Você está na página 1de 88

GENIRA PEREIRA DE ANDRADE

DIAGNSTICO FITOSSANITRIO DA CULTURA DO INHAME (DIOSCOREA SPP.) EM REAS PRODUTORAS DO NORDESTE DO BRASIL

Tese

apresentada

ao

Programa

de

Ps-

Graduao em Fitopatologia da Universidade Federal Rural de Pernambuco, como parte dos requisitos para obteno do grau de Doutor em Fitopatologia.

RECIFE PE, BRASIL FEVEREIRO, 2007

DIAGNSTICO FITOSSANITRIO DA CULTURA DO INHAME (DIOSCOREA SPP.) EM REAS PRODUTORAS DO NORDESTE DO BRASIL

GENIRA PEREIRA DE ANDRADE

COMIT DE ORIENTAO Prof Dr. Gilvan Pio Ribeiro - Orientador Prof Dr Lilia Willadino Co-orientadora Prof Dr. Pricles de Albuquerque Melo Filho Co-orientador

RECIFE PE, BRASIL FEVEREIRO, 2007

DIAGNSTICO FITOSSANITRIO DA CULTURA DO INHAME (DIOSCOREA SPP.) EM REAS PRODUTORAS DO NORDESTE DO BRASIL

GENIRA PEREIRA DE ANDRADE

Tese defendida e aprovada pela Banca Examinadora em 20 de maro de 2007

ORIENTADOR: _________________________________________ Prof Dr. Gilvan Pio Ribeiro (UFRPE) EXAMINADORES: _______________________________________ Prof Dr Uided Maaze Tibrcio Cavalcante

(UFPE) ___________________________________________
Dr Roseane Cavalcanti dos Santos (Embrapa Algodo) _________________________________________ Prof Dr Luiza Suely Smen Martins (UFRPE)

____________________________________________
Prof Dr Elineide Barbosa da Silveira (UFRPE)

______________________________________________
Prof Dr. Pricles de Albuquerque Melo Filho

(UFRPE)

RECIFE PE, BRASIL FEVEREIRO, 2007

quele que me d a cada dia oportunidade de resgatar a sabedoria e a bondade como entidade do Universo (DEUS)

AG RAD E O

Aos meus pais Geni Pereira de Andrade (in memorian) e Otaviano Dionzio de Andrade, pela confiana, carinho, amor e

compreenso que me guiaram na vida

Aos meus irmos, em especial a Osmar (in memorian), Aldo Oldaci e Pedro Odair Pereira de Andrade, pela colaborao carinho e amizade

OFEREO

Ao meu filho Accio Pereira de Andrade Farias, pela pacincia e colaborao em todos os momentos DEDICO

Amars o Senhor teu Deus, com todo teu corao, com toda tua alma e com toda a tua mente (Evg. S. Mateus 22: 37)

AGRADECIMENTOS

A Deus, pela fora, determinao e nimo para perseverar diante dos obstculos para alcanar a meta;

Universidade Federal Rural de Pernambuco, e a Coordenao do Programa de Ps-Graduao em Fitopatologia pela oportunidade de realizao do Curso de Doutorado;

Ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico CNPq, pelo apoio financeiro;

Ao Senhor Benoit Le Hir da Condado Agroexportadora Ltda e aos produtores de inhame dos Estados de Pernambuco e da Paraba, em especial, aos senhores Clcio Lucena e Valdenir dos municpios de Conde - PB e So Joaquim do Monte PE, respectivamente, pelo apoio concedido durante as coletas de material;

Aos Pesquisadores Philippe Vernier e Denis Filloux do Centre de Coopration Internationale en Recherche Agronomique pour le Developpement - CIRAD, pela colaborao nas atividades de campo e anlises moleculares, respectivamente;

Ao Professor Gilvan Pio Ribeiro pelos ensinamentos, orientao, confiana, amizade e excelente exemplo de tica, integridade e profissionalismo a ser seguido;

vi

Dra. Roseane Cavalcanti dos Santos, Pesquisadora da Embrapa Algodo, e Dra. Ana Vernica Silva do Nascimento, pela preciosa colaborao e apoio;

Aos professores Romero Marinho de Moura, Maria Menezes, Rosa de Lima Ramos Mariano, Tnia de Arruda Falco, Lilia Willadino e Pricles de Albuquerque Melo Filho pelos valiosos ensinamentos, incentivo, confiana, dedicao, amizade e exemplos de integridade e profissionalismo a serem seguidos;

A Ana Maria, Marcos e Regina Buccini Pio Ribeiro, pela confiana, amizade, especialmente pelo apoio incondicional nas vrias fases da minha vida;

Aos amigos Robson Jos do Nascimento, Antonia Alice Costa Rodrigues, Maria Anglica Guimares Barbosa e Adriana Melo pela saudvel convivncia, companheirismo, apoio e amizade no decorrer do Curso;

A toda equipe do Laboratrio de Fitovirologia em especial a Amanda Soares, Diego Xavier e Andr Xavier, pela boa convivncia, colaborao e amizade e ao estagirio Thiciano Miranda do Laboratrio de Fitonematologia pela colaborao, apoio e amizade.

vii

SUMRIO Pginas

AGRADECIMENTOS.................................................................................. SUMRIO................................................................................................... RESUMO.................................................................................................... ABSTRACT................................................................................................ CAPTULO I INTRODUO GERAL..................................................... REFERNCIAS BIBLIOGRFICAS.......................................................... CAPTULO II Anlise dos principais problemas fitossanitrios do inhame em Pernambuco e Paraba, ........................................................ RESUMO.................................................................................................... ABSTRACT................................................................................................ INTRODUO........................................................................................... MATERIAL E MTODOS.......................................................................... RESULTADOS E DISCUSSO................................................................. LITERATURA CITADA.............................................................................. CAPTULO III - Infeco simples e mista por duas espcies de potyvirus e um badnavirus em Dioscorea spp. no Nordeste do Brasil................................................................................................ RESUMO........................................................................................... ABSTRACT............................................................................................. INTRODUO. ......................................................................................... MATERIAL E MTODOS...... ................................................................... RESULTADOS E DISCUSSO.. ............................................................ viii

vi

viii x xii 01 15

24 25 26 31 32 34 36

45 46 47 48 50 54

AGRADECIMENTOS.................................. ............................................... REFERNCIAS BIBLIOGRFICAS ........................................................ CONCLUSES GERAIS ...........................................................................

58 58 70

ix

RESUMO

O inhame (Dioscorea spp.) tem sido afetado por a vrios problemas fitossanitrios, que se manifestam na lavoura e durante o transporte e/ou armazenamento. uma cultura de elevada importncia scio-econmica para a regio Nordeste do Brasil, inclusive com potencial de expanso via exportao de tberas, especialmente para a Europa. Foi efetuada uma avaliao do

desenvolvimento de doenas e pragas em importantes reas produtoras, bem como um estudo da qualidade do material de propagao utilizado pelos produtores. Foram visitados sete municpios de Pernambuco e trs da Paraba, totalizando 30 propriedades. Para avaliao da ocorrncia das doenas da parte area e danos causados por lagarta, foram marcadas em cada campo, 5 fileiras de 10 plantas e mais 30 plantas, escolhidas aleatoriamente, para anlise de viroses, as quais foram avaliadas um ms antes e no perodo da colheita. Para extrao dos nematides foi usado mtodo de centrifugao rpida associadoao de Jenkins, os quais foram identificados por suas estruturas observadas ao microscpio tico. Os fungos detectados foram isolados e identificados e observando-se suas estruturas reprodutivas. Para identificao dos vrus foram efetuadas observaes ao microscpio eletrnico de transmisso, teste triple antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA), com anti-corpos policlonais e monoclonais especficos para Yam mosaic virus (YMV), obtidos do IITA, Nigria e reaao de PCR (polimerase chain reaction) com oligonucleotdeos degenerados para

deteco

de

badnavrus

duplex reverse

transcription

(RT)-PCR com

oligonucleotdeos especficos para YMV e Yam mild mosaic virus (YMMV). Os produtos de PCR e RT-PCR foram purificados e seqenciados para validao dos testes usados na deteco de badnavrus e identificao dos potyvrus, por anlise comparativa com as seqncias disponveis no GenBank. Ficou comprovada a ocorrncia de pinta preta, causada por Curvularia eragrostidis em todas as reas estudadas, com maior intensidade na cv. Inhame-da-Costa do complexo D. cayennensis-D. rotundata, enquanto que o ataque de lagarta das folhas (Pseudoplusia oo), presente em todos os campos, teve maior severidade na cv. So Tom de D. alata. As tberas-semente de ambas as espcies de inhame, coletadas em cinco propriedades representativas das reas de cultivo em Pernambuco e Paraba, aps 60 dias de armazenamento, apresentaram srios problemas de Podrido Verde, causada por Penicillium sclerotigenum, cochonilhas (Planoccocus sp.) e brocas das tberas (Araecerus fasciculatus). Foram identificados os potyvrus YMV e YMMV, ocorrendo em infeco simples e mista com badnavrus, constituindose o primeiro registro detalhado com informaes moleculares destes vrus no Brasil.

xi

ABSTRACT

The yam (Dioscorea spp.) is affected by several diseases and pests occurring in field and/or during transport and storage. It is a crop with a high social economic importance in Northeast of Brazil, showing a good expansion potential by tuber export, especially to Europe. An evaluation of disease and pest development in important producing areas was undertaken, as well as a study on the quality of tuber seed used by the growers. Visits to seven counties of Pernambuco and three of Paraba, totaling 30 farms were done. In order to evaluate the occurrence of diseases and the damages caused by pests under field conditions, in each field five lines of 10 plants were marked, while for virus evaluation, 30 plants were randomly selected. The plants were analyzed 30 days before and at the harvest day. The nematodes were extracted by association the Jenkins method and identified by their structures under light microscope. For fungus identification, isolation and inoculation were done and the structures were observed under light microscope. For the viruses, observation under electron microscopy, triple antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA), with polyclonal and monoclonal antibodies specific to Yam mosaic virus (YMV), from IITA, Nigeria, and a polymerase chain reaction (PCR) with degenerated primers for detecting badnavirus and duplex

reverse transcription (RT-PCR) with specific primers to YMV and Yam mild mosaic virus (YMMV) were used. The PCR and RT-PCR products were purified and sequenced in order to validate the tests xii used for detecting badnavirus and

identification of the potyviruses by the comparative analyses of the sequences available in the GenBank. It was observed the leaf spot caused by Curvularia

eragrostidis in all areas studied, with a higher intensity on cv. Inhame-da-Costa of D. cayennensis-D. rotundata complex, whereas the damages caused by leaf worm (Pseudoplusia oo), present in all fields, were higher on cv. So Tom of D. alata plants. The seed tubers of both yam species, collected in five farms representative of the growing areas of Pernambuco and Paraba, after 60 days of storage, presented serious problems of green rot caused by Penicilium sclerotigenum, mealybugs (Planoccocus sp.) and tuber worms (Araecerus fasciculatus). It was identified the potyviruses YMV and YMMV, occurring in single and mixed infections with badnavirus, consisting the first detailed report with molecular information on these viruses in Brazil.

xiii

CAPTULO I

Introduo Geral

INTRODUO GERAL
Aspectos gerais da cultura do inhame O inhame (Dioscorea spp.) uma monocotilednea, herbcea, pertencente famlia Dioscoreaceae, cujo rgo de reserva conhecido como tbera comercial ou simplesmente tbera. O gnero Dioscorea possui cerca de 600 espcies originrias da frica, sia ou Amrica do Sul (COURSEY, 1976; SANTOS, 1996). As espcies D. cayennensis Lam. e D. rotundata Poir.,

internacionalmente conhecidas como inhame amarelo (yellow yam) e inhame branco (white yam), originaram-se no continente africano

(COURSEY, 1976; AMUSA et al., 2000). Estas duas espcies tm sido reunidas num complexo denominado D. cayennensis - D. rotundata (MALAURIE et al., 1998). O Inhame-da-Costa ou Car-da-Costa, cultivar mais utilizada no Brasil, apresenta as caractersticas do inhame branco e pertence a este complexo, sendo referido como uma cv. de D. cayennensis (SILVA, 1971; SANTOS, 1996; MOURA, 2005) ou de D. rotundata (PIORIBEIRO et al., 2005; 2006). Entre as espcies mais cultivadas que tiveram origem no continente asitico, destaca-se D. alata L. (AMUSA et al., 2000; MENEZES, 2002), referida como inhame-gua (water yam), representada no Nordeste do Brasil pela cv. So Tom (SANTOS, 1996).

Antes da introduo de outras culturas alimentares fornecedoras de razes, o inhame era a principal fonte de carboidratos para os povos da frica Ocidental e Central (OZEROL; MASSEY, 1984; CARMO, 2002;). Atualmente, os maiores produtores de inhame so pases tropicais da frica Ocidental, principalmente Nigria e Costa do Marfim, onde se concentram 91% do total que produzido no mundo, 39.897.327 t/ano, com uma rea plantada de 4.438.362 ha. A Nigria, sozinha, assume 70% do que se produz mundialmente, acima de 26 milhes t/ano, com uma produtividade mdia de 19.553 kg/ha. Entretanto, pases como o Japo, que dispe de maior nvel tecnolgico, chegam a alcanar uma produtividade superior a 22.000 kg/ha (FAO, 2005). Alm de alimento humano, o gnero Dioscorea apresenta espcies que fornecem produtos de uso farmacolgico e industrial, a exemplo de contraceptivos orais e cosmticos (PEIXOTO NETO et al., 2000; MENDES, 2005; MOURA, 2005). O inhame medicinal D. floribunda Mart. et Gal. uma fonte importante de diosgenina, empregada na sntese da cortisona, e em outros compostos de corticosterides teis para tratamento alergnicos

