [A] 19. a) Tipo de molcula: cido ribonuclico (RNA)

Justificativa: a uridina se incorpora ao cido ribonuclico. Este cido principalmente sintetizado no nuclolo, deslocando-se posteriormente para o citoplasma. b) Compartimento: ncleo Justificativa: a timidina exclusiva do DNA, encontrado principalmente no ncleo. 20. [C] 21. a) AAATTACCCGTA b) AAAUUACCCGUA 22. A autoduplicao permite que o DNA produza cpias e possa ser transmitido descendncia. Transcrio a capacidade do DNA produzir o RNA que ser traduzido em protena especfica nos ribossomos das clulas. 23. a) TAA GAT GCG TTT CCG b) UAA GAU GCG UUU CCG 24. a) TTT CCG TAA b) UUU CCG UAA 25. [E] 26. Se houvesse a transcrio simultnea das cadeias complementares dos genes, as molculas de ARN sintetizadas tambm teriam seqncias complementares. Tal situao provocaria ento a formao de molculas de ARN de cadeia dupla, que no poderiam ser traduzidas nos ribossomas. 27. RNA mensageiro - determina a ordem dos aminocidos na cadeia polipeptdica RNA transportador - ativao e transporte de aminocidos para os ribossomos no processo de sntese protica 28. [A] 29. [C] 30. a) (1) = cido fosfrico, (2) = ribose, (3) = base nitrogenada b) nucleotdeo 31. [C] 32. [A] 33. [B] 34. 400 nucleotdeos porque o DNA constitudo por duas cadeias complementares e apenas uma cadeia com 200 nucleotdeos serviu de molde para a produo de RNA. 35. a) TTT AAG CCC CTA b) 12 nucleotdeos. 36. [C] 37. [A] 38. [B] 39. [B] 40. [C] 41. [E] 42. [D] 43. a) Os RNA mensageiros transcritos do gene normal e do gene inserido formam um RNA de dupla hlice ou hbrido. A disposio das bases destes dois RNA mensageiros so exatamente complementares. b) Havendo a interao entre os RNA mensageiros transcritos a partir destes dois genes, restaro menos mensageiros normais (fita simples) capazes de serem traduzidos em enzima, ao nvel ribossomal. Em conseqncia, a concentrao da enzima diminuir nas clulas, o que retardar o processo de maturao.

44. [A] 45. [C] 46. O DNA um polinucleotdeo capaz de produzir o RNA mensageiro. Cada trs nucleotdeos (cdon) do RNAm ser traduzido por um aminocido ao nvel dos ribossomos. 47. [D] 48. [E] 49. a) Protena normal: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo A: Val - Leu - Tre - Pro Indivduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo C: Val - Met - Tre - Pro - Tir - Val - Lis b) A afetado porque produz uma protena menor. B normal, apesar da substituio de uma base nitrogenada no seu DNA, porque o cdigo gentico degenerado. C afetado porque possui um aminocido diferente em sua protena. 50. [B] 51. [D] 52. [B] 53. [B] 54. [D] 55. [C] 56. Com a descoberta do cdigo gentico sabe-se que um aminocido sempre codificado por trs nucleotdeos, logo o gene que codifica uma protena tem sempre maior nmero de nucleotdeos que de aminocidos. Sabe-se ainda que existem vrios nucleotdeos do gene que servem para a funo de regulao e no so transcritos. 57. F F V V 58. Porque o cdigo gentico degenerado, isto , para um mesmo aminocido existem vrios cdons diferentes. 59. [E] 60. [A] 61. [D] 62. [C] 63. a) RNAm: UCC GUU AAU UCC GGC AAG b) O cdon mutado, TTA, especificaria o terceiro aminocido da tabela. c) UUA 64. [C] 65. [A] 66. [D] 67. a) As protenas produzidas pelos extraterrestres em questo, poderiam ter, no mximo, 16 tipos diferentes de aminocidos. Seu cdigo gentico, formado por pares de bases, permite a formao de apenas 16 cdons diferentes. Isso sem considerar a possibilidade da existncia de um, ou mais, cdons de finalizao. Neste caso, no seria possvel a produo das protenas B e C com, respectivamente, 16 e 19 aminocidos. b) A diversidade no planeta Terra seria maior, pois o cdigo gentico dos terrqueos formado

