Você está na página 1de 362




01. Reservas de carboidratos nos msculos esquelticos ficam na forma de: a) glicognio. b) maltose. c) ATP. d) sacarose. e) glicose. [A] 02. Os dois grficos a seguir referem-se velocidade da reao A+B C+D, que ocorre em animais de uma mesma espcie, quando suas temperaturas variam. O grfico nmero 1 representa a reao em um indivduo que, alm dos reagentes A e B, possui o polipeptdeo E, que no ocorre no indivduo do grfico nmero 2. e) O alto teor nutritivo do produto devido ao fato de as molculas orgnicas simples obtidas serem sais minerais indispensveis ao desenvolvimento orgnico. [B] 07. Analise a seguinte experincia. PRIMEIRA ETAPA Procedimento: Em dois tubos de ensaio, numerados como I e II, acrescenta-se: TUBO I - gua oxigenada + dixido de mangans TUBO II - gua oxigenada + fgado Resultado obtido: formao de borbulhas nos dois tubos. Concluso: desprendimento de gs oxignio proveniente da decomposio da gua oxigenada devido ao dixido de mangans (Tubo I) e alguma substncia liberada pela fgado (Tubo II). SEGUNDA ETAPA Procedimento: adio de nova quantidade de gua oxigenada nos dois tubos da primeira etapa desta experincia. Resultado obtido: novo desprendimento de borbulhas (gs oxignio) nos dois tubos. Concluso: O dixido de mangans (Tubo I) e a substncia liberada pelo fgado (Tubo II) no foram consumidas nas reaes da primeira etapa experincia. Com base nesta experincia podemos concluir que o dixido de mangans e a substncia liberada pelo fgado so: a) enzimas. b) catalisadores. c) ionizadores. d) substncias orgnicas. e) substncias inorgnicas. [B] 08. "Pesquisador brasileiro desenvolve uma bactria que permite produzir lcool a partir do soro do leite e do bagao da cana." A produo do lcool pela bactria ocorrer graas a um processo de: a) fermentao. b) combusto. c) fotlise. d) oxidao eletrnica. e) respirao aerbia. [A] 09. Muitas estruturas do nosso organismo possuem em sua estrutura o colgeno. Quimicamente, o colgeno pertence ao grupo de: a) carboidratos b) lipdeos c) protenas d) glicdeos e) cidos nuclicos [C] 10. Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

V = velocidade de formao do produto C em mg/hora. Baseado nos grficos, responda: a) Em que grupo de substncias pode ser classificado o polipeptdeo E? b) D duas justificativas para a sua classificao. a) Enzima b) Os catalisadores biolgicos atuam dentro de uma faixa "tima" de temperatura (grfico 1). Sem o catalisador a reao lenta como mostra o grfico 2. 03. As________ so compostos formados por ________unidos (as) por ligaes ________e as _______so ________ orgnicos, de natureza _______sensveis s variaes de temperatura. Os termos que corretamente preenchem as lacunas so, respectivamente, a) gorduras - protenas - peptdicas - enzimas - acares - lipdica. b) protenas - aminocidos - energticas - gorduras - compostos - protica. c) protenas - aminocidos - peptdicas - enzimas - catalisadores - protica. d) enzimas - aminocidos - hdricas - protenas - catalisadores - lipdica. e) protenas - acares - proticas - enzimas - acares - enzimtica. [C] 04. Se corarmos uma clula animal com um corante especfico para RNA, a estrutura mais corada ser a) o lisossomo. b) o complexo de Golgi. c) a mitocndria. d) o nuclolo. e) o centrolo. [D] 05. O esquema a seguir representa um tipo de processo energtico utilizado por alguns seres vivos na natureza. Esse processo denominado:

a) fotossntese. d) respirao. [B]

b) quimiossntese. e) putrefao.

c) fermentao.

06. "Cear joga fora opo alimentar" Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabea de lagosta no so aproveitadas sendo lanadas ao mar. "0 estudo sobre hidrlise enzimtica de desperdcio de lagosta", ttulo do pesquisador Gustavo Vieira, objetiva o uso de material de baixo custo para enriquecer a alimentao de populaes carentes. O processo consiste na degradao de molculas orgnicas complexas em simples por meio de um catalisador e na posterior liofilizao. O p resultante de alto teor nutritivo, com baixa umidade e resiste, em bom estado de conservao, por longos perodos. Com base nos processos descritos no artigo anterior, assinale a opo correta. a) As molculas orgnicas simples obtidas so glicerdios que so utilizados pelo organismo com funo reguladora. b) As molculas orgnicas complexas empregadas so protenas que, ao serem digeridas em aminocidos so utilizadas pelo organismo com funo estrutural. c) O catalisador do processo uma enzima capaz de degradar protenas em monossacardeos essenciais liberao de energia para as atividades orgnicas. d) A hidrlise enzimtica de molculas orgnicas complexas realizada por catalisador inorgnico em presena de gua.

a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso. a) O ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA. b) Protenas e Glicoprotenas porque os ribossomos produzem as protenas que so associadas aos acares no Complexo de Golgi. 11. A organela citoplasmtica que se origina a partir do nuclolo e que sintetiza protenas o a) ribossomo. b) centrolo. c) lisossomo. d) cloroplasto. e) complexo de Golgi. [A] 12. A produo de ATP numa clula animal ocorre, fundamentalmente, a) nos golgiossomos. b) nos cromossomos. c) nos lisossomos. d) nos ribossomos. e) nas mitocndrias. [E] 13. Uma clula que perdeu grande quantidade de gua s poder se recuperar se colocada em soluo a) isotnica. b) hipotnica. c) hipertnica. d) isotnica ou hipertnica. e) isotnica ou hipotnica. [B]

2 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

14. Considere o texto a seguir. "As clulas caliciformes do intestino secretam muco que constitudo, fundamentalmente, por glicoprotenas. A parte protica do muco sintetizada .......(I)....... e a polissacardica, ........(II)........" Para completar o texto corretamente, I e II devem ser substitudos, respectivamente, por a) nos ribossomos e nas mitocndrias. b) nas mitocndrias e no complexo de Golgi. c) no complexo de Golgi e nas mitocndrias. d) no retculo endoplasmtico rugoso e no complexo de Golgi. e) no retculo endoplasmtico rugoso e nas mitocndrias. [D] 15. Dois apreciadores de vinho fizeram vrias suposies sobre o assunto. A alternativa que contm a suposio biologicamente correta a) "A acidez do vinho devida aos cidos orgnicos presentes nas leveduras utilizadas na sua fabricao." b) "A doura de alguns vinhos se deve fermentao completa dos carboidratos de uva." c) "A fermentao permite a quebra das ligaes peptdicas das protenas da uva." d) "As folhas das parreiras realizam a fotossntese, sem a qual no haver a matria-prima para a fermentao." e) "Se o lcool no fosse adicionado durante a fabricao dos vinhos, beberamos suco de uva." [D] 16. Os sintomas a seguir numerados se referem aos efeitos mais marcantes da carncia de algumas vitaminas no organismo humano. I. Deformao no esqueleto e anomalias da dentio. II. Secura da camada crnea do globo ocular e deficincia visual em ambiente de luz fraca. III. Dificuldade de coagulao do sangue. IV. Inflamao da pele e das mucosas, com sangramento. Esses sintomas esto associados, respectivamente, carncia das vitaminas a) D, E, C e A b) K, A, B e D c) B, K, A e C d) B, D, K e A e) D, A, K e C [E] 17. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Os sais minerais existem nos seres vivos de forma imobilizada ou dissociados em ons. Pequenas variaes nas porcentagens de ons podem modificar profundamente a permeabilidade, irritabilidade e viscosidade de clula. Analise as propostas apresentadas. ( ) Magnsio (Mg+2) presente na clorofila , portanto, necessrio fotossntese. ( ) Clcio (Ca+2) necessrio para a ao de certas enzimas em importantes processos fisiolgicos. ( ) Ferro (F+2), presente na hemoglobina, faz parte de pigmentos importantes na respirao (citocromos). ( ) Fosfato (PO4--) o principal ction extra e intracelular. ( ) Cloreto (Cl - ) importante ction presente tanto na hemoglobina quanto na clorofila. VVVFF 18. O exagero na prtica de exerccios fsicos leva a dores musculares fortes. Isso ocorre devido ao acmulo de: a) cido pirvico. b) cido lctico. c) cido ntrico. d) cido fosfoglicrico. e) cido flico. [B] 19. Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos. Sobre as substncias que compem os seres vivos, correto afirmar que: 01. os carboidratos, os lipdios e as vitaminas so fontes de energia para os seres vivos; 02. a gua a substncia encontrada em maior quantidade nos seres vivos; 04. alm de sua funo energtica, os carboidratos esto presentes na formao de algumas estruturas dos seres vivos; 08. as gorduras constituem o principal componente estrutural dos seres vivos; 16. os seres vivos apresentam uma composio qumica mais complexa do que a matria bruta, sendo formados por substncias orgnicas, como as protenas, os lipdios, os carboidratos, as vitaminas e os cidos nuclicos. 02 + 04 + 16 = 22 20. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. A gua a substncia mais abundante na constituio dos mamferos. encontrada nos compartimentos extracelulares (lquido intersticial), intracelulares (no citoplasma) e transcelulares (dentro de rgos como a bexiga e o estmago). Sobre a gua e sua presena nos mamferos CORRETO afirmar que: 01. a quantidade em que encontrada nos organismos invarivel de espcie para espcie. 02. com passar dos anos, existe uma tendncia de aumentar seu percentual em um determinado tecido. 04. importante fator de regulao trmica dos organismos. 08. em tecidos metabolicamente ativos inexistente. 16. participa da constituio dos fluidos orgnicos que transportam substncias dissolvidas por todo o corpo.

32. constitui meio dispersante para facilitar a realizao das reaes qumicas. 04 + 16 + 32 = 52 21. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. A "teoria celular", uma das maiores generalizaes da biologia, postula que todos os seres vivos so formados por clulas. Em relao morfofisiologia celular, julgue os itens. ( ) As clulas procariontes caracterizam-se pela ausncia de material gentico. ( ) As mitocndrias so organelas responsveis pela respirao celular. ( ) A carioteca delimita o contedo nuclear. ( ) O trifosfato de adenosina (ATP) um composto qumico constitudo pela base nitrogenada adenina, pelo acar ribose e por trs radicais fosfatos. FVVV 22. Considere os seguintes orgnulos celulares: I. LISOSSOMO II. COMPLEXO DE GOLGI III. CLOROPLASTO IV. MITOCNDRIA A sntese de ATP (adenosina trifosfato) ocorre normalmente: a) apenas em III. b) apenas em IV. c) apenas em II e III. d) apenas em III e IV. e) em I, II, III e IV. [D] 23. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Um dos maiores cientistas de todos os tempos, Louis Pasteur (18221895), foi um pioneiro. Em 1995, ele foi homenageado pela comunidade cientfica mundial, por ocasio do centenrio de sua morte. Destacam-se como contribuies de Pasteur: - "Nada existe no ar, capaz de gerar, a no ser os germes, que este mesmo ar carrega." (Pasteur, apud CINCIA HOJE, p. 10.) - "Muitas doenas de plantas e animais so causadas pela invaso de germes. - As perdas na indstria do vinho, por sua transformao em vinagre, na Frana do sculo XIX, eram causadas por bactrias. - O aquecimento moderado, por um determinado perodo de tempo, eliminava microorganismos que contaminavam o vinho e a cerveja. - A mortalidade causada por infeces ps-operatrias foi drasticamente diminuda com o uso de processos de esterilizao. - A imunidade clera das galinhas, ao carbnculo e raiva pde ser alcanada, atravs da injeo de vrus artificialmente atenuados. Entre as repercusses do trabalho de Pasteur no campo da Biologia Celular, pode-se citar: (01) A reproduo celular um dos atributos que definem a condio vital. (02) Microorganismos causadores de doenas limitam-se categoria das clulas eucariticas. (04) Variaes trmicas so insuficientes para provocar alteraes em processos celulares de microorganismos. (08) O sucesso dos procariotos, na contaminao do vinho, se relaciona simplicidade do seu processo reprodutivo. (16) Vinho e vinagre so produtos de atividade biolgica, envolvendo sistemas enzimticos correlacionados. (32) As clulas procariticas e eucariticas se diferenciam basicamente pelos mecanismos de obteno de energia. (64) As clulas so capazes de responder de modo a neutralizar o efeito de um agente infeccioso. 16 24. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Foi Louis Pasteur quem observou, pela primeira vez, na dcada de 1860, que, quando o oxignio introduzido em uma suspenso de clulas que esto consumindo glicose em alta velocidade, em anaerobiose, essa velocidade diminui significativamente, medida que o oxignio passa a ser consumido. Ao mesmo tempo, cessa o acmulo de lactato. O "efeito Pasteur", descrito anteriormente, se relaciona a aspectos da fisiologia e da estrutura celular, tais como: (01) A utilizao da glicose para obteno de energia em clulas aerbicas facultativas. (02) A exigncia de organelas celulares especializadas para o metabolismo anaerbico da glicose. (04) A sntese de lactato como produto final do metabolismo energtico mais rentvel. (08) O consumo do oxignio no processo de degradao completa da molcula de glicose. (16) A dependncia de membranas celulares para sntese de ATP, no processo aerbico de produo de energia. (32) O bloqueio da gliclise pela presena de oxignio nas clulas aerbicas. (64) A relao entre o mecanismo bioenergtico utilizado e a quantidade de glicose consumida. 01 + 02 + 08 + 16 + 64 = 91 25. A fenilcetonria uma doena que resulta de um defeito na enzima fenilalanina hidroxilase, que participa do catabolismo do aminocido fenilalanina. A

2 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

falta de hidroxilase produz o acmulo de fenilalanina que, por transaminao, forma cido fenilpirvico. Quando em excesso, o cido fenilpirvico provoca retardamento mental severo. Por outro lado, o portador desse defeito enzimtico pode ter uma vida normal desde que o defeito seja diagnosticado imediatamente aps o nascimento e que sua dieta seja controlada. A fenilcetonria to comum que mesmo nas latas de refrigerantes dietticos existe o aviso: "Este produto contm fenilcetonricos!". Qual o principal cuidado a tomar com a dieta alimentar de um portador desse defeito enzimtico? Por qu? Evitar a ingesto de alimentos que contenham o aminocido fenilalanina pois os "fenilcetonricos" so incapazes de metabolizar essa substncia e correm risco de apresentar graves distrbios metablicos com conseqncias irreversveis. 26. Assinale a alternativa que completa CORRETAMENTE as afirmativas a seguir: As_________ so protenas especiais que_________ reaes qumicas que ocorrem no_________ das clulas. Quando o organismo aquecido demasiadamente, elas so__________. a) gorduras; catalisam; interior; desnaturadas b) molculas; aceleram; exterior; recriadas c) enzimas; retardam; exterior; derretidas d) gorduras; alteram; limite; destrudas e) enzimas; catalisam; interior; desnaturadas [E] 27. O esquema abaixo representa o processo de:

3. fermentao actica Coluna II ( ) fabricao de po ( ) produo de vinagre ( ) fabricao de queijos A seqncia correta, de cima para baixo, na coluna II : a) 1, 2, 3 b) 1, 3, 2 c) 2, 1, 3 d) 2, 3, 1 e) 3, 1, 2 [B] 33. As carnes "salgadas" no se estragam, porque qualquer microorganismo que nela se instalar desidratar e morrer. Esta carne se encontra no estado: a) hipotnica b) isotnica c) trgida d) osmtica e) hipertnica [E] 34. O processo qumico realizado por certos microorganismos e que tem como produtos finais lcool e gs carbnico denomina-se: a) fotossntese b) sudao c) respirao d) fermentao e) fotlise [D] 35. Durante a Preparao do po, para que a massa cresa, adiciona-se um pouco de fermento ('Saccharomyces sp'.). O crescimento da massa est relacionado com a: a) embebio da farinha pela gua eliminada pelo fungo. b) dilatao da massa em virtude da alta temperatura do forno. c) formao de vapor d'gua no interior da massa. d) formao de gs carbnico resultante da fermentao. e) proliferao extraordinria do fermento em funo da temperatura. [D] 36. O corante I especfico para DNA e o corante II para RNA. Um pesquisador usou esses dois corantes em clulas fixadas e observou sua ao sobre algumas organelas citoplasmticas. Assinale, no quadro a seguir, a alternativa que representa os possveis resultados obtidos por esse pesquisador (o sinal + significa reao positiva e o sinal negativa).

a) osmose, onde as molculas de solvente migram da soluo mais concentrada para a soluo menos concentrada. b) osmose, onde as molculas de soluto migram da soluo menos concentrada para a soluo mais concentrada. c) difuso, onde as molculas de soluto tendem a se distribuir homogeneamente, migrando da regio mais concentrada para a regio menos concentrada. d) difuso, onde as molculas de soluto tendem a se distribuir homogeneamente, migrando da regio menos concentrada para a mais concentrada. e) transporte ativo, onde as molcula de soluto tendem a se distribuir homogeneamente, j que ocorre gasto de energia. [C] 28. A equao simplificada a seguir, representa o processo de fermentao realizado por microorganismos como o 'Saccharomyces cerevisiae' (levedura). A B +C A, B e C so, respectivamente: a) glicose, gua e gs carbnico. b) glicose, lcool e gs carbnico. c) lcool, gua e gs carbnico. d) lcool, glicose e gs oxignio. e) sacarose, gs carbnico e gua. [B] 29. A principal substncia ORGNICA que encontramos nas clulas dos seres vivos animais (so): a) a gua. b) gorduras. c) protenas. d) sais. e) vitaminas. [C] 30. A principal substncia INORGNICA que encontramos nas clulas dos seres vivos (so): a) a gua. b) gorduras. c) protenas. d) sais. e) vitaminas. [A] 31. O elemento qumico Nitrognio essencial para os seres vivos porque entra na composio a) dos acares e gorduras. b) das protenas e dos cidos nuclicos. c) das gorduras e dos cidos nuclicos. d) das vitaminas e dos acares. e) dos cidos nuclicos e das vitaminas. [B] 32. Relacione a coluna I com a coluna II: Coluna I 1. fermentao alcolica 2. fermentao ltica [D] 37. O esquema a seguir representa dois processos observados numa clula eucaritica.

Assinale a alternativa correta. a) O processo 1 somente observado no ncleo da clula, sendo inexistente em todas as outras organelas. b) Para interromper o processo 2, necessrio bloquear o funcionamento de todo o retculo endoplasmtico dessa clula. c) O processo 2 ocorre principalmente no perodo S da intrfase. d) Um dos mais importantes locais de ocorrncia do processo 1 o nuclolo. e) As molculas produzidas no processo 2 podero ser utilizadas como catalisadoras, mas nunca sero constituintes de outras organelas. [D] 38. Reservas de carboidrato nos msculos ficam na forma de a) glicognio. b) lactose. c) amido. d) sacarose. e) glicose. [A] 39. Observe o seguinte esquema:

3 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Assinale a alternativa que identifica corretamente as organelas e os processos celulares representados em I e II. a) I - (ribossomo - sntese de acares), II - (mitocndria - respirao) b) I - (cloroplasto - fotossntese), II - (ribossomo - respirao) c) I - (cloroplasto - fotossntese), II - (mitocndria - respirao) d) I - (mitocndria - respirao), II - (cloroplasto - fotossntese) e) I - (mitocndria - sintese de acares), II - (ribossomo - respirao) [C] 40. Considere as seguintes afirmativas: I - As protenas so molculas de grande importncia para os organismos - atuam tanto estruturalmente como tambm metabolicamente. II - As enzimas so protenas que atuam como catalisadores biolgicos. III - Existem protenas que atuam como linhas de defesa do organismo e algumas delas so conhecidas como anticorpos. Quais esto corretas? a) Apenas I b) Apenas II c) Apenas III d) Apenas II e III e) I, II, III [E] 41. O esquema a seguir mostra a via metablica de um aminocido, levando formao de alguns hormnios:

a) capaz de se ligar a outra molcula do mesmo tipo atravs de pontes de hidrognio. b) Entra na constituio de enzimas. c) R representa um radical varivel que identifica diferentes tipos moleculares dessa substncia. d) Os vegetais so capazes de produzir todos os tipos moleculares dessa substncia, necessrios sua sobrevivncia. e) Essas molculas so unidas umas s outras nos ribossomos. [A] 44. As hemcias humanas foram selecionadas ao longo da evoluo de modo a que desempenhassem hoje em dia suas funes de maneira eficiente. Durante este processo evolutivo, as mitocndrias e os ncleos foram perdidos na fase madura. Quais dos processos biolgicos a seguir continuam a ocorrer, nas hemcias maduras, apesar desta adaptao? a) Cadeia transportadora de eltrons. b) Ciclo de Krebs. c) Gliclise. d) Replicao. e) Transcrio. [C] 45. Analise o esquema simplificado a seguir:

As fases 1 e 2 do esquema resumem, respectivamente: a) fotossntese e fermentao b) respirao e fotossntese c) fermentao e respirao d) fotossntese e respirao [D] 46. O esquema a seguir resume o consumo (X) e a produo (Y) de ATP, na gliclise, por molcula de glicose oxidada:

A respeito deste esquema so feitas as seguintes afirmaes: I - Um indivduo com a enzima 1 inibida acumular grandes quantidades de aminocido 3. II - Um indivduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. III - Um indivduo com a enzima 1 inibida precisa receber os hormnios 1 e 2 de fontes externas. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) Apenas II e III. [C] 42. Considere um gato siams, que difere de outras raas de gatos por sua pelagem caracterstica: escura nas patas, no focinho e no pavilho auditivo, contrastando com o resto do corpo, onde clara. As regies escuras so as mais frias e nelas, a substncia que controla a produo do pigmento responsvel pela pelagem escura ativa, enquanto nas claras, que so quentes, essa substncia inativa.Pela sua ao no escurecimento da pelagem do animal, conclui-se que essa substncia : a) um glicdio b) um lipdio c) uma enzima d) um glicosaminoglicano e) uma vitamina [C] 43. Assinale a alternativa INCORRETA a respeito da molcula dada pela frmula geral a seguir

Os valores de X e Y so, respectivamente: a) 2 e 4 b) 4 e 2 c) 2 e 8 d) 8 e 4 [A] 47. Catalase uma enzima que est presente em nosso organismo e capaz de desdobrar a gua oxigenada em gua comum e oxignio, de acordo com a reao: H2O2 + catalase 1/2 O2 + H2O A gua oxigenada usada em curativos como antisptico. Considerando a reao anterior e o seu uso, podemos afirmar que a gua oxigenada um: a) catalisador e age contra bactrias anaerbicas b) produto que age contra bactrias aerbicas c) substrato que age diretamente como cicatrizante d) substrato que age contra bactrias anaerbicas [D] 48. Observe as funes a seguir: I - Estimula a sntese do colgeno II - Estimula a migrao qumica III - Facilita a absoro do ferro IV - Participa da fosforilao oxidativa V - Aumenta a disponibilidade energtica Indique a opo que contm a vitamina detentora de todas as funes anteriores: a) vitamina K b) vitamina D c) vitamina B12 d) vitamina C

4 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[D] 49. No processo de contrao e relaxamento muscular, o elemento mineral mais diretamente presente o: a) clcio b) iodo c) mercrio d) ferro [A] 50. comum aos processos de fotossntese e respirao: a) a utilizao de citocromos como transportadores de eltrons b) o oxignio como aceptor final de eltrons c) o NADPH2 reduzir o oxignio d) a glicose ser o agente redutor do CO2 [A] 51. A observao da figura nos permite afirmar que: [D] 55. "Cerca de 27 milhes de brasileiros tm intolerncia ao leite por deficincia na produo de uma enzima do intestino." (FOLHA DE SO PAULO, 09/08/98) Sobre a enzima citada no artigo, e as enzimas em geral, podemos afirmar que: a) aumentam a energia de ativao necessria para as reaes. b) atuam de forma inversamente proporcional ao aumento da temperatura. c) so altamente especficas em funo de seu perfil caracterstico. d) so estimuladas pela variao do grau de acidez do meio. e) so consumidas durante o processo, no podendo realizar nova reao do mesmo tipo. [C] 56. "A margarina finlandesa que reduz o COLESTEROL chega ao mercado americano ano que vem." "O uso de ALBUMINA est sob suspeita" "LACTOSE no degradada gera dificuldades digestivas" As substncias em destaque nos artigos so, respectivamente, de natureza: a) lipdica, protica e glicdica. b) lipdica, glicdica e protica. c) glicdica, orgnica e lipdica. d) glicerdica, inorgnica e protica. e) glicerdica, protica e inorgnica. [A] 57. 6.000 a.C.: babilnios e sumrios utilizam lvedo para produzir cerveja. 4.000 a.C.: egpcios descobre como fazer po fermentado. Ainda na Antigidade: transformao do leite em iogurte e uso do mofo na elaborao de queijo. As informaes contidas no artigo anterior envolvem um processo biolgico fundamental para os seres vivos que o realizam. Todas as opes apresentam conceitos corretos sobre esse processo, EXCETO uma. Assinale-a. a) Na fabricao de iogurte e queijo o produto formado o cido lctico. b) Na fabricao de cerveja e po os produtos formados so etanol e gs carbnico. c) Nesse processo a molcula orgnica utilizada degradada a cido pirvico. d) O saldo energtico obtido, nos dois processos, de 2 ATP. e) Os seres que realizam este processo objetivam conseguir matria-prima para sua nutrio. [E] 58. O esquema a seguir representa reagentes e produtos de reaes qumicas que ocorrem nas clulas.

a) a molcula de glicose sofrer um pequeno desdobramento com pouca produo de energia. b) a "desmontagem" da glicose se d pela remoo gradativa dos seus hidrognios (desidrogenao). c) NAD, FAD e O2 so substncias fundamentais no processo, j que funcionaram como aceptores intermedirios de hidrognio. d) a dupla membrana da figura constitui um fator importante para a ocorrncia do Ciclo de Krebs. e) a formao do cido pirvico ocorre principalmente na matriz mitocondrial. [B] 52. Considere as seguintes etapas da respirao celular: I. Cadeia respiratria; II. Formao de Acetil-CoA; III. Ciclo de Krebs; IV. Glicose. Assinale a alternativa que contm a seqncia correta dos eventos da respirao celular: a) I, II, III e IV b) II, IV, III e I c) III, IV, I e II d) IV, II, III e I e) II, III, I e IV [D] 53. Analise as equaes I, II e III a seguir: I. 6CO2 + 12H2O C6H12O6 + 6O2 + 6H2O II. 2NH3 + 3O2 2HNO2 + 2H2O III. C6H12O6 2C2H5OH + 2CO2 Assinale a alternativa INCORRETA referente s equaes: a) I representa, de forma simplificada, um processo realizado por organismos clorofilados. b) II realizada por certos tipos de bactrias e est relacionada com a ciclagem de nitrognio nos ecossistemas. c) II realizada por animais em geral e no est relacionada com a ciclagem de nitrognio nos ecossistemas. d) III representa, de forma simplificada, um processo anaerbico realizado por certos tipos de fungos, conhecidos como leveduras. e) I, II e III representam, de forma simplificada, processos bioqumicos relacionados com a ciclagem de matria nos ecossistemas. [C] 54. O corante I especfico para identificar a presena de DNA e o corante II especfico para RNA. Numa experincia, foram usados esses dois corantes em dois tipos diferentes de organelas citoplasmticas fixadas e observou-se a ao dos mesmos. Qual a alternativa no quadro a seguir que representa corretamente os resultados esperados dessa experincia, sabendo-se que os sinais (+) e (-) representam, respectivamente, a presena e a ausncia de um cido nuclico?

Essa seqncia de reaes um modelo que mostra a a) ao de uma enzima na sntese de uma substncia. b) produo de ADP a partir de ATP. c) formao de um nucleotdeo. d) digesto de uma protena. e) oxidao de uma molcula de glicose. [A] 59. A glicoquinase e a hexoquinase so duas enzimas que reagem com o mesmo substrato, a glicose. Ambas so enzimas intracelulares que fosforilam a glicose formando glicose 6-fosfato (G6P). Dependendo da enzima produtora, a G6P pode ou ser degradada na via da gliclise para gerar energia ou ento ser usada para sntese de glicognio. A gliclise ocorre nos tecidos em geral e a sntese de glicognio ocorre principalmente no fgado. A sntese do glicognio somente acontece quando existe excesso de glicose no sangue. Essa uma forma de armazenar esse acar.

5 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Observe a figura a seguir, que apresenta as velocidades de reao dessas duas enzimas em funo da concentrao da glicose. Nveis normais de glicose no sangue esto ao redor de 4mM.

(0) O movimento citoplasmtico, conhecido como ciclose, visvel ao microscpio ptico e tem intensidade inversamente proporcional temperatura. (1) Alteraes na concentrao dos ons provocam, nas clulas, modificaes profundas na permeabilidade, na viscosidade e na capacidade de resposta a estmulos. (2) Mitocndrias, retculo endoplasmtico e lisossomos so comuns s clulas procariticas e s eucariticas. (3) O nmero de cloroplastos de uma clula determinado geneticamente, mantendo-se estvel ao longo da vida celular. (4) O acar das frutas produzido durante o processo de fotossntese. (5) O fumo e a atividade fsica regular tm papis antagnicos na destruio do excesso de colesterol. Itens corretos: 1 e 5 Itens errados: 0, 2, 3 e 4 64. Em diversas circunstncias, ocorre produo de gua oxigenada (H 2O2) em nosso organismo. Na presena de ons F+2, a gua oxigenada d origem a um radical livre que ocasiona mutaes no DNA. Nesse processo, a enzima catalase importante, pois catalisa a produo de H2O e O2 a partir de H2O2. Para a verificao desse fato, realizou-se um experimento constitudo de vrios testes, nos quais, em tubos de ensaio contendo H2O2, acrescentaram-se diferentes materiais, conforme especificado na tabela adiante medindo-se a quantidade de O2 liberada.

Qual das duas enzimas gera G6P para sntese de glicognio heptico? Justifique sua resposta. A hexoquinase possui uma grande afinidade pela glicose, ou seja, ela atinge a velocidade mxima com uma concentrao muito pequena de glicose. A glicoquinase exibe uma afinidade bem menor pois somente atinge sua velocidade mxima em concentraes bem mais altas do substrato. Logo, a enzima que contribui para a formao de glicognio heptico a glicoquinase, pois esta somente produz G6P com mxima eficincia quando h excesso de glicose no sangue. 60. Nos laboratrios qumicos, a maneira mais freqente de ativar um reao fornecendo calor, que funciona como energia de ativao. Nos seres vivos, isso no possvel, pois corre-se o risco de as protenas serem desnaturadas. A estratgia desenvolvida pelos seres vivos para superar a barreira inicial das reaes foi a utilizao de: a) ATP. b) enzimas. c) hormnios. d) glicose. e) clorofila. [B] 61. Sobre o esquema abaixo, so feitas as seguintes afirmativas:

I - a formao de molculas de protenas uma reao de degradao; II - atravs de reaes de sntese que o ser vivo consegue energia para a sua vida; III - o conjunto das reaes de sntese e degradao constituem o metabolismo. A(s) afirmativa(s) (so): a) apenas a I. d) apenas a I e a II. [C] b) apenas a II. e) apenas a II e a III. c) apenas a III.

Com base no experimento apresentado, julgue os seguintes itens. (0) O experimento evidencia a existncia da catalase do fgado. (1) Os testes mostraram que a liberao de O diretamente proporcional concentrao de enzima. (2) No teste VI, no ocorre liberao de O porque o calor desnatura e, conseqentemente, inativa as enzimas. (3) testes de III e VI podem ser considerados como sendo os testes realizados para o controle do experimento. (4) A liberao de O cessa aps um curto perodo de tempo por ocorrer consumo de enzima durante a reao. Itens corretos: 0 e 2 Itens errados: 1, 3 e 4 65. A sntese protica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

62. Comparando o esquema dos dois processos metablicos representados, podemos afirmar que o(a):

a) aceptor final de hidrognios, na fermentao, o oxignio. b) molcula de glicose totalmente degradada, na fermentao. c) fermentao encontrada na maioria dos seres vivos unicelulares. d) formao de ATP na cadeia respiratria s ocorre na respirao. e) formao de cido pirvico uma exclusiva da respirao. [D] 63. Desde o incio da teoria celular at hoje, muito se tem descoberto acerca da clula, de suas organelas e caractersticas, e a respeito dos processos bioqumicos que nelas ocorrem. Com relao a esse tema, julgue os itens seguintes.

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a sntese protica em uma clula procaritica. (1) Os tipos de RNA necessrios para a sntese protica em procariotos e eucariotos so essencialmente diferentes. (2) Na expresso de um gene eucaritico, a transcrio e a traduo ocorrem simultaneamente. (3) Uma molcula de RNAm pode ser utilizada para a sntese concomitante de vrias molculas da protena. Item correto: 3 Itens errados: 0, 1 e 2 66. O ciclo a seguir esquematizado envolve duas importantes estruturas celulares I e II.

6 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

71. No esquema a seguir os algarismos I e II referem-se a dois processos de produo de energia. As letras X e Y correspondem s substncias resultantes de cada processo.

correto afirmar que a) as estruturas celulares I e II ocorrem apenas nos vegetais. b) as estruturas celulares I e II ocorrem nos animais e vegetais. c) a estrutura celular I ocorre apenas nos vegetais, e a II, apenas nos animais. d) a estrutura celular I ocorre apenas nos vegetais, e a II ocorre nos animais e vegetais. e) a estrutura celular I ocorre nos animais e vegetais, e a II ocorre apenas nos vegetais. [E] 67. As clulas de nosso msculos executam, em condies normais, a respirao aerbica. Porm, durante um esforo muscular intenso, se o organismo no consegue fornecer gs oxignio suficiente para a respirao celular, as clulas musculares trabalham anaerobicamente. Esse processo anaerbico provoca dor e sensao de queimao nos msculos devido ao acmulo de: a) cido ltico. b) cido ascrbico. c) cido pirvico. d) cido actico. e) acetil-CoA. [A] 68. O experimento representado na figura a seguir deve ser analisado em relao ao fenmeno osmose.

Assinale a alternativa que indica a relao entre o processo de produo de energia e a respectiva substncia resultante. a) Em I o processo fermentao e a letra X indica a substncia gua. b) Em I o processo respirao e a letra X indica a substncia lcool. c) Em II o processo fermentao e a letra Y indica a substncia gua. d) Em II o processo respirao e a letra Y indica a substncia lcool. e) Em I o processo respirao e a letra X indica a substncia gua. [E] 72. Considere as afirmativas a seguir, relacionadas ao metabolismo. I - O glicognio a forma de armazenamento da glicose. II - As protenas so degradadas, produzindo amnia, e esta , posteriormente, transformada em uria. III - O cido graxo o principal produto da metabolizao dos lipdos. Quais esto corretas? a) Apenas I b) Apenas II c) Apenas I e II d) Apenas II e III e) I, II e III [E] 73. Considere a rota metablica que produz o aminocido arginina na figura adiante.

Com relao a esse experimento so formulados trs hipteses: I. A presso osmtica tem sentido A B. II. A protena com certeza passa de B para A, uma vez que a membrana semipermevel deixa passar soluto. III. Aps um certo tempo no haver variao do volume de gua no lado B, pois um sistema aberto. Assinale a alternativa que classifica corretamente cada hiptese como provvel (+) ou improvvel (-). a) I. (+), II. (-), III. (-) b) I. (-), II. (+), III. (-) c) I. (-), II. (-), III. (+) d) I. (+), II. (+), III. (+) e) I. (-), II. (-), III. (-) [A] 69. O dinitrofenol (DNP) uma substncia que interfere na produo de ATP. Se uma clula receber uma dose dessa substncia, o processo de_______ ser prejudicado e conseqentemente essa clula no poder_______. Assinale a alternativa que preenche correta e respectivamente as lacunas da frase anterior. a) fotossntese; se reproduzir b) respirao celular; gerar impulsos nervosos c) respirao celular; realizar osmose d) fotossntese; realizar difuso e) respirao celular; realizar trocas gasosas [B] 70. O gato siams um animal de rara beleza pois a pelagem de seu corpo clara com extremidades - orelhas, focinho, ps e cauda - pretas. A presena do pigmento que d a cor negra a essas extremidades o resultado da atividade de uma enzima que fica inativada acima de 34C. Explique por que esses animais tm a pelagem negra nas extremidades do corpo. As extremidades do corpo perdem calor para o meio ambiente com mais facilidade e costumam, portanto, apresentar uma temperatura inferior do restante do corpo. Como a enzima s ativa abaixo de 34C, a sntese do pigmento que confere cor negra s ocorrer nas extremidades do corpo.

Em um experimento, trs linhagens de bactrias foram irradiadas com Raios X, que causaram mutaes nos genes envolvidos na rota metablica acima representada. Para descobrir quais enzimas da rota metablica foram afetadas, as trs linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. [E] 74. correto dizer: a) A membrana plasmtica uma estrutura lipo-protica presente em todos os tipos celulares e funciona como uma barreira seletiva entre o citoplasma e o ncleo. b) O controle do metabolismo celular embasado pela sntese de DNA, pelo RNA, tendo como conseqncia, a sntese protica. c) O ncleo uma estrutura revestida por envoltrio nuclear, presente tanto em organismos procariontes como eucariontes. d) Os vrus so constitudos de uma cpsula protica e de um cido nuclico e, para multiplicarem-se precisam de hospedeiro. e) Pentoses e hexoses so monossacardeos e, como exemplo, podemos citar a glicose e a ribose, respectivamente. [D] 75. O esquema a seguir mostra alguns intercmbios bioqumicos existentes dentro de uma clula vegetal. As setas indicam o percurso de algumas substncias.

7 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

D o nome das 6 substncias que fazem esses percursos e dos respectivos processos metablicos nos quais elas foram produzidas. 1. RNAm - transcrio 2. Enzimas - traduo 3. O - fotossntese 4. ATP - respirao aerbia 5. Protenas - traduo 6. Glicoprotenas glicosilao 76. Um mdico holands observou, no final do sculo XIX, que galinhas alimentadas com arroz polido, ou descascado, apresentavam os sintomas de uma doena conhecida como beribri, que era curada com a ingesto da pelcula, ou casca, retirada dos gros do arroz. A substncia necessria em pequenas quantidades na dieta para evitar o beribri, a vitamina denominada: a) E b) C c) B12 d) A [C] 77. Observe os esquemas a seguir:

[A] 80. Para a realizao de alguns processos fisiolgicos, o organismo humano tem a necessidade de ons de clcio. Dentre os mecanismos que dependem diretamente destes ons para sua realizao, temos: a) excreo de toxinas e atividade da tiride. b) digesto de alimentos bsicos e respirao. c) coagulao do sangue e contrao muscular. d) atividade neurolgica e oferta de O s clulas. e) crescimento dos ossos e atividade da hipfise. [C] 81. O clcio desempenha papel importante em vrios processos fisiolgicos do homem. Por isso, indispensvel a manuteno dos nveis plasmticos de clcio em estreitos limites, o que ocorre com a participao de alguns hormnios. Acerca do exposto acima, pode-se afirmar: a) A diminuio da concentrao plasmtica de clcio um fator de estmulo para a liberao de calcitonina pelas clulas parafoliculares da tireide. b) A diminuio da concentrao plasmtica de clcio um fator de estmulo para a liberao do paratormnio pelas paratireides. c) A elevao da concentrao plasmtica de clcio um fator de estmulo para a liberao de triiodotironina e tiroxina pela tireide. d) A elevao da concentrao plasmtica de clcio um fator de estmulo para a liberao de aldosterona pelo crtex das adrenais. e) A diminuio da concentrao plasmtica de clcio um fator de estmulo para a liberao de adrenalina pela medula das adrenais. [B] 82. Uma bactria, um fungo e uma samambaia apresentam em comum a) produo de glicose, atravs da utilizao de energia solar. b) presena de carioteca, envolvendo os componentes do ncleo celular. c) utilizao de oxignio no interior de mitocndrias. d) presena de DNA como material gentico. e) produo de ATP no interior de plastos. [D] 83. A invertase a enzima que hidrolisa a sacarose em glicose e frutose. Incubouse, em condies adequadas, essa enzima com sacarose, de tal forma que a concentrao inicial, em milimoles por litro, do dissacardeo fosse de 10mM. Observe os grficos a seguir:

Assinale a alternativa que explica corretamente a diferena de rendimento energtico entre os processos 1 e 2. a) O processo 1 pode ser uma das etapas da fotossntese, produzindo lcool etlico, enquanto que o processo 2 a respirao aerbica e libera muita energia na forma de ATP. b) O processo 1 pode ser uma das etapas da respirao aerbica, produzindo lcool etlico, enquanto o processo 2 a fotossntese e libera muita energia na forma de ATP. c) O processo 1 anaerbico, e parte da energia fica no lcool etlico, enquanto o processo 2 aerbico, e a energia vem da glicose decomposta em gua e gs carbnico. d) O processo 1 aerbico, e parte da energia fica no lcool etlico, enquanto que o processo 2 anaerbico, e a energia vem da degradao da glicose em gua e gs carbnico. e) O processo 1 um tipo de fermentao com baixa produo de ATP, ficando a energia no gs carbnico liberado, enquanto que o processo 2 uma fermentao completa, liberando energia na forma de 38 ATP. [C] 78. Clulas vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram fixadas e submetidas autoradiografia, para comprovar os locais que possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa SOMENTE nos a) nuclolos. b) ribossomos. c) nuclolos e nas mitocndrias. d) ribossomos e nos cloroplastos. e) ribossomos, nos cloroplastos e nas mitocndrias. [E] 79. Considere o esquema a seguir. Assinale a alternativa da tabela que identifica corretamente as substncias I e II, liberadas durante o dia e durante a noite.

Aquele que melhor representa a variao das concentraes, em funo do tempo de incubao, da sacarose e da glicose, o de nmero: a) 4 b) 3 c) 2 d) 1 [C] 84. Considere o esquema a seguir, referente ao processo respiratrio de uma clula eucariota: Glicose (I) cido Pirvico (II) Acetil CoA (III) Ciclo de Krebs (IV)

8 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Cadeia Respiratria (V) Assinale a afirmativa INCORRETA: a) Para que I se transforme em II, necessrio o gasto de ATP. b) As fases I e II ocorrem fora da mitocndria. c) Na converso de II para III, no h produo local de ATP. d) Em IV ocorre liberao de CO e formao local de ATP. e) Em V h quebra da molcula de gua, com liberao de oxignio. [E] 85. O processo de respirao celular pode ser dividido em trs etapas bsicas. O esquema a seguir representa uma mitocndria inserida no hialoplasma, com as indicaes I, II e III.

ATPs. Dos 40 ATPs, acima citados, so recuperados na cadeia transportadora de eltrons via NADH e FADH: a) 30 ATPs b) 32 ATPs c) 34 ATPs d)36 ATPs [C] 90. O elemento qumico fundamental no processo de contrao e relaxamento muscular o: a) mercrio b) clcio c) enxofre d) argnio [B] 91. A especificidade enzimtica consiste na: a) energia de ativao da enzima b) vulnerabilidade da enzima de desnaturar-se a temperaturas altas c) exclusividade da enzima de somente atuar em seu substrato d) capacidade da enzima de "identificar" o pH especfico que propicie a reao [C] 92. Com relao energtica da clula, correto afirmar que 01. uma clula muscular passa a transformar cido pirvico em cido lctico em condies anaerbicas. 02. o processo quer permite as clulas retirar a energia acumulada nos compostos orgnicos a respirao celular. 04. tanto o processo de respirao aerbica como a fermentao ocorre em trs etapas: glicose, ciclo de Krebs e cadeia respiratria. 08. lipdios e protenas no so utilizados como combustveis pela clula, mesmo na ausncia de glicose. 16. a partir de 2 molculas de glicose so produzidas 6 molculas de piruvato e 12 molculas de ATP. 32. a gliclise e o ciclo de Krebs ocorrem no interior das mitocndrias. VVFFFF 93. Uma substncia X o produto final de uma via metablica controlada pelo mecanismo de retro-inibio (feed-back) em que, acima de uma dada concentrao, X passa a inibir a enzima 1.

Observe o esquema e assinale a afirmativa CORRETA: a) A fosforilao oxidativa ocorre no nmero III. b) A gliclise ocorre no nmero I. c) O ciclo de Krebs ocorre no nmero II. d) A etapa fotoqumica ocorre nos nmeros I e II. e) O ciclo das pentoses ocorre nos nmeros I, II e III. [C] 86. O grfico a seguir representa a atividade enzimtica de uma determinada reao em funo da temperatura:

Podemos afirmar que, nessa via metablica, a) a quantidade disponvel de X tende a se manter constante. b) o substrato faltar se o consumo de X for pequeno. c) o substrato se acumular quando a concentrao de X diminuir. d) a substncia A se acumular quando a concentrao de X aumentar. e) a substncia B se acumular quando o consumo de X for pequeno. [A] 94. Com base em estudos citolgicos, pode-se afirmar: 01) A quantidade de gua em um organismo depende da intensidade da atividade metablica de suas clulas, do tipo de tecido considerado, da idade do indivduo e da espcie a que ele pertence. 02) Uma planta provavelmente aumentar sua taxa de fotossntese quando for colocada em um local iluminado por luz verde. 04) O processo de transporte de eltrons, acoplado oxigenao fosforilativa, ocorre na matriz mitocondrial. 08) Clulas que manifestam alta atividade fagocitria devem apresentar um nmero elevado de lisossomos. 16) Durante a prfase I meitica ocorre o "crossing-over", de grande importncia na variabilidade gentica entre os descendentes. 32) Os peroxissomos atuam na decomposio de H2O2, composto formado como produto final em muitas reaes do metabolismo, de efeito altamente lesivo s clulas. 64) Apenas clulas de vida livre apresentam clios, visto serem eles estruturas cuja nica funo a movimentao celular. VFFVVVF 95. O retculo endoplasmtico rugoso responsvel pela sntese de transporte de protenas. No entanto, a sntese protica realizada por grnulos, que esto aderidos a ele, denominados de: a) mitocndrias. b) ribossomos. c) lisossomos. d) cloroplastos. e) fagossomos. [B] 96. Considere as seguintes relaes: Organelas Funes I ribossomo ......................... sntese de protenas II lisossomo .......................... respirao III mitocndria ....................... produo de energia IV complexo de Golgi ........... armazenamento Esto corretamente relacionadas: a) todas b) somente I e III c) somente II, III e IV d) somente I, III e IV e) somente II e IV [D]

A seta indica o ponto: a) timo de temperatura para a atividade enzimtica. b) de desnaturao da enzima. c) de desnaturao do produto. d) mnimo da temperatura para a reao enzimtica. e) mximo de substrato obtido. [A] 87. O componente celular em que se forma maior nmero de molculas de ATP durante a converso de uma molcula de glicose em gua e gs carbnico a) o peroxissomo. b) a mitocndria. c) o cloroplasto. d) o ribossomo. e) o complexo de Golgi. [B] 88. A estrutura abaixo, na forma como est representada, refere-se a

a) um aminocido essencial com funo enzimtica na clula. b) um nucleotdeo que participa da estrutura qumica dos cidos nuclicos. c) um nucleosdeo estvel que participa da estrutura qumica dos cidos nuclicos. d) um carboidrato no hidrolisvel que atua no metabolismo celular. e) um nucleotdeo que participa de reaes bioqumicas como fornecedor de energia. [E] 89. As clulas procariontes aerbicas conseguem reduzir a glicose a CO2+H2O2 recuperando um total de 40 ATPs por molcula de glicose, com um saldo de 38

9 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

97. Clulas de certos organismos possuem organelas que produzem ATPs e os utilizam na sntese de substncia orgnica a partir de dixido de carbono. Essas organelas so: a) os lisossomos. b) os mitocndrios. c) os cloroplastos. d) o sistema de Golgi. e) os nuclolos. [B] 98. Nos tbulos do nfron h intenso transporte ativo. Portanto, as clulas das paredes desses tbulos so ricas em: a) mitocndrias. b) DNA. c) lisossomos. d) ribossomos. e) retculo endoplasmtico. [A] 99. A energia liberada em uma seqncia de reaes ao longo da cadeia respiratria utilizada na converso do ADP+Pi em ATP. Essa seqncia de reaes denominada: a) gliclise. b) ciclo de Calvin. c) fosforilao oxidativa. d) ciclo de Krebs. e) fermentao. [C] 100. Em relao aos componentes celulares, assinale a alternativa correta. a) Membrana plasmtica uma estrutura lipoprotica que funciona como barreira seletiva entre o citoplasma e o ncleo. b) Parede celular uma estrutura exoesqueltica rgida que circunda e protege o contedo da maior parte das clulas vegetais. c) Plastos so organelas citoplasmticas encontradas em clulas vegetais, recobertas por membranas e incapazes de auto duplicao. d) Mitocndrias so organelas limitadas por membranas, encontradas somente em clulas animais e que geram energia qumica na forma de ATP. e) Ncleo uma organela revestida por envoltrio nuclear, presente tanto em organismos procariontes como em organismos eucariontes. [B] 101. Um antibitico que atue nos ribossomos mata: a) bactrias por interferir na sntese de protenas. b) bactrias por provocar plasmlise. c) fungos por interferir na sntese de lipdios. d) vrus por alterar DNA. e) vrus por impedir recombinao gnica. [A] 102. Organelas citoplasmticas que contm DNA: a) mitocndria e ribossomo. b) mitocndria e cloroplasto. c) nuclolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. [B] 103. Leia as afirmativas a seguir: I - Nas clulas vegetais, os vacolos so bem desenvolvidos e possuem como funo principal, armazenar gua e outras substncias. II - As clulas vegetais e as clulas animais possuem quantidades semelhantes de lisossomos e mitocndrias. III - As clulas vegetais so auttrofas e as clulas animais so hetertrofas. Assinale a) se apenas a I estiver correta. b) se apenas a II estiver correta. c) se a II e a III estiverem corretas. d) se a I e a III estiverem corretas. e) se todas estiverem corretas. [D] 104. Uma clula animal est sintetizando protenas. Nessa situao, os locais indicados por I, II e III na figura a seguir, apresentam alto consumo de:

organelas celulares: a) serem estruturas equivalentes, com grande superfcie interna. b) apresentarem DNA prprio. c) estarem envolvidas, respectivamente, na produo e consumo de oxignio. d) apresentarem tilacides e cristas como as bactrias. e) serem encontradas tanto em organismos superiores como inferiores. [B] 106. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Observe as estruturas celulares, indicadas pelas setas numeradas no desenho a seguir, e selecione as alternativas corretas:

01) A estrutura 3 est envolvida na transmisso das caractersticas genticas do indivduo. 02) A remoo da estrutura 4 afetaria profundamente o processo de sntese de protenas. 04) Se ocorrer uma anomalia na estrutura 5, o primeiro processo celular a ser afetado seria o mecanismo de produo de energia. 08) A estrutura 2 representa o retculo endoplasmtico rugoso ou granular e a organela responsvel pela digesto intracelular. 16) A seqncia correta de estruturas envolvidas na sntese protica, desde a entrada dos aminocidos na clula at a eliminao da protena pronta, : 2, 6, 7 e 1. 01 + 02 + 04 + 16 = 23 107. Observe a figura a seguir.

A organela citoplasmtica envolvida no processo nela esquematizado denominada a) ribossomo. b) lisossomo. c) centrolo. d) mitocndria. e) cloroplasto. [B] 108. As enzimas contidas nos lisossomos so sintetizadas pela clula partir do: a) complexo de Golgi b) R.E.L. c) R.E.R. d) mitocndrio e) centrolo [C] 109. Considere os seguintes componentes celulares: I. parede celular II. ribossomos III. ncleo IV. membrana plasmtica V. mesossomo VI. DNA Uma clula bacteriana desprovida, apenas, de a) I b) III c) I e III d) II e V e) III, IV e VI [B] 110. A organela citoplasmtica que se origina a partir do nuclolo e que sintetiza protenas o a) ribossomo. b) centrolo. c) lisossomo. d) cloroplasto. e) complexo de Golgi. [A] 111. A produo de ATP numa clula animal ocorre, fundamentalmente,

a) (I) bases nitrogenadas, (II) aminocidos, (III) oxignio. b) (I) bases nitrogenadas, (II) aminocidos, (III) gs carbnico. c) (I) aminocidos, (II) bases nitrogenadas, (III) oxignio. d) (I) bases nitrogenadas, (II) gs carbnico, (III) oxignio. e) (I) aminocidos, (II) oxignio, (III) gs carbnico. [A] 105. A hiptese de que os cloroplastos e as mitocndrias tenham surgido atravs de uma associao simbitica de um eucarioto primitivo com, respectivamente, bactrias fotossintetizantes e bactrias aerbicas, reforada pelo fato daquelas

10 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) nos golgiossomos. b) nos cromossomos. c) nos lisossomos. d) nos ribossomos. e) nas mitocndrias. [E] 112. Considere o texto a seguir. "As clulas caliciformes do intestino secretam muco que constitudo, fundamentalmente, por glicoprotenas. A parte protica do muco sintetizada .......(I)....... e a polissacardica, ........(II)........" Para completar o texto corretamente, I e II devem ser substitudos, respectivamente, por a) nos ribossomos e nas mitocndrias. b) nas mitocndrias e no complexo de Golgi. c) no complexo de Golgi e nas mitocndrias. d) no retculo endoplasmtico rugoso e no complexo de Golgi. e) no retculo endoplasmtico rugoso e nas mitocndrias. [D] 113. "A silicose uma doena muito comum em trabalhadores que lidam com amianto. Um dos componentes do amianto a slica, uma substncia inorgnica que forma minsculos cristais que podem se acumular nos pulmes. As clulas dos alvolos pulmonares afetadas por estes cristais acabam sofrendo autlise". Essa doena est relacionada com organides citoplasmticos denominados a) plastos b) lisossomos c) dictiossomos d) mitocndrias e) centrolos [B] 114. Considere as afirmaes apresentadas a seguir. I. O rendimento energtico total de cada molcula de glicose degradada at 6CO e 6HO de 38 ATP (dois na Gliclise e trinta e seis nos processos Mitocondriais). II. A utilizao do oxignio se d nas cristas mitocondriais, como aceptor final de hidrognios. III. Em alguns microorganismos, o piruvato, proveniente da glicose, posteriormente metabolizado para produzir molculas de etanol. Com relao fermentao, pode-se afirmar que, das afirmaes, apenas a) a I est correta. b) a II est correta. c) a III est correta. d) a I e a III esto corretas. e) a II e a III esto corretas. [C] 115. Sobre as funes das estruturas e das organelas, associe as colunas: 1. Flagelos 2. Lisossomos 3. Cloroplastos 4. Mitocndrias ( ) movimento de clulas ( ) realizam a fotossntese ( ) respirao celular ( ) digesto intracelular A seqncia correta : a) 1, 3, 4 e 2 b) 1, 4, 3 e 2 c) 3, 2, 4 e 1 d) 1, 3, 2 e 4 e) 4, 2, 1 e 3 [A] 116. Observe a reao bioqumica apresentada a seguir e assinale a alternativa correta com relao a esse processo. 6C + 2ADP + 2P 2PlRUVATO + 2 ATP a) Trata-se da gliclise, que constitui numa srie de reaes enzimticas processadas no interior da mitocndria. b) Apresenta um alto rendimento energtico. c) Ocorre consumo de 0. d) O produto desta reao, piruvato, transformado em cido actico e este participa de outros processos bioenergticos, com alto rendimento em ATP. e) Este processo ocorre somente em clulas vegetais clorofiladas. [D] 117. Na digesto intracelular, formam-se no interior do citoplasma celular os VACOLOS DIGESTIVOS, que derivam da associao de: a) fagossomas e pinossomos. b) fagossomas e ribossomas. c) lisossomas e orgnulos intracitoplasmticos. d) ribossomas e vesculas de pinocitose. e) lisossomas e fagossomas. [E] 118. Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos. A MITOCNDRIA, que uma das mais importantes organelas celulares, possui DNA, RNA e ribossomos, o que a torna apta sntese protica. Dentre as alternativas a seguir, assinale as que exemplificam outros processos que ocorrem na mitocndria. 01. Ciclo de Krebs. 02. Intercmbio de substncias entre a clula e o meio. 04. Gliclise. 08. Fosforilao oxidativa. 16. Regulao osmtica da clula.

01 + 08 = 09 119. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. A "teoria celular", uma das maiores generalizaes da biologia, postula que todos os seres vivos so formados por clulas. Em relao morfofisiologia celular, julgue os itens. ( ) As clulas procariontes caracterizam-se pela ausncia de material gentico. ( ) As mitocndrias so organelas responsveis pela respirao celular. ( ) A carioteca delimita o contedo nuclear. ( ) O trifosfato de adenosina (ATP) um composto qumico constitudo pela base nitrogenada adenina, pelo acar ribose e por trs radicais fosfatos. FVVV 120. Considere os seguintes orgnulos celulares: I. LISOSSOMO II. COMPLEXO DE GOLGI III. CLOROPLASTO IV. MITOCNDRIA A sntese de ATP (adenosina trifosfato) ocorre normalmente: a) apenas em III. b) apenas em IV. c) apenas em II e III. d) apenas em III e IV. e) em I, II, III e IV. [D] 121. As mitocndrias, organelas celulares relacionadas com a produo de energia (ATP), esto presentes em: a) clulas animais e vegetais. b) eucariotos e procariotos. c) clulas animais apenas. d) clulas vegetais apenas. e) procariotos. [A] 122. Assinale a alternativa que contm as organelas celulares relacionadas com a sntese e a secreo de protenas, respectivamente: a) Retculo endoplasmtico granular e complexo de Golgi. b) Retculo endoplasmtico granular e lisossomos. c) Complexo de Golgi e mitocndrias. d) Mitocndrias e lisossomos. e) Retculo endoplasmtico liso e complexo de Golgi. [A] 123. Os macrfagos so clulas capazes de fagocitar bactrias e outros agentes estranhos que sero digeridos pelas enzimas contidas a) nas mitocndrias. b) nos ribossomos. c) nos centrolos. d) nos lisossomos. e) nos cloroplastos. [D] 124. Relativamente organela celular representada na figura a seguir, correto afirmar que:

a) formada por uma membrana simples com invaginaes chamadas lamelas. b) est ausente nas clulas animais, sendo exclusiva de vegetais. c) apresenta enzimas responsveis pela quebra de glicose para produo de ATP. d) possui vesculas membranosas em forma de disco, os tilacides, com pigmento para absoro de luz. e) visvel somente ao microscpio eletrnico. [D] 125. Os lisossomos, organides observados no citoplasma de clulas como as das amebas tem por finalidade: a) a digesto do alimento ingerido. b) a produo de energia. c) o transporte de substncias. d) o armazenamento de substncias. e) a defesa da clula amebiana. [A] 126. O Complexo de Golgi observado no citoplasma de clulas animais e vegetais tem por finalidade: a) a digesto do alimento ingerido.

11 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) a produo de energia. c) o transporte de substncias. d) o armazenamento e secreo de substncias. e) a defesa da clula amebiana. [D] 127. Durante a embriognese, ocorre o processo de diferenciao celular, no qual cada clula se especializa para o desempenho de determinada funo. Clulas com funo de secreo, proteo e absoro, todas em intensa atividade metablica, devem apresentar, respectivamente: a) desmossomos, microvilosidades, abundncia de complexos de Golgi e mitocndrias. b) abundncia de complexos de Golgi, desmossomos, microvilosidades e maior nmero de mitocndrias. c) abundncia de complexos de Golgi, microvilosidades, desmossomos e muitas mitocndrias. d) microvilosidades, desmossomos, abundncia de mitocndrias e de retculos endoplasmticos rugosos. e) abundncia de mitocndrias, desmossomos, microvilosidades e extensa rede de microfilamentos. [B] 128. Os clios e flagelos so formados pelos: a) cloroplastos b) centrolos d) vacolos e) nuclolos [B] 129. Os cloroplastos se originam a partir a) de proplastos com capacidade de autoduplicao. b) do retculo endoplasmtico rugoso. c) do retculo endoplasmtico liso. d) do complexo de Golgi. e) dos nuclolos. [A] 130. Considere os seguintes eventos numa mucopolissacardeos: I. sntese de polipeptdeos II. combinao de acares com polipeptdeos III. formao dos gros de secreo O complexo de Golgi responsvel apenas por a) I b) II c) III d) I e II e) II e III [E] clula produtora de c) mitocndrias

[D] 134. Clulas musculares, clulas glandulares e clulas de um microorganismo de gua doce, devero ter bem desenvolvidas as seguintes organelas, respectivamente: a) cloroplastos, mitocndrias e centrolos. b) complexo de Golgi, retculo endoplasmtico liso e lisossomos. c) mitocndrias, complexo de Golgi e vacolo contrtil. d) retculo endoplasmtico rugoso, mitocndrias e complexo de Golgi. e) centrolos, vacolo contrtil e lisossomos. [C] 135. A figura a seguir indica as diversas etapas do processo que uma ameba realiza para obter alimento.

131. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos.A Citologia se fundamenta em estudos morfolgicos, funcionais e moleculares. De acordo com os estudos citolgicos, correto afirmar que: 01) As mitocndrias so responsveis pela respirao celular tanto em clulas animais como em clulas vegetais. 02) O centrolo orienta a formao do fuso mittico nas clulas dos vegetais superiores. 04) possvel diferenciar o DNA do RNA pela base pirimdica e pela pentose. 08) O principal componente do ncleo a cromatina que constituda por DNA e protenas. 16) O nuclolo uma estrutura caracterstica das clulas eucariontes, visvel na interfase. 32) O complexo de Golgi est relacionado a vrias funes celulares, sendo a secreo celular uma delas. 01 + 04 + 08 + 16 + 32 = 61 132. Nos eritroblastos ocorre intensa sntese de hemoglobina. Essa sntese relaciona-se diretamente com a) o complexo de Golgi. b) os centrolos. c) as mitocndrias. d) os lisossomos. e) os ribossomos. [E] 133. O corante I especfico para DNA e o corante II para RNA. Um pesquisador usou esses dois corantes em clulas fixadas e observou sua ao sobre algumas organelas citoplasmticas. Assinale, no quadro a seguir, a alternativa que representa os possveis resultados obtidos por esse pesquisador (o sinal + significa reao positiva e o sinal negativa).