(CARMO, 2002; MOURA, 2005). As propriedades de algumas espcies de Dioscorea so valiosas pela produo de tanino, substncias anti-alrgicas, sapogeninas esteroidais e alcalides (COURSEY, 1976; PEDRALLI, 2003). A produo mundial dessa cultura aumentou em torno de 40% entre 1961 a 1999 (FAO, 2005), o que provavelmente se deu devido a agroindstria farmacutica que se tornou um campo do agronegcio do

inhame, considerado bastante amplo que envolve a extrao e uso dos derivados da diosgenina (PEDRALLI, 2003). O Brasil produz cerca de 230.000t de inhame anualmente com rea plantada de 25.000ha, ficando em segundo lugar em volume produzido na Amrica do Sul, ultrapassado apenas pela Colmbia com 255.000t/ano (FAO, 2005). Por no ser includa no rol das culturas nobres, a explorao do inhame no contemplada nas polticas agrcolas importantes, apresentando carncia de apoio tcnico e de crdito, normalmente destinados s monoculturas de produtos exportveis (PEIXOTO NETO et al., 2000; RITZINGER et al., 2003). Apesar de ser referida no cardpio de diversas civilizaes ao longo dos sculos e estar presente desde o incio da colonizao brasileira so os nordestinos quem, praticamente, assumem a demanda do inhame no Brasil. Dessa forma, a regio Nordeste apresenta-se como a maior produtora, destacando-se os Estados de Alagoas, Bahia, Pernambuco e Paraba onde o inhame normalmente cultivado, utilizando-se mo de obra familiar e baixos nveis tecnolgicos, que no tem permitido alcanar produtividade satisfatria (SANTOS, 1996; MOURA, 2002; MENDES, 2005). Em muitos casos, os produtores no dispem de capital suficiente para aquisio de terras frteis e utilizam equipamentos e maquinrios obsoletos. As novas tecnologias que poderiam ser adotadas por produtores com este perfil apresentam dificuldades na sua implementao, desde o alto custo, at o fato dos possveis usurios serem destitudos de formao e educao

tecnolgica. Assim, usam seus prprios conhecimentos e no as prticas e tcnicas resultantes de pesquisa e novos conhecimentos provados pela cincia (RITZINGER et al., 2003; SANTOS; MACDO, 2006). Embora seja considerada, na maioria dos casos, uma cultura de subsistncia, o inhame tem grande importncia scio-econmica no cenrio da agricultura familiar no Nordeste do Brasil, com um significativo potencial de desenvolvimento, contribuindo para alimentao humana, beneficiando populaes carentes, alm de ser fonte de renda para pequenos e mdios produtores (MENDES, 2005; SANTOS; MACDO, 2006). O destino da produo varia de acordo com a qualidade do produto e da poca do ano, podendo abastecer vrios estados do Nordeste e de outras regies, ou ainda, seguir a rota da exportao. Da produo brasileira de inhame 4.000t/ano, so exportadas, enquanto que outros pases sul-americanos destinam sua produo inteiramente ao mercado interno (FAO, 2005). Dessa forma, esta cultura se destaca pelo seu alto valor comercial, com forte potencial no agronegcio de exportao para Europa, especialmente, Frana e Inglaterra e para os Estados Unidos (RITZINGER et al., 2003; SANTOS; MACDO, 2006). A maior dificuldade para comercializao do inhame no exterior, basicamente est no material de baixa qualidade sanitria e colheita precoce, resultando em produto inaceitvel para tal demanda (PEIXOTO NETO et al., 2000; MENDES, 2005). Em Pernambuco, as principais reas cultivadas encontram-se no Litoral e Zonas da Mata Norte e Sul, tendo os municpios de Aliana,

Condado, Goiana, Igarassu, Itapissuma, Itamb, Barra de Guabiraba, Bonito, Sair e So Joaquim do Monte, os responsveis pela maior parte da produo (VEIGA; MOURA; SENA 1970; CEAGESPE, 2002), e de onde se verifica maior fluxo de exportao, tanto para outros Estados como para outros pases (MELO, 1994; SANTOS; MACDO, 2006).

Doenas do inhame Dentre os entraves enfrentados pelos produtores de inhame, tanto no Brasil quanto nos demais pases produtores, esto as elevadas perdas devido s diversas doenas que ocorrem no campo, reduzindo a produo e a qualidade do produto em ps-colheita, agravadas por condies de armazenamento e transporte inadequadas (MOURA; TEXEIRA, 1980; MOURA, 2002; RITZINGER et al., 2003). Entre as doenas, destacam-se as causadas por nematides, fungos e vrus (RITZINGER et al., 2003; SANTOS; MACDO, 2006). Sendo uma cultura propagada vegetativamente, atravs de tberas sementes, vrios agentes fitopatognicos sobrevivem e se disseminam por esta via, sendo comum o acmulo de patgenos em anos sucessivos (MOURA; COLHO; PIO-RIBEIRO,1978; MENEZES, 2002). No campo, os fungos que infectam o inhame, mais prevalentes em nvel mundial so Curvularia eragrostidis (P. Henn) Mayer e Colletotrichum sp. que causam a Queima e Antracnose, respectivamente, doenas da parte area da planta, inicialmente com sintomas na forma de manchas

necrticas nas folhas. Com o desenvolvimento, a necrose atinge grande parte ou toda a folhagem e ramos novos (MENEZES, 2002). A podrido verde, causada por Penicillium sclerotigenum Yam., outra doena importante de natureza fngica, a qual ocorre em tberas colhidas especialmente, naquelas que sofreram ferimentos durante a colheita e transporte e/ou apresenta danos causados por nematides (MENEZES, 2002; MOURA, 2002; RITZINGER et al., 2003; MOURA; OLIVEIRA; TORRES, 2006; SANTOS; MACDO, 2006). A doena conhecida como casca preta ou casca seca apresenta grande importncia econmica na regio Nordeste (MOURA, 2002; 2005). Os sintomas se manifestam no campo e continuam a se desenvolver durante o armazenamento, sendo levado em considerao na classificao das tberas comerciais, constituindo-se um dos principais fatores

responsveis pela queda da qualidade. Esta doena causada por duas espcies de nematides. A primeira registrada no Brasil foi Scutellonema bradys (Stainer e LeHew), Andrssy (MOURA; COELHO; PIO-RIBEIRO 1978; MOURA; TEIXEIRA, 1980), que tem sido observada na maior parte do mundo onde se cultiva o inhame (MOURA, 2005; RITZINGER et al., 2003). A segunda, Pratylenchus coffeae (Zimmermann) (Filipjev & Stekhoven), atualmente a mais frequentemente encontrada em campos de cultivos comerciais na Regio Nordeste do Brasil (MOURA, 2002). Outras espcies de nematides infectam o inhame tais como, Meloydogine incognita (Kofoid & White) Chitwood; M. javanica (Treub.)

Chitwood e M. arenaria (Neal) Chitwood, sendo as duas primeiras de maior predominncia em cultivos comerciais de Inhame-da-Costa no Nordeste brasileiro (MOURA, 2002; RITZINGER et al., 2003). Segundo Moura, (2005), em D. alata no h registro de infeco por nematide no Nordeste. Contudo, recentemente foi detectada a ocorrncia de S. bradys nessa

espcie no Estado de So Paulo (MOURA; OLIVEIRA; TORRES 2006). Diversas viroses tm sido descritas na cultura do inhame causadas por membros dos gneros Potyvirus, Badnavirus, Cucumovirus e

Potexvirus. Destacam-se pela importncia e distribuio geogrfica, os potyvrus e badnavrus, ocorrendo em infeces simples e mistas (MUNFORD; SEAL, 1997; PHILLIPS; BRUNT; HULL 1999; YANG et al., 2003; ODU et al., 2006). Atravs da anlise de seqncias de aminocidos de seis isolados do Yam mosaic virus (YMV), Duterme et al. (1996) confirmaram este vrus como membro do gnero Potyvirus. Em estudo realizado com o YMV (Isolado Ivory Coast) foi verificado que o RNA genmico possui 9.608 nucleotdeos (nt) e contm uma open reading frame (ORF) que codifica para uma poliprotena de 3.103 aminocidos. A regio 5 do YMV que precede a ORF de 134 nt enquanto que a regio 3 no traduzida (UTR) possui 165 nt excluindo a poli A (ALEMAN et al., 1996; DUTERME et al., 1996). Um outro potyvrus, Yam mild mosaic virus (YMMV), foi encontrado amplamente difundido em pases da frica Ocidental (MUNFORD; SEAL,

1997). Em nvel mundial, as viroses causadas pelas espcies do gnero Potyvirus tm acarretado importantes perdas econmicas na cultura do inhame (MALAURIE et al., 1998). A presena de badnavrus em Dioscorea spp. tem sido detectada por Microscopia Eletrnica de Transmisso (MET), teste sorolgico e molecular. Embora se saiba que pelo menos duas espcies virais deste gnero infectam o inhame, h ainda necessidade de desenvolvimento de testes que permitam identificar os isolados ao nvel de espcie, em trabalhos de rotina, uma vez que somente com seqenciamento de todo o genoma viral tem sido possvel distingui-las (SEAL; MULLER, 2007) Apesar de existirem registros de vrus na cultura h bastante tempo em outras partes do mundo, no Brasil, poucas informaes encontram-se disponveis sobre as espcies que ocorrem em cultivos comerciais. O primeiro relato foi feito por vila et al., (1982), os quais detectaram a presena de um potyvrus na coleo de germoplasma no Estado da Bahia, o que no foi caracterizado por apresentar dificuldades na transmisso mecnica e por insetos, tendo sido observadas, por microscopia eletrnica, partculas e incluses tpicas de potyvrus. Recentemente, trabalhos apresentados em Congressos de Fitopatologia, relatam identificao das espcies YMV e YMMV de potyvrus e a deteco de badnavrus em inhame na regio Nordeste, ocorrendo em campos comerciais (BOARI et al., 2005; ANDRADE et al., 2006; PIO-RIBEIRO, et al., 2005; 2006).

10

Pragas do inhame As pragas mais comumente encontradas na cultura do inhame so: lagartas da folhagem, brocas do caule e da tbera e cochonilhas, sendo que as duas ltimas pragas ocorrem no armazenamento (RITZINGER et al., 2003; SANTOS; MACDO, 2006). A lagarta da folhagem (Pseudoplusia oo Cramer) pertencente ordem Lepidptera, famlia Noctuidae, considerada principal praga do inhame. Esse inseto apresenta colorao verde-claro, medindo de 25 a 35mm de comprimento e possui uma linha clara, branco-amarelada em toda a extenso lateral-mediana do corpo. Os cortes irregulares e arredondados entre as nervuras do limbo foliar e pelo acmulo de excrementos de cor negra, em forma de bolotas sobre as folhas, danos ocasionados na planta, demonstram a presena do inseto (RITZINGER et al., 2003). O adulto uma mariposa de hbito noturno, de cor marrom pardacenta, com duas manchas brancas e brilhantes, de formas irregulares e arredondadas, em cada asa anterior (VEIGA; MOURA; SENA, 1970; RITZINGER et al., 2003). As fmeas depositam os ovos sobre as folhas, as quais servem como alimento durante o desenvolvimento das lagartas, produzindo orifcios irregulares, cortes e rendilhamento no limbo foliar, provocando srios prejuzos cultura. O aparecimento das lagartas em campos de inhame est relacionado ao perodo de chuvas, ocorrendo tanto nos cultivos no irrigados como nos campos com irrigao por asperso. O ataque dessa praga causa reduo do limbo foliar, alterando a fotossntese, e

11

consequentemente

menor

desenvolvimento

das

tberas

baixa

produtividade (GARRIDO; JESUS; SOARES, 2003; RITZINGER et al., 2003). Outra praga que ataca o inhame a broca do caule Xystus arnoldi (Kirby), que teve a primeira constatao na cultura no Estado da Paraba e a broca da tbera, Araecerus fasciculatus (Degeer) (EMEHUTE; ECHENDU, 1992) sendo esta ltima praga de armazenamento. A ocorrncia dessas pragas nos cultivos conduzidos na mesorregio da Mata Paraibana, zona produtora dessa dioscoreacea no muito comum (SANTOS, 2006). O adulto da broca do caule um pequeno besouro de colorao preto brilhante com aproximadamente 4mm de comprimento e 3,5mm de largura. Os machos apresentam um par de espinhos prosternais, recurvados e pontiagudos e uma profunda cavidade de 0,5mm de dimetro entre as duas patas anteriores. A larva da broca de cor branco-leitosa, com cabea escura e apresentando fortes mandbulas bem desenvolvidas (PEIXOTO NETO et. al., 2000; SANTOS, 2006). Quando ocorre o ataque dessa praga, observa-se o secamento progressivo do ramo principal acima do colo, comprometendo o crescimento e acarretando a morte da planta (SANTOS, 2006).

Identificao de pragas do inhame e diagnose de doenas A identificao de pragas, de forma geral, realizada a partir da coleta de insetos e caros com uso de armadilhas, seguindo-se da

12

montagem indicada na literatura para famlia ou ordem. A avaliao inicial realizada utilizando-se descries j existentes e efetuando-se

comparaes com exemplares depositados em colees entomolgicas que pertenam a instituies confiveis sem dispensar o uso das chaves de identificao referidas para a ordem da praga encontrada (GALLO et al., 2002). A diagnose precisa de uma doena um requisito essencial para a recomendao de medidas de controle. O ideal que um teste diagnstico proporcione resultados rpidos e precisos a baixo custo, o que geralmente no acontece na prtica, uma vez que, a rapidez e preciso dos testes, geralmente, so inversamente proporcionais ao seu custo (ZERBINI; CARVALHO; ZAMBOLIM, 2002). Para identificao de fungos, bactrias, fitoplasmas e nematides os mtodos clssicos so importantes, sem descartar as ferramentas modernas, especialmente quelas advindas com a Biologia Molecular. Em trabalhos de rotina, as observaes dos sintomas e sinais so suficientes para uma diagnose segura de muitas doenas, especialmente as causadas por fungos e nematides, embora o isolamento e inoculao em hospedeiros susceptveis sejam necessrios em determinados casos, fazendo com que a diagnose leve dias ou semanas para ser efetuada (SOUTO; TESSMAN; NUNES, 2000). Muitas vezes, preferem-se testes como os sorolgicos e moleculares que proporcionam, em geral, respostas rpidas (04 a 24 horas) e precisas, apesar dos custos bem mais elevados.

13

Estes so especialmente indicados para os casos de fitobacterioses e fitoviroses em trabalhos de rotina e, em especial, quando se trata de espcie nova ou pouco conhecida, para se fazer uma identificao de forma segura e, se necessrio, adoo de uma nova nomenclatura (SOUTO; TESSMAN; NUNES, 2000; ZERBINI; CARVALHO; ZAMBOLIM, 2002). Os testes mais comumente empregados para a diagnose das fitoviroses podem ser divididos em trs grupos: a) biolgicos baseados nas propriedades biolgicas dos vrus, como morfologia da partcula e gama de hospedeiros; b) sorolgicos, com base na deteco da protena capsidial do vrus; c) testes moleculares, os quais so fundamentados na deteco e/ou anlise do cido nuclico viral. Os testes biolgicos podem auxiliar em diagnose de rotina, porm, normalmente se usa um conjunto de mtodos quando se deseja uma informao mais precisa (ZERBINI; CARVALHO; ZAMBOLIM, 2002). Com o desenvolvimento da Biologia Molecular, vrias tcnicas foram evidenciadas como ferramenta auxiliar para identificao de fitopatgenos, o que elevou consideravelmente a eficincia e segurana principalmente no que diz respeito taxonomia e classificao (ZERBINI; CARVALHO; ZAMBOLIM, 2002). Por meio dos estudos moleculares possvel detectar indivduos e suas diferenas que muitas vezes so causadas por alteraes de um nico par de bases, tendo aplicaes imediatas na identificao e caracterizao de linhagens e gentipos (SOUTO; TESSMAN; NUNES, 2000).