por 64 cdons, sendo 3 cdons de finalizao. Assim o nmero de tipos distintos de aminocidos presentes nos polipeptdeos seria, obviamente, maior. c) A protena produzida pela bactria terrestre "transgnica" no ser idntica ao polipeptdeo aliengena, uma vez que o equipamento ribossmico da bactria que incorporou o gene, est capacitado para traduzir cdons constitudos por 3 bases nitrogenadas consecutivas. 68. [A] 69. [A] 70. [A] 71. [B] 72. Quando a mutao for localizada: a) no stio 1 A seqncia do DNA ser modificada pelo benzo[a]pireno de ATG para ATT levando, na transcrio, a formao de um RNAm com a seqncia UAA ao invs de UAC. UAA um cdon de terminao, portanto, a mutao provocar a produo de uma protena menor. b) no stio 2 A seqncia do DNA de CCG ser modificada para CCT levando na transcrio, a formao de um RNAm com a seqncia GGA ao invs de GGC. Nessa situao, a modificao de GGC para GGA no provocar alterao na protena; os dois cdons na traduo produzem uma protena com o aminocido glicina, nesta posio. 73. [B] 74. a) RNA-polimerase. b) UAC. c) W - A - T - S - O - N - E - C - R - I - C - K. d) A protena no ser formada, pois foi alterado o cdon de iniciao. 75. [C] 76. a) Observe a figura a seguir:

b) No. Sendo o cdigo gentico degenerado, diferentes trincas de nucleotdeos especificam o mesmo aminocido. 77. a) AUG AGU UGG CCU G b) Serina - triptofano - Prolina c) Metionina - Serina - Glicina 78. a) CAU CGG AUC b) Somente se formar o mesmo peptdeo se os cdons transcritos partir da fita complementar especificarem os mesmos aminocidos, devido degenerao do cdigo gentico.

79. AUG AGG CGA AUC e UAC UCC GCU UAG 80. a) TTA CAT CCG b) trs 81. a) ncleo e ribossomos. b) cessa o processo de traduo. 82. [C] 83. UGA GGC GAA e ACU CCG CUU 84. [A] 85. [B] 86. [B] 87. [A] 88. [D] 89. [D] 90. [B] 91. No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que contm. Assim, a diferenciao dos tecidos resulta principalmente da transcrio de genes diferentes, o que naturalmente produz uma composio de RNAm qualitativamente diferente de tecido para tecido. 92. [C] 93. [A] 94. As regies 2 e 4. Essas regies formam alas justamente por no possurem as seqncias de nucleotdeos complementares, que foram eliminadas aps o processo de transcrio. 95. [D] 96. [D] 97. [E] 98. [E] 99. Os genes que no codificam polipeptdeos transcrevem para produzir RNA ribossmico e RNA transportador. 100. a) Para que o genoma RNA (-) seja expresso em protenas na clula infectada, primeiro necessrio que seja transcrito em RNA complementar, o que feito, apenas, pela RNA replicase, que no existe na clula. Desta forma, o prprio vrus ter de j possuir a enzima em sua estrutura. Os vrus RNA (+) j funcionam como mensageiros na clula infectada, sendo diretamente traduzidos em protenas virais, inclusive a RNA replicase. b) Os vrus s existem em virtude de sua habilidade de utilizar a maquinaria metablica das clulas hospedeiras, direcionando-a para a formao de novas partculas virais. Portanto, os vrus s devem ter surgido aps o aparecimento das primeiras clulas. 101. [E] 102. Treonina - Arginina - Leucina 103. [C] 104. a) Do ponto de vista gentico, poderiam ocorrer trs tipos de albinismo, pois esto envolvidos trs pares de genes para a produo do pigmento no animal. Defeitos no gene A, impedem a formao do composto 1, interrompendo toda a cadeia de reaes que levam ao desenvolvimento da cor. Alteraes no gene B, acarretam a no formao do composto 2, resultando tambm na no formao da pigmentao. Mutaes no gene C, impedindo a sntese do composto 3, tambm causariam albinismo. b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo: AAbbCC x AABBcc

Gerao:

AABbCc - 100% pigmentados

c) Devido degenerao do cdigo gentico, um aminocido pode ser determinado por diferentes cdons. Assim, uma mutao em um gene, pode no causar qualquer alterao na protena codificada. 105. So molculas (DNA e RNA) que comandam, atravs da sntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a traduo do cdigo gentico em uma protena. 106. [C] 107. [C] 108. [C] 109. [D] 110. [B] 111. [D] 112. [E] 113. Experimento realizado com bactrias 'Pneumococo pneumoniae' sem cpsula (no patognicas) e com cpsula (patognicas). 1) bactrias pneumococo sem cpsula ratos = ratos vivos. 2) bactrias pneumococo com cpsula ratos = ratos mortos. 3) bactrias pneumococo sem cpsula + bactrias capsuladas mortas pelo calor ratos = ratos vivos. 4) bactrias sem cpsula + extrato de bactrias capsuladas mortas pelo calor ratos = ratos mortos. Concluso: Existe algum agente transformante no extrato de bactrias capsuladas mortas pelo calor que capaz de modificar as no capsuladas. Esse agente seria o cido Desoxirribonuclico (DNA). 114. Trataram o extrato de bactrias pneumococo capsuladas mortas pelo calor com a enzima desoxirribonuclease. Esta enzima hidrolisa o DNA, destruindo, portanto, o agente transformante capaz de modificar as bactrias sem cpsula no patognicas em capsuladas patognicas e letais para os ratos utilizados nos experimentos. 115. Vrus utilizados nos experimentos que serviram para demonstrar que o DNA de fato o material gentico. 116. 1) bactrias 'Escherichia coli' cultivadas em meio contendo P e S bactrias marcadas com os elementos radioativos. 2) Vrus bacteriofagos parasitam as bactrias marcadas e ficam tambm marcados com P no DNA e S na cpsula protica. 3) Vrus marcados parasitam bactrias no marcadas. 4) Antes da lise bacteriana o preparado levado ao liquidificador e centrifugado. 5) O sobrenadadante apresenta as cpsulas proticas marcadas com S e no precipitado h bactrias contendo DNA marcado com P. Concluso: O DNA viral a substncia capaz de TRANSFORMAR as bactrias em "fbricas" de novos vrus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substncia que controla a hereditariedade. 117. [C] 118. [A] 119. [E] 120. [A] 121. A mutao deve ter alterado um cdon que codificava um aminocido transformando-o em

um cdon de parada, que interrompe a leitura do ARNm pelo ribossoma. 122. [D] 123. O vrus da AIDS um retrovrus que, para multiplicar-se em clulas humanas, precisa transcrever o cdigo gentico contido em sua molcula de RNA, sintetizando um DNA que ser incorporado ao genoma da clula infectada. Para isso, emprega a transcriptase reversa contida no prprio vrus. 124. a) Os animais tm 2n = 63 cromossomos, porque so resultantes da unio de espermatozide, com n = 31 cromossomos, e vulo, com n = 32 cromossomos. b) Os cromossomos so de 2 espcies diferentes e, portanto, no ocorre pareamento dos chamados cromossomos homlogos, impossibilitando a meiose e a gametognese. 125. a) no tubo B a densidade intermediria devido a presena do istopo normal e do istopo pesado, dada a caracterstica do DNA ser semiconservativo. b) na faixa superior, h X de DNA, com densidade menor(istopo normal) 126. REPLICAO para que possa ser transmitido descendncia e TRANSCRIO, ou produo do RNA, para controlar as atividades celulares atravs da sntese de protenas. 127. A replicao do DNA sempre CONSERVA, nas molculas-filhas, metade da molcula-me. 128. a) TTACCGTAG b) UUACCGUAG 129. As mutaes ocorrem aleatoriamente, com uma taxa mdia constante. Logo, a variabilidade gentica diretamente proporcional antiguidade, o que confirma que nosso ancestral comum mais recente viveu na frica. 130. a) C = G = 29% e A = T = 21%. b) Porque a proporo de bases apresentada refere-se s duas cadeias da molcula de DNA, no sendo possvel determinar a proporo de citosina na cadeia que ser transcrita. 131. a) Os 'corrimos' correspondem a uma sucesso alternada de fosfato e desoxirribose (acar). Os 'degraus' so constitudos por pares de bases nitrogenadas, unidas por pontes de hidrognio, onde adenina pareia com timina, e citosina com guanina. b) O DNA realiza a transcrio, isto , produz o RNA mensageiro, que conduz os cdons para a sntese da protena nos ribossomos. c) As protenas podem ser diferenciadas pelo nmero, tipos e seqncias de seus aminocidos. 132. a) DNA cadeia complementar: 30A-20C-12T-10G cadeia ativa: 30T-20G-12A-10C RNA-mensageiro: 30A-20C-12U-10G Portador, o RNA-m ter 12 uracilas e 10 guaninas. b) A cadeia ativa apresenta 72 bases. Cada aminocido codificado por um cdon constitudo por 3 bases. Da conclumos que 72 bases formam 24 cdons que produziro uma cadeia polipeptdica com 24 aminocidos. 133. a) Replicao: no interfere; no h alteraes na incorporao de timidina marcada no DNA. Transcrio: no interfere; no h alterao na incorporao de uridina marcada no RNA. Traduo: interfere; esta etapa bloqueada porque h uma queda acentuada na incorporao de aminocido marcado na protena. b) Duas dentre as ligaes ou interaes: - ponte dissulfeto - ponte de hidrognio - foras de van der Walls - interaes hidrofbicas - interaes eletrostticas 134. a) As protenas obtidas possuam apenas um tipo de aminocido porque o DNA utilizado apresentava um nico tipo de cdon (AGC). b) O tipo de aminocido utilizado na produo da protena poder variar dependendo do local onde os ribossomos iniciam a traduo do cdigo gentico. O aminocido utilizado a serina quando a leitura comea no A, do cdon AGC. O aminocido a alanina quando a leitura comea no G, do cdon GCA. O aminocido utilizado a glutamina, quando a leitura comea no C, do cdon CAG. 135. a) 3'TACGCA5'.