A organela que se funde ao fagossomo contm a) produtos finais da digesto. b) enzimas que sintetizam carboidratos. c) enzimas digestivas. d) enzimas da cadeia respiratria. e) reservas energticas. [C] 136. As funes de sntese protica, sntese de lipdios, digesto intracelular, respirao celular e formao do fuso acromtico so realizadas, respectivamente, pelas seguintes estruturas: a) ribossomo, retculo endoplasmtico liso, mitocndrias, lisossomos e centrolos b) ribossomo, retculo endoplasmtico liso, lisossomos, mitocndrias e centrolos c) ribossomo, lisossomos, retculo endoplasmtico liso, mitocndrias e centrolos d) retculo endoplasmtico liso, mitocndrias, lisossomos, centrolos e ribossomos e) retculo endoplasmtico liso, ribossomos, lisossomos, centrolos e mitocndrias [B] 137. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos.Sobre clulas, organelas celulares e suas funes, correto afirmar que: 01 - As mitocndrias esto presentes tanto em clulas animais quanto em vegetais e so responsveis pela produo de energia. 02 - Lisossomas so organelas responsveis pela digesto intracelular. 04 - Numa clula onde se processa intensa sntese de protenas encontra-se bastante desenvolvido o retculo endoplasmtico granular ou rugoso. 08 - Um organismo multicelular que produza gs carbnico e gua a partir da glicose apresenta obrigatoriamente cloroplastos. 16 - A remoo dos centrolos de uma clula impede o processo da fotossntese, 32 - Os ribossomos podem ser encontrados aderidos ao retculo endoplasmtico agranular ou liso. 64 - Entende-se por permeabilidade seletiva o controle de entrada e sada de substncias da clula, feito pela membrana celular. 01 + 02 + 04 + 64 = 71 138. A clula um organismo que realiza suas vrias funes de uma maneira dinmica.

12 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

A organela indicada no desenho o ............., responsvel pela eliminao do excesso de ............. que entra por ............. em uma clula que vive em um meio ............. em relao ao seu citoplasma. a) vacolo pulstil; gua; osmose; hipotnico. b) vacolo digestivo; sais minerais; osmose; hipertnico. c) vacolo pulstil; gua; transporte ativo; hipertnico. d) vacolo digestivo; sais minerais; difuso; hipertnico. e) vacolo pulstil; sais minerais; transporte ativo; hipertnico. [A] 144. Na clula representada a seguir, a produo, o armazenamento e a secreo de protenas so funes exercidas respectivamente pelas organelas:

O esquema anterior, de uma clula em atividade, s NO mostra a: a) correlao funcional existente entre organelas celulares. b) captura de substncias pela clula num processo denominado endocitose. c) circulao de substncias por vesculas membranosas na clula. d) liberao de excreo lipdica para o meio extracelular onde vo atuar. e) produo, armazenagem e atuao de enzimas digestivas. [D] 139. Considere as seguintes funes que ocorrem no interior da clula: Digesto intracelular, respirao, transporte de substncias e secreo. Estas funes so realizadas respectivamente por a) Mitocndria, Complexo de Golgi, Lisossomo e Retculo endoplasmtico. b) Ribossomo, Mitocndria, Retculo endoplasmtico e Complexo de Golgi. c) Lisossomo, Mitocndria, Retculo endoplasmtico e Complexo de Golgi. d) Lisossomo, Complexo de Golgi, Mitocndria e Retculo endoplasmtico. e) Ribossomo, Mitocndria, Retculo endoplasmtico e Complexo de Golgi. [C] 140. Os centrolos so organelas celulares relacionadas com a) o surgimento de vacolos autofgicos. b) a remoo do excesso de gua. c) o processo de recombinao gentica. d) a formao de clios e flagelos. e) os fenmenos de plasmlise e deplasmlise. [D] 141. Observe o seguinte esquema:

a) I, III e V d) I, IV e V [B]

b) I, II e IV e) II, III e IV

c) II, III e V

145. Relacione a coluna A, que apresenta as funes, com a coluna B, onde esto as organelas. Coluna A 1 - digesto celular 2 - respirao 3 - presena de material gentico 4 - presena de substncias para exportao Coluna B ( ) ncleo ( ) mitocndria ( ) lisossoma ( ) complexo de Golgi A seqnciar numrica correta, de cima para baixo, na coluna B, a) 3 - 4 - 2 1 b) 3 - 2 - 1 4 c) 4 - 3 - 2 - 1 d) 3 - 1 - 2 4 e) 4 - 3 - 1 2 [B] 146. Qual das estruturas a seguir est relacionada com o processo da diviso celular e com os movimentos de clios e flagelos? a) Retculo endoplasmtico. b) Lisossoma. c) Vacolo. d) Centrolo. e) Ribossoma. [D] 147. Relacione a coluna I (organela celular), com a coluna II (funo respectiva). COLUNA I I - Mitocndria II - Ribossomo III - Lisossomo IV - Centrolo COLUNA II ( ) Digesto celular ( ) Sntese protica ( ) Respirao ( ) Diviso celular Marque a opo que contm, na coluna II, a seqncia correta, de cima para baixo, de sua relao com a coluna I: a) III, IV, I, II b) IV, II, III, I c) III, II, I, IV d) II, I, III, IV [C] 148. Quando a clula engloba gotculas do lquido extracelular, formam-se vesculas de pinocitose que do origem a vacolos digestivos unindo-se com a) fagossomos. b) lisossomos. c) cromossomos. d) ribossomos. e) centrossomos. [B] 149. Considere o seguinte texto:

Assinale a alternativa que identifica corretamente as organelas e os processos celulares representados em I e II. a) I - (ribossomo - sntese de acares), II - (mitocndria - respirao) b) I - (cloroplasto - fotossntese), II - (ribossomo - respirao) c) I - (cloroplasto - fotossntese), II - (mitocndria - respirao) d) I - (mitocndria - respirao), II - (cloroplasto - fotossntese) e) I - (mitocndria - sintese de acares), II - (ribossomo - respirao) [C] 142. "Captura aminocidos que se encontram dissolvidos no citoplasma e carregaos ao local da sntese de protenas". Essa funo desempenhada pelo a) RNA mensageiro. b) RNA transportador. c) RNA ribossmico. d) ribossomo. e) DNA. [B] 143. Observe o desenho a seguir e assinale a alternativa que preenche corretamente os espaos da frase a seguir.

13 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

"Em seu processo de diferenciao, os eritroblastos da medula ssea vermelha sintetizam grande quantidade de molculas de hemoglobina, transformando-se em reticulcitos que passam para a corrente sangnea." O texto permite concluir que eritroblastos so clulas a) ricas em ribossomos. b) ricas em lisossomos. c) dotadas de clios. d) dotadas de flagelo. e) com reservas de gorduras. [A] 150. Nas clulas dos eucariontes auttrofos, as enzimas que atuam no processo da fotossntese esto a) em invaginaes da membrana plasmtica. b) dispersas no citoplasma fundamental. c) no suco celular do vacolo. d) no interior dos cloroplastos. e) no interior das mitocndrias. [D] 151. Considere o seguinte texto: "Quando uma espermtide se transforma em espermatozide, seu ...(I)... d origem ao acrossomo, estrutura repleta de enzimas digestivas; suas ...(II)... concentram-se na pea intermediria e seu ...(III)... d origem ao flagelo." Para complet-lo corretamente, os espaos I, II e III devem ser preenchidos, respectivamente, por: a) ncleo - reservas nutritivas - centrolo b) centrolo - reservas nutritivas - ncleo c) ncleo - mitocndrias - complexo de Golgi d) complexo de Golgi - reservas nutritivas - ncleo e) complexo de Golgi - mitocndrias centrolo [E] 152. Observe os esquemas a seguir que representam dois organismos.

c) respirao celular, apenas. d) sntese de protenas e lpides. e) sntese de cidos nuclicos. [B] 156. Est presente na clula bacteriana: a) aparelho de Golgi. b) carioteca. d) retculo endoplasmtico. e) ribossomo. [E] c) mitocndria.

157. A doena de Tay-Sachs hereditria e provoca retardamento mental grave e morte do paciente na infncia. Essa doena devida incapacidade das clulas de digerir uma substncia cujo acmulo responsvel pelas leses no sistema nervoso central. Com base nessas informaes, pode-se afirmar que a organela celular cuja funo est alterada nessa doena a) a mitocndria. b) o complexo de Golgi. c) o lisossomo. d) o retculo endoplasmtico rugoso. [C] 158. O esquema adiante representa uma clula animal vista ao microscpio eletrnico, na qual algumas estruturas foram numeradas de 1 a 9.

Com relao s estruturas indicadas no esquema, INCORRETO afirmar que a) 1, 5 e 6 sofrem intensas modificaes na diviso celular. b) 2, 3 e 7 sintetizam e/ou armazenam substncias orgnicas. c) 4 e 8 realizam digesto celular com produo de energia e liberao de CO. d) 5 e 9 so desprovidos de membrana lipoprotica. [C] 159. Tendo sua origem na fase de maturao do Complexo de Golgi, os lisossomas so corpsculos citoplasmticos arredondados, pequenos, e que possuem grande quantidade de protenas no seu interior. Assim, podemos afirmar que os lisossomas esto ligados funo de: a) digesto intracelular. b) sntese de protenas. c) complexao de lipdeos. d) coagulao sangnea. e) reserva de glicognio. [A] 160. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos.Um feixe de clulas musculares estriadas, mantido em cultura com todas as condies ideais, foi submetido a vrias sries de contraes e relaxamentos (exerccio) por vrios dias consecutivos, seguido de um perodo de repouso (sem exerccio) de tambm alguns dias. Durante esses perodos quantificou-se o nmero de mitocndrias por clula, possibilitando a elaborao do grfico a seguir:

O corpo basal de cada estrutura locomotora corresponde a a) um centrolo. b) um ribossomo. c) um lisossomo. d) um cloroplasto. e) uma mitocndria. [A] 153. O alto grau de independncia de alguns orgnulos citoplasmticos levou elaborao da "hiptese endossimbintica": esses orgnulos teriam se originado de procariontes de vida livre, possivelmente bactrias, que em algum momento associaram-se a uma clula de eucarionte. Esses orgnulos so os a) clios e os flagelos. b) cloroplastos e os lisossomos. c) cloroplastos e as mitocndrias. d) lisossomos e as mitocndrias. e) centrolos, os clios e os flagelos. [C] 154. Podemos dividir as funes citoplasmticas em trs grupos: I - sntese e transporte das macromolculas; II - metabolismo energtico; III - movimentos celulares. Quanto s estruturas envolvidas nessas funes, podemos afirmar que: a) ribossomos, retculo endoplasmtico e Complexo de Golgi desempenham funes do tipo I. b) cloroplastos, mitocndrias e microtbulos desempenham funes do tipo II. c) microtbulos, microfilamentos e vacolos desempenham funes do tipo III. d) peroxissomos e glioxissomos desempenham tanto as funes do tipo I quanto as funes do tipo II. e) centrolos, clios e flagelos desempenham tanto as funes do tipo II quanto as funes do tipo III. [A] 155. Nas clulas eucariotas vegetais, o cloroplasto responsvel pela: a) fotossntese e respirao celular. b) fotossntese, apenas.

A partir desse grfico e de conhecimentos sobre o assunto enfocado, correto afirmar: 01) O nmero de mitocndrias por clula aumenta durante o exerccio porque a clula precisa de muito ATP, e a mitocndria que o produz. 02) H um nmero mnimo necessrio de mitocndrias por clula para manter o metabolismo desta, mesmo quando em repouso. 04) Se fosse sempre mantida a mesma carga de exerccios, o nmero de mitocndrias por clula aumentaria indefinidamente. 08) O nmero de mitocndrias aumenta nas clulas porque elas so fagocitadas do meio de cultura.

14 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

16) Quando cessa o exerccio, o excesso de mitocndrias removido pela digesto intracelular dessas organelas. 32) Se fosse tambm medido o consumo de oxignio destas clulas, o grfico seria semelhante ao obtido para o nmero de mitocndrias. 01 + 02 + 16 + 32 = 51 161. A maioria das molculas de ATP que as clulas utilizam em suas atividades metablicas forma-se a) no ncleo celular. b) no retculo endoplasmtico. c) no sistema de Golgi. d) nas mitocndrias. e) nos lisossomos. [D] 162. Das estruturas celulares a seguir, aquela cuja existncia foi revelada pelo microscpio eletrnico a) o nuclolo. b) a cromatina. c) a mitocndria. d) o centrolo. e) o retculo endoplasmtico. [E] 163. Uma substncia txica que interfira com a sntese de protenas afetar, em primeiro lugar, a funo exercida a) pelo ncleo. b) pelos ribossomos. c) pelas mitocndrias. d) pela membrana celular. e) pelos centrolos. [B] 164. Desde o incio da teoria celular at hoje, muito se tem descoberto acerca da clula, de suas organelas e caractersticas, e a respeito dos processos bioqumicos que nelas ocorrem. Com relao a esse tema, julgue os itens seguintes. (0) O movimento citoplasmtico, conhecido como ciclose, visvel ao microscpio ptico e tem intensidade inversamente proporcional temperatura. (1) Alteraes na concentrao dos ons provocam, nas clulas, modificaes profundas na permeabilidade, na viscosidade e na capacidade de resposta a estmulos. (2) Mitocndrias, retculo endoplasmtico e lisossomos so comuns s clulas procariticas e s eucariticas. (3) O nmero de cloroplastos de uma clula determinado geneticamente, mantendo-se estvel ao longo da vida celular. (4) O acar das frutas produzido durante o processo de fotossntese. (5) O fumo e a atividade fsica regular tm papis antagnicos na destruio do excesso de colesterol. Itens corretos: 1 e 5 Itens errados: 0, 2, 3 e 4 165. O esquema a seguir representa uma clula animal sobre a qual so feitas as afirmaes a seguir:

Valendo-se das informaes dadas, julgue os seguintes itens. (1) O processo representado em A ocorre na estrutura III de clulas vegetais. (2) A matria orgnica produzida no processo representado em B utilizada na estrutura II. (3) A estrutura II encontrada em grande quantidade nas clulas do pncreas endcrino. (4) As estruturas I e III contm DNA. (5) A primeira etapa do processo representado em B ocorre sem a participao de enzimas. EECCE 167. Alimento protico marcado com radioatividade foi fagocitado por paramcios. Poucos minutos depois, os paramcios foram analisados e a maior concentrao de radiatividade foi encontrada a) nos centrolos. b) nas mitocndrias. c) na carioteca. d) no nuclolo. e) no retculo endoplasmtico. [E] 168. Os primeiros citologistas, observando alguns seres vivos, detectaram unidades morfolgicas comuns a todos eles - as clulas -, cada uma delas contendo as informaes hereditrias de todo o organismo. Com relao clula, julgue os itens a seguir. (0) A destruio do nuclolo de uma clula no afeta o metabolismo dessa clula. (1) Se a membrana lisossmica se romper dentro de uma clula, causar a destruio desta. (2) Diferentemente de uma ameba marinha, a ameba de gua doce pode no apresentar vacolos pulsteis. (3) As clulas epiteliais do intestino grosso apresentam microvilosidades que aumentam a superfcie de absoro do alimento. Item correto: 1 Itens errados: 0, 2 e 3 169. De acordo com a "teoria celular", a continuidade da vida tem base na clula, na qual existe um princpio de complementariedade entre estrutura e funo. Com o auxlio da figura a seguir, que representa uma clula vegetal, julgue os itens que se seguem.

I. A estrutura 2 representa a parede celular que funciona como uma barreira seletiva entre o citoplasma e o meio ambiente. II. A estrutura 3 corresponde ao retculo endoplasmtico rugoso onde ocorre a sntese protica. III. A estrutura 4 desempenha funes relacionadas ao processo de digesto intracelular. IV. O esquema representa uma clula ingerindo pores lquidas e formando vesculas pinocitticas. V. A estrutura 5 est presente apenas nas clulas animais. VI. Os plastos responsveis pela realizao da fotossntese no esto presentes nessa clula. Assinale a alternativa que rene as afirmaes corretas. a) III, V e VI. b) I, II, e IV. c) II, IV e VI. d) II, IV, V e VI. e) I, II, III e V. [C] 166. Os esquemas abaixo representam aspectos ultra-estruturais de trs organelas (I a III) presentes no citoplasma de uma determinada clula e dois processos (A e B) executados pelas clulas.

(1) A estrutura I est presente tanto nas clulas procariontes quanto nas eucariontes, sendo responsvel pela respirao celular. (2) A estrutura II totalmente produzida na estrutura V. (3) Clulas glandulares possuem as estruturas III e VI bem desenvolvidas. (4) No estroma da estrutura IV, encontram-se cidos nuclicos. (5) A quantidade de estruturas no citoplasma est relacionada com a atividade metablica da clula. Itens corretos: 4 e 5 Itens errados: 1, 2 e 3 170. A figura adiante representa a fagocitose de uma bactria e alguns eventos celulares subseqentes.

15 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Com base na figura, julgue os seguintes itens. (1) A estrutura lipoprotica das membranas celulares permite-lhe grande mobilidade e eventos como invaginao e fuso. (2) I representa um lisossomo primrio e III, um lisossomo secundrio. (3) II uma organela rica em proteases, nucleases e lipases. (4) No interior de IV, encontram-se aminocidos, acares e nucleotdeos provenientes da lise da bactria. Itens corretos: 1, 3 e 4 Item errado: 2 171. O grfico mostra o resultado de um experimento onde se avaliou o consumo de oxignio de uma soluo, pela mitocndria, em presena de adenosina difosfato (ADP) e adenosina trifosfato (ATP).

a) Est presente em todos os organismos auttrofos. b) A estrutura 1 apresenta pigmentos que absorvem energia utilizada na produo de ATP. c) Em 2, h enzimas que utilizam CO para fabricao de glicose. d) Essa organela possui capacidade de autoduplicao. e) O processo realizado por essa organela ocorre em 2 etapas, sendo que uma delas no depende de luz. [A] 175. Podemos definir "condrioma" como: a) a fase anaerbica da respirao celular. b) a degradao total da glicose. c) um conjunto de mitocndrias. d) um processo de liberao de energia pela clula. e) uma organela citoplasmtica exclusiva das clulas vegetais. [C] 176. O esquema a seguir representa um espematozide humano.

A partir deste resultado, podemos afirmar que, em relao taxa de consumo de oxignio, ocorre: a) aumento pela adio de ATP e produo ADP b) aumento pela adio de ADP e produo de ATP c) diminuio pela adio de ATP e produo de ADP d) diminuio pela adio de ADP e produo de ATP [B] 172. Assinale a alternativa que apresenta estruturas encontradas em todos os tipos de clulas. a) ncleo, mitocndrias e ribossomos b) parede celular, ribossomos e nuclolo c) centrolo, complexo de Golgi e ncleo d) ribossomos, membrana plasmtica e hialoplasma e) hialoplasma, carioteca e retculo endoplasmtico [D] 173. Relativamente clula animal abaixo, assinale a alternativa correta.

Os centrolos e o complexo de Golgi participam, respectivamente, na formao das estruturas a) I e II b) II e IV c) III e V d) IV e I e) V e III [E] 177. As mitocndrias so organelas citoplasmticas que apresentam estruturas internas chamadas cristas. Essas cristas mitocondriais tm por funo a) capturar glicose. b) produzir enzimas. c) aumentar a superfcie da membrana interna. d) aumentar a disponibilidade de lipdios. e) produzir oxignio. [C] 178. Um tecido de determinado animal tem uma alta atividade fagocitria; portanto, a organela encontrada em maior quantidade nesse tecido a denominada a) mitocndria b) complexo de Golgi. c) lisossoma. d) ribossoma. e) retculo endoplasmtico. [C] 179. "Derrubamos a grande barreira que separava os reinos animal e vegetal: a clula a unidade da matria viva." Essa afirmativa foi feita por cientistas ao descobrirem, em 1839, aquilo que lrios, guas-vivas, gafanhotos, minhocas, samambaias e humanos tm em comum. Pode-se dizer que todas as clulas dos seres acima citados tm as seguintes caractersticas: a) centrolo e lisossomo b) parede celular e mesossomo c) ncleo individualizado e mitocndria d) material nuclear disperso e cloroplasto [C]

a) Se o funcionamento da organela 1 for bloqueado, no ocorrer transcrio. b) A organela 2 membranosa e pouco numerosa em clulas musculares. c) A organela 3 o centrolo, que promove a duplicao dos cromossomos durante a diviso celular. d) A organela 4 somente aparece em clulas secretoras. e) A estrutura 5 est associada organela 1 , podendo apresentar ribossomos aderidos a ela. [E] 174. A respeito da organela representada abaixo, assinale a alternativa INCORRETA.

180. Considere as seguintes estruturas de um espermatozide: I - Acrossomo II - Retculo endoplasmtico rugoso III - Complexo de Golgi O caminho percorrido pelas enzimas digestivas responsveis pela perfurao do vulo : a) II III I b) II I III c) III II I d) I II III

16 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[A] 181. Silicose, doena freqente em operrios que trabalham em pedreiras, um exemplo de conseqncia da autlise celular. A slica, que se mistura ao ar inspirado, destri determinados componentes celulares, cujas enzimas resultam na morte das clulas pulmonares. Os componentes celulares diretamente afetados pela slica so a) os ribossomos. b) os centrolos. c) os lisossomos. d) as mitocndrias. e) os peroxissomos. [C] 182. Diversas espcies de peixes modificam a cor da pele quando submetidas a algumas variaes do meio ambiente. As clulas responsveis por essa alterao contm grnulos de pigmentos que se espalham por toda a clula ou se agregam numa posio mais central da mesma, em resposta a estmulos hormonais ou nervosos. Assinale a opo que indica, corretamente, as estruturas celulares responsveis pela movimentao dos grnulos de pigmentos no citoplasma. a) desmossomos b) dictiossomos c) glioxissomos d) microtbulos e) ribossomos [D] 183. O acrossomo, presente nos espermatozides maduros, essencial para a fecundao. A formao do acrossomo ocorre a partir do: a) peroxissomo b) lisossomo c) complexo de Golgi d) centrolo e) retculo endoplasmtico liso [C] 184. Sobre a organela celular representada a seguir, CORRETO afirmar que:

c) aos ribossomos associados sua face externa. d) a perfuraes para sada de molculas proticas. e) a canais para passagem de ons. [C] 187. Autofagia e autlise: a) so denominaes diferentes para o mesmo fenmeno. b) so fenmenos diferentes, sendo que, no primeiro, a clula capta partculas nutritivas do meio extracelular. c) so fenmenos diferentes, sendo que, no segundo, a clula destruda pela ruptura dos lisossomos. d) constituem o mesmo tipo de fenmeno, em que a clula busca alimento nomeio extracelular. e) constituem o mesmo tipo de fenmeno, sendo que o primeiro corresponde fagocitose e o segundo, pinocitose. [C] 188. Assinale o elemento que NO um componente de uma clula eucariota hetertrofa: a) Carioteca. b) Mitocndria. c) Cloroplasto. d) DNA. e) RNA. [C] 189. NO uma caracterstica associada mitocndria: a) envolvida por unidade de membrana dupla. b) Tem capacidade de autoduplicao. c) encontrada em clulas eucariotas animais e vegetais. d) Tem funo de produo e armazenamento de energia. e) No possui DNA em sua matriz. [E] 190. Sabe-se que as clulas do cino no pncreas so as responsveis pela produo das enzimas pancreticas. As estruturas que a nvel celular so responsveis por esse processo so a) o complexo de Golgi e a mitocndria. b) a membrana e o RER. c) o ribossoma e o REL. d) o RER e o complexo de Golgi. e) o REL e o complexo de Golgi. [D] 191. Com relao s caractersticas que diferenciam clulas bacteriana, vegetal e animal, analise as afirmativas a seguir e assinale a alternativa INCORRETA: a) A clula vegetal se diferencia da animal por apresentar parede celulsica. b) A clula animal se diferencia da bacteriana por apresentar complexo de Golgi. c) A clula bacteriana se diferencia da vegetal por no apresentar cloroplastos. d) A clula vegetal se diferencia da animal por apresentar plastdeos. e) A clula bacteriana se diferencia da animal por ter material gentico envolto por membrana. [E] 192. Analisando o esquema a seguir, assinale a alternativa que representa os nmeros I, II e III, respectivamente:

a) revestida por unidade de membrana dupla. b) contm grande quantidade de DNA na sua luz. c) tem papel importante na sntese de ATP. d) realiza a fotossntese. e) sintetiza carboidratos e armazena protenas. [E] 185. Observe a figura a seguir, que representa o corte transversal de um clio de um protozorio:

A estrutura apontada pela seta corresponde: a) ao microtbulo. b) unidade de membrana. c) ao feixe esqueltico calcificado. d) a tecido conjuntivo fibroso. e) a uma fibra conjuntiva elstica. [A] 186. Observe a figura a seguir, que corresponde ao esquema de um retculo endoplasmtico rugoso observado ao microscpio eletrnico: a) fagocitose, clasmocitose e pinocitose. b) pinocitose, fagocitose e clasmocitose. c) clasmocitose, pinocitose e fagocitose. d) clasmocitose, fagocitose e pinocitose. e) pinocitose, clasmocitose e fagocitose. [B] 193. O componente celular em que se forma maior nmero de molculas de ATP durante a converso de uma molcula de glicose em gua e gs carbnico a) o peroxissomo. b) a mitocndria. c) o cloroplasto. d) o ribossomo. e) o complexo de Golgi. [B] 194. Uma clula eucarionte, que realiza sntese protica para exportao, geralmente utiliza, como vias de direcionamento de sada dos produtos, as organelas:

As estruturas globulares associadas face externa da membrana do retculo citoplasmtico, como a apontada pela seta, correspondem: a) a dobras da unidade de membrana que o reveste. b) ao acmulo de DNA proveniente do ncleo.

17 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) retculo endoplasmtico rugoso e complexo de Golgi b) lisossomos e complexo de Golgi c) centrolos e lisossomos d) retculo endoplasmtico rugoso e mitocndrias [A] 195. As "doenas de depsito", so aquelas em que as clulas acumulam, no seu interior, certas substncias, em virtude da sua incapacidade de catabolisar as mesmas. Isto causa srios danos s clulas, por prejuzos, fundamentalmente no "turnover" celular, prejudicando seus processos vitais e podendo levar at morte. Indique a opo que contm a organela mais diretamente relacionada causa dessas doenas. a) complexo de Golgi b) lisossomo c) retculo endoplasmtico liso d) ribossomo [B] 196. O desenho representa o processo de

a) no ATP. b) na glicose. d) no gs carbnico. e) na gua. [E]

c) no NADH.

201. Com base em estudos citolgicos, pode-se afirmar: 01) A quantidade de gua em um organismo depende da intensidade da atividade metablica de suas clulas, do tipo de tecido considerado, da idade do indivduo e da espcie a que ele pertence. 02) Uma planta provavelmente aumentar sua taxa de fotossntese quando for colocada em um local iluminado por luz verde. 04) O processo de transporte de eltrons, acoplado oxigenao fosforilativa, ocorre na matriz mitocondrial. 08) Clulas que manifestam alta atividade fagocitria devem apresentar um nmero elevado de lisossomos. 16) Durante a prfase I meitica ocorre o "crossing-over", de grande importncia na variabilidade gentica entre os descendentes. 32) Os peroxissomos atuam na decomposio de HO, composto formado como produto final em muitas reaes do metabolismo, de efeito altamente lesivo s clulas. 64) Apenas clulas de vida livre apresentam clios, visto serem eles estruturas cuja nica funo a movimentao celular. VFFVVVF 202.Temos a seguir esquematizado o ciclo de vida de uma determinada planta terrestre. Analisando esse ciclo e desprezando a ocorrncia de mutaes, pode-se prever que os componentes com a mesma constituio gentica so indicados por:

a) secreo celular: A representa a pinocitose e B, complexo de Golgi. b) digesto intracelular: A representa a fagocitose e B, os peroxissomos. c) digesto intracelular: A representa a formao do lisossomo e B, a dos peroxissomos. d) secreo celular: A representa a fagocitose e B, a formao de lisossomos. e) digesto intracelular: A representa a fagocitose e B, a formao dos lisossomos. [E] 197. Em relao ocorrncia, origem estrutura e funo das organelas citoplasmticas, assinale a(s) proposio(es) VERDADEIRA(S). 01. O Complexo de Golgi existe em abundncia nas clulas secretoras e participa da sntese de aminocidos. 02. Os vacolos pulsteis ocorrem em alguns Protistas e participam da manuteno do equilbrio homeosttico. 04. As Mitocndrias so formadas de enzimas oxidantes e participam do processo de desintoxicao celular. 08. Os lisossomos originam-se do ergastoplasma (RER) e do Complexo de Golgi e participam do processo de respirao celular. 16. Os vacolos do suco celular so exclusivos das clulas vegetais, sendo pequenos e numerosos nas clulas jovens e geralmente nico na clula adulta. 32. Os centrolos coordenam o processo de diviso cromossmica. 64. Os plastos so organelas citoplasmticas que ocorrem em todos os vegetais e em todos os Protistas. FVFFVVF 198. Escolha a(s) alternativa(s) correta(s) com relao organelas celulares. 01. Lisossomos so pequenas vesculas originadas a partir das mitocndrias. 02. O complexo de Golgi tem como funo receber, armazenar e, freqentemente, modificar protenas. 04. Ribossomos so constitudos de RNA e protenas. 08. Peroxissomos esto relacionados com a quebra de cidos graxos. 16. As mitocndrias tm como funo principal produzir glicose a partir de CO e HO. 32. Os centrolos esto presentes tanto em clulas animais quanto em clulas vegetais. 64. O acrossomo de um espermatozide formado a partir do complexo de Golgi modificado. FVVVFFV 199. No que se refere respirao celular, assinale a alternativa correta. a) A respirao celular divide-se em trs fases: a Gliclise (que ocorre no citoplasma), o Ciclo de Krebs (que ocorre na mitocndria) e a Cadeia Respiratria (que ocorre na mitocndria). b) A Gliclise a fase aerbica da respirao que consiste na degradao da glicose at a formao do cido pirvico. c) Na Gliclise, h a oxidao de molculas de NAD em NADH e ADP, sendo essa a fase mais energtica da respirao celular dos mamferos. d) No Ciclo de Krebs, o gs-carbnico liberado da transformao do cido pirvico em cido ctrico, processo que consome 2 ATPs. e) Na Cadeia Respiratria, o FAD ganha H+ e se transforma em FADH, liberando CO e HO. [A] 200. Em uma situao experimental, camundongos respiraram ar contendo gs oxignio constitudo pelo istopo O. A anlise de clulas desses animais dever detectar a presena de istopo O, primeiramente,

a) I, II e III. d) II, III e IV. [B]

b) I, II e V. e) III, IV e V.

c) I, III e IV.

203. A figura a seguir representa algumas etapas do ciclo de vida de uma espcie animal. Analise e assinale a alternativa que corresponde s etapas 1, 2 e 3, respectivamente:

a) meiose, desenvolvimento e fecundao; b) mitose, fecundao e meiose; c) mitose, fecundao e desenvolvimento; d) meiose, fecundao e desenvolvimento; e) mitose, meiose e fecundao. [D] 204. Considere as seguintes afirmaes. I - Apesar da grande diversidade de organismos eucariontes existentes e tipos de clulas que eles apresentam, h basicamente dois tipos de diviso celular: mitose e meiose. II - A evoluo biolgica, pela seleo natural, depende diretamente do processo meitico. III - Nos ciclos de vida de organismos que se reproduzem sexualmente, h sempre uma seqncia entre meiose e fertilizao. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) I, II e III. [E] 205. Considere o seguinte ciclo de vida:

18 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[D] 209. Partindo-se de 15 espermatcitos de 1 ordem e 15 ovcitos de 1 ordem, os nmeros de espermatozides e de vulos sero: a) 15 e 15 b) 15 e 60 c) 30 e 15 d) 60 e 15 e) 60 e 60 [D] 210. Considerando que na perereca 'Hyla viridis' o caritipo normal 2n=24, quantos cromossomos podemos esperar encontrar, respectivamente numa ovognia, num glbulo polar, num ovcito primrio e num vulo desse animal? a) 12, 24, 12, 24; b) 24, 12, 24, 12; c) 24, 24, 12, 12; d) 24, 12, 12, 24; e) 24, 24, 24, 12; [B] Nele, a meiose precede a formao dos a) gametas e a fase adulta predominante diplide. b) gametas e a fase adulta predominante haplide. c) gametas e ocorre alternncia de geraes. d) esporos e a fase adulta predominante a diplide. e) esporos e ocorre alternncia de geraes. [E] 206. Todo indivduo eucarionte com reproduo sexuada realiza, em alguma fase de seu ciclo, o processo meitico. 211. Sabendo-se que numa cadela o caritipo normal 2n=78, quantos cromossomos podemos esperar encontrar, respectivamente numa ovognia, num glbulo polar, num ovcito primrio e num vulo desse animal? a) 78, 39, 39, 78. b) 39, 39, 78, 78. c) 78, 78, 39, 39. d) 78, 39, 78, 39. e) 39, 78, 39, 78. [D] 212. Na perereca ('Hyla viridis') o caritipo normal 2n=24, quantos cromossomos podemos esperar encontrar, respectivamente numa espermatognia, num espermatcito primrio, num espermatcito secundrio e num espermatozide desse animal? a) 12, 24, 12, 24; b) 24, 12, 24, 12; c) 24, 24, 12, 12; d) 24, 12, 12, 24; e) 24, 24, 24, 12; [C] 213. Num gorila fmea o caritipo normal 2n=48, quantos cromossomos podemos esperar encontrar, respectivamente numa ovognia, num glbulo polar, num ovcito primrio e num vulo desse animal? a) 48, 24, 48, 24. b) 24, 48, 48, 24. c) 24, 48, 24, 48. d) 48, 48, 24, 24. e) 24, 24, 48, 48. [A] 214. Em relao ao esquema a seguir, que representa o processo de espermatognese humana, assinale a alternativa correta:

A observao da figura nos permite classificar esta meiose como: a) somtica. b) gamtica. c) esprica. d) zigtica. e) haplntica. [D] 207. O esquema abaixo ilustra o ciclo reprodutivo de um grande nmero de seres vivos. Como exemplo de representantes deste ciclo temos:

a) 1 representa uma clula germinativa diplide. b) 2 representa um espermatcito primrio diplide. c) 3 representa um espermatcito secundrio haplide. d) 5 representa uma espermtide diplide. e) 6 representa um espermatozide diplide [A] a) cogumelos. d) avenca. [C] b) algas. e) ervilha. c) insetos. 215. Em relao gametognese humana, responda: a) Quantos espermatcitos primrios se formam a partir de 150 espermatognias? b) Quantos vulos so formados a partir de 346 ovognias? a) 150 b) 346 216. Sabendo- se que seres humanos possuem 46 cromossomos em suas clulas somticas, pode-se afirmar que no processo de gametognese no homem a) as clulas germinativas tm 23 cromossomos. b) as espermatognias tm 46 cromossomos. c) os espermatcitos primrios tm 23 cromossomos. d) os espermatcitos secundrios tm 46 cromossomos. e) as espermtides tm 46 cromossomos. [B] 217. Em relao gametognese humana, assinale a alternativa INCORRETA: a) no homem ocorre nos tbulos seminferos dos testculos. b) na mulher ocorre nos folculos ovarianos. c) tem como finalidade reduzir o nmero de cromossomos metade. d) produz clulas reprodutoras diplides. e) produz clulas reprodutoras haplides. [D] Os ciclos de vida vlidos para todas as samambaias, certas algas e todas as aves so, respectivamente, a) I, II e III b) I, III e II c) II, III e I d) III, I e II e) III, II e I 218. Partindo-se de 20 espermatcitos de 1 ordem e 20 ovcitos de 1 ordem, os nmeros de espermatozides e de vulos sero: a) 80 e 20 b) 20 e 20 c) 40 e 20 d) 20 e 40 e) 20 e 80

208. Os esquemas a seguir representam trs tipos de ciclos de vida.

19 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[A] 219. Sabendo- se que seres humanos possuem 46 cromossomos em suas clulas somticas, pode-se afirmar que no processo de gametognese na mulher a) as clulas germinativas tm 23 cromossomos. b) as ovognias tm 46 cromossomos. c) os ovcitos primrios tm 23 cromossomos. d) os ovcitos secundrios tm 46 cromossomos. e) os glbulos polares possuem 46 cromossomos. [B] 220. Cada clula germinativa humana que passa pelo processo de gametognese produz no homem e na mulher, respectivamente a) um vulo e quatro espermatozides. b) um vulo e um espermatozide. c) quatro vulos e quatro espermatozides. d) quatro vulos e um espermatozide. e) quatro espermatozides e um vulo. [E] 221. Considere uma ovognia de uma mulher heterozigota para o par de alelos Dd. Entre os possveis gametas formados por essa ovognia, podemos encontrar: a) quatro vulos Dd. b) quatro vulos D e quatro vulos d. c) dois vulos D e dois vulos d. d) apenas um vulo Dd. e) apenas um vulo D ou um vulo d. [E] 222. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos.Analisando o processo de gametognese em mamferos, correto afirmar que: 01) O gameta feminino uma clula grande e imvel cujo citoplasma aumenta muito durante o processo de formao. 02) Na formao dos espermatozides, ocorre uma etapa de diferenciao celular aps a diviso meitica. 04) Aps a diviso meitica, de cada ovognia originam-se quatro ovcitos idnticos. 08) O processo de ovulognese ocorre em etapas, permanecendo os ovcitos I em estgio inicial da meiose durante grande parte da vida da mulher. 16) De cada espermatognia que inicia o processo de espermatognese, formamse oito espermatozides. 32) Espermatognias e espermtides so clulas haplides resultantes de etapas do processo de espermatognese. 64) O nmero diplide caracterstico da espcie s reconstitudo no momento da fecundao, quando se forma o zigoto. 01 + 02 + 64 = 67 223. Numere relacionando corretamente: ( ) Ciclo celular ( ) Nuclolo ( ) Espermatognese ( ) Centrmero ( ) Espermiognese 1. Desaparece na prfase. 2. Modificao morfolgica nas espermtides. 3. Gametognese masculina. 4. Prende os cromossomos ao fuso 5. Intrfase seguida de diviso A seqncia numrica correta de cima para baixo : a) 5 - 1 - 2 - 3 - 4. b) 5 - 1 - 3 - 4 - 2. c) 3 - 4 - 1 - 2 - 5. d) 1 - 5 - 3 - 4 - 2. e) 5 - 1 - 2 - 4 - 3. [B] 224. Considere uma espcie animal em que o nmero haplide de cromossomos 20. Durante o processo de espermatognese normal, um macho dessa espcie produzir: a) espermatognias com 20 cromossomos; b) espermtides com 10 cromossomos; c) espermatcitos secundrios com 20 cromossomos; d) espermatcitos primrios com 10 cromossomos; e) espermatozides com 5 cromossomos. [C] 225. Observe a figura da clula representada a seguir e assinale a alternativa INCORRETA:

a) o flagelo, indicado pelo nmero 3, a estrutura responsvel pela locomoo. b) uma clula formada a partir da diferenciao de uma espermtide, aps a meiose de uma espermatognia. c) o ncleo, indicado pelo nmero 2, o local onde se encontra o material gentico. d) representa um gameta masculino, o qual produzido no epiddimo. e) o acrossomo, indicado pelo nmero 1, a vescula que contm enzimas necessrias penetrao no vulo. [D] 226. Uma amostra celular foi retirada de um certo organismo diplide e sem anormalidades cromossmicas para estudo do seu caritipo. Entre as clulas observadas, a representada pelo desenho a seguir foi a nica obtida com os cromossomos bem visveis. Com base neste desenho, assinale a afirmativa mais provvel:

a) trata-se de uma clula somtica com dois pares de cromossomos homlogos. b) trata-se de uma clula gamtica em meiose - I. c) trata-se de uma clula somtica com nmero haplide de cromossomos. d) trata-se de uma clula mittica no incio da metfase. e) trata-se de uma clula germinativa em meiose - II. [E] 227. Um pesquisador fez o seguinte desenho de uma clula observada ao microscpio ptico.

Pode tratar-se de uma clula de a) ovrio. b) sangue. d) medula ssea. [A]

c) linfa. e) pele.

228. Os espermatozides so clulas muito ativas, com enorme capacidade de movimentao. Durante sua formao (espermatognese) ocorrem vrias fases diferentes, cuja sequncia : a) espermatognia, espermtide, espermatcito I, espermatcito II e espermatozide. b) espermtide, espermatcito I, espermatcito II, espermatognia o espermatozide. c) espermatcito I, espermatcito II, espermtide, espermatognia e espermatozide. d) espermatcito I, espermatcito II, espermatognia, espermtide e espermatozide. e) espermatognia, espermatcito I, espermatcito II, espermtide e espermatozide. [E] 229. Com relao gametognese masculina, pode-se dizer que:

20 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) das clulas germinativas primordiais originam-se espermtides que, por mitose, formam espermatozides. b) o homem, antes da puberdade possui um nmero suficiente de espermatozides capacitados para a fecundao. c) ela se passa nos testculos, onde ocorre a espermiognese. d) a espermatognese independe de qualquer ao hormonal. e) o recm-nascido apresenta nos tbulos seminferos pequena quantidade de espermatozides. [C] 230. Durante a ovulognese da mulher, so produzidos dois corpsculos polares. O primeiro e o segundo corpsculos polares humanos contm, respectivamente, a) 46 cromossomos duplicados e 46 cromossomos simples. b) 46 cromossomos simples e 23 cromossomos simples. c) 23 cromossomos duplicados e 23 cromossomos simples. d) 23 cromossomos simples e 23 cromossomos simples. e) 23 cromossomos simples e nenhum cromossomo. [C] 231. As figuras a seguir representam os processos de gametognese em animais. a) as clulas II so gametas produzidos por mitose. b) as clulas II so gametas produzidos por meiose. c) a clula III o zigoto produzido por meiose. d) a clula III um esporo produzido por meiose. e) a clula III produz I por meiose e diferenciao. [B] 237. Analisando o esquema adiante que representa o ciclo vital de uma alga haplobionte (N), podemos afirmar que:

a) as clulas II so gametas produzidos por mitose. b) as clulas II so gametas produzidos por meiose. c) a clula III o zigoto produzido por meiose. d) a clula III um esporo produzido por meiose. e) a clula III produz o adulto N por meiose e diferenciao. [A] Supondo que se trate da gametognese humana, correto concluir que a) clulas com 46 cromossomos existem somente no perodo 1. b) as divises meiticas ocorrem nos perodos 2 e 3. c) a partir de uma espermatognia, formam-se dois espermatcitos primrios. d) cada ovcito primrio d origem a um ovcito secundrio. e) a fertilizao ocorre durante o perodo 4. [D] 232. "Cada carter condicionado por um par de fatores que se separam na formao dos gametas". Mendel ao enunciar essa lei j admitia, embora sem conhecer, a existncia das seguintes estruturas e processo de diviso celular, respectivamente: a) cromossomos, mitose. b) ncleos, meiose. c) ncleos, mitose. d) genes, mitose. e) genes, meiose. [E] 233. Considere os seguintes eventos: I. Permutao ou "crossing-over". II. Disjuno de cromtides irms. III. Pareamento de cromossomos homlogos. IV. Disjuno de cromossomos homlogos. A ordem em que esses eventos ocorrem no processo de meiose : a) I II III IV. b) II I III V. c) III I IV II. d) III IV I II. e) IV III II I. [C] 234. Qual dos seguintes processos ocorre exclusivamente na meiose? a) Diviso do centrmero. b) Duplicao dos cromossomos. c) Migrao dos cromossomos. d) Pareamento dos cromossomos. e) Espiralizao dos cromossomos. [D] 235. As fases da prfase da primeira diviso meitica, em seqncia correta, so: a) paquteno, leptteno, diplteno, zigteno, diacinese. b) paquteno, diacinese, leptteno, zigteno, diplteno. c) leptteno, zigteno, paquteno, diplteno, diacinese. d) leptteno, paquteno, zigteno, diacinese, diplteno. e) diacinese, zigteno, leptteno, paquteno, diplteno. [C] 236. Analisando o esquema a seguir que representa o ciclo vital de um animal (2N), podemos afirmar que: a) separao dos centrolos. b) formao do fuso acromtico. c) manuteno da carioteca. d) pareamento dos cromossomos homlogos. e) duplicao das cromtides. [D] 238. Analisando o esquema a seguir que representa o ciclo vital de um vegetal, podemos fazer todas as afirmaes, EXCETO:

a) as clulas a e b so gametas produzidos por mitose (I). b) a gerao 2N produz esporo (clula d) por meiose (III). c) o esporo (clula d) germina por mitose (IV) e se diferencia originando a gerao N. d) a meiose final ou gamtica (III). e) os vegetais apresentam metagnese ou alternncia de geraes. [D] 239. Na meiose de uma espcie de planta formam-se 16 ttradres ou bivalentes. Qual o nmero diplide da espcie? a) 4. c) 8. c) 16. d) 32. e) 64. [D] 240. A figura a seguir caracterstica da Meiose porque s nesse tipo de diviso celular acontece:

21 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

251. Numa dada fase de um processo de diviso celular, os cromossomos homlogos migram para plos opostos da clula. Essa fase a a) metfase da mitose. b) anfase da mitose. c) metfase da meiose I. d) anfase da meiose I. e) anfase da meiose II. [D] 252. Com relao diviso celular, podemos afirmar que a) a mitose s ocorre em organismos com reproduo sexuada. b) a mitose permite variabilidade gentica, principal diferena do processo em relao meiose. c) na meiose no h associao de cromossomos homlogos com troca de partes entre eles, fato que s ocorre na mitose. d) na meiose no ocorre segregao de genes. e) o objetivo do processo mittico o crescimento do organismo e do processo meitico a formao de gametas. [E] 253. Em relao ao processo de diviso celular, podemos afirmar que: a) a mitose consiste em duas divises celulares sucessivas. b) os vulos e os espermatozides so produzidos por divises mitticas. c) durante a meiose no ocorre a permutao ou "crossing-over". d) a meiose um processo que d origem a quatro clulas haplides. e) durante a mitose as cromtides irms no se separam. [D] 254. O quadro a seguir apresenta algumas diferenas entre mitose e meiose. Assinale a alternativa correta.

d) a mutao e a fase a metfase II e) recombinao gentica e a fase a anfase I [A] 259. Uma amostra celular foi retirada de um certo organismo diplide e sem anormalidades cromossmicas para estudo do seu caritipo. Entre as clulas observadas, a representada pelo desenho a seguir foi a nica obtida com os cromossomos bem visveis. Com base neste desenho, assinale a afirmativa mais provvel:

a) trata-se de uma clula somtica com dois pares de cromossomos homlogos. b) trata-se de uma clula gamtica em meiose - I. c) trata-se de uma clula somtica com nmero haplide de cromossomos. d) trata-se de uma clula mittica no incio da metfase. e) trata-se de uma clula germinativa em meiose - II. [E] 260. Considere os seguintes eventos: I. recombinao gentica II. segregao de cromossomos homlogos III. segregao de cromtides irms IV. alinhamento dos cromossomos na placa equatorial. Desses, os que ocorrem tanto na mitose quanto na meiose so APENAS a) I e II b) I e III c) II e III d) II e IV e) III e IV [E] 261. Nos processos de diviso celular o posicionamento dos cromossomas na metfase e anfase importante porque garante: a) distribuio eqitativa dos cromossomas pelas clulas filhas. b) pareamento cromossmico para a ocorrncia do "crossing-over". c) duplicao de DNA indispensvel continuidade do processo. d) formao de cromossomas homlogos e independentes. e) alinhamento de cromossomas necessrio formao de sinapses. [A] 262. Uma clula com 16 cromossomos ao sofrer meiose produz: a) 4 clulas com 16 cromossomos; b) 2 clulas com 8 cromossomos; c) 2 clulas com 16 cromossomos; d) 4 clulas com 8 cromossomos; e) 8 clulas com 16 cromossomos. [D] 263. Leia com ateno as afirmativas a seguir: I - Durante a intrfase os cromossomos se duplicam. II - Na prfase os cromossomos migram para os plos opostos. III - Na metfase os cromossomos atingem o mximo de espiralizao. Dessas afirmativas, a) apenas I e III so corretas. b) I, II e III so corretas. c) so corretas apenas I e II. d) apenas I correta. e) so corretas apenas II e III. [A] 264. O crossing-over um importante mecanismo evolutivo, pois proporciona, para a maioria dos seres vivos, recombinao dos seus genes durante o processo de produo das clulas reprodutivas, como os gametas animais. Esse processo ocorre na: a) prfase da mitose b) metfase da mitose c) prfase I da meiose d) metfase I da meiose e) prfase II da meiose [C] 265. Ao compararmos mitose com meiose, podemos concluir que: a) a meiose est associada reproduo de pluricelulares, e a mitose, ao seu crescimento. b) a meiose divide metade o nmero de cromossomos de uma clula, e a mitose o duplica. c) a meiose est associada reproduo de unicelulares, e a mitose, ao seu crescimento. d) a mitose garante o nmero cromossomial da espcie, e a meiose, o nmero cromossomial do indivduo.

[C] 255. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Analise as proposies apresentadas com relao ao tpico "Diviso celular". ( ) Nos organismos pluricelulares, o crescimento e a reparao dos tecidos ocorrem atravs de mitose. ( ) Na mitose ocorre recombinao de genes e formam-se, ao final do processo, quatro clulas, todas 2n (diplide) como a clula me. ( ) Em organismos adultos, clulas em que a capacidade de diviso diminuiu, podem voltar a se dividir ativamente, como o caso de clulas sseas aps a ocorrncia de fraturas. ( ) No processo de meiose ocorre uma duplicao cromossmica para duas divises celulares. ( ) Na primeira diviso meitica ocorre a segregao das cromtides irms de cada cromossomo a na segunda diviso ocorre a separao dos cromossomos homlogos de cada par. VFVVF 256. Considere as proposies a seguir e assinale a alternativa correta. I) A duplicao do DNA ocorre durante a intrfase da clula. II) Quando uma clula diplide sofre meiose seu nmero cromossmico se reduz a 1/4. III) A duplicao dos centrolos ocorre na telfase da mitose. a) Apenas a afirmativa I est correta. b) Esto corretas I e III. c) Apenas a afirmativa III est correta. d) Todas so corretas. e) Todas esto erradas. [A] 257. Na meiose, para a formao das clulas reprodutoras, observa-se o emparelhamento de cromossomos homlogos na: a) metfase II; b) metfase I; c) prfase II; d) anfase I; e) anfase II. [B] 258. No processo de meiose h um fenmeno importante e responsvel pela evoluo das espcies com reproduo sexuada. O nome do processo e a fase em que ocorre: a) o crossing-over e a fase a prfase I b) o crossing-over e a fase a prfase II c) a mutao e a fase a metfase I

22 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) a mitose s acontece em clulas reprodutoras, e a meiose s em clulas haplides. [A] 266. Meiose com formao de esporos haplides ocorre no ciclo de vida de a) brifitas, de pteridfitas e de fanergamas. b) brifitas e de pteridfitas apenas. c) fanergamas apenas. d) pteridfitas apenas. e) brifitas apenas. [A] 267. A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqncia _______________. a) A, B, C, D, E d) B, D, A, C, E [B] b) E, A, D, C, B e) D, A, C, E, B c) C, E, A, D, B

A alternativa que preenche correta e respectivamente os espaos anteriores : a) o crossing-over; metfase da mitose; a variabilidade gentica. b) o pareamento de cromtides-irms; anfase I da meiose; a troca de genes alelos. c) o crossing-over; prfase I da meiose; a variabilidade gentica. d) a segregao de cromossomos homlogos; anfase I da meiose; a formao de clulas haplides. e) o pareamento de cromossomos homlogos; metfase da mitose; a formao de gametas. [C] 268. Um organismo tem constituio cromossmica em suas clulas somticas mostrada esquerda na figura adiante.

271. Certa espcie animal tem nmero diplide de cromossomos igual a 8 (2n=8). Uma clula de um indivduo dessa espcie encontra-se em diviso e apresenta 4 cromossomos simples sendo puxados para cada plo. A partir dessa informao, pode-se afirmar que a referida clula se encontra a) na metfase da mitose. b) na anfase da mitose. c) na metfase da 1 diviso da meiose. d) na anfase da 1 diviso da meiose. e) na anfase da 2 diviso da meiose. [E] 272. As afirmativas a seguir relacionam a Gentica Mendeliana Diviso Celular. I - As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formao dos gametas, logo esto relacionadas com o comportamento cromossmico na meiose. II - Dois pares de genes se segregam independentemente, se estiverem localizados em cromossomos diferentes. III - A lei da segregao independente (2 lei) est relacionada s conseqncias do arranjo, ao acaso, de pares de cromossomos homlogos na placa metafsica, na meiose. Est(o) correta(s): a) somente I. b) somente I e II. c) somente I e III. d) somente II e III. e) I, II e III. [E] 273. Considere os processos de diviso celular: a) mitose b) meiose Considere tambm os seguintes eventos: I. As clulas-filhas recebem um cromossomo de cada par de homlogos. II. Durante o processo, h emparelhamento dos homlogos. III. Durante o processo, os cromossomos ligam-se s fibras do fuso celular. IV. As clulas-filhas e a clula-me tm o mesmo nmero de cromossomos. A associao correta entre os processos de diviso celular e os eventos considerados a) I a, II a+b, III b, IV a b) I a, II a, III b, IV a+b c) I b, II a+b, III a, IV b d) I b, II b, III a+b, IV a e) I a+b, II b, III b, IV a [D] 274. A meiose o processo pelo qual clulas diplides podem originar clulas haplides, objetivando a formao de clulas destinadas reproduo da espcie. A meiose consiste em duas etapas consecutivas, cada uma com vrias subfases sucessivas. Correlacione as etapas da meiose com suas principais caractersticas. (I) Zigteno da Prfase I (II) Paquteno da Prfase I (III) Metfase I (IV) Metfase II (V) Telfase (P) reconstituio nuclear e citocinese (Q) sinapse cromossmica (R) formao da placa equatorial dupla (S) participao dos centrmeros e separao das cromtides A associao correta : a) I - P; III - R; IV - Q; V - S. b) I - Q; II - P; III - S; IV - R. c) I - Q; II - R; III - S; IV - P. d) I - Q; III - R; IV - S; V - P. e) II - Q; III - S; IV - R; V - P. [D] 275. Assinale a alternativa da tabela a seguir que identifica corretamente os cromossomos que migram para plos opostos da clula durante as anfases da meiose e da mitose. a) MEIOSE I - homlogos, MEIOSE II - irmos, MITOSE - irmos

Nesse organismo, os conjuntos de cromossomos nas clulas resultantes da primeira e da segunda diviso meitica esto representados, respectivamente, em a) I e II b) I e III c) II e III d) II e IV e) III e IV [D] 269. Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como no so completamente homlogos, no se pareiam na meiose. b) como so completamente homlogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma regio homloga. d) no se pareiam na meiose, pois possuem uma regio no homloga. e) os genes que se encontram na regio no homloga do X condicionam um tipo de herana chamado herana restrita ao sexo. [C] 270. Uma espcie de pernilongo possui 2n = 6 cromossomos. A seguir esto representados fenmenos meiticos pelos quais passam as clulas gamticas desse pernilongo. Marque a alternativa que contm a seqncia correta dos eventos meiticos.

23 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) MEIOSE I - homlogos, MEIOSE II - irmos, MITOSE - homlogos c) MEIOSE I - irmos, MEIOSE II - irmos, MITOSE - homlogos d) MEIOSE I - irmos, MEIOSE II - homlogos, MITOSE - irmos e) MEIOSE I - irmos, MEIOSE II - homlogos, MITOSE homlogos [A] 276. Com relao ao processo conhecido como crossing-over, podemos afirmar que o mesmo a) diminui a variabilidade gentica. b) separa cromtides homlogas. c) corrige a recombinao gnica. d) aumenta a variabilidade gentica. e) troca cromossomos entre genes homlogos. [D] 277. Considerando o desenho, analise as afirmativas a seguir.

a) I e V. d) II e III. [B]

b) V e III. e) III e IV.

c) II e V.

281. Num mamfero adulto, grande quantidade de clulas em diviso ocorre normalmente a) no msculo cardaco. b) na medula espinhal. c) no crebro. d) na medula ssea. e) nos msculos esquelticos. [D] 282. Sobre o esquema a seguir que representa o ciclo celular, so feitas 3 afirmativas:

I. A e C representam clulas em metfase; B e D representam clulas em anfase. II. A representa uma clula em mitose, pois possvel observar os cromossomos homlogos pareados. III. D representa a separao das cromtides-irms, fenmeno que ocorre durante a meiose II e a mitose. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas I e III. d) apenas III. e) I, II e III. [C] 278. A mitose e a meiose so dois tipos de diviso celular. Com relao a esses processos, assinale a(s) proposio(es) VERDADEIRA(S). 01. A mitose uma diviso do tipo equacional. 02. A meiose ocorre em quatro etapas sucessivas. 04. O nmero de cromossomos das clulas resultantes de ambos os processos igual ao das clulas que lhes deram origem, porm somente as clulas que sofreram meiose podem apresentar recombinao gentica. 08. A mitose ocorre nas clulas somticas. 16. A meiose ocorre na linhagem germinativa, quando da produo dos gametas. 32. Ambos os processos ocorrem em todos os seres. 64. Em alguns organismos a mitose utilizada como forma de reproduo. VFFVVFV 279. A figura adiante representa a citocinese em duas clulas diferentes, 1 e 2.

I - A duplicao do ADN acontece no perodo S. II - A sntese de protenas mais intensa durante a mitose. III - As clulas resultantes da mitose diferem da clula-me, devido ao fenmeno do "crossing-over". Est(o) correta(s) a(s) afirmativa(s): a) apenas I. b) apenas II. c) apenas I e III. d) apenas II e III. e) I, II e III. [A] 283. No processo de mitose: a) a partir de uma clula diplide originam-se duas novas clulas diplides b) a partir de uma clula diplide originam-se quatro novas clulas diplides c) a partir de uma clula haplide originam-se duas novas clulas diplides d) a partir de uma clula haplide originam-se quatro novas clulas diplides e) a partir de uma clula diplide originam-se quatro novas clulas haplides [A] 284. Os grficos representam a interfase de clulas diferenciadas de dois tipos, respectivamente:

a) estveis e lbeis. b) estveis e perenes. c) lbeis e estveis. d) lbeis e perenes. e) perenes e lbeis. [D] As clulas 1 e 2 poderiam corresponder, respectivamente, a clulas de: a) homem e banana. b) alface e rato. c) rato e mosquito. d) caranguejo e coelho. e) babau e goiaba. [A] 280. A figura a seguir representa varias clulas em diferentes estgios do ciclo de vida. A duplicao do material gentico e o rompimento dos centrmeros ocorrem, respectivamente, em: 285. Considere as seguintes fases da mitose: I. telfase II. metfase III. anfase Considere tambm os seguintes eventos: a. As cromtides-irms movem-se para os plos opostos da clula. b. Os cromossomos alinham-se no plano equatorial da clula. c. A carioteca e o nuclolo reaparecem. Assinale a alternativa que relaciona corretamente cada fase ao evento que a caracteriza. a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III a [E] 286. Com relao diviso celular, podemos afirmar que a) a mitose s ocorre em organismos com reproduo sexuada. b) a mitose permite variabilidade gentica, principal diferena do processo em relao meiose. c) na meiose no h associao de cromossomos homlogos com troca de partes entre eles, fato que s ocorre na mitose.