14

Em inhame, a visualizao dos sinais do patgeno, constitudos por partculas e incluses virais, efetuada atravs da observao ao MET, considerada uma ferramenta importante, especialmente, quando no se dispe de anti-soros ou primers especficos para realizao de testes sorolgicos e PCR (Polymerase Chain Reaction), respectivamente. Com a diagnose efetuada apenas com a visualizao das partculas e/ou incluses virais, se pode chegar ao conhecimento do gnero a que pertence o isolado em estudo, uma vez que todas as espcies pertencentes a um determinado gnero possuem a mesma morfologia (ZERBINI; CARVALHO; ZAMBOLIM, 2002). Anlise ao MET tambm tem sido usada, para indexao de material de micropropagao quando se quer confirmar a ausncia de vrus (LAWSON et al., 1973; WATERWORTH; LAWSON; KAHN, 1974). A anlise de gama de hospedeiros um mtodo biolgico que consiste na inoculao do isolado viral em plantas de uma srie de espcies ou variedades botnicas ou cultivares, ditas indicadoras, e observao das reaes de cada uma delas. A diagnose realizada comparando os sintomas observados com queles relatados na literatura (ZERBINI; CARVALHO; ZAMBOLIM, 2002). Em inhame, apesar de ter sido usado em vrios trabalhos, este mtodo no tm mostrado resultados satisfatrios devido s dificuldades apresentadas pelos vrus que infectam esta cultura em serem transmitidos experimentalmente, seja por inoculao mecnica, seja com uso de vetores (PIO-RIBEIRO et al., 2006).

15 O mtodo sorolgico enzyme-linked immunosorbent assay (ELISA)

um teste de imunoadsoro que emprega uma enzima ligada ao anticorpo, a qual confere maior sensibilidade, pela reao com o substrato nas amostras em que ocorre a reao sorolgica. Este teste capaz de identificar cerca de 100pg de antgeno em uma amostra, enquanto a dupla difuso em gar exige mais que 2 g de antgeno para a deteco (ALMEIDA, 2001; ZERBINI; CARVALHO; ZAMBOLIM, 2002). Em inhame, o uso do teste ELISA para detectar e identificar vrus tem diminuido, pela dificuldade de obteno de anti-soros especficos de boa qualidade. Atravs das tcnicas de PCR e RT-PCR, que consistem na amplificao de seqncias DNA e cDNA, respectivamente, se atinge uma grande seletividade, sensibilidade e rapidez adequadas para deteco e identificao de fitovrus (SOUTO; TESSMAN; NUNES, 2000; ZERBINI; CARVALHO; ZAMBOLIM, 2002). Por outro lado, o sequenciamento do produto da PCR ou da RT-PCR permite a validao da tcnica como mtodo de diagnose, o que pode ser tambm obtido com hibridizao de cido nuclico, usando-se sondas quentes ou frias (MOWAT; DAWSON, 1987; ZERBINI; CARVALHO; ZAMBOLIM, 2002). Na cultura do inhame, PCR e RT-PCR tm sido as tcnicas preferidas para identificao dos vrus e diagnose das fitoviroses (MUNFORD; SEAL, 1997; YANG et al., 2003; ANDRADE et al., 2006; PIO-RIBEIRO et al., 2006). O presente trabalho teve como objetivo elaborar um diagnstico dos problemas fitossanitrios de reas produtoras de inhame em Pernambuco

e Paraba e caracterizar isolados virais obtidos desses Estados e da Bahia.

16

REFERNCIAS
ALEMAN, M. E.; MARCOS, J. F.; BRUGIDOU, C.; BEACHY, R. N.; FAUQUET, C. et al. The complete nucleotide sequence of Yam mosaic virus (Ivory Coast isolate) genomic RNA. Archives of Virology, New York, v. 141, n. 7, p. 1259-1278, 1996.

ALMEIDA, A. M. R. Deteco e quantificao de vrus por ELISA. In: ALMEIDA, A. M. R.; LIMA, J. A .A. (Eds.) Princpios e tcnicas de diagnose aplicadas em fitovirologia, Braslia, DF, 2001. p. 63-94.

AMUSA, N. A.; ADEGBITE, A. A.; MUHAMMED, S.; BAIYWU, R. A. Yam diseases and its management in Nigeria. African Journal of

Biotecnology, v. 2, n. 12, p. 497-502, 2000.

ANDRADE, G. P.; SILVA, A. K. S.; FILLOUX, D.; PIO-RIBEIRO, G.; KITAJIMA, E. W.; XAVIER, D. M. Planta de Dioscorea alata infectada com YMMV no estado de Pernambuco. Fitopatologia Brasileira, Braslia, DF, v. 31, p. S 344, 2006. (Resumo).

VILA, A. C.; GAMA, M. I. C. S.; KITAJIMA, E. W. Deteco de um Potyvirus em inhame (Dioscorea spp.) no Brasil. Fitopatologia Brasileira, Braslia, DF, v. 7, n. 1, p. 447-452, 1982.

17 BOARI, A. J.; AZEVEDO, V. G.; SILVA-MANN, R.; FRANCO-FILHO, E.;

KITAJIMA, E. W. Ocorrncia de Badnavirus e Potyvirus em inhame (Dioscorea sp.) no estado de Sergipe. Summa Phytopathologica, Jaguariuna, SP, v. 31, p. 35-36, 2005. (Resumo).

CARMO, C. A. S. Situao das culturas do taro e do Inhame no Estado do Esprito Santo. Vitria, ES: INCAPER, 2002. 7p.

COMPANHIA

DE

ENTREPOSTOS

ARMAZNS

GERAIS

DE

PERNAMBUCO CEAGESPE. Inhame. Pernambuco: CEAGESPE, 2002. 2 p. COURSEY, D. G. Yams - Dioscorea spp. (Dioscoreaceas). In: SIMMNONDS, N. W. Evolution of crop plants, New York, Ed. Longman, 1976. p. 70-74. DUTERME, O.; COLINET, D.; KUMMERT, J.; LEPOIVRE, P. Determination of the taxonomic position and characterization of Yam mosaic virus isolates based on sequence data of the 5-terminal part of the coat protein cistron. Archives of Virology, New York, v. 141, n. 6, p. 1067-1075, 1996.

EMEHUTE, J. K. U.; ECHENDU, N. T. C. Susceptibility of stored yam tubers (Dioscorea spp.) To infestation by Araecerus fasciculatus Degeer. Tropical Science, London, v. 32, n. 1, p. 99-103, 1992.

18 FAO. FAOSTAT Agricultural statistic database. Roma. World Agricultural

Information Center, 2005. Disponvel em: http://faostat.fao.org/faostat/form?collection=Production.Crops.Primary&Dom ain=Production&servlet=1&hasbulk=0&version=ext&language=EN Acesso em : 07/02/06.

GALLO, D.; NAKANO, O.; NETO, S. S.; CARVALHO, R. P. L; BAPTISTA, G. C.; FILHO, E. B.; PARRA, J. R. P. ZUCCHI, R.A. Coleta, montagem e conservao de insetos, In: GALLO, D. Entomologia Agrcola, So Paulo, SP, v. 10, p. 182-189, 2002.

LAWSON, R. H.; HEARON, S. S.; SMITH, F. F.; KAHN, R. P. Electron microscopy and separation of viruses in Dioscorea floribunda.

Phytopathology, Saint Paul, v. 63, p. 1435, 1973. (Abstract).

MALAURIE, B.; TROUSLOT, M-F.; BERTHAUD, J.; BOUSALEM, M.; PINEL, A.; DUBERN, J. Medium-term and long-term in vitro conservation and safe international exchange of yam (Dioscorea spp.) germplasm. EJB Eletronic Journal of biotechnology, London, v. 1, n. 3, p. 1-15 1998.

MELO, N. F. Cultivo in vitro de Car-da-Costa (Dioscorea cayennensis Lam.) aspectos e condies adequadas. Recife: UFRPE, 1994. 85p. Dissertao (Mestrado). Universidade Federal Rural de Pernambuco.

19 MENDES, R. A. Cultivando inhame ou Car da Costa. Cruz das Almas:

EMBRAPA, 26p. 2005. (Circular Tcnica, n. 4).

MENEZES, M. Condies epidemiolgicas de doenas fngicas na cultura do inhame. In: SIMPSIO NACIONAL SOBRE AS CULTURAS DO INHAME E DO TARO, 2., 2002, Joo Pessoa. Anais ... UFPB, 2002.

MOURA, R. M. Doenas do inhame da Costa. In: KIMATI, H.; AMORIM, L.; BERGAMIN-FILHO, A. E; CAMARGO, L. E. A. (Ed.) Manual de Fitopatologia: doenas das plantas cultivadas. 4 ed. v. 2, 2005, p. 415419.

MOURA, R. M. Problemas fitossanitrios do inhame no Nordeste e proposta para um sistema integrado de controle. In: In: SIMPSIO NACIONAL SOBRE AS CULTURAS DO INHAME E DO TARO, 2., 2002, Joo Pessoa. Anais ... UFPB, 2002. p.68-72.

MOURA, R. M.; TEIXEIRA, L. M. S. Aspectos morfolgicos de Scutellonema bradys (Steiner & Lehew, 1933) Andrassy, 1958 (Nematoda hoplolaiminae). Fitopatologia Brasileira, Braslia, DF, v. 5, p. 359-367, 1980.

MOURA, R. M.; COLHO, R. S. B.; PIO-RIBEIRO, G. Estudo etiolgico e efeito de 1,2,-dibromo-3-cloropropano no controle da casca preta do inhame

20 (Dioscorea cayennensis Lam.) para plantio. Fitopatologia Brasileira,

Braslia, DF, v. 3, p. 47-53, 1978.

MOURA, R. M.; OLIVEIRA, I. S.; TORRES, G. R. C. Primeiro assinalamento de Scutellonema bradys em Dioscorea alata no Brasil. Brasileira, Braslia, DF, v. 31, p. 506, 2006. (Resumo). Fitopatologia

MOWAT, W. P.; DAWSON, S. Detection of plant virus by ELISA using crude sap unfractionated antisera. Journal Virology Methods, Amsterdam, v. 15, p. 233-247, 1987.

MUMFORD, R. A., SEAL, S. E. Rapid Single-tube immunocapture RT-PCR for the detection of two yam potyviruses. Journal of Virological Methods, Amsterdam, v. 69, p.73-79, 1997.

ODU, B. O.; ASIEDU, R.; SHOYINKA, S. A.; HUGHES, J. D. A. Screening of water yam (Dioscorea alata L) genotypes for reactions to viruses in Nigria. Journal of Phytopathology, Berlim, v. 154, p. 716-724, 2006.

OZEROL, N. H.; MASSEY, H.

F. Specilization in the understanding of

production the root tropical potatos, yam and cocoyams. Root Crop, Austrlia, v. 15, p. 1-23, 1984.

PEDRALLI,

G.

Dioscoreaceae

Araceae:

aspectos

21 taxonmicos,

etnobotnicos e espcies nativas com potencial para melhoramento gentico. Revista Agropecuria, p. 1-7, 2003.

PEIXOTO NETO, P.A.S.; LOPES FILHO, J.; CAETANO, L.C.; ALENCAR, L.M.C.; LEMOS; E.E.B. Inhame: o Nordeste frtil. Macei, AL: EDUFAL, 2000. 88p.

PHILLIPS, R. W.; BRUNT, A. A.; HULL R. The parcial characterization of a Badnavirus infecting the greater Asiatic or Water yam (Dioscorea alata). Journal of Phytopathology, Berlim, v. 147, p. 434-439, 1999.

PIO-RIBEIRO, G.; ANDRADE, G. P.; FILOUX, D.; VERNIER, P.; MELOFILHO, P. A.; ALMEIDA, H. S. M.; XAVIER, A. S. Plantas de inhame em Pernambuco e Paraba apresentam infeces simples e mista por potyvrus e badnavrus. Fitopatologia Brasileira, Braslia, v. 31, p. S. 309, 2006. (Resumo).

PIO-RIBEIRO, G.; MELO-FILHO, P. A.; KITAJIMA, E. W.; LIMA, S. K.; ANDRADE, G. P.; DOMINGOS, C. A. Deteco de potyvrus em inhame em reas produtoras de Pernambuco e obteno de matrizes in vitro. Fitopatologia Brasileira, Braslia, DF, v. 30, p. S 183, 2005. (Resumo).

22 RITZENGER, C. H. S. P.; SANTOS FILHO, H. P.; ABREU, K. C. L. M.;

FANCELLI, M.; RITZENGER, R. Aspectos fitossanitrios da cultura do inhame. 2003, 39p. (Documentos EMBRAPA/SPI).

SANTOS, E. S. Inhame (Dioscorea spp.): aspectos bsicos da cultura. Joo Pessoa: EMEPA-PB, SEBRAE, 1996. 158p.

SANTOS, E. S. Manejo sustentvel da cultura do inhame. (Dioscorea sp.) no Nordeste do Brasil, Joo Pessoa, PB, 2006. Disponvel em: http://www.emepa.br/php, Acesso em: 15 dez. 2006.

SANTOS, E. S.; MACDO, L. S. Tendncias e potencialidades da cultura do Inhame (Dioscorea sp.) no Nordeste do Brasil, Joo Pessoa, PB, 2006. Disponvel em: http://www.emepa.org.br/ php Acesso em: 15 dez. 2006.

SEAL, S.; MULLER, E. Molecular analysis of a full-length sequence of a new yam badnavirus from Dioscorea sasibarensis. Archives of Virology, New York, v. 152, n. 4, p. 819-825, 2007

SILVA, A. A. A cultura do car-da-Costa. Fortaleza, CE, 1971. 66p. (Boletim Tcnico).

23 SOUTO, E. R.; TESSMAN, D. J.; NUNES, W. N. C. Mtodos de PCR

aplicados Fitopatologia. Fitopatologia Brasileira, Braslia, DF, v. 27, p. 22-46, 2000.

VEIGA, A. F. S. L.; MOURA, R. M.; SENA, R. C. Aspectos fitossanitrios do car inhame: variedade da Costa (Dioscorea cayennensis Lam.) no Nordeste do Brasil. Secretaria de Agricultura de Pernambuco - SAG-PE, 1970, 18p.

YANG, I. C.; HAFNER, G. J.; REVILL, P. A.; DALE, J. L.; HARDING, R. M. Sequence diversity of South Pacific isolates of Taro bacilliform virus and the development of a PCR-based diagnostic test. Archives of Virology, New York, v. 148, p. 1957-1968, 2003.

WATERWORTH, H. E.; LAWSON, R. H.; KAHN, R. P. Purification electron microscopy, and serology of Dioscorea latent virus. Journal Agriculture University Puerto Rico, v. 58, n. 3, p. 351-357, 1974.

ZERBINI, F. M.; CARVALHO, M. G.; ZAMBOLIM, E. M. Introduo virologia vegetal. UFV, 2002. 145p.