b) 5'AUGCGU3'. O RNA que ser utilizado na traduo o RNAm (RNA mensageiro). 136. No necessariamente, pois a substituio de bases nitrogenadas na cadeia do DNA poder determinar os mesmos aminocidos, na mesma ordem, em uma protena, j que o cdigo gentico degenerado. 137. [D] 138. [B] 139. [B] 140. [A] 141. [B] 142. [C] 143. [C] 144. [D] 145. [A] 146. 01+04+08+16=29 147. [D] 148. [B] 149. [A] 150. [C] 151. [C] 152. [A] 153. [E] 154. [D] 155. [C] 156. 02 + 08 = 10 157. [A] 158. [A] 159. [D] 160. [A]

RESUMO
Nmero das questes: documento banco 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 8704 37451 4628 50178 18663 29882 52196 3470 18633 25237 2927 2995 2998 3006 3041 3060 4636 18578 30594 34040 490 3042 3044 3053 31409 35844 367 2915 2917 3000 3005 3008 3010 3037 3045 3057 3412 3418 4612 25236 35758 36745 54468 8 588 1553 4008 4047 4526 4861 18332 18438 21011 21059 24915 24943 25031 25150 29885 32029 32182 32441 34926 35325 36940 37334 37457 41700 41737 41879 52353 54469 54470 54471 54472 42421 fixo 8704 37451 4628 50178 18663 29882 52196 3470 18633 25237 2927 2995 2998 3006 3041 3060 4636 18578 30594 34040 490 3042 3044 3053 31409 35844 367 2915 2917 3000 3005 3008 3010 3037 3045 3057 3412 3418 4612 25236 35758 36745 54468 8 588 1553 4008 4047 4526 4861 18332 18438 21011 21059 24915 24943 25031 25150 29885 32029 32182 32441 34926 35325 36940 37334 37457 41700 41737 41879 52353 54469 54470 54471 54472 42421

77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159

54475 181 366 411 2926 3013 3052 3056 4674 11474 18370 18482 18514 20917 24953 25064 25220 25322 37343 37676 41963 42077 42266 54474 63167 370 2913 37435 1407 2919 3059 3413 3417 3434 3435 3436 3465 3466 3467 3468 3469 25286 33635 54477 54481 335 42111 50345 52306 368 369 410 54463 54466 54467 42433 62893 54476 63592 372 50279 58381 42463 63839 63061 58379 61430 54309 52242 52287 54310 52377 54462 42460 50256 64134 42517 54464 50339 64355 50196 64163 52189

54475 181 366 411 2926 3013 3052 3056 4674 11474 18370 18482 18514 20917 24953 25064 25220 25322 37343 37676 41963 42077 42266 54474 63167 370 2913 37435 1407 2919 3059 3413 3417 3434 3435 3436 3465 3466 3467 3468 3469 25286 33635 54477 54481 335 42111 50345 52306 368 369 410 54463 54466 54467 42433 62893 54476 63592 372 50279 58381 42463 63839 63061 58379 61430 54309 52242 52287 54310 52377 54462 42460 50256 64134 42517 54464 50339 64355 50196 64163 52189

160

42445

42445