24 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) na meiose no ocorre segregao de genes. e) o objetivo do processo mittico o crescimento do organismo e do processo meitico a formao de gametas. [E] 287. Em relao ao processo de diviso celular, podemos afirmar que: a) a mitose consiste em duas divises celulares sucessivas. b) os vulos e os espermatozides so produzidos por divises mitticas. c) durante a meiose no ocorre a permutao ou "crossing-over". d) a meiose um processo que d origem a quatro clulas haplides. e) durante a mitose as cromtides irms no se separam. [D] 288. O quadro a seguir apresenta algumas diferenas entre mitose e meiose. Assinale a alternativa correta.

d) Todas so corretas. e) Todas esto erradas. [A] 293. Considere os seguintes eventos: I. recombinao gentica II. segregao de cromossomos homlogos III. segregao de cromtides irms IV. alinhamento dos cromossomos na placa equatorial. Desses, os que ocorrem tanto na mitose quanto na meiose so APENAS a) I e II b) I e III c) II e III d) II e IV e) III e IV [E] 294. Analise os eventos mitticos relacionados a seguir: I. Desaparecimento da membrana nuclear. II. Diviso dos centrmeros. III. Migrao dos cromossomos para os plos do fuso. IV. Posicionamento dos cromossomos na regio mediana do fuso. Qual das alternativas indica corretamente sua ordem temporal? a) IV - I - II - III. b) I - IV- III - II. c) I - II - IV - III. d) I - IV - II - III. e) IV - I - III - II. [D] 295. Nos processos de diviso celular o posicionamento dos cromossomas na metfase e anfase importante porque garante: a) distribuio eqitativa dos cromossomas pelas clulas filhas. b) pareamento cromossmico para a ocorrncia do "crossing-over". c) duplicao de DNA indispensvel continuidade do processo. d) formao de cromossomas homlogos e independentes. e) alinhamento de cromossomas necessrio formao de sinapses. [A] 296. Mitose um processo de diviso celular pelo qual uma clula origina duas outras com o mesmo nmero de cromossomos. Com relao diviso celular, podemos afirmar que a) na mitose a clula-me diplide origina clulas-filhas haplides. b) a interfase caracteriza-se pela pouca atividade metablica desempenhada pela clula. c) a mitose precedida de uma duplicao de material gentico. d) durante a diviso celular a organizao do ncleo mantm-se inalterada. e) no perodo de mitose a quantidade de DNA mantm-se constante. [C] 297. Leia com ateno as afirmativas a seguir: I - Durante a intrfase os cromossomos se duplicam. II - Na prfase os cromossomos migram para os plos opostos. III - Na metfase os cromossomos atingem o mximo de espiralizao. Dessas afirmativas, a) apenas I e III so corretas. b) I, II e III so corretas. c) so corretas apenas I e II. d) apenas I correta. e) so corretas apenas II e III. [A] 298. Se a quantidade de DNA de uma clula somtica em metfase mittica 2X, as clulas do mesmo tecido, nas fases G1 e G2 apresentam, respectivamente, as seguintes quantidades de DNA: a) X e X b) X/2 e X c) X/2 e 2X d) X e X/2 e) X e 2X [E] 299. Ao compararmos mitose com meiose, podemos concluir que: a) a meiose est associada reproduo de pluricelulares, e a mitose, ao seu crescimento. b) a meiose divide metade o nmero de cromossomos de uma clula, e a mitose o duplica. c) a meiose est associada reproduo de unicelulares, e a mitose, ao seu crescimento. d) a mitose garante o nmero cromossomial da espcie, e a meiose, o nmero cromossomial do indivduo. e) a mitose s acontece em clulas reprodutoras, e a meiose s em clulas haplides. [A] 300. Considere os seguintes eventos que ocorrem durante a mitose: I - Desespiralizao dos cromossomos. II - Desaparecimento da carioteca. III - Desaparecimento do fuso acromtico. IV - Separao das cromtides irms. V - Reaparecimento do nuclolo. Assinale a alternativa que rene os eventos que caracterizam a telfase. a) I - III - V b) I - II - IV c) I - II - III

[C] 289. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Em relao ao ciclo celular: ( ) a fase G do ciclo celular o perodo durante o qual o DNA duplicado; ( ) a fase G o principal perodo de crescimento do material citoplasmtico, inclusive das organelas; ( ) durante a prfase, os centrolos se distanciam e formam-se as fibras do fuso; ( ) na anfase, ocorre a citocinese; ( ) a desespiralizao dos cromossomos ocorre na metfase. FFVFF 290. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Analise as proposies apresentadas com relao ao tpico "Diviso celular". ( ) Nos organismos pluricelulares, o crescimento e a reparao dos tecidos ocorrem atravs de mitose. ( ) Na mitose ocorre recombinao de genes e formam-se, ao final do processo, quatro clulas, todas 2n (diplide) como a clula me. ( ) Em organismos adultos, clulas em que a capacidade de diviso diminuiu, podem voltar a se dividir ativamente, como o caso de clulas sseas aps a ocorrncia de fraturas. ( ) No processo de meiose ocorre uma duplicao cromossmica para duas divises celulares. ( ) Na primeira diviso meitica ocorre a segregao das cromtides irms de cada cromossomo a na segunda diviso ocorre a separao dos cromossomos homlogos de cada par. VFVVF 291. Numere relacionando corretamente: ( ) Ciclo celular ( ) Nuclolo ( ) Espermatognese ( ) Centrmero ( ) Espermiognese 1. Desaparece na prfase. 2. Modificao morfolgica nas espermtides. 3. Gametognese masculina. 4. Prende os cromossomos ao fuso 5. Intrfase seguida de diviso A seqncia numrica correta de cima para baixo : a) 5 - 1 - 2 - 3 - 4. b) 5 - 1 - 3 - 4 - 2. c) 3 - 4 - 1 - 2 - 5. d) 1 - 5 - 3 - 4 - 2. e) 5 - 1 - 2 - 4 - 3. [B] 292. Considere as proposies a seguir e assinale a alternativa correta. I) A duplicao do DNA ocorre durante a intrfase da clula. II) Quando uma clula diplide sofre meiose seu nmero cromossmico se reduz a 1/4. III) A duplicao dos centrolos ocorre na telfase da mitose. a) Apenas a afirmativa I est correta. b) Esto corretas I e III. c) Apenas a afirmativa III est correta.

25 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) II - III - IV e) III - IV V [A] 301. As figuras a seguir representam a citocinese de dois tipos de clulas.

Os exemplos de organismos cujas clulas representam de maneira correta as figuras A e B so, respectivamente, a) alface e minhoca. b) homem e lesma. c) peixe e rato. d) macaco e trigo. e) grama e tomate. [D] 302. Considerando que a ilustrao a seguir, referente diviso de uma clula somtica hipottica, apresenta um erro, assinale a alternativa que apresenta a situao que tornaria o desenho correto.

Assinale a alternativa que indica corretamente a fase da vida em que se encontram as clulas representadas. a) 1 - intrfase, 2 - mitose, 3 - mitose, 4 - mitose b) 1 - intrfase, 2 - mitose, 3 - meiose, 4 - meiose c) 1 - mitose, 2 - meiose, 3 - meiose, 4 - meiose d) 1 - mitose, 2 - intrfase, 3 - mitose, 4 - meiose e) 1 - meiose, 2 - mitose, 3 - mitose, 4 mitose [A] 305. Considerando que uma espcie possua n de cromossomos nas clulas somticas 2n = 6, a clula apresentada na figura adiante evidencia estes cromossomos em:

a) metfase mittica. d) anfase mittica. [D]

b) metfase I. e) anfase II.

c) metfase II.

a) A clula-me deveria ter apenas 2 cromossomos e as clulas-filhas deveriam ter 4 cromossomos, pois tm origem aps a duplicao dos cromossomos. b) A clula-me deveria ter 4 cromossomos e as clulas-filhas deveriam ter 2 cromossomos, pois foram originadas por mitose. c) A clula-me deveria ter 4 cromossomos e as clulas-filhas deveriam ser 4 e ter cada uma 2 cromossomos, pois seriam o resultado de uma meiose. d) A clula-me deveria ter 4 cromossomos e cada clula-filha 4 cromossomos, pois seriam o resultado de uma mitose. e) A clula-me deveria ter 2 cromossomos e as clulas-filhas 2 cromossomos, pois seriam o resultado de uma meiose. [D] 303. No preparo do caritipo humano se faz necessrio que os cromossomos se apresentem bastante individualizados, como mostra a figura:

306. Pontas de razes so utilizadas para o estudo dos cromossomos de plantas por apresentarem clulas a) com cromossomos gigantes do tipo politnco. b) com grande nmero de mitocndrias. c) dotadas de nuclolos bem desenvolvidos. d) em diviso mittica. e) em processo de diferenciao. [D] 307. O diagrama a seguir representa o ciclo de vida de uma clula somtica humana, onde X representa o contedo de DNA.

A fase da mitose favorvel a esta individualizao cromossomial, como mostra a figura anterior, a: a) anfase c) prfase b) telfase d) metfase [D] 304. A figura a seguir representa um corte longitudinal da regio de crescimento de uma raiz.

Com base nas afirmaes do diagrama e em seus conhecimentos, INCORRETO afirmar que a) a fase de menor durao do ciclo a MITOSE. b) a fase F do ciclo corresponde INTERFASE. c) em G1 a clula haplide. d) em S ocorre a duplicao dos cromossomos. [C] 308. Com o auxlio do diagrama e do grfico a seguir, relativos ao ciclo celular, julgue os itens abaixo.

26 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(1) O grfico representa um processo importante para o aumento da variabilidade gentica. (2) Na fase I, ocorre sntese de RNA. (3) Na fase III, a clula tem o dobro dos cromossomos que tem na fase I. (4) Nas clulas em A, est ausente o envoltrio nuclear. ECEC 309. Assinale a alternativa da tabela a seguir que identifica corretamente os cromossomos que migram para plos opostos da clula durante as anfases da meiose e da mitose. a) MEIOSE I - homlogos, MEIOSE II - irmos, MITOSE - irmos b) MEIOSE I - homlogos, MEIOSE II - irmos, MITOSE - homlogos c) MEIOSE I - irmos, MEIOSE II - irmos, MITOSE - homlogos d) MEIOSE I - irmos, MEIOSE II - homlogos, MITOSE - irmos e) MEIOSE I - irmos, MEIOSE II - homlogos, MITOSE homlogos [A] 310. A mosca de frutas (Drosophila melanogaster) apresenta 08 cromossomos nas clulas somticas. correto afirmar, portanto, que uma clula somtica do referido inseto apresenta a) 04 cromtides em G1. b) 08 cromtides em G2. c) 32 centrmeros na metfase. d) 16 cinetcoros na prfase. [D] 311. Na mitose, a prfase constitui a fase: a) terminal, onde a clula se divide. b) inicial, onde os cromossomos se duplicam e a clula armazena energia para o processo de duplicao. c) intermediria, onde os cromossomos atingem o grau de condensao mxima. d) inicial, onde a carioteca e o nuclolo desaparecem e se forma o fuso mittico. e) intermediria, onde os centrmeros se dividem e as cromtides irms migram para o plo da clula. [D] 312. Observe o esquema representativo de um ciclo celular e assinale a alternativa INCORRETA:

O momento em que a clula-me acabou de se dividir e cada clula-filha tem um conjunto de cromossomos idntico ao da original a) 1 b) 2 c) 3 d) 4 e) 5 [E] 314. A mitose e a meiose so dois tipos de diviso celular. Com relao a esses processos, assinale a(s) proposio(es) VERDADEIRA(S). 01. A mitose uma diviso do tipo equacional. 02. A meiose ocorre em quatro etapas sucessivas. 04. O nmero de cromossomos das clulas resultantes de ambos os processos igual ao das clulas que lhes deram origem, porm somente as clulas que sofreram meiose podem apresentar recombinao gentica. 08. A mitose ocorre nas clulas somticas. 16. A meiose ocorre na linhagem germinativa, quando da produo dos gametas. 32. Ambos os processos ocorrem em todos os seres. 64. Em alguns organismos a mitose utilizada como forma de reproduo. VFFVVFV 315. A respeito da figura adiante, que representa uma clula em mitose, assinale a alternativa INCORRETA.

a) II o centro celular, responsvel pela formao do aparelho mittico. b) III indica fibra do fuso, responsvel pelo deslizamento dos cromossomos durante a anfase. c) Nos animais, II apresenta um centrolo, que est ausente nos vegetais superiores. d) Os filamentos de DNA contidos em I so idnticos entre si. e) Na etapa anterior representada na figura, ocorreu a duplicao do DNA. [E] 316. Na membrana plasmtica h predominncia de: a) carboidratos e protenas b) lpedes e protenas c) carboidratos e lpedes d) carboidratos e cidos nuclicos e) cidos nuclicos e protenas [B] 317. Considere os seguintes componentes qumicos: I. lipdios II. acares III. protenas IV. cidos nuclicos Assinale, a alternativa que identifica corretamente os componentes bsicos de cada estrutura considerada. 1) MEMBRANA PLASMTICA 2) PAREDE CELULAR a) (1) I e II, (2) III e IV b) (1) I e III, (2) II c) (1) I e IV, (2) II d) (1) II, (2) II e III e) (1) III, (2) I e III [B] 318. Observe o desenho a seguir, referente ao esquema ultra-estrutural da membrana celular. A natureza qumica dos componentes 1, 2 e 3, respectivamente, :

a) A duplicao do material gentico ocorre na subfase S. b) A separao das cromtides irms ocorre em A. c) A mitose compreende as fases P, M, A e T. d) A quantidade de DNA est reduzida metade em G2. e) A interfase compreende as subfases G1, S e G2. [D] 313. Analise o grfico a seguir:

27 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

16. O nmero 5 indica uma protena transmembrana que dificulta a passagem de gases pela membrana. 32. O nmero 1 e 2 indicam regies hidroflica e hidrofbica de lipdios, respectivamente. FFFVFV 322. Para exercerem suas funes de reabsoro, as clulas epiteliais dos tbulos renais apresentam a) vilosidades e muitas mitocndrias. b) superfcie lisa e muitas mitocndrias. c) vilosidades e poucas mitocndrias. d) superfcie lisa e poucas mitocndrias. e) grandes vacolos. [A] a) lpides; protenas; protenas. b) protenas; lpides; protenas. c) protenas; protenas; lpides. d) lpides; lpides; protenas. e) protenas; lpides; lpides. [D] 319. Com relao membrana plasmtica e parede celulsica, incorreto afirmar que: a) a membrana plasmtica apresenta em sua constituio protenas, lipdios e hidratos de carbono. b) o modelo do mosaico fluido, prope que protenas integrais esto includas na bicamada lipdica da membrana plasmtica. c) o modelo de mosaico fluido admite que tanto as protenas integrais como os lipdios podem realizar movimentos dentro da bicamada. d) a parede celular dos vegetais pode ser formada por 3 camadas: lamela mdia, parede primria e parede secundria. e) a parede primria atua como elemento cimentante entre duas clulas vegetais. [E] 320. O esquema a seguir representa o modelo de organizao molecular da membrana plasmtica. 323. As clulas animais apresentam um revestimento externo especfico, que facilita sua aderncia, assim como reaes a partculas estranhas, como, por exemplo, as clulas de um rgo transplantado. Esse revestimento denominado: a) membrana celulsica. b) glicoclix. c) micro vilosidades. d) interdigitaes. e) desmossomos. [B] 324. Assinale a NICA proposio CORRETA. O esquema a seguir diz respeito ao:

01. tecido nervoso, sendo A representa os dendritos e B representa a bainha de mielina. 02. tecido nervoso, onde A representa os clios e B representa o axnio. 04. tecido epitelial, onde A representa as microvilosidades e B representa um ducto de excreo. 08. tecido epitelial, em que A representa os clios e B representa os desmossomos. 16. tecido epitelial, em que A representa microvilosidades e B representa os desmossomos. 16 Assinale a alternativa INCORRETA. a) Esse mesmo tipo de membrana encontrado em organelas citoplasmticas. b) 1 indica a camada de fosfolipdios. c) 2 indica protena responsvel pelo transporte de certas substncias que atravessam a membrana. d) Trata-se da membrana de uma clula eucariota, j que nas clulas procariotas h apenas uma camada de fosfolipdios. e) 3 indica carboidrato que forma o glicoclix. [D] 321. O modelo a seguir representa a estrutura molecular da membrana plasmtica, segundo Singer e Nicholson (1972). Observando-o, leia as afirmativas propostas e assinale a(s) correta(s): 325. Durante a embriognese, ocorre o processo de diferenciao celular, no qual cada clula se especializa para o desempenho de determinada funo. Clulas com funo de secreo, proteo e absoro, todas em intensa atividade metablica, devem apresentar, respectivamente: a) desmossomos, microvilosidades, abundncia de complexos de Golgi e mitocndrias. b) abundncia de complexos de Golgi, desmossomos, microvilosidades e maior nmero de mitocndrias. c) abundncia de complexos de Golgi, microvilosidades, desmossomos e muitas mitocndrias. d) microvilosidades, desmossomos, abundncia de mitocndrias e de retculos endoplasmticos rugosos. e) abundncia de mitocndrias, desmossomos, microvilosidades e extensa rede de microfilamentos. [B] 326. As bactrias no apresentam organelas citoplasmticas, tais como complexo de Golgi, mitocndrias, etc., geralmente encontradas em clulas de seres eucariontes. Entretanto, as bactrias possuem uma invaginao da membrana plasmtica chamada MESOSSOMO que apresenta uma funo anloga da organela: a) lisossomo b) mitocndria c) complexo de Golgi d) plasto e) centrolo [B] 327. As clulas da mucosa intestinal aumentam sua superfcie de absoro atravs de uma especializao de sua membrana denominada: a) nexos. b) tonofilamentos. c) desmossomos. d) microvilos. e) pseudpodos. [D] 328. A membrana plasmtica apresenta algumas transformaes, que procedem como especializaes destinadas a aumentar o poder de absoro da clula ou a permitir o seu deslocamento. So exemplos dessas especializaes, respectivamente: a) desmossomas e interdigitaes.

01. O nmero 1 indica a parte hidrofbica dos fosfolipdios que controlam o transporte pela membrana. 02. O nmero 2 indica as protenas que formam barreiras para substncias hidrossolveis. 04. O nmero 3 indica uma protena perifrica que facilita a passagem de ons pela membrana. 08. O nmero 4 indica uma molcula de glicdio que faz parte do glicoclix.

28 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) vacolos e plastos. c) cariomembrana e peroxissoma. d) microvilos e clios. e) interdigitaes e glioxissomas. [D] 329. A membrana plasmtica pode apresentar modificaes ligadas ao aumento da adeso celular. Assinale a alternativa que apresente exemplos destas modificaes nas clulas epiteliais animais. a) glicoclix e plasmodesmos b) glicoclix e interdigitaes c) plasmodesmos e microvilos d) desmossomos e vilosidades e) znula de ocluso e trama terminal [B] 330. A tabela a seguir compara a concentrao de certos ons nas clulas de 'Nitella' e na gua do lago onde vive essa alga.

c) as clulas de lvedo cresceriam mesmo sem a presena desse carboidrato ou de seus derivados. d) as clulas de lvedo tm enzimas que carregam a sacarose para dentro da clula, onde ocorre a digesto. e) a sacarose se transforma em amido, por ao de enzimas do lvedos, e entre as clula, onde utilizada. [B] 334. A passagem de substncias atravs da membrana se d pelos seguintes processos: 1. Difuso Simples 2. Difuso Facilitada 3. Transporte Ativo correto afirmar que os processos envolvidos na passagem de gua, O 2 , CO2 e substncias solveis em lipdios esto representados apenas no(s) item(ns): a) 2 e 3 b) 1 e 3 c) 2 d) 1 e) 1 e 2 [D] 335. Assinale a alternativa incorreta: a) a difuso um processo que ocorre sem gastos de energia b) a difuso do solvente chamada Osmose c) gs carbnico e oxignio no atravessam a membrana porque no so solveis em lipdios d) pequenas molculas e gua passam livremente pela membrana celular e) a difuso o movimento de molculas a favor de um gradiente de concentrao [C] 336. Quando uma clula fagocita uma partcula: a) a digesto das substncias fagocitadas ocorre por meio de um processo exgeno clula em estruturas chamadas de desmossomos b) h formao de pseudpodes contendo enzimas proteolticas e cidos nuclicos c) a digesto das substncias fagocitadas feita pelas enzimas encontradas nos lisossomos d) a digesto das substncias fagocitadas ocorre no retculo endoplasmtico rugoso com a participao dos ribossomos [C] 337. A figura a seguir representa uma hemcia (A) que sofre alteraes quando mergulhada em um meio hipertnico (1), ou quando mergulhada em um meio hipotnico (2).

Os dados permitem concluir que as clulas dessa alga absorvem: a) esses ons por difuso. b) esses ons por osmose. c) esses ons por transporte ativo. d) alguns desses ons por transporte ativo e outros por osmose. e) alguns desses ons por difuso e outros por osmose. [C] 331. Medidas da concentrao de ons de sdio (Na+) e de potssio (K+), dentro e fora dos neurnios gigantes de lula, revelaram os seguintes valores: [Na+] no citoplasma = 50 [Na+] no meio extracelular = 440 [K+] no citoplasma = 400 [K+] no meio extracelular = 20 Se os neurnios so expostos a um bloqueador respiratrio, como o cianeto, a concentrao de sdio rapidamente se iguala dentro e fora da clula, o mesmo ocorrendo com o potssio. Em condies normais, qual o mecanismo responsvel pela manuteno da diferena entre as concentraes inicas dentro e fora do neurnio? a) Difuso, pelo qual ons podem atravessar a membrana espontaneamente. b) Osmose, pelo qual apenas a gua atravessa a membrana espontaneamente. c) Transporte ativo, pelo qual ons atravessam a membrana com gasto de energia. d) Fagocitose, pelo qual a clula captura partculas slidas. e) Pinocitose, pelo qual a clula captura gotculas. [C] 332. O grfico a seguir mostra as concentraes relativas de alguns ons no citoplasma da alga verde Nitella e na gua circundante. A partir dos conhecimentos sobre permeabilidade da membrana celular, qual a melhor interpretao para os dados mostrados no grfico?

Com base nessas informaes RESPONDA: a) Se uma dose de soluo salina, com concentrao muito superior do sangue, for injetada em um co, qual dos fenmenos, anteriormente representados, pode ocorrer em suas hemcias? JUSTIFIQUE sua resposta. b) correto afirmar que houve, tanto em (1) como em (2), o fenmeno da osmose? JUSTIFIQUE sua resposta. a) Fenmeno 1, pois as hemcias perderam gua por osmose. b) Sim, porque nos dois casos houve transporte passivo de gua atravs da membrana plasmtica das hemcias. 338. Quando temperamos a salada com sal, vinagre e azeite, depois de algum tempo, observamos que as folhas esto murchas. Esse processo denominado: a) diapedese b) dilise c) osmose d) hemlise e) difuso [C] a) Os ons difundem-se espontaneamente atravs da membrana. b) A diferena de concentrao inica deve-se osmose. c) A diferena de concentrao inica se deve pinocitose. d) A carga eltrica atrai os ons para dentro da clula. e) Ocorre transporte ativo dos ons atravs da membrana. [E] 333. A membrana celular impermevel sacarose. No entanto, culturas de lvedos conseguem crescer em meio com gua e sacarose. Isso possvel porque: a) a clula de lvedo fagocita as molculas de sacarose e as digere graas s enzimas dos lisossomos. b) a clula de lvedo elimina enzimas digestivas para o meio e absorve o produto da digesto. 339. No que diz respeito osmose, em condies normais, podemos fazer a seguinte afirmao: a) As hemcias dos mamferos so hipotnicas em relao ao sangue e linfa. b) As clulas dos animais superiores so isotnicas em relao ao sangue e linfa. c) Os paramcios, com vacolo pulstil, so isotnicos em relao ao meio ambiente. d) Os unicelulares, com vacolo pulstil, so hipotnicos em relao ao meio ambiente. e) Os unicelulares de gua salgada so geralmente hipotnicos em relao ao meio ambiente. [B]

29 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

340. As carnes "salgadas" no se estragam, porque qualquer microorganismo que nela se instalar desidratar e morrer. Esta carne se encontra no estado: a) hipotnica b) isotnica c) trgida d) osmtica e) hipertnica [E] 341. Na figura a seguir, as setas numeradas indicam o sentido do fluxo de gua em duas clulas.

346. Se colocarmos uma clula animal e outra vegetal em uma soluo de NaCl a 1,5%, observaremos que: a) ambas as clulas permanecem intactas por estarem mergulhadas em uma soluo isotnica. b) as duas perdem gua por osmose e, enquanto a clula animal arrebenta num fenmeno denominado de plasmoptose, a clula vegetal sofre turgncia. c) as duas perdem gua por osmose e, enquanto a clula animal murcha, ficando com a superfcie enrugada, a clula vegetal sofre plasmlise. d) o volume de ambas as clulas aumenta devido entrada de gua por osmose e, enquanto a clula animal sofre hemlise, a clula vegetal sofre turgncia. e) ao serem colocadas em uma soluo hipertnica, a clula animal perde gua e murcha, enquanto que a clula vegetal, protegida pela parede celular, permanece intacta. [C] 347. Colocando-se hemcias humanas em diferentes solues com concentraes inicas variveis, pode-se exemplificar a influncia que o grau de permeabilidade da membrana plasmtica gua exerce sobre a clula. As conseqncias desse experimento esto demonstradas nos esquemas adiante.

Qual das alternativas identifica corretamente os processos responsveis pelos fluxos indicados? a) I - osmose, II - osmose, III - osmose. b) I - osmose, II - osmose, III - transporte ativo. c) I - osmose, II - transporte ativo, III - transporte ativo. d) I - transporte ativo, II - transporte ativo, III - osmose. e) I - transporte ativo, II - transporte ativo, III - transporte ativo. [B] 342. Uma clula ao ser mergulhada em uma soluo, apresenta uma variao de concentrao de solutos em funo do tempo, de acordo com o grfico a seguir:

O esquema que representa o comportamento da hemcia, ao ser colocada em um meio hipertnico, o de nmero: a) 1 b) 2 c) 3 d) 4 [A] 348. O mercrio um metal pesado cuja forma inorgnica (Hgo) utilizada de maneira indiscriminada na extrao de ouro nos garimpos da Amaznia. Esta forma qumica do mercrio capaz de formar amlgama com o ouro, separando-o temporariamente de outros metais. Quando o amlgama submetido a altas temperaturas, ocorre a volatilizao do Hgo, o qual lanado na atmosfera, obtendo-se assim o ouro puro. Uma vez na atmosfera, o Hgo pode atingir os ambientes aquticos por deposio atmosfrica mida e/ou seca. Atravs da ao microbiolgica o Hgo oxidado a Hg++ para em seguida ser metilado (CH3Hg+). A forma orgnica (CH3Hg+ - metilmercrio) atravessa facilmente a membrana das clulas e, uma vez dentro delas, altera a funo estrutural e/ou enzimtica das protenas. A respeito da ao do metilmercrio nas clulas, correto afirmar: ( ) Uma enzima participa da troca dos ons Na+ e K+ atravs da membrana plasmtica, que controla o equilbrio osmtico nas clulas eucariticas animais. Apesar do metilmercrio (CH3Hg+) ser tambm um monovalente, no chega a alterar o mecanismo de trocas entre Na+ e K+ nessas clulas. ( ) A membrana plasmtica manter-se- intacta estrutural e funcionalmente, uma vez que as protenas presentes na membrana esto imersas e protegidas pela bicamada lipdica. ( ) Uma vez dentro da clula, o mercrio certamente no afetar o processo de sntese das protenas, j que elas ainda no esto completamente formadas. ( ) O mercrio altera processos importantes no metabolismo celular, como duplicao e transcrio do DNA. ( ) O mercrio poder afetar a estrutura dos microtbulos, prejudicando assim a formao do citoesqueleto, bem como os movimentos celulares e/ou o trnsito de organelas e vesculas dentro da clula. FFFVV 349. Uma clula animal foi mergulhada na soluo de cloreto de potssio cuja concentrao semelhante do plasma sangneo (esquema 1). Aps um certo tempo, a concentrao de potssio na clula tornou-se vinte vezes maior que a da soluo, e o volume da mesma no se alterou (esquema 2). Analise os esquemas:

De acordo com o grfico, podemos afirmar que a clula sofreu: a) desplasmlise b) plasmoptise c) plasmlise d) hemlise [C] 343. O movimento de molculas de aminocidos para o interior das clulas faz-se, geralmente, por a) osmose. b) simples difuso. c) difuso facilitada. d) transporte ativo. e) fagocitose. [C] 344. O esquema a seguir representa a passagem de ons Na+ (sdio) e K+ (potssio) atravs da membrana plasmtica.

Em relao ao processo esquematizado, podemos afirmar que: a) por transporte ativo os ons Na+ entram na clula objetivando atingir a isotonia. b) por difuso os ons K+ entram na clula contra um gradiente de concentrao. c) a entrada de ons K+ por transporte ativo compensada pela sada de Na+ pelo mesmo processo. d) a sada de ons Na+ por transporte passivo serve para contrabalanar a entrada dos mesmos ons por transporte ativo. e) para entrada e sada desses ons da clula no so consumidas molculas de ATP. [C] 345. Existe um tipo de troca entre a clula e o meio, que ocorre contra o gradiente de concentrao e no qual necessria a existncia de uma protena carregadora, cuja ativao depende de gasto de energia. Esse tipo de troca denominado: a) Difuso. b) Difuso facilitada. c) Pinocitose. d) Fagositose. e) Transporte ativo. [E]

A explicao para o fenmeno : a) O potssio entrou na clula por osmose. b) Uma enzima lisossmica rompeu a membrana da clula por uma frao de segundo, e o potssio entrou nela. c) Houve transporte ativo de gua para o interior da clula, e esta arrastou o potssio. d) Houve transporte passivo de potssio para o interior da clula, deslocando gua para fora da mesma. e) Houve transporte ativo de potssio para o interior da clula. [E]

30 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

350. A representao a seguir indica as concentraes intra e extracelulares de sdio e potssio relativas a uma clula animal tpica.

b) os cromossomos so constitudos essencialmente por RNA mensageiro e protenas, material utilizado na produo de ribossomos. c) os cromossomos contm DNA; este controla a sntese de ribonucleoprotenas que formaro o nuclolo e que, posteriormente, faro parte dos ribossomos. d) os cromossomos so constitudos essencialmente por RNA transportador e protenas, material utilizado na produo de ribossomos. e) os cromossomos, produzidos a partir do nuclolo, fornecem material para a organizao dos ribossomos. [C] 357. A clula nervosa, o espermatozide e o zigoto possuem, respectivamente: a) 46, 46 e 46 cromossomos b) 23, 46 e 23 cromossomos c) 23, 23 e 46 cromossomos d) 46, 23 e 23 cromossomos e) 46, 23 e 46 cromossomos [E]

Observou-se, em uma experincia, que as concentraes de sdio nos dois compartimentos se tornaram aproximadamente iguais, o mesmo acontecendo com as concentraes de potssio. Neste caso poderia ter ocorrido: a) uma inibio do processo de difuso facilitada. b) a utilizao de um inibidor especfico da bomba de clcio. c) um estmulo ao processo de osmose. d) a utilizao de um ativador especfico da bomba de sdio e potssio. e) a utilizao de um inibidor da cadeia respiratria. [E] 351. Uma alga marinha unicelular transferida para gua de lago. Embora no possa sobreviver nesse meio, num primeiro momento ela tentar entrar em equilbrio com ele a) formando vacolos contrteis. b) perdendo gua. c) absorvendo gua. d) sofrendo hemlise. e) entrando em plasmlise. [C] 352. A membrana plasmtica uma membrana semipermevel, no havendo condies, normalmente, para o extravasamento dos colides citoplasmticos para fora da clula. Sob esse aspecto, a membrana j comea a selecionar o que deve entrar na clula ou dela sair. Considerando os diferentes processos de passagem atravs da membrana plasmtica, CORRETO afirmar que 01. a OSMOSE a passagem de molculas de gua sempre no sentido do meio mais concentrado para o menos concentrado. 02. a PINOCITOSE outro tipo de ENDOCITOSE, ocorrendo, neste caso, o englobamento de pequenas pores de substncias lquidas. 04. no TRANSPORTE ATIVO, enzimas agem como transportadoras de molculas, tais como o acar, ou ons. 16. na DIFUSO FACILITADA, participam molculas especiais, de natureza lipdica e h gasto de energia. 32. para EXOCITOSE, substncias inteis clula so eliminadas com o auxlio dos centrolos. FVVVFF 353. Atravs de uma lmina, em microscpio ptico, possvel distinguir o corte da raiz do corte do caule de uma dicotilednea jovem porque: I - O xilema alternado com o floema na raiz, enquanto que no caule se observa xilema para fora e floema para dentro. II - O caule no apresenta endoderme ntida e a raiz s possui periciclo. III - A raiz no possui cmbio e o caule tem. Para esta questo assinale: a) Se s uma proposio estiver correta. b) Se todas as proposies estiverem erradas. c) Se a primeira e a segunda estiverem corretas. d) Se a primeira e a terceira estiverem corretas. e) Se todas as proposies estiverem corretas. [B] 354. Considere uma espcie de vertebrado cujas clulas embrionrias tm oito cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Nmero varivel. [B] 355. A presena de cromatina sexual predominante em nmero de clulas femininas est relacionada a cromossomos: a) Y inativos b) X inativos c) autossmicos inativos d) autossmicos que no se dividiram e) autossmicos agregados [B] 356. Na aula de Biologia, o professor fez a seguinte afirmao: "A produo de ribossomos depende, indiretamente, da atividade dos cromossomos. Em seguida pediu a seus alunos que analisassem a afirmao e a explicassem. Foram obtidas cinco explicaes diferentes, que se encontram a seguir citadas. Assinale a nica afirmao correta: a) os cromossomos so constitudos essencialmente por RNA ribossmico e protenas, material utilizado na produo de ribossomos.

358. "A intrfase a fase em que ocorre o repouso celular". A afirmativa est: a) correta, porque praticamente no h atividade metablica celular. b) correta, pois ocorrem apenas alteraes no formato da clula. c) incorreta, porque ocorre movimento dos centrolos. d) incorreta, porque ocorre a condensao dos cromossomas. e) incorreta, porque ocorre duplicao do DNA. [E] 359. Na meiose de uma espcie de planta formam-se 16 ttradres ou bivalentes. Qual o nmero diplide da espcie? a) 4. c) 8. c) 16. d) 32. e) 64. [D] 360. Se corarmos uma clula animal com um corante especfico para RNA, a estrutura mais corada ser a) o lisossomo. b) o complexo de Golgi. c) a mitocndria. d) o nuclolo. e) o centrolo. [D] 361. Os cromossomos das clulas somticas de um dado animal foram esquematizados como mostra a figura a seguir:

A partir desse esquema, foram feitas as seguintes dedues sobre esse animal: I. Suas clulas diplides possuem 2n=16 cromossomos. II. Suas clulas haplides apresentam n=8 cromossomos. III. Seu caritipo formado por 4 cromossomos metacntricos, 2 cromossomos submetacntricos e 2 cromossomos acrocntricos. Dessas afirmaes, a) apenas I verdadeira. b) apenas II verdadeira. c) apenas III verdadeira. d) apenas I e II so verdadeiras. e) I, II e III so verdadeiras. [C] 362. Em uma clula eucaritica, as caractersticas genticas responsveis por todo o controle de atividades celulares esto: a) nas organelas citoplasmticas b) somente nos retculos endoplasmticos c) nas cristas mitocondriais d) encerradas no interior do ncleo, na cromatina e) somente nos ribossomos [D] 363. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso.A elucidao de crimes, como tambm a identificao da paternidade, vm sendo efetuadas com certa facilidade e segurana atravs do uso de tcnicas apropriadas, em que so considerados bsicos alguns conceitos de gentica. Sobre esses conceitos, julgue os itens. ( ) Caritipo o conjunto de informaes sobre os cromossomos de uma determinada espcie. ( ) Genes alelos so genes que ocupam o mesmo "locus" gnico em cromossomos homlogos. ( ) Um dos catalisadores do processo de duplicao do DNA a enzima DNA polimerase. ( ) Na espcie humana distinguem-se 3 tipos sangneos, e os indivduos do grupo sangneo AB so considerados doadores universais. VVVF

31 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

364. Considere a quantidade normal de DNA do ncleo de uma clula da mucosa duodenal humana igual a 2C. A partir dessa informao, pode-se prever que a) essa mesma quantidade seja encontrada no ncleo de um linfcido normal. b) essa mesma quantidade seja encontrada no ncleo de um espermatozide normal. c) uma quantidade igual a C seja encontrada no ncleo de um neurnio normal. d) uma quantidade igual a C/2 seja encontrada no ncleo de um vulo normal. e) uma quantidade igual a 4C seja encontrada no ncleo de um blastmero que apresente 46 fios de cromatina. [A] 355. O nmero dos cromossomos nas clulas do cavalo ('Equus caballus') 64 e no trigo ('Triticum aestivum') 42. Quando esses organismos passam pelos processos de mitose e meiose, respectivamente como sero os nmeros cromossmicos de: (I) Cavalo (II) Trigo a) (I) 32 e 64, (II) 42 e 21 b) (I) 128 e 32, (II) 84 e 21 c) (I) 64 e 32, (II) 42 e 21 d) (I) 32 e 16, (II) 42 e 21 e) o nmero de cromossomos no sofre modificaes. [C] 366. Uma clula com 16 cromossomos ao sofrer meiose produz: a) 4 clulas com 16 cromossomos; b) 2 clulas com 8 cromossomos; c) 2 clulas com 16 cromossomos; d) 4 clulas com 8 cromossomos; e) 8 clulas com 16 cromossomos. [D] 367. Uma clula procarionte se diferencia de uma clula eucarionte pela ausncia de: a) DNA b) Carioteca c) Citoplasma d) Membrana Plasmtica e) Ribossomos [B] 368. Considere uma espcie de vertebrado cujas clulas embrionrias tm oito cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Nmero varivel. [B] 369. Se a quantidade de DNA de uma clula somtica em metfase mittica 2X, as clulas do mesmo tecido, nas fases G1e G2, apresentam, respectivamente, as seguintes quantidades de DNA: a) X e X b) X/2 e X c) X/2 e 2X d) X e X/2 e) X e 2X [E] 370. Leia com ateno a tirinha a seguir:

Ele representa a) o fentipo do organismo. b) o genoma de uma clula haplide. c) o genoma de uma clula diplide. d) os cromossomos de uma clula haplide. e) os cromossomos de uma clula diplide. [E] 372. Muitas vezes, durante a realizao de eventos esportivos, realizada a determinao do sexo gentico. Este exame feito pela observao dos cromossomos de clulas epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta no deveriam apresentar corpsculo de Barr. [A] 373. Numere a coluna inferior, relacionando-a com a superior. Indivduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) trs Assinale a opo que apresenta a seqncia correta de numerao. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 [B] 374. Algumas clulas apresentam material nuclear bastante desespiralizado e metabolismo muito alto. Essas caractersticas podem indicar: a) pouca atividade do DNA e, como conseqncia, pouco desenvolvimento das organelas celulares. b) intensa traduo, exigindo a presena de grande desenvolvimento de retculo endoplasmtico liso. c) intensa transcrio e traduo, exigindo a presena de retculo endoplasmtico rugoso muito desenvolvido. d) intensa duplicao do material gentico, demonstrando alta taxa de diviso celular e organelas pouco desenvolvidas. e) intensa transcrio, exigindo grande desenvolvimento do complexo de Golgi, responsvel pela traduo. [C] 375. Considerando que a ilustrao a seguir, referente diviso de uma clula somtica hipottica, apresenta um erro, assinale a alternativa que apresenta a situao que tornaria o desenho correto.

Segundo a tirinha, a amiga do Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga do Calvin mutante, por isso hostil b) um cromossomo X da amiga do Calvin ativo e o outro chamado de cromatina sexual c) a heterocromatina ocorre no Calvin, pois ele XY d) os dois cromossomos X que o Calvin fala da cobra que quer com-lo e) no h cromatina sexual em meninas [B] 371. A anlise citogentica realizada em vrias clulas de um mamfero permitiu elaborar o seguinte esquema:

a) A clula-me deveria ter apenas 2 cromossomos e as clulas-filhas deveriam ter 4 cromossomos, pois tm origem aps a duplicao dos cromossomos.

32 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) A clula-me deveria ter 4 cromossomos e as clulas-filhas deveriam ter 2 cromossomos, pois foram originadas por mitose. c) A clula-me deveria ter 4 cromossomos e as clulas-filhas deveriam ser 4 e ter cada uma 2 cromossomos, pois seriam o resultado de uma meiose. d) A clula-me deveria ter 4 cromossomos e cada clula-filha 4 cromossomos, pois seriam o resultado de uma mitose. e) A clula-me deveria ter 2 cromossomos e as clulas-filhas 2 cromossomos, pois seriam o resultado de uma meiose. [D] 376. Considere as seguintes afirmaes relativas ao nuclolo: I. uma regio de intensa sntese de RNA ribossmico. II. No nuclolo, as molculas de RNA ribossmico associam-se a protenas formando as subunidades que comporo os ribossomos. III. A organizao do nuclolo independe dos cromossomos que compem o ncleo. Dessas afirmaes, APENAS a) I verdadeira. b) II verdadeira. c) III verdadeira. d) I e II so verdadeiras. e) II e III so verdadeiras. [D] 377. Existem algumas tcnicas de colorao que so desenvolvidas para determinar o tipo de substncia presente em um determinado componente celular. Entre eles, temos o mtodo de FEULGEN, especfico para demonstrar a presena de DNA na clula. Se uma clula heptica de uma cobra for submetida a esse mtodo, espera-se que se veja(m) bem corado(s) a) retculo endoplasmtico rugoso, ncleo e nuclolo. b) apenas retculo endoplasmtico rugoso e ncleo. c) apenas retculo endoplasmtico rugoso e nuclolo. d) apenas ncleo e nuclolo. e) apenas ncleo. [E] 378. A cromatina sexual compreende: a) o citoplasma de clulas gamticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de clulas gamticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em ncleos de hemcias humanas. d) um dos cromossomos X da mulher, que permanece condensado no ncleo das clulas, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o perodo da interfase. [D] 379. No citoplasma de clulas eucariotas, existem estruturas revestidas por unidade de membrana. Assinale a estrutura celular revestida por membrana DUPLA: a) Lisossomo b) Carioteca. c) Retculo endoplasmtico liso. d) Retculo endoplasmtico rugoso. e) Complexo golgiense. [B] 380. Um cromossomo formado por uma longa molcula de DNA associada a protenas. Isso permite afirmar que o ncleo de uma clula somtica humana em ... A... possui ... B... molculas de DNA. Qual das alternativas indica os termos que substituem corretamente as letras A e B? a) A = incio de intrfase (G1); B = 46. b) A = fim da intrfase (G2); B = 23. c) A = incio de mitose (prfase); B = 46. d) A = fim de mitose (telfase); B = 23. e) A = qualquer fase do cicio celular; B = 92. [A] 381. Os genes presentes nos cromossomos, em conjunto com fatores ambientais, determinam as caractersticas individuais dos seres vivos. Em relao a esse assunto, julgue os seguintes itens. (0) Nas regies no-homlogas dos cromossomos sexuais, intensa a atividade de recombinao gnica. (1) Gmeas univitelinas podem apresentar diferenas fenotpicas relacionadas aos genes localizados no cromossomo X. (2) Quanto maior a variabilidade gentica de uma populao, maior o nmero de genes em homozigose. (3) Cada um dos cromossomos do caritipo humano contm o mesmo nmero de genes. Item correto: 1 Itens errados: 0, 2 e 3 382. Durante a ovulognese da mulher, so produzidos dois corpsculos polares. O primeiro e o segundo corpsculos polares humanos contm, respectivamente, a) 46 cromossomos duplicados e 46 cromossomos simples. b) 46 cromossomos simples e 23 cromossomos simples. c) 23 cromossomos duplicados e 23 cromossomos simples.

d) 23 cromossomos simples e 23 cromossomos simples. e) 23 cromossomos simples e nenhum cromossomo. [C] 383. Os cromossomos so classificados de acordo com a posio do seu centrmero. Observe os esquemas anteriores e indique a classificao dos cromossomos representados.

a) Telmero, acrocntrico, metacntrico. b) Acntrico, metacntrico, mesocntrico. c) Acntrico, acrocntrico, mesocntrico. d) Telocntrico, acrocntrico e metacntrico. e) Telocntrico, submetacntrico, acrocntrico. [D] 384. O esquema anterior representa o ciclo mittico de clulas em larva de 'Drosophila' (mosca-de-fruta).

O ciclo delimitado pelo retngulo ocorre por diversas vezes seguidas durante um mesmo ciclo celular. Como conseqncia disso, a condensao cromossmica revelar a presena de um ncleo com a(o): a) metade da quantidade de material gentico do ncleo original. b) mesma quantidade de material gentico do ncleo original. c) quantidade de material gentico original multiplicada vrias vezes. d) nmero de cromossomas do ncleo original aumentado duas vezes. e) nmero de cromossomas do ncleo original reduzido metade. [C] 385. A figura anterior representa os diferentes tipos de cromossomos humanos. Os autossomos esto numerados de 1 a 22, e os cromossomos sexuais, designados por X e Y. Sendo assim, uma clula somtica do corpo de uma mulher apresenta:

a) 22 autossomos + Y c) 22 autossomos + XY e) 44 autossomos + XX [E]

b) 22 autossomos + XX d) 44 autossomos + X

386. A mosca de frutas (Drosophila melanogaster) apresenta 08 cromossomos nas clulas somticas. correto afirmar, portanto, que uma clula somtica do referido inseto apresenta

33 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) 04 cromtides em G1. b) 08 cromtides em G2. c) 32 centrmeros na metfase. d) 16 cinetcoros na prfase. [D] 387. Observe os cromossomos a seguir esquematizados.

[C] 393. Um ser vivo acelular que contm apenas um tipo de cido nuclico pode ser um a) protozorio b) fungo c) vrus d) caro e) lquen [C] 394. Entre as caractersticas biolgicas citadas a seguir, a nica pode ser encontrada nos vrus um: a) programa gentico especfico que permite a reproduo de novos seres do mesmo tipo. b) processo metablico que requer compostos nitrogenados e de carbono, incluindo os produzidos pelos auttrofos. c) maquinaria biolgica que pode utilizar a energia armazenada em sua clula ou obtida dos alimentos. d) maquinaria biossinttica para a sntese de protenas. e) membrana celular que estabelece um limite e regula as trocas de matria e energia. [A] 395. "Medicina do futuro recruta vrus "bonzinhos" para vencer cncer e AIDS atravs de batalhas genticas." Utilizando vrus inofensivos como vetores de genes, cientistas esto colocando, nas clulas dos pacientes, o material gentico que os mdicos desejam. Tal tcnica possvel, pois, na clula hospedeira, o DNA do vrus: a) inativa as diferentes funes vitais. b) comanda a produo de protenas. c) inibe a respirao celular. d) induz uma mensagem deletria. e) estimula a duplicao do DNA celular. [B] 396. Em relao AIDS (Sndrome de Imunodeficincia Adquirida), analise as proposies a seguir: 1. causada por um retrovrus. 2. Pode ser transmitida pelo leite materno das mes contaminadas pelo HIV. 3. O uso de preservativos (camisinha) durante as relaes sexuais uma das principais medidas profilticas. 4. A transmisso freqente pelo contato de mos. Considerando o estgio atual de conhecimentos, esto corretos: a) 1, 3 e 4, apenas b) 2 e 4, apenas c) 1, 2 e 3, apenas d) 2 e 3, apenas e) 1, 2, 3 e 4 [C] 397. Os vrus, apesar de no possurem organizao celular, podem ser considerados seres vivos, porque: a) so constitudos de protenas; b) possuem molculas auto-reprodutveis; c) possuem maquinaria enzimtica necessria que lhes permite a sntese das molculas, independentes de outras clulas; d) crescem e se reproduzem por processos anlogos aos das bactrias. e) todas as afirmativas anteriores esto corretas. [B] 398. Uma das estratgias mais eficientes que os rgos de sade dispem no combate s doenas infecciosas a preveno atravs da vacinao em massa da populao. Esse combate s possvel quando se conhece o agente causal da doena. Dentre as doenas ocasionadas por VRUS, podemos relacionar as seguintes: 01. Gonorria. 02. Raiva ou hidrofobia. 04. Clera. 08. Meningite meningoccica. 16. Poliomielite. 02 + 16 = 18 399. Assinale a alternativa correta a respeito dos vrus. a) Apresentam membrana plasmtica envolvendo seu material interno. b) Sintetizam cido nuclico e protenas para a sua reproduo. c) Apresentam metabolismo prprio. d) No sofrem mutao no seu material gentico. e) Possuem um nico tipo de cido nuclico que, dependendo do vrus, pode ser o DNA ou o RNA. [E] 400. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Penso que a vida resulta da combinao de quatro processos metabolismo, compartimentao, memria e manipulao - e de uma lei de correspondncia entre memria e manipulao. Se tomarmos isso como definio, os vrus no podem ser considerados seres vivos, pois no tm nem metabolismo nem lei de correspondncia. A confrontao do conceito de vida expresso anteriormente com caractersticas exibidas pelos vrus permite afirmar:

As figuras que representam, respectivamente, um conjunto diplide e o conjunto haplide correspondente so a) I e III b) I e IV c) II e III d) II e IV e) V e I [B] 388. Os cromossomos so constitudos principalmente por: a) fosfolipdeos. b) protenas. c) cido ribonuclico. d) enzimas. e) cido desoxirribonuclico. [E] 389. Ao se pesquisar a funo dos nuclolos realizaram-se experincias com uma linhagem mutante do anfbio 'Xenopus'. Verificou-se que cruzamentos de indivduos desta linhagem produziam prole com alta incidncia de morte - os embries se desenvolviam normalmente e, pouco depois da ecloso, os girinos morriam. Estudos citolgicos mostraram que os ncleos dos embries ou no apresentavam nuclolos, ou apresentavam nuclolos anormais. Conclui-se que a primeira atividade celular afetada nestes embries foi: a) o processamento do RNA mensageiro b) a produo de RNA mensageiro c) a produo de histonas d) a produo de ribossomos e) a produo de RNA polimerase [D] 390. Observe o ciclo reprodutivo da abelha domstica e assinale a alternativa CORRETA:

Os nmeros 1, 2, 3 e 4 correspondem, respectivamente, a: a) partenognese, meiose, mitose e fecundao. b) meiose, fecundao, mitose e partenognese. c) fecundao, meiose, mitose e partenognese. d) fecundao, meiose, partenognese e mitose. e) meiose, partenognese, fecundao e mitose. [D] 391. Sabe-se que o homem possui em torno de 80.000 genes, que, entre outras funes, codificam protenas. Considerando-se essa informao e conhecimento sobre o assunto, CORRETO afirmar que a) o gentipo das clulas do tecido nervoso diferente do gentipo das clulas do tecido epitelial. b) o nmero total de genes, aps a diferenciao e a especializao das clulas, reduz-se. c) os genes cuja atividade no necessria ao funcionamento de uma clula perdem a capacidade de duplicao. d) os genes responsveis pelo sistema sangneo ABO esto presentes nas clulas epiteliais, mas so incapazes de se expressar. [D] 392. Indique em qual dos seres vivos, citados a seguir, o cido desoxirribonuclico (DNA) e o cido ribonuclico (RNA) no ocorrem em um mesmo indivduo: a) bactria b) protozorio c) vrus d) fungos e) algas

34 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(01) Os vrus e os seres vivos compartilham uma mesma linguagem na construo de seus genomas. (02) Os vrus obtm energia usando os mesmos processos bioenergticos celulares. (04) A organizao molecular dos vrus expressa a exigncia de proteo para o material gentico e de reconhecimento pela clula hospedeira. (08) A universalidade do DNA como material gentico, entre os vrus, os aproxima da condio biolgica. (16) A condio vital est inevitavelmente associada estrutura celular. (32) A capacidade de evoluir uma propriedade comum aos vrus e aos seres vivos. 01 + 04 + 16 + 32 = 53 401. Impressionados com a notcia do poder arrasador com que o vrus Ebola vem dizimando uma certa populao na frica, alguns alunos de um colgio sugeriram medidas radicais para combater o vrus desta terrvel doena. Considerando-se que este agente infeccioso apresenta caractersticas tpicas dos demais vrus, assinale a alternativa que contenha a sugesto mais razovel: a) descobrir urgentemente um potente antibitico que possa destruir a sua membrana nuclear. b) alterar o mecanismo enzimtico mitocondrial para impedir o seu processo respiratrio. c) injetar nas pessoas contaminadas uma dose macia de bacterifagos para fagocitar o vrus. d) cultivar o vrus "n vitro", semelhante cultura de bactrias, para tentar descobrir uma vacina. e) impedir, de alguma maneira, a replicao da molcula de cido nuclico do vrus. [E] 402. O organismo A um parasita intracelular constitudo por uma cpsula protica que envolve a molcula de cido nuclico. O organismo B tem uma membrana lipoprotica revestida por uma parede rica em polissacardios que envolvem um citoplasma, onde se encontra seu material gentico, constitudo por uma molcula circular de DNA. Esses organismos so, respectivamente: a) uma bactria e um vrus. b) um vrus e um fungo. c) uma bactria e um fungo. d) um vrus e uma bactria. e) um vrus e um protozorio. [D] 403. Caracterstica(s) que todos os seres vivos tm, inclusive os vrus: a) metabolismo prprio e reproduo b) reproduo e mutao c) organizao celular d) ncleo com DNA e) citoplasma com ribossomos [B] 404. Qual das alternativas a seguir relaciona apenas doenas causadas por vrus: a) Febre amarela, Dengue e Sarampo. b) Malria, Catapora e Meningite. c) Gripe, Mal de Chagas e Lepra. d) Amebase, Lombriga e Amarelo. e) Elefantase, Giardase e Catapora. [A] 405. Assinale a alternativa que relaciona os seres vivos que no tem estrutura celular e, portanto, no possuem membrana plasmtica ou organides no citoplasma. a) fungos. b) algas. c) moluscos. d) vrus. e) protozorios. [D] 406. O organismo que causa o sarampo um(a): a) vrus. b) bactria. d) inseto. e) fungo. [A] c) protozorio.

a) o RNA produz um "molde" de molcula de DNA. b) o RNA, torna-se uma molcula autoduplicvel. c) o DNA possui cadeia simples sem timina. d) o DNA possui mecanismos de retroao. e) o DNA e RNA no se pareiam. [A] 408. Os itens I a VI apresentam, no necessariamente na seqncia, os passos pelos quais um vrus replicado. I. sntese das protenas do vrus. II. adeso da capa do vrus com a membrana celular. III. produo de protenas. IV. abandono da cpsula. V. liberao do vrus da clula. VI. replicao do RNA viral. Assinale a alternativa que apresenta todos esses passos na seqncia correta. a) II - IV - I - VI - III - V. b) VI - IV - I - III - V - II. c) II - VI - IV - III - I - V. d) V - II - I - IV - VI - III. e) II - IV - VI - I - III - V. [E] 409. caracterstica do ciclo reprodutivo de um bacterifago a: a) penetrao por inteiro na clula hospedeira. b) injeo do material gentico, RNA, no interior da clula hospedeira. c) injeo do material gentico, DNA, no interior da clula hospedeira. d) reproduo sexuada denominada conjugao. e) reproduo assexuada denominada diviso binria. [C] 410. Os vrus so minsculos "piratas" biolgicos porque invadem as clulas, saqueiam seus nutrientes e utilizam as reaes qumicas das mesmas para se reproduzir. Logo em seguida os descendentes dos invasores transmitemse a outras clulas, provocando danos devastadores. A estes danos, d-se o nome de virose, como a raiva, a dengue hemorrgica, o sarampo, a gripe, etc. (Texto modificado do livro "PIRATAS DA CLULA", de Andrew Scott.) De acordo com o texto, correto afirmar: a) Os vrus utilizam o seu prprio metabolismo para destruir clulas, causando viroses. b) Os vrus utilizam o DNA da clula hospedeira para produzir outros vrus. c) Os vrus no tem metabolismo prprio. d) As viroses resultam sempre das modificaes genticas da clula hospedeira. e) As viroses so transcries genticas induzidas pelos vrus que degeneram a cromatina na clula hospedeira. [C] 411. Os vrus so entidades que s apresentam propriedades de vida quando esto no interior de clulas vivas. Fora delas, deixam de apresentar tais propriedades e podem at cristalizar-se, como os minerais. Os vrus so importantes agentes causadores de doenas humanas, dentre as quais podem apontar: a) AIDS, sarampo e difteria. b) sarampo, catapora e herpes. c) clera, febre amarela e ttano. c) febre amarela, sarampo e ttano. e) disenteria bacilar, hansenase e poliomielite. [B] 412. correto dizer: a) A membrana plasmtica uma estrutura lipo-protica presente em todos os tipos celulares e funciona como uma barreira seletiva entre o citoplasma e o ncleo. b) O controle do metabolismo celular embasado pela sntese de DNA, pelo RNA, tendo como conseqncia, a sntese protica. c) O ncleo uma estrutura revestida por envoltrio nuclear, presente tanto em organismos procariontes como eucariontes. d) Os vrus so constitudos de uma cpsula protica e de um cido nuclico e, para multiplicarem-se precisam de hospedeiro.

407. O vrus da AIDS formado por uma cpsula esfrica contendo em seu interior o material gentico. Este tipo de vrus chamado RETROVRUS porque:

35 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) Pentoses e hexoses so monossacardeos e, como exemplo, podemos citar a glicose e a ribose, respectivamente. [D] 413. Pesquisadores tm procurado isolar o vrus da gripe espanhola que, em 1918, matou mais de 20 milhes de pessoas. O trabalho est sendo realizado em um cemitrio de Spitzberg, numa ilha da Noruega, a pouco mais de um quilmetro do Plo Norte. O conhecimento desse vrus um caminho importante para o desenvolvimento de mtodos de preveno para novos casos de epidemias virticas. Assinale a opo que apresenta uma caracterstica dos vrus, a qual permite sua existncia aps tantas dcadas transcorridas. a) Esses organismos apresentam DNA ou RNA como material gentico. b) Fora de uma clula viva os vrus podem ser cristalizados. c) Os vrus apresentam um capsdeo protico envolvendo o material gentico. d) Os vrus tm capacidade de reduzir seu metabolismo. e) Os vrus promovem a decomposio lenta dos cadveres em solos gelados. [B] 414. "Os cientistas examinaram 11 homens aidticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes apresentavam novas mutaes do vrus, resistentes s drogas ministradas e passveis de serem transmitidas a outras pessoas." De acordo com o texto, o vrus HIV a) somente sofreu mutao nos homens que tomaram medicamentos antivirais. b) no sofreu mutao nos homens que nunca usaram medicamentos antivirais. c) sofreu mutao nas pessoas que tomaram ou no medicamentos antivirais. d) foi completamente destrudo pela ao dos medicamentos antivirais. e) facilmente destrudo pela ao de mutantes produzidos por medicamentos antivirais. [C] 415. "Os cientistas examinaram 11 homens aidticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes apresentavam novas mutaes do vrus, resistentes s drogas ministradas e passveis de serem transmitidas a outras pessoas." Pela anlise do texto, pode-se concluir que a fabricao da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. b) s pode ser feita contra as formas mutantes do HIV. c) precisa ser feita contra a forma normal do HIV. d) fcil de ser efetuada, tendo em vista a estabilidade do HIV. e) certamente dever estar no mercado dentro de pouco tempo. [A] 416. Relativamente aos vrus afirma-se, corretamente, que: a) No caso dos retrovrus, que causam diversos tipos de infeces, a enzima transcriptase reversa catalisar a transformao do DNA viral em RNA mensageiro. b) Em qualquer infeco viral, o cido nuclico do vrus tem a capacidade de se combinar quimicamente com substncias presentes na superfcie das clulas, o que permite ao vrus reconhecer e atacar o tipo de clula adequado a hosped-lo. c) No caso dos vrus que tm como material gentico o DNA, este ser transcrito em RNA mensageiro, que comandar a sntese de protenas virais. d) Em qualquer infeco viral, indispensvel que o capsdeo permanea intacto para que o cido nuclico do vrus seja transcrito. e) Em todos os vrus que tm como material gentico o RNA, este ser capaz de se duplicar sem a necessidade de se transformar em DNA, originando vrias cpias na clula hospedeira. [C] 417. Existe uma srie de caractersticas que distinguem os seres vivos da matria bruta. Analise as caractersticas a seguir e, depois, assinale aquelas caractersticas que so exclusivas dos seres vivos: I- metabolismo II- ausncia de molculas III- reproduo IV- material gentico Esto CORRETAS: a) apenas I e III b) I, II e IV c) I, III e IV d) II, III e IV e) apenas III e IV [C] 418. Caracterstica(s) que todos os seres vivos tm, inclusive os vrus: a) metabolismo prprio e reproduo b) reproduo e mutao c) organizao celular d) ncleo com DNA e) citoplasma com ribossomos [B]

419. Uma clula procarionte se diferencia de uma clula eucarionte pela ausncia de: a) DNA b) Carioteca c) Citoplasma d) Membrana Plasmtica e) Ribossomos [B] 420. Todos os seres vivos (exceto os vrus) so formados por clulas. De acordo com o tipo estrutural de clulas que os compem, os organismos podem ser classificados em eucariontes ou procariontes. Assinale a alternativa correta. a) Os protozorios e as bactrias possuem clulas eucariticas. b) Os fungos (bolores e leveduras) possuem clulas eucariticas. c) Os fungos e as bactrias possuem clulas procariticas. d) As bactrias e as algas possuem clulas eucariticas. e) As bactrias e os protozorios possuem clulas procariticas. [B] 421. Assinale a opo que contm as estruturas presentes tanto em clulas vegetais quanto em clulas animais. a) Membrana plasmtica, parede celular e citoplasma. b) Retculo endoplasmtico, mitocndrias e Complexo de Golgi. c) Plastdeos, lisossomos e centrolos. d) Vacolos, cariomembrana e lisossomos. e) Cromossomos, cariomembrana e plastdeos. [B] 422. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos.Das caractersticas apresentadas a seguir, selecione aquelas que so comuns tanto a bactria como a clulas vegetais e animais. 01) Presena de parede celular rgida. 02) Material gentico constitudo por DNA. 04) Presena de retculo endoplasmtico e complexo de Golgi. 08) Presena de membrana plasmtica. 16) Utilizao de oxignio como principal fonte de obteno de energia qumica. 32) Presena de ribossomas. 64) Vida livre. Soma = ( ) 02 + 08 + 32 = 42 423. Os protistas so seres vivos que podem ser encontrados em toda parte, na terra e na gua, assim como no interior de outros organismos, onde atuam como parasitas ou simbiontes. Sobre eles so feitas as afirmaes a seguir: I. Cada protista consiste de uma nica clula procaritica, na qual o material hereditrio se encontra mergulhado diretamente no lquido citoplasmtico. II. Algumas formas parasticas de protistas provocam doenas bastante conhecidas, como malria, febre amarela e ttano. III. O Reino Protista engloba seres vivos exclusivamente hetertrofos, pluricelulares, que se alimentam por absoro de nutrientes do meio. IV. As bactrias e muitos protistas atuam na digesto da celulose no interior do trato digestivo dos animais ruminantes, como cabras, bois, carneiros, veados e girafas. Dentre essas afirmaes, somente a) I e II esto corretas. b) I e III esto corretas. c) II e III esto corretas. d) III e IV esto corretas. e) IV est correta. [E] 424. "Derrubamos a grande barreira que separava os reinos animal e vegetal: a clula a unidade da matria viva." Essa afirmativa foi feita por cientistas ao descobrirem, em 1839, aquilo que lrios, guas-vivas, gafanhotos, minhocas, samambaias e humanos tm em comum. Pode-se dizer que todas as clulas dos seres acima citados tm as seguintes caractersticas: a) centrolo e lisossomo b) parede celular e mesossomo c) ncleo individualizado e mitocndria d) material nuclear disperso e cloroplasto [C] 425. Durante a evoluo celular surgiram subdivises membranosas, originando organelas, tais como lisossomos e peroxissomos, nas quais um conjunto de enzimas opera sem a interferncia das demais reaes que ocorrem em outros compartimentos internos. A clula assim formada constitui o corpo de: a) arqueobactrias. b) eubactrias. c) cianobactrias. d) micoplasmas. e) eucariontes. [E] 426. Assinale o elemento que NO um componente de uma clula eucariota hetertrofa: a) Carioteca. b) Mitocndria. c) Cloroplasto.

36 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) DNA. [C]

e) RNA.