CAPTULO II
Anlise dos principais problemas fitossanitrios do inhame em Pernambuco e Paraba

25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

Anlise

dos

principais

problemas

fitossanitrios

do

inhame

em

Pernambuco e Paraba Genira P. de Andrade1, Myriam A. Khalid2, Philippe Vernier2, Pricles A. Melo Filho1, Gilvan Pio-Ribeiro1, Elvira M. R. Pedrosa1, Delson Laranjeira1, Andr S. Xavier1
1

UFRPE, Departamento Agronomia, Recife-PE, CEP. 52171-900; 2CIRAD,

Montpellier, Frana. Autor para correspondncia: Genira Pereira de Andrade

Recebido para publicao em

; aceito em

RESUMO

Visando avaliar a qualidade do material de propagao de inhame (Dioscorea spp.) utilizado nos Estados de Pernambuco e Paraba e a ocorrncia de doenas e pragas, foram realizadas visitas a 30 propriedades para anlise de 80 plantas em cada uma, um ms antes e no perodo da colheita. Para a identificao dos fitonematides foram observadas as estruturas de espcimes extradas com a coleta de 10g de casca, utilizandose a associao da tcnica da macerao rpida em liquidificador, flotao centrfuga com o mtodo de Jenkins. Para os fungos, isolamento e observao das estruturas e, para os vrus, os testes triple antibodies sandwich enzyme-linked immunosorbent assay (TAS-ELISA), com anticorpos policlonais e monoclonais especficos para Yam mosaic virus, polimerase chain reaction (PCR) com oligonucleotdeos degenerados para deteco de badnavrus e duplex reverse transcription PCR (RT-PCR), com oligonucleotdeos especficos para YMV e Yam mild mosaic virus (YMMV). A pinta preta (Curvularia eragrostidis) e a lagarta da folha (Pseudoplusia oo) foram detectadas em todas as reas de cultivo com maior freqncia na cv. Inhame-da-Costa do complexo D. cayennensis-D. rotundata e D. alata, respectivamente. Em ambas as espcies de inhame,

26 35 36 37 38 39 40 41 42 43 44 45

observaram-se Meloidogyne spp. e os agentes da casca preta Pratylenchus coffeae (espcie prevalente) e Scutellonema bradys. Foi detectado badnavrus em infeco simples e mista com YMV and YMMV. Em tberassemente detectou-se a podrido verde (Penicillium sclerotigenum) em 80 e 60% das propriedades na cv. Inhame-da-Costa e na cv. So Tom, respectivamente. Notificou-se tambm a broca das tberas (Araecerus fasciculatus) e cochonilhas (Planoccocus sp.) em material de propagao armazenado oriundos das reas estudadas.

Palavras-chave adicionais: Dioscorea, Yam mosaic virus, Yam mild mosaic virus, badnavrus, potyvrus ABSTRACT

46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61

In order to evaluate the quality of the propagative material of yam (Dioscorea spp.) used in the states o Pernambuco and Paraba and the development of diseases and pests, 30 farms were visited to analyse in each one plants the insect damages and the diseases of the aerial part on 80, a month before and at the harvest day. For nematode identification the structures of specimens extracted by the Jenkins methods were observed; for the fungi, isolation and structure observation and, for the viruses, the tests triple antibodies sandwich enzyme-linked immunosorbent assay (TASELISA), with polyclonal and monoclonal antibodies specific for Yam mosaic virus, polymerase chain reaction (PCR) with degenerated primers for

detecting badnavirus and duplex reverse transcription PCR (RT-PCR), with primers specific for YMV e Yam mild mosaic virus (YMMV) were used. Leaf spot (Curvularia eragrostidis) and leaf worm (Pseudoplusia oo) were detected in all growing areas, with higher frequency on cv. Inhame-da-Costa

27 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 Additional key words: Dioscorea spp., Yam mosaic virus, Yam mild mosaic

of D. cayennensis-D.rotundata complex and cv. So Tom of D. alata, respectively. In both yam species it was observed Meloidogyne spp. and the agents of dry rot Pratylenchus coffea (prevalent specie) and Scutellonema bradys. It was detected badnavirus in single and mixed infections with YMV and YMMV. In seed tubers it was detected the green rot (Penicillium sclerotigenum) in 80 and 60% of the farms on cv. Inhame-da-Costa and So Tom, respectively. It was registered the tuber worm (Araecerus

fasciculatus) and the mealy bugs (Planoccocus sp.) in storaged propagative materials from all studied areas.

virus, badnavrus, potyvrus

INTRODUO O inhame (Dioscorea spp.) uma planta trepadeira, monocotilednea da famlia Dioscoreaceae. Cerca de 600 espcies desse gnero j foram descritas, destacando-se entre elas D. rotundata Poir., D. alata L., D. cayennensis Lam., D. esculenta (Lour.) Burk. e D. trifida L. por produzirem tberas comestveis (Santos, 1996; Garrido et al., 2003). A cultura do inhame tem grande importncia scio-econmica no Nordeste brasileiro por participar fortemente da base alimentar de populaes rurais e urbanas (Mendes, 2005; Santos & Macdo, 2006), constituindo-se alimento energtico, com elevado teor de carboidrato, alm

28 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110

de fonte de vitaminas e sais minerais (Santos, 1996; Menezes, 2002; Ritzinger et al., 2003; Mendes, 2005; Santos & Macdo, 2006). Vrios Estados brasileiros produzem inhame, com reas de cultivo variadas, estando mais concentradas no Nordeste, sendo Pernambuco e Paraba os maiores produtores (Moura, 2002). Nessa regio, a cultivar Inhame-da-Costa, do complexo D. cayennensis-D. rotundata, a mais plantada e a cv. So Tom de D. alata L. usada para plantio em menor escala, apresentando forte potencial para expanso, por proporcionar elevada rentabilidade. Essas espcies se desenvolvem de forma satisfatria em clima tropical quente e mido (Garrido et al., 2003; Ritzinger et al., 2003; Moura et al., 2006). O plantio de inhame no Estado de Pernambuco apresenta maior concentrao nas regies Agreste e Zona da Mata, especialmente, nos municpios de Aliana, Bonito, Condado, Goiana, Sair e So Joaquim do Monte. Na Paraba, os principais municpios produtores so Alhandra, Conde e Santa Rita, que se localizam na regio litornea (Santos, 1996, 2006). No cultivo comercial do inhame o plantio realizado utilizando-se normalmente tberas-sementes ou segmentos de tberas comerciais (Santos, 1996). Esse mtodo de propagao vegetativa, associado ao baixo nvel tecnolgico empregado, em geral, favorece a sobrevivncia, acmulo e disseminao de patgenos e pragas que podem ser introduzidas em reas isentas, via material de propagao (Menezes, 2002; Oliveira et al., 2006). O manejo desta olercula, da maneira que conduzido pelos produtores nordestinos, contribui decisivamente para baixa produtividade e

29 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

qualidade das tberas comerciais. O uso de tberas-semente infectadas compromete os plantios subseqentes, constituindo-se principal fator limitante para a produo da cultura (Santos, 1996; Peixoto Neto et. al., 2000; Moura et al., 2006; Oliveira et al., 2006). Durante a fase de desenvolvimento da planta do inhame verifica-se a ocorrncia de pragas e vrios patgenos de natureza fngica e viral entre os fungos j relatados em nvel mundial encontram-se Curvularia eragrostidis (P. Henn) Mayer, Colletotrichum gloeosporioides Penz. Sacc., Pestalotia sp. e Rhizoctonia solani Kuhn. (Amusa et al., 2000). A lagarta da folhagem (Pseudoplusia oo) Cramer, da ordem Lepidptera, famlia Noctuidae considerada a principal praga da cultura. Outra praga que tambm ataca a planta do inhame a broca do caule (Xystus arnoldi Kirby), que teve a primeira constatao na cultura no Estado da Paraba (Santos, 2006), O adulto da broca do caule um pequeno besouro de colorao preto brilhante, que provoca o secamento progressivo do ramo principal acima do colo, comprometendo o crescimento da planta, podendo acarretar a morte (Ritzinger et al., 2003). As viroses causadas pelos Yam mosaic virus (YMV), um potyvirus de grande importncia para o inhame (Aleman et al., 1996) Yam mild mosaic virus (YMMV), Dioscorea alata baciliform virus (DaBV) (Phillips et al., 1999), Cucumber mosaic virus (CMV) que, dependendo das condies da cultura e da espcie viral, pode chegar a ocasionar perdas acima de 40% na produo (Pio-Ribeiro et al., 2005; 2006; Andrade et al., 2006). Dentre as doenas e pragas que causam reduo na qualidade das tberas comerciais e tberas-sementes ressaltam-se: a praga de

30 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154

armazenamento, conhecida como broca da tbera Araecerus fasciculatus (Degeer) (Emehute & Echendu, 1992); as fitonematoses casca preta, causada por Scutellonema bradys (Stainer & LeHew) Andrassy, (Amusa et al., 2003) e Prathylenchus coffeae (Filipjev & Stekhoven) (Oliveira et al., 2006) e a meloidoginose causada por Meloidogyne spp.; a podrido verde que tem como agente Penicillium sclerotigenum Yam. (Oliveira et al., 2006). A identificao da praga e a diagnose segura da doena em qualquer cultura de fundamental importncia para se determinar as medidas necessrias para se atingir um controle eficaz. Atualmente, as tcnicas de diagnose, usando-se mtodos moleculares tm sido bastante indicadas, especialmente para as viroses, por proporcionar resultados precisos. No entanto, existem casos em que no se podem dispensar estudos biolgicos e mtodos clssicos como o uso de microscpio eletrnico para visualizao das partculas virais (Souto et al., 2000; Azevedo et al., 2003). O presente trabalho teve como objetivo analisar nos Estados de Pernambuco e Paraba a qualidade do material propagativo usado pelos produtores de inhame e a ocorrncia dos principais agentes de doenas e pragas em reas de produo comercial e em armazenamento de tberassementes.

31 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179

MATERIAL E MTODOS

O trabalho foi conduzido em reas de produo comercial de inhame em Pernambuco e Paraba e nos Laboratrios de Fitonematologia, Fitovirologia e Fitopatologia Molecular do Departamento de Agronomia da Universidade Federal Rural de Pernambuco e no Ncleo de Apoio a Pesquisa em Microscopia Eletrnica aplicada a Pesquisa Agropecuria NAP/MEPA, ESALQ/USP. Para verificao da ocorrncia de pragas e patgenos nas reas produtoras de inhame, 10 municpios foram visitados em Pernambuco e Paraba, sendo sete no primeiro Estado e trs no segundo, perfazendo um total de 30 propriedades, onde foram coletadas amostras foliares e/ou tberas-semente e comerciais. Em cada campo selecionado, foram marcadas 50 plantas, (cinco linhas aleatrias com 10 plantas cada), para analisar ocorrncia de pragas, fungos e nematides fitopatognicos. Para avaliao de infeco viral, mais 30 plantas foram marcadas, escolhidas aleatoriamente (sendo 10 com sintomas intensos, 10 com poucos sintomas e 10 assintomticas) (Figura 1 A E). Em relao s pragas, foram avaliados no campo os danos causados pela alimentao de insetos nas folhas do inhame na forma de perfuraes e observando-se a presena de lagartas. A ocorrncia dos patgenos foi avaliada com base na sintomatologia um ms antes e no perodo da colheita, quando se registraram, alm da presena de manchas foliares, os sintomas causados por nematide nas tberas na hora da capao.

32 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204

Para anlises laboratoriais dos principais patgenos que ocorreram na lavoura e as pragas e os patgenos presentes durante o

armazenamento, foram coletadas folhas e tberas-semente e/ou comerciais da cv. So Tom de D. alata e a cv. Inhame-da-Costa do complexo D. cayennensis-D. rotundata em cinco propriedades: uma de So Joaquim do Monte; uma de Goiana-PE; uma em Condado-PE e duas no municpio do Conde-PB, representando as principais reas de produo. Para a pinta preta foram realizados isolamentos a partir de folhas com sintomas, utilizando-se meio BDA. Aps sete dias foram realizadas medidas do crescimento radial da colnia fngica com auxlio de rgua milimetrada e preparadas lminas para observao das estruturas e identificao do patgeno. As tberas foram incubadas em condies de temperatura e umidade iguais s utilizadas pelos produtores da regio em estudo, depositadas em bandejas plsticas, previamente forradas com papel jornal e deixadas por 60 dias, perodo normal de armazenamento para quebra da dormncia. Aps o perodo de armazenamento, foram realizadas observaes visuais nas tberas-semente para avaliar danos de infestao de cochonilhas e perfuraes e galerias causadas pela broca das tberas (Santos, 1996; Novo & Baptista, 1998). Aps o perodo de incubao, a presena de P. sclerotigenum nas tberas foi determinada com base na observao visual do crescimento fngico e retiradas amostras presente em cinco tberas-semente, de cada uma das propriedades estudadas, para isolamento e identificao do fungo, usando-se o procedimento descrito para pinta preta. Realizou-se

33 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229

visualizao da formao e colorao da colnia em placa de Petri e estrutura em lmina. Em seguida, foi efetuado teste de patogenicidade realizando inoculao dos isolados, transferindo-se discos de meio BDA com colnia fngica para segmentos de tberas sadias previamente feridas. De trs isolados foram realizadas microculturas para preparao de lminas, observao ao microscpio e registro fotogrfico. Para quantificao dos nematides nas tberas-semente

armazenadas de cada propriedade, amostras de cinco tberas da cv. Inhame-da-Costa e da cv. So Tom foram processadas pelo mtodo de Jenkins (Jenkins, 1964) com adaptao, sendo a extrao foi efetuada com dez gramas de cada tbera trituradas em liquidificador e peneiradas em um conjunto de peneiras de 200 sobre 500 Mesh do tipo stand seguida de flotao centrfuga, os quais foram contados ao microscpio tico. Para anlise de vrus foram realizados os seguintes procedimentos: cinco amostras de cada cultivar de inhame com sintomas intensos de mosaico foram utilizadas para preparaes do tipo Leaf dip e cortes ultrafinos e observao ao Microscpio Eletrnico de Transmisso (MET); teste Triple antibody sandwich enzyme-linked immunosorbent assay (TASELISA) com anticorpos policlonais e monoclonais contra YMV, adquiridos no IITA, Nigria; Polymerase chain reaction (PCR) para deteco de badnavrus, no qual se utilizaram oligonucleotdeos degenerados (Yang et al, 2003) e duplex reverse transcription PCR (RT-PCR) para identificao dos potyvrus com oligonucleotdeos especficos para YMV e YMMV (Munford & Seal, 1997). Os isolados usados para anlise de seqncia foram denominados usando a sigla do municpio de origem: Bonito (BON),

34 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255

Itapissuma (ITA), Quipap (QUI), So Joaquim do Monte (SJM) de Pernambuco; Conde (CND) da Paraba e Cruz das Almas (CRA) da Bahia. Tanto para PCR como para RT-PCR foi empregado o mtodo cobertura (Coating) em substituio ao procedimento clssico de extrao de RNA ou captura do vrus com anticorpos. O procedimento de cobertura consiste em macerao do tecido com tampo carbonato, acrescido 1% de PVP e de 2% de sulfito de sdio 1:10 (p/v), seguida de centrifugao a 6000g por 5 minutos a 4C, transferncia de alquota de 25L para tubos de PCR e incubao por uma noite a 4C. Finalmente conclui-se o procedimento com duas lavagens com PBS-T esterilizado e uma vez com gua Milli-q. Para os potyvrus utilizou-se Kit One Step RT-PCR e para badnavrus a Taq-polymerase em PCR ambos da Invitrogen, seguindo instrues do fabricante.