427. Em cianofceas, ou cianobactrias, no se conhece nenhum processo de reproduo sexuada. Nesse grupo a variabilidade gentica causada especialmente por: a) recombinao gentica b) mutao c) permutao d) conjugao e) cruzamentos seletivos [B] 428. Os procariontes diferenciam-se dos eucariontes porque os primeiros, entre outras caractersticas: a) no possuem material gentico. b) possuem material gentico como os eucariontes, mas so anucleados. c) possuem ncleo, mas o material gentico encontra-se disperso no citoplasma. d) possuem material gentico disperso no ncleo, mas no em estruturas organizadas denominadas cromossomos. e) possuem ncleo e material gentico organizado nos cromossomos. [C] 429. A clula bacteriana no possui: a) membrana plasmtica b) parede celular d) nucleide e) ribossomos [C] 430. Observe o esquema a seguir. c) ncleo

02. Zoologia - estudo dos vegetais. 04. Botnica - estudo dos animais. 08. Citologia - estudo das clulas. 16. Histologia - estudo dos tecidos. 32. Anatomia - estudos dos fungos. Soma ( ) 01 + 08 + 16 = 25 436. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Um dos maiores cientistas de todos os tempos, Louis Pasteur (18221895), foi um pioneiro. Em 1995, ele foi homenageado pela comunidade cientfica mundial, por ocasio do centenrio de sua morte. Destacam-se como contribuies de Pasteur: - "Nada existe no ar, capaz de gerar, a no ser os germes, que este mesmo ar carrega." (Pasteur, apud CINCIA HOJE, p. 10.) - "Muitas doenas de plantas e animais so causadas pela invaso de germes. - As perdas na indstria do vinho, por sua transformao em vinagre, na Frana do sculo XIX, eram causadas por bactrias. - O aquecimento moderado, por um determinado perodo de tempo, eliminava microorganismos que contaminavam o vinho e a cerveja. - A mortalidade causada por infeces ps-operatrias foi drasticamente diminuda com o uso de processos de esterilizao. - A imunidade clera das galinhas, ao carbnculo e raiva pde ser alcanada, atravs da injeo de vrus artificialmente atenuados. Entre as repercusses do trabalho de Pasteur no campo da Biologia Celular, pode-se citar: (01) A reproduo celular um dos atributos que definem a condio vital. (02) Microorganismos causadores de doenas limitam-se categoria das clulas eucariticas. (04) Variaes trmicas so insuficientes para provocar alteraes em processos celulares de microorganismos. (08) O sucesso dos procariotos, na contaminao do vinho, se relaciona simplicidade do seu processo reprodutivo. (16) Vinho e vinagre so produtos de atividade biolgica, envolvendo sistemas enzimticos correlacionados. (32) As clulas procariticas e eucariticas se diferenciam basicamente pelos mecanismos de obteno de energia. (64) As clulas so capazes de responder de modo a neutralizar o efeito de um agente infeccioso. Soma ( 16 437. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. A figura a seguir ilustra possveis conseqncias do uso indiscriminado de antibiticos no combate a infeces bacterianas. )

Ele representa a) uma bactria. b) um protozorio. d) uma clula animal. [A]

c) um fungo. e) uma clula vegetal.

431. Entre os vrios grupos de microrganismos existe um que representado por seres unicelulares procariontes que podem ser utilizados na produo industrial de insulina humana. Esse grupo constitudo por a) bactrias. b) bacterifagos. c) fungos. d) protozorios. e) vrus. [A] 432. A pasteurizao, tcnica de esterilizao parcial de alimentos, como o leite e os sucos industrializados, consiste em a) aquecer a mais de 200C, durante 15 minutos, para destruir esporos e fungos. b) aquecer at 75C e resfriar bruscamente, entre 0 e 2C, visando eliminar bactrias patognicas. c) resfriar a 0C, durante 15 horas, que resultar em morte de todos os tipos de vrus. d) transformar o lquido em pasta, por centrifugao contnua e resfriada, para desnaturar protenas txicas. e) utilizar conservantes bactericidas e fungicidas os quais no alteram o sabor. [B] 433. Uma clula bacteriana no possui: a) material hereditrio e carioteca. b) parede celular e centrolo. c) ribossomas e dictiossoma. d) membrana plasmtica. e) nuclolo e carioteca. [E] 434. Comparando uma clula procaritica com clulas eucariticas vegetal e animal, em comum as trs apresentam: a) mitocndrias, centrolos e flagelos b) membrana plasmtica, ribossomos e cromatina c) membrana esqueltica, ribossomos e cromatina d) parede celular celulsica, membrana plasmtica e lisossomos e) membrana esqueltica, membrana plasmtica e cromatina [B] 435. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos.A biologia uma das cincias naturais e estuda os fenmenos relativos vida. Assinale as proposies que apresentam associaes CORRETAS entre os ramos da biologia e os seus objetos de estudo. 01. Gentica - estudo da hereditariedade.

Em relao ao aspecto da biologia bacteriana esquematizada em B e suas conseqncias, pode-se afirmar: (01) A conjugao um processo que exige o contato celular entre os organismos conjugantes. (02) A recombinao gentica um atributo prprio de clulas eucariticas. (04) A transferncia de material gentico entre os conjugantes unidirecional. (08) A importncia evolutiva da conjugao se expressa no aumento do potencial de adaptao, em bactrias. (16) A transferncia de material gentico, na conjugao, se caracteriza como um processo de reproduo sexuada. (32) A conjugao pode ser um mecanismo de transmisso da mensagem que condiciona a resistncia. Soma ( ) 01 + 08 + 16 = 25 438. Existe uma srie de caractersticas que distinguem os seres vivos da matria bruta. Analise as caractersticas a seguir e, depois, assinale aquelas caractersticas que so exclusivas dos seres vivos: I- metabolismo II- ausncia de molculas

37 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

III- reproduo IV- material gentico Esto CORRETAS: a) apenas I e III b) I, II e IV d) II, III e IV e) apenas III e IV [C] c) I, III e IV

64) Vida livre. Soma = ( ) 02 + 08 + 32 = 42 446. Um cientista, ao descobrir um novo ser vivo, teve como incumbncia classific-lo de acordo com o sistema de Lineu. O ser foi ento classificado como: MONERA - SCHYZOPHYTA - AUTOTRFICO Ele chegou a tal concluso por se tratar de um organismo: a) procarionte, unicelular, de reproduo predominantemente assexuada e capaz de realizar fotossntese. b) procarionte, unicelular, de reproduo predominantemente sexuada e que retira a molcula orgnica j digerida do ambiente. c) procarionte, unicelular, sem parede celular, de respirao anaerbica facultativa. d) eucarionte, unicelular, com parede celular, de respirao anaerbica e quimiossintetizantes. e) eucarionte, pluricelular, com parede celular, de reproduo predominantemente assexuada e capaz de realizar fotossntese. [A] 447. Assinale a alternativa correta. a) As bactrias reproduzem-se, geralmente, por diviso binria, uma forma assexuada de reproduo pela qual uma nica bactria pode originar um "clone", ou seja, uma populao de bactrias idnticas. b) As bactrias e as algas cianofceas distinguem-se de todos os outros seres vivos porque no possuem carioteca envolvendo o material nuclear, isto , so eucariontes. c) As bactrias s vivem isoladas, embora prximas; nunca formam colnias. d) Em algumas espcies de bactrias observa-se o fenmeno da conjugao, isto , um tipo de reproduo assexuada. e) As algas cianofceas assemelham-se s bactrias, porm so hetertrofas, isto , produzem a matria orgnica por fotossntese. [A] 448. Entre as doenas sexualmente transmissveis, so causadas por bactrias a) a sfilis, a gonorria e a pediculose pubiana. b) o cancro mole, a tricomonase e a gonorria. c) o condiloma acuminado, a sfilis e a AIDS. d) a sfilis, o cancro mole e a gonorria. e) a pediculose pubiana, a tricomonase e a AIDS. [D] 449. Sobre as cianofceas, INCORRETO afirmar que: a) no possuem ncleo individualizado. b) possuem clorofila como pigmento fotossintetizante. c) possuem cromoplastos. d) a reproduo somente assexuada. e) so unicelulares ou coloniais. [C] 450. Um gene de bactria com 600 pares de bases nitrogenadas produzir uma cadeia polipeptdica com nmero de aminocidos aproximadamente igual a a) 200 b) 300 c) 600 d)1200 e)1800 [A] 451. Uma anomalia gentica autossmica recessiva condicionada por uma alterao na seqncia do DNA. Um homem portador dessa anomalia apresenta a seqncia timina-citosina-timina enquanto sua mulher, que normal, apresenta a seqncia timina-adenina-timina. A anlise do DNA de um filho do casal mostrou que ele portador tanto da seqncia de bases do pai quanto da me. a) O filho ter a doena? Por que? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqncias iguais da me? a) No porque a seqncia herdada do pai recessiva em relao materna. b) A probabilidade de uma outra criana desse casal herdar as duas seqncias maternas zero porque na fecundao h unio das seqncias paterna e materna. 452. Considere um fragmento de DNA com a seguinte seqncia de bases: GTAGCCTAG e responda: a) Qual ser a seqncia do RNAm transcrito a partir deste DNA? b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar? Explique. a) CAU CGG AUC b) Somente se formar o mesmo peptdeo se os cdons transcritos partir da fita complementar especificarem os mesmos aminocidos, devido degenerao do cdigo gentico. 453. A estrutura qumica de uma protena poder ser modificada se a) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma celular. b) durante sua sntese houver variao dos tipos de RNA transportadores.

439. O esquema a seguir representa um experimento sobre a influncia de solues bactericidas de diferentes concentraes (A, B, C D) e seu efeito sobre populaes de bactrias. As reas claras do esquema representam o espectro de ao de cada uma das solues, indicadas pela respectiva letra. Assinale a alternativa CORRETA.

Analisando o esquema, possvel concluir que a ao bactericida de: a) A < B > C > D b) A > B > C > D c) A = C > B > D d) A < C < B < D e) A = D < B = C [D] 440. Qual das caractersticas a seguir NO corresponde s bactrias: a) So seres unicelulares. b) So seres eucariontes.. c) Algumas so patognicas. d) Algumas vivem em colnias. e) A reproduo assexuada feita por diviso binria. [B] 441. Seres de organizao celular muito simples, com ncleo no organizado, causadores das infeces e que se encontram por toda parte so: a) algas. b) protozorios. c) vrus. d) fungos. e) bactrias. [E] 442. Bactrias e Cianofceas (ou Cianobactrias) so seres vivos unicelulares e procariontes porque: a) podem causar doenas no homem e nos animais, possuem membrana plasmtica e membrana nuclear. b) so constitudos por uma clula apenas, no possuem membrana plasmtica e possuem membrana nuclear. c) so constitudos por uma clula apenas, possuem membrana plasmtica e no possuem membrana nuclear. d) so constitudos por uma clula apenas e podem formar colnias. e) No formam colnias e podem causar doenas no homem e nos animais. [C] 443. Nas bactrias, o MESOSSOMO apresenta uma coleo enzimtica responsvel por um processo que tambm ocorre: a) nas lamelas dos cloroplastos. b) na membrana do retculo endoplasmtico rugoso. c) no nuclolo. d) no complexo de Golgi. e) nas cristas mitocondriais. [E] 444. Est presente na clula bacteriana: a) aparelho de Golgi. b) carioteca. d) retculo endoplasmtico. e) ribossomo. [E] c) mitocndria.

445. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos.Das caractersticas apresentadas a seguir, selecione aquelas que so comuns tanto a bactria como a clulas vegetais e animais. 01) Presena de parede celular rgida. 02) Material gentico constitudo por DNA. 04) Presena de retculo endoplasmtico e complexo de Golgi. 08) Presena de membrana plasmtica. 16) Utilizao de oxignio como principal fonte de obteno de energia qumica. 32) Presena de ribossomas.

38 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) sua sntese ocorrer no complexo de Golgi e no no retculo endoplasmtico rugoso. d) uma base prica substituir uma pirimdica no RNA mensageiro que a codifica. e) o DNA no se duplicar durante a intrfase. [D] 454. Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqncia de bases TACTCCGCTTAG e, em sua cadeia complementar, a seqncia ATGAGGCGAATC, quais so as seqncias de bases de RNAm por ele produzido? AUG AGG CGA AUC e UAC UCC GCU UAG 455. Que papis desempenham o RNA mensageiro e do RNA transportador no processo de sntese das protenas? RNA mensageiro - determina a ordem dos aminocidos na cadeia polipeptdica RNA transportador - ativao e transporte de aminocidos para os ribossomos no processo de sntese protica 456. Quais so as duas propriedades fundamentais do DNA que permitem a essa substncia desempenhar o papel de material gentico? REPLICAO para que possa ser transmitido descendncia e TRANSCRIO, ou produo do RNA, para controlar as atividades celulares atravs da sntese de protenas. 457. Porque o processo de replicao do DNA chamada semiconservativa? A replicao do DNA sempre CONSERVA, nas molculas-filhas, metade da molcula-me. 458. Os cdons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminocidos arginina, leucina e treonina. Escreva esses aminocidos na ordem correspondente seqncia TGA - TCT - GAC de um segmento de DNA. Treonina - Arginina - Leucina 459. A substituio de uma nica base na molcula de DNA leva necessariamente substituio de um aminocido na protena a ser sintetizada pela clula. Certo ou errado? Justifique. No. O cdigo gentico degenerado, ou seja, diferentes trincas podem especificar o mesmo aminocido na sntese das protenas celulares. 460. Qualquer alterao no DNA pode modificar o funcionamento de uma clula? Justifique. No necessariamente, pois a substituio de bases nitrogenadas na cadeia do DNA poder determinar os mesmos aminocidos, na mesma ordem, em uma protena, j que o cdigo gentico degenerado. 461. Quais os papis do gene e do ribossomo na sntese das protenas celulares? O gene (cstron) determina a ordenao dos aminocidos das protenas produzidas em uma clula. Os ribossomos fazem a traduo do cdigo gentico do DNA atravs da leitura do RNA mensageiro. 462. Dada a seqncia de bases nitrogenadas de um segmento de DNA: AATGGCATC, responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? a) TTACCGTAG b) UUACCGUAG 463. Dado um segmento de RNA mensageiro com a seguinte seqncia de bases: AAUGUAGGC, pergunta-se: a) Qual a seqncia de bases do DNA que deu origem a esse RNA? b) Quantos aminocidos ter o polipeptdeo traduzido, no ribossomo, a partir desse RNA? a) TTA CAT CCG b) trs 464. Dada a seqncia de bases nitrogenadas de um segmento de DNA a seguir, responda aos itens adiante. TTTAATGGGCAT a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? a) AAATTACCCGTA b) AAAUUACCCGUA 465. Considere as seguinte tabela que indica seqncias de bases do RNA mensageiro e os aminocidos por elas codificados. Com base na tabela fornecida e considerando um segmento hipottico de DNA, cuja seqncia de bases AAGTTTGGT, qual seria a seqncia de aminocidos codificada? 1) cido fosfrico 2) Desoxirribose 3) Base nitrogenada 469. O que so cidos nuclicos? Como atuam na sntese de protenas? So molculas (DNA e RNA) que comandam, atravs da sntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a traduo do cdigo gentico em uma protena. 470. Em um segmento de DNA que codifica determinada protena, considere duas situaes: a) um nucleotdeo suprimido; b) um nucleotdeo substitudo por outro. A situao "a", geralmente, mais drstica que a situao "b". Explique por qu. A supresso de um nucleotdeo pode causar completa ou incompletamente a descodificao da seqncia de bases do DNA provocando alteraes na protena correspondente ao cdigo alterado. Uma substituio no necessariamente altera o fentipo por causa da degenerao do cdigo gentico. 471. Recentemente, os meios de comunicao noticiaram o caso de uma mulher norte-americana que, impossibilitada de ter filhos por anomalia no tero, teve seu vulo fertilizado "in vitro", e este foi implantado no tero de sua me. Assim, quem engravidou e deu luz foi a me da referida mulher. Responda: a) Do ponto de vista gentico, quem a me da criana? Justifique. a) Aspargina, leucina, valina. b) Aspargina, lisina, prolina. c) Fenilalanina, lisina, prolina. d) Fenilalanina, valina, lisina. e) Valina, lisina, prolina. [C] 466. No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? Justifique sua resposta. Na fita dever existir 18% de guanina, 32% de adenina e 32% de timina. O DNA formado por uma dupla cadeia de polinucleotdeos. Sabendo-se que as cadeias so complementares e o pareamento sempre adenina com timina e citosina com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser igual a de timina. 467. No caracterstica do DNA: a) o acar com cinco tomos de carbono. b) a presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) a presena de cido fosfrico. d) polinucleotdeo. e) ocorre nos cromossomos. [B] 468. Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.

39 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimnio gentico da criana? a) A mulher que no podia engravidar porque foi a doadora do vulo implantado em sua me. b) Em mdia 25% dos genes seriam herdados da av parturiente. 472. Uma alterao no DNA pode modificar o funcionamento de uma clula. Por qu? O DNA comanda, atravs da sntese de enzimas, todo o metabolismo celular. Uma alterao no DNA pode provocar modificaes nas enzimas e consequentemente nas reaes qumicas da clula. 473. Certos mutantes nutricionais do fungo Neurospora s conseguem crescer quando aminocidos so adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausncia de crescimento.

d) bases da molcula de RNA - transportador. e) bases da molcula de RNA ribossmico [C] 480. Importante informao que permitiu o estabelecimento de um modelo para a molcula de DNA foi a verificao de que o nmero de adenina nucleotdeos era sempre igual ao de timina nucleotdeos, o mesmo ocorrendo com a guanina e citosina nucleotdeos. O fato nos permite afirmar que os nucleotdeos a) ocorrem em igual quantidade. b) ocorrem aos pares na molcula de DNA. c) pricos pareiam com outros pricos. d) pirimdicos pareiam com outros pirimdicos. e) ligam-se como se fossem o corrimo de uma escada. [B] 481. Uma molcula de RNAmensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUUGUGCCCAAC. Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA. a) AAACACGGGTTG b) TTTCACGGGUUG c) AAACTCGGGTTG d) TTTGAGGGGTTG e) AAACACCCCUUG [A] 482. Na figura a seguir que representa o modelo da molcula de DNA os nmeros 1, 2 e 3 indicam, respectivamente

Sabe-se que as etapas que levam sntese da arginina so: substrato (gene1) ornitina (gene2) citrulina (gene3) arginina Supondo que em cada mutante h apenas um gene alterado, explique o porqu do mutante Z s crescer quando se adiciona arginina ao meio de cultura. Cada mutante possui um gene alterado. Z s cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta alterao 474. Um antibitico que atue nos ribossomos mata: a) bactrias por interferir na sntese de protenas. b) bactrias por provocar plasmlise. c) fungos por interferir na sntese de lipdios. d) vrus por alterar DNA. e) vrus por impedir recombinao gnica. [A] 475. De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas? O DNA um polinucleotdeo capaz de produzir o RNA mensageiro. Cada trs nucleotdeos (cdon) do RNAm ser traduzido por um aminocido ao nvel dos ribossomos. 476. Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma inativao na Regio Organizadora do Nuclolo? Justifique. a) Transcrio no ncleo ao nvel dos cromossomos e traduo no citoplasma ao nvel dos ribossomos. b) Sem a regio organizadora do nuclolo no haver RNA ribossmico, matria prima para a produo destes organides e, consequentemente, cessar a sntese de protenas na clula. 477. Organelas citoplasmticas que contm DNA: a) mitocndria e ribossomo. b) mitocndria e cloroplasto. c) nuclolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. [B] 478. A engenharia gentica permitiu a introduo, em ratos, do gene humano para produo do hormnio de crescimento, levando produo de ratos gigantes. Estes ratos so considerados a) isognicos. b) transgnicos. c) infectados. d) mutantes. e) clones. [B] 479. A seqncia de aminocidos de uma protena determinada pela seqncia de a) pentoses da molcula de DNA. b) pentoses da molcula de RNA - mensageiro. c) bases da molcula de DNA. a) desoxirribose, cido fosfrico e base nitrogenada. b) cido fosfrico, desoxirribose e base nitrogenada. c) ribose, cido fosfrico e base nitrogenada. d) cido fosfrico, ribose e base nitrogenada. e) cido fosfrico, base nitrogenada e desoxirribose. [C] 484. Numa molcula de DNA, a quantidade de a) adenina igual a de citosina. b) citosina igual a de timina. c) guanina igual a de citosina. d) citosina igual a de adenina. e) adenina igual a de uracila. [C] 485. Griffth em 1928 descobriu que pneumococos sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias. Nesse extrato o agente transformante era a) o cido ribonuclico. b) o cido indolilactico. a) desoxirribose, cido fosfrico e base nitrogenada. b) cido fosfrico, desoxirribose e base nitrogenada. c) ribose, cido fosfrico e base nitrogenada. d) cido fosfrico, ribose e base nitrogenada. e) cido fosfrico, base nitrogenada e desoxirribose. [B] 483. Na figura a seguir que representa o modelo da molcula de RNA os nmeros 1, 2 e 3 indicam, respectivamente

40 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) o cido desoxirribonuclico. d) uma enzima. e) uma protena. [C] 486. Para funcionar como material gentico o cido desoxirribonuclico (DNA) apresenta a capacidade de autoduplicao. Utilizando seus conhecimentos sobre o material gentico, responda: a) Qual a importncia de o DNA autoduplicar-se? b) Por que essa replicao semiconservativa? a) Os genes so constitudos por DNA e se duplicam para que possam ser transmitidos da clula-me para as clulas-filhas durante as divises celulares e tambm descendncia dos seres vivos. b) A replicao semiconservativa porque as molculas-filhas produzidas sempre conservam metade da molcula-me. 487. No DNA de um organismo, 20% das bases nitrogenadas so constitudas por adenina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? Timina = 20%, Guanina = 30% e Citosina = 30% 488. Ribossomos so formados por RNA e protenas, sintetizados pelos processos de TRANSCRIO E TRADUO, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma destruio do(s) nuclolo(s) de uma clula?. a) ncleo e ribossomos. b) cessa o processo de traduo. 489. Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e ribonuclico (RNA) pode-se afirmar que a) timina uma base nitrogenada exclusiva do RNA. b) uracila uma base nitrogenada exclusiva do DNA. c) ribose um acar que entra na composio qumica do RNA. d) cido fosfrico s entra na composio qumica do DNA. e) timina pareia com adenina no RNA. [C] 490. Mencione duas diferenas de natureza molecular entre o DNA e o RNA. O DNA um polinucleotdeo formado por uma dupla hlice, contm a pentose desoxirribose e Timina como base pirimidica exclusiva. No RNA observa-se uma hlice simples contendo nucleotdeos com ribose e como base pirimidica exclusiva encontramos a Uracila. 491. Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicao do DNA. As molculas-filhas sempre conservam metade da molcula-me 492. O que so NUCLEOTDEOS? Quais so as molculas que entram em sua composio qumica? Unidades estruturais dos cidos nuclicos (DNA e RNA). Constitudos por cido fosfrico + acar + base nitrogenada 493. Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? DNA - Desoxirribose (pentose) e Timina (base nitrogenada exclusiva) RNA - Ribose (pentose) e Uracil (base nitrogenada exclusiva) 494. O que representa o desenho a seguir? Qual o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do cido desoxirribonuclico (DNA). a) Quais so as molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do cido ribonuclico (RNA). b) Qual o nome dessa unidade estrutural? a) (1) = cido fosfrico, (2) = ribose, (3) = base nitrogenada b) nucleotdeo 496. No desenho a seguir que representa a estrutura da molcula de DNA, o que representam os nmeros 1, 2 e 3, respectivamente?

1 - fosfato (PO4--) 2 - desoxirribose 3 - base nitrogenada 497. Molculas de DNA constitudas por duplo filamento helicoidal mantm as cadeias unidas entre si por a) ligaes covalentes. b) ligaes inicas. c) pontes de hidrognio. d) pontes de nitrognio. e) ligao metlica. [C] 498. Sobre o DNA, INCORRETO afirmar que a) possui a base nitrogenada uracila. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo. d) integrante dos genes e dos cromossomos. e) formado de dupla cadeia com formato helicoidal. [A] 499. Sobre o DNA, CORRETO afirmar que a) possui a base nitrogenada uracila. b) no origina o RNA mensageiro c) no capaz de replicar-se. d) integrante do nuclolo e dos ribossomos. e) formado de dupla cadeia com formato helicoidal. [E] 500. Sobre o RNA, INCORRETO afirmar que a) possui a base nitrogenada uracila. b) participa da estrutura dos ribossomos. c) reproduz-se de modo semiconservativo. d) traduzido em protenas nos ribossomos. e) formado de simples cadeia com formato helicoidal. [C] 501. O DNA e o RNA quanto sua estrutura qumica, so classificados como a) polipeptdeos. b) nucleoprotenas. c) polissacardeos. d) fosfatdeos. e) polinucleotdeos. [E] 502. Qual das seguintes bases nitrogenadas NO entra na composio qumica do DNA? a) Timina. b) Citosina. c) Adenina. d) Uracila. e) Guanina. [D]

1 - cido fosfrico 2 - acar desoxirribose 3 - base nitrogenada (Adenina, Guanina, Citosina ou Uracila) 495. Observe o esquema adiante e responda:

41 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

503. Qual das seguintes bases nitrogenadas NO entra na composio qumica do RNA? a) Timina. b) Citosina. c) Adenina. d) Uracila. e) Guanina. [A] 504. Qual das seguintes molculas NO entra na composio qumica do DNA? a) Ribose. b) Desoxirribose. c) cido fosfrico. d) Adenina. e) Guanina. [A] 505. Qual das seguintes molculas NO entra na composio qumica do RNA? a) Ribose. b) Desoxirribose. c) cido fosfrico. d) Adenina. e) Guanina. [B] 506. Se um segmento de DNA possui a seqncia de bases nitrogenadas TTA CCG ATT ATG, pode-se afirmar que a cadeia complementar a esse segmento ter a seqncia a) AAT GGC TAA TAC. b) UUT GGC TUU UAC. c) TTA CCG ATT ATG. d) AAT GGC TAA UAC. e) AAU GGC UAA UAC. [A] 507. Dado um segmento de RNA com a seguinte seqncia de bases nitrogenadas: UUA UUU GGC UCC, pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. b) AAT AAA GGC UCC. c) AAT AAA CCG AGG. d) TTA TTT CCG AGG. e) AAU AAA CCG AGG. [C] 508. Uma molcula de DNA contm 15% de Guanina. Que outras bases nitrogenadas possui essa molcula e em que propores? Segundo a relao de Chargaff (A + G = T + C), pode-se concluir que as outras bases so: Citosina (C) = 15%, Adenina (A) = 35%, Timina (T) = 35%. 509. Uma cadeia de RNA tem 200 nucleotdeos. Quantos nucleotdeos tinha o DNA que originou esse RNA? 400 nucleotdeos porque o DNA constitudo por duas cadeias complementares e apenas uma cadeia com 200 nucleotdeos serviu de molde para a produo de RNA. 510. Um ser vivo acelular que contm apenas um tipo de cido nuclico pode ser um a) protozorio b) fungo c) vrus d) caro e) lquen [C] 511. Os cidos nuclicos so macromolculas definidas como polinucleotdeos. a) Represente um nucleotdeo apontando seus trs constituintes moleculares. b) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? a) Observe a figura a seguir:

Timina = 21% Guanina = 29% Citosina = 29% 514. Considere um segmento de DNA com a seguinte seqncia de bases nitrogenadas: ATT CTA CGC AAA GGC a) Quais so as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produo de RNA, qual ser a seqncia de bases desse RNA? a) TAA GAT GCG TTT CCG b) UAA GAU GCG UUU CCG 515. Um segmento de RNA mensageiro apresenta a seqncia de bases nitrogenadas a seguir: AAA UUC GGG GAU. a) Quais so as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotdeos existem no DNA que deu origem a essa molcula de RNA mensageiro? a) TTT AAG CCC CTA b) 12 nucleotdeos. 516. Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqncia de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as seqncias de bases do RNA por ele produzido? UGA GGC GAA e ACU CCG CUU 517. Dada a seqncia de bases nitrogenadas de um segmento de DNA = AAAGGCATT, responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? a) TTT CCG TAA b) UUU CCG UAA 518. No DNA de um organismo, 32% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? As outras bases sero: Guanina =32% Adenina = 18% Timina = 18% 519. Observa-se a presena de DNA nos seguintes organides citoplasmticos a) mitocndria e ribossomo. b) ribossomo e cromossomo. c) nuclolo e cloroplasto. d) lisossomo e ribossomo. e) mitocndria e cloroplasto. [E] 520. Uma molcula de RNAmensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUUGUGCCCAAA. Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA. a) AAACACGGGTTT b) TTTCACGGGUUU c) AAACTCGGGTTT d) TTTGAGGGGTTT e) AAACACCCCUUT [A] 521. No modelo molecular do cido ribonuclico (RNA) representado adiante os nmeros 1, 2 e 3 indicam, respectivamente

b) DNA - desoxirribose e timina RNA - ribose e uracila 512. Para funcionar como material gentico o DNA apresenta duas propriedades fundamentais. So elas: I - AUTODUPLICAO II - TRANSCRIO Explique essas duas propriedades A autoduplicao permite que o DNA produza cpias e possa ser transmitido descendncia. Transcrio a capacidade do DNA produzir o RNA que ser traduzido em protena especfica nos ribossomos das clulas. 513. Sabendo-se que numa molcula de DNA formada por uma dupla hlice h 21% de timina, responda quais so as outras bases dessa molcula e em que propores ocorrem.

a) desoxirribose, cido fosfrico e base nitrogenada. b) cido fosfrico, desoxirribose e base nitrogenada. c) ribose, cido fosfrico e base nitrogenada. d) cido fosfrico, ribose e base nitrogenada. e) cido fosfrico, base nitrogenada e desoxirribose. [C] 522. Na molcula de DNA, a quantidade de

42 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) adenina igual a de citosina. b) citosina igual a de timina. c) guanina igual a de adenina. d) citosina igual a de adenina. e) adenina igual a de timina. [E] 523. Em 1928 Griffth descobriu que pneumococos (bactrias) sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias. Nesse extrato o agente capaz de transformar bactrias no patognicas em patognicas era a) o cido ribonuclico. b) o cido indolilactico. c) o cido desoxirribonuclico. d) uma enzima. e) uma protena. [C] 524. Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e ribonuclico (RNA) NO se pode afirmar que a) timina uma base nitrogenada exclusiva do DNA. b) uracila uma base nitrogenada exclusiva do DNA. c) ribose um acar que entra na composio qumica do RNA. d) cido fosfrico entra na composio qumica do DNA e do RNA. e) timina pareia com adenina no DNA. [B] 525. Assinale a alternativa que relaciona corretamente o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que a figura adiante representa a unidade estrutural do cido desoxirribonuclico (DNA).

530. O ser vivo acelular que contm como material gentico apenas um tipo de cido nuclico um a) protozorio b) vrus c) fungo d) caro e) lquen [B] 531. Uma molcula de DNA contm 15% de Guanina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas propores? a) Citosina = 15%, Adenina = 15% e Timina = 15% b) Citosina = 35%, Adenina = 15% e Timina = 15% c) Citosina = 15%, Adenina = 35% e Timina = 15% d) Citosina = 15%, Adenina = 35% e Timina = 35% e) Citosina = 15%, Adenina = 15% e Timina = 35% [D] 532. Uma molcula de DNA contm 16% de Citosina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas propores? a) Guanina = 16%, Timina = 16% e Adenina = 16% b) Guanina = 16%, Timina = 34% e Adenina = 34% c) Guanina = 34%, Timina = 16% e Adenina = 16% d) Guanina = 34%, Timina = 34% e Adenina = 16% e) Guanina = 34%, Timina = 34% e Adenina = 16% [B] 533. A experincia do "liquidificador" realizada por Hersey e Chase demonstrou que a substncia que determinava a destruio de bactrias parasitadas pelos vrus bacterifagos era a) uma protena viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lpide viral. [D] 534. caracterstica do RNA: a) acar com quatro tomos de carbono. b) presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) ausncia de cido fosfrico. d) polipeptdeo. e) ocorre nos lisossomos. [B] 535. Numa molcula de DNA formada por uma dupla-hlice a quantidade de a) adenina igual a de citosina. b) citosina igual a de timina. c) adenina igual a de uracila. d) citosina igual a de adenina. e) guanina igual a de citosina. [E] 536. Assinale a alternativa que relaciona as estruturas celulares em se observa a presena de DNA: a) membrana plasmtica, centrolos e lisossomos. b) centrolos, cromossomos e complexo de Golgi. c) ribossomos, cromosssomos e lisossomos. d) centrolos, mitocndrias e cromossomos. e) lisossomos, complexo de Golgi e ribossomos [D] 537. O experimento em que foi observado o fenmeno da "transformao bacteriana", ou seja, que bactrias no patognicas sem cpsula desenvolvem cpsula e causam a morte de camundongos foi realizada por a) Mendel. b) Morgan. c) Griffth. d) Lamarck. e) Darwin. [C] 538. O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruio de bactrias. Os organismos que podem infectar bactrias so a) fungos. b) vrus. c) algas. d) caros. e) protozorios. [B] 539. Bacterifagos so a) protozorios de vida livre. b) lquenes parasitas. c) vermes parasitas. d) vrus. e) vermes de vida livre. [D] 540. A experincia do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material gentico formado por protenas. b) o material gentico formado de RNA. c) o material gentico formado de lipdios.

a) base nitrogenada, ribose e cido fosfrico. b) cido fosfrico, ribose e base nitrogenada. c) desoxirribose, base nitrogenada e cido fosfrico. d) cido fosfrico, desoxirribose e base nitrogenada. e) base nitrogenada, desoxirribose e cido fosfrico. [D] 526. O modelo molecular dos cidos nuclicos (DNA e RNA) foi proposto por J. Watson e F. Crick em 1953. Segundo esse modelo esses cidos so a) micromolculas. b) polipeptdeos. c) polinucleotdeos. d) enzimas. e) lipdios. [C] 527. caracterstica do DNA: a) acar com quatro tomos de carbono. b) presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) ausncia de cido fosfrico. d) polipeptdeo. e) ocorre nos cromossomos. [E] 528. Uma molcula de RNAmensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUUGUGCCCAAU. Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA. a) AAACACGGGTTA b) TTTCACGGGUUT c) AAACTCGGGTTT d) TTTGAGGGGTTA e) AAACACCCCUUA [A] 529. Griffth em 1928 descobriu que bactrias pneumococos sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluram que o agente capaz de transformar as bactrias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma protena. [C]

43 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) o material gentico formado por acares. e) o material gentico formado de DNA. [E] 541. Pneumococos capsulados so bactrias que causam pneumonia em ratos. A presena de uma cpsula a) torna essas bactrias capazes de sofrer mutao. b) torna essas bactrias resistentes ao sistema de defesa dos ratos c) torna essas bactrias resistentes aos antibiticos convencionais. d) torna essas bactrias inofensivas para os seres humanos. e) torna essas bactrias incapazes de sofrer transformao. [B] 542. Sabemos que os genes so constitudos de DNA e esto localizados nas seguintes estruturas celulares: a) lisossomos, complexo de Golgi e cromossomos. b) cloroplastos, cromossomos e mitocndrias. c) retculo endoplasmtico, ribossomos e centrolos. d) membrana plasmtica, ribossomos e cromossomos. e) vacolos, centrolos e cromossomos. [B] 543. Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformao" de bactrias pneumococos sem cpsula, no patognicas, em pneumococos com cpsula patognicas. Experimento realizado com bactrias 'Pneumococo pneumoniae' sem cpsula (no patognicas) e com cpsula (patognicas). 1) bactrias pneumococo sem cpsula ratos = ratos vivos. 2) bactrias pneumococo com cpsula ratos = ratos mortos. 3) bactrias pneumococo sem cpsula + bactrias capsuladas mortas pelo calor ratos = ratos vivos. 4) bactrias sem cpsula + extrato de bactrias capsuladas mortas pelo calor ratos = ratos mortos. Concluso: Existe algum agente transformante no extrato de bactrias capsuladas mortas pelo calor que capaz de modificar as no capsuladas. Esse agente seria o cido Desoxirribonuclico (DNA). 544. Como que os cientistas O. Avery, M. Mac Leod e M. Mac Carthy chegaram concluso em 1944 que o "agente transformante" capaz de permitir o desenvolvimento da cpsula em pneumococos no capsulados era o cido desoxirribonuclico? Trataram o extrato de bactrias pneumococo capsuladas mortas pelo calor com a enzima desoxirribonuclease. Esta enzima hidrolisa o DNA, destruindo, portanto, o agente transformante capaz de modificar as bactrias sem cpsula no patognicas em capsuladas patognicas e letais para os ratos utilizados nos experimentos. 545. O que so bacterifagos? Qual sua importncia na identificao do DNA como material gentico? Vrus utilizados nos experimentos que serviram para demonstrar que o DNA de fato o material gentico. 546. Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S35) e de fsforo (P32) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir deste trabalho. 1) bactrias 'Escherichia coli' cultivadas em meio contendo P32 e S35 bactrias marcadas com os elementos radioativos. 2) Vrus bacteriofagos parasitam as bactrias marcadas e ficam tambm marcados com P32 no DNA e S35 na cpsula protica. 3) Vrus marcados parasitam bactrias no marcadas. 4) Antes da lise bacteriana o preparado levado ao liquidificador e centrifugado. 5) O sobrenadadante apresenta as cpsulas proticas marcadas com S35 e no precipitado h bactrias contendo DNA marcado com P32. Concluso: O DNA viral a substncia capaz de TRANSFORMAR as bactrias em "fbricas" de novos vrus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substncia que controla a hereditariedade. 547. A bactria 'Pneumococo pneumoniae' pode possuir uma cpsula que lhe permite a) sofrer mutaes. b) desenvolver flagelos. c) resistir s defesas dos hospedeiros. d) ficar imune s defesas dos hospedeiros. e) sobreviver em ambientes sem gua. [C] 548. As evidncias de que o DNA a substncia hereditria que determina as caractersticas dos seres vivos foram primeiramente observadas em a) vrus. b) protozorios. c) caros. d) liquens. e) bactrias. [E] 549. Os vrus so seres acelulares que possuem como material gentico a) DNA e enzimas. b) RNA e enzimas. c) DNA e RNA. d) DNA ou RNA. e) somente enzimas [D]

550. O rei Salomo resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criana. Ao propor dividir a criana ao meio, uma das mulheres desistiu. O rei ento concluiu que aquela que havia desistido era de fato a me verdadeira. Nos tribunais modernos, um juiz pode utilizar a anlise dos grupos sanguneos e teste de DNA para ajudar a solucionar questes semelhantes. Analisando uma situao em que uma mulher de sangue A atribua a paternidade de seu filho de sangue O a um homem de sangue B, o juiz no pde chegar a nenhuma deciso conclusiva. a) Explique por qu. b) Qual deveria ser o grupo sangneo do homem para que a deciso pudesse ser conclusiva? c) Com base no teste de DNA, o juiz concluiu que o homem era pai da criana. Por que o teste de DNA permite tirar concluses to precisas em casos com este? a) Um homem do grupo sangneo B pode ser heterozigoto (Ii) e, portanto, pai de criana do grupo O (ii). b) Se o homem fosse do grupo AB, com gentipo IAIB, no poderia ser o pai de criana O (ii). c) O teste de DNA capaz de comparar as seqncias de bases nitrogenadas de "pais" e "filhos" com acerto de 99,9%. Se as seqncias forem idnticas o indivduo testado certamente o pai biolgico da criana. 551. O antibitico Estreptomicina age sobre as bactrias promovendo a leitura errada do RNAm, a Tetraciclina liga-se subunidade ribossmica menor e inibe a ligao do AA-RNAt, o Cloranfenicol inibe a peptidiltransferase na subunidade ribossmica maior e a Rifampicina inibe a RNA polimerase no stio de iniciao. Sabe-se que esses antibiticos so substncias cuja utilizao mdica se baseia na inibio das clulas bacterianas atuando no mecanismo de: a) fagocitose. b) secreo de substncias. c) sntese protica. d) produo de energia. e) reproduo celular. [C] 552. Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir:

O resultado esperado para este trabalho que as clulas que receberam o implante: a) morram pela presena de cido nuclico estranho composio do ncleo. b) morram por ficarem prejudicadas na realizao da sntese protica. c) reproduzam-se, produzindo clulas defeituosas incapazes de sobreviverem. d) reproduzam-se, transferindo as caractersticas implantadas para as clulasfilhas. e) cresam, produzindo anticorpos contra as protenas estranhas que sero fabricadas. [D] 553. A hiptese de que os cloroplastos e as mitocndrias tenham surgido atravs de uma associao simbitica de um eucarioto primitivo com, respectivamente, bactrias fotossintetizantes e bactrias aerbicas, reforada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfcie interna. b) apresentarem DNA prprio. c) estarem envolvidas, respectivamente, na produo e consumo de oxignio. d) apresentarem tilacides e cristas como as bactrias. e) serem encontradas tanto em organismos superiores como inferiores. [B] 554. A tabela a seguir relaciona trincas de bases do DNA aos aminocidos correspondentes.

44 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) substituio da quarta base nitrogenada por outra. d) substituio das trs primeiras bases nitrogenadas por outras. e) incluso de mais trs bases nitrogenadas no final da molcula. [A] 558. Uma doena gentica de herana dominante causada por mutaes em um gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de DNA desse gene, cuja seqncia normal est representada a seguir.

Assinale a alternativa que apresenta a possvel seqncia de cdons para a formao do seguinte tetrapeptdeo: GLU - GLI - FEN - LEU a) GUU - GGU - UUU - CUC; b) GAA - GGC - TTT - CTC; c) CTT - CCG - AAA - AAC; d) GAA - GGA - UUU - CUC; e) GUU - GGC - UUU - UUG. [D] 555. O quadro a seguir contm um segmento de DNA, os cdons e os anticdons correspondentes.

Usando a tabela que relaciona alguns codons aos respectivos aminocidos e considerando que a fita molde a ser transcrita aquela assinalada com a letra m, responda: a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e C? b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu? Seqncia normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG a) Protena normal: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo A: Val - Leu - Tre - Pro Indivduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo C: Val - Met - Tre - Pro - Tir - Val - Lis b) A afetado porque produz uma protena menor. B normal, apesar da substituio de uma base nitrogenada no seu DNA, porque o cdigo gentico degenerado. C afetado porque possui um aminocido diferente em sua protena. 559. Na sntese protica, um processo bastante complexo e fundamental para a sobrevivncia das clulas, a participao dos cidos nuclicos, substncias qumicas indispensveis vida, est corretamente referida em: a) O DNA transcreve a mensagem gentica para o RNA, que serve de modelo para a formao de uma protena. b) O DNA transcreve a mensagem gentica para o RNA solvel, que se liga ao ribossomo, local da sntese protica. c) O RNA mensageiro contm trincas de nucleotdeos denominadas cdons, responsveis pela transcrio de uma cadeia polipeptdica. d) O RNA transportador apresenta na sua molcula uma trinca de nucleotdeos denominada anticdon, local de ligao com o aminocido que ele transporta. e) O RNA ribossmico se une a protenas formando o ribossomo, local onde ocorre a transcrio da mensagem gentica. [A] 560. O estudo do mecanismo da sntese de protenas no interior das clulas, confirma que: a) a transcrio gnica caracteriza-se pela autoduplicao do DNA b) trs tipos de RNA participam do processo c) os anticdons localizam-se no RNA-m d) os cdons so trincas de bases nitrogenadas do RNA-t e) no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado [B] 561. Com relao composio qumica, as molculas de DNA e RNA diferem entre si quanto ao tipo de a) acar, apenas. b) base nitrogenada, apenas. c) base nitrogenada e de acar, apenas. d) base nitrogenada e de fosfato, apenas. e) base nitrogenada, de acar e de fosfato.

Para preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos, respectivamente, por a) GAC, TAA, AGT e CTG b) GTC, AUU, UCA e GUC c) GTC, ATT, TCA e GUC d) CTG, ATT, TCA e CUG e) CTG, AUU, UCA e CUG [E] 556. Ao longo da molcula de DNA, existem quatro tipos de genes que atuam como est demonstrado no esquema a seguir:

So esses mecanismos que tornam possvel a: a) diferenciao celular. b) produo de energia. c) duplicao de RNA. d) mutao gnica. e) lise celular. [A] 557. Considere um segmento de DNA com seqncia de bases indicadas a seguir: TTATCGGGACCGATCATCGTA A alterao mais drstica que esta molcula pode sofrer a: a) supresso da segunda base nitrogenada. b) supresso das trs primeiras bases nitrogenadas.

45 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[C] 562. O segmento CGATAGACT de uma fita de DNA, aps o processo de transcrio, origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA [B] 563. "A nova tecnologia do DNA recombinante est permitindo que cientistas dos pases do primeiro mundo desenvolvam um projeto denominado GENOMA que tem por objetivo seqenciar os cerca de 3 bilhes de bases nitrogenadas que compem os cromossomos de um ser humano. Ao lado dos inmeros benefcios desse projeto, algumas questes de cunho tico tm sido levantadas." ("Cincia Hoje", maro/93) Em relao a esse projeto, o procedimento que pode afetar diretamente o equilbrio gentico de populaes humanas a) a deteco de indivduos superdotados intelectualmente por meio de procedimentos laboratoriais. b) o aumento de seleo gentica ou gamtica artificial. c) o emprego de testes genticos como um novo critrio para admisso a empregos. d) o registro de patentes de seqncias do genoma humano para especulao mercadolgica. e) o uso de testes pr-sintomticos para a realizao de seguros de vida. [B] 564. Considere estes dados como hipotticos. Um casal apresenta, em seus cromossomos de nmero 21, pontos de quebra por enzimas especiais, indicados no esquema por setas. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genticos. No esquema a seguir, os fragmentos so indicados por Kb (1Kb=1000 pares de bases nitrogenadas). Esse casal tem uma criana com Sndrome de Down devida trissomia do cromossomo 21. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai, da me e da criana esto indicados na figura 2, onde cada trao indica a posio e o tamanho dos fragmentos num campo de eletroforese.

Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanas entre estas duas molculas de DNA? b) Justifique sua resposta. A nica afirmao possvel face aos dados que as duas molculas possuem as mesmas propores de bases nitrogenadas. Somente seriam idnticas se a ordenao das bases fosse exatamente a mesma nas duas molculas. 566. OBSERVE: 1. O cdigo gentico descreve a relao entre a seqncia de bases nitrogenadas e a seqncia de aminocidos, na protena que ele especifica. 2. A seqncia de aminocidos que forma uma cadeia polipeptdica compreende a estrutura secundria de uma protena. 3. Trs bases nitrogenadas adjacentes codificam um aminocido e formam um cdon. Est(o) correta(s): a) 1, apenas d) 1, 2 e 3 [B] b) 1 e 3, apenas e) 2, apenas c) 3, apenas

567. No esquema, os nmeros 1, 2 e 3 substituem, respectivamente:

a) represso gnica, transcrio, replicao b) replicao, traduo, transcrio c) amplificao gnica, represso, traduo d) replicao, transcrio, traduo e) transcrio, replicao, traduo [D] 568. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. As proposies a seguir so relativas ao processo de sntese de protenas nas clulas vivas. ( ) A molcula de DNA transcreve no ncleo uma molcula de RNA mensageiro (RNAm) com vrias seqncias de trs bases - os cdons. ( ) Cada cdon do RNA mensageiro determinar a colocao de um aminocido especfico na cadeia polipeptdica. ( ) No local onde houver um ribossomo, pequenas molculas de RNA transportador (RNAt), ligadas a aminocidos, unem-se ao RNAm por uma seqncia de trs bases - o anticdon. ( ) O processo de sntese de protenas ao nvel do citoplasma tambm conhecido como transcrio gentica. ( ) Os diversos aminocidos unem-se atravs de ligaes do tipo ster, dando formao, ao final da leitura do RNAm, a uma protena funcional. VVVFF 569. So feitas as seguintes afirmativas a respeito da sntese protica. Analise-a e assinale alternativa correta. I) Um RNAt transporta sempre o mesmo aminocido. II) A traduo do cdigo gentico do RNAm feita nos ribossomos localizados no retculo endoplasmtico rugoso. III) O anticdon corresponde a uma trinca de bases localizada numa determinada regio de todos os RNAt. a) Apenas II est correta. b) Todas esto corretas. c) Esto corretas apenas I e II. d) Apenas III est correta. e) Esto corretas apenas I e III. [B] 570. A composio das bases pricas adenina e guanina do DNA do homem e do co, so as seguintes: Homem: Adenina = 30,4 %

Com base nas informaes apresentadas e em conhecimento sobre o assunto responda ao que se pede. 1) Identifique o genitor que transmitiu dois cromossomos 21 criana. Justifique sua resposta. 2) Determine o estgio da meiose, I ou II, em que ocorreu o fenmeno de no separao ou no-disjuno dos cromossomos. Justifique sua resposta. 3) Suponha que a mulher est novamente grvida e que o exame para marcadores do cromossomo 21, como descrito no texto, foi realizado para o feto atravs de puno do lquido amnitico, amniocentese. Analise o resultado obtido na figura 3. Pelos resultados apresentados na figura pressupe-se que a criana deve ser normal. Entretanto, aps o nascimento, constatou-se que a criana apresentava Sndrome de Down. Com base nessa informao, determine: O genitor onde ocorreu a no-disjuno. A fase da meiose em que o fenmeno ocorreu. 1) O Pai porque a criana possui apenas 1 cromossomo 21 materno. 2) Diviso I porque a criana possui 2 cromossomos 21 distintos. 3) A criana herdou um cromossomo 21 duplicado de sua me (segmento de DNA maior) e a no disjuno, nesse caso, ocorreu na segunda diviso da meiose. 565. A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases: Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina;

46 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Guanina = ? Co: Adenina = ? Guanina = 21,0 % As percentagens que esto faltando para o homem e co so, respectivamente: a) 19,6 e 29,0; b) 21,0 e 30,4; c) 29,0 e 30,4; d) 19,6 e 21,0; e) 30,4 e 21,0. [A] 571. O genoma da bactria "Escherichia coli" tem um tamanho de 4106 pares de nucleotdeos. J o genoma haplide humano tem 3109 pares de nucleotdeos. Para replicar o genoma, antes da diviso celular, existe uma enzima, a DNA polimerase, cuja velocidade de reao equivalente a cerca de 800 nucleotdeos/s. Assim, para replicar todo o genoma de uma bactria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias! Sabemos, no entanto, que o tempo de gerao da "E.coli" de cerca de 20 minutos, e que o tempo mdio de replicao de uma clula eucariota de 12 horas. Assumindo que a DNA polimerase apresenta uma velocidade de reao constante para todas as espcies analisadas, explique essa aparente contradio. Vrias molculas de DNA-polimerase iniciam a replicao do DNA, simultneamente, em diversos stios do genoma denominados stios de origem de replicao. 572. O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genmica. Isto significa que cada indivduo possui variaes discretas e caractersticas na seqncia de seu DNA, ou seja, a seqncia de nucleotdeos do DNA de cada pessoa nica (excetuando-se o caso de gmeos monozigticos). Assim, a tipagem do DNA revela um padro de bandas que estvel (presente no DNA de todos os tecidos) e transmitido aos descendentes seguindo as leis de Mendel. Graas a essas caractersticas possvel atualmente realizar testes de paternidade que comparam os padres de bandas de DNA das pessoas e revelam se um homem de fato o pai biolgico de uma outra pessoa. Suponha agora a seguinte situao: um homem acusado de ser o pai de uma criana tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfuso de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de clulas nucleadas). a) Qual a influncia da transfuso sugerida no resultado no exame? b) Que precaues podem ser tomadas para desmascarar a tentativa de fraude? a) A influncia pode ser crucial pois analisado o DNA fornecido por clulas nucleadas, como os glbulos brancos, que podem viver muitos anos e se duplicar ativamente. b) A fraude pode ser evitada colhendo-se clulas brancas da medula ssea vermelha do indivduo a ser testado. 573. A tabela mostra a composio das bases nitrogenadas pricas, adenina e guanina, nos DNAs do homem e do boi. Adenina Guanina Homem 30,4% ? Boi ? 21,0% As porcentagens que esto faltando para o homem e para o boi so, respectivamente: a) 19,6 e 29,0 b) 21,0 e 30,4 c) 29,0 e 30,4 d) 19,6 e 21,0 e) 30,4 e 21,0 [A] 574. Na espcie humana h dois tipos de hemoglobina, conhecidas como hemoglobinas A e S, que diferem apenas em um aminocido: Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-cido glutmico... Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x... Essa pequena diferena suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. Os cdons de RNA-m que codificam esses aminocidos so: valina - GUU, GUG, GUC, GUA histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA cido glutmico - GAG, GAA A mutao pode ocorrer no ADN como mostra o esquema a seguir:

a) Qual o aminocido que aparece, na hemoglobina S, no lugar do cido glutmico? Justifique sua resposta. b) Todas as clulas, a partir da clula que sofre a mutao, sero anmalas? Justifique sua resposta. a) Valina porque houve uma substituio (T x A) no codon do DNA correspondente a esse aminocido. b) No porque aps a replicao do DNA semiconservativa. 575. O desenho a seguir mostra a sntese de um polipeptdio a partir da molcula de DNA, num certo organismo. Esse organismo um procarioto ou um eucarioto? Por qu?

Procarioto porque no existe a carioteca separando o material gentico (DNA) do citoplasma, onde se localizam os ribossomos. 576. Os processos de transcrio e traduo gnicas resultam na sntese, respectivamente, de a) protenas e de RNA. b) RNA e de protenas. c) DNA e de protenas. d) RNA e de DNA. e) DNA e de RNA. [B] 577. Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqncia de radiaes UV, o que resultou em pequenos tumores na pele. Caso ele venha a ser pai de uma criana, ela a) s herdar os tumores se tiver ocorrido dano em um gene dominante. b) s herdar os tumores se tiver ocorrido dano em dois genes recessivos. c) s herdar os tumores se for do sexo masculino. d) herdar os tumores, pois houve dano no material gentico. e) no herdar os tumores. [E] 578. Enzimas de restrio so fundamentais Engenharia Gentica porque permitem a) a passagem de DNA atravs da membrana celular. b) inibir a sntese de RNA a partir de DNA. c) inibir a sntese de DNA a partir de RNA. d) cortar DNA onde ocorrem seqncias especficas de bases. e) modificar seqncias de bases do DNA. [D] 579. Duas mulheres disputam a maternidade de uma menina. Foi realizada a anlise de um mesmo trecho do DNA, obtido de um dos cromossomos X de cada mulher e da menina. As seqncias de bases do referido trecho gnico esto esquematizadas adiante:

47 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) Adenina = 30%, Citosina = 40% e Timina = 40% e) Adenina = 40%, Citosina = 30% e Timina = 40% [B] 583. Partindo-se do conhecimento do RNA m (CCU GAG), indique, nas opes a seguir, qual a seqncia correta do DNA e do RNA transportador.

Os dados obtidos a) so suficientes para excluir a possibilidade de qualquer uma das mulheres ser a me da menina. b) So suficientes para excluir a possibilidade de uma das mulheres ser a me da menina. c) no so suficientes, pois o cromossomo X da menina analisado pode ser o de origem paterna. d) no so suficientes, pois a menina recebe seus dois cromossomos X da me e apenas um deles foi analisado. e) no podem ser considerados, pois uma menina no recebe cromossomo X de sua me. [C] 580. Considere os seguintes fragmentos de cidos nuclicos que participam da sntese de uma protena.

[C] 584. O esquema a seguir representa a seqncia de aminocidos de um trecho de uma protena e os respectivos anticdons dos RNA transportadores.

Os espaos 1, 2 e 3 ficariam corretamente preenchidos por: a) ACA; CUC; GAU b) TGT; GAG; CAU c) TCT; GUG; GTA d) UGU; GAG; CAT e) TGT; CAC; GUA [B] 581. A tabela a seguir mostra alguns aminocidos e as trincas de bases no DNA que os identificam:

Assinale a alternativa que contm a seqncia de cdons do RNA mensageiro que participou dessa traduo. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT [B] 585. O esquema a seguir representa dois processos observados numa clula eucaritica.

Se um RNA mensageiro apresenta a seqncia de bases AUU AGA UGU GUU UUA, a seqncia de aminocidos no polipeptdeo correspondente ser, de acordo com a tabela anterior: a) Cis - Val - Leu - Arg - Ile b) Leu - Val - Cis - Arg - Ile c) Arg - Ile - Val - Leu - Cis d) Ile - Arg - Cis - Val - Leu e) Val - Cis - Arg - Ile Leu [D] 582. Num dado organismo, o contedo de guanina no seu DNA 30%. Assinale a alternativa que contm a porcentagem correta de cada uma das demais bases nitrogenadas. a) Adenina = 20%, Citosina = 20% e Timina = 30% b) Adenina = 20%, Citosina = 30% e Timina = 20% c) Adenina = 30%, Citosina = 30% e Timina = 30%

Assinale a alternativa correta. a) O processo 1 somente observado no ncleo da clula, sendo inexistente em todas as outras organelas. b) Para interromper o processo 2, necessrio bloquear o funcionamento de todo o retculo endoplasmtico dessa clula. c) O processo 2 ocorre principalmente no perodo S da intrfase. d) Um dos mais importantes locais de ocorrncia do processo 1 o nuclolo. e) As molculas produzidas no processo 2 podero ser utilizadas como catalisadoras, mas nunca sero constituintes de outras organelas. [D] 586. A composio qumica de uma protena pode ser alterada se a) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma. b) durante sua sntese houver variao dos tipos de RNA transportadores. c) sua sntese ocorrer no retculo endoplasmtico liso e no no rugoso. d) uma base prica substituir uma pirimdica no RNA mensageiro que a codifica. e) O DNA no se duplicar durante a interfase.

48 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[D] 587. Um fragmento de DNA de uma espcie de organismo procarionte apresenta a seguinte seqncia de bases: AATATTCGAGTCTAAAGA. Indique qual a seqncia de mRNA transcrito a partir deste segmento DNA:: a) TTATAAGCTCAGATTTCT b) TTATTAGCTCAGATTTCT c) UUAUUUGGUCAGAUUUGU d) UUAUAAGCUCAGAUUUCU e) AATATTCGAGTCTAAAGA [D] 588. Sobre a sntese de protenas, so feitas as seguintes afirmaes: I - Um RNA-t (RNA transportador) transporta sempre um determinado aminocido. Esse aminocido, porm, pode ser transportado por vrios RNA-t. II - A traduo do cdigo qumico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retculo endoplasmtico rugoso. III - As molculas de RNA-t apresentam numa determinada regio da sua molcula uma trinca de bases denominada anticdon. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. b) Apenas III. d) Apenas II e III. e) I, II e III. [E] c) Apenas I e II.

b) Os bacterifagos injetam seu DNA com 32P no interior da bactria hospedeira, deixando-a marcada com radioatividade. c) No. Os vrus no injetam sua capa protica na clula bacteriana. O 35S radioativo entra na composio de protenas e no no DNA introduzido pelo vrus. 593. Depois da descoberta da estrutura da molcula do cido Desoxirribonuclico (DNA ou ADN), novos mtodos de diagnstico foram desenvolvidos e utilizados para inmeros fins (identificao de microrganismos patognicos, testes de paternidade, mapa gentico, medicina forense, entre outros) Assinale a afirmao correta. a) A molcula de DNA constituda por uma fita nica e por vrios nucleotdeos que tm a transcrio como principal funo. b) A molcula de DNA nas bactrias se encontra na carioteca da clula. c) A molcula de DNA no capaz de produzir a molcula de RNA. d) A molcula de DNA tem funo de duplicao e constituda por uma fita dupla, sendo que cada filamento composto por vrios nucleotdeos. e) A molcula de DNA, nos organismos eucariontes, no se encontra no ncleo da clula. [D] 594. Considere as seguintes afirmativas: I - As protenas so molculas de grande importncia para os organismos - atuam tanto estruturalmente como tambm metabolicamente. II - As enzimas so protenas que atuam como catalisadores biolgicos. III - Existem protenas que atuam como linhas de defesa do organismo e algumas delas so conhecidas como anticorpos. Quais esto corretas? a) Apenas I d) Apenas II e III [E] b) Apenas II e) I, II, III c) Apenas III

589. O diagrama ilustra uma fase da sntese de protenas.

595. O esquema a seguir mostra a via metablica de um aminocido, levando formao de alguns hormnios:

Os algarismos I, II, III e IV correspondem, respectivamente, a: a) ribossomo, cdon, RNAm e RNAt. b) RNAt, RNAm, ribossomo e cdon. c) RNAt, RNAm, ribossomo e anticdon. d) RNAm, RNAt, ribossomo e cdon. e) RNAm, RNAt, ribossomo e anticdon. [B] 590. Um pesquisador que pretende estudar comparativamente a sntese de DNA e RNA em uma clula deve usar nucleotdios radiativos contendo a) timina e uracila. b) guanina e timina. c) citosina e guanina. d) adenina e timina. e) citosina e uracila. [A] 591. A anlise qumica em amostras de cinco lminas com cidos nuclicos apresentou os seguintes resultados: 1 lmina: ribose 2 lmina: uracila 3 lmina: dupla-hlice 4 lmina: timina 5 lmina: 15% de guanina e 25% de citosina. a) Entre estas lminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5 lmina. a) Contm DNA as lminas de nmeros 3 e 4. b) As propores desiguais de citosina e guanina indicam a presena, na quinta lmina, de um cido nuclico formado por uma hlice simples, podendo se DNA ou RNA. 592. Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo fsforo radioativo (32P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos bacterifagos formados estavam marcados radioativamente. Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas cultivadas sem a presena de fsforo radioativo. A marcao radioativa foi detectada dentro destas bactrias. a) Como se explica que o fsforo radioativo tenha passado para o bacterifago? b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham sido marcadas? c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (35S) para marcao de protenas, os resultados seriam os mesmos? Justifique. a) Os bacterifagos utilizam nucleotdeos que contm 32P da bactria para construir seu material gentico (DNA). A respeito deste esquema so feitas as seguintes afirmaes: I - Um indivduo com a enzima 1 inibida acumular grandes quantidades de aminocido 3. II - Um indivduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. III - Um indivduo com a enzima 1 inibida precisa receber os hormnios 1 e 2 de fontes externas. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) Apenas II e III. [C] 596. Algumas clulas apresentam material nuclear bastante desespiralizado e metabolismo muito alto. Essas caractersticas podem indicar: a) pouca atividade do DNA e, como conseqncia, pouco desenvolvimento das organelas celulares. b) intensa traduo, exigindo a presena de grande desenvolvimento de retculo endoplasmtico liso. c) intensa transcrio e traduo, exigindo a presena de retculo endoplasmtico rugoso muito desenvolvido. d) intensa duplicao do material gentico, demonstrando alta taxa de diviso celular e organelas pouco desenvolvidas. e) intensa transcrio, exigindo grande desenvolvimento do complexo de Golgi, responsvel pela traduo. [C] 597. Considere as seguintes etapas da sntese de protenas. I - Transcrio do cdigo gentico do DNA em cdons do RNA mensageiro. II - Ligao dos cdons de RNA mensageiro aos anticdons correspondentes dos RNAs transportadores. III - Fixao do RNA mensageiro aos ribossomos. Qual a seqncia correta dessas etapas durante o processo? a) I - II - III. b) I - III - II. c) II - III - I.