RESULTADOS E DISCUSSO

Foi verificada a ocorrncia de lagartas causando reduo do limbo foliar, alterando a rea fotossinttica e como conseqncia resultando em pouco desenvolvimento das tberas e baixa produtividade, conforme descrito em Garrido et al. (2003) e Ritzinger et al. (2003). Entre as pragas de armazenamento foram detectadas cochonilhas (Planoccocus sp.) e brocas das tberas (A. fasciculatus), comuns em condies quentes e midas de armazenamento, locais geralmente usados por produtores da regio onde se cultiva inhame (Figura 2 A - E). Foi detectada a presena de C. eragrostidis espcie fngica que infecta parte area (Figura 3A) nas trs reas fisiogrficas visitadas dos

35 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280

Estados, com maior prevalncia em reas de plantios mais adensados. Estes resultados esto de acordo com os obtidos por Paula et al. 2000. A presena de P. sclerotigenum nas tberas foi determinada baseada na observao do crescimento fngico seguindo-se da reinoculao aps sete dias, em fragmentos de tberas sadias (Figura 3 B - D). Para a cultivar Inhame-da-Costa foi constatada a presena deste fungo em 80% das propriedades e 60% na cv. So Tom nas principais reas produtoras. Com os resultados obtidos nas anlises foi constatada a presena de nematide causando infeco em ambas cultivares em todas as propriedades. As espcies detectadas foram: Meloidogyne spp., S. bradys e P. coffeae em Pernambuco e Paraba, observando marcante predominncia de P. coffeae. A esse respeito, Moura et al., 2002 mostram que, atualmente, nas regies fisiogrficas envolvidas no estudo tem ocorrido a substituio da espcie S. bradys, comum no inhame, por P. coffeae (Figura 4 A - H). Para vrus, os testes TAS-ELISA e de microscopia eletrnica de transmisso (MET) revelaram a presena de YMV em amostras da cv. Inhame-da-Costa, oriundas de QUI, entretanto, no se obteve reao positiva para amostras da cv. So Tom oriundo de Itapissuma, tambm municpio pernambucano. Os resultados obtidos atravs de anlises do material em MET concordam com os dados de estudos de vila et al. (1982) e Pio-Ribeiro et al. (2005, 2006), que demonstraram infeco em inhame causada por potyvrus. Boari et al. (2005), usando a mesma ferramenta, registraram a ocorrncia de potyvrus e badnavrus em inhame.

36 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305

A partir dos testes de PCR e RT-PCR identificou-se a espcie YMV, YMMV e detectou-se badnavrus, nas trs regies estudadas e nas duas cultivares nas reas de produo comercial dos dois Estados. O sequenciamento para potyvrus dos produtos de RT-PCR dos isolados virais QUI, SJM e CND confirmou a separao de duas espcies distintas deste gnero infectando o inhame e com a obteno das seqncias parciais para badnavrus foi confirmado que os isolados QUI, CRA e ITA pertencem a mesma espcie. Esses resultados esto de acordo com os obtidos por Yang et al. (2003), que estudaram os badnavrus em taro e inhame e Munford & Seal (1997) que sequenciaram YMV e YMMV em inhame (Andrade et al., 2006; Pio-Ribeiro et al., 2006).

LITERATURA CITADA AMUSA, NA; ADEGBITE, AA; MUHAMMED, S; BAIYWU, RA. 2000. Yam diseases and its management in Nigeria. African Journal of Biotecnology. 2: (12), 497-502.

ALEMAN, ME; MARCOS, JF; BRUGIDOU, C; BEACHY, RN.; FAUQUET, C. 1996. The complete nucleotide sequence of Yam mosaic vrus (Ivory Coast isolate) genomic RNA. Archives of Virology 141: (7), 1259-1278.

ANDRADE, GP; SILVA, AKS; FILLOUX, D; PIO-RIBEIRO, G; KITAJIMA, EW; XAVIER, DM. 2006. Plantas de Dioscorea alata infectada com YMMV no estado de Pernambuco. Fitopatologia Brasileira 31:.S 344.

37 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329

VILA, AC; GAMA, MICS; KITAJIMA, EW. 1982. Deteco de um Potyvirus em inhame (Dioscorea spp.) no Brasil. Fitopatologia Brasileira 7: (1) 447-452.

AZEVEDO, MO; FELIPE, MSS; BRGIDO, MM; MARANHO, AQ; SOUZA, MT. 2003. Tcnicas bsicas em Biologia Molecular. Braslia-DF: Editora Universidade de Braslia. 212p.

BOARI, AJ; AZEVEDO, VG; SILVA-MANN, R; FRANCO-FILHO, E; KITAJIMA, EW. 2005. Ocorrncia de Badnavirus e Potyvirus em inhame (Dioscorea sp.) no estado de Sergipe. Summa Phytopathologica 31: 35-36,

EMEHUTE, JKU; ECHENDU, NTC. 1992. Susceptibility of stored yam tubers (Dioscorea spp.) To infestation by Araecerus fasciculatus Degeer, Tropical Science 32: (1) 99-103.

GARRIDO, MS; JESUS, ON; SOARES, ACF. 2003. Produo e qualidade de tberas de inhame (Dioscorea cayennensis Lam.) em sistema de produo (MSG) fileira dupla. In: Sociedade Brasileira de Olericultura, 43 S.B.O., CD-ROM.

JENKINS, WR. 1964. A rapid centrifugal-flotation, technique for separating nematodes from soil. Plant Disease Reporter 48: 692.

38 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352

LAWSON, RH; HEARON, SS; SMITH, FF; KAHN, RP. 1973. Electron microscopy and separation of viruses in Dioscorea floribunda.

Phytopathology 63: 1435.

MENDES, RA. 2005. Cultivando inhame ou Car da Costa. Cruz das Almas. EMBRAPA. Circular Tcnica n. 4, 26p.

MENEZES, M. 2002. Condies epidemiolgicas de doenas fngicas na cultura do inhame. In: Santos, ES. (Coord.) Simpsio Nacional sobre as culturas do Inhame e do Taro 2: 50-67.

MOURA, RM. 2002. Problemas fitossanitrios do inhame no Nordeste e proposta para um sistema integrado de controle. In: Santos, ES. (Cood.) Simpsio Nacional sobre as culturas do Inhame e do Taro 2: 50-67.

MOURA, RM; OLIVEIRA, IS; TORRES, GRC. 2006. Primeiro assinalamento de Scutelonema bradys em Dioscorea alata no Brasil. Brasileira 31: 506. Fitopatologia

MUMFORD, RA; SEAL, SE. 1997. Rapid Single-tube immunocapture RTPCR for the detection of two yam potyvirUses. Journal of Virological Methods 69: 73-79.

39 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377

NOVO, JPS; BAPTISTA, GC. 1998. Resposta do caruncho-do-caf Araecerus fascilulatus (Deg.) (Coleoptera:Anthribidae) a feromnios. Revista da Sociedade Entomolgica do Brasil 27: (3), p.1-9.

OLIVEIRA, IS; LUZ, EDMN; BEZERRA, JL; MOUZA, RM; TORRES, GRC; MAIA, LC. 2006. Severidade de da podrido-verde em inhames e

especializao

fisiolgica

Penicillium

sclerotigenum. Fitopatologia

Brasileira 31: 094-098.

PAULA, H; MICHEREFF, SJ; COSTA, VSO; LARANJEIRA, D; OLIVEIRA, SMA. 2000. Variabilidad de aislamientos de Curvularia eragrostidis que causan atizonamiento de las hojas de ame (Dioscorea cayennensis) en Pernambuco, Brasil. Boletn Micolgico 11: (1) 85-92.

PEIXOTO NETO, PAS; LOPES FILHO, J; CAETANO, LC; ALENCAR, LMC; LEMOS; EEB. 2000. Inhame: o Nordeste frtil. Macei: EDUFAL. 88p.

PHILLIPS, R.W.; BRUNT, A.A.; HULL R. 1999. The parciail characterization of a Badanvirus infecting the greater Asiatic or Water yam (Dioscorea alata). Journal of Phytopathology 147: 434-439.

PIO-RIBEIRO, G; MELO-FILHO, PA; KITAJIMA, EW; LIMA, SK; ANDRADE, GP; DOMINGOS, CA; LIMA, ES. 2005. Deteco de potyvrus em inhame em reas produtoras de Pernambuco e obteno de matrizes in vitro. Fitopatologia Brasileira 30: S 183

40 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401

PIO-RIBEIRO, G; ANDRADE, GP; FILOUX, D; VERNIER, P; MELO-FILHO, PA; ALMEIDA, HSM; XAVIER, AS. 2006. Plantas de inhame em Pernambuco e Paraba apresentam infeces simples e mista por potyvrus e badnavrus. Fitopatologia Brasileira 31: S 309.

RITZINGER, CHSP; SANTOS FILHO, HP; ABREU, KCLM; FANCELLI, M; RITZENGER, R. 2003. Aspectos fitossanitrios da cultura do inhame. Cruz das Almas.EMBRAPA/SPI 39p.

SANTOS, ES. 1996. Inhame (Dioscorea spp.): aspectos bsicos da cultura. EMEPA-PB, SEBRAE, 158p.

SANTOS, ES. 2006. Manejo Sustentvel da Cultura do Inhame. (Dioscorea sp.) no Nordeste do Brasil, Disponvel em: http:// www.emepa.org.br/inhame_manejo.php Acesso em: 15/12/06.

SANTOS, ES, MACDO, LS. 2006. Tendncias e Potencialidades da Cultura do Inhame (Dioscorea sp.) no Nordeste do Brasil, Disponvel em: http://www.emepa.org.br/inhame_tendencias.php Acesso em: 12/ 11/06.

SOUTO, ER; TESSMAN, DJ; NUNES, WNC. 2000. Mtodos de PCR aplicados Fitopatologia. Belm. Fitopatologia Brasileira 27:.22-46,

41 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426

YANG, IC; HAFNER, GJ; REVILL, PA; DALE, JL; HARDING, RM. 2003. Sequence diversity of South Pacific isolates of Taro bacilloform virus and the development of a PCR-based diagnostic test. Archives of Virology 148: 1957-1968.

ZERBINI JR, FM; CARVALHO, MG; ZAMBOLIM, EM. 2002. Introduo a Virologia Vegetal Viosa, MG: UFV. 145p.

42 427

Figura 1

428 429 Figura 2

430 431 432 433 434 435 436 437

43 438

Figura 3 e 4

439

440

44 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 LEGENDA

Figura 1. Plantas de inhame em campo exibindo sintomas causados por vrus. A- Sintoma de nanismo; B- Folha com mosaico intenso e deformao foliar; C- Sintomas severos com distoro foliar intensa causados pela infeco viral.

Figura 2. Plantas e tberas de inhame com danos causados pelas pragas. A- Forma jovem da lagarta da folhagem; B- Folhas com perfuraes da lagarta; C- Tbera apresentando cochonilhas; D E-Tberas-semente com a broca da tbera e os respectivos danos.

Figura 3. Sintomas em planta de inhame, tbera, crescimento e estruturas de fungo. A- Pinta preta Curvularia eragrostidis e detalhe em folha; B- Podrido verde Penicillium sclerotigenum em segmento de tbera-semente; C- Crescimento em placa D- Estrutura do patgeno.

Figura 4. Espcies de nematides e danos em tberas-sementes e comerciais. A- Scutellonema bradys; B e C- Inhame-da-Costa e So Tom com dano de casca preta; D- Pratyllenchus coffeae; E e F- Meloidogyne spp.; G e H- Tberas-semente antes e depois do armazenamento.

CAPTULO III
Infeces simples e mista causadas por duas espcies de potyvrus e um badnavrus em Dioscorea spp. no Nordeste do Brasil

46

Infeces simples e mista causadas por duas espcies de potyvrus e um badnavrus em Dioscorea spp. no Nordeste do Brasil G. P. Andrade1*, G. Pio-Ribeiro1*, D. Filoux2, D. M. Xavier, A. K. S. Silva1**, A.V. S. Nascimento1, P. A. Melo-Filho1,
1

Depto. de Agronomia, Fitossanidade, Universidade Federal Rural de Pernambuco, CEP: 52171-900, Recife, PE, e-mail: genira@ufrpe.br
2

CIRAD, Montpellier, Frana; *Apoio CNPq/UFRPE; PIBIC/CNPq/UFRPE

**

Bolsista

Parte da Tese de Doutorado do primeiro autor apresentada Universidade Federal Rural de Pernambuco. (Aceito para publicao em: / / / )

Autor para correspondncia: Genira Pereira de Andrade

Andrade, G. P., Pio-Ribeiro, G., Filoux, D., Xavier, D. M.,

Silva, A. K. S.,

Nascimento, A.V. S. & Melo-Filho, P. A. Infeces simples e mista causadas por duas espcies de potyvrus e um badnavrus em Dioscorea spp. no Nordeste do Brasil. Fitopatologia Brasileira

RESUMO Um isolado de Yam mosaic virus (YMV) e um de Yam mild mosaic virus (YMMV), obtidos de inhame (Dioscorea spp.), previamente identificados por RT-PCR e denominados QUI e ITA, foram inoculados mecanicamente em plantas indicadoras das famlias Chenopodiaceae, Leguminoseae e

47

Solanaceae

entre

outras,

sendo

observados

sintomas

em

Nicotiana

benthamiana e Gomphrena purpurea. Os mesmos isolados foram inoculados em feijo-caupi, amendoim, Emilia sonchifolia, G. purprea, N. benthamiana e N. glutinosa com Aphis gossypii e Toxoptera citricidus, no se obtendo a transmisso viral e, por leaf dip e pelo mtodo sorolgico de microscopia eletrnica, verificaram-se partculas e incluses tpicas de potyvirus em material de ambos isolados. Das 135 amostras de tberas-semente de D. alata e do complexo D. cayennensis-D. rotundata coletadas em plantios comerciais, 90 plantadas em microparcelas e 45 em casa de vegetao, estabeleceram-se 82 e 43, respectivamente, todas com sintomas semelhantes aos verificados no campo. As amostras trazidas de campos e testadas por ELISA indireto, com anti-soros contra Cucumber mosaic virus e Cowpea aphid-borne mosaic virus no apresentaram resultados positivos. Foi confirmada a identidade do isolalado QUI como YMV por TAS-ELISA. Analisaram-se amostras de campos comercias por PCR, para deteco de badnavrus com oligonucleotdeos degenerados e RT-PCR, para identificar Alguns YMV e YMMV, usando-se foram

oligonucleotdeos

especficos.

produtos

dessas

reaes

purificados, seqenciados e comparados com isolados de outros pases, visando confirmar a ocorrncia das trs espcies virais em inhame na regio Nordeste do Brasil. Verificaram-se, normalmente, mosaico severo juntamente com deformao foliar nas infeces mistas de potivrus com badnavrus e sintomas suaves nas infeces simples. Palavras-chave adicionais: Inhame, Yam mosaic virus, Yam mild mosaic virus, badnavrus.