49 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) III - II I [B]

e) III - I - II.

598. Com relao ao cdigo gentico, foram feitas as seguintes afirmaes: I. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminocido. II. O RNA ribossmico contm as informaes para as protenas que devem ser sintetizadas. III. O RNA mensageiro, de acordo com o anticdon que possui, liga-se a um aminocido especfico. IV. Diversos aminocidos so codificados por mais de uma trinca de nucleotdios. So verdadeiras APENAS as afirmaes a) I e II b) I e IV c) II e III d) II e IV e) I, III e IV [B] 599. Sobre o cdigo gentico so feitas as seguintes afirmaes: I - pode existir mais de um cdon para determinar um mesmo aminocido; II - em todos os seres vivos os cdons que codificam um respectivo aminocido so os mesmos; III - a traduo da seqncia de bases do RNA para a protena feita, a nvel citoplasmtico, nos ribossomos. Est(o) correta(s) afirmativa(s): a) II apenas. b) III apenas. c) I e II apenas. d) I, II e III. e) I e III apenas. [D] 600. O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de algumas dessas protenas, levando a mudanas no ciclo de vida da clula. a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica? a) Gene um segmento do DNA localizado nos cromossomos. Possui um cdigo qumico representado por seqncias de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases capaz de codificar um aminocido de uma protena. A seqncia de trincas determinar a seqncia dos aminocidos de um polipeptdeo. b) Mutaes so modificaes na seqncia ou na composio das bases do DNA (gene) que podem causar a produo de uma protena alterada, ou mesmo a no produo da protena. c) A substituio de uma base nitrogenada no DNA pode no causar nenhuma alterao na protena produzida pela clula porque o cdigo gentico degenerado, ou seja, um mesmo aminocido pode ser codificado por diferentes trincas de bases. 601. Em se tratando do processo de sntese de protenas, certo afirmar: a) os aminocidos que esto no citoplasma so selecionados pelo RNAm b) todo o processo da sntese de uma protena ocorre exclusivamente no ncleo da clula c) o RNAm controla a sntese de uma protena, mas a sntese dele prprio controle do DNA d) o RNAt responsvel pela etapa de transcrio no processo de sntese de uma protena [C] 602. A anlise do esquema abaixo nos permite afirmar que:

a) I apenas. d) II e III apenas. [B]

b) I e II apenas. e) I, II e III.

c) I e III apenas.

603. "EXAME DE PATERNIDADE, NO BRASIL, J PODE SER FEITO COM SALIVA" "Novo teste pode, pela anlise do DNA das clulas, identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. Esse tipo de teste particularmente indicado para bebs e crianas pequenas." (O GLOBO, 20/08/98) Nesse tipo de teste, a semelhana estrutural existente entre as molculas de DNA tomada por base para a identificao da paternidade. Essa diferena consiste na(o): a) seqncia de bases nitrogenadas. b) aspecto da dupla hlice presente. c) nmero de fosfatos contidos. d) tipo de pentose existente. e) tipo de desoxirriboses presentes. [A] 604. Uma substncia txica que interfira com a sntese de protenas afetar, em primeiro lugar, a funo exercida a) pelo ncleo. b) pelos ribossomos. c) pelas mitocndrias. d) pela membrana celular. e) pelos centrolos. [B] 605. Considere os seguintes cdons do RNA mensageiro e os aminocidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticdons do RNAt e os cdons do DNA relacionados com esses aminocidos.

[C] 606. O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos. Por que sempre encontramos N > P ? Com a descoberta do cdigo gentico sabe-se que um aminocido sempre codificado por trs nucleotdeos, logo o gene que codifica uma protena tem sempre maior nmero de nucleotdeos que de aminocidos. Sabe-se ainda que existem vrios nucleotdeos do gene que servem para a funo de regulao e no so transcritos. 607. O grfico a seguir mostra as alteraes no contedo de ADN durante o ciclo de vida da maioria das clulas:

I - os ribossomas alinhados nessa molcula de RNA traduziro os mesmos cdons; II - durante o processo a protena formada depende, em ltima anlise, de uma molcula de DNA; III - qualquer protena formada ser conseqncia direta de uma transcrio do RNA. A(s) afirmativa(s) correta(s) (so):

Considerando que no tecido nervoso dos adultos no h reproduo celular, construa o grfico que representa a quantidade de ADN no ciclo celular dessas clulas. Justifique sua resposta.

50 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

No havendo reproduo celular nos neurnios no ocorre duplicao do ADN; no havendo portanto a fase S da duplicao do ADN: como conseqncia, tambm no existiro as fases G2 e M.

612. Bactrias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de geraes. Dessa cultura, foram isoladas 100 bactrias e transferidas para um meio sem substncias radioativas. Essas bactrias sofreram trs divises no novo meio, produzindo 800 bactrias. A anlise dos cidos nuclicos mostrou que dessas 800 bactrias a) 100 apresentavam o DNA marcado, mas no o RNA. b) 200 apresentavam o DNA marcado, mas no o RNA. c) 400 apresentavam o DNA marcado, mas no o RNA. d) 200 apresentavam o DNA e o RNA marcados. e) todas apresentavam o DNA e o RNA marcados. [B] 613. Existe um nmero muito grande de substncias com funes antibiticas. Essas substncias diferem quanto maneira pela qual interferem no metabolismo celular. Assim, a TETRACICLINA liga-se aos ribossomos e impede a ligao do RNA transportador; a MITOMICINA inibe a ao da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos cdons do RNA mensageiro. Essas informaes permitem afirmar que

608. Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justifique sua resposta No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que contm. Assim, a diferenciao dos tecidos resulta principalmente da transcrio de genes diferentes, o que naturalmente produz uma composio de RNAm qualitativamente diferente de tecido para tecido. 609. A sntese protica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

I - a TETRACICLINA impede a transcrio e leva a clula bacteriana morte por falta de RNA mensageiro. II - a MITOMICINA, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana. III - a ESTREPTOMICINA interfere na traduo e leva a clula bacteriana a produzir protenas defeituosas. Assinale a alternativa que rene as afirmaes corretas. a) apenas I correta. b) apenas I e II so corretas. c) apenas II e III so corretas. d) apenas I e III so corretas. e) I, II e III so corretas. [C] 614. O esquema a seguir representa a sntese protica.

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a sntese protica em uma clula procaritica. (1) Os tipos de RNA necessrios para a sntese protica em procariotos e eucariotos so essencialmente diferentes. (2) Na expresso de um gene eucaritico, a transcrio e a traduo ocorrem simultaneamente. (3) Uma molcula de RNAm pode ser utilizada para a sntese concomitante de vrias molculas da protena. Item correto: 3 Itens errados: 0, 1 e 2 610. Um trecho de fita de DNA com a sequncia... TACACCTCTCGT... responsvel pela incorporao respectiva dos seguintes aminocidos: metionina, triptofano, arginina e alanina. Considerando as informaes apresentadas, julgue os itens que se seguem. (1) Os cdons do mRNA, para os aminocidos mencionados, so, respectivamente, UAC ACC UCU CGU. (2) A molcula de DNA referente ao trecho apresentado tem 20% de adenina. (3) A perda de um nucleotdeo do DNA implicar a alterao dos aminocidos da cadeia polipeptdica. (4) A fumaa do cigarro, os raios X e a luz ultravioleta podem produzir mutaes na molcula de DNA. EECC 611. Enquanto o projeto que visa seqenciar completamente o genoma humano segue seu curso, nos ltimos 2 anos chegaram ao fim vrios seqenciamentos do genoma de bactrias. Em setembro de 1997, foi publicada a sequncia do DNA da bactria 'Escherichia coli.' Os nmeros impressionam: so cerca de 4,6 milhes de pares de bases, e os genes que codificam protenas so 4.288. Para surpresa de muitos, 38% desses genes ainda no tm uma funo conhecida. Com o auxlio do texto, julgue os itens a seguir. (1) O DNA da bactria 'Escherichia coli' tem cerca de 9,2 milhes de molculas de fosfato. (2) Para 38% dos genes, no se sabe a sequncia de amionocidos da protena. (3) Pode-se fazer estudos da evoluo das bactrias, comparando-se a sequncia de DNA de diferentes espcies. (4) A 'Escherichia coli' pode produzir 8.576 RNAs mensageiros diferentes. CECE Analise o esquema e julgue os itens a seguir. (0) Ao final da sntese, todas as protenas representadas no esquema sero iguais. (1) Os ribossomos esto se movendo da parte de baixo para a de cima do esquema. (2) No esquema, no est representado o RNA transportador, que tambm participa do processo. (3) O conjunto representado pode estar localizado no retculo endoplasmtico rugoso. (4) O nmero de aminocidos da protena depender do tamanho do RNA mensageiro. Itens corretos: 0, 2, 3 e 4 Item errado: 1 615. CLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTRIA DA EVOLUO DA HUMANIDADE Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo") a) Explique por que o processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. b) "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula. a) O DNA produz cpias idnticas de si mesmo. b) Sntese protica. 616. Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de nucleotdeos do seu gene, ou do RNA-m correspondentes.

51 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu. Porque o cdigo gentico degenerado, isto , para um mesmo aminocido existem vrios cdons diferentes. 617. A tipagem de DNA uma tcnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivduos. Para se realizar uma anlise patrilnea, isto , a investigao dos ancestrais paternos, usa-se um marcador do cromossomo Y, que no se altera ao longo das geraes (salvo em casos de mutaes). Por outro lado, para uma anlise matrilnea (materna), lana-se mo do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a anlise matrilnea? Durante a fertilizao, somente o DNA nuclear do espermatozide penetra no vulo. Por esse motivo, o DNA mitocondrial do zigoto necessariamente materno. 618. O esquema resume parcialmente as relaes funcionais dos cidos nucleicos que ocorrem na maioria das clulas vivas.

De acordo com o esquema, verifica-se que a) ocorre lise da bactria no fim do ciclo. b) o DNA viral se incorpora ao cromossomo bacteriano. c) o DNA viral destrudo pela bactria. d) as bactrias perdem a capacidade de se dividir. e) h grande multiplicao do DNA viral no interior da bactria. [B] 621. Meselson e Stahl, em 1957, fizeram um experimento sobre a replicao do DNA. Nesse experimento, a bactria 'Escherichia coli' foi cultivada, por muitas geraes, em meio contendo um istopo pesado de nitrognio, 15N, at todo o seu DNA estar marcado com esse istopo. Depois disso, as bactrias foram transferidas para um meio contendo nitrognio leve, 14N. As molculas de DNA das bactrias foram ento isoladas e analisadas com relao ao seu contedo de 15N e de 14N, sendo observado o seguinte:

Com relao a esses dados, podemos concluir que a) a replicao do DNA semiconservativa. b) a replicao do DNA conservativa. c) a replicao do DNA randmica. d) no ocorreu replicao do DNA mas, sim, uma mutao. e) no ocorreu replicao do DNA mas, sim, transcrio. [A] Considerando-se apenas clulas eucariontes, as etapas que representam, respectivamente, transcrio, duplicao e traduo so: a) I, II e III. b) I, III e II. c) II, I e III. d) III, I e II. e) II, III e I. [A] 619. Os itens a seguir referem-se estrutura, composio e funo dos cidos nuclicos. - Estrutura: I. dupla hlice II. cadeia simples - Composio: 1. presena de uracila 2. presena de timina - Funo: a. sntese de protenas b. transcrio gnica So caractersticas do cido ribonuclico a) I - 1 a b) I - 2 b c) II - 1 - a d) II - 1 b e) II - 2 b [C] 620. O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacterifagos. 622. Sabendo que o DNA dos vrus bacterifagos contm fsforo e que a cpsula protica contm enxofre, Hersey e Chase, em 1952, cultivaram vrus em meio contendo istopos de fsforo (32P) e de enxofre (35S). Esses pesquisadores observaram, ao introduzir os vrus marcados em meio contendo bactrias, que os istopos de fsforo (32P) apareciam no interior das bactrias e que os istopos de enxofre (35S) permaneciam fora das clulas. Observaram tambm que, aps lavarem a superfcie das bactrias, retirando o enxofre (35S), continuava ocorrendo a replicao dos vrus. Com esse experimento, eles puderam concluir que a) a informao gentica necessria para a sntese de novos vrus est contida no DNA viral. b) as capas proticas dos vrus contm parte importante da informao gentica necessria sntese de novos vrus. c) o DNA viral precisa estar associado integralmente s capas proticas para poder se replicar no interior das bactrias. d) a capa protica protege o DNA viral da ao de endonucleases no interior do organismo hospedeiro. e) os vrus bacterifagos contm DNA como material gentico, e essa molcula muito rica em enxofre. [A] 623. Considere a rota metablica que produz o aminocido arginina na figura adiante.

52 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[A] 626. O grfico a seguir demonstra a distribuio citoplasmtica do nmero de ribossomos isolados e polirribossomas, em comparao com o nmero de cadeias polipeptdicas em formao durante um certo perodo de tempo.

Em um experimento, trs linhagens de bactrias foram irradiadas com Raios X, que causaram mutaes nos genes envolvidos na rota metablica acima representada. Para descobrir quais enzimas da rota metablica foram afetadas, as trs linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. [E] 624. Suponha um gene de um eucarioto responsvel pela sntese de uma protena. Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na protena em questo. As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de transcrio. A figura a seguir representa o resultado de uma experincia de hibridao do ARN mensageiro com a cadeia de ADN que lhe deu origem.

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relao existente entre os ribossomas isolados e a formao das cadeias polipeptdicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptdicas e a dos polirribossomas. a) Em ribossomos isolados no h sntese de cadeias polipeptdicas. O RNA mensageiro necessrio pois transmite a mensagem gentica para a sntese dos polipeptdeos. b) Polipeptdeos so formados a partir do encadeamento de aminocidos. Polirribossomos so constitudos de ribossomos ligados ao RNA mensageiro. 627. Um pesquisador injetou RNA mensageiro (mRNA) de vrus em ovcitos de anfbios. Aps certo tempo, verificou que esses ovcitos, alm de suas prprias protenas, produziam, tambm, protenas virais. Esses dados sugerem que a) o DNA dos ovcitos foi impedido de se expressar. b) o mRNA se integrou ao DNA dos ovcitos, comandando a sntese da protena viral. c) o material injetado nos ovcitos foi capaz de se autoduplicar. d) os ovcitos foram capazes de interpretar a informao contida no mRNA viral. [D] 628. O assunto na aula de Biologia era a evoluo do Homem. Foi apresentada aos alunos uma rvore filogentica, igual mostrada na ilustrao, que relacionava primatas atuais e seus ancestrais. Legenda da ilustrao: 1 - Smios do Novo Mundo 2 - Smios do Velho Mundo 3 - Gibo 4 - Orangotango 5 - Gorila 6 - Chimpanz 7 - Homem I - Hilobatdeos II - Pongdeos III - Homindeos

A figura mostra cinco regies, identificadas por nmeros de 1 a 5. Quais dessas regies correspondem aos ntrons? Justifique sua resposta. As regies 2 e 4. Essas regies formam alas justamente por no possurem as seqncias de nucleotdeos complementares, que foram eliminadas aps o processo de transcrio. 625. TESTES GENTICOS: A Cincia se antecipa doena Com o avano no mapeamento de 100 mil genes dos 23 pares de cromossomos do ncleo da clula (projeto Genoma, iniciado em 1990, nos EUA), j possvel detectar por meio de exames de DNA (cido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenas (...). (O GLOBO, 10/08/97) Sabe-se que o citado mapeamento feito a partir do conhecimento da seqncia de bases do DNA. O esquema abaixo que representa o pareamento tpicos de bases encontradas na molcula de DNA, :

"rvore filogentica provvel dos antropides" Foram feitas comparaes entre DNA e protenas da espcie humana com DNA e protenas de diversos primatas. Observando a rvore filogentica, voc espera que os dados bioqumicos tenham apontado, entre os primatas atuais, como nosso parente mais prximo o: a) Australopithecus. b) Chimpanz. c) Ramapithecus. d) Gorila.

53 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) Orangotango. [B] 629. Joo ficou intrigado com a grande quantidade de notcias envolvendo DNA: clonagem da ovelha Dolly, terapia gnica, testes de paternidade, engenharia gentica, etc. Para conseguir entender as notcias, estudou a estrutura da molcula de DNA e seu funcionamento e analisou os dados do quadro a seguir.

d) ao final da 2 gerao, cada molcula hbrida de DNA formar duas molculas, sendo uma hbrida e outra no. [D] 633. Clulas vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram fixadas e submetidas autoradiografia, para comprovar os locais que possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa SOMENTE nos a) nuclolos. b) ribossomos. c) nuclolos e nas mitocndrias. d) ribossomos e nos cloroplastos. e) ribossomos, nos cloroplastos e nas mitocndrias. [E] 634. Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio sintetizado a partir dele: ATA - GCA - GTG - ACA - CCT TIROSINA - ARGININA - HISTIDINA - CISTENA - GLICINA Aps a substituio de uma nica base nitrogenada no segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas. A seqncia de trincas no RNA mensageiro que pode ter codificado esse polipeptdio alterado a) CUC - TGC - TGC - CGC - GGU b) TUT - CGT - CGT - TGT - GGU c) CGT - CGT - CAC - TGT - GGA d) UAU - CTU - CAC - CTU - TTA e) UAU - CGU - CAC - CGU GGA [E] 635. Os cromossomos so constitudos principalmente por: a) fosfolipdeos. b) protenas. c) cido ribonuclico. d) enzimas. e) cido desoxirribonuclico. [E] 636. Em clulas eucariotas mantidas em cultura, adicionou-se o nucleosdeo uridina marcado radioativamente com H3 ao meio de cultura. Aps algum tempo, as clulas foram transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro, fixadas e submetidas a autoradiografia. Esse processo marca a posio aproximada do istopo dentro da clula, como representado no esquema a seguir.

Analisando-se o DNA de um animal, detectou-se que 40% de suas bases nitrogenadas eram constitudas por Adenina. Relacionando esse valor com o emparelhamento especfico das bases, os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%; C = 20%; G = 40% b) T = 10%; C = 10%; G = 40% c) T = 10%; C = 40%; G = 10% d) T = 40%; C = 10%; G = 10% e) T = 40%; C = 60%; G = 60% [D] 630. Joo ficou intrigado com a grande quantidade de notcias envolvendo DNA: clonagem da ovelha Dolly, terapia gnica, testes de paternidade, engenharia gentica, etc. Para conseguir entender as notcias, estudou a estrutura da molcula de DNA e seu funcionamento e analisou os dados do quadro a seguir.

Em I est representado o trecho de uma molcula de DNA. Observando o quadro, pode-se concluir que: a) a molcula de DNA formada por 2 cadeias caracterizadas por seqncias de bases nitrogenadas. b) na molcula de DNA, podem existir diferentes tipos de complementao de bases nitrogenadas. c) a quantidade de A presente em uma das cadeias exatamente igual quantidade de A da cadeia complementar. d) na molcula de DNA, podem existir 5 diferentes tipos de bases nitrogenadas. e) no processo de mitose, cada molcula de DNA d origem a 4 molculas de DNA exatamente iguais. [A] 631. Uma molcula de DNA apresenta uma dupla hlice de cadeias polinucleotdicas. Nela identificamos 20% de adenina. Assinale a alternativa correta em relao porcentagem de guanina. a) 20% b) 30% c) 40% d) 50% e) 60% [B] 632. Geraes sucessivas de bactrias da espcie 'Escherichia coli' foram cultivadas num meio cuja nica fonte de nitrognio era o istopo 15N, o qual se incorporou nas molculas de DNA. Posteriormente, essas bactrias foram transferidas para um novo meio, onde existia o 14N como nica forma de nitrognio. Em relao ao experimento, pode-se prever que, nesse novo meio, a) ao final da 1 gerao, sero formadas molculas de DNA apenas com 15N e molculas apenas com 14N. b) ao trmino da 1 gerao, todas as molculas de DNA apresentaro apenas 14N incorporado. c) ao trmino da 2 gerao, cerca de 1/4 do DNA ser hbrido, sendo o restante no-hbrido.

a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta. b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado fosse a timidina e justifique sua resposta. a) Tipo de molcula: cido ribonuclico (RNA) Justificativa: a uridina se incorpora ao cido ribonuclico. Este cido principalmente sintetizado no nuclolo, deslocando-se posteriormente para o citoplasma. b) Compartimento: ncleo Justificativa: a timidina exclusiva do DNA, encontrado principalmente no ncleo. 637. A mutao em um gene humano provoca cegueira. Com a utilizao de tcnicas de gentica clssica e molecular, verificou-se que este gene est localizado no genoma mitocondrial. Sabe-se que todas as mitocndrias dos indivduos afetados pela cegueira no possuem o gene normal, mas sim o gene mutado. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher normal e o homem cego; II) cuja mulher cega e o homem normal. b) Justifique as respostas ao item a. a) I) filhas: 0% filhos: 0% II) filhas: 100%

54 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

filhos: 100% b) Em seres humanos, a herana do genoma mitocondrial , exclusivamente, materna, pois as mitocndrias do espermatozide no penetram no vulo. Portanto, o pai no transmitir esta caracterstica (cegueira) para a sua prole. Por outro lado, no caso de a me ser afetada (cega), esta caracterstica ser transmitida para todos os seus filhos. 638. Considerando as propriedades de duplicao do DNA, observe o resultado do experimento a seguir.

a) metionina - treonina - asparagina - aspartato b) metionina - glutamina - histidina - glicina c) glutamina - treonina - aspartato - arginina d) glutamina - histidina - glicina - arginina e) glicina - cistena - glutamina treonina [A] 641. Os cdons UGC, UAU, GCC e AGC codificam, respectivamente os aminocidos cistena, tirosina, alanina e serina; o cdon UAG terminal, ou seja, indica a interrupo da traduo. Um fragmento de DNA, que codifica a seqncia serina - cistena - tirosina - alanina, sofreu a perda da 9 base nitrogenada. Assinale a alternativa que descreve o que acontecer com a seqncia de aminocidos. a) O aminocido tirosina ser substitudo por outro aminocido. b) O aminocido tirosina no ser traduzido, resultando numa molcula com 3 aminocidos. c) A seqncia no ser traduzida, pois essa molcula de DNA alterada no capaz de comandar esse processo. d) A traduo ser interrompida no 2 aminocido. e) A seqncia no sofrer prejuzo, pois qualquer modificao na fita de DNA imediatamente corrigida. [D] 642. O aminocido leucina pode ser codificado por mais de uma trinca de nucleotdios do DNA (AAT, GAA e outras). Assim sendo, podemos dizer que I - o cdigo gentico degenerado, o que significa que um aminocido pode ser codificado por mais de uma trinca. II - um aminocido pode ser codificado por apenas uma trinca de nucleotdios de DNA. III - assim como a leucina pode ser codificada por diferentes trincas, uma determinada trinca tambm pode codificar diferentes aminocidos. Esto corretas afirmativas: a) apenas III. d) I e III. [C] b) apenas II. ) nenhuma delas. c) apenas I.

1 etapa: Em uma cultura com 15N, obtm-se o crescimento de colnias de bactrias, aps esse crescimento promove-se o desenvolvimento de mais duas geraes, em cultura com 14N. 2 etapa: Extrai-se o DNA de todas as bactrias e obtm-se o seguinte resultado: - Cultura de crescimento com 15N: 300 molculas de DNA todas com 15N. - Cultura de 1 gerao com 14N: 600 molculas de DNA todas com 15N e 14N. - Cultura de 2 gerao com 14N: 1200 molculas de DNA nas quais 600 com 14N e 600 com 15N e 14N. Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta. Cultura de crescimento 15N 100% de molculas de DNA com 15N. Cultura de 1 gerao 100% de molculas, cada uma com parte da hlice do DNA com 15N e parte com 14N. Cultura de 2 gerao 50% de molculas com 14N e 50% com 14N - 15N. A justificativa se baseia na propriedade semi-conservativa da duplicao do DNA. 639. Em um segmento de cadeia ativa de DNA h 20 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar h 10 adeninas e 30 guaninas. Com base nesses dados, conclui-se que nos segmentos de RNA originrios desse DNA haver a) 30 citosinas. b) 20 timinas. c) 15 guaninas. d) 10 uracilas. e) 10 adeninas. [E] 640. A tabela apresenta o cdigo gentico, com os cdons e os aminocidos correspondentes.

643. Uma substncia X o produto final de uma via metablica controlada pelo mecanismo de retro-inibio (feed-back) em que, acima de uma dada concentrao, X passa a inibir a enzima 1.

Podemos afirmar que, nessa via metablica, a) a quantidade disponvel de X tende a se manter constante. b) o substrato faltar se o consumo de X for pequeno. c) o substrato se acumular quando a concentrao de X diminuir. d) a substncia A se acumular quando a concentrao de X aumentar. e) a substncia B se acumular quando o consumo de X for pequeno. [A] 644. Em um organismo, clulas musculares e clulas nervosas diferem principalmente por: a) possurem genes diferentes. b) possurem ribossomos diferentes. c) possurem cromossomos diferentes. d) expressarem genes diferentes. e) utilizarem cdigo gentico diferente. [D] 645. Sabe-se que o homem possui em torno de 80.000 genes, que, entre outras funes, codificam protenas. Considerando-se essa informao e conhecimento sobre o assunto, CORRETO afirmar que a) o gentipo das clulas do tecido nervoso diferente do gentipo das clulas do tecido epitelial. b) o nmero total de genes, aps a diferenciao e a especializao das clulas, reduz-se. c) os genes cuja atividade no necessria ao funcionamento de uma clula perdem a capacidade de duplicao. d) os genes responsveis pelo sistema sangneo ABO esto presentes nas clulas epiteliais, mas so incapazes de se expressar. [D]

phe = FENILALANINA; leu = LEUCINA; ileu = ISOLEUCINA; met = METIONINA; val = VALINA; ser = SERINA; pro = PROLINA; thr = TREONINA; ala = ALANINA; tyr = TIROSINA; his = HISTIDINA; glu = GLUTAMINA; asn = ASPARAGINA; lys = LISINA; asp = ASPARTATO; cys = CISTENA; trp = TRIPTOFANO; arg = ARGININA; gly = GLICINA LOPES, Snia. Bio Volume nico. So Paulo: Saraiva, 1996. Utilizando a tabela, determine a seqncia de aminocidos que corresponde seqncia de DNA TAC TGA TTG CTA

55 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

646. O controle gentico de determinado carter feito por uma srie de quatro alelos de um s locus. O alelo A1 dominante sobre os alelos A2, A3 e A 4; o alelo A2 dominante sobre os alelos A 3 e A 4 e o alelo A3 dominante sobre A 4. Do cruzamento A1 A2 x A3 A4 devem ser obtidas: a) quatro classes genotpicas e quatro classes fenotpicas. b) quatro classes genotpicas e duas classes fenotpicas. c) quatro classes genotpicas e trs classes fenotpicas. d) trs classes genotpicas e trs classes fenotpicas. e) trs classes genotpicas e duas classes fenotpicas. [B] 647. A cor dos plos nas cobaias condicionada por uma srie de alelos mltiplos com a seguinte escala de dominncia: C (preta) >C1 (marrom) >C2 (creme) >c (albino). Uma fmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituio de cada ninhada.

A partir desses dados possvel afirmar que o macho responsvel pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. [D] 648. Se um carter tem trs alelos possveis, podendo haver seis gentipos, e um segundo carter apresenta oito gentipos possveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 gentipos. b) 12 gentipos. c) 24 gentipos. d) 48 gentipos. e) 96 gentipos. [D] 649. A presena de cromatina sexual predominante em nmero de clulas femininas est relacionada a cromossomos: a) Y inativos b) X inativos c) autossmicos inativos d) autossmicos que no se dividiram e) autossmicos agregados [B] 650. O esquema a seguir mostra a formao dos gametas responsveis pela produo de um indivduo com alterao do seu nmero cromossomial.

a) a determinao do sexo nesses animais independente da localizao dos ovos no ninho e da poca da postura. b) a determinao do sexo, sob controle de temperatura, pode ser til em condies de manejo de espcies em extino. c) indivduos de sexo indeterminado, em tartarugas, so produzidos em temperaturas abaixo de 28C. d) temperatura maiores que 28C produzem fmeas tanto em tartarugas quanto em lagartos. e) machos so produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. [B] 652. Observe a figura.

Essa figura representa a herana do carter mancha negra numa espcie de peixes em que a determinao do sexo segue o padro mais comum nas aves. Com relao ao padro de herana desse carter, correto afirmar-se que a) a probabilidade do casal em F1 ter um descendente macho e sem mancha negra zero. b) a probabilidade de uma fmea com mancha, cruzada com macho sem mancha, ter descendentes machos sem mancha de 50%. c) as fmeas de F e P sem mancha negra possuem gentipos diferentes, d) o carter mancha negra exclusivo de indivduos homozigotos. e) o sexo heterogamtico nessa espcie de peixes o masculino. [A] 653. Leia o texto a seguir referente Hiptese de Lyon. "A pesquisadora inglesa Mary Lyon props, em 1961, a hiptese de que fmeas de mamferos compensariam a dose dupla de genes do cromossomos X atravs da inativao de um desses cromossomos. Assim, as clulas femininas ficariam iguais s masculinas, que possuem apenas uma cpia funcionante dos genes ligados ao cromossomo X. A inativao do cromossomo X ocorre ao acaso, independentemente dos genes que possuem, e nos blastmeros iniciais do desenvolvimento embrionrio. Logo, as mulheres apresentam clulas geneticamente diferentes entre si, pois em algumas esto ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas clulas e o alelo recessivo em outras."

Entre as caractersticas que esse indivduo passar a apresentar, teremos: a) sexo masculino. b) caracteres sexuais desenvolvidos. c) caritipo normal. d) ausncia de cromatina sexual. e) estatura elevada. [D] 651. A figura a seguir se refere determinao do sexo em algumas espcies de tartarugas e lagartos. Com base nessa figura pode-se afirmar que

Assinale a alternativa que confirma o texto anterior. a) Algumas mulheres, heterozigotas para os grupos sangneos, so tipo A e B simultaneamente. b) Algumas mulheres, heterozigotas para a cor do cabelo, so loiras e castanhas, simultaneamente. c) Algumas mulheres, heterozigotas para o daltonismo (XD Xd), tm viso normal em um dos olhos e daltonismo no outro. d) Algumas mulheres, heterozigotas para a cor da pele, tm manchas brancas e pretas, simultaneamente. e) Algumas mulheres, heterozigotas para a cor dos olhos, tm um olho azul e outro castanho. [C] 654. Na espcie humana, a determinao cromossmica do sexo dada pelos cromossomos X e Y. O cromossomo Y apresenta genes holndricos, isto , genes

56 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

que no possuem homologia com o cromossomo X. As caractersticas condicionadas por tais genes so a) transmitidas da me para 100% das filhas. b) transmitidas do pai para 100% dos filhos homens. c) transmitidas do pai s para as filhas. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. e) exclusivas das mulheres. [B] 655. Durante as Olimpadas comum fazer-se teste da cromatina sexual ou corpsculo de Barr nas mulheres. Esse teste permite o diagnstico citolgico do sexo feminino. Uma mulher normal apresentar em suas clulas bucais: a) Dois cromossomos X, sendo que um deles a cromatina sexual. b) Trs cromossomos Y, sendo que um deles a cromatina sexual. c) Dois cromossomos X e blocos de cromatina sexual. d) Trs cromossomos X, sendo que dois deles formam a cromatina sexual. e) Um cromossomo X apenas. [A] 656. Na espcie humana a determinao sexual feita por um par de cromossomos, X e Y. O indivduo do sexo feminino apresenta dois cromossomos X enquanto que o indivduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Com base neste texto INCORRETO afirmar: a) O sexo masculino heterogamtico e sempre o homem quem determina o sexo dos filhos b) O sexo feminino homogamtico e o gameta feminino normal sempre apresenta um cromossomo X c) na mulher um cromossomo X est sempre condensado e recebe o nome de cromatina sexual d) A hipertricose auricular uma caracterstica restrita ao sexo masculino, pois o gene est localizado no cromossomo Y e) Toda doena hereditria e recessiva ligada ao cromossomo X s afeta as mulheres [E] 657. O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais. A partir desse dado, assinale a alternativa INCORRETA com relao ao nmero de cromossomos encontrado em diversas clulas nessa espcie. a) Um neurnio de carneiro deve apresentar 52 autossomos. b) Um linfcito de carneiro deve apresentar 54 cromossomos, incluindo 2 cromossomos sexuais. c) Um vulo de ovelha deve apresentar 26 autossomos. d) Uma clula de carneiro que est na metfase da mitose deve apresentar 54 cromossomos duplicados. e) Uma clula muscular de carneiro deve apresentar 54 autossomos, alm de 2 cromossomos sexuais. [E] 658. Em uma espcie animal, cujo 2n = 6, o caritipo de clulas somticas de machos e fmeas se apresenta como mostram os desenhos a seguir:

Segundo a tirinha, a amiga do Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga do Calvin mutante, por isso hostil b) um cromossomo X da amiga do Calvin ativo e o outro chamado de cromatina sexual c) a heterocromatina ocorre no Calvin, pois ele XY d) os dois cromossomos X que o Calvin fala da cobra que quer com-lo e) no h cromatina sexual em meninas [B] 661. Muitas vezes, durante a realizao de eventos esportivos, realizada a determinao do sexo gentico. Este exame feito pela observao dos cromossomos de clulas epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta no deveriam apresentar corpsculo de Barr. [A] 662. Numere a coluna inferior, relacionando-a com a superior. Indivduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) trs Assinale a opo que apresenta a seqncia correta de numerao. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 [B] 663. A cromatina sexual compreende: a) o citoplasma de clulas gamticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de clulas gamticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em ncleos de hemcias humanas. d) um dos cromossomos X da mulher, que permanece condensado no ncleo das clulas, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o perodo da interfase. [D] 664. Na espcie humana existe um gene raro que causa a displasia ectodrmica anidrtica, que uma anomalia caracterizada pela ausncia das glndulas sudorparas. Esse gene se localiza no cromossomo sexual X. Algumas mulheres, portadoras desse gene em heterozigose, ficam com a pele toda manchada, formando um mosaico de manchas claras e escuras, quando se passa um corante sobre a pele.

A anlise desses caritipos revela que, nessa espcie, a determinao do sexo feita por um sistema, em que o macho e a fmea so, respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 659. A anlise do caritipo de exemplares de uma dada espcie revelou que o nmero diplide idntico em ambos os sexos e que o sexo heterogamtico o feminino. Com base nesses dados, possvel dizer que o sistema de determinao do sexo nessa espcie do tipo a) XX : XY b) XX : XO ) XX : YO d) ZZ : ZW e) ZZ : ZO [D] 660. Leia com ateno a tirinha a seguir:

57 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

670. Um casal no hemoflico teve um filho do sexo masculino com hemofilia. Indique a alternativa com a probabilidade desse casal ter uma filha hemoflica: a) 0% b) 25% c) 50% d) 75% e) 100% [A] 671. A distrofia muscular de Duchenne devida a um gene recessivo, ligado ao cromossomo X. O heredograma a seguir refere-se a uma famlia com esta anomalia. A probabilidade de A ser portador da anomalia, sabendo-se que a mulher B homozigota de

a) Explique a formao dessas manchas do ponto de vista gentico. b) Por que esse mosaico no pode aparecer em um homem? a) A mulher que heterozigota para esse gene, em funo da inativao ao acaso de um dos cromossomos X, apresentar regies da pele em que o gene normal ser ativo e outras regies em que o gene anormal ser o gene ativo. b) Os homens s tm um cromossomo X, que sempre funcional e portador de apenas um dos dois genes. Se o cromossomo X do homem tiver o gene em questo, toda sua pele estar comprometida, caso contrrio toda sua pele ser normal. 665. Em galinhas, a cor das penas apresenta herana ligada ao sexo. O alelo dominante determina penas barradas e o recessivo, penas pretas. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as geraes F1 e F2: I. machos homozigticos de penas barradas fmeas de penas pretas II. machos de penas pretas fmeas de penas barradas Assinale a alternativa que indica corretamente as geraes nas quais espera-se encontrar galinhas pretas. a) I F1: galinha barrada; F2: galinha barrada II - F1: galinha preta; F2: galinha barrada b) I - F1: galinha barrada; F2: galinha preta II - F1: galinha preta; F2: galinha preta c) I - F1: galinha barrada; F2: galinha barrada II - F1: galinha preta; F2: galinha preta d) I - F1: galinha preta; F2: galinha barrada II - F1: galinha barrada; F2: galinha preta e) I - F1: galinha barrada; F2: galinha preta II - F1: galinha barrada; F2: galinha preta [B] 666. Um estudante, ao analisar os cromossomos de 'Drosophila', encontrou a proporo de 1X : 2A (onde a letra A simboliza o conjunto haplide de autossomos). Alm disso, no observou a presena do cromossomo Y. Analisando os dados do estudante, podemos concluir que a mosca a) uma fmea normal. b) uma fmea aneuplide. c) um macho normal. d) um macho estril. e) um intersexuado. [D] 667. O estudo de linhagens de galinhas em que aparecia uma anomalia hereditria mostrou que fmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fmeas normais. A anomalia, provavelmente, determinada por gene a) autossmico dominante. b) autossmico recessivo. c) recessivo ligado ao cromossomo X. d) recessivo ligado ao cromossomo Z.. e) dominante ligado ao cromossomo Z.. [E] 668. Um homem afetado por uma doena gentica muito rara, de herana dominante, casa-se com uma mulher, no consangnea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual ser a proporo esperada de filhas e filhos afetados pela doena do pai no caso do gene em questo estar localizado. a) em um autossomo; b) no cromossomo X. a) 6 crianas b) Nenhum dos filhos ser afetado (XaY) e todas as filhas (XAXa) sero afetadas. 669. A hipertricose auricular (plos na orelha) transmitida apenas pelo homem e somente para os filhos do sexo masculino. Este fenmeno chamado de: a) epistasia. b) codominncia. c) herana holndrica. d) pleiotropia. e) interao gnica. [C]

a) 1/8 [C]

b) 3/8




672. Um homem tem av materna e pai com viso normal e av materno e me com daltonismo. Assinale a alternativa correta quanto aos gentipos do homem e de seus avs maternos. a) Homem - XdY, Av - XDXd, Av - XdY b) Homem - XDY, Av - XDXd, Av - XdY c) Homem - XdY, Av - XDXd, Av - XDY d) Homem - XDY, Av - XDXd, Av - XDY e) Homem - XdY, Av - XdXd, Av XdY [A] 673. Um homem hemoflico casa-se com uma mulher normal e homozigota para este carter. A probabilidade deste casal vir a ter uma filha hemoflica igual a: a) zero b) 50% c) 25% d) 12,5% e) 100% [A] 674. Em drosfila, a cor amarela do corpo determinada por um gene recessivo localizado no cromossomo X e a cor cinza, pelo alelo dominante. Assinale, a descendncia esperada a partir do cruzamento entre uma fmea amarela e um macho cinzento. a) machos: 100% amarelos - fmeas: 100% cinzentas. b) machos: 100% cinzentos - fmeas: 100% amarelas. c) machos: 100% amarelos - fmeas: 50% cinzentas e 50% amarelas. d) machos: 50% cinzentos e 50% amarelos - fmeas: 100% cinzentas. e) machos: 50% cinzentos e 50% amarelos - fmeas: 50% cinzentas e 50% amarelas. [A] 675. Considere o heredograma a seguir.

A partir da sua anlise, possvel concluir que a anomalia devida provavelmente a um alelo a) localizado no cromossomo Y. b) dominante, localizado no cromossomo X. c) recessivo, localizado no cromossomo X. d) dominante, situado num autossomo. e) recessivo, situado num autossomo. [C] 676. Observe a figura a seguir que apresenta o heredograma de uma famlia na qual alguns membros apresentam hemofilia, grave anomalia relacionada alterao no tempo de coagulao do sangue. Essa figura indica os grupos sangineos do sistema ABO de alguns dos seus membros.

58 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) transmitidas do pai s para as filhas. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. e) exclusivas das mulheres. [B] 680. Considerando que o heredograma a seguir o de uma herana dominante, ligada ao X, analise os itens:

Com base nas informaes do heredograma e considerando-se que no ocorreu mutao, INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia de 50%. b) a probabilidade de nascimento de outra criana hemoflica e do grupo B para o casal III-6 e III-7 de 25%. c) o indivduo III-4 pode receber sangue de III-6. d) o indivduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh. e) o indivduo I-1 heterozigoto para o sistema ABO. [B] 677. Analise o heredograma.

1. A mulher I.2 homozigota 2. A mulher I.2 heterozigota 3. A mulher II.4 homozigota 4. A mulher III.5 heterozigota 5. A mulher III.9 homozigota Est(o) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 anulado 681. O gene h que determina a hemofilia na espcie humana recessivo e esta localizado no cromossomo X . Com base no heredograma a seguir, podemos afirmar corretamente:

Em relao caracterstica representada no heredograma, todas as alternativas so possveis, EXCETO a) A herana pode ser autossmica. b) A herana pode ser ligada ao sexo. c) A herana pode representar uma famlia de hemoflicos. d) I-1 e I-2 podem ser heterozigotos. e) II-2, II-5 e III-1 podem ser homozigotos dominantes. [E] 678. Observe a figura.

a) O gentipo da Sra 5 XHXH. b) O gentipo da Sra 5 XHXh. c) O gentipo da Sra 8 XHXH. d) O gentipo da Sra 9 XHY. e) O gentipo da Sra 8 XhXh. [B] 682. O daltonismo uma doena hereditria e ligada ao sexo na espcie humana. Se um homem daltnico, casa-se com uma mulher normal, no portadora do gene para o daltonismo, a probabilidade desse casal ter um filho homem e daltnico, : a) 25 % b) 8 % c) 12,5 % d) 0 % [D] Essa figura representa a herana do carter mancha negra numa espcie de peixes em que a determinao do sexo segue o padro mais comum nas aves. Com relao ao padro de herana desse carter, correto afirmar-se que a) a probabilidade do casal em F1 ter um descendente macho e sem mancha negra zero. b) a probabilidade de uma fmea com mancha, cruzada com macho sem mancha, ter descendentes machos sem mancha de 50%. c) as fmeas de F e P sem mancha negra possuem gentipos diferentes, d) o carter mancha negra exclusivo de indivduos homozigotos. e) o sexo heterogamtico nessa espcie de peixes o masculino. [A] 679. Na espcie humana, a determinao cromossmica do sexo dada pelos cromossomos X e Y. O cromossomo Y apresenta genes holndricos, isto , genes que no possuem homologia com o cromossomo X. As caractersticas condicionadas por tais genes so a) transmitidas da me para 100% das filhas. b) transmitidas do pai para 100% dos filhos homens. 683. Na espcie humana a determinao sexual feita por um par de cromossomos, X e Y. O indivduo do sexo feminino apresenta dois cromossomos X enquanto que o indivduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Com base neste texto INCORRETO afirmar: a) O sexo masculino heterogamtico e sempre o homem quem determina o sexo dos filhos b) O sexo feminino homogamtico e o gameta feminino normal sempre apresenta um cromossomo X c) na mulher um cromossomo X est sempre condensado e recebe o nome de cromatina sexual d) A hipertricose auricular uma caracterstica restrita ao sexo masculino, pois o gene est localizado no cromossomo Y e) Toda doena hereditria e recessiva ligada ao cromossomo X s afeta as mulheres [E] 684. Um homem de viso normal e com nmero normal de dedos casa-se com uma mulher polidctila e daltnica. Sabendo-se que a polidactilia uma herana autossmica dominante, assinale a alternativa correta.

59 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) Esse casal poder ter uma filha polidctila e daltnica. b) A me dessa mulher ter obrigatoriamente o mesmo gentipo para o daltonismo que ela. c) O pai dessa mulher daltnico. d) A mulher obrigatoriamente filha de pai e me polidctilos. e) Os filhos homens desse casal sero sempre daltnicos e no polidctilos. [C] 685. Assinale a NICA proposio CORRETA. Em um indivduo daltnico, do sexo masculino, o gene para o daltonismo encontra-se: 01. em todas as clulas somticas. 02. em todas as clulas gamticas. 04. apenas nas clulas do globo ocular. 08. apenas nas clulas-me dos gametas. 16. apenas nos gametas com cromossomo y. 01 686. O raquitismo resistente vitamina D uma doena determinada por um gene dominante de herana ligada ao sexo. Na prole de um homem afetado casado com uma mulher normal, espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. b) tanto os filhos quanto as filhas sejam sempre afetados. c) tanto os filhos quanto as filhas sejam sempre normais. d) apenas as filhas sejam afetadas. e) apenas os filhos sejam afetados. [D] 687. Na genealogia a seguir, os smbolos cheios representam pessoas afetadas por uma doena gentica rara.

I - 100% dos filhos homens do casal 3 e 4 sero daltnicos; II - 50% das filhas do casal 3 e 4 sero normais portadoras, e 50%, daltnicas; III - No possvel identificar o gentipo de 2; IV - 100% das filhas do casal 3 e 4 sero normais portadoras. a) Todas as afirmaes so verdadeiras. b) Apenas as afirmaes I e II so verdadeiras. c) Apenas as afirmaes I, III e IV so verdadeiras. d) Apenas as afirmaes II e III so verdadeiras. e) Apenas as afirmaes II e IV so verdadeiras. [D] 691. Considere as seguintes afirmaes sobre uma mulher hemoflica: I- seu pai hemoflico. II- sua me possui um gene para a hemofilia. III- sua av paterna NO apresenta o gene para a hemofilia. Sabendo-se que o gene em questo recessivo e ligado ao sexo, e excluindo-se a possibilidade de mutao, possvel considerar que APENAS a) I verdadeira. b) II verdadeira. c) III verdadeira. d) I e II so verdadeiras. e) I e III so verdadeiras. [D] 692. Um casal tem uma criana de sexo masculino e hemoflica. correto afirmar, com certeza, que: a) o pai normal. b) o pai normal e a me hemoflica. c) o pai e a me so hemoflicos. d) ela recebeu da me o gene para a hemofilia. e) se ela tiver um irmo, este ser hemoflico tambm. [D] 693. O gene que determina o daltonismo na espcie humana caracteriza o seguinte tipo de herana a) autossmico dominante. b) dominante ligado ao sexo. c) autossmico recessivo. d) recessivo ligado ao sexo. e) interao gnica. [D] 694. Na espcie humana, o gentipo para hemofilia XHY, fenotipicamente representa: a) homem normal b) homem hemoflico c) mulher normal d) mulher hemoflica e) homem normal, porm portador [A] 695. Em moscas de frutas, a cor branca dos olhos devida herana ligada ao sexo. Uma mosca fmea com olhos coloridos, cuja me tinha olhos brancos, cruza-se com macho de olhos brancos. Qual a probabilidade de se obter uma fmea de olhos brancos deste cruzamento? a) 1,00. b) 0,67. c) 0,50. d) 0,25. e) 0,00. [D] 696. Existe uma doena condicionada por um gene recessivo, localizado na regio no homloga do cromossomo X, que leva a uma debilidade muscular progressiva (distrofia muscular progressiva). - Uma mulher com fentipo normal tem um irmo afetado e um tio materno tambm afetado pela doena; - seus pais no so afetados; - ela est casada com um homem normal. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doena? a) Se a mulher for homozigota, a probalidade 100%.

O padro de herana que melhor explica o heredograma a) autossmico dominante, porque a doena afeta os dois sexos. b) autossmico dominante, porque a doena aparece em todas as geraes. c) autossmico dominante, porque aproximadamente 50% da prole afetada. d) dominante ligado ao sexo, porque todas as filhas de homens afetados so afetadas. e) recessivo ligado ao sexo, porque no h transmisso de homem para homem. [D] 688. Em relao aos cromossomas sexuais X e Y, so feitas as seguintes afirmaes: I - quando pareados, so exemplos de cromossomas homlogos; II - caractersticas como a hemofilia, por exemplo, fazem parte do cromossoma X, III - caractersticas como o daltonismo, por exemplo, esto associadas a gens do cromossoma Y. Esto corretas as seguintes afirmaes: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. [B] 689. Uma mulher, filha de pai normal e me portadora do gene para o daltonismo, casa-se com um homem daltnico e tem uma criana do sexo masculino e daltnica. correto afirmar que: a) essa mulher daltnica. b) essa mulher poderia ter uma irm daltnica. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo. d) o gentipo dessa mulher igual ao de sua me. e) essa mulher no poder ter uma filha daltnica. [D] 690. O daltonismo uma anomalia que apresenta um tipo de herana ligada ao sexo. De acordo com o heredograma, analise as afirmaes de I a IV e assinale a alternativa correta.

60 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) Se a mulher for homozigota, a probabilidade zero. c) Se a mulher for homozigota, a probabilidade 25%. d) Se a mulher for heterozigota, a probabilidade 75%. e) Se a mulher for heterozigota, a probabilidade 100%. [B] 697. Uma criana do sexo feminino, daltnica e canhota, possui pai daltnico e destro e me de viso normal e canhota. Sabendo que o uso da mo esquerda uma caracterstica recessiva, ento a probabilidade do segundo filho ser do sexo masculino e com fentipos dominantes : a) b) c) 1/6 d) 1/8 e) 1 [D] 698. Acerca da relao entre os cromossomos de um menino e os de seus avs, fizeram-se as seguintes afirmaes: I. Seu cromossomo Y descendente do Y de seu av paterno. II. Seu cromossomo X descendente de um X de sua av paterna. III. Entre seus autossomos, h descendentes de autossomos de seus avs. Dessas afirmaes, esto corretas APENAS a) I b) II c) III d) I e III e) II e III [D] 699. O heredograma a seguir representa uma famlia em que um dos filhos afetado por doena determinada por um alelo recessivo localizado no cromossomo X.

703. Ao fazer um exame de vista para tirar carteira de motorista, um rapaz descobriu que era daltnico. Assinale entre as alternativas a seguir, aquela que contm o heredograma que NO poderia representar a famlia desse rapaz.

a) 1 [B]

b) 2

c) 3

d) 4

704. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos. No homem, o gene (h) para hemofilia est localizado no cromossoma X e recessivo em relao ao gene (h+) para coagulao normal do sangue. Com base nesta informao, correto afirmar: 01) Um homem hemoflico, casado com uma mulher homozigota normal, ter 50% de seus filhos afetados, independentemente do sexo. 02) Uma mulher, filha de um indivduo hemoflico, certamente ser hemofilica. 04) Um homem hemoflico, casado com uma mulher homozigota normal, ter todos os seus filhos normais, independentemente do sexo. 08) Um homem hemofilico teve uma filha normal. A probabilidade desta mulher ter uma criana do sexo masculino e hemofilico igual a 1/4. 04 + 08 = 12 705. Observe a rvore genealgica a seguir, referente a uma famlia com herana para daltonismo (herana ligada ao sexo e deve-se a um gene recessivo).

Se uma das irms desse indivduo casar-se com um homem sadio, a probabilidade desse casal ter um menino afetado a) b) c) d) 1/8 e) 1/16 [D] 700. Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como no so completamente homlogos, no se pareiam na meiose. b) como so completamente homlogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma regio homloga. d) no se pareiam na meiose, pois possuem uma regio no homloga. e) os genes que se encontram na regio no homloga do X condicionam um tipo de herana chamado herana restrita ao sexo. [C] 701. Observe o esquema a seguir:

Relativamente aos indivduos anteriores, podemos afirmar: a) somente o indivduo 2 daltnico b) o gentipo do indivduo 4 XdY c) o indivduo 1 normal, porm portador do gene para o daltonismo d) os indivduos 4 e 5 so daltnicos [D] 706. "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos so decorrentes de mutaes novas, isto , a doena se manifesta em meninos que no tem histria familiar de hemofilia." Quando nos debruamos sobre a hemofilia, aprendemos que ela mais comum nos homens porque: a) os homens so mais propensos doena devido influncia do hormnio testosterona. b) sendo uma herana ligada ao sexo, suficiente nos homens apenas um alelo para que a doena se manifeste. c) mulheres hemoflicas precisam de dois alelos dominantes, ao passo que os homens s necessitam de um alelo. d) mulheres hemoflicas morrem nos primeiros sangramentos menstruais. e) causada por um alelo tpico do cromossoma Y, que , masculinizante. [B] 707. Analise o heredograma.

A anlise do esquema permite formular as concluses a seguir, EXCETO uma. Indique-a. a) O casal 1/2 nunca formar mulheres hemoflicas. b) O casal 5/6 formar homens hemoflicos. c) O gentipo de 4 ser XHY. d) O gentipo de 6 ser XHXH ou XHXh. e) O indivduo 5 com certeza hemoflico. [D] 702. O daltonismo condicionado por um gene recessivo ligado ao sexo. Um homem normal casou-se com uma mulher daltnica. A probabilidade de terem um filho homem e normal de: a) 0 b) c) 1/3 d) e) 1 [A]

61 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Assinale a alternativa que NO contm um tipo de herana compatvel com a anomalia representada no heredograma. a) Ligada ao X. b) Autossmica recessiva. c) Ligada ao Y. d) Autossmica dominante. [A] 708. A tabela a seguir classifica caractersticas hereditrias da espcie humana. Assinale a alternativa que corresponde classificao correta.

a) Os indivduos 1 e 2 so homozigotos normais. b) O indivduo 8 portador do gene para hemofilia. c) O indivduo 9 no pode ser hemoflico. d) Todos os filhos e filhas do indivduo 10 sero hemoflicos. e) O indivduo 14 pode ser homo ou heterozigoto. [B] 711. Com relao colorao da pelagem de gatos, observam-se os seguintes fentipos:

[B] 59. No grfico abaixo temos representado um exemplo de doena ligada ao sexo onde apenas o indivduo IV afetado. Feita a anlise desse grfico, podemos afirmar corretamente que:

Utilizando as informaes anteriores, julgue os itens a seguir. (0) O carter cor da pelagem, nos gatos, condicionado por genes ligados ao cromossomo X, no havendo dominncia. (1) As fmeas manchadas so heterozigotas para o carter cor da pelagem. (2) Os descendentes de uma fmea amarela, cruzada com um macho preto, sero manchados. (3) Um gato macho no transmite para seus filhos machos os genes para cor da pelagem. Itens corretos: 0, 1 e 3 Item errado: 2 712. O raquitismo resistente vitamina D uma doena provocada por um gene dominante ligado ao X. Do casamento entre uma mulher afetada e um homem normal, nasceu uma menina normal. A probabilidade do nascimento de um menino tambm normal : a) 50 % b) 75 % c) 25 % d) 100 % e) 0 [C] 713. Um homem hemoflico e uma mulher daltnica tiveram um filho com sndrome de Klinefelter (47, XXY). Admitindo-se que o gameta anormal tenha sido produzido pela mulher, espera-se que esse filho do casal seja a) normal, quanto hemofilia e ao daltonismo. b) daltnico e hemoflico. c) daltnico ou hemoflico. d) apenas hemoflico. e) apenas daltnico. [E] 714. A enzima G-6-PD (glicose-6-fosfato desidrogenase) est presente nas hemcias de indivduos normais. A ausncia dessa enzima, em indivduos afetados, torna as hemcias sensveis a certas drogas e nutrientes, provocando sua destruio. O gene que determina a ausncia de G-6-PD recessivo e situase no cromossoma X. Observe o heredograma que representa uma famlia com essa caracterstica.

a) a anomalia causada por um gen dominante. b) o indivduo I obrigatoriamente homozigoto. c) o cromossoma Y paterno pode apresentar o gen para a doena. d) o casal apresenta 50% de probabilidade de ter filhas afetadas. e) os indivduos III e V podem ser homozigotos ou heterozigotos. [E] 709. Os genes presentes nos cromossomos, em conjunto com fatores ambientais, determinam as caractersticas individuais dos seres vivos. Em relao a esse assunto, julgue os seguintes itens. (0) Nas regies no-homlogas dos cromossomos sexuais, intensa a atividade de recombinao gnica. (1) Gmeas univitelinas podem apresentar diferenas fenotpicas relacionadas aos genes localizados no cromossomo X. (2) Quanto maior a variabilidade gentica de uma populao, maior o nmero de genes em homozigose. (3) Cada um dos cromossomos do caritipo humano contm o mesmo nmero de genes. Item correto: 1 Itens errados: 0, 2 e 3 710. A hemofilia uma doena gentica cuja herana ligada ao sexo. Analise o heredograma adiante e assinale a alternativa correta.

62 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Com base nesse heredograma, CORRETO afirmar que a) cada um dos indivduos representados tem, pelo menos, um gene para ausncia de G-6-PD. b) essa famlia apresenta dois indivduos heterozigotos para o gene que determina a G-6-PD. c) casais como I.1 x I.2 tm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. d) o indivduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua me. [B] 715. A hipertricose auricular uma anomalia gentica condicionada por um gene localizado no cromossomo Y. Um homem com hipertricose casa-se, e todos os seus filhos so homens. Na prxima gerao dessa famlia esse gene se manifestar a) em todas as mulheres. b) em todos os homens. c) em 50% das mulheres e 50% dos homens. d) somente nas mulheres heterozigotas. e) somente nos homens heterozigotos. [B] 716. Observe os heredogramas a seguir, que tratam de um caso e hemofilia:

Assinale dentre as alternativas que se seguem, a(s) correta(s). 01. O daltonismo est relacionado com genes localizados em cromossomos autossmicos. 02. O daltonismo determinado por um gene recessivo, sendo que seu alelo dominante condiciona viso normal. 04. O indivduo 1 transmite a todas as suas filhas um cromossomo Xd. 08. O indivduo 8 tem o mesmo fentipo de sua av materna. 16. O casal 1 x 2 pode ter filhos homens daltnicos. 32. O gentipo do indivduo 9 XdY. 64. O gentipo do indivduo 5 XdXd. FVVVFVF 720. A engenharia gentica permitiu a introduo, em ratos, do gene humano para produo do hormnio de crescimento, levando produo de ratos gigantes. Estes ratos so considerados a) isognicos. b) transgnicos. c) infectados. d) mutantes. e) clones. [B] 721. O modelo molecular dos cidos nuclicos (DNA e RNA) foi proposto por J. Watson e F. Crick em 1953. Segundo esse modelo esses cidos so a) micromolculas. b) polipeptdeos. c) polinucleotdeos. d) enzimas. e) lipdios. [C] 722. A experincia do "liquidificador" realizada por Hersey e Chase demonstrou que a substncia que determinava a destruio de bactrias parasitadas pelos vrus bacterifagos era a) uma protena viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lpide viral. [D] 723. O experimento em que foi observado o fenmeno da "transformao bacteriana", ou seja, que bactrias no patognicas sem cpsula desenvolvem cpsula e causam a morte de camundongos foi realizada por a) Mendel. b) Morgan. c) Griffth. d) Lamarck. e) Darwin. [C] 724. A experincia do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material gentico formado por protenas. b) o material gentico formado de RNA. c) o material gentico formado de lipdios. d) o material gentico formado por acares. e) o material gentico formado de DNA. [E] 725. As evidncias de que o DNA a substncia hereditria que determina as caractersticas dos seres vivos foram primeiramente observadas em a) vrus. b) protozorios. c) caros. d) liquens. e) bactrias. [E] 726. O antibitico Estreptomicina age sobre as bactrias promovendo a leitura errada do RNAm, a Tetraciclina liga-se subunidade ribossmica menor e inibe a ligao do AA-RNAt, o Cloranfenicol inibe a peptidiltransferase na subunidade ribossmica maior e a Rifampicina inibe a RNA polimerase no stio de iniciao. Sabe-se que esses antibiticos so substncias cuja utilizao mdica se baseia na inibio das clulas bacterianas atuando no mecanismo de: a) fagocitose. b) secreo de substncias. c) sntese protica. d) produo de energia. e) reproduo celular. [C] 727. Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir:

Sabendo que o indivduo 7 do sexo feminino, a probabilidade de apresentar hemofilia : a) 1 b) c) d) 1/8 e) 1/16 [B] 717. Um casal que possui viso normal para as cores, tem 3 filhos com as seguintes caractersticas: - menina com viso normal para as cores; - menino com viso normal para as cores; - menino com daltonismo. Sabendo-se que o daltonismo uma herana ligada ao X, a possibilidade de esse casal ter uma filha com daltonismo a) zero. b) 1/4. c) 1/2. d) 3/4. e) 1. [A] 718. Em 'Drosophila', a cor dos olhos determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y. A cor vermelha determinada pelo gene W+, enquanto a cor branca devida ao gene W. Um macho de olhos brancos foi cruzado com uma fmea heterozigota. Considerando que nesses indivduos o sexo heterogamtico o masculino, a porcentagem de indivduos de olhos brancos em F1 ser de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % [E] 719. A genealogia abaixo nos mostra uma forma de transmisso do daltonismo.