48

ABSTRACT

Single and mixed infections caused by two Potyvirus Species and Badanavirus in Dioscorea spp. in the Northeast of Brazil An isolate of Yam mosaic virus (YMV) and one of Yam mild mosaic virus

(YMMV), obtained form yam (Dioscorea spp.), previously identified by RT-PCR and called QUI and ITA were inoculated mechanically on indicator hosts of the families Chenopodiaceae, Leguminoseae and Solanaceae, being observed

symptoms in Nicotiana benthamiana e Gomphrena purpurea. The same isolates were inoculated on cowpea, peanut, Emilia sonchifolia, N. benthamiana and N. glutinosa with Aphis gossypii and Toxoptera citricidus, showing negative results. By leaf dip and immunoelectron microscopy it was observed particles and inclusions bodies typical of the potyviruses, for both isolates. Out of 135 samples of seed tubers of D. alata e D. rotundata collected in commercial fields, 90 were planted in micro plots and 45 under greenhouse, being established 82 and 43 plants, respectively, all showing symptoms similar to those observed in field. The samples from field analyzed by DAC-ELISA with antisera against Cucumber mosaic virus e Cowpea aphid-borne mosaic virus did not present positive results. It was confirmed the identity of the isolate QUI as YMV by TASELISA. Field samples were analyzed by PCR for detecting badnavirus, with degenerated primers and RT-PCR for identification of the potyviruses YMV and YMMV, with specific primers. Some products of these reactions were purified, sequenced and compared with isolates of other countries in order to confirm the

49

occurrence of these three viral species in yam in the Northeast region of Brazil. Usually, it was verified strong mosaic and foliar distortion in mixed infection of potyvirus with badnavirus and light symptoms in single infections. Additional key words: Yam, Yam mosaic virus, Yam mild mosaic virus, badnavrus.

INTRODUO O inhame (Dioscorea spp.) uma cultura que possui elevada importncia scio-econmica, em especial nos pases em desenvolvimento situados nos trpicos, sendo difundido e cultivado em maior escala na frica, Caribe, sia e Oceania (Mendes, 2005; Santos & Macdo, 2006). Entre as razes e tubrculos usados na alimento humana, o inhame tem destaque por fornecer para populaes rurais e urbanas, um produto de alto valor nutricional, consumido cozido ou frito e ser uma excelente fonte de carboidratos, sais minerais e vitaminas do complexo B, e ainda usado na fabricao de farinhas, bolos, tortas, doces e salgados (Santos, 1996; Menezes, 2002; Mendes, 2005). Alm das espcies de Dioscorea, que produzem tberas comestveis, existem outras que so exploradas para fabricao de cosmticos e contraceptivos, graas aos seus constituintes como os saponceos e diosgenina (Pedralli, 2003; Santos & Macdo, 2006). No Brasil, a cultivar mais utilizada o Inhame-da-Costa (Moura, 2005; Santos, 2006), pertencente espcie D. rotundata Poir., comumente referida como parte do complexo D. cayenensis Lam.-D. rotundata, espcies vulgarmente conhecidas como inhame amarelo (yellow yam) e inhame branco (white yam), respectivamente (Malaurie et al., 1998). Em segundo lugar encontra-se a cv. So-

50

Tom, da espcie D. alata L. (Moura, 2005), conhecida como inhame gua (water yam) (Malaurie et al., 1998). No Nordeste brasileiro tem crescido bastante a rea plantada com inhame e tem havido uma importante demanda para o mercado de exportao, contudo, os produtores no tm conseguido atingir as metas das empresas de comrcio exterior, pricipalmente pela baixa qualidade do produto devido a problemas de ordem fitossanitria (Moura, 2002; Santos & Macdo, 2006). Entre os diversos fatores limitantes da cultura do inhame encontram-se as doenas, incluindo as de etiologia viral. Vrias espcies pertencentes aos gneros Potyvirus, Cucumovirus, Badnavirus e Potexvirus foram descritas em Dioscorea spp. Duas espcies de Potyvirus, famlia Potyviridae, esto bem caracterizados, o Yam mosaic virus (YMV) e o Yam mild mosaic virus (YMMV), sendo o YMV considerado o vrus mais importante e de maior distribuio geogrfica (Munford & Seal, 1997). Com grande importncia para a cultura tem sido registrada, tambm, a ocorrncia de vrus do gnero Badnavirus, famlia, Caulimoviridae, tanto em infeco simples como mista com potyvrus (Yang et al., 2003; Boari, et al., 2005; Pio-Ribeiro et. al., 2005; Andrade et al., 2006). A propagao vegetativa, atravs de tberas-semente, utilizada na cultura do inhame facilita a sobrevivncia, disseminao e o acmulo de agentes virais em cultivos sucessivos, tendo sido observado 100% de plantas com sintomas a partir de material propagativo obtido de plantios comerciais (Brilhante et al., 2005). Nos estudos dos vrus que infectam o inhame, visando a identificao ao nvel de espcie e caracterizao de isolados, tem sido dado preferncia aos mtodos moleculares, os quais apresentam grande sensibilidade e especificidade

51

(Munford & Seal, 1997; Yang et al., 2003; Odu et al., 2004). Os testes sorolgicos, embora sejam recomendados, o seu uso tem diminudo pela pouca disponibilidade de anti-soros especficos. J os testes biolgicos so mais ainda limitados porque mesmo nos casos em que os vrus so transmitidos experimentalmente por inoculao mecnica e por vetores resultados positivos so conseguidos com dificuldade. Para deteco e identificao ao nvel de gnero, partculas e incluses virais tm sido observadas ao microscpio eletrnico de transmisso (MET) (vila et al., 1982; Boari, et al., 2005).

O presente trabalho teve como objetivo identificar e caracterizar isolados virais obtidos da cv. Inhame-da-Costa e cv So Tom em Pernambuco, Paraba e Bahia, usando-se mtodos biolgicos, sorolgicos e moleculares.
MATERIAL E MTODOS

Inoculao mecnica em plantas indicadoras Para estudo de gama de hospedeiros foram escolhidos os isolados de YMV e YMMV, previamente identificados por RT-PCR (Pio-Ribbeiro, et al., 2006), oriundos, repectivamente, de Quipap-PE (QUI), da cv. Inhame-da-Costa e de Itapissuma-PE (ITA), da cv. So Tom. Procedeu-se a inoculao de oito a vinte plantas das diferentes indicadoras pertencentes s famlias Chenopodiacea, Leguminoseae, Solanaceae, entre outras (Tabela 1). Amostras de folhas jovens de inhame foram maceradas na presena de soluo tampo fosfato de potssio (K2HPO4 + K2HPO4), 0,05M, (pH 7,0) com 0,1% sulfito de sdio. O extrato obtido foi inoculado nas plantas-teste usando gaze, que estavam cobertas durante 24 horas antes da inoculao, previamente polvilhadas com Carborundum 400 Mesh.

52

Para cada indicadora foi realizado o tratamento, semelhante inoculao, de cinco plantas-testemunha, usando-se apenas soluo tampo. Foram realizadas leituras peridicas de sintomas locais e sistmicos no perodo de quatro semanas, a partir da inoculao. Por amostragem, foram realizados testes de PCR para deteco de possveis plantas infectadas de forma assintomtica.

Inoculao por afdeos Afdeos das espcies Aphis gossypii Glov. e Toxoptera citricidus Kirk, coletados respectivamente em algodoeiro (Gossypium sp.) e plantas ctricas (Citrus sp.), mantidos em jejum durante duas horas, foram colocados sobre a superfcie de folhas de inhame infectadas com os isolados QUI e ITA, respectivamente, em placas de Petri, por um perodo de acesso em torno de cinco horas e transferidos para plantas-teste (cinco insetos por planta) de feijo-caupi (Vigna unguiculata (L.) Walp.), amendoim (Arachis hypogaea L.), Emilia sonchifolia, Nicotiana benthamiana e N. glutinosa. Para as plantas-testemunhas, seguiu-se o mesmo procedimento, com acesso dos insetos em plantas sadias. As leituras foram realizadas durante quatro semanas, com base na sintomatologia comparando-se sempre com as testemunhas. Foi feita amostragem e realizado teste de PCR para verificar se havia plantas infectadas de maneira assintomtica.

Tcnica leaf dip e mtodo sorolgico de microscopia eletrnica Para anlise usando-se leaf dip amostras foliares de inhame com os isolados QUI e ITA foram cortadas em pequenos fragmentos, mergulhadas em gotas de gua destilada para que as partculas virais entrassem em suspenso.

53

Em seguida, as telinhas ou grades, cobertas com pelcula de Formvar, reforada com carbono, foram colocadas sobre a gua contendo o material, as quais permaneceram em repouso por cinco minutos. Aps esse perodo, as mesmas foram secas em papel filtro, contrastadas negativamente com acetato de uranila a 2% durante um minuto, lavadas com gua destilada, secas a temperatura ambiente e organizadas em estojos apropriados e observadas ao MET no Ncleo de Apoio a Pesquisa em Microscopia Eletrnica Aplicada a Pesquisa Agropecuria - NAP/MEPA-ESALQ. Para anlise usando-se o mtodo sorolgico de microscopia eletrnica, telas revestidas com Formvar e Carbono foram imersas em gotas de anticorpos contra YMV e na diluio de 1:500, durante 30 min e lavadas com soluo tampo TRIS. Amostras com o isaolado QUI foram maceradas em tampo TRIS. As telas tratadas com anti-soros foram colocadas sobre uma gota do extrato vegetal, permanecendo por 4h em cmara mida. Em seguida, foram lavadas com dez gotas de soluo tampo TRIS, coradas com acetato de uranila a 2%, lavadas com gua destilada em jato contnuo de uma pisseta durante vinte segundos e colocadas para secar a temperatura ambiente e observada ao MET.

Anlises sorolgicas das plantas oriundas de campo comercial Amostras da cv. Inhame-da-Costa e da cv. So Tom oriundas de cultivos comerciais foram analisadas empregando-se Direct antigen coating ELISA (DACELISA), utilizando-se anti-soros contra Cucumber mosaic virus (CMV) e Cowpea aphid-borne mosaic virus (CABMV). Os isolados QUI e ITA foram tambm testados por triple antibody sandwich (TAS-ELISA), com um conjunto de anticorpos policlonais e monoclonais especficos para YMV, obtidos do IITA, Nigria. Foram

54

realizadas leituras a 405 nm, sendo cosiderado positivos valores duas vezes superiores absoro do controle negativo.

Transmisso por tberas-semente Foram coletadas tberas-sementes das cultivares Inhame-da-Costa e So Tom em 12 campos que apresentavam plantas com sintomas tpicos de viroses nas reas produtoras de Pernambuco, Paraba e Bahia, as quais foram plantadas, sendo 90 em microparcelas instaladas em rea experimental e 45 em condies de casa de vegetao, usando vasos com capacidade para 5 kg contendo uma mistura de solo e p de coco (peneirado) na proporo de 3:1. Aps a germinao, as plantas foram adubadas com Nitrognio, Fsforo e Potssio (NPK) e pulverizadas duas vezes ao ms visando o controle de pragas, e avaliadas visualmente quanto presena ou ausncia de sintomas. De cada local e espcie de inhame foram escolhidas amostras para realizao de anlise por PCR e RTPCR, visando confirmao de infeco viral. Anlise atravs de RT-PCR e determinao de seqncias As anlises de RT-PCR e determinao de seqncias foram realizadas com a colaborao do Dr. Denis Filloux (CIRAD, Frana). Os isolados constantes deste estudo foram denominados usando a sigla do municpio de origem: Bonito (BON), ITA, QUI, So Joaquim do Monte (SJM) de Pernambuco; Conde (CND) da Paraba e Cruz das Almas (CRA) da Bahia. Amostras de plantas oriundas de 12 campos comerciais dos Estados envolvidos no estudo e das estabelecidas em microparcelas e em casa de vegetao e material de plantas oriundas de tberas de QUI e ITA foram analisadas por PCR e RT-PCR. Procedendo-se primeiramente, com a macerao

55

das amostras em tampo de carbonato, estril, acrescido de 2% de PVP e 1% de sulfito de sdio a 1:10 (p/v), onde permaneceram em geladeira por um perodo de 12h. A lavagem dos tubos foi realizada com tampo PBS-Tween, por duas vezes e uma vez com gua Miliq esterelizada. Em seguida, foi utilizado kit One Step RTPCR (Invitrogen) com pares de oligonucleotdeos especficos para YMMV CP 2F (5-GGCACACATGCAAATGAAAGC-3) e UTR 1R (5-

CACCAGTAGAGTGAACATAG-3) Munford; Seal (1997)

e YMV CP 1F (5-

ATCCGGGATGTGGACAATGA-3) e UTR 1R (5-TGGTCCTCCGCCACATCAAA3) Munford; Seal (1997) e degenerados para e badnavrus BadnaFP BadnaRP

(5ATGCCITTYGGIITIAARAAYGCICC3)

(5CCAYTTRCAIACISCICCCCAICC3) Yang et al., 2003, empregados conforme instrues do fabricante. A visualizao dos resultados foi feita atravs de anlise em gel de agarose com tampo TAE e os produtos de PCR foram purificados usando o kit GFX PCR DNA and Gel Band purification Kit com Low Mass Ladder (Invitrogen)de acordo com as recomendaes do fabricantes e o sequenciamento foi realizado com o aparelho seqenciador GE Healthecare MegaBase 1000 e foi utilizado o Kit Dye Terminator da GE Healthecare estes dois procedimentos foram realizados no

Laboratrio de Genoma Humano da Universidade de So Paulo (USP). A visualizao dos resultados foi feita atravs de anlise em gel de agarose a 1,2% com tampo TAE e os produtos de PCR foram purificados usando o kit GFX PCR DNA and Gel Band purification Kit com Low Mass Ladder (Invitrogen) de acordo com as recomendaes dos fabricantes e o sequenciamento foi realizado com o aparelho seqenciador GE Healthecare utilizando o Kit Dye Terminator da GE Healthecare MegaBase 1000

estes dois procedimentos

56

foram realizados no Laboratrio de Genoma Humano da Universidade de So Paulo (USP). As seqncias de nucleotdeos foram comparadas com seqncias de potyvrus e badnavrus relacionados disponveis no GenBanK

(www.ncbi.nlm.nih.govGenBanK). Alinhamentos mltiplos foram obtidos utilizandose o programa Clustal W (www.ebi.ac.uK/Clustalw) e procedeu-se com a construo de uma rvore utilizando-se o programa MEGA 3.1

(www.megasoftware.net), pelo mtodo de neighbour-joining com 2000 repeties.

RESULTADOS E DISCUSSO

Inoculao mecnica e por afdeos Na anlise da inoculao mecnica foi constatado desenvolvimento de sintomas de mosaico e deformao foliar em plantas de N. benthamiana e mosaico G. purprea inoculada com o isolado QUI. Este resultado contrasta com aqueles obtidos por vila et al., (1982) que no observaram transmisso de um isolado de potyvrus estudado em plantas de inhame na Bahia para plantas indicadoras.

Transmisso mecnica de um potvirus de inhame para inhame foi constatada em nove de 24 gentipos inoculados (Odu et al., 2004). Nos testes de transmisso dos dois isolados por afdeos no foi observado o desenvolvimento de sintomas em nenhuma das plantas inoculadas. Contudo, Odu et al. (2004) observaram transmisso de um potivrus de inhame para inhame, empregando-se Aphis craccivora em 10 de 24 gentipos testados.

57

A ampla distribuio e susceptibilidade do YMV em plantas de Inhame-daCosta alta na regio da Mata Norte, Sul e litoral dos Estados de Pernambuco e Paraba, no entanto, plantas da cv. So Tom apresentou sintoma mais suave em ocorrncia de infeco simples (Figura 1A) e sintomas mais intensos, at de cordo de sapato quando ocorre em infeces com duas espcies virais (PioRibeiro et al., 2006).

Tcnica leaf dip e mtodo sorolgico de microscopia eletrnica Foram observadas partculas virais tpicas do gnero Potyvirus, tanto nas amostras de cv. Inhame-da-Costa e da cv. So Tom. Este resultado foi semelhante ao de vila et al. (1982) que observaram partculas alongadas de 680nm em preparaes leaf dip em inhame-da-Costa. Este mtodo tem se

mostrado uma forma rpida de deteco de vrus em inhame. Com o mtodo sorolgico de microscopia eletrnica foram observadas partculas virais do gnero Potyvirus nas amostras do isolado QUI (Figura 1 B). Transmisso via de tberas-sementes Das 90 tberas-sementes plantadas em microparcelas 82 se estabeleceram e das 45 em casa de vegetao 43 deram origem a plantas, as quais foram inicialmente analisadas visualmente. Com a anlise das amostras por PCR e RTPCR foi possvel associar os sintomas (Figura 2 A - F) tanto na cv. Inhame-daCosta como na cv. So Tom com a presena de vrus. Houve a confirmao de que 100% das plantas reproduziram sintomas idnticos aos observados em campo, confirmando-se a transmisso por tberas-sementes demonstrando que possvel disseminao do agente causal por meio do material de propagao.

58

Foi observado tambm que no rebrotamento de tberas oriundas de vasos e microparcelas h a presena do mesmo sintoma. Estes resultados concordam com os obtidos por Brilhante et al., 2005. Esta constatao est de acordo com as informaes da literatura consultada tendo em vista se tratar de propagao vegetativa (Bousalem et al., 2000). Nos plantios comerciais em Pernambuco e Paraba se verificou que no existe alta freqncia de infeco mista com os dois potyvrus, no entanto, ocorre mais comumente registro de um ou outro com badnavrus embora em alguns casos tenha se confirmado infeco por trs espcies, constatao que deve ser mais bem investigada por haver possibilidade de detectar outras espcies como, por exemplo, potexvrus nas reas estudadas se estendendo para um nmero maior de campos tanto para cv. Inhame-da-Costa como na So Tom (Pio-Ribeiro et al., 2006).

A anlise atravs de RT-PCR e determinao de seqncias Com as anlises de RT-PCR dos isolados virais oriundos de campos de Pernambuco, Paraba e Bahia, foi possvel determinar a infeco de YMV, YMMV e badnavrus em infeco simples ou mista como pode ser visualizado na Figura 3 A. Nas amplificaes via RT-PCR utilizando um par de oligonucleotdeos (YMV-CP 1F e YMV-UTR 1F) para os isolados QUI, BON, verificou-se a presena de um fragmento de aproximadamente 586 pares de bases, entretanto, para as amplificaes utilizando um par de oligonucleotdeos (YMMV-CP 2F e YMMVUTR-1F) para os isolados SJM e CND verificou-se a presena de um fragmento de aproximadamente 249 pares de bases (Figura 3 A). A partir dos fragmentos amplificados obteve-se as seqncias parciais referente regio C terminal da

59

capa protica (CP) para os quatro isolados. Com a amplificao das amostras para badnavrus se constatou fragmento de 579 pares de base (Figura 3B) Os isolados QUI e BON quando comparados SJM e CND apresentam similaridade de aproximadamente 78%, indicando se tratar de espcies diferentes (Figura 4), e quando comparados com outros potyvrus apresentaram maior similaridade com isolados de YMV (95,7% a 96,2%). No entanto, os isolados SJM e CND apresentaram maior similaridade com os isolados de YMMV (89,8% a 95,2%). No agrupamento filogentico preparado a partir das seqncias de nucleotdeos dos isolados QUI, BON, SJM e CND e de outros potyvrus disponveis no GenBanK observou-se a formao de grupos distintos entre os isolados, ou seja, os isolados QUI e BON agruparam-se no mesmo ramo da espcie YMV, ficando mais prximo das seqncias YMV-GrSavaneC4, j os isolados SJM e CND foram agrupados com os isolados de YMMV distantes dos isolados de YMV (Figura 4). A comparao das seqncias parciais dos isolados QUI, ITA CRA, referente a ORF III confirmou a presena de Dioscorea alata baciliform virus (DABV) com aproximadamente 97% de similaridade e baixa homologia (75%) com o isolado DSBV-B 39-6 disponvel no GenBank. interessante ressaltar que foi detectada infeco mista por badnavrus e potyvrus em isolados das vrias regies dos dois Estados (Figura 3 e 5). e entre os escolhidos para serem seqenciados em QUI se verificou a ocorrncia de infeco com YMV e DABV, confirmando infeco mista causada por duas espcies virais distintas. A rvore filogentica preparada a partir das seqncias parciais dos isolados de QUI, ITA e CRA e de outros badnavrus relacionados apresentada na

60

Figura 6. Os isolados QUI, ITA e CRA se agruparam no mesmo ramo dos isolados de DABV e distantes isolado DSBV-B39-6, que na literatura est descrito como uma nova espcie (Seal & Muller, 2007). possvel observar no agrupamento filogentico que os isolados QUI e ITA (Pernambuco) esto mais prximos entre si quando comparados com o isolado de CRA (Bahia) (Figura 7) indicando uma correlao entre as seqncias e a distribuio geogrfica dos isolados. Dessa forma, estudos adicionais sero necessrios para estudos da seqncia completa para maior nmero de amostras e reas de coleta. Foi possvel avaliar a similaridade dos isolados das reas fisiogrficas constantes do estudo se confirmando a ocorrncia de trs espcies virais em inhame na regio nordeste do Brasil. A epidemiologia da doena causada por YMV e YMMV, no est definida por no existir evidncia de qual a fonte primria de inculo deste vrus para o inhame, mais uma dificuldade para que sejam tomadas medidas eficientes para o controle desses patgenos em campo. Baseado nos estudos de caracterizao do YMV verificou-se que as caractersticas biolgicas do isolado de Potyvirus do inhame referidos por vila et al. (1982) no diferem daquelas apresentadas pelos isolados estudados por Pio-Ribeiro et. al., 2006 e dos resultados obtidos no estudo de Andrade et al., 2006.

AGRADECIMENTOS Ao Prof Elliot W. Kitajima pela colaborao na anlise de MET e ao estagirio Andr da Silva Xavier pela colaborao no processamento das amostras.

61

REFERNCIAS BIBLIOGRFICAS ALEMAN, M. E., MARCOS, J.F., BRUGIDOU, C., BEACHY, R.N. & FAUQUET, C. The complete nucleotide sequence of Yam mosaic vrus (Ivory Coast isolate) genomic RNA. Archives of Virology, v.141, n.7, p.1259-1278, 1996.

ALMEIDA, A.M.R. Deteco e quantificao de vrus por ELISA. In: ALMEIDA, A.M.R.;.A.A. (Eds.) Princpios e tcnicas de diagnose aplicadas em Fitovirologia. p.63-94, 2001.

AMUSA, N.A., ADEGBITE, A.A., MUHAMMED, S. & BAIYWU, R.A. Yam diseases and its management in Nigeria. African Journal of Biotecnology, v.2, n.12, p. 497-502 2003.

ANDRADE, G.P., SILVA, A.K.S., FILLOUX, D., PIO-RIBEIRO, G., KITAJIMA, E.W. & XAVIER, D.M. Plantas de Dioscorea alata infectada com YMMV no estado de Pernambuco. Fitopatologia Brasileira. v.31, p.S 344, 2006.

VILA, A.C., GAMA, M.I.C.S. & KITAJIMA, E.W. Deteco de um Potyvirus em inhame (Dioscorea spp.) no Brasil. Fitopatologia Brasileira. v.7, n.1, p.447-452, 1982.

BOARI, A.J., AZEVEDO, V.G., SILVA-MANN, R., FRANCO-FILHO, E. & KITAJIMA, E.W. Ocorrncia de Badnavirus e Potyvirus em inhame (Dioscorea sp.) no estado de Sergipe. Summa Phytopathologica, v.31, p.35-36, 2005.

62

BOUSALEM, M., DALLOT, S., FUJI, S., NATSUAKI, K.T. 2003. Origin, world-wide dispersion, bio-geographical diversification, radiation and recombination: an evolutionary history of Yam mild mosaic virus (YMMV). Infection, genetics and evolution. 3: 189-206.

DUTERME, O., COLINET, D., KUMMERT, J. & LEPOIVRE, P. Determination of the taxonomic pisition and characterization of Yam mosaic virus isolates based on sequence data of the 5-terminal part of the coat protein cistron. Archives of Virology. v.141, n.6, p.1067-1075, 1996.

HEARON, S.S. An ultrastruture study of Dioscorea spp. infected with two flexuous rot viruses. 1974. Proceedings American Phytopathological Society. v.1, p.151,

LAWSON, R. H., HEARON, S. S., SMITH, F. F. & KAHN, R. P. Electron microscopy and separation of viruses in Dioscorea floribunda. Phytopathology. v.63, p.1435, 1973.

MALAURIE, B., TROUSLOT, M-F., BERTHAUD, J., BOUSALEM, M., PINEL, A. & DUBERN, J. Meduim-term and long-term in vitro conservation and safe international exchange of yam (Dioscorea spp.) germplasm. EJB Eletronic Journal of biotechnology. v.1, n.3, p.1-15 1998.

63

MENDES, R.A. Cultivando inhame ou Car da Costa. Cruz das Almas. EMBRAPA. Circular Tcnicca n. 4. 2005, 26p.

MENEZES, M. Condies epidemiolgicas de doenas fngicas na cultura do inhame. In: SANTOS, E.S. (Cood.) Simpsio Nacional sobre as culturas do Inhame e do Taro. Simpsio Nacional sobre as culturas do Inhame e do Taro. Joo Pessoa, v.2, p.50-67, 2002.

MOURA, R.M. Doenas do inhame da Costa. In: KIMATI, H.; AMORIM, L.; BERGAMIN-FILHO, A.E. & CAMARGO, L.E.A. (Eds.) Manual de Fitopatologia: Doenas das Plantas cultivadas. v.2, 4 ed. So Paulo. p.415-419 2005.

MOURA, R.M. Problemas fitossanitrios do inhame no Nordeste e proposta para um sistema integrado de controle. In: SANTOS, E.S. (Cood.) Simpsio Nacional sobre as culturas do Inhame e do Taro. Joo Pessoa, v.2, p.68-72, 2002.

MUMFORD, R.A. & SEAL, S.E. Rapid Single-tube immunocapture RT-PCR for the detection of two yam potyviruses. Journal of Virological Methods. v.69, p 73-79, 1997.

ODU, B. O.; ASIEDU, R.; SHOYINKA, S. A.; HUGHES, J. D. A. Screening of water yam (Dioscorea alata L) genotypes for reactions to viruses in Nigria. Journal of Phytopathology, v. 154, p. 716-724, 2006.

64

PEDRALLI, G. Dioscoreaceae e Araceae: aspectos taxonmicos, ethobotnicos e espcies nativas com potencial para melhoramento gentico. In: SANTOS, E.S. (Cood.) Simpsio Nacional sobre as culturas do Inhame e do Taro, v.2, p.3953, 2002.

PHILLIPS, R.W., BRUNT, A.A. & HULL R. The parciail characterization of a Badanvirus infecting the greater Asiatic or Water yam (Dioscorea alata). Journal of Phytopathology, v.147, p.434-439, 1999.

PIO-RIBEIRO, G., MELO-FILHO, P.A., KITAJIMA, E.W., LIMA, S.K., ANDRADE, G.P. & DOMINGOS, C.A. Deteco de potyvrus em inhame em reas produtoras de Pernambuco e obteno de matrizes in vitro. Fitopatologia Brasileira, v.30, p.S 183, 2005.

PIO-RIBEIRO, G., ANDRADE, G.P., FILOUX, D., VERNIER, P., MELO-FILHO, P.A., ALMEIDA, H.S.M. & XAVIER, A.S. Plantas de inhame em Pernambuco e Paraba apresentam infeces simples e mista por potyvrus e badnavrus. Fitopatologia Brasileira, v.31, p.S 309, 2006.

RITZINGER, C.H.S.P., SANTOS FILHO, H.P., ABREU, K.C.L.M., FANCELLI, M. & RITZENGER, R. Aspectos fitossanitrios da cultura do inhame. Cruz das Almas. Documentos EMBRAPA/SPI, 2003, 39p.

65

SANTOS, E. S.; MACDO, L.S. Tendncias e Potencialidades da Cultura do Inhame (Dioscorea sp.) no Nordeste do Brasil, 2006. Disponvel em:

http://www.emepa.org.br/inhame_tendencias.php Acesso em: 12/ 11/06.

SANTOS, E. S. Manejo Sustentvel da Cultura do Inhame. (Dioscorea sp.) no Nordeste do Brasil, 2006. Disponvel em: http://

www.emepa.org.br/inhame_manejo.php Acesso em: 15/12/06.

SANTOS, E.S. Inhame (Dioscorea spp.): aspectos bsicos da cultura. Joo Pessoa: EMEPA-PB, SEBRAE, 1996. 158p.

SEAL, S. & MULLER, E. Molecular analysis of a full-length sequence of a new yam badnavirus from Dioscorea sasibarensis. Achives of Virology. v.152, n. 4, 829832, 2007.

YANG, I.C., HAFNER, G.J., REVILL, P.A.; DALE, J.L. & HARDING, R.M. Sequence diversity of South Pacific isolates of Taro bacilloform virus and the development of a PCR-based diagnostic test. Archives of Virology. v.148, p.1957-1968, 2003.

66

Tabela 1.