63 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

O resultado esperado para este trabalho que as clulas que receberam o implante: a) morram pela presena de cido nuclico estranho composio do ncleo. b) morram por ficarem prejudicadas na realizao da sntese protica. c) reproduzam-se, produzindo clulas defeituosas incapazes de sobreviverem. d) reproduzam-se, transferindo as caractersticas implantadas para as clulasfilhas. e) cresam, produzindo anticorpos contra as protenas estranhas que sero fabricadas. [D] 728. O estudo do mecanismo da sntese de protenas no interior das clulas, confirma que: a) a transcrio gnica caracteriza-se pela autoduplicao do DNA b) trs tipos de RNA participam do processo c) os anticdons localizam-se no RNA-m d) os cdons so trincas de bases nitrogenadas do RNA-t e) no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado [B] 729. "A nova tecnologia do DNA recombinante est permitindo que cientistas dos pases do primeiro mundo desenvolvam um projeto denominado GENOMA que tem por objetivo seqenciar os cerca de 3 bilhes de bases nitrogenadas que compem os cromossomos de um ser humano. Ao lado dos inmeros benefcios desse projeto, algumas questes de cunho tico tm sido levantadas." Em relao a esse projeto, o procedimento que pode afetar diretamente o equilbrio gentico de populaes humanas a) a deteco de indivduos superdotados intelectualmente por meio de procedimentos laboratoriais. b) o aumento de seleo gentica ou gamtica artificial. c) o emprego de testes genticos como um novo critrio para admisso a empregos. d) o registro de patentes de seqncias do genoma humano para especulao mercadolgica. e) o uso de testes pr-sintomticos para a realizao de seguros de vida. [B] 730. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Clones so seres vivos obtidos pelo desenvolvimento de clulas retiradas de indivduos j existentes. A clonagem um processo que vem sendo desenvolvido rapidamente com vrios organismos e, em humanos, encontra barreiras de ordem tica. Sobre esse processo CORRETO afirmar: 01. Os clones so como irmos gmeos fraternos do doador das clulas. 02. O material gentico do doador das clulas e do clone idntico. 04. Se o doador das clulas possuir um defeito gentico, como o albinismo, seu clone possuir, tambm, essa anomalia. 08. rgos transplantados do clone para o doador das clulas sero sempre rejeitados. 16. J existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. 32. Se o doador de clulas sofrer a perda de um membro antes de ser realizada a clonagem, o organismo originado posteriormente, por esse processo, nascer sem o referido membro. 02 + 04 = 06 731. Enzimas de restrio so fundamentais Engenharia Gentica porque permitem a) a passagem de DNA atravs da membrana celular. b) inibir a sntese de RNA a partir de DNA. c) inibir a sntese de DNA a partir de RNA. d) cortar DNA onde ocorrem seqncias especficas de bases. e) modificar seqncias de bases do DNA. [D] 732. Duas mulheres disputam a maternidade de uma menina. Foi realizada a anlise de um mesmo trecho do DNA, obtido de um dos cromossomos X de cada mulher e da menina. As seqncias de bases do referido trecho gnico esto esquematizadas adiante:

Os dados obtidos a) so suficientes para excluir a possibilidade de qualquer uma das mulheres ser a me da menina. b) So suficientes para excluir a possibilidade de uma das mulheres ser a me da menina. c) no so suficientes, pois o cromossomo X da menina analisado pode ser o de origem paterna. d) no so suficientes, pois a menina recebe seus dois cromossomos X da me e apenas um deles foi analisado. e) no podem ser considerados, pois uma menina no recebe cromossomo X de sua me. [C] 733. As tcnicas utilizadas pela Engenharia Gentica permitem qu se atue em uma substncia presente em todas as clulas, procariontes e eucariontes, sendo responsvel pelo controle do seu metabolismo. Essa substncia se denomina a) DNA, e formada por cadeias polipeptdicas que apresentam em sua composio os aminocidos adenina, uracila, citosina e guanina. b) DNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, citosina, guanina e timina. c) RNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, timina, citosina e guanina. d) polimerase, e formada por aminocidos que apresentam em sua composio a desoxirribose. e) transcriptase, e formada por aminocidos que apresentam em sua composio a ribose. [B] 734. Clone um populao de seres geneticamente idnticos, originados pela multiplicao assexuada de um nico genitor ou por manipulao citogentica. Recentemente os jornais publicaram uma receita de clonagem para "fazer a ovelha "Dolly" da raa "Finn Dorset". A receita prope os seguintes passos: Os cientistas retiraram vulos de uma ovelha adulta da raa "Scottish Blackface". Deles removeram os ncleos e guardaram o resto. Foram retiradas as clulas das glndulas mamrias de uma ovelha adulta da raa "Finn Dorset". Delas so retirados os ncleos, que so guardados. Os ingredientes foram colocados numa soluo qumica para "hibernar" e esperar um tempo para serem encaixados nos vulos anucleados. Os cientistas, transferiram o ncleo da clula mamria para o vulo da ovelha "Scottish Blackface" Passado um tempo, ele comeou a se dividir, formando um aglomerado de clulas. O aglomerado celular foi transferido para o aparelho reprodutor da ovelha "Scottish Blackface". Dele se formou um embrio que deu origem Dolly. Tomando por base o texto, podemos afirmar que: a) A clonagem est correta mas no revela a tecnologia necessria para as clulas "hibernarem" e acertarem o tempo, tambm necessrio, para a transferncia do ncleo para o vulo anucleado. b) "Dolly" no tem pai mas , certamente, filha da ovelha da raa "Scottish Blackface", que cedeu o vulo anucleado. c) A clonagem est errada, pois o pai a ovelha da raa "Finn Dorset", uma vez que no seu gentipo h cromossomos de seu av. d) A clonagem est correta, pois a genitora a ovelha da raa "Scottish Blackface", uma vez que "Dolly" veio de seu vulo. e) H uma falha tcnica no experimento, pois ncleo de clula de glndula mamria no pode influir nas caratersticas da "Dolly". [A] 735. Uma experincia realizada com coelhos (linhagem pura selvagem) consistiu em submet-los a uma descarga excessiva de raio-X. Aps o experimento, podemos esperar vrias reaes, EXCETO: a) produo de um filhote albino. b) produo de filhotes anormais. c) morte em conseqncia da dose de radiao. d) tornaram-se albinos. e) tornaram-se estreis. [D] 736. Recentemente, o mundo foi abalado pela notcia da produo do clone de uma ovelha. Nessa clonagem, utilizou-se o ncleo de uma clula da mama de uma ovelha (A) e o citoplasma de um vulo de outra ovelha (B). CORRETO concluir que:

64 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) todos os cromossomos do clone so iguais aos da ovelha A. b) os autossomos do clone so iguais aos da ovelha A, e os cromossomos sexuais so iguais aos da ovelha B. c) todos os cromossomos do clone so iguais aos da ovelha B, e os cromossomos sexuais so iguais aos da ovelha A. d) os autossomos do clone so iguais aos da ovelha B, e os cromossomos sexuais so iguais aos da ovelha A. e) existem cromossomos no clone que so diferentes de A e de B. [A] 737. Uma maneira de se obter um clone de ovelha transferir o ncleo de uma clula somtica de uma ovelha adulta A para um vulo de uma outra ovelha B do qual foi previamente eliminado o ncleo. O embrio resultante implantado no tero de uma terceira ovelha C, onde origina um novo indivduo. Acerca do material gentico desse novo indivduo, pode-se afirmar que a) o DNA nuclear e o mitocondrial so iguais aos da ovelha A. b) o DNA nuclear e o mitocondrial so iguais aos da ovelha B. c) o DNA nuclear e o mitocondrial so iguais aos da ovelha C. d) o DNA nuclear igual ao da ovelha A, mas o DNA mitocondrial igual ao da ovelha B. e) o DNA nuclear igual ao da ovelha A, mas o DNA mitocondrial igual ao da ovelha C. [D] 738. Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da tcnica de clonagem. Esses pesquisadores retiraram o ncleo da clula de uma ovelha (A) e o implantaram num vulo colhido de uma outra ovelha (B), do qual o ncleo fora previamente removido. Esse vulo fora posteriormente implantado no tero de uma terceira ovelha (C), originando Dolly. A partir dos dados envolvidos no experimento realizado pelos pesquisadores, pode-se prever que Dolly apresente a) constituio cromossmica da ovelha A e DNA mitocondrial da ovelha B. b) constituio cromossmica e DNA mitocondrial da ovelha A. c) constituio cromossmica e DNA mitocondrial da ovelha B. d) constituio cromossmica da ovelha A e DNA mitocondrial da ovelha C. e) constituio cromossmica e DNA mitocondrial correspondente a uma mistura das trs ovelhas. [A] 739. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos. Em parte motivada pela necessidade mundial de aumentar a produo de alimentos, a cincia do melhoramento gentico procura encontrar solues que aumentem a produtividade de certas espcies. Muitas vezes, usando tcnicas sofisticadas, os cientistas provocam modificaes nessas espcies em busca de seus benefcios e atuam semelhana da natureza. Leia o texto adiante e compare-o com o esquema. "Nos prximos meses chegam s lavouras dos Estados Unidos e Canad sementes de milho, batata e algodo alteradas geneticamente em laboratrio, para destruir as pragas que atacam essas culturas. Os cientistas alteraram o cdigo gentico dessas sementes e, nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma protena inseticida. Essa protena, quando ingerida com as folhas, matava os insetos que atacavam as plantaes. Livre dos mesmos, a produtividade das lavouras ser bem maior." (Veja, 21/02/1996) - Da comparao entre o texto e o esquema, correto afirmar:

740. "EXAME DE PATERNIDADE, NO BRASIL, J PODE SER FEITO COM SALIVA" "Novo teste pode, pela anlise do DNA das clulas, identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. Esse tipo de teste particularmente indicado para bebs e crianas pequenas." Nesse tipo de teste, a semelhana estrutural existente entre as molculas de DNA tomada por base para a identificao da paternidade. Essa diferena consiste na(o): a) seqncia de bases nitrogenadas. b) aspecto da dupla hlice presente. c) nmero de fosfatos contidos. d) tipo de pentose existente. e) tipo de desoxirriboses presentes. [A] 741. "Tracy uma ovelha transgnica, capaz de produzir uma protena humana cuja deficincia causa problema heptico e pulmonar". Analise as afirmativas a seguir, referentes tcnica utilizada para obteno da Tracy. I. Animal transgnico aquele que recebe e incorpora genes de outra espcie. II. As substncias utilizadas para isolar o gene a ser transplantado so denominados ENZIMAS TRANSGNICAS. III. Para a ligao do DNA transplantado ao DNA hospedeiro a clula utiliza a ENZIMA LIGASE. IV. A tcnica do DNA recombinante foi utilizada para obteno de Tracy. Esto corretas apenas as afirmativas: a) II e III. b) I, II e III. c) I, II e IV. d) I, III e IV. e) II, III e IV. [D] 742. Enquanto o projeto que visa seqenciar completamente o genoma humano segue seu curso, nos ltimos 2 anos chegaram ao fim vrios seqenciamentos do genoma de bactrias. Em setembro de 1997, foi publicada a sequncia do DNA da bactria 'Escherichia coli.' Os nmeros impressionam: so cerca de 4,6 milhes de pares de bases, e os genes que codificam protenas so 4.288. Para surpresa de muitos, 38% desses genes ainda no tm uma funo conhecida. Com o auxlio do texto, julgue os itens a seguir. (1) O DNA da bactria 'Escherichia coli' tem cerca de 9,2 milhes de molculas de fosfato. (2) Para 38% dos genes, no se sabe a sequncia de amionocidos da protena. (3) Pode-se fazer estudos da evoluo das bactrias, comparando-se a sequncia de DNA de diferentes espcies. (4) A 'Escherichia coli' pode produzir 8.576 RNAs mensageiros diferentes. CECE 743. Est em andamento o projeto GENOMA, pelo qual se pretende seqenciar totalmente o DNA humano, ou seja, obter a seqncia de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. A esse respeito, julgue os itens que se seguem. (0) Uma vez obtida a seqncia de um gene, ser possvel conhecer a seqncia de aminocidos da protena correspondente. (1) As seqncias obtidas correspondero exatamente ao DNA de qualquer pessoa. (2) A seqncia de todos os cromossomos ser do mesmo tamanho. (3) O projeto GENOMA tem levantado questes ticas, pelo eventual uso inadequado que se possa fazer do conhecimento obtido, como, por exemplo, a discriminao de pessoas. (4) Todos os genes tero a mesma proporo de adenina e guanina. Itens corretos: 0 e 3 Itens errados: 1, 2 e 4 744. Os morangos de excelente qualidade que se encontram atualmente nos supermercados so produto principalmente de tcnicas de propagao vegetativa "in vitro". A partir de clulas de um morangueiro, faz-se uma cultura de tecidos e, a partir desta, obtm-se plantas adultas. Essas tcnica permite, por exemplo, a eliminao de infeces virais presentes na planta-me e que, pelo procedimento tradicional, seriam passadas para as plantas-filhas. Com base nessa informao, julgue os itens adiante. (1) As plantas obtidas de uma mesma cultura de tecidos so geneticamente iguais. (2) Uma vantagem dessa tcnica que as plantas produzidas no so suscetveis ao ataque de pragas. (3) A cultura de tecidos vegetais facilita o melhoramento gentico de plantas, pois as clulas podem ser manipuladas geneticamente e, a partir delas, podem-se obter indivduos adultos com caractersticas alteradas. (4) Uma vez obtida uma variedade de morangueiro com as caractersticas ideais, no se justifica preservar as variedades silvestres, muito menos produtivas. Itens corretos: 1 e 3 Itens errados: 2 e 4 745. Desde que Watson e Crick propuseram um modelo para a estrutura do DNA, em 1953, tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular, do que exemplo a recente clonagem de uma ovelha. Julgue os itens a seguir, acerca do referido cido nuclico. (1) Apesar de ser o sexto elemento mais abundante no universo e o mais verstil de todos, o carbono no faz parte da estrutura do DNA.

01) A afirmativa "Os cientistas alteraram o cdigo gentico dessas sementes" est relacionada somente ao item 1 do esquema. 02) A afirmativa "Os cientistas alteraram o cdigo gentico dessas sementes" est relacionada aos itens 1, 2 e 4 do esquema. 04) A afirmativa "nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma protena inseticida" est relacionada aos itens 3 e 4 do esquema. 08) A afirmativa "nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma protena inseticida" est relacionada aos itens 4 e 5 do esquema. 16) A afirmativa "Livre dos mesmos, a produtividade das lavouras ser bem maior" refere-se ao item 6 do esquema. 01 + 08 + 16 = 25

65 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(2) A colorao de cromossomos com vrios matizes uma tcnica atual que se baseia no uso de vrios corantes para os diferentes lipdios que constituem os cromossomos. (3) No processo de recombinao entre cromtides, ocorre a troca de, no mnimo, um segmento de DNA que corresponde a um gene funcional. (4) As mutaes gnicas implicam necessariamente a modificao do fentipo do indivduo. (5) Nos processos de fecundao natural, a me transmite maior quantidade de DNA para o filho do que o pai. Item correto: 5 Itens errados: 1, 2, 3 e 4 746. As tcnicas modernas de biologia molecular tm permitido a insero de segmentos novos de DNA em clulas vegetais, em crescimento no meio apropriado, para gerar uma nova planta com novas caractersticas. Estes novos segmentos de DNA introduzidos podem, por exemplo, gerar novas plantas com reservas modificadas de lipdios, amido e protenas em suas sementes ou melhorar a resistncia das plantas a pestes e vrus ou ainda aumentar a sobrevivncia destes organismos em ambientes adversos. Estas novas plantas so exemplos de organismos criados por engenharia gentica e so genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgnicos [D] 747. Se retirarmos o ncleo de uma clula-ovo de r e o substituirmos por outro ncleo diplide de uma clula de tecido epitelial normal de r j adulta, a nova clula-ovo assim formada ser capaz de produzir outra r normal. Dentre as alternativas a seguir, a que apresenta a melhor explicao sobre o que ocorre neste caso, em relao sequncia funcional do DNA da clula diplide doadora, : a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na clula epitelial d) expressou-se como na clula germinativa [B] 748. Recentemente foi noticiada a criao de uma planta transgnica, capaz de produzir hemoglobina. Para que isso fosse possvel, essa planta recebeu: a) os anticdons que determinam a seqncia de aminocidos nessa protena. b) os ribossomos utilizados na produo dessa protena. c) o fragmento de DNA, cuja seqncia de nucleotdeos determina a seqncia de aminocidos da hemoglobina. d) O RNAm que carrega os aminocidos usados na sntese de hemoglobina. e) somente os aminocidos usados nessa protena. [C] 749. Na Argentina, durante a ditadura militar iniciada em 1976, muitas crianas foram seqestradas com seus pais ou nasceram em centros clandestinos de deteno. Essas crianas foram adotadas, vendidas ou abandonadas em orfanatos. A Associao Civil "Avs da Praa de Maio" tem buscado localizar essas crianas com a finalidade de restitu-las a suas famlias legtimas, empregando para isso testes de identificao gentica, que so possveis, atualmente, mesmo na ausncia dos pais. A comparao entre os DNAs mitocondriais de possveis netos e avs tem sido um dos testes utilizados nesses processos de identificao de parentesco. A escolha desse teste est relacionada com o fato a) de o DNA mitocondrial, por ser herdado da av materna, atravs das mitocndrias existentes no citoplasma do ovcito da me, permitir traar rvores familiares confiveis. b) de o DNA mitocondrial, por ser herdado das duas avs, atravs de uma mistura dos genes do pai e da me, garantir um registro familiar que se mantm de gerao a gerao. c) de o DNA mitocondrial, por ser herdado da av paterna, atravs das mitocndrias existentes no citoplasma do ovcito da me, permitir traar rvores familiares confiveis. e) de o DNA mitocondrial, por ser herdado do av paterno, atravs das mitocndrias existentes no citoplasma do espermatozide do pai, permitir identificar a filiao com segurana. [A] 750. Maria teve um filho, e Pedro, seu ex-namorado, nega a paternidade da criana, alegando que o filho pode ser de Paulo (irmo de Pedro), ou de Joo (primo de Pedro), ou ainda de um vizinho, Antnio. Para solucionar esse impasse, a famlia de Maria resolveu fazer um teste de paternidade, e o resultado foi o seguinte.

Assinale a alternativa que interpreta corretamente os resultados do teste. a) A criana no filha de nenhum dos supostos pais, pois todos os resultados foram menores que 85%. b) A criana filha de Pedro, pois, aproximadamente, 50% dos genes so herdados da me e 50%, do pai. c) A criana filha de Joo, pois, para se hibridizarem, os DNAs devem ser diferentes. d) O teste no foi conclusivo, pois deveramos ter hibridizado o DNA do pai com o da me. e) Pedro e Paulo so, na verdade, irmos adotivos. [B] 751. Todas as alternativas apresentam aplicaes da tecnologia do DNA recombinante nas duas ltimas dcadas, EXCETO a) Investigao de paternidade e criminalstica. b) Recuperao de espcies extintas. c) Produo, em bactrias, de protenas humanas de interesse mdico. d) Terapia gnica de algumas doenas hereditrias. [B] 752. Um pesquisador injetou RNA mensageiro (mRNA) de vrus em ovcitos de anfbios. Aps certo tempo, verificou que esses ovcitos, alm de suas prprias protenas, produziam, tambm, protenas virais. Esses dados sugerem que a) o DNA dos ovcitos foi impedido de se expressar. b) o mRNA se integrou ao DNA dos ovcitos, comandando a sntese da protena viral. c) o material injetado nos ovcitos foi capaz de se autoduplicar. d) os ovcitos foram capazes de interpretar a informao contida no mRNA viral. [D] 753. A seqncia a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. Retirou-se um vulo da vaca Z. O ncleo foi desprezado, obtendo-se um vulo anucleado. II. Retirou-se uma clula da glndula mamria da vaca W. O ncleo foi isolado e conservado, desprezando-se o resto da clula. III. O ncleo da clula da glndula mamria foi introduzido no vulo anucleado. A clula reconstituda foi estimulada para entrar em diviso. IV. Aps algumas divises, o embrio foi implantado no tero de uma terceira vaca Y, me de aluguel. O embrio se desenvolveu e deu origem ao clone. Considerando-se que os animais Z, W e Y no tm parentesco, pode-se afirmar que o animal resultante da clonagem tem as caractersticas genticas da vaca. a) Z, apenas b) W, apenas c) Y, apenas d) Z e da W, apenas e) Z, W e Y [B] 754. A seqncia a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. Retirou-se um vulo da vaca Z. O ncleo foi desprezado, obtendo-se um vulo anucleado. II. Retirou-se uma clula da glndula mamria da vaca W. O ncleo foi isolado e conservado, desprezando-se o resto da clula. III. O ncleo da clula da glndula mamria foi introduzido no vulo anucleado. A clula reconstituda foi estimulada para entrar em diviso. IV. Aps algumas divises, o embrio foi implantado no tero de uma terceira vaca Y, me de aluguel. O embrio se desenvolveu e deu origem ao clone. Se a vaca Y, utilizada como "me de aluguel", for a me biolgica da vaca W, a porcentagem de genes da "me de aluguel", presente no clone ser a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % [C] 755. CHEGA AO MERCADO UM NOVO FRMACO INTEIRAMENTE DESENVOLVIDO NO PAS A insulina humana recombinante (IH-r), um dos mais significativos produtos do avano cientfico nacional na rea da engenharia gentica, est prestes a chegar ao mercado, com o nome de Biohulin: a empresa BIOBRS, uma das quatro empresas em todo o mundo e a nica no hemisfrio sul a deter a tecnologia de produo desta insulina, inicia em 1999 a comercializao do produto.

66 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Uma parceria entre a BIOBRS e a Universidade de Braslia (UnB), em 1988, deu incio aos trabalhos. Ao grupo da UnB coube a parte de Biologia Molecular, desenvolvendo clones de bactrias produtoras de insulina. Esta conquista tecnolgica permitir o desenvolvimento de outros medicamentos, como o hormnio de crescimento, o interferon e a calcitonina. Informe PADCT/Ministrio da Cincia e Tecnologia, jan/99, p.7(com adaptaes). Com o auxlio do texto, julgue os itens abaixo. (1) As tcnicas de engenharia gentica permitem a recombinao de genes entre organismos totalmente diferentes. (2) Para que uma bactria passe a produzir insulina humana, ela deve receber altas doses dessa protena. (3) O Biohulin ser um medicamento destinado ao tratamento de diabticos. (4) A partir da insulina produzida por bactrias, pode ser obtido o hormnio de crescimento. VFVF 756. No filme "Jurassic Park", de Steven Spielberg, cientistas retiraram do intestino de insetos hematfagos fsseis molculas de DNA de dinossauros. A reconstituio dessas molculas teria sido feita atravs da insero de fragmentos de DNA de r. Apesar da eficincia proposta no filme, na prtica esse procedimento extremamente improvvel porque: a) seria necessrio encontrar um genoma completo e conhecer sua ordem nos cromossomas. b) a composio qumica do DNA dos dinossauros diferente das encontradas em espcies atuais. c) as caractersticas do organismo se devem estrutura primria das protenas e no do DNA. d) o DNA coletado sofre mutaes durante o perodo em que ficou fossilizado. e) no existem tcnicas para a insero de fragmentos de DNA de uma espcie em outra. [A] 757. Pesquisadores de alguns centros de pesquisa brasileiros, utilizando tcnicas de engenharia gentica, obtiveram, recentemente, plantas que produzem protenas humanas, entre as quais o hormnio do crescimento (GH). Estas plantas so chamadas transgnicas. Considere estas informaes e assinale a opo incorreta: a) O gene para a produo de GH , em geral, introduzido no plasmdeo antes de sua introduo na clula vegetal. b) a utilizao de clulas vegetais diminui a possibilidade de contaminao humana por vrus animais. c) Antes de se obter a planta produtora de GH necessria a produo do DNA recombinante. d) O RNA mensageiro, relacionado ao GH, quando introduzido na clula vegetal transcrito em DNA na presena da enzima transcriptase vegetal. e) O DNA relacionado sntese do GH pode ser obtido a partir do RNA mensageiro. [D] 758. No vaga-lume h um gene que determina produo de luciferase, enzima responsvel pela oxidao da substncia luciferina, levando produo de luz. Atravs da engenharia gentica, esse gene foi transferido para uma clula vegetal e, a partir desta, obteve-se uma planta inteira. Aps ser regada com soluo de luciferina, a referida planta comeou a emitir luz. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume, a partir do qual as clulas da planta produziram RNA e luciferase. b) incorporou um segmento de RNA do vaga-lume, a partir do qual as clulas da planta produziram DNA e luciferase. c) incorporou um segmento de DNA do vaga-lume, que possibilitou s clulas da planta a produo de luciferase. d) incorporou um segmento de DNA do vaga-lume, que no possibilitou a produo de RNA e nem de luciferase. e) no expressou o gene do vaga-lume. [C] 759. Em anfbios, realizaram-se experimentos em que os ncleos de clulas embrionrias foram transplantados para ovos de anfbios, que tiveram seus ncleos retirados. Considerando-se o total de ovos que no rejeitaram o ncleo transplantado, foi montado o grfico a seguir: A explicao para a diferena refletida no grfico que: a) os ncleos de mrula esto em um estgio em que todos os genes esto reprimidos. b) os ncleos de mrula so geneticamente distintos dos outros ncleos em questo. c) os ncleos de blstula e gstrula no receberam os estmulos citoplasmticos necessrios para o desenvolvimento do embrio. d) os ncleos de blstula e gstrula tm seus produtos gnicos eliminados por mecanismos de regulao. e) os ncleos de gstrula j se encontram em estgio de diferenciao. [E] 760. Os conhecimentos cientficos envolvendo a "clonagem" tm proporcionado humanidade grandes avanos e sua utilizao em vegetais tem sido mais fcil e menos controversa que em animais, porque a) os mecanismos de regulao gnica nos vegetais so mais simples, devido ao seu menor grau de complexidade. b) os embries resultantes da clonagem em vegetais so mais resistentes s modificaes ambientais. c) os vegetais apresentam, em sua maioria, a capacidade de propagao vegetativa, o que facilita a continuidade do processo. d) a regulao hormonal da reproduo nos vegetais mais facilmente controlada pelos cientistas. e) os vegetais produzem maior nmero de embries por indivduo, o que diminui a perda, em caso de rejeio. [C] 761. Os bacterifagos so constitudos por uma molcula de DNA envolta em uma cpsula de protena. Existem diversas espcies, que diferem entre si quanto ao DNA e s protenas constituintes da cpsula. Os cientistas conseguem construir partculas virais ativas com DNA de uma espcie e cpsula de outra. Em um experimento, foi produzido um vrus contendo DNA do bacterifago T2 e cpsula do bacterifago T4. Pode-se prever que a descendncia desse vrus ter: a) cpsula de T4 e DNA de T2. b) cpsula de T2 e DNA de T4. c) cpsula e DNA, ambos de T2. d) cpsula e DNA, ambos de T4. e) mistura de cpsulas e DNA de T2 e de T4. [C] 762. Em 1978, registrou-se o nascimento do primeiro beb gerado 'in vitro'. Desde ento, alguns aspectos ticos importantes vm sendo discutidos em relao s conseqncias da aplicao de tcnicas de reproduo humana assistida sobre o equilbrio gentico de populaes humanas. Todas as alternativas apresentam procedimentos que podem alterar esse equilbrio gentico, EXCETO a) Clonagem b) Doao de embries c) Seleo de embries d) Seleo de sexo [B] 763. Considere uma populao em que metade dos indivduos mantm-se heterozigota para um dado gene(Aa), enquanto que a outra metade composta por indivduos duplo-recessivos(aa). Nessa populao a frequncia do alelo A a) impossvel de se determinar. b) 1,00. c) 0,75. d) 0,50. e) 0,25. [E] 764. No heredograma adiante o indivduo 3 afetado pelo albinismo. Sabendo-se que, na populao, a frequncia de heterozigoto para o albinismo de 1/50, qual a probabilidade de que o casal 4x5 tenha uma menina albina?

67 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

768. Uma populao em equilbrio constituda de 500 indivduos, dos quais 45 apresentam um fentipo determinado por gene recessivo. Com base nesses dados INCORRETO afirmar-se que a) a freqncia de indivduos com fentipo dominante 91% b) cerca de 10% da populao homozigota. c) o gene dominante mais freqente que o recessivo. d) 30% dos gametas produzidos carregam o alelo recessivo. e) os heterozigotos representam 42% da populao. [B] 769. A cor da raiz da cenoura controlada por um par de genes autossmicos. O gene B responsvel pela cor branca e seu alelo recessivo, pela cor amarela. Um agricultor colheu 20.000 sementes de uma populao panmtica, que se cruza ao acaso, das quais 12.800 desenvolveram plantas com razes brancas. A partir dessas informaes pode-se afirmar que a) a freqncia do gene para colorao amarela de 36% nessa populao. b) a freqncia de heterozigotos nessa populao de 24%. c) a freqncia de plantas com razes amarelas ser de 64% se a populao se mantiver em equilbrio. d) a probabilidade de formao de gametas B de 80% nessa populao. e) a probabilidade de ocorrncia de homozigotos nessa populao de 52%. [E] 770. O grfico mostra as relaes entre as freqncias dos alelos A e a e as freqncia genotpicas AA, Aa e aa numa populao em equilbrio.

P = 1/600 765. A frequncia de indivduos afetados por uma anomalia gentica autossmica recessiva, em uma dada populao, era de 0,16. Constatou-se a diminuio dessa frequncia aps a) a morte de 5% da populao total por falta de alimento. b) a imigrao de muitos indivduos homozigotos dominantes. c) o nascimento de 48 indivduos afetados entre 300 nascidos. d) o casamento preferencial de indivduos heterozigotos. e) o crescimento da populao da populao devido a diminuio da predao. [B] 766. O grfico a seguir mostra a dinmica das freqncias do gene s, o qual determina a doena chamada siclemia ou anemia falciforme. Os homozigotos siclmicos morrem precocemente devido severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, so mais resistentes malria que os indivduos normais. O grfico refere-se ao perodo posterior erradicao da malria. Qual a explicao para o comportamento das curvas do grfico?

a) Diminuio da freqncia de mutao de S para s. b) Seleo contra os portadores do gene s. c) Aumento da freqncia de mutao de S para s. d) Cruzamentos preferenciais entre pessoas anmicas. e) Cruzamentos preferenciais entre portadores de malria. [B] 767. Uma populao humana foi testada quanto ao sistema MN de grupos sanguneos. Os dados obtidos compem a tabela a seguir:

Numa populao em equilbrio, em que os casamentos ocorrem ao acaso e a freqncia dos genes A e a de 50%, para cada um. A probabilidade de se encontrarem indivduos AA, Aa e aa , respectivamente, a) 25%, 50% e 25%. b) 40%, 30% e 30%. c) 50%, 25% e 25%. d) 70%, 15% e 15%. e) 80%, 10% e 10%. [A] 771. Numa populao em equilbrio, a freqncia de indivduos Rh negativos de 16%. A probabilidade de ocorrncia de indivduos heterozigotos nessa populao a) 84%. b) 60%. c) 48%. d) 36%. e) 24%. [C] 772. Numa populao a freqncia do gene dominante W 0,7. A probabilidade de um indivduo desta populao ser heterozigoto Ww igual a: a) 9/100. b) 49/100. c) 3/10. d) 42/100. e) 1/2. [D] 773. Numa populao em equilbrio de Hardy-Weinberg, formada por 10.000 indivduos, existem 900 do tipo Rh negativo. Espera-se que o nmero de indivduos Rh positivo homozigoto nessa populao seja de a) 9.100 b) 4.900 c) 4.550 d) 2.100 e) 900 [B] 774. A hemofilia causada por um gene recessivo (h) localizado no cromossomo X. Se, numa determinada populao, um homem em 25.000 hemoflico, a freqncia do gene h nessa populao a) 1/500 b) 1/12.500 c) 1/25.000 d) 1/50.000 e) 1/100.000 [C]

a) Quais as freqncias dos alelos M e N nessa populao? b)Essa populao est em equilbrio de Hardy-Weinberg para esse loco gnico? N total de alelos na populao = 12258 (cada pessoa tem dois alelos) N de alelos M = 6613 N de alelos N = 5645 freqncia do alelo M = 6613/12258 = 0,54 freqncia do alelo N = 5645/12258 = 0,46 A populao est em equilbrio porque as freqncias de aproximam da distribuio binomial (p + q)2 = 1, sendo p a freqncia do alelo M e q a freqncia do alelo N.

775. A anemia falciforme ou siclemia uma doena hereditria que leva formao de hemoglobina anormal e, conseqentemente, de hemcias que se deformam. condicionada por um alelo mutante s. O indivduo SS normal, o Ss apresenta anemia atenuada e o ss geralmente morre. Supondo populaes africanas com incidncia endmica de malria, onde a anemia falciforme no sofra influncia de outros fatores e onde novas mutaes no estejam ocorrendo, a freqncia do gene a) S permanece constante. b) S tende a diminuir. c) S tende a aumentar.

68 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) s permanece constante. e) s tende a aumentar. [C] 776. A anemia falciforme ou siclemia uma doena hereditria que leva formao de hemoglobina anormal e, conseqentemente, de hemcias que se deformam. condicionada por um alelo mutante s. O indivduo SS normal, o Ss apresenta anemia atenuada e o ss geralmente morre. Verificou-se que em populaes de regies onde a malria endmica, os heterozigotos (Ss) so mais resistentes malria do que os normais (SS). Nesse caso so verdadeiras as afirmaes a seguir, EXCETO: a) A malria atua como agente seletivo. b) O indivduo ss leva vantagem em relao ao SS. c) O indivduo Ss leva vantagem em relao ao SS. d) Quando a malria for erradicada, ser heterozigoto deixar de ser vantagem. e) Quando a malria for erradicada, haver mudana na freqncia gnica da populao. [B] 777. Numa determinada populao a capacidade de enrolar a lngua determinada por um gen dominante A. Nessa mesma populao foi observado que 64% das pessoas apresentam esta caracterstica. A freqncia esperada de indivduos heterozigotos ser de: a) 70% b) 48% c) 36% d) 16% e) 10% [B] 778. Sabendo-se que a freqncia de um gene recessivo a, numa populao, 0,1, as freqncias genotpicas esperadas para essa populao, se estiver em equilbrio, sero: a) AA - 0,9; Aa - 0,09; aa - 0,01 b) AA - 0,81; Aa - 0,18; aa - 0,01 c) AA - 0,81; Aa - 0,09; aa - 0,1 d) AA - 0,72; Aa - 0,18; aa - 0,1 e) AA - 0,25; Aa - 0,50; aa - 0,25 [B] 779. Sabe-se que olhos escuros so dominantes sobre olhos azuis. Sabe-se tambm que, na maioria das populaes da Amrica do Sul predomina o nmero de pessoas de olhos escuros, enquanto em diversas populaes europias acontece o inverso: pessoas de olhos escuros constituem a minoria. Essa diferena deve-se fato de a) a herana da cor dos olhos no obedecer s leis de Mendel. b) a mecanismo de herana da cor dos olhos no ser ainda bem conhecido. c) a dominncia dos genes relacionados com a cor dos olhos modificar-se com o ambiente. d) a freqncia dos alelos para olhos escuros ser maior nas populaes sulamericanas do que nas europias. e) tratar-se de um caso de herana quantitativa, que sempre influenciada por fatores ambientais. [D] 780. A doena de Tay-Sachs resulta da ao de um gene mutante localizado no cromossomo nmero 15, provocando a degenerescncia nervosa mortal. O diagnstico pr-natal possvel, e h tentativas de tratamento com algum sucesso em poucos casos. Em certas comunidades da Europa Central, uma em cada 30 pessoas apresenta fentipo normal e heterozigota quanto ao gene determina a doena de Tay-Sachs. Em 2.700 casamento ocorridos entre membros sadios dessas comunidades, o nmero esperado de casamentos com risco de gerar crianas com degenerescncia nervosa : a) 0,3 b) 3 c) 45 d) 60 e) 90 [B] 781. Em uma populao em equilbrio de Hardy-Weinberg, a freqncia do alelo autossmico (b) de 30%. Se essa populao for formada por 1000 indivduos, espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 [B] 782. Analise o heredograma a seguir no qual os smbolos escuros significam a presena de uma anomalia.

Sabendo-se que a freqncia de heterozigotos na populao 1/20, a probabilidade do casal III.1 x III.2 vir a ter uma criana com a anomalia a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 [C] 783. Uma populao em que atuam os princpios postulados por Hardy e Weinberg, as freqncias genotpicas de um determinado par de alelos "a" se distribui de acordo com o grfico destacado: Marque o grfico que representa a freqncia genotpica aps 12 geraes:

[E] 784. Na espcie humana, h certas protenas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangneo M, N ou MN. Essa caracterstica determinada por um par de alelos entre os quais no h dominncia. Se em uma populao em equilbrio de Hardy-Weinberg, a freqncia de indivduos do grupo M 49%, as freqncias esperadas de indivduos dos grupos N e MN so, respectivamente, a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% [A] 785. Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relao a uma outra variedade da mesma populao. Com o tempo, a freqncia desse gene tende a aumentar devido a) ao fato de ser recessivo. b) s mutaes que continua a sofrer. c) seleo natural. d) ao seu efeito dominante. e) oscilao gentica. [C] 786. A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossmico dominante I e a insensibilidade, ao seu alelo recessivo i. Sabendo-se que, numa populao de 1200 pessoas, as freqncias dos genes I e i so, respectivamente, 0,8 e 0,2, os nmeros esperados de pessoas sensveis e insensveis nessa populao so, respectivamente: a) 960 e 240. b) 768 e 432. c) 1008 e 192. d) 1152 e 48. e) 816 e 384. [D] 787. Para se determinar o tipo sangneo de uma pessoa, foram colocadas trs gotas de seu sangue sobre uma lmina de vidro, adicionando-se, a cada uma, soros anti-A, anti-Rh e anti-B, conforme o esquema adiante. Aps alguns segundos, notou-se aglomerao de hemcias apenas no local onde havia soros anti-B e anti-A. Com relao a esses resultados, assinale a opo correspondente ao possvel gentipo da pessoa em teste:

a) IAIARR b) IAIBrr [B]

c) IBiRr

d) IAirr

e) iiRR

788. Duas mulheres disputam a maternidade de uma criana, que, ao nascer, apresentou a doena hemoltica ou eritroblastose fetal. O sangue das duas mulheres foi testado com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir.

69 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) pleiotropia. [C]

e) polignica.

794. Qual das opes a seguir relaciona os grupos sangneos de um doador universal ideal? a) ARhb) ABRh+ c) Orh+ d) ABRhe) ORh[E] 795. Uma mulher com tero infantil, RH+ homozigota, casa-se com um homem RH-. Impedida de ter filhos, o casal decide ter um "beb de proveta" e contrata uma "me de aluguel" para receber em seu tero o zigoto formado por aquele casal. O que o casal no sabia que a "me de aluguel" tivera trs filhos, sendo que o ltimo apresentara a doena hemoltica do recm-nascido. A probabilidade de o "beb de proveta" nascer com a doena hemoltica do recm-nascido : a) mnima, visto que seu pai RH-. b) mnima, visto que sua me gentica RH+. c) alta, j que o "beb de proveta", com absoluta certeza, ser RH+. d) nula, visto que a doena hemoltica do recm-nascido s ocorre quando a me RH- e o pai RH+. e) alta, pois a "me de aluguel" RH+. [C] 796. Um determinado banco de sangue possui 4 litros de sangue tipo AB, 7 litros de sangue tipo A, 1 litro de sangue tipo B e 9 litros de sangue tipo O, todos Rh+. Se houver necessidade de transfuses sanguneas para um indivduo com sangue tipo AB, Rh+, estaro disponveis para ele, do total acima mencionado: a) 4 litros. b) 8 litros. c) 12 litros. d) 13 litros. e) 21 litros. [E] 797. A tabela a seguir foi elaborada a partir de testes para determinao dos grupos sangneos de seis pessoas de uma academia de ginstica. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "no aglutina". Aps analisar a tabela, assinale a alternativa que indica os grupos sangneos de todas as pessoas quanto aos sistemas ABO e Rh, mantendo a seqncia disposta na tabela.

Qual das mulheres poderia ser a verdadeira me daquela criana? Justifique sua resposta. A me da criana a mulher nmero dois porque Rh negativo j que seu sangue no sofre aglutinao em presena de soro anti-Rh (anti-D). 789. Um banco de sangue possui 5 litros de sangue tipo AB, 3 litros de tipo A, 8 litros B e 2 litros O. Para transfuses em indivduos O, A, B e AB esto disponveis, respectivamente: a) 2, 5, 10 e 18 litros. b) 2, 3, 5 e 8 litros. c) 18, 8, 13 e 5 litros. d) 2, 3, 8 e 16 litros. e) 2, 5, 18 e 10 litros. [A] 790. No heredograma a seguir esto indicados os fentipos dos grupos sangneos ABO e Rh. O indivduo 6 dever ser, em relao aos locos dos sistemas ABO e Rh, respectivamente:

a) heterozigoto - heterozigoto. b) heterozigoto - homozigoto dominante. c) heterozigoto - homozigoto recessivo. d) homozigoto - heterozigoto. e) homozigoto - homozigoto dominante. [A] 791. Utilizando-se trs lminas de microscopia, foi colocada uma gota de sangue humano em cada uma delas. A cada gota foi juntada igual quantidade de soro anti-A na primeira, soro anti-B na segunda e soro anti-Rh na terceira. Aps a mistura do sangue com os respectivos soros, foi observada aglutinao nas duas primeiras lminas. A partir desses dados podemos afirmar que o indivduo, quanto aos grupos sanguneos ABO e fator Rh, : a) B e Rh positivo. b) AB e Rh negativo. c) A e Rh negativo. d) AB e Rh positivo. e) A e Rh positivo. [B] 792. A afirmao que uma mulher Rh- no deve casar-se com um homem Rh+: a) correta, pois todos os filhos desse casal sero abortados. b) correta, pois todos os filhos desse casal tero uma doena grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). c) incorreta, pois o primeiro filho em geral no tem a anemia, mesmo sendo Rh+, bem como todos os filhos Rh- no sero atingidos pela doena e esta s atinge uma pequena frao de casos em outras gestaes de filhos Rh+. d) incorreta, pois filhos Rh+, mesmo no caso de glbulos vermelhos atingirem a circulao materna em sucessivas gestaes, no sero atingidos pela Eritroblastose fetal. e) incorreta, pois no existe influncia do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. [C] 793. A herana do sistema ABO do tipo: a) com dominncia. b) quantitativa. c) polialelia.

a) O, Rh-/ AB, Rh+/ B, Rh-/ A,Rh+/ O,Rh+/ A,Rhb) O, Rh+/ AB, Rh-/ B, Rh+/ A, Rh-/ O, Rh-/ A, Rh+ c) AB, Rh-/ O, Rh+/ A, Rh-/ B, Rh+/ AB, Rh+/ B, Rhd) AB, Rh+/ O, Rh-/ A, Rh+/ B, Rh-/ AB, Rh-/ B, Rh+ e) AB, Rh+/ O, Rh-/ B, Rh+/ A, Rh-/AB, Rh-/ A, Rh+ [D] 798. Num caso de investigao de paternidade, foram realizados exames para identificao de grupos sangneos e anlise de DNA. A tabela a seguir resume os resultados parciais da anlise de grupos sangneos (do menino, de sua me e do suposto pai) e de duas seqncias de DNA ( do menino e do suposto pai), correspondentes a um segmento localizado num autossomo e outro no cromossomo X. Considerando apenas a tabela adiante, podemos afirmar que:

a) os resultados dos grupos sangneos excluem a possibilidade do homem ser o pai da criana; os outro exames foram desnecessrios. b) os resultados dos grupos sangneos no excluem a possibilidade do homem ser o pai da criana, mas a seqncia de DNA do cromossomo X exclui.

70 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) os resultados dos grupos sangneos e de DNA no excluem a possibilidade do homem ser pai da criana. d) os trs resultados foram necessrios para confirmar que o homem mesmo o pai da criana. e) os resultados de DNA contradizem os resultados dos grupos sangneos. [C] 799. Nas hemceas de um indivduo pertencente ao grupo sangneo B: a) existe o aglutingeno B b) existe o aglutingeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutingeno A e a aglutinina B [A] 800. A incompatibilidade materno-fetal ao antgeno Rh pode determinar um doena denominada Eritroblastose Fetal. Se uma mulher foi orientada a usar a vacina anti-Rh logo aps o nascimento do primeiro filho, podemos dizer que seu fator Rh, o do seu marido e o da criana so, respectivamente: a) negativo; negativo; negativo. b) negativo; negativo; positivo. c) negativo; positivo; positivo. d) positivo; negativo; positivo. e) positivo; positivo; negativo. [C] 801. Uma mulher Rh+, cujo pai Rh-, casada com um homem Rh+, cuja me Rh-. A probabilidade desse casal vir a ter uma criana Rh- de a) 100% b) 75% c) 50% d) 25% e) 0% [D] 802. Uma mulher com grupos sangneos B, N, Rh+ teve trs crianas com pais distintos: CRIANAS I. O, MN, RhII. AB, N, Rh+ III. B, N, RhPAIS a. A, N, Rhb. A, M, Rhc. B, N, Rh+ Assinale a alternativa que relaciona corretamente cada criana ao seu pai. a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - b; II - c; III - a e) I - c; II - b; III a [C] 803. O heredograma a seguir representa uma famlia na qual foram determinados os grupos sangneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informaes contidas no heredograma e em seus conhecimentos sobre o assunto, INCORRETO afirmar-se que

e) independente do Rh materno, o filho Rh-. [B] 805. Observe a rvore genealgica a seguir, para o grupo sangneo (ABO) em uma famlia: Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O

OBS: 1. O indivduo 2 mulher do grupo sangneo "A" 2. O indivduo 4 homem do grupo sangneo "B" 3. O indivduo 5 mulher do grupo sangneo "O" Sobre a rvore anterior, marque a opo correta: a) o indivduo 3 do grupo sangneo "AB" b) o indivduo 1 pode ser do grupo sangneo "AB" c) o indivduo 1 do grupo sangneo "A" d) o indivduo 1 do grupo sangneo "O" [B] 806. Considerando os casamentos a seguir, uma criana de tipo sangneo B, Rh+ poder ser filha:

a) somente do casal I. b) do casal I ou do casal IV. c) o casal III ou do casal IV. d) somente do casal II e) do casal I ou do casal II ou do casal III. [E] 807. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. A elucidao de crimes, como tambm a identificao da paternidade, vm sendo efetuadas com certa facilidade e segurana atravs do uso de tcnicas apropriadas, em que so considerados bsicos alguns conceitos de gentica. Sobre esses conceitos, julgue os itens. ( ) Caritipo o conjunto de informaes sobre os cromossomos de uma determinada espcie. ( ) Genes alelos so genes que ocupam o mesmo "locus" gnico em cromossomos homlogos. ( ) Um dos catalisadores do processo de duplicao do DNA a enzima DNA polimerase. ( ) Na espcie humana distinguem-se 3 tipos sangneos, e os indivduos do grupo sangneo AB so considerados doadores universais. VVVF 808. Em um hospital h um homem necessitando de uma transfuso de emergncia. Sabe-se que ele pertence ao grupo sangneo A e que, no hospital, h quatro indivduos que se ofereceram para doar sangue. Foi realizada a determinao de grupos sangneos do sistema ABO dos quatro indivduos, com a utilizao de duas gotas de sangue de cada um deles, que, colocadas em uma lmina, foram, em seguida, misturadas aos soros anti-A e antiB. Os resultados so apresentados a seguir:

a) a probabilidade do indivduo I-2 formar gametas iR de 50%. b) a probabilidade de II-4 ter uma criana com eritroblastose fetal de O%. c) os indivduos Rh-positivos da gerao II pertencem ao grupo sangneo A, e os Rh-negativos, ao grupo O. d) o indivduo I-1 heterozigoto para uma das caractersticas. e) os indivduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. [C] 804. A eritroblastose fetal uma doena hemoltica adquirida apresentada por alguns recm-nascidos, sendo observado, alm da anemia, ictercia e aumento do bao e fgado. Esta condio provocada por incompatibilidade sangnea do fator Rh, exclusivamente: a) quando a me Rh+ e o filho Rh-; b) quando a me Rh- e o filho Rh+; c) quando a me Rh- e o pai Rh+; d) quando a me Rh+ e o pai Rh-;

71 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

815. Uma mulher que possui aglutinina anti-B no seu sangue, teve um filho do grupo O. Sabendo-se que o marido tem o aglutinognio B, os gentipos do casal so: a) IAi e IAi. b) IAIA e IBi. c) IAi e IBi. d) IAIB e IAIA. e) IAi e IBIB. [C] 816. A observao do esquema a seguir, que representa a genealogia de uma famlia em relao aos grupos sanguneos MN, nos permite afirmar que:

Observao: o sinal + significa aglutinao de hemcias; o sinal - significa ausncia de aglutinao. A partir dos resultados observados, podero doar sangue ao referido homem, os indivduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV [A] 809. Uma mulher de sangue tipo A, casada com um homem de sangue tipo B, teve um filho de sangue tipo O. Se o casal vier a ter outros 5 filhos, a chance deles nascerem todos com sangue do tipo O a) igual chance de nascerem todos com sangue do tipo AB. b) menor que a chance de nascerem todos com sangue do tipo AB. c) maior que a chance de nascerem todos com sangue do tipo AB. d) menor que a chance de nascerem sucessivamente com sangue do tipo AB, A, B, A e B. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB, B, B, A e A. [A] 810. Jorge, que tem tipo sangneo A, Rh- e filho de pai tipo A e me tipo B, recebeu transfuso de sangue de sua mulher Tnia, que filha de pai e me do tipo B. Sabendo-se que Tnia teve eritroblastose fetal ao nascer, a probabilidade do casal ter uma criana do tipo A, Rh+ : a) 100% b) 25% c) 75% d) 50% e) 0 [B] 811. Um homem de gentipo AB casa-se com uma mulher receptora universal. Os tipos de sangue dos filhos so apenas: a) A e AB b) A e B c) A, B, AB d) A, B, O e) A, O [C] 812. Sendo um homem de sangue tipo O, pergunta-se: I - Se esse homem casar-se com uma mulher de sangue tipo AB, quais os provveis tipos de sangue dos filhos do casal? II - Se casar-se com uma mulher de sangue tipo A, qual a probabilidade do nascimento de uma criana do tipo AB? A alternativa que responde corretamente s perguntas anteriores : a) (I) - A ou B ou O; (II) - zero b) (I) - O ou A ou B; (II) - 50% c) (I) - A ou B; (II) - 50% d) (I) - A ou B; (II) - zero e) (I) - A ou B; (II) - 25% [D] 813. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Com base nos estudos de Gentica, correto afirmar que: 01) Uma planta de sementes brancas, autofecundada, ser heterozigota para o carter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. 02) Uma mulher do grupo sanguneo A cuja me do grupo O, casando-se com um homem doador-universal, ter filhos apenas do grupo sangneo O. 04) Indivduos heterozigotos para duas caractersticas produzem quatro tipos de gametas. 08) Na interao gnica, ou polimeria, os genes de um par agem combinando-se com outro par (ou outros pares), a fim de condicionar um determinado fentipo. 16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo, uma criana hemoflica nascida de pais normais s poder ser do sexo feminino, 01 + 08 = 09 814. Uma mulher Rh- casou-se e teve um filho. Numa segunda gestao a criana apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opo que apresenta o fentipo para o fator Rh da me, do pai e da criana, respectivamente. a) Me Rh negativo, Pai Rh positivo e Criana Rh positivo. b) Me Rh positivo, Pai Rh positivo e Criana Rh negativo. c) Me Rh positiva, Pai Rh negativo e Criana Rh negativa. d) Me Rh positivo, Pai Rh negativo e Criana Rh positivo. e) Me Rh negativo, Pai Rh positivo e Criana Rh negativo. [A]

a) sangue MN caracterstica determinada por gene dominante. b) os indivduos 4 e 5 so heterozigotos. c) o casal 3 e 4 poder ter filhos dos trs tipos de grupos sanguneos. d) se o indivduo 5 casar-se com uma mulher de sangue N, todos os filhos sero heterozigotos. e) um prximo filho do casal 6 e 7 poder ser do grupo N. [D] 817. A transfuso de sangue do tipo B para uma pessoa do grupo A, resultaria em a) reao de anticorpos anti-B do receptor com os glbulos vermelhos do doador. b) reao dos antgenos B do receptor com os anticorpos anti-B do doador. c) formao de anticorpos anti-A e anti-B pelo receptor. d) nenhuma reao, porque A receptor universal. e) reao de anticorpos anti-B do doador com antgenos A do receptor. [A] 818. Quanto ao surgimento da eritroblastose fetal ou doena hemoltica do recmnascido podemos afirmar que ela ocorre quando o pai e a me respectivamente apresentam: a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. [A] 819. Assinale a alternativa que esquematiza as transfuses que podem ser feitas entre indivduos com diferentes grupos sanguneos do sistema ABO (as setas indicam o sentido das transfuses).

[A] 820. Uma criana tem gentipo igual ao pai, que receptor universal e teve eritroblastose fetal. Ento INCORRETO afirmar que: a) a me certamente Rh-. b) o pai possui gentipo IAIB. c) a me pode pertencer ao tipo sangneo O. d) essa criana certamente heterozigota para o fator Rh. e) a me pode ter gentipo IAi. [C] 821. Assinale a alternativa que completa corretamente as lacunas no texto a seguir. Uma mulher do tipo sangneo Rh-, homozigota recessiva e seu marido Rh+. Se ele for ................., ................. Rh+. A me reconhecer os glbulos vermelhos do embrio como estranhos e produzir anticorpos anti-Rh. Isto s acontecer quando houver passagem do sangue do embrio para a circulao materna. a) homozigoto, nenhum dos filhos ser b) heterozigoto, todos os filhos sero c) homozigoto, todos os filhos sero d) heterozigoto, nenhum dos filhos ser e) homozigoto, metade dos filhos ser [C]

72 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

822. Observe a rvore genealgica a seguir, para o grupo sangneo ABO em uma famlia:

Marque a opo correta: a) o indivduo n 5 pode ser de grupo sangneo "AB" b) o indivduo n 1 do grupo sangneo "AB" c) o indivduo n 6 do grupo sangneo "AB" d) o indivduo n 7 no pode ser filho do casal 56 [B] 823. Sabe-se que, numa famlia, dois irmos so do grupo sangneo A, outro do grupo AB e outro do grupo O. Dos pares de gentipos a seguir, o nico que pode ser dos pais desses indivduos a) ii IBi b) IAi IAIB c) IAi IBi d) IAIA IAIB e) IAIA IBIB [C] 824. Os grupos sanguneos de uma populao foram estudados no que se refere ao sistema MN dos seus indivduos. Verificou-se que existiam, numa porcentagem de 9%, portadores de sangue do tipo N. Assim, a freqncia dos indivduos do grupo MN dessa populao de: a) 79%. b) 61%. c) 50%. d) 49%. e) 42%. [E] 825. Pais cujo grupo sanguneo so AB e O, tm cinco filhos com os seguintes fentipos: dois so O, um A, um B e um AB. Quantos filhos biolgicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 [D] 826. Indivduos sem antgeno Rh nas hemcias so considerados recessivos. Carlos, que tem Rh e homozigoto, casou-se com Elaine, que tem Rh-. Ambos possuem o mesmo grupo sangneo. Fazendo um exame pr-natal e relatando esse fato ao mdico, o mesmo ficou: a) despreocupado e no fez qualquer recomendao relativa ao fato. b) despreocupado, no fez qualquer recomendao, apenas solicitando ao casal que o procurasse no momento da segunda gestao. c) preocupado, recomendando que, logo aps o parto, a me recebesse soro antiRh. Numa segunda gravidez, entretanto, disse que esse procedimento no seria mais necessrio. d) bastante preocupado, inclusive pela informao de compatibilidade de grupo sangneo, recomendando bastante ateno em cada gravidez, de maneira que, aps cada parto, a me receba o soro anti-Rh. e) bastante preocupado, dizendo ao casal que a gravidez era de altssimo risco e eles no poderiam mais ter outro filho. [D] 827. Suponha que um grupo de pessoas, pertence a uma determinada seita religiosa, imigrou para uma regio, h mais de meio sculo. A populao originria desse grupo vive at hoje no mesmo local, totalmente isolada. Nas tabelas a seguir, so mostradas as freqncias aproximadas dos grupos sangneos do sistema ABO da populao original (tabela 1) e da populao atual (tabela 2).

Qual das alternativas a seguir apresenta uma explicao possvel para a mudana na freqncia dos grupos sangneos nessa populao? a) O gene O dominante sobre os genes A e B. Assim, os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. b) O gene O dominante sobre os genes A e B. Assim, os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. c) O gene O recessivo e, portanto, o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O. d) As pessoas pertencentes ao grupo AB so recessivas e, portanto, apresentam pouca chance de existir numa populao. e) As pessoas pertencentes ao grupo AB s recebem sangue de AB. Essa situao leva a uma menor freqncia dessas pessoas na populao. [C] 828. Um laboratorista realizou exames de sangue em cinco indivduos e analisou as reaes obtidas com os reagentes anti-A, anti-B, anti-Rh, para a determinao da tipagem sangnea dos sistemas ABO e Rh. Os resultados obtidos encontramse no quadro seguinte.

Com base nesses resultados, indique quais os indivduos que sero considerados, respectivamente, receptor e doador universal. a) 5 e 2. b) 4 e 3. c) 3 e 4. d) 2 e 5. e) 1 e 4. [C] 829. Observe o diagrama geral das possveis trocas sangneas por doao e recepo no sistema "ABO":

A(s) seta(s) cujo sentido (doao recepo) est(o) errado(s) (so): a) 4 e 5 b) 2 c) 1 d) 3 [A] 830. Dois casais suspeitavam da troca de seus bebs no berrio da maternidade. Os casais e os bebs foram submetidos tipagem do sangue quanto ao sistema ABO, cujos resultados obtidos so mostrados na tabela adiante. Analisando-os, pode-se identificar os pais de cada beb.

73 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) em X, a me foi sensibilizada com o sangue Rh+ do 2 filho, o qual no teve eritroblastose fetal. c) em Y, a me transferiu anticorpos anti-Rh para o 2 filho Rh+, o qual teve eritroblastose fetal. d) em Y, a me foi sensibilizada com o fator Rh- do 1 filho, o qual no teve eritroblastose fetal. [C] 834. Um casal possui o seguinte gentipo para o fator Rh: Pai=Rr; Me=rr. Considerando apenas o fator Rh, a probabilidade de esse casal vir a ter um filho do sexo masculino, com ocorrncia de eritroblastose fetal, : a) 1 b) c) 1/3 d) e) 1/8 [D] 835. Uma criana tem tipo sangneo do tipo AB. Os tipos sangneos dos pais biolgicos dessa criana so: a) A e A. b) B e B. c) A e O. d) A e B. e) AB e O. [D] 836. Alexsander no sabe qual o seu grupo sangneo e o seu tipo de Rh. Entretanto sabe que seu pai A+, sua me O+ e seu irmo A-. Assinale a opo que contm o(s) grupo(s) sangneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGNEO: A, somente; FATOR Rh: positivo ou negativo; b) TIPO SANGNEO: O, somente; FATOR Rh: positivo, somente; c) TIPO SANGNEO: A ou O; FATOR Rh: negativo ou positivo; d) TIPO SANGNEO: A ou O; FATOR Rh: positivo, somente; e) TIPO SANGNEO: O, somente; FATOR Rh: negativo, somente; [C] 837. Aps uma primeira gravidez bem sucedida, uma me abortou trs vezes. Seu caso foi diagnosticado, em consulta mdica, como eritroblastose fetal. Em relao patologia observada nesta famlia, assinale a alternativa CORRETA: a) A me Rh positivo. b) Os abortados certamente eram Rh negativo. c) Este casal jamais poder ter outros filhos. d) A criana Rh negativo. e) O pai Rh positivo. [E] 838. A respeito do heredograma abaixo, que considera o sistema sangneo ABO, assinale a alternativa INCORRETA.

Aps identificar os pais do beb n.2, calcule a probabilidade, em porcentagem, de que um futuro irmo deste beb seja do sexo masculino e venha a ter tipo sangneo diferente do irmo. Despreze a parte fracionria do seu resultado, caso exista. 37 % 831. Um homem sofreu um acidente e precisou de transfuso sangnea. Analisado o seu sangue, verificou-se a presena de anticorpos anti-A e ausncia de anti-B. No banco de sangue do hospital, havia trs bolsas disponveis, sendo que o sangue da bolsa 1 apresentava todos os tipos de antgenos do sistema ABO, o sangue da bolsa 2 possua anticorpos anti-A e anti-B e a bolsa 3 possua sangue com antgenos somente do tipo B. Esse homem pode receber sangue: a) apenas da bolsa 1. b) apenas da bolsa 3. c) da bolsa 2 ou da bolsa 3. d) da bolsa 1 ou da bolsa 2. e) apenas da bolsa 2. [C] 832. Em um banco de sangue de um hospital, as etiquetas que identificavam os tipos sangneos estavam em cdigo, e, por acidente, o livro onde estavam registrados os cdigos foi perdido. Para que os frascos contendo sangue fossem identificados, foram feitos testes com amostras correspondentes a cada cdigo, e o resultado foi o seguinte:

Baseados nesse teste, podemos afirmar que a) existem 105 litros de sangue disponveis para um receptor AB Rh+ b) existem 135 litros de sangue disponveis para um receptor AB Rhc) existem 105 litros de sangue disponveis para um receptor A Rh+ d) existem 135 litros de sangue disponveis para um receptor O Rh+ e) existem 25 litros de sangue disponveis para um receptor O Rh[E] 833. Os dois grficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestaes distintas.

a) O indivduo 9 pode ser doador universal. b) O indivduo 7 pertence ao grupo sangneo A. c) O indivduo 6 homozigoto. d) O indivduo 1 receptor universal. e) O indivduo 8 heterozigoto. [C] 839. Considerando o casamento entre um homem tipo sangneo A+, cujo pai era O-, com uma mulher B+ cuja me era A-, assinale a(s) alternativa(s) correta(s). 01. A probabilidade de nascer 1 filha mulher B+ 3/16. 02. A probabilidade de nascer 1 filho homem O- nula. 04. A probabilidade de nascer 1 filho homem e 1 filha mulher AB 9/1024. 08. A probabilidade de nascer filho homem AB- 1/16. 16. A probabilidade de nascer 1 filho homem A+ 1/8. 32. A probabilidade de nascer 2 filhas mulheres A- 1/1024. FFVFFV 840. Lcia e Joo so do tipo sangneo Rh positivo e seus irmos, Pedro e Marina, so do tipo Rh negativo. Quais dos quatro irmos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. b) Lcia e Joo. c) Lcia e Marina. d) Pedro e Joo.

Pela observao dos grficos e considerando que essa mulher teve um filho em cada gestao e nunca recebeu transfuso de sangue, correto concluir que, a) em X, a me transferiu anticorpos anti-Rh para o 1 filho Rh-, o qual teve eritroblastose fetal.

74 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) Joo e Marina. [E] 841. Determinada caracterstica quantitativa depende da ao de cinco pares de genes. Do cruzamento entre dois indivduos com gentipo AaBbCcDdEe resultam a) 5 classes fenotpicas. b) 9 classes fenotpicas. c) 10 classes fenotpicas. d) 11 classes fenotpicas. e) 15 classes fenotpicas. [D] 842. A pigmentao da pele humana condicionada por pares de genes com ausncia da dominncia. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de gentipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos so mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros maior do que a de ser brancos. e) 50% apresenta pele branca e 50%, pele negra. [C] 843. As diferenas hereditrias entre os indivduos de uma populao podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opo correta. a) Na herana de caracteres quantitativos, existe um grande contraste entre as caractersticas que um dado trao fenotpico pode apresentar. b) Na herana de caracteres qualitativos, um dado trao de fentipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenas entre si. c) Altura, peso e cor da pele so exemplos de algumas caractersticas quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influncia do meio. e) A altura no uma caracterstica hereditria, j que um indivduo cresce menos se no receber a alimentao adequada na infncia. [C] 844. Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F1 ser de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. [C] 845. Admita que a diferena de comprimento das orelhas nos coelhos seja um caso de herana quantitativa envolvendo dois pares de genes com segregao independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzir na descendncia uma maior porcentagem de coelhos com orelhas de no mnimo 7,0cm o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb [A] 846. O grfico a seguir representa um tipo de herana onde os caracteres variam de forma gradativa. As opes a seguir so exemplos deste tipo de herana no homem, EXCETO uma. Assinale-a.

848. A tabela a seguir classifica caractersticas hereditrias da espcie humana. Assinale a alternativa que corresponde classificao correta.

[B] 849. A altura dos espcimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. Os responsveis por essa variao so 3 pares de genes com segregao independente, que interferem igualmente na altura da planta. Determine a altura, em centmetros, esperada para a primeira gerao de um cruzamento entre dois indivduos com os gentipos AABBCC e aabbCC. 76 cm 850. A altura de uma planta depende de dois pares de genes, A e B. O grfico adiante mostra a variao da altura dos descendentes de dois indivduos dibridos.

Com relao ao grfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B so, respectivamente, 40 e 30cm. (2) A freqncia de descendentes heterozigotos, para os dois genes, de 50%. (3) Esto ilustrados cinco gentipos. (4) A herana apresentada polignica. Item correto: 4 Itens errados: 1, 2 e 3 851. A altura de uma certa espcie de planta determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta planta 0,15m. Verificou-se que plantas desta espcie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% tero 1,30m de altura. b) 75% tero 1,30m e 25% tero 1,45m de altura. c) 25% tero 1,00m e 75% tero 1,60m de altura. d) 50% tero 1,15m e 50% tero 1,30m de altura. e) 25% tero 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. [D] 852. Para uma determinada planta, suponha que a diferena entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que tm efeito aditivo e que se segregam independentemente. Na descendncia do cruzamento entre dois indivduos que produzem frutos com 15cm, espera-se uma proporo de plantas com frutos de 17,5cm igual a a) 9/16 b) c) 3/16 d) e) 1/8 [D] 853. Os seguintes conceitos genticos foram escritos por um aluno que estava com dvidas sobre a matria e que pediu a um professor qualificado que os conferisse: I - Os genes em um mesmo cromossomo tendem a ser herdados juntos e so denominados "genes ligados" II - Quando uma caracterstica particular de um organismo governada por muitos pares de genes, que possuem efeitos similares e aditivos, ns dizemos que esta caracterstica uma caracterstica polignica. III - Quando trs ou mais alelos, para um dado "locus", esto presentes na populao, dizemos que este "locus" possui alelos mltiplos. IV - Um organismo com dois alelos idnticos para um "locus" em particular considerado homozigoto para este "locus", enquanto um organismo com dois

a) Estatura. d) Fator RH. [D]

b) Inteligncia. e) Cor da pele.

c) Obesidade.

847. Em um caso de herana quantitativa, esto envolvidos trs pares de genes, "a", "b" e "c". Cruzando-se dois indivduos triplo heterozigotos, a proporo de homozigotos esperada de: a) b) 1/8 c) 1/16 d) 1/32 e) 1/64 [B]

75 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

alelos diferentes para um mesmo "locus" considerado heterozigoto para este "locus". V - A aparncia de um indivduo com respeito a uma dada caracterstica herdada chamada de fentipo. Quais afirmativas o professor diria que esto corretas? a) Apenas II, III e IV b) Apenas I, II, III e IV c) Apenas I, II, III e V d) Apenas II, III, IV e V e) I, II, III, IV e V [E] 854. A massa de um determinado tipo de fruto depende da ao de dois genes A e B, no alelos, independentes e de ao cumulativa (polimeria). Esses genes contribuem com valores idnticos para o acrscimo de massa. Os genes a e b, alelos de A e B respectivamente, no contribuem para o acrscimo de massa. O fruto de uma planta de gentipo AABB tem 40 gramas de massa enquanto o de uma planta de gentipo aabb tem 20 gramas. Determine a massa do fruto de uma planta de gentipo AABb. Justifique sua resposta. Se os genes a e b no contribuem para o peso e o fruto aabb tem 20g, teremos AABB = 40 g - 20 g = 20 g. Logo, cada gene A ou B contribui com 5 g. Portanto o fruto de gentipo AABb ter 20 + 15 = 35 g. 855. Um estudante de 23 anos, doador de sangue tipo universal, moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam caractersticas hereditrias desse estudante que so influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangneo c) Cor da pele d) Peso [B] 856. Um novo tipo de tratamento da AIDS comeou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV, contidos no plasma de pessoas contaminadas h muitos anos mas sem os sintomas da doena, para pessoas aidticas sintomticas. Tal tratamento, cuja inteno fortalecer a defesa desses indivduos, denomina-se a) imunoterapia ativa. b) imunoterapia passiva. c) profilaxia. d) quimioterapia. e) vacinoterapia. [B] 857. As vacinas utilizadas nas campanhas de imunizao em massa so constitudas de a) anticorpos que destruiro o agente infeccioso especfico. b) anticorpos que persistiro ativos por toda a vida do receptor. c) drogas capazes de aumentar a resistncia infeco. d) microorganismos ou produtos deles derivados que induziro a formao de anticorpos. e) soros obtidos de animais que neutralizaro os antgenos especficos. [D] 858. Os meios de comunicao tm convocado dentistas e outros profissionais da sade para a vacinao contra a hepatite B. Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doena de forma branda. O corpo imunizado produzir antgenos especficos. b) uma substncia que combata a doena j instalada e que produza no corpo uma reao para a fabricao de anticorpos resistentes. c) microrganismos mortos ou atenuados que, reconhecidos pelo corpo como antgenos, induzam a produo de anticorpos especficos. d) o plasma, retirado de convalescentes, para que o corpo produza ento os antgenos especficos. e) o soro obtido atravs do sangue de animais, como os cavalos, criados em laboratrio, onde recebem grande quantidade de antgenos. [C] 859. Um coelho recebeu, pela primeira vez, a injeo de uma toxina bacteriana e manifestou a resposta imunitria produzindo a antitoxina (anticorpo). Se aps certo tempo for aplicada uma segunda injeo da toxina no animal, espera-se que ele a) no resista a essa segunda dose. b) demore mais tempo para produzir a antitoxina. c) produza a antitoxina mais rapidamente. d) no produza mais a antitoxina por estar imunizado. e) produza menor quantidade de antitoxina. [C] 860. Aps um traumatismo, um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. Recuperou-se e passou a viver normalmente. A parte retirada era a) o fgado. b) o diafragma. c) a hipfise. d) o pncreas. e) o bao. [E]

861. Todas as estruturas citadas a seguir podem ser ligadas defesa do organismo, EXCETO: a) pncreas b) amdalas c) bao d) timo e) gnglios linfticos [A] 862. Um organismo recebeu uma primeira dose de um antgeno X e, como resposta imune, produziu anticorpos especficos. Se, aps algum tempo, for aplicada uma segunda dose do mesmo antgeno, espera-se que o organismo: a) reaja da mesma forma como reagiu primeira dose. b) reaja sem utilizar seus anticorpos. c) no produza mais anticorpos, por estar imunizado. d) no consiga reagir a essa segunda dose. e) produza anticorpos mais rapidamente. [E] 863. Leia com ateno a tirinha do Frank & Ernest

Existe um erro de fundamento biolgico na estorinha da tirinha. Assinale a alternativa que esclarece o erro: a) que vrus do tipo "A" no sofre efeito de vacina alguma b) que a vacina no combate vrus, somente doenas causadas por bactrias c) que a vacina no combate vrus, ela proporciona ao nosso organismo produzir defesas, os anticorpos, que so especficos aos seus antgenos, no caso o vrus "A" d) que a vacina feita de vrus, portanto ela no pode destruir o que a produz e) que o vrus impede a ao da vacina, inibindo a sua atividade de defesa, que o sistema "chave-fechadura" [C] 864. Os meios de comunicao tm noticiado que a Unicef (Fundo das Naes Unidas para a Infncia) estabeleceu como uma das metas, a serem cumpridas at o ano 2.000, a imunizao de 90% das crianas, o que reduzir a mortalidade infantil em pelo menos um tero. Para que esta meta seja atingida, necessria a vacinao, que consiste em injetar no organismo: a) vrus ou bactrias vivas para provocar a doena de forma branda. O corpo, imunizado, produzir antgenos especficos. b) um medicamento eficaz no combate doena j instalada e que produza no corpo uma reao para a fabricao de anticorpos especficos e resistentes. c) vrus ou bactrias mortos ou atenuado que, reconhecidos pelo corpo como antgenos, induzam a produo de anticorpos especficos. d) o plasma, retirado de pessoas que j tiveram a doena, para que o corpo produza antgenos e anticorpos especficos. e) o soro obtido atravs do sangue de animais, como os cavalos, criados em laboratrio, onde recebem grande quantidade de antgenos. [C] 865. Ao ser picado por uma cobra peonhenta, voc dever procurar recurso atravs de a) vacina, porque contm antgenos especficos. b) soro, porque estimula o organismo a produzir anticorpos. c) vacina, porque j contm anticorpos. d) soro, porque j contm anticorpos. e) vacina, porque estimula o organismo a produzir anticorpos. [D] 866. Quando uma pessoa picada por um animal peonhento, deve procurar socorro atravs de a) soro, que induzir a formao de anticorpos. b) soro, porque composto antgenos especficos. c) soro, porque contm anticorpos prontos. d) vacina, porque fornecer ao organismo elementos de defesa. e) vacina, para eliminar quimicamente o veneno. [C] 867. Um srio risco a que est exposto o trabalhador rural em nosso pas o de acidentes com animais peonhentos. Dentre estes um dos mais temveis e agressivos do gnero a cobra surucucu. Com relao surucucu, considere as proposies:

76 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1 - Pertence ao gnero Bothrops e seu veneno tem potente ao neurotxica e coagulante. 2 - Pertence ao gnero Crotalus e seu veneno tem ao neurotxica e homoltica. 3 - Seu veneno tem ao proteoltica e coagulante e o antiofdico especfico o soro antibotrpico. 4 - O princpio ativo do seu veneno provoca intensa dor no local da inoculao, podendo haver gangrena, especialmente no caso de se utilizar torniquetes. As proposies que esto corretas so as indicadas por: a) 2 e 3 b) 1, 2 e 4 c) 3 e 4 d) 1 e 4 e) 2, 3 e 4 [C] 868. A alergia uma hipersensibilidade desenvolvida em relao a determinadas substncias, os alergnicos, que so reconhecidas por um tipo especial de anticorpo. A reao alrgica ocorre quando as molculas do alergnico a) ligam-se a molculas do anticorpo presas membrana dos mastcitos, que reagem liberando histaminas. b) desencadeiam, nos gnglios linfticos, uma grande proliferao de linfcitos especficos. c) so reconhecidas pelas clulas de memria, que se reproduzem e fabricam grande quantidade de histaminas. d) ligam-se aos anticorpos e migram para os rgos imunitrios primrios onde so destrudas. e) so fagocitadas pelos mastcitos e estimulam a fabricao das interleucinas. [A] 869. O grfico a seguir exemplifica como a exposio de um homem normal, repetidas vezes, a um mesmo tipo de antgeno (ex.: vrus) provoca, aps um certo espao de tempo, uma resposta do organismo.

[B] 872. Duas crianas foram levadas a um posto de sade: uma delas, para se prevenir contra poliomielite; a outra, para atendimento, em virtude de uma picada de serpente peonhenta. Indique o que deve ser aplicado em cada criana, RESPECTIVAMENTE. a) vacina (porque contm antgenos) e soro (porque contm anticorpos) b) soro (porque contm antgenos) e vacina (porque contm anticorpos) c) vacina (porque contm anticorpos) e soro (porque contm antgenos) d) soro (porque contm anticorpos) e vacina (porque contm antgenos) [A] 873. "Os cientistas examinaram 11 homens aidticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes apresentavam novas mutaes do vrus, resistentes s drogas ministradas e passveis de serem transmitidas a outras pessoas." Pela anlise do texto, pode-se concluir que a fabricao da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. b) s pode ser feita contra as formas mutantes do HIV. c) precisa ser feita contra a forma normal do HIV. d) fcil de ser efetuada, tendo em vista a estabilidade do HIV. e) certamente dever estar no mercado dentro de pouco tempo. [A] 874. O soro antiofdico ministrado em pessoas picadas por cobra peonhenta porque: a) induz a formao de anticorpos. b) contm anticorpos. c) um antibitico. d) provoca imunizao. e) possui antgenos especficos. [B] 875. Um casal de surdos teve dois filhos com audio normal. Sabendo se que a surdez determinada por qualquer dos genes recessivos d ou e, em homozigose, espera se que o gentipo dos filhos seja a) ddee. b) Ddee. c) DDEE. d) DdEe. e) DDee. [D] 876. Em camundongos, a colorao da pelagem determinada por dois pares de genes, Aa e Cc, com segregao independente. O gene A determina colorao aguti e dominante sobre seu alelo a que condiciona colorao preta. O gene C determina a produo de pigmentos e dominante sobre seu alelo c que inibe a formao de pigmentos dando origem a indivduos albinos. Do cruzamento de um camundongo preto com um albino, foram obtidos apenas descendentes agutis. Qual o gentipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x Aacc [E] 877. Em cebola, dois pares de genes que apresentam segregao independente participam na determinao da cor do bulbo: o alelo dominante I impede a manifestao de cor e o recessivo i permite a expresso; o alelo dominante A determina cor vermelha e o recessivo a, cor amarela. Uma proporo de 2 incolores: 1 vermelho: 1 amarelo esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa [E] 878. Em coelhos, o gene P produz pelagem preta e o seu alelo recessivo p, pelagem parda desde que esteja presente o gene A. Os animais aa so sempre albinos. Considerando que ocorra segregao independente entre esses genes, a partir do cruzamento PpAa x ppaa espera-se uma proporo fenotpica de a) 1 preto: 1 pardo: 2 albinos. b) 1 preto: 1 pardo. c) 1 preto: 1 albino.

Podemos atribuir esta resposta do organismo ao fenmeno de memria imunolgica, que tem como conseqncia: a) o aumento da produo de anticorpos b) a inibio da produo de anticorpos c) o aumento da produo de antgenos d) a inibio da produo de antgenos [A] 870. A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunizao das crianas. A imunizao contra diversos tipos de doenas atingida atravs de vacinao, que consiste em injetar no organismo: a) o soro obtido atravs do sangue de animais criados em laboratrio, como macacos, onde recebem grande quantidade de antgenos e anticorpos especficos. b) o plasma retirado de pessoas que j tiveram a doena, para que o organismo produza antgenos e anticorpos especficos. c) um agente qumico eficaz no combate a doena j instalada e que produza no corpo uma reao para a fabricao de anticorpos especficos. d) vrus ou bactrias mortos ou atenuados que, reconhecidos pelo organismo como antgenos, induzem a produo de anticorpos especficos. e) vrus ou bactrias vivos, em quantidade pequena, para provocar a doena de forma branda, pois o corpo imunizado produzir anticorpos especficos. [D] 871. A variao da quantidade de anticorpos especficos foi medida por meio de uma experincia controlada, em duas crianas durante um certo perodo de tempo. Para a imunizao de cada uma das crianas foram utilizados dois procedimentos diferentes: Criana I: aplicao de soro imune Criana II: vacinao. O grfico que melhor representa as taxas de variao da quantidade de anticorpos nas crianas I e II :

77 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) 1 preto: 3 albinos. e) 1 pardo: 3 albinos. [A] 879. As diversas substncias ingeridas pelo homem so transformadas em outras, durante os processos metablicos. Essas transformaes so catalisadas por diferentes enzimas. O esquema abaixo representa alguns passos da sntese de melanina.

d) Ccpp x ccPp [D]

e) CcPp x CcPp

884. Observe a figura.

Com base no esquema e sabendo que indivduos incapazes de sintetizar a melanina so albinos, julgue os itens seguintes. (1) Na produo de melanina a partir de fenilalanina, atuam trs mRNAs. (2) Indivduos albinos podem apresentar homozigose recessiva bb e cc. (3) Um casal de indivduos albinos pode ter filhos com pigmentao normal. (4) O gene B episttico sobre o gene C. CCCC 880. Nos camundongos, a pelagem pode ser aguti, preta ou albina. A figura a seguir mostra as reaes bioqumicas envolvidas na sntese de pigmentos.

Todas as alternativas contm gentipos possveis para os porquinhos vermelhos de F2, EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb [C] 885. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Com base nos estudos de Gentica, correto afirmar que: 01) Uma planta de sementes brancas, autofecundada, ser heterozigota para o carter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. 02) Uma mulher do grupo sanguneo A cuja me do grupo O, casando-se com um homem doador-universal, ter filhos apenas do grupo sangneo O. 04) Indivduos heterozigotos para duas caractersticas produzem quatro tipos de gametas. 08) Na interao gnica, ou polimeria, os genes de um par agem combinando-se com outro par (ou outros pares), a fim de condicionar um determinado fentipo. 16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo, uma criana hemoflica nascida de pais normais s poder ser do sexo feminino, 01 + 08 = 09 886. O esquema a seguir evidencia que a formao de melanina no depende apenas da ao de um gen. No processo ali representado, est ocorrendo a ao conjunta de dois gens.

Com base na figura foram feitas as seguintes afirmaes: I - A formao de qualquer pigmento no plo depende da presena do alelo P. II - Quando animais pretos homozigticos so cruzados com certos albinos tambm homozigticos, os descendentes so todos aguti. III - Trata-se de um caso de interao gnica do tipo epistasia recessiva. Pode-se considerar correto o que afirmado em a) I, somente. b) III, somente. c) I e II, somente. d) II e III, somente. e) I, II e III. [E] 881. A cor da pelagem em cavalos depende, dentre outros fatores, da ao de dois pares de genes Bb e Ww. O gene B determina plos pretos e o seu alelo b determina plos marrons. O gene dominante W "inibe" a manifestao da cor, fazendo com que o plo fique branco, enquanto que o alelo recessivo w permite a manifestao da cor. Cruzando-se indivduos heterozigotos para os dois pares de genes obtm-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco [D] 882. A audio normal depende da presena de pelo menos um dominante de dois pares de genes, D e E que se segregam independentemente. Caso voc examine a prole de um grande nmero de casamentos em que ambos os conjuges so duplo heterozigotos para esses dois pares de genes, que proporo fenotpica voc espera encontrar? 15/16 audio normal : 1/16 surdos 883. Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). A presena do gene C ou P ou ausncia de ambos produz flor branca. A presena de ambos simultaneamente produz flor prpura. Cruzando-se duas plantas de flores brancas, obtm-se em F1 plantas produtoras de flores coloridas, na proporo de 3 brancas: 1 colorida. Os gentipos das plantas cruzadas so, respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP

Situaes como essa so conhecidas como: a) polialelia. b) poligens. d) interao gnica. e) alelos mltiplos. [D]

c) norma de reao.

887. Considere uma espcie de vertebrado cujas clulas embrionrias tm oito cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Nmero varivel. [B] 888. Considere uma espcie de vertebrado cujas clulas somticas tm 12 cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Quatro. b) Seis. c) Trs. d) Oito. e) Dez. [B] 889. Considere uma espcie de vertebrado cujas clulas embrionrias tm oito cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Nmero varivel. [B] 890. Suponha que 100 clulas germinativas entram em meiose e que essas clulas tenham o seguinte gentipo:

78 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[B] 895. Sabendo-se que as freqncias de permutao entre os genes A e C de 20% e entre os genes B e C de 10%, ento a distncia entre os genes A e B ser a) 10 morgandeos. b) 30 morgandeos. c) 10 ou 30 morgandeos. d) 20 morgandeos. e) 20 ou 10 morgandeos. [C] 896. Sabendo-se que as freqncias de permutao entre os genes A e C de 40% e entre os genes B e C de 15%, ento a distncia entre os genes A e B ser a) 45 morgandeos. b) 25 morgandeos. c) 40 morgandeos. d) 25 ou 15 morgandeos. e) 40 ou 15 morgandeos. [D] 897. Supondo-se que a distncia entre locos gnicos seja de 16 morgandios, a taxa de recombinao entre eles de a) 8% b) 16% c) 32% d) 42% e) 84% [B] 898. Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo hbrido BR/br, uma certa espcie apresentou a seguinte proporo de gametas: BR - 48,5% br - 48,5% Br - 1,5% bR - 1,5% Pela anlise dos resultados, pode-se concluir que a distncia entre os genes B e R de: a) 48,5 morgandeos. b) 97 morgandeos. c) 1,5 morgandeo. d) 3 morgandeos. e) 50 morgandeos. [D] 899. Numa certa espcie de milho, o gro colorido condicionado por um gene dominante B e o gro liso por um gene dominante R. Os alelos recessivos b e r condicionam, respectivamente, gros brancos e rugosos. No cruzamento entre um indivduo colorido liso com um branco rugoso, surgiu uma F1, com os seguintes descendentes: 150 indivduos que produziam sementes coloridas e lisas, 150 indivduos que produziam sementes brancas e rugosas, 250 indivduos que produziam sementes coloridas e rugosas e 250 indivduos que produziam sementes brancas e lisas. A partir desses resultados, podemos concluir que o gentipo do indivduo parental colorido liso e a distncia entre os genes B e R so a) BR/br; 62,5 U.R. b) BR/br; 37,5 U.R. c) Br/bR; 62,5 U.R. d) Br/bR; 37,5 U.R. e) BR/br; 18,75 U.R. [D] 900. Analise as proposies: 1. Modificaes hereditrias que ocorrem num locus especfico so chamadas de mutaes gnicas. 2. Os principais agentes mutagnicos so as radiaes ionizantes e os raiosultravioleta. 3. As mutaes do tipo substituio de base acarretam a alterao de vrios aminocidos nas protenas. Est(o) correta(s): a) 1, apenas b) 1 e 3, apenas c) 3, apenas d) 1, 2 e 3 e) 2, apenas [A] 901. Atualmente so bem conhecidos os efeitos adversos sade humana, causados por diversos poluentes ambientais, especialmente aqueles que possuem potencialidades mutagnicas ou carcinognicas, os quais, devido sua interao com mecanismos genticos, podem causar mutaes e doenas nas geraes futuras. Assinale as afirmaes corretas: I - Mutaes so modificaes bruscas do material gentico que podem ser transmitidas prole (descendncia ou clulas filhas). II - A mutao pode ser espontnea ou induzida por agentes fsicos, qumicos ou biolgicos com potencial mutagnico.

Quantos gametas recombinantes sero formados se 20 das 100 clulas apresentarem permutao na meiose? a) 20 b) 40 c) 80 d) 160 e) 180 [B] 891. Mendel, nas primeiras experincias sobre hereditariedade, trabalhou com apenas uma caracterstica de cada vez. Posteriormente, ele acompanhou a transmisso de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres so transmitidos para os gametas de modo totalmente independente ". Esta observao foi enunciada como "2 Lei de Mendel" ou "Lei da Segregao Independente", a qual no vlida para os genes que esto em ligao gnica ou "linkage", isto , genes que esto localizados nos mesmos cromossomos. Observando as seguintes propores de gametas produzidos pelo dihbrido AaBb em trs situaes distintas, I - AB (25%); Ab (25%); aB (25%); ab (25%), II - AB (50%); ab (50%), III - AB (40%); Ab (10%); aB (10%); ab (40%), pode-se afirmar que: a) I e II so situaes nas quais os genes segregam-se independentemente. b) II e III so situaes nas quais ocorre segregao independente e ligao gnica sem "crossing-over", respectivamente, c) I e III so situaes nas quais ocorre segregao independente e ligao gnica com "crossing-over", respectivamente. d) II uma situao na qual ocorre ligao gnica com "crossing-over". e) III uma situao na qual ocorre ligao gnica sem "crossing-over". [C] 892. Os seguintes conceitos genticos foram escritos por um aluno que estava com dvidas sobre a matria e que pediu a um professor qualificado que os conferisse: I - Os genes em um mesmo cromossomo tendem a ser herdados juntos e so denominados "genes ligados" II - Quando uma caracterstica particular de um organismo governada por muitos pares de genes, que possuem efeitos similares e aditivos, ns dizemos que esta caracterstica uma caracterstica polignica. III - Quando trs ou mais alelos, para um dado "locus", esto presentes na populao, dizemos que este "locus" possui alelos mltiplos. IV - Um organismo com dois alelos idnticos para um "locus" em particular considerado homozigoto para este "locus", enquanto um organismo com dois alelos diferentes para um mesmo "locus" considerado heterozigoto para este "locus". V - A aparncia de um indivduo com respeito a uma dada caracterstica herdada chamada de fentipo. Quais afirmativas o professor diria que esto corretas? a) Apenas II, III e IV b) Apenas I, II, III e IV c) Apenas I, II, III e V d) Apenas II, III, IV e V e) I, II, III, IV e V [E] 893. O cruzamento de dois indivduos, um com gentipo AaBb e outro com gentipo aabb resultou numa F1 com as seguintes propores: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados, pode-se concluir que os genes "a" e "b": a) esto em um mesmo brao do cromossomo. b) seguem as leis do diibridismo. c) constituem um caso de interao gnica. d) so pleiotrpicos. e) so epistticos. [A] 894. Considerando os genes X, Y e Z de um cromossomo, sabe-se que h 15% de recombinao entre os genes X e Y, entre Y e Z h 30% e entre os genes Z e X ocorre 45%. Qual a posio relativa desses trs genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ

79 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

III - Mutao toda alterao do material gentico, que resulta sempre de segregao ou recombinao cromossmicas. IV - Mutaes gnicas podem ser causadas por poluentes ambientais o provocar alteraes responsveis pelo aparecimento de gentipos diferentes numa populao. A alternativa que contm as afirmaes corretas : a) I e III. b) II e III. c) I, II e IV. d) IV e III. e) III. [C] 902. Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqncia de radiaes UV, o que resultou em pequenos tumores na pele. Caso ele venha a ser pai de uma criana, ela a) s herdar os tumores se tiver ocorrido dano em um gene dominante. b) s herdar os tumores se tiver ocorrido dano em dois genes recessivos. c) s herdar os tumores se for do sexo masculino. d) herdar os tumores, pois houve dano no material gentico. e) no herdar os tumores. [E] 903. Monossomia do cromossomo X, ovrios rudimentares, mau desenvolvimento dos caracteres sexuais secundrios, baixa estatura so, entre outros, dados que podem ser relacionados com a sndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau [D] 904. A constituio gentica dos indivduos com sndrome de Klinefelter : a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY [B] 905. A sndrome de Down ou mongolismo uma anomalia causada por: a) uma mutao gnica b) uma deficincia cromossmica c) uma diminuio do nmero de cromossomos no genoma d) um aumento do nmero de cromossomos do genoma e) uma inverso cromossmica [D] 906. Se na ovulognese, no houver disjuno do par de cromossomos sexuais, os vulos correspondentes, sendo fecundados, podero dar origem a casos de a) sndrome de Turner b) sndrome de Klinefelter c) sndrome de Down d) sndrome de Patau e) a e b so possveis [E] 907. Duas espcies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um hbrido interespecfico que, germinando, produz alguns gros de plen que foram utilizados para fecundar vulos da espcie B. Assinale a opo que relaciona o nvel de ploidia e o nmero de cromossomos da descendncia. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 [D] 908. Duas espcies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um hbrido interespecfico que, germinando, produz alguns gros de plen que foram utilizados para fecundar vulos da espcie B. Assinale a opo que relaciona o nvel de ploidia e o nmero de cromossomos da descendncia. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 [C] 909. A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutao cromossmica estrutural denominada:

[A] 910. Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espcies de gramnea: Qual das alternativas a seguir indica corretamente o valor de 2N dos hbridos III e IV do processo esquematizado?

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. [B] 911. As alteraes do nmero de cromossomos, tais como: presena de um cromossomo 21 a mais; 47 cromossomos, sendo dois X e um Y e 45 cromossomos, tendo apenas um X, determinam, respectivamente, as sndromes de: a) Down, Klinefelter e Turner. b) Morgan, Turner e Klinefelter. c) Turner, Down e Morgan. d) Down, Turner e Klinefelter. e) Klinefelter, Turner e Down. [A] 912. O esquema a seguir mostra a formao dos gametas responsveis pela produo de um indivduo com alterao do seu nmero cromossomial.

Entre as caractersticas que esse indivduo passar a apresentar, teremos: a) sexo masculino. b) caracteres sexuais desenvolvidos. c) caritipo normal. d) ausncia de cromatina sexual. e) estatura elevada. [D] 913. A respeito das mutaes, leia as afirmaes a seguir. I - Ocorrem para adaptar o indivduo ao ambiente. II - Ocorrem em clulas sexuais e somticas. III - Podem alterar o nmero, a forma e o tamanho dos cromossomos. A(s) afirmao(es) correta(s) (so): a) somente a II. b) somente a I e a II. c) somente a I e a III. d) somente a II e a III. e) a I, a II e a III. [D] 914. Na figura a seguir, em I, temos uma clula diplide 2n = 6 cromossomos. Em II, III e IV, temos exemplos, respectivamente, de

a) inverso pericntrica b) translocao c) duplicao d) deleo e) isocromossomos

80 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

3) Suponha que a mulher est novamente grvida e que o exame para marcadores do cromossomo 21, como descrito no texto, foi realizado para o feto atravs de puno do lquido amnitico, amniocentese. Analise o resultado obtido na figura 3. Pelos resultados apresentados na figura pressupe-se que a criana deve ser normal. Entretanto, aps o nascimento, constatou-se que a criana apresentava Sndrome de Down. Com base nessa informao, determine: O genitor onde ocorreu a no-disjuno. A fase da meiose em que o fenmeno ocorreu. 1) O Pai porque a criana possui apenas 1 cromossomo 21 materno. 2) Diviso I porque a criana possui 2 cromossomos 21 distintos. 3) A criana herdou um cromossomo 21 duplicado de sua me (segmento de DNA maior) e a no disjuno, nesse caso, ocorreu na segunda diviso da meiose. a) haploidia; translocao; inverso paracntrica. b) haploidia; inverso pericntrica; translocao. c) monossomia; translocao; inverso pericntrica. d) monossomia; translocao; inverso paracntrica. e) monossomia; inverso paracntrica; translocao. [D] 915. A fenilcetonria e a miopia so doenas decorrentes da ao de genes autossmicos recessivos. Do casamento entre uma mulher normal, filha de me com fenilcetonria e pai mope, com um homem normal para fenilcetonria e mope, nasceu uma criana de viso normal e fenilcetonrica. A probabilidade desse casal ter uma criana normal para as duas caractersticas : a) 1/8 b) c) 3/8 d) 7/8 e) [C] 916. Vegetais maiores, mais vigorosos e, por esse motivo, mais vantajosos economicamente, ocorrem casualmente na natureza. Esses vegetais podem ser reproduzidos pelo homem, artificialmente, usando tcnicas de melhorando gentico. Como exemplo, podemos citar o uso da Colchicina, que induz a) haploidia. b) inverso cromossmica. c) poliploidia. d) recombinao gnica. e) translocao cromossmica. [C] 917. A estrutura qumica de uma protena poder ser modificada se a) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma celular. b) durante sua sntese houver variao dos tipos de RNA transportadores. c) sua sntese ocorrer no complexo de Golgi e no no retculo endoplasmtico rugoso. d) uma base prica substituir uma pirimdica no RNA mensageiro que a codifica. e) o DNA no se duplicar durante a intrfase. [D] 918. Considere estes dados como hipotticos. Um casal apresenta, em seus cromossomos de nmero 21, pontos de quebra por enzimas especiais, indicados no esquema por setas. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genticos. No esquema a seguir, os fragmentos so indicados por Kb (1Kb=1000 pares de bases nitrogenadas). Esse casal tem uma criana com Sndrome de Down devida trissomia do cromossomo 21. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai, da me e da criana esto indicados na figura 2, onde cada trao indica a posio e o tamanho dos fragmentos num campo de eletroforese. 919. Muitas aberraes cromossmicas humanas se manifestam como sndromes bem definidas e de fcil constatao pela anlise do caritipo. Na tabela a seguir so dados cinco casos cuja veracidade voc dever analisar. Assinale nos parntesses V se for verdadeira ou F se a afirmao for falsa.

FVVVF 920. Numa dada espcie, um indivduo trissmico apresenta um caritipo contendo 97 cromossomos. Qual o nmero de cromossomos que deve ser encontrado em um espermatozide normal nessa espcie? 48 921. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Doena pode ser definida como um desequilbrio do organismo ou ausncia de bem-estar fsico e mental. Ela pode ter inmeras causas e variar de intensidade e manifestao. Com relao a esse tema, CORRETO afirmar: 01. O alcoolismo, o tabagismo e a dependncia de outras drogas so exemplos de causas que podem resultar em doenas. 02. Doenas genticas so aquelas causadas por alteraes do patrimnio gentico e podem passar de pais para filhos, atravs do material gentico. 04. Doenas traumticas so aquelas que se originam de acidentes, podendo resultar em fratura de ossos, hemorragias, etc. 08. Doenas funcionais resultam do mau desempenho ou da perda de um rgo ou sistema. 16. Doenas transmissveis so as transmitidas por patgenos ou por seus produtos. 32. O mongolismo um exemplo de doena hereditria, enquanto a eritroblastose fetal uma doena congnita. 01 + 02 + 04 + 08 + 16 + 32 = 63 922. Considere um segmento de DNA com seqncia de bases indicadas a seguir: TTATCGGGACCGATCATCGTA A alterao mais drstica que esta molcula pode sofrer a: a) supresso da segunda base nitrogenada. b) supresso das trs primeiras bases nitrogenadas. c) substituio da quarta base nitrogenada por outra. d) substituio das trs primeiras bases nitrogenadas por outras. e) incluso de mais trs bases nitrogenadas no final da molcula. [A] 923. O esquema a seguir representa a formao dos gametas responsveis pela produo de um indivduo com alterao do seu nmero cromossomial.

Com base nas informaes apresentadas e em conhecimento sobre o assunto responda ao que se pede. 1) Identifique o genitor que transmitiu dois cromossomos 21 criana. Justifique sua resposta. 2) Determine o estgio da meiose, I ou II, em que ocorreu o fenmeno de no separao ou no-disjuno dos cromossomos. Justifique sua resposta.

81 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Entre as caractersticas que este indivduo passar a apresentar, teremos: a) sexo masculino. b) caritipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausncia de cromatina sexual. [E] 924. Num dado organismo, foram encontradas clulas somticas normais com seis cromossomos (I) e clulas aberrantes (II e III) cujos caritipos esto esquematizados a seguir.

sensibilidade luz solar, resultando em alta freqncia de cncer de pele, principalmente na face. Alguns desses pacientes tambm desenvolvem anormalidades neurolgicas, que parecem resultar da morte prematura de clulas nervosas. Estudos genticos, em clulas de organismos afetados, revelam a existncia de defeitos no sistema enzimtico responsvel pelo reparo de molculas de DNA danificadas pela exposio a agentes mutagnicos. Uma anlise da situao apresentada anteriormente permite afirmar: (01) Agentes mutagnicos incluem fatores fsicos que alteram a estrutura da molcula de DNA. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem gentica predispe ao cncer. (04) A condio gentica dos indivduos com "xeroderma pigmentosum" determinada pela exposio radiao ultravioleta. (08) A morte prematura de clulas nervosas resulta dos efeitos do acmulo de leses na molcula de DNA. (16) Os genes que condicionam o "xeroderma pigmentosum" so caractersticos de clulas epidrmicas. (32) A ocorrncia de alteraes em clulas nervosas e em clulas epidrmicas pode estar relacionada sua origem embriolgica comum. (64) A preciso dos sistemas de reparo do DNA inviabiliza o processo evolutivo. 01 + 02 + 08 + 32 = 43 930. A figura abaixo esquematiza a no-disjuno cromossmica.

As aberraes cromossmicas dos caritipos II e III so, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. [A] 925. Por razes pouco conhecidas, durante a meiose pode ocorrer a nodisjuno de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossmica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Sndrome de Turner. e) Sndrome de Klinefelter. [A] 926. A sndrome de Klinefelter uma anomalia gentica devido : a) presena de trs cromossomos autossmicos n 21. b) ausncia de um cromossomo autossmico n 21. c) presena de um cromossomo X e dois cromossomos Y. d) presena de um cromossomo Y e dois cromossomos X. e) ausncia de cromossomos sexuais. [D] 927. Uma pesquisadora analisou clulas da mucosa bucal de frentistas de postos de gasolina. Foram encontradas muitas clulas que, alm do ncleo, apresentavam microncleos originados em cromossomos defeituosos. Quanto a esses microncleos, podemos supor que se originaram a partir de a) translocao. b) substituio. c) deleo. d) deslocao. e) bipartio. [C] 928. O nmero de cromossomos de uma espcie 2n=20. O sistema de determinao do sexo do tipo ZW. O caritipo que representa uma euploidia : a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW [C] 929. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Indivduos portadores da doena "xeroderma pigmentosum", condio gentica autossmica recessiva, apresentam, em clulas epidrmicas, extrema

A respeito desse tema, julgue os itens abaixo. (1) As fibras do fuso acromtico so importncia fundamental para as migraes cromossmicas caractersticas da anfase. (2) Os erros na distribuio de cromossomos que levam s aneuploidias so freqentes no processo de meiose e raros nas mitoses. (3) As aberraes cromossmicas numricas causam grandes alteraes no funcionamento celular, produzindo doenas graves e at mesmo a morte. (4) As sndromes de Down e de Turner, causadas por no-disjunes cromossmicas, so exemplo de trissomia e de monossomia. VFVV 931. "Era um burrinho pedrs, mido e resignado, vindo de Passa-Tempo, Conceio do Serro, ou no sei onde no serto. Chamava-se Sete-de-Ouros, e j fora to bom, como outro no existiu e nem pode haver igual." Todas as alternativas apresentam caractersticas biolgicas do burrinho referido nesse texto, EXCETO a) resultante do cruzamento de gua com jumento. b) Tem caractersticas morfolgicas idnticas s de um dos pais. c) um tpico exemplo de animal hbrido. d) Produz gametas inviveis. [B] 932. Pela anlise dos cromossomas, possvel detectar a anomalia que caracteriza a sndrome de Down. O esquema a seguir apresenta quatro eventos da diviso celular.

Os eventos possveis da meiose que levam sndrome de Down so os de nmero: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 [C] 933. A anemia falciforme ou siclemia uma doena hereditria que leva formao de hemoglobina anormal e, conseqentemente, de hemcias que se deformam. condicionada por um alelo mutante s. O indivduo SS normal, o Ss apresenta anemia atenuada e o ss geralmente morre. O esquema a seguir mostra

82 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a seqncia do DNA que leva formao da hemoglobina normal e a que leva formao da hemoglobina alterada. Considere os segmentos de DNA a seguir:

08) Segregao monognica dominante. 16) Deriva gentica, fixando aleatoriamente alguns genes. 32) Semiletalidade, ou seja, efeitos nocivos que podem surgir devido a gentipos recessivos produzidos atravs do cruzamento entre indivduos aparentados. 02 + 08 + 32 = 42 939. A respeito das mutaes, leia as afirmaes a seguir. I - Ocorrem para adaptar o indivduo ao ambiente. II - Ocorrem em clulas sexuais e somticas. III - Podem alterar o nmero, a forma e o tamanho dos cromossomos. A(s) afirmao(es) correta(s) (so): a) somente a II. b) somente a I e a II. c) somente a I e a III. d) somente a II e a III. e) a I, a II e a III. [D] 940. Observe a seqncia de bases nitrogenadas.

Trata-se de um caso de mutao por a) perda de um par de bases no DNA, sem alterao do aminocido codificado. b) adio de um par de bases no DNA, sem alterao do aminocido codificado. c) inverso de um par de bases no DNA, sem alterao do aminocido codificado. d) inverso de um par de bases no DNA, com alterao do aminocido codificado, mas no da protena correspondente. e) inverso de um par de bases no DNA, com alterao do aminocido codificado e da protena correspondente. [E] 934. Em uma certa espcie de animal selvagem, os machos normais apresentam complemento cromossmico igual a 2n=6,XY. Entretanto, um indivduo anormal foi identificado na populao e seu caritipo foi representado pela seguinte forma:

Todas as afirmativas so corretas quanto seqncia, EXCETO a) A introduo de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrio a partir desse ponto. b) A mutao da 3 base na trinca indicada por 9 pode traduzir um aminocido diferente. c) A seqncia pertence a um DNA e pode codificar um polipeptdeo contendo, pelo menos, 27 aminocidos. d) A trinca indicada por 5 pode transcrever um cdon CGA, o qual reconhecido pelo anti-cdon GCU. e) A troca da primeira base, em quaisquer das trincas indicadas, pode resultar na troca do aminocido respectivo na protena. [C] Considerando-se os dados anteriores, pode-se afirmar que o indivduo : a) trissmico. b) poliplide. c) triplide. d) haplide. e) monossmico. [A] 935. Na espcie humana, a anomalia conhecida como sndrome de Down ou mongolismo deve-se a) mutao de um gene autossmico. b) mutao de um gene do cromossomo X. c) existncia de um autossomo extra. d) existncia de um cromossomo X extra. e) falta de um cromossomo X. [C] 936. A mutao gnica, nos organismos eucariontes a) constitui a principal fonte de variabilidade gentica. b) ocorre exclusivamente pela ao de agentes mutagnicos. c) origina apenas seres recessivos. d) ocorre devido a alteraes na molcula de DNA. e) origina somente combinaes gnicas adaptativas. [A] 937. Vrios so os processos que atuam na evoluo. Dentre eles, o nico que fornece material gentico novo a um determinado conjunto gnico preexistente a: a) mutao gnica. b) recombinao gnica. c) seleo natural. d) reproduo assexuada. e) reproduo sexuada. [A] 938. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Um canil, especializado na criao de dlmatas, escolheu dois irmos de uma ninhada e os cruzou. Desse cruzamento resultaram oito filhotes que, na sua maioria, apresentaram as mesmas caractersticas dos pais. Observou-se, entretanto, que, dos oito cezinhos, dois nasceram cegos. luz dos conhecimentos de gentica, esse fato pode ser explicado porque houve: 01) Heterose, reduzindo o vigor da ninhada. 02) Efeito gentico da consanginidade. 04) Herana ligada ao cromossomo sexual. 941. Analise as proposies: 1. Modificaes hereditrias que ocorrem num locus especfico so chamadas de mutaes gnicas. 2. Os principais agentes mutagnicos so as radiaes ionizantes e os raiosultravioleta. 3. As mutaes do tipo substituio de base acarretam a alterao de vrios aminocidos nas protenas. Est(o) correta(s): a) 1, apenas b) 1 e 3, apenas c) 3, apenas d) 1, 2 e 3 e) 2, apenas [A] 942. Atualmente so bem conhecidos os efeitos adversos sade humana, causados por diversos poluentes ambientais, especialmente aqueles que possuem potencialidades mutagnicas ou carcinognicas, os quais, devido sua interao com mecanismos genticos, podem causar mutaes e doenas nas geraes futuras. Assinale as afirmaes corretas: I - Mutaes so modificaes bruscas do material gentico que podem ser transmitidas prole (descendncia ou clulas filhas). II - A mutao pode ser espontnea ou induzida por agentes fsicos, qumicos ou biolgicos com potencial mutagnico. III - Mutao toda alterao do material gentico, que resulta sempre de segregao ou recombinao cromossmicas. IV - Mutaes gnicas podem ser causadas por poluentes ambientais o provocar alteraes responsveis pelo aparecimento de gentipos diferentes numa populao. A alternativa que contm as afirmaes corretas : a) I e III. b) II e III. c) I, II e IV. d) IV e III. e) III. [C] 943 Analise as afirmativas a seguir, a respeito das mutaes. I - Sempre que o ambiente se torna desfavorvel, o ser vivo reage sofrendo uma mutao gnica. II - As mutaes transmitidas s geraes futuras so aquelas que ocorrem em clulas germinativas.

83 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

III - As mutaes ocorridas em clulas somticas so de grande valor adaptativo para a perpetuao da espcie. Est(o) correta(s) a) I apenas b) II apenas. c) III apenas. d) I e II apenas. e) II e III apenas. [B] 944. Recentemente, cientistas confirmaram suas suspeitas de que existem pessoas imunes AIDS. A partir do estudo de um grupo de 1850 pessoas, os cientistas afirmaram que a imunidade est relacionada a uma mutao gentica, apresentada por 3% dos pacientes estudados. Os cientistas consideraram esse percentual muito elevado. A caracterstica da mutao, que permite que ela ocorra em grande nmero de indivduos, por ter sido transmitida de gerao em gerao, : a) impedir a multiplicao de determinado vrus no interior das clulas b) evitar a ao de agentes externos sobre os genes c) representar uma vantagem para a sobrevivncia d) ocorrer em resposta necessidade de adaptao [C] 945. Uma bactria sofre uma mutao pontual em uma regio do seu DNA, que era: TAC CTT ATA GAT Ocorreu uma mudana na terceira base, que passou de citidina a guanina. Indique o RNA mensageiro codificado pela seqncia de DNA mutada. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA [D] 946. Pode-se afirmar que a mutao a) sempre ocorre para adaptar o indivduo ao ambiente. b) aumenta a freqncia de crossing-over. c) aumenta o nmero de alelos disponveis em um locus. d) sempre dominante e prejudicial ao organismo. [C] 947. Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio sintetizado a partir dele: ATA - GCA - GTG - ACA - CCT TIROSINA - ARGININA - HISTIDINA - CISTENA - GLICINA Aps a substituio de uma nica base nitrogenada no segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas. A seqncia de trincas no RNA mensageiro que pode ter codificado esse polipeptdio alterado a) CUC - TGC - TGC - CGC - GGU b) TUT - CGT - CGT - TGT - GGU c) CGT - CGT - CAC - TGT - GGA d) UAU - CTU - CAC - CTU - TTA e) UAU - CGU - CAC - CGU GGA [E] 948. Em certo fungo, ocorre a seqncia de reaes a seguir esquematizada que leva sntese do aminocido arginina.

950. O cruzamento CD/cd x cd/cd produziu 300 descendentes. Quantos devero ser diferentes dos pais, sabendo-se que a frequncia de permutao de 10% a) 30 b) 15 c) 270 d) 290 e) 45 [A] 951. O cruzamento AB/ab x ab/ab produziu 450 descendentes. Quantos devero ser diferentes dos pais, sabendo-se que a frequncia de permutao de 20% a) 30 b) 90 c) 430 d) 360 e) 45 [B] 952. Um cruzamento entre dois indivduos, com os gentipos DdEe x ddee, originou 42 descendentes com gentipo DdEe, 160 Ddee, 168 ddEe e 40 ddee. Sobre os genes D e E podemos concluir que: a) esto ligados e h permuta entre eles. b) esto ligados e no h permuta entre eles. c) segregam-se independentemente e h permuta entre eles. d) segregam-se independentemente e no h permuta entre eles. e) no esto ligados, logo segregam-se independentemente. [A] 953. Na meiose de um indivduo AB/ab, ocorre "crossing-over" entre esses genes em 40% das clulas. A freqncia de gametas AB, Ab, aB e ab produzidos por esse indivduo deve ser, respectivamente, a) 10%, 40%, 40% e 10% b) 30%, 20%, 20% e 30% c) 30%, 30%, 20% e 20% d) 40%, 10%, 10% e 40% e) 40%, 40%, 10% e 10% [D] 954. Especiao um processo de formao de novas espcies. O mecanismo diretamente responsvel pela especiao chamado de: a) hibridao. b) isolamento reprodutivo. c) esterilizao. d) recombinao gnica. e) multiplicao celular. [B] 955. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Analise os dados apresentados a seguir, que trata dos tipos e percentuais de gametas produzidos por um indivduo de gentipo no divulgado (indivduo parental). AB = 47,4% Ab = 2,6% aB = 2,6% ab = 47,4% ( ) Trata-se de um caso de genes de segregao independente, determinando uma distribuio 1:1:1:1: ( ) 5,2% dos gametas apresentam combinaes allicas diferentes daquelas existentes nos cromossomos do indivduo parental. ( ) O indivduo parental um heterozigoto AB/ab e, portanto, um heterozigoto "Cis". ( ) O indivduo parental um heterozigoto aB/Ab, ou seja, um heterozigoto "Trans". ( ) Considerando que 5,2% dos gametas so recombinantes, pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94,8% das clulas meiticas que originaram estes gametas. FVVFF 956. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Considerando inclusive a possibilidade de permuta gentica, um indivduo portador do gentipo ABD//abD poder produzir os seguintes gametas: 01. Portador apenas de A ou a, sem alelos B e D. 02. a b D 04. portador apenas de B ou d, sem alelos A e D. 08. A B D 16. a B D 32. portador apenas de D, sem alelos A e B. 64. A b D 02 + 08 + 16 + 64 = 90

Verificou-se que certos fungos mutantes s conseguem sintetizar arginina quando a ornitina acrescentada ao meio de cultura. Esses fungos devem ter sofrido mutao no gene a) X, somente. b) Y, somente. c) Z, somente. d) X ou no gene Y. e) X ou no gene Z. [A] 949. Considerando os genes X, Y e Z de um cromossomo, sabe-se que h 15% de recombinao entre os genes X e Y, entre Y e Z h 30% e entre os genes Z e X ocorre 45%. Qual a posio relativa desses trs genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ [B]

957. Em determinada espcie, os locos dos genes A e B situam-se no mesmo cromossomo. Na meiose de um indivduo duplo-heterozigoto AB/ab ocorre permutao entre esses locos em 80% das clulas. A porcentagem esperada de gametas Ab que o indivduo formar a) 10% b) 20% c) 30% d) 40% e) 80% [B] 958. Se a distncia entre dois locos gnicos de 20 unidades, a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esses cruzamento poderia ser

84 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd [D] 959. No rgo reprodutor de um animal, h 1000 (mil) clulas, em cujos ncleos esto os cromossomas, como mostra o desenho a seguir:

Quantos gametas recombinantes sero formados se 20 das 100 clulas apresentarem permutao na meiose? a) 20 b) 40 c) 80 d) 160 e) 180 [B] 963. Em um caso de "linkage", dois genes A e B, autossmicos, distam entre si 20 UR. Considere o seguinte cruzamento: Fmea (Ab/aB) X Macho (ab/ab) Qual a freqncia esperada de machos com o gentipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% [E] 964. Com relao ao processo conhecido como crossing-over, podemos afirmar que o mesmo a) diminui a variabilidade gentica. b) separa cromtides homlogas. c) corrige a recombinao gnica. d) aumenta a variabilidade gentica. e) troca cromossomos entre genes homlogos. [D] 965. Numa certa espcie de milho, o gro colorido condicionado por um gene dominante B e o gro liso por um gene dominante R. Os alelos recessivos b e r condicionam, respectivamente, gros brancos e rugosos. No cruzamento entre um indivduo colorido liso com um branco rugoso, surgiu uma F, com os seguintes descendentes: 150 indivduos que produziam sementes coloridas e lisas, 150 indivduos que produziam sementes brancas e rugosas, 250 indivduos que produziam sementes coloridas e rugosas e 250 indivduos que produziam sementes brancas e lisas. A partir desses resultados, podemos concluir que o gentipo do indivduo parental colorido liso e a distncia entre os genes B e R so a) BR/br; 62,5 U.R. b) BR/br; 37,5 U.R. c) Br/bR; 62,5 U.R. d) Br/bR; 37,5 U.R. e) BR/br; 18,75 U.R. [D] 966. Com relao ao processo denominado permutao ou crossing over, correto afirmar: 01. a troca de gametas que ocorre durante o cruzamento de dois indivduos da mesma espcie. 02. a troca de microncleos entre indivduos unicelulares para renovar o seu material gentico. 04. o processo que origina novos arranjos gnicos resultantes de trocas de fragmentos de cromtides homlogas. 08. o pareamento de cromossomos homlogos de modo a se tornarem bivalentes. 16. o processo de duplicao dos cromossomos para garantir a manuteno da espcie. 32. um processo que ocorre necessariamente durante a mitose. 64. o processo responsvel pela variabilidade gentica entre organismos de uma mesma espcie. FFVFFFV 967. No heredograma adiante o indivduo 3 afetado pelo albinismo. Sabendo-se que, na populao, a frequncia de heterozigoto para o albinismo de 1/50, qual a probabilidade de que o casal 4x5 tenha uma menina albina?

Se em todas as clulas ocorrer "crossing-over" entre os gens A e B, e se cada uma originar 4 (quatro) gametas, podemos afirmar que: a) todos os gametas formados contero as combinaes resultantes do "crossing". b) a proporo de gametas com as formas no "crossing" seria maior do que a de gametas com as formas "crossing". c) a ocorrncia do "crossing" no altera a seqncia dos gens nos cromossomas, porque s as cromtides irms so envolvidas. d) as propores entre os tipos de gametas seriam iguais s que ocorrem quando os genes esto em cromossomas diferentes. e) no possvel calcular essas propores, porque os gametas recebem cromossomas ao acaso. [D] 960. Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo hbrido BR/br, uma certa espcie apresentou a seguinte proporo de gametas: BR - 48,5% br - 48,5% Br - 1,5% bR - 1,5% Pela anlise dos resultados, pode-se concluir que a distncia entre os genes B e R de: a) 48,5 morgandeos. b) 97 morgandeos. c) 1,5 morgandeo. d) 3 morgandeos. e) 50 morgandeos. [D] 961. A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqncia _______________.

A alternativa que preenche correta e respectivamente os espaos anteriores : a) o crossing-over; metfase da mitose; a variabilidade gentica. b) o pareamento de cromtides-irms; anfase I da meiose; a troca de genes alelos. c) o crossing-over; prfase I da meiose; a variabilidade gentica. d) a segregao de cromossomos homlogos; anfase I da meiose; a formao de clulas haplides. e) o pareamento de cromossomos homlogos; metfase da mitose; a formao de gametas. [C] 962. Suponha que 100 clulas germinativas entram em meiose e que essas clulas tenham o seguinte gentipo:

85 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

P = 1/600 968. No heredograma a seguir os smbolos cheios representam indivduos portadores de uma anomalia gentica. Qual a probabilidade de o indivduo 9 ser portador dessa anomalia?

a) autossmica dominante - ss, Ss, ss e ss. b) autossmica dominante - SS, ss, SS e SS. c) autossmica dominante - Ss, SS, Ss e Ss. d) autossmica recessiva - SS, ss, Ss e SS. e) autossmica recessiva - Ss, ss, Ss e Ss. [E] 971. Analise o heredograma que representa a herana de um tipo de disfuno dos msculos esquelticos e cardaco em seres humanos.

P = 1/6 969. Os heredogramas a seguir apresentam o padro de herana de um mesmo carter em cinco diferentes famlias, identificadas por 1, 2, 3, 4 e 5. Os crculos representam as mulheres e os quadrados, os homens. Os smbolos cheios indicam que o indivduo portador do carter. Com relao ao heredograma, correto afirmar-se que a) a herana para esse tipo de caracterstica recessiva e ligada ao sexo. b) a ocorrncia da caracterstica nessa famlia se deve aos casamentos consangneos. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas zero. d) as mulheres afetadas apresentam fentipos idnticos aos de suas mes. e) o casamento de III-4 com indivduo de fentipo igual a II-4 tem como resultado esperado 1OO% de mulheres afetadas. [D] 972. Analise o heredograma.

Supondo que no haja mutao, analise os heredogramas e assinale a alternativa correta. a) A famlia l permite concluir que se trata de um carter dominante ligado ao cromossomo X. b) A famlia 2 permite concluir que se trata de um carter autossmico recessivo. c) A famlia 3 permite concluir que se trata de um carter recessivo, ligado ao cromossomo X. d) A famlia 4 permite concluir que se trata de um carter recessivo, ligado ao cromossomo Y. e) A famlia 5 mostra que o carter no pode ser controlado por gene ligado ao cromossomo X. [B] 970. Na espcie humana h um tipo de surdez hereditria que determinada por um par de genes. No heredograma a seguir, as pessoas surdas esto representadas por smbolos hachurados: Com base nessa afirmao, assinale a opo correta quanto ao tipo de herana e os gentipos dos indivduos 1, 2, 3 e 4, respectivamente:

Em relao caracterstica representada no heredograma, todas as alternativas so possveis, EXCETO a) A herana pode ser autossmica. b) A herana pode ser ligada ao sexo. c) A herana pode representar uma famlia de hemoflicos. d) I-1 e I-2 podem ser heterozigotos. e) II-2, II-5 e III-1 podem ser homozigotos dominantes. [E] 973. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Um pesquisador apresentou a seus alunos o heredograma a seguir, relativo a uma certa doena observada por ele em humanos. Sabendo-se que os indivduos afetados esto representados em negrito e os normais em branco, pode-se afirmar:

86 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

00 a doena causada por um alelo recessivo; 11 trata-se de um caso de herana parcialmente ligada ao sexo; 22 a doena causada por um alelo dominante; 33 trata-se de um caso de herana ligada ao sexo; 44 um caso de polialelia com epistasia recessiva. VFFFF 974. Analise a genealogia a seguir, onde foi estudado o carter BRAQUIDACTILIA (dedos curtos), que determinado por um par de genes:

Com base na anlise do heredograma, pode-se concluir que a caracterstica em questo condicionada por gene a) dominante, localizado no cromossomo X. b) recessivo, localizado no cromossomo X. c) dominante, localizado em um autossomo. d) recessivo, localizado em um autossomo. e) localizado no cromossomo Y. [D] 977. O esquema a seguir representa indivduos de trs geraes de uma famlia. Os smbolos escuros indicam os portadores de uma anomalia hereditria.

Nessa famlia, os indivduos 1, 2, 3, 4 e 7 so braquidctilos, enquanto os indivduos 5 e 8 apresentam dedos normais. Considerando essas informaes e desprezando a possibilidade de ocorrncia de mutao, pode-se afirmar que o indivduo 6: a) braquidctilo e homozigoto. b) braquidctilo e heterozigoto. c) tem dedos normais e homozigoto. d) tem dedos normais e heterozigoto. e) pode ser ou no braquidctilo e homozigoto. [B] 975. Analise o heredograma a seguir, onde os indivduos masculinos so representados por quadrados e os femininos por crculos.

Analisando-se a genealogia, conclui-se que a anomalia determinada por gene a) dominante, localizado no cromossomo x. b) dominante, localizado no cromossomo y. c) dominante, localizado em autossomo. d) recessivo, localizado no cromossomo y. e) recessivo, localizado em autossomo. [E] 978. O tipo de herana gentica apresentada pelos indivduos afetados :

Sobre as informaes contidas no heredograma, podemos afirmar que os indivduos heterozigotos so: a) 1, 2, 3, 4 b) 1, 2, 4, 5 c) 1, 2, 6, 8 d) 4, 5, 6, 7 e) 3, 5, 9 [C] 976. No heredograma a seguir, crculos representam mulheres, quadrados representam homens e smbolos preenchidos representam indivduos portadores de certa caracterstica.

a) autossmica dominante. b) autossmica recessiva. c) ligada ao x dominante. d) ligada ao x recessiva. e) ligada ao y. [A] 979. Se os indivduos 7 e 11 se casarem, a probabilidade desse casal ter uma filha com o mesmo fentipo do av materno de:

87 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) [B]


c) 1/8

d) 1/3

e) 2/3

980. O heredograma a seguir representa a herana de um par de genes entre os quais h dominncia. Os smbolos escuros representam indivduos que exibem a caracterstica recessiva.

A probabilidade do casal I x II ter uma criana mope a) imprevisvel, porque a mulher tanto pode ser homozigota como heterozigota. b) nula, porque a mulher tem o gene dominante em homozigose. c) 1/2, porque 50% dos gametas da mulher transportam o gene recessivo. d) 1/4, porque o casal j tem trs filhos com viso normal. e) 1/4, porque o gene para a miopia recessivo. [C] 983. A acondroplasia (uma das formas de nanismo) causada por um gene dominante autossmico. Da unio de um homem acondroplsico com uma mulher normal resulta um filho normal. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo).

Nesse heredograma NO se pode determinar o gentipo do indivduo a) 1 b) 3 c) 5 d) 6 e) 7 [E] 981. Na espcie humana h um tipo de doena hereditria muito rara denominada Aquiropodia, que determinada por um par de genes. No heredograma a seguir, os aquirpodos esto representados por smbolos hachurados. Em relao aos descendentes deste ltimo casamento e ao carter em questo, considerando ausncia de mutao, correto afirmar: ( ) O descendente ser obrigatoriamente heterozigoto. ( ) A freqncia genotpica na descendncia ser 1:2:1. ( ) A probabilidade de acondroplasia na descendncia igual a zero. ( ) A probabilidade de heterozigose na descendncia em relao a este locus igual a zero. ( ) A freqncia fenotpica numa prole numerosa ser 3:1. ( ) Numa prole numerosa, a freqncia fenotpica ser de 1 acondroplsico para 1 normal. FFVVFF 984. O heredograma mostra a incidncia de uma anomalia gentica em grupo familiar. Com base na anlise do heredograma, assinale a afirmativa INCORRETA. a) Pode-se dizer que a Aquiropodia condicionada por um alelo recessivo a. b) Pode-se assumir que os indivduos II.1 e II.5 possuem o gentipo AA, j que a condio herdada em anlise muito rara. c) No possvel ter certeza sobre o gentipo de alguns indivduos, como o caso dos indivduos II.3 e III.5. d) Os pais dos aquirpodos so primos. e) O gentipo dos indivduos IV.2 e IV.4 aa. [C] 982. O esquema mostra a genealogia de uma famlia. Os smbolos escuros representam os indivduos mopes e os claros, os indivduos de viso normal.