Origem

Espcie

Sintomas na planta

Teste realizado

Reaes em 1 ELISA**

RT-PCR YMV YMMV -

PCR DaBV + +

Paraba Alhandra Conde

Inhane-da-Costa Inhane-da-Costa

Conde Pitimb

So Tom Inhane-da-Costa

Mosaico intenso Mosaico intenso, cordo de sapato Mosaico intenso Mosaico intenso, cordo de sapato Mosaico intenso Mosaico intenso Mosaico suave Mosaico intenso Mosaico intenso Mosaico suave Mosaico suave Mosaico suave Mosaico intenso Mosaico intenso Mosaico intenso, clareamento de nervura Mosaico suave Assintomtico Mosaico Suave

DAC-ELISA* DAC-ELISA

+ +

DAC-ELISA DAC-ELISA

+ -

+ +

Bahia Cruz das Almas Pernambuco Aliana Aliana Bonito Condado Condado Goiana Goiana Quipap Itapissuma Vitria de Santo Anto Vitria de Santo Anto DEPA/UFRPE DEPA/UFRPE

Inhane-da-Costa Inhane-da-Costa So Tom Inhane-da-Costa Inhane-da-Costa So Tom Inhame-da-Costa So Tom Inhane-da-Costa So Tom So Tom (folha grande) So Tom (folha pequena) So Tom Dioscorea sp.

TAS-ELISA DAC-ELISA Nt DAC-ELISA Nt Nt DAC-ELISA Nt TAS-ELISA TAS-ELISA DAC-ELISA

Nt Nt Nt Nt + -

+ + + + + -

+ + + + + +

+ + + + + + + + +

DAC-ELISA DA-ELISA DAC-ELISA

+ -

+ -

*Anti-soro utilizados no DAC-ELISA: CMV ** Anti-soro utilizados no TAS-ELISA: YMV, CMV e CABMV. 1 Apenas para as amostras de Quipap e Itapissuma se utilizou os trs anti-soros Nt= No testado

67

Figura 1, 2 e 3

68

Fig 4.
YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus YMV_DrCDI1.seq YMV_DRnig8.seq YMV_DrCMN_164.se YMV_Dr_ben3.seq YMV_GR_savaneC4. YMV_DSnig.seq YMV_GrGha4.seq GPR1.seq GPR2.seq Consensus ATGATGGACGGTGCGGAGCAGGTGGAATATCCATTGAAAC ATGATGGACGGTGCGGAGCAGGTGGAATATCCATTGAAAC ATGATGGACGGTGTGGAGCAGGTGGAGTATCCATTGAAAC ATGATGGACGGTGCGGAGCAGGTGGAATACCCATTGAAAC ATGATGGACGGTGCGGAGCAAGTGGAATACCCATTGAAAC ATGATGGACGGTGCGGAGCAAGTGGAATATCCATTGAAAC ATGATGGACGGTGCGGAGCAAGTGGAATATCCATTGAAAC ATGAAAGACGGTGCGGAGCAAGTGGAATATCCATTAAAAC ATGATGGACGGTGCGGAGCAAGTGGAATATCCATTAAAAC atga gacggtg ggagca gtgga ta ccatt aaac CGATCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGATCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGATCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGATCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGATCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGATCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGGTCATAGAAAATGCCAAACCCACATTTCGTCAGATAAT CGTTCATAGAGAATGCCAAACCCACAATTCGTCAGATAAT CGATCATAGAGAATGCCAAACCCACATTTCGTCAGATAAT cg tcataga aatgccaaacccaca ttcgtcagataat GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG GATGCATTTTAGTGACGCGGCTGAAGCGTACATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTATATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG GATGCATTTCAGTGACGCAGCTGAAGCGTACATTGAATTG gatgcattt agtgacgc gctgaagcgta attgaattg CGGAACTCAAAAGAACCGTATATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTACATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTATATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTATATGCCCCGGTACGGTATTC CGGAACTCAAAAGAACCGTATATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTACATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTATATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTACATGCCCCGATACGGTATTC CGGAACTCAAAAGAACCGTACATGCCCCGATACGGTATTC cggaactcaaaagaaccgta atgccccg tacggtattc AGCGCAATTTGAGGGACTACTCATTGGCCAGATATGCGTT AGCGCAATTTGAGGGACTACTCATTGGCCAGATATGCGTT AGCGCAATTTGAGGGACTACTCATTGGCTAGATATGCGTT AGCGCAATTTGAGGGATTACTCATTGGCCAGATATGCGTT AGCGCAATTTGAGGGATTACTCATTGGCCAGATATGCGTT AGCGCAATTTGAGGGACTACTCATTGGCCAGATATGCGTT AGCGCAACTTAAGGGACTACTCATTGGCCAGATATGCGTT AGCGCAATTTGAGGGATTACTCATTGGCCAGATATGCGTT AGCGCAATTTGAGGGATTACTCATTGGCCAGATATGCGTT agcgcaa tt aggga tactcattggc agatatgcgtt CGACTTCTTAGAGATAACTTCTAAAACTCCAGTTCGAGCG CGACTTCTTAGAAATAACTTCTAAAACTCCAGTTCGAGCG CGACTTCTTAGAGATAACTTCGAAAACTCCAGTTCGAGCG CGACTTCTTAGAGATAACTTCTAAAACTCCAGTTCGAGCG CGACTTCTTAGAGATAACTTCTAAAACTCCAGTTCGAGCG CGACTTCTTAGAGATAACTTCTAAAACTCCAGTTCGAGCG CGATTTCTTAGAGATAACTTCTAAAACTCCAGTTCGAGCG CGATTTCCTAGAGATAACCTCTAAAACTCCAGTTCGAGCG CGATTTCCTAGAGATAACCTCTAAAACTCCAGTTCGAGCG cga ttc taga ataac tc aaaactccagttcgagcg CGTGAAGCCCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCTCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAGGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAAGCAGCAGCTATTGGAA CGTGAAGCCCACCATCAGATGAAAGCAGCAGCTATTGGAA cgtgaagc caccatcagatgaa gcagcagctattggaa ACAAGACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAGGCTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAGACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAGACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAGACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAGACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAGACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAAACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG ACAAAACTTACAAAATGTTTGGATTTGATGGCAAAGTGGG acaa cttacaaaatgtttggatttgatggcaaagtggg TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAAAGACACGCTGCAAGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT TTCCCAGGAAGAGGATACAGAGAGACACGCTGCAGGTGAT ttcccaggaagaggatacaga agacacgctgca gtgat GTCACGAAAGACATGCACAGCCTTTTGGGCATGAGAGGT. GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGTA GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGT. GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGT. GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGT. GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGTA GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGT. GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGT. GTCACGAAAGACATGCACAGCCTTTTAGGCATGAGAGGT. gtcacgaaagacatgcacagcctttt ggcatgagaggt 40 40 40 40 40 40 40 40 40

80 80 80 80 80 80 80 80 80

120 120 120 120 120 120 120 120 120

160 160 160 160 160 160 160 160 160

200 200 200 200 200 200 200 200 200

240 240 240 240 240 240 240 240 240

280 280 280 280 280 280 280 280 280

320 320 320 320 320 320 320 320 320

360 360 360 360 360 360 360 360 360

399 400 399 399 399 400 399 399 399

69

Fig 5.
Ymmv_guard_3.seq YMMV_togo_1.seq GPR4.seq GPR3.seq YMMV_mart1.seq YMMV_JPN_3.seq YMMV_PNG_2.seq Consensus Ymmv_guard_3.seq YMMV_togo_1.seq GPR4.seq GPR3.seq YMMV_mart1.seq YMMV_JPN_3.seq YMMV_PNG_2.seq Consensus Ymmv_guard_3.seq YMMV_togo_1.seq GPR4.seq GPR3.seq YMMV_mart1.seq YMMV_JPN_3.seq YMMV_PNG_2.seq Consensus Ymmv_guard_3.seq YMMV_togo_1.seq GPR4.seq GPR3.seq YMMV_mart1.seq YMMV_JPN_3.seq YMMV_PNG_2.seq Consensus CAAATGAAAGCAGCAGCTTTACGGAATACCAGAACTCGTC CAAATGAAGGCAGCAGCTTTACGGAATACCAGAACTCGTC CAAATGAAAGCAGCAGCTTTACGGAACACCAGAACTCGTC CAAATGAAAGCAGCAGCTTTACGGAACACCAGAATTCGAC CAAATGAAAGCAGCAGCTCTACGGAACACCAGAACTCGTC CAAATGAAGGCAGCAGCTTTAAGGAACACCAGAACTCGAC CAAATGAAGGCAGCAGCCTTAAGGAACACCAGAACTCGAC caaatgaa gcagcagc ta ggaa accagaa tcg c TTTTTGGTCTAGACGGTTCTGTCAGCAACAACGAGGAAAA TTTTTGGTCTAGACGGTTCTGTCAGCAACAACGAGGAAAA TTTTTGGTCTAGATGGTTCTGTCAGCGGCAACGAGGAAAA TTTTTGGCCTAGATGGTTCTGTCAGCAACAACGAGGAAAA TTTTCGGTTTAGATGGTTCTGTCAGCAACAATGAGGAAAA TTTTCGGTTTCGATGGTTCTGTCAGCAACAACGAAGAGAA TTTTCGGTTTAGATGGTTCTGTCAGCAATAACGAAGAGAA tttt gg t ga ggttctgtcagc aa ga ga aa CACAGAAAGGCACACAAGCGATGATGTGAGCAAGGACATG CACAGAAAGGCACACAAGCGATGATGTGAGCAAGGACATG CACAGAAAGGCACACAAGCGATGATGTGAGCAAGGACATG CACAGAAAGNCACACAAGCGATGATGTGAGCAAGGACATG CACGGAGCGGCACACAAGTGATGACGTGAGCAAAGACATG CACAGAACGACACACAAGTGACGATGTGAGCAAAGACATG CACAGAACGACACACAAGTGATGATGTGAGCAAAGACATG cac ga g cacacaag ga ga gtgagcaa gacatg CACTCTCTTCTTGGAGTGCGCAATATCT CACTCTCTTCTTGGAGTGCGCAATATCT CACTCTCTTCTTGGAGTGCGTAATATCT CACTCTCTTCTTGGAGTGCGCAATATCT CACTCTCTTCTTGGAGTGCGCAATATCT CACTCTCTTCTCGGAGTGCGCAATATCT CACTCTCTTCTCGGAGTGCGCAATATCT cactctcttct ggagtgcg aatatct 40 40 40 40 40 40 40

80 80 80 80 80 80 80

120 120 120 120 120 120 120

148 148 148 148 148 148 148

70

Fig 6 e 7.

71

LEGENDA

Tabela 1. Amostras de inhame de diferentes reas produtoras analisadas pelos testes DAC-ELISA e TAS-ELISA FIG 1. Folha de inhame e partculas virais. A- Partculas observadas em

preparaes leaf dip em amostra da cv. Inhame-da-Costa; B- Sintomas de mosaico na cv. So Tom. FIG 2. Sintomas em planta de inhame e tberas coletadas de plantas marcadas em campo. A- Sem sintomas (fita branca); B- Pouco sintoma (fita azul); CSintomas severos (fita amarela); D F- Tberas colhidas de plantas marcadas.

FIG 3.

Gel de agarose com produtos de RT-PCR e PCR. Gis A e B- M= Indicao de peso molecular (Marcador); ala= Dioscorea alata e rot.= Dioscorea rotundata, controles fornecidos pelo CIRAD; 2;4;5;6 e 7=Amostras. rot.= Dioscorea rotundata; ala= Dioscorea alata; m= Yam mosaic virus (YMV); mm= Yam mild mosaic virus (YMMV) b= Badanavirus; PE= Pernambuco; PB= Paraba.

FIG 4. Alinhamento mltiplo entre as seqncias dos isolados QUI e BON (YMV) e outros isolados de YMV disponveis no GenBanK. Os nucleotdeos marcados com a cor preta significam alta similaridade entre as seqncias; nucleotdeos marcados com a cor rosa significam

similaridade intermediria entre as seqncias; nucleotdeos marcados com a cor azul significam baixa similaridade entre as seqncias e nucleotdeos no significam que so diferentes dos demais

72

FIG 5.

Alinhamento mltiplo entre as seqncias dos isolados SJM e CND (YMMV) e outros isolados de YMMV disponveis no GenBanK. Os nucleotdeos marcados com a cor preta significam alta similaridade entre as seqncias; nucleotdeos marcados com a cor rosa significam similaridade intermediria entre as seqncias; nucleotdeos marcados com a cor azul significam baixa similaridade entre as seqncias e nucleotdeos no marcados significa que so diferentes dos demais.

FIG 6.

rvore filogentica preparada a partir das seqncias de nucleotdeos referente a regio C terminal da protena capsidial de isolados de potyvrus causadores do Yam mosaic virus e Yam mild mosaic virus. O comprimento dos ramos horizontais proporcional distncia gentica entre os isolados; os ramos verticais so arbitrrios. Os nmeros sobre os ramos indicam a porcentagem de repeties da anlise de bootstrap na qual as ramificaes foram observadas.

FIG 7.

rvore filogentica preparada a partir das seqncias de nucleotdeos referente a regio C terminal da protena capsidial de isolados de badnavrus causadores do Dioscorea alata baciliform virus (DaBV). O comprimento dos ramos horizontais proporcional distncia gentica entre os isolados; os ramos verticais so arbitrrios. Os nmeros sobre os ramos indicam a porcentagem de repeties da anlise de bootstrap na qual as ramificaes foram observadas.

CONCLUSES GERAIS

74

CONCLUSES GERAIS

A cultura do inhame (Dioscorea spp.) no Nordeste brasileiro apresenta importantes pragas e doenas nas regies produtoras pesquisadas.

No campo, destacam-se, a lagarta da folhagem (Pseudoplusia oo), Pinta Preta (Curvularia eragrostidis); Casca Preta (Scutellonema bradys e Pratyllenchus coffea), Meloidoginose (Meloidogyne spp.) e viroses (Yam mosaic virus, Yam mild mosaic virus e badnavrus);

A lagarta da folhagem, presente em todas as reas mais prevalente em D. alata, Inhame So Tom;

Pinta Preta, registrada em todos os campos predominante em D. rotundata, Inhame-da-Costa;

Casca Preta, observada na maioria dos campos apresenta maior intensidade em D. rotundata, causada por Pratyllenchus coffea;

Meloidoginose, detectada na maioria das reas produtoras, mostra baixa intensidade, sendo mais frequente em D. rotundata;

75

As viroses, presentes em praticamente todos os campos possui maior frequncia e intensidade em D. rotundata;

Em tberas-sementes armazenadas, alm do agravamento dos danos de Casca Preta, predominam cochonilha (Planoccocus sp.), broca das tberas (Araecerus fasciculatus) e Podrido Verde (Penicillium sclerotigenum) ;

Todas as pragas e doenas de armazenamento desenvolveram-se em material de todas as reas pesquisadas, sendo que a Podrido Verde preedominou em D. rotundata;

Ficou comprovado que as tberas-semente so veculos importantes para sobrevivncia, disseminao e acmulo das trs espcies virais estudadas.