Aps a anlise deste heredograma, podemos afirmar: a) todos os indivduos normais so homozigotos recessivos; b) a anomalia condicionada por um gene recessivo; c) a anomalia ocorre apenas em homozigotos dominantes; d) todos os indivduos normais so homozigotos dominantes; e) todos os indivduos normais so homozigotos dominantes ou heterozigotos. [A] 985. A calvcie uma caracterstica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino. Observe a genealogia a seguir, relativa a essa caracterstica.

88 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas [A] 990. Do cruzamento entre aves andaluzas de colorao azulada, nasceram 15 filhotes azulados, 7 brancos e 8 pretos. Trata-se de um caso de _____________ e os indivduos parentais so _______________. O preenchimento correto das lacunas , respectivamente: a) herana quantitativa e homozigotos dominantes. b) codominncia e heterozigotos c) linkage e heterozigotos. d) herana ligada ao sexo e homozigotos recessivos. e) epistasia e homozigotos dominantes. [B] 991. Valria gostava muito de flores. Observando seu jardim, notou a existncia de plantas de uma mesma espcie, que possuam indivduos com flores brancas, rosas e vermelhas. Curiosa para saber como se dava a transmisso desse carter, Valria promoveu uma autofecundao nas plantas de cor rosa e, para sua surpresa, obteve plantas que davam flores brancas, vermelhas e rosas, estas ltimas em quantidade duas vezes maior que as plantas de flor branca e vermelha, obtendo plantas que s davam flores de cor rosa. Valria concluiu CORRETAMENTE que: a) trata-se de dominncia da cor rosa sobre as demais. b) trata-se de um caso de co-dominncia entre os genes alelos que determinam o padro de cor. c) as plantas de flor rosa eram recessivas. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. e) trata-se de um caso de gene letal, pois o cruzamento de plantas de flores brancas e vermelhas s originou flores rosas. [B] 992. Um casal de africanos teve trs filhos. O primeiro morreu aos 5 anos de idade, em conseqncia de anemia, falciforme; o segundo normal e bastante suscetvel a malria (doena endmica na regio); o ltimo normal, porm pouco suscetvel a malria. Assinale a opo em que se indicam, corretamente, o membro da famlia com seu respectivo gentipo e o padro de herana da anemia falciforme. a) 2 filho homozigoto recessivo Herana: dominncia completa; b) pai heterozigoto Herana: epistasia dominante; c) 3 filho heterozigoto Herana: co-dominncia; d) me homozigoto dominante Herana: pleiotropia. [C] 993. Observe o esquema.

A probabilidade do casal 34 ter o primeiro filho homem e que venha a ser calvo, : a) b) c) 1/8 d) 1/6 [B] 986. A anemia falciforme causada pela presena de uma hemoglobina anormal. Essa doena herdada como autossmica recessiva. Considerando o heredograma apresentado inicialmente os indivduos I - 2 e I - 3 forem heterozigotos e os indivduos I - 1 e I - 4 forem homozigotos normais, quem poder ser afetado pela doena?

a) Apenas III - 1 e III - 2. b) Apenas II - 1 e II - 3. c) Apenas II - 2 e II - 4. d) II - 1, II - 2, II - 3 e II - 4. e) II - 1, II - 3, III - 1 e III - 2. [A] 987. Considerando o heredograma abaixo, onde os indivduos afetados pela sndrome unha-rtula (deformao nas unhas e nas rtulas) aparecem em preto, correto afirmar:

01) A anomalia causada por gene provavelmente recessivo. 02) A anomalia causada por gene provavelmente dominante. 04) Trata-se de gene localizado no cromossomo X. 08) Trata-se de gene localizado no cromossomo Y. 16) Trata-se de gene autossmico. 32) Trata-se de Herana Intermediria. 64) Trata-se de Herana Holndrica. FVFFVFF 988. A talassemia uma doena hereditria que resulta em anemia. Indivduos homozigotos MM apresentam a forma mais grave, identificada como talassemia maior e os heterozigotos MN, apresentam uma forma mais branda chamada de talassemia menor. Indivduos homozigotos NN so normais. Sabendo-se que todos os indivduos com talassemia maior morrem antes da maturidade sexual, qual das alternativas a seguir representa a frao de indivduos adultos, descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor, que sero anmicos? a) b) c) 1/3 d) 2/3 e) 1/8 [D] 989. Mendel cruzou duas variedades de 'Mirabilis jalapa', uma com flores vermelhas e outra com flores brancas. Na gerao F todas as flores eram rosas. Indique qual ser o resultado do cruzamento da variedade de flores rosas (F). a) 25% brancas : 25% vermelhas : 50% rosas

Com base nesse esquema e em conhecimentos sobre o assunto, CORRETO afirmar que a) o gene HbA dominante sobre o gene HbS. b) os indivduos HbA/HbS e HbS/HbS devem apresentar os mesmos nveis de hemoglobina anormal. c) os indivduos que produzem s hemcias anormais podem ser curados por meio de transfuso sangnea. d) um determinado gentipo pode produzir diferentes fentipos. [D] 994. Moscas de colorao acinzentada cruzadas entre si fornecem moscas de cor preta. Para determinarmos se uma mosca cinza homozigota ou heterozigota quanto ao par de genes que condicionam esse carter, o procedimento correto analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta. b) cor cinza. c) gentipo igual ao seu. d) fentipo igual ao seu. e) fentipo dominante. [A] 995. "Cada carter condicionado por um par de fatores que se separam na formao dos gametas". Mendel ao enunciar essa lei j admitia, embora sem

89 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

conhecer, a existncia das seguintes estruturas e processo de diviso celular, respectivamente: a) cromossomos, mitose. b) ncleos, meiose. c) ncleos, mitose. d) genes, mitose. e) genes, meiose. [E] 996. Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. Depois de alguns dias, as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo gentipo e fentipos diferentes. b) o mesmo fentipo e gentipos diferentes. c) gentipos e fentipos iguais. d) gentipos e fentipos diferentes. e) gentipos variados em cada grupo. [A] 997. "Casais de pigmentao da pele normal, que apresentam gentipo __(I)__ podem ter filhos albinos. O gene para o albinismo __(II)__ e no se manifesta nos indivduos __(III)__. So albinos apenas os indivduos de gentipo __(IV)__." No trecho acima, as lacunas I, II, III e IV devem ser preenchidas correta e, respectivamente, por: a) AA, dominante, homozigoto e aa. b) AA, recessivo, homozigoto e Aa. c) Aa, dominante, heterozigotos e aa. d) Aa, recessivo, heterozigotos e aa. e) aa, dominante, heterozigotos e AA. [D] 998. Considere os seguintes cruzamentos para ervilha, sabendo que V representa o gene que determina cor amarela dos cotildones e dominante sobre o alelo v, que determina cor verde. I. VVx vv II. Vv x Vv III. Vv x vv Um p de ervilha, heterozigoto e que, portanto, produz vagens com sementes amarelas e com sementes verdes, pode resultar a) apenas do cruzamento I. b) apenas do cruzamento II. c) apenas do cruzamento III. d) apenas dos cruzamentos II e III. e) dos cruzamentos I, II e III. [D] 999. Um gato preto (A) foi cruzado com duas gatas (B e C) tambm pretas. O cruzamento do gato A com a gata B produziu 8 filhotes, todos pretos; o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. A anlise desses resultados permite concluir que: a) a cor preta dominante, A e C so homozigotos. b) a cor preta dominante, A e B so homozigotos. c) a cor preta dominante, A e C so heterozigotos. d) a cor preta recessiva, A e C so homozigotos. e) a cor preta recessiva, B e C so heterozigotos. [C] 1000. Dois genes alelos atuam na determinao da cor das sementes de uma planta: (A), dominante, determina a cor prpura e (a), recessivo, determina a cor amarela. A tabela a seguir apresenta resultados de vrios cruzamentos feitos com diversas linhagens dessa planta:

c) est num autossomo. d) pode estar no cromossomo X ou no Y. e) pode estar num cromossomo ou num autossomo [C] 1002. Na espcie humana h um tipo de surdez hereditria que determinada por um par de genes. No heredograma a seguir, as pessoas surdas esto representadas por smbolos hachurados: Com base nessa afirmao, assinale a opo correta quanto ao tipo de herana e os gentipos dos indivduos 1, 2, 3 e 4, respectivamente:

a) autossmica dominante - ss, Ss, ss e ss. b) autossmica dominante - SS, ss, SS e SS. c) autossmica dominante - Ss, SS, Ss e Ss. d) autossmica recessiva - SS, ss, Ss e SS. e) autossmica recessiva - Ss, ss, Ss e Ss. [E] 1003. Considere uma ovognia de uma mulher heterozigota para o par de alelos Dd. Entre os possveis gametas formados por essa ovognia, podemos encontrar: a) quatro vulos Dd. b) quatro vulos D e quatro vulos d. c) dois vulos D e dois vulos d. d) apenas um vulo Dd. e) apenas um vulo D ou um vulo d. [E] 1004. Qual a porcentagem de descendentes Aa nascidos de uma me Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai. [B] 1005. Sabendo-se que o albinismo um carter recessivo, determine a porcentagem de descendentes com o fentipo igual ao do pai, resultantes do casamento de um homem heterozigoto para esse fator, com uma mulher de igual gentipo. a) 0% b) 25% c) 50% d) 75% e) 100% [D] 1006. Num homem heterozigoto para determinado carter, a porcentagem provvel de espermatozides que contero o gene recessivo desse carter de: a) 0% b) 25% c) 50% d) 75% e) 100% [C] 1007. Considere que o comprimento da cauda, numa dada espcie, seja condicionado por um par de alelos. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. Os descendentes, quando cruzados entre si, tambm s originaram filhotes de cauda longa. A partir desses dados, s possvel concluir que a) o carter recessivo. b) o carter dominante. c) os animais cruzados eram homozigotos. d) os animais cruzados eram heterozigotos. e) o gentipo dos descendentes difere do dos pais. [C] 1008. Uma planta feminina de angiosperma com gentipo PP foi cruzada com uma masculina pp. As sementes resultantes devem apresentar embrio e endosperma, respectivamente, a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp [D]

Apresentam gentipo (Aa) as linhagens: a) I e III b) II e III d) I e IV e) III e IV I [C]

c) II e IV

1001. Pedro e seus filhos, Joo e Maria, tm uma doena determinada por um gene dominante. No h outros afetados na famlia. Esse gene: a) est no cromossomo X. b) est no cromossomo Y.

1009. Em cobaias, a cor preta do plo condicionada por um alelo dominante e a cor branca, pelo alelo recessivo. Um cruzamento-teste de um indivduo de cor preta produziu descendentes brancos e pretos em igual nmero. Se esses descendentes pretos forem cruzados entre si, a proporo fenotpica esperada na prole ser de a) 3 pretos, 1 branco b) 2 pretos, 1 branco c) 1 preto, 3 brancos d) 1 preto, 2 brancos

90 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) 1 preto, 1 branco [A] 1010. Quando Mendel cruzou plantas de ervilha apresentando vagens de colorao verde com plantas de vagens de colorao amarelas, obteve na primeira gerao (F1) todos os descendentes de colorao verde. Na segunda gerao (F2) obteve 428 verdes e 152 amarelas. Todas as alternativas apresentam concluses a partir desses resultados, EXCETO a) A expresso do alelo recessivo do gene desaparece apenas em F1. b) As plantas com vagens verdes ou amarelas da gerao parental devem ser homozigotas. c) O alelo dominante do gene se expressa em cor verde. d) O carter controlado por um par de genes. e) Os indivduos que apresentam vagens de colorao verde em F so heterozigotos. [E] 1011. A colorao das flores de ervilha determinada por herana autossmica. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores prpuras e plantas com flores brancas. Se Mendel utilizasse como genitor masculino as plantas de flores prpuras e como feminino, as plantas de flores brancas, os descendentes obtidos em F1 apresentariam

( ) a doena causada por um alelo recessivo; ( ) trata-se de um caso de herana parcialmente ligada ao sexo; ( ) a doena causada por um alelo dominante; ( ) trata-se de um caso de herana ligada ao sexo; ( ) um caso de polialelia com epistasia recessiva. VFFFF 1015. Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos. Os termos a seguir fazem parte da nomenclatura gentica bsica. Assinale as alternativas que trazem o significado correto de cada um desses termos: 01. GENE sinnimo de molcula de DNA. 02. GENTIPO a constituio gentica de um indivduo. 04. DOMINANTE um dos membros de um par de alelos que se manifesta inibindo a expresso do outro. 08. FENTIPO a expresso do gene em determinado ambiente. 16. GENOMA o conjunto de todos os alelos de um indivduo. 02 + 04 + 08 = 14 1016. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. TEXTO I: Como muito mais organismos de cada espcie nascem do que provavelmente sobrevivem e como, conseqentemente, h uma freqente luta pela existncia, segue-se que qualquer organismo que varia de modo proveitoso para si prprio, sob condies de vida complexas e algumas vezes variveis, ter uma melhor oportunidade de sobrevivncia e, assim, de ser "naturalmente selecionado" . (Darwin, apud DARNELL, p. 2 - traduzido) TEXTO II: Os hbridos, de cada par de caracteres diferenciais, formam sementes das quais a metade novamente desenvolve a forma hbrida, enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais. (Mendel, apud FREIRE-MAIA, p. 1117) Em relao s idias de Darwin e de Mendel, exemplificadas nos textos, pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das geraes so homozigotas. (02) A herana de um carter determinada pela fuso dos fatores condicionantes, na descendncia. (04) A citao de Mendel expressa a proporo genotpica 1:2:1, esperada em F2. (08) A seleo natural pode preservar caractersticas diferentes, em diferentes ambientes. (16) O trabalho de Darwin afirma a constncia gentica do mundo biolgico. (32) Variaes referidas por Darwin transmitem-se descendncia segundo o padro mendeliano de herana. 01 + 04 + 08 = 13 1017. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. A idia da eugenia, que se ocupa do aperfeioamento fsico e mental da espcie humana, perigosamente em alta em pases desenvolvidos da Europa, se sustenta em premissas incorretas, que violam princpios sociais e admitem conceitos biolgicos errneos, como na citao: Os cromossomos, (...) os determinantes (...) se entrechocam, lutam entre si, selecionam-se, eliminando-se com o glbulo polar os mais fracos, os inferiores, e persistindo nos proncleos resultantes os mais aptos, os mais fortes. (Kehl apud BIZZO, p. 30) Considerando-se os princpios biolgicos que regem a herana, pode-se afirmar: (01) A subordinao aos princpios mendelianos reduz a variabilidade nas espcies que se reproduzem sexuadamente. (02) A segregao dos cromossomos homlogos, na primeira diviso meitica, aleatria. (04) O efeito de um determinado gene depende do ambiente em que ele expresso. (08) Os fatores genticos se misturam e se diluem ao longo das geraes. (16) A aplicao de princpios eugnicos comprometeria a sobrevivncia da espcie humana. (32) Alteraes do fentipo, adquiridas por indivduos de uma gerao, repercutem alm dela, atingindo sua prole.

a)100% de flores brancas. b)100% de flores prpuras. c) 75% de flores prpuras e 25% de flores brancas. d) 50% de flores prpuras e 50% de flores brancas. e)100% de flores de colorao rsea. [B] 1012. Os vrios tipos de diabete so hereditrios, embora o distrbio possa aparecer em crianas cujos pais so normais. Em algumas dessas formas, os sintomas podem ser evitados por meio de injees dirias de insulina. A administrao de insulina aos diabticos evitar que eles tenham filhos com este distrbio? a) No, pois o gentipo dos filhos no alterado pela insulina. b) No, pois tanto o gentipo como o fentipo dos filhos so alterados pela insulina. c) Sim, pois a insulina incorporada nas clulas e ter ao nos filhos. d) Sim, pois a insulina incorporada no sangue fazendo com que os filhos no apresentem o distrbio. e) Depende do tipo de diabete, pois nesses casos o gentipo pode ser alterado evitando a manifestao da doena nos filhos. [A] 1013. O gene autossmico, que condiciona plos curtos em cobaias, dominante em relao ao gene que determina plos longos. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias, das quais 240 tinham plos curtos. Entre as cobaias de plos curtos, o nmero esperado de heterozigotos : a) 45. b) 60. c) 90. d) 160. e) 180. [D] 1014. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Um pesquisador apresentou a seus alunos o heredograma a seguir, relativo a uma certa doena observada por ele em humanos. Sabendo-se que os indivduos afetados esto representados em negrito e os normais em branco, pode-se afirmar:

91 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(64) As repercusses da eugenia em populaes humanas descartam sua aplicao para qualquer fim. 02 + 04 + 08 + 16 + 64 = 94 1018. De acordo com a primeira lei de Mendel, um indivduo heterozigoto para um carter regulado por dominncia completa, provavelmente produzir a seguinte porcentagem de gametas: a) 100% com alelo recessivo. b) 100% com alelo dominante. c) 50% com alelo recessivo e 50% com alelo dominante. d) 75% com alelo dominante e 25% com alelo recessivo. e) 75% com alelo recessivo e 25% com alelo dominante. [C] 1019. No homem, a acondroplasia uma anomalia determinada por um gene autossmico dominante. Qual a probabilidade de um casal de acondroplsicos, que j tem uma menina normal, vir a ter um menino acondroplsico? a) 1 b) c) 3/8 d) e) 1/8 [B] 1020. De uma populao de 100 camundongos foi retirado ao acaso um indivduo com deficincia da enzima E, carter condicionado por um alelo recessivo a. correto afirmar que a) seus pais podem ser fenotipicamente normais. b) seus pais so certamente heterozigotos. c) a freqncia do alelo a 0,1. d) a freqncia do alelo a 0,2. e) 1% dos indivduos da populao tm deficincia da enzima E. [A] 1021. Uma mulher normal, casada com um portador de doena gentica de herana autossmica dominante, est grvida de um par de gmeos. Qual a probabilidade de que pelo menos um dos gmeos venha a ser afetado pela doena no caso de serem, respectivamente, gmeos monozigticos ou dizigticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% [E] 1022. Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais. Para determinarmos se uma mosca de asa longa homozigota ou heterozigota quanto ao par de genes que condicionam este carter, o procedimento correto analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial. b) de asa longa. c) gentipo igual ao seu. d) fentipo igual ao seu. e) fentipo dominante. [A] 1023. Algumas variedades de canrios mudam de cor dependendo da alimentao que recebem. Esta mudana indica que o: a) fentipo depende do ambiente. b) gentipo depende do ambiente. c) fentipo depende do gentipo e do meio ambiente. d) gentipo depende do fentipo e do meio ambiente. e) gentipo depende dos genes. [C] 1024. Do cruzamento de duas moscas com asas, nasceram 120 descendentes com asas e 40 sem asas. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivduos, o nmero esperado de indivduos com asas e sem asas ser, respectivamente, a) 6.000 e 3.000 b) 6.000 e 6.000 c) 8.000 e 4.000 d) 9.000 e 3.000 e) 12.000 e 4.000 [C] 1025. No heredograma a seguir, crculos representam mulheres, quadrados representam homens e smbolos preenchidos representam indivduos portadores de certa caracterstica.

Com base na anlise do heredograma, pode-se concluir que a caracterstica em questo condicionada por gene a) dominante, localizado no cromossomo X. b) recessivo, localizado no cromossomo X. c) dominante, localizado em um autossomo. d) recessivo, localizado em um autossomo. e) localizado no cromossomo Y. [D] 1026. O esquema a seguir representa indivduos de trs geraes de uma famlia. Os smbolos escuros indicam os portadores de uma anomalia hereditria.

Analisando-se a genealogia, conclui-se que a anomalia determinada por gene a) dominante, localizado no cromossomo x. b) dominante, localizado no cromossomo y. c) dominante, localizado em autossomo. d) recessivo, localizado no cromossomo y. e) recessivo, localizado em autossomo. [E] 1027. O tipo de herana gentica apresentada pelos indivduos afetados :

a) autossmica dominante. b) autossmica recessiva. c) ligada ao x dominante. d) ligada ao x recessiva. e) ligada ao y. [A] 1028. Considere as seguintes proposies: 1 - Em nenhuma hiptese a calvcie ocorre na mulher, por se tratar de herana ligada ao sexo. 2 - Um homem calvo (homozigoto) transmite a caracterstica da calvcie a todos os filhos homens nascidos de seu casamento com uma mulher no calva. 3 - A calvcie dominante no sexo masculino 4 - A calvcie pode ser originada por causas ambientais, mas na maioria dos casos, claramente hereditria. 5 - Uma mulher ser calva se seus pais forem calvos e se sua me (heterozigota) possuir um de seus genitores calvo. Concluiu-se com relao a estas proposies que: a) Apenas a 2, a 3 e a 4 so corretas.

92 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) Apenas a 1, a 2 e a 3 so corretas. c) Apenas a 1, a 3 e a 4 so corretas. d) Apenas a 1, a 2 , a 3 e a 4 so corretas. e) Apenas a 2, a 3, a 4 e a 5 so corretas. [E] 1029. Em tomates, o estame pode ser de cor prpura ou verde. Cruzando-se plantas de estames de cor prpura com plantas de estames verdes, obteve-se uma gerao F composta apenas de indivduos com estames de cor prpura. Se esses indivduos forem retrocruzados com os parentais de estames verdes, ento a porcentagem de descendentes com estames verdes ser de: a) 25% b) 50% c) 75% d) 0 e) 100% [B] 1030. Esta figura representa o cruzamento de drosfilas de asas normais com indivduos de asas enroladas, mutantes, criadas em temperatura de 25C. a) norma de reao. b) mutao gnica. c) expressividade de um gene. d) penetrncia de um gene. e) alterao do gentipo pelo ambiente. [A] 1033. No Brasil, uma lei determina que os recm-nascidos sejam submetidos ao "teste do pezinho", por meio do qual se identifica a fenilcetonria, doena hereditria que pode levar ao retardamento mental, com prejuzo da fala e dos movimentos. Se detectada a tempo, essa doena pode ser controlada ministrando-se ao recm-nascido uma dieta especial. O heredograma seguinte ilustra uma situao em que h indivduos fenilcetonricos.

As moscas de gentipo igual ao do tipo III, quando criadas em temperatura de 16C, apresentam asas normais. O resultado desse fenmeno ilustra a) a adaptao dos mutantes. b) a influncia do ambiente na expresso do gentipo. c) a transmisso dos caracteres adquiridos. d) o processo de seleo natural. [B] 1031. Na espcie humana h um tipo de doena hereditria muito rara denominada Aquiropodia, que determinada por um par de genes. No heredograma a seguir, os aquirpodos esto representados por smbolos hachurados. Considerando o heredograma, julgue os itens abaixo. (1) O carter fenilcetonrico apresenta herana autossmica dominante. (2) O cruzamento entre os indivduos 10 e 11 ilustra como a consanginidade influencia o aparecimento de doenas hereditrias. (3) Os homens normais representados no heredograma so necessariamente heterozigotos. (4) A probabilidade de que o casal formado pelos indivduos 10 e 11 tenha um descendente do sexo masculino fenilcetonrico igual a 12,5%. (5) A dieta especial a que devem ser submetidos os recm-nascidos fenilcetonricos tende a alterar a frequncia do gene da fenilcetonria na populao. ECEEC 1034. Em uma populao de mariposas, 96% dos indivduos tm cor clara e 4%, cor escura. Indivduos escuros cruzados entre si produzem, na maioria das vezes, descendentes claros e escuros. J os cruzamentos entre indivduos claros produzem sempre apenas descendentes de cor clara. Esses resultados sugerem que a cor dessas mariposas condicionada por a) um par de alelos, sendo o alelo para cor clara dominante sobre o que condiciona cor escura. b) um par de alelos, sendo o alelo para cor escura dominante sobre o que condiciona cor clara. c) um par de alelos, que no apresentam dominncia um sobre o outro. d) dois genes ligados com alta taxa de recombinao entre si. e) fatores ambientais, como a colorao dos troncos onde elas pousam. [B] 1035. A primeira lei de Mendel ou lei da segregao significa: a) um cruzamento onde se considera apenas um gene, representado por dois alelos. b) um cruzamento de dois genitores homozigotos contrastantes. c) um cruzamento de dois genitores heterozigotos. d) a separao de um par de alelos durante a formao dos gametas. e) um carter controlado por dois ou mais genes. [D] 1036. Sabe-se que a transmisso hereditria da cor das flores conhecidas como copo-de-leite se d por herana mendeliana simples, com dominncia completa. Em um cruzamento experimental de copos-de-leite vermelhos, obteve-se uma primeira gerao F1 - bastante numerosa, numa proporo de 3 descendentes vermelhos para cada branco (3:1). Analisando o gentipo da F1, os cientistas

Com base na anlise do heredograma, assinale a afirmativa INCORRETA. a) Pode-se dizer que a Aquiropodia condicionada por um alelo recessivo a. b) Pode-se assumir que os indivduos II.1 e II.5 possuem o gentipo AA, j que a condio herdada em anlise muito rara. c) No possvel ter certeza sobre o gentipo de alguns indivduos, como o caso dos indivduos II.3 e III.5. d) Os pais dos aquirpodos so primos. e) O gentipo dos indivduos IV.2 e IV.4 aa. [C] 1032. O esquema anterior mostra uma experincia com um coelho himalaia. A mudana ocorrida na colorao do plo em funo da queda de temperatura demonstra o efeito da:

93 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

constataram que apenas um em cada trs descendentes vermelhos era homozigoto para essa caracterstica. De acordo com tais dados, pode-se afirmar que a produo genotpica da F1 desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa [D] 1037. A acondroplasia (uma das formas de nanismo) causada por um gene dominante autossmico. Da unio de um homem acondroplsico com uma mulher normal resulta um filho normal. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo).

b) Os indivduos pretos de F1 eram homozigotos. c) Todos os indivduos pretos de F2 eram heterozigotos. d) Todos os indivduos marrons eram homozigotos. e) Os indivduos pretos da gerao F1 eram heterozigotos e a fmea parental era homozigota. [D] 1041. Uma populao experimental contm 200 indivduos AA, 200 aa e 200 Aa. Todos os indivduos AA foram cruzados com indivduos aa e os indivduos Aa foram cruzados entre si. Considerando que cada casal produziu 2 descendentes, espera-se encontrar entre os filhotes: a) AA - 50 Aa - 500 aa - 50 b) AA - 100 Aa - 400 aa - 100 c) AA - 100 Aa - 1000 aa - 100 d) AA - 200 Aa - 200 aa - 200 e) AA - 200; Aa - 800; aa 100 [A] 1042. O grfico a seguir mostra a dinmica das freqncias do gene s, o qual determina a doena chamada siclemia ou anemia falciforme. Os homozigotos siclmicos morrem precocemente devido severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, so mais resistentes malria que os indivduos normais. O grfico refere-se ao perodo posterior erradicao da malria. Qual a explicao para o comportamento das curvas do grfico?

Em relao aos descendentes deste ltimo casamento e ao carter em questo, considerando ausncia de mutao, correto afirmar: ( ) O descendente ser obrigatoriamente heterozigoto. ( ) A freqncia genotpica na descendncia ser 1:2:1. ( ) A probabilidade de acondroplasia na descendncia igual a zero. ( ) A probabilidade de heterozigose na descendncia em relao a este locus igual a zero. ( ) A freqncia fenotpica numa prole numerosa ser 3:1. ( ) Numa prole numerosa, a freqncia fenotpica ser de 1 acondroplsico para 1 normal. FFVVFF 1038. No cruzamento de plantas verdes, normais, possvel o aparecimento de indivduos albinos. Embora plantas albinas morram antes de produzirem sementes, a caracterstica "albinismo" no desaparece entre elas. Isto se explica porque: a) muitas plantas verdes so heterozigticas. b) plantas normais homozigticas tornam-se albinas na ausncia de luz. c) plantas albinas tornam-se verdes na presena de luz. d) o gene para albinismo ativado no escuro. e) o albinismo impede a sntese de clorofila. [A] 1039. A calvcie uma caracterstica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino. Observe a genealogia a seguir, relativa a essa caracterstica.

a) Diminuio da freqncia de mutao de S para s. b) Seleo contra os portadores do gene s. c) Aumento da freqncia de mutao de S para s. d) Cruzamentos preferenciais entre pessoas anmicas. e) Cruzamentos preferenciais entre portadores de malria. [B] 1043. A talassemia uma doena hereditria que resulta em anemia. Indivduos homozigotos MM apresentam a forma mais grave, identificada como talassemia maior e os heterozigotos MN, apresentam uma forma mais branda chamada de talassemia menor. Indivduos homozigotos NN so normais. Sabendo-se que todos os indivduos com talassemia maior morrem antes da maturidade sexual, qual das alternativas a seguir representa a frao de indivduos adultos, descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor, que sero anmicos? a) b) c) 1/3 d) 2/3 e) 1/8 [D] 1044. Na espcie humana, o albinismo causado por um gene autossmico recessivo. A probabilidade do primeiro filho de um homem albino casado com uma mulher normal, mas heterozigota, ser albino e do sexo masculino : a) nula b) 25 % c) 50 % d) 75 % e) 100 % [B] 1045. Em aves, existe uma anomalia que se caracteriza pelo encurtamento das asas. Quando aves anmalas heterozigticas so cruzadas, originam uma descendncia com indivduos anmalos e normais numa proporo de 2 :1, respectivamente. A partir desses dados, possvel deduzir que o alelo que condiciona a anomalia a) letal em homozigose. b) letal recessivo. c) pleiotrpico. d) hiposttico. e) episttico. [A]

A probabilidade do casal 34 ter o primeiro filho homem e que venha a ser calvo, : a) b) c) 1/8 d) 1/6 [B] 1040. Em porquinhos da ndia, o plo pode ser preto ou marrom. Uma fmea preta foi cruzada com um macho marrom, produzindo uma F1 composta por indivduos marrons e pretos em igual quantidade. Retrocruzando-se um macho preto de F1 com a fmea parental, 75% dos filhotes produzidos em F2 tinham plo preto e 25% apresentavam plo marrom. A partir desses resultados, assinale a alternativa correta. a) 50% dos indivduos pretos de F2 eram heterozigotos.

94 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1046. Um determinado casal normal, mas heterozigoto para o albinismo, solicitou aconselhamento gentico sobre a possibilidade de vir a ter crianas apresentando a condio albina. Qual a probabilidade desse casal ter: a) quatro crianas albinas? b) uma criana albina e do sexo feminino? c) uma criana normal heterozigota e do sexo masculino? d) Represente o provvel heredograma desse casal, admitindo-se que as suposies feitas nas letras (b) e (c), realmente se concretizem. a) 1/256 b) 1/8 c) 1/4 d) Observe a figura a seguir:

A probabilidade do casal I x II ter uma criana mope a) imprevisvel, porque a mulher tanto pode ser homozigota como heterozigota. b) nula, porque a mulher tem o gene dominante em homozigose. c) 1/2, porque 50% dos gametas da mulher transportam o gene recessivo. d) 1/4, porque o casal j tem trs filhos com viso normal. e) 1/4, porque o gene para a miopia recessivo. [C] 1052. Fenilcetonria uma doena hereditria humana resultante da inabilidade do organismo de processar o aminocido fenilalanina, que est presente nas protenas da dieta humana, e causada por um alelo recessivo por herana Mendeliana simples. Um casal decide ter um filho, mas consulta um geneticista porque o homem tem uma irm com fenilcetonria, e a mulher tem um irmo com esta mesma doena. No h outros casos conhecidos nas famlias. A probabilidade de sua primeira criana ter fenilcetonria de: a) 1/2. b) 1/4. c) 1/9. d) 2/3. e) 4/9. [C] 1053. Considere a figura a seguir que representa o resultado da primeira diviso meitica de uma clula feminina:

1047. No homem, a acondroplasia uma anomalia determinada por um gene autossmico dominante. Qual a probabilidade de um casal de acondroplsicos, que j tem uma menina normal, vir a ter um menino acondroplsico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 [B] 1048. Uma mulher normal, casada com um portador de doena gentica de herana autossmica dominante, est grvida de um par de gmeos. Qual a probabilidade de que pelo menos um dos gmeos venha a ser afetado pela doena no caso de serem, respectivamente, gmeos monozigticos ou dizigticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% [E] 1049. Se os indivduos 7 e 11 se casarem, a probabilidade desse casal ter uma filha com o mesmo fentipo do av materno de:

a) Indique o gentipo do embrio formado a partir da fecundao do vulo resultante dessa clula por um espermatozide de um macho recessivo para os dois pares de genes considerados. b) Quais os possveis gentipos dos filhos possveis do mesmo casal? a) o ocito AAbb formar, na segunda diviso meitica, vulo do tipo Ab, que fecundado por um espermatozide ab produzir um embrio de gentipo Aabb. b) A mulher de gentipo AaBb cruzando com um homem aabb poder ter filhos com os seguintes gentipos: AaBb, Aabb, aaBb, aabb. 1054. Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos, cuja me albina, nasceram duas crianas, uma com cabelos crespos e outra com cabelos lisos. A probabilidade de que uma terceira criana seja albina com cabelos crespos : a) 75% b) 50% c) 37,5% d) 25% e) 12,5% [C] a) [B] b) c) 1/8 d) 1/3 e) 2/3 1055. Um casal de surdos teve dois filhos com audio normal. Sabendo se que a surdez determinada por qualquer dos genes recessivos d ou e, em homozigose, espera se que o gentipo dos filhos seja a) ddee. b) Ddee. c) DDEE. d) DdEe. e) DDee. [D] 1056. O cruzamento entre duas linhagens de ervilhas, uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr), originou 800 indivduos. Quantos indivduos devem ser esperados para cada um dos fentipos obtidos? a) amarelas-lisas = 80 amarelas-rugosas = 320 verdes-lisas = 320 verdes-rugosas = 80. b) amarelas-lisas = 100 amarelas-rugosas = 100 verdes-lisas = 300 verdes-rugosas = 300. c) amarelas-lisas = 200

1050. A fenilcetonria uma doena com herana autossmica recessiva. Em certa comunidade europia, uma em cada 20 pessoas com fentipo normal heterozigtica quanto ao gene que determina a fenilcetonria. Em 800 casamentos ocorridos entre membros sadios dessa comunidade, qual o nmero esperado de casamentos com risco de gerar crianas fenilcetonricas? a) 2. b) 8. c) 16. d) 40. e) 80. [A] 1051. O esquema mostra a genealogia de uma famlia. Os smbolos escuros representam os indivduos mopes e os claros, os indivduos de viso normal.

95 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

amarelas-rugosas = 200 verdes-lisas = 200 verdes-rugosas = 200. d) amarelas-lisas = 300 amarelas-rugosas = 300 verdes-lisas = 100 verdes-rugosas=100. e) amarelas-lisas = 450 amarelas-rugosas = 150 verdes-lisas = 150 verdes-rugosas=50. [D] 1057. As flores de uma determinada planta podem ser vermelhas ou amarelas. Dois pares de genes (Vv e Aa) determinam essa caracterstica: plantas V_A_ produzem flores vermelhas e plantas V_aa, vvA_ ou vvaa, flores amarelas. Na descendncia do cruzamento VvAa x VvAa espera-se encontrar uma proporo fenotpica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela [C] 1058. Na genealogia a seguir, est representada a herana de duas caractersticas determinadas por genes autossmicos.

1061. Em humanos a polidactilia condicionada por um gene dominante, sendo os indivduos homozigotos recessivos portadores de ps e mos normais (com 5 dedos cada). Por sua vez, o albinismo condicionado por um gene recessivo, sendo que o alelo dominante produz em seus portadores pigmentao normal. Ambos os locos citados so autossmicos. Considere este caso: Antnio, um homem com ps e mos normais, porm albino, casa-se com Maria, mulher normal para o albinismo, polidctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidctila. A partir das informaes anteriores, assinale a alternativa CORRETA. a) Todos os filhos desse casal devero ser albinos. b) No existe qualqueir chance de nascer um filho polidctilo dessa relao. c) Antnio poder produzir 2 tipos de gametas diferentes para essas caractersticas. d) A me de Maria , obrigatoriamente, homozigota para as duas caractersticas. e) Maria produzir gametas de 4 tipos diferentes para essas caractersticas. [E] 1062. Em coelhos, o gene P produz pelagem preta e o seu alelo recessivo p, pelagem parda desde que esteja presente o gene A. Os animais aa so sempre albinos. Considerando que ocorra segregao independente entre esses genes, a partir do cruzamento PpAa x ppaa espera-se uma proporo fenotpica de a) 1 preto: 1 pardo: 2 albinos. b) 1 preto: 1 pardo. c) 1 preto: 1 albino. d) 1 preto: 3 albinos. e) 1 pardo: 3 albinos. [A] 1063. Numa ave domstica, o gene C condiciona plumagem branca e o seu alelo recessivo, plumagem colorida; o gene P determina patas com plumas e o seu alelo recessivo, patas sem plumas. Esses pares de genes so autossmicos e segregam independentemente. Uma ave branca com patas com plumas, homozigota para os dois pares de genes, foi cruzada com uma colorida com patas sem plumas. Se os decendentes obtidos forem cruzados entre si, espera-se que a proporo de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 d) 3/16 e) 1/16 [C] 1064. Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. Deste casal, nasce uma criana albina o de olhos claros. Qual o gentipo dos pais a da criana? a) aacc, AaCc, aacc. b) Aacc, AACC, Aacc. c) AaCC, AaCc, AaCC. d) aaCC, aacc, aacc. e) aacc, AaCc, AaCc. [A] 1065. Um casal, ambos polidctilos (com mais de 5 dedos) e de viso normal, tem uma criana normal para polidactilia, mas mope. Considerando-se que ambas as anomalias so autossmicas e os respectivos genes esto em cromossomos diferentes, ento, a probabilidade do casal ter outra criana normal para as duas caractersticas : a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 [C] 1066. Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd - Ee) localizados em cromossomos no homlogos. Os indivduos homozigotos dd ou ee so surdos; os indivduos com audio normal possuem, pelo menos, um gene D e um E. Qual a probabilidade de um casal DdEE ddEe vir a ter uma criana com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% [C] 1067. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Imagine uma espcie animal na qual um gene A determina a formao do olho e seu alelo recessivo determina a ausncia de olhos. Um outro gene B dominante determina a pigmentao clara do olho, enquanto seu alelo recessivo determina a cor escura. Sabe-se que o gene A est em um cromossomo e B em outro. Feito um cruzamento entre dois indivduos duplamente heterozigticos, correto afirmar que: 01 - 9/16 dos descendentes desse cruzamento tero olhos normais e com pigmentao escura. 02 - 3/16 dos descendentes desse cruzamento tero olhos normais e com pigmentao clara. 04 - 4/16 dos descendentes nascero sem olhos. 08 - Estes problemas envolve a Segunda Lei de Mendeliana, ou seja "Lei da Segregao Independente dos Caracteres". 02 + 04 + 08 = 14 1068. Observe o heredograma a seguir:

Quais so os indivduos obrigatoriamente heterozigotos para as duas caractersticas? a) 6, 7, 13 e 14 b) 5, 8, 9, 12 e 15 c) 1, 2, 3, 4, 7 e 13 d) 6, 9, 10, 11, 14, 15 e 16 e) 1, 2, 3, 4, 7, 9, 13 e 15 [C] 1059. Na genealogia a seguir, est representada a herana de duas caractersticas determinadas por genes autossmicos.

Quais so os indivduos que seguramente produzem um s tipo de gameta? a) 6, 7, 8, 9, 13 e 14 b) 6, 8, 11, 14 e 16 c) 5, 9, 10, 12 e 15 d) 3, 4, 8, 9 e 15 e) 1, 2, 3, 4 e 13 [B] 1060. No homem, a polidactilia um carter dominante e a miopia, uma anomalia recessiva. Os genes responsveis por essas caractersticas situam-se em autossomos e apresentam segregao independente. Uma mulher com polidactilia e miopia, cuja me era normal para as duas caractersticas, casada com um homem normal, cujo pai era mope. A probabilidade desse casal ter uma criana com polidactilia e miopia a) 0% b) 25% c) 50% d) 75% e) 100% [B]

96 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1073. No cruzamento entre indivduos heterozigotos para dois pares de genes que se segregam independentemente, espera-se que a proporo de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) c) d) 3/16 e) 1/16 [B] 1074. Um pesquisador averiguava a transmisso de caracteres em vegetais ao longo de geraes, determinados por genes que se segregavam independentemente. Cruzando dois indivduos homozigotos, sendo um dominante e outro recessivo, ele obteve a primeira linhagem, na qual promoveu autofecundao. Como resultado, obteve quatro tipos de fentipos, na proporo de 9:3:3:1. Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 [B] Sabendo-se que a miopia e o uso da mo esquerda no condicionados por genes recessivos, considere as seguintes afirmaes: I - Os indivduos 2 e 4 tm o mesmo gentipo. II - Se o indivduo 3 se casar com um homem de viso normal (heterozigoto) e canhoto, tero 25% de chance de ter uma filha canhota e de viso normal. III - O indivduo 5 heterozigoto para o gene do uso da mo esquerda e o indivduo 6 heterozigoto para o gene da miopia. Assinale: a) se todas as afirmativas forem corretas. b) se somente as afirmativas I e III forem corretas. c) se somente as afirmativas II e III forem corretas. d) se somente as afirmativas I e II forem corretas. e) se somente a afirmativa II for correta. [A] 1069. Sabendo-se que a miopia e o uso da mo esquerda no condicionados por genes recessivos, analise a genealogia a seguir e responda. 1075. Um criador fez cruzamentos entre porquinhos-da-ndia para estudar as caractersticas: cor e tamanho do plo. Observou os seguintes resultados: GERAO P: plo preto curto X plo marrom longo GERAO F1: plo preto curto GERAO F2: 81 plo preto curto 27 plo preto longo 27 plo marrom curto 09 plo marrom longo Com base nesses resultados, INCORRETO afirmar que a) as caractersticas plo preto e curto so dominantes. b) as duas caractersticas segregam-se independentemente. c) os indivduos da gerao F1 so homozigotos. d) os indivduos da gerao P formam um s tipo de gameta. [C] 1076. As afirmativas a seguir relacionam a Gentica Mendeliana Diviso Celular. I - As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formao dos gametas, logo esto relacionadas com o comportamento cromossmico na meiose. II - Dois pares de genes se segregam independentemente, se estiverem localizados em cromossomos diferentes. III - A lei da segregao independente (2 lei) est relacionada s conseqncias do arranjo, ao acaso, de pares de cromossomos homlogos na placa metafsica, na meiose. Est(o) correta(s): a) somente I. b) somente I e II. c) somente I e III. d) somente II e III. e) I, II e III. [E] 1077. Mendel, nas primeiras experincias sobre hereditariedade, trabalhou com apenas uma caracterstica de cada vez. Posteriormente, ele acompanhou a transmisso de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres so transmitidos para os gametas de modo totalmente independente ". Esta observao foi enunciada como "2 Lei de Mendel" ou "Lei da Segregao Independente", a qual no vlida para os genes que esto em ligao gnica ou "linkage", isto , genes que esto localizados nos mesmos cromossomos. Observando as seguintes propores de gametas produzidos pelo dihbrido AaBb em trs situaes distintas, I - AB (25%); Ab (25%); aB (25%); ab (25%), II - AB (50%); ab (50%), III - AB (40%); Ab (10%); aB (10%); ab (40%), pode-se afirmar que: a) I e II so situaes nas quais os genes segregam-se independentemente. b) II e III so situaes nas quais ocorre segregao independente e ligao gnica sem "crossing-over", respectivamente, c) I e III so situaes nas quais ocorre segregao independente e ligao gnica com "crossing-over", respectivamente. d) II uma situao na qual ocorre ligao gnica com "crossing-over". e) III uma situao na qual ocorre ligao gnica sem "crossing-over". [C] 1078. Do cruzamento entre dois indivduos portadores do gentipo CcDd, a probabilidade de ocorrncia na F1 de indivduos com o mesmo gentipo dos pais, : a) zero b) c) d) 1/8 [C] 1079. Plantas de gentipo AaBb foram intercruzadas. Sabendo-se que os alelos representados por letras maisculas so dominantes e que os no-alelos sofrem segregao independente, os nmeros de gentipos e de fentipos diferentes entre os descendentes desses cruzamentos so, respectivamente, a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 [C] 1080. A fenilcetonria e a miopia so doenas decorrentes da ao de genes autossmicos recessivos. Do casamento entre uma mulher normal, filha de me com fenilcetonria e pai mope, com um homem normal para fenilcetonria e

A probabilidade do casal 4 x 5 ter uma criana dibrida : a) 1/8 b) 3/16 c) 1/16 d) e) [D] 1070. Em ervilha, o gene que determina a forma lisa da vagem (C) dominante sobre o gene que determina vagens com constries (c). O gene que determina plantas de altura normal (H) dominante sobre o gene que determina plantas ans (h). Cruzando-se plantas CCHH com plantas CcHh, espera-se obter na descendncia: a) 50% de plantas ans com vagens lisas e 50% de plantas de altura normal com vagens com constries. b) 100% de plantas ans com vagens com constries. c) 100% de plantas de altura normal com vagens com constries. d) 100% de plantas ans com vagens lisas. e) 100% de plantas de altura normal com vagens lisas. [E] 1071. Qual a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossmicos com segregao independente vir a ter um descendente com apenas uma caracterstica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 e) 1/16 [C] 1072. Considere que em cavalos a colorao do plo resulta da ao de dois pares de genes autossmicos localizados em cromossomos no homlogos. O gene M condiciona cor preta e seu alelo m, cor marrom; o gene B determina colorao uniforme e seu alelo b, manchas brancas em qualquer cor de pelagem. Um macho preto com manchas brancas (I), cujo pai era marrom uniforme (II), cruzado com uma fmea marrom com manchas brancas (III), cuja me era preta uniforme (IV). Assinale, a seguir, a alternativa que contm os gentipos dos indivduos mencionados. a) I - (mmBb), II - (Mmbb), III - (MmBb), IV - (mmbb) b) I - (Mmbb), II - (mmBb), III - (mmBb), IV - (Mmbb) c) I - (MMbb), II - (mmBb), III - (mmbb), IV - (MmBb) d) I - (mmbb), II - (MmBb), III - (Mmbb), IV - (mmBb) e) I - (Mmbb), II - (mmBb), III - (mmbb), IV - (MmBb) [E]

97 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

mope, nasceu uma criana de viso normal e fenilcetonrica. A probabilidade desse casal ter uma criana normal para as duas caractersticas : a) 1/8 b) c) 3/8 d) 7/8 e) [C] 1081. Em uma determinada espcie animal, foram analisadas duas caractersticas com segregao independente e herana co-dominante: cor e textura do plo. Para a cor do plo, os homozigotos podem ser vermelhos ou brancos. Para a textura, os homozigotos tm plo liso ou crespo. Calcule a porcentagem esperada de descendentes fmeas com plo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. Despreze a parte fracionria de seu resultado, caso exista. 1/32 = 3% 1082. A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou bano. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fmea de corpo bano e asas longas (parentais P1) obtevese F1 que deu origem a F2 atravs da autofecundao, como mostra a figura a seguir.

a) ABC, ABc, aBC, AbC, Abc, abC, abc b) ABC, abc c) Aa, Bb, Cc d) AABBCC, aabbcc e) AaBbCc [E] 1088. Se a meiose ocorre numa clula de gentipo AaBbCc, onde os trs pares de genes esto em pares de cromossomos separados, quais sero os gentipos das clulas resultantes? a) Aa, Bb e Cc b) ABC e abc c) ABC, ABc, aBC, aBc, AbC, Abc, abC e abc d) AaBbCc e) AABBCC e aabbcc [C] 1089. Considere a segunda lei de Mendel ou lei da distribuio independente e indique os gametas produzidos pelo gentipo aaBbccDdEE. a) a; B; b; c; D; d ; E. b) aBcDE; aBcdE; abcDE; abcdE. c) aa; Bb; cc; Dd; EE. d) aaBb; ccDd; aaEE; BbDd. e) aB; bc; cD; dE. [B] 1090. Assinale a alternativa correta. Em experimentos envolvendo trs caractersticas independentes (triibridismo), se for realizado um cruzamento entre indivduos AaBbCc, a freqncia de descendentes AABbcc ser igual a a) 8/64 b) 1/16 c) 3/64 d) e) 1/32 [E] 1091. No homem, a polidactilia um carter dominante e a miopia, uma anomalia recessiva. Os genes responsveis por essas caractersticas situam-se em autossomos e apresentam segregao independente. Uma mulher com polidactilia e miopia, cuja me era normal para as duas caractersticas, casada com um homem normal, cujo pai era mope. A probabilidade desse casal ter uma criana com polidactilia e miopia a) 0% b) 25% c) 50% d) 75% e) 100% [B] 1092. Um casal, ambos polidctilos (com mais de 5 dedos) e de viso normal, tem uma criana normal para polidactilia, mas mope. Considerando-se que ambas as anomalias so autossmicas e os respectivos genes esto em cromossomos diferentes, ento, a probabilidade do casal ter outra criana normal para as duas caractersticas : a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 [C] 1093. Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd - Ee) localizados em cromossomos no homlogos. Os indivduos homozigotos dd ou ee so surdos; os indivduos com audio normal possuem, pelo menos, um gene D e um E. Qual a probabilidade de um casal DdEE ddEe vir a ter uma criana com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% [C] 1094. Observe o heredograma a seguir:

Aps a anlise dos resultados dos cruzamentos, foram feitas as afirmativas abaixo. I - A probabilidade de ocorrncia do mesmo gentipo dos indivduos de F1 em F2 de 4/16. II - Os genes para cor do corpo e pra tipo de asa esto localizados num mesmo cromossoma. III - Em F, a probabilidade de ocorrncia de homozigose dominante a mesma de homozigose recessiva. IV - O gene para corpo bano s est presente na gerao P1 e em parte de F2. V - Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formao dos gametas. As afirmativas corretas so: a) I, II e IV, apenas. b) I, II e V , apenas. c) I, III e V , apenas. d) II, III e IV , apenas. e) III, IV e V, apenas. [C] 1083. Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE. Sabendo-se que os zanges surgem de vulos que se desenvolvem por partenognese, quantos gentipos diferentes, relativos a esses cinco pares de genes podem apresentar os zanges filhos dessa rainha? a) Um. b) Dois. c) Quatro. d) Oito. e) Dezesseis. [C] 1084. Do cruzamento de dois indivduos com gentipo AaBbCc, a probabilidade de surgir um descendente com gentipo que apresenta, pelo menos, um gene dominante, Obs.: Considere um tipo de herana mendeliana. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) [B] 1085. Considere um homem heterozigoto para o gene "A", duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". Considere ainda que todos esses genes situam-se em cromossomos diferentes. Entre os gametas que podero se formar encontraremos apenas a(s) combinao(es): a) AdF. b) AADDFF. c) AaddFF. d) AdF e adF. e) ADF e adf. [D] 1086. Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. Sabendo-se que os zanges surgem de vulos que se desenvolvem por partenognese, quantos gentipos diferentes, relativos a esses quatro pares de genes, podem apresentar os zanges filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis [E] 1087. Se a mitose ocorre em uma clula de gentipo AaBbCc, onde os trs pares de genes esto em pares de cromossomos distintos, os gentipos das clulas resultantes sero:

Sabendo-se que a miopia e o uso da mo esquerda no condicionados por genes recessivos, considere as seguintes afirmaes: I - Os indivduos 2 e 4 tm o mesmo gentipo. II - Se o indivduo 3 se casar com um homem de viso normal (heterozigoto) e canhoto, tero 25% de chance de ter uma filha canhota e de viso normal. III - O indivduo 5 heterozigoto para o gene do uso da mo esquerda e o indivduo 6 heterozigoto para o gene da miopia. Assinale: a) se todas as afirmativas forem corretas. b) se somente as afirmativas I e III forem corretas. c) se somente as afirmativas II e III forem corretas.

98 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) se somente as afirmativas I e II forem corretas. e) se somente a afirmativa II for correta. [A] 1095. Sabendo-se que a miopia e o uso da mo esquerda no condicionados por genes recessivos, analise a genealogia a seguir e responda.

1102. Em relao ao sistema circulatrio humano, so feitas as seguintes afirmativas: I - No corao, o sangue que penetra na aurcula esquerda arterial e chega atravs das veias pulmonares. II - O corao envia sangue venoso aos pulmes atravs das artrias pulmonares, que saem do ventrculo esquerdo. III - Atravs da artria aorta, o sangue chega ao ventrculo esquerdo de onde distribudo para todo o corpo. Indique a alternativa correta: a) todas so verdadeiras. b) somente I e II so verdadeiras. c) somente II e III so verdadeiras. d) somente I verdadeira. e) somente II verdadeira. [D] 1103. Nos mamferos, pode-se encontrar sangue venoso: a) na aurcula direita, na artria pulmonar e na veia cava. b) no ventrculo direito, na veia pulmonar e na veia cava. c) na aurcula direita, na veia pulmonar e na artria aorta. d) na aurcula esquerda, na artria pulmonar e na veia cava. e) no ventrculo esquerdo, na veia pulmonar e na artria aorta. [A] 1104. O sistema circulatrio dos artrpodos diferencia-se do dos cordados por no transportar a) gases da respirao. b) hormnios. c) resduos orgnicos. d) nutrientes. e) gua. [A] 1105. Jogadores de futebol que vivem em altitudes prximas do nvel do mar sofrem adaptaes quando jogam em cidades de grande altitude. Algumas adaptaes so imediatas, outras s ocorrem aps uma permanncia de pelos menos 3 semanas. Qual alternativa inclui as reaes imediatas e as que podem ocorrer a longo prazo? a) IMEDIATAS: aumentam a freqncia respiratria, os batimentos cardacos e a presso arterial. A LONGO PRAZO: diminui o nmero de hemcias. b) IMEDIATAS: diminuem a freqncia respiratria e os batimentos cardacos; aumenta a presso arterial. A LONGO PRAZO: aumenta o nmero de hemcias. c) IMEDIATAS: aumentam a freqncia respiratria e os batimentos cardacos; diminui a presso arterial. A LONGO PRAZO: diminui o nmero de hemcias. d) IMEDIATAS: aumentam a freqncia respiratria, os batimentos cardacos e a presso arterial; diminui a presso arterial. A LONGO PRAZO: aumenta o nmero de hemcias. e) IMEDIATAS: aumentam a freqncia respiratria, os batimentos cardacos e a presso arterial. A lONGO PRAZO: aumenta o nmero de hemcias. [D] 1106. A figura a seguir representa diferentes padres de corao de vertebrados. Qual a seqncia indica a ordem crescente da eficincia circulatria, com relao ao transporte de gases, conferida pelos trs coraes?

A probabilidade do casal 4 x 5 ter uma criana dibrida : a) 1/8 b) 3/16 c) 1/16 d) e) [D] 1096. Qual a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossmicos com segregao independente vir a ter um descendente com apenas uma caracterstica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 e) 1/16 [C] 1097. Uma criana do sexo feminino, daltnica e canhota, possui pai daltnico e destro e me de viso normal e canhota. Sabendo que o uso da mo esquerda uma caracterstica recessiva, ento a probabilidade do segundo filho ser do sexo masculino e com fentipos dominantes : a) b) c) 1/6 d) 1/8 e) 1 [D] 1098. No cruzamento entre indivduos heterozigotos para dois pares de genes que se segregam independentemente, espera-se que a proporo de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) c) d) 3/16 e) 1/16 [B] 1099. Do cruzamento entre dois indivduos portadores do gentipo CcDd, a probabilidade de ocorrncia na F1 de indivduos com o mesmo gentipo dos pais, : a) zero b) 1/2 c) 1/4 d) 1/8 [C] 1100. No corao dos mamferos h passagem de sangue. a) da aurcula esquerda para o ventrculo esquerdo. b) do ventrculo direito para a aurcula direita. c) do ventrculo direito para o ventrculo esquerdo. d) da aurcula direita para a aurcula esquerda. e) da aurcula direita para o ventrculo esquerdo. [A] 1101. O esquema a seguir apresenta o percurso do sangue no corpo humano. Assinale a alternativa que indica corretamente as regies desse percurso onde se espera encontrar as maiores concentraes de oxignio, glicose e uria.

a) 1, 2, 3 d) 2, 1, 3 [E]

b) 1, 3, 2 e) 3, 1, 2

c) 3, 2, l

oxignio/ glicose/ uria. a) I III VI. b) II III VII. c) II VII VI. d) I IV VII. e) II IV VI. [E]

1107. No tecido sangneo humano, a substncia intersticial liquida e os neutrfilos podem ser responsveis, respectivamente, a) pelo transporte de alimentos e transporte de oxignio. b) pelo transporte de gs carbnico e transporte de oxignio. c) pela produo de hemcias e fagocitose de elementos estranhos ao organismo. d) pela fagocitose de elementos estranhos ao organismo e transporte de gs carbnico. e) pelo transporte de gs carbnico e fagocitose de elementos estranhos ao organismo. [E] 1108. Ao observarmos a circulao humana, quando comparamos artrias e veias, podemos afirmar que: a) veias conduzem sempre sangue carbonado, assim como as artrias sempre possuem sangue oxigenado.

99 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) veias levam sangue do corao para os tecidos, e as artrias trazem sangue dos tecidos para o corao. c) artrias e veias apresentam grande nmero de vlvulas que impedem o retorno do sangue ao corao. d) o grau de elasticidade do tecido muscular liso presente em artrias e veias o mesmo. e) a presso do sangue nas veias mais baixa que nas artrias. [E] 1109. Relacione as descries dos Sistemas Circulatrios com seus respectivos Filos animais. I - Ausente. O alimento distribudo diretamente da cavidade gastrovascular. II - Ausente. O alimento distribudo pelo intestino muito ramificado. III - Ausente. O alimento distribudo pelo fluido da cavidade pseudocelmica. IV - Presente, do tipo fechado, com vasos pulsteis e sangue dotado de pigmentos respiratrios. V - Presente, do tipo aberto, com corao e vasos sanguneos, onde circula o fluido celmico. P - Artrpodos. Q - Aneldeos. R - Moluscos. S - Nematelmintos. T - Platelmintos. U - Cnidrios. Assinale a opo que contm as associaes corretas. a) I - P; II - Q; III - R; IV - S; V - T b) I - P; II - Q; III - R; IV - T; V - U c) I - P; II - Q; III - R; IV - U; V - T d) I - U; II - T; III - S; IV - Q; V - P e) I - U; II - T; III - S; IV - S; V Q [D] 1110. O termo hipxia refere-se condio na qual a disponibilidade ou a utilizao de oxignio est reduzida. Os indivduos B, C, D e E, relacionados na tabela a seguir, esto submetidos, a diferentes formas de hipxia. O indivduo A tem metabolismo de oxignio normal. Considere que o peso, o sexo e a idade de todos os indivduos so os mesmos.

[A] 1113. Na circulao dos peixes, o sangue sai do corao pela aorta ventral e dirige-se diretamente para a) as brnquias. b) o encfalo. c) os rgos dos sentidos. d) o estmago e para o intestino. e) a musculatura do tronco e da cauda. [A] 1114. Observe o esquema referente ao sistema circulatrio de um vertebrado adulto representado na figura a seguir. Com base nesse esquema e em seus conhecimentos sobre o assunto, assinale a alternativa que contm o grupo de vertebrados nele apresentado.

a) Anfbios. d) Peixes. [D]

b) Aves. e) Rpteis.

c) Mamferos.

1115. A substncia que impede a coagulao do sangue humano nos vasos sanguneos (ou so) a) a trombina. b) a heparina. c) o fibrinognio. d) a vitamina K. e) ons de clcio. [B] 1116. Observe o esquema que se refere ao sistema crdio-respiratrio de um determinado animal.

a) Qual dos indivduos est sofrendo as conseqncias de uma dieta pobre em ferro? Qual apresenta insuficincia cardaca e circulao deficiente? Em que dados voc baseou suas concluses? b) Qual deles est sofrendo de envenenamento que impede suas clulas de usar o oxignio? Justifique a resposta. c) Observa-se uma acelerao da freqncia respiratria quando sobe o nvel de gs carbnico. Explique como isso acontece. a) O paciente C porque apresenta hemoglobina abaixo do normal, D porque est com um dbito cardaco baixo. b) O paciente E porque a taxa de oxignio no sangue venoso muito prxima taxa observada no sangue arterial. c) O gs carbnico estimula o bulbo raquidiano a aumentar a freqncia respiratria, 1111. Comparando-se a estrutura e a fisiologia dos coraes dos vertebrados, podemos considerar vlida a seguinte afirmativa: a) no corao dos peixes passa apenas sangue venoso b) o corao dos anfbios dotado de. quatro cmaras, duas aurculas (ou trios) e dois ventrculos c) no corao das aves passa apenas sangue arterial d) o corao dos rpteis apresenta-se com trs cmaras, uma aurcula (ou trio) e dois ventrculos e) no corao dos mamferos, as duas aurculas (ou trios) recebem sangue venoso e os dois ventrculos recebem sangue arterial [A] 1112. Nos vertebrados terrestres, a circulao sistmica tem incio e trmino, respectivamente, na a) artria aorta e na veia cava. b) veia cava e na artria aorta. c) artria pulmonar e na veia cava. d) artria aorta e na veia pulmonar. e) veia pulmonar e na artria pulmonar.

Com base nesse esquema e em seus conhecimentos sobre o assunto, pode-se afirmar que a) a estrutura 3 caracterstica de animais de circulao fechada. b) a estrutura 6 representa uma artria e, junto com 7 participa da grande circulao. c) a funo de 2 realizada pela bexiga natatria no tubaro. d) o rgo 1 tpico de rpteis. e) o teor de 0 em 4 maior do que em 5. [A] 1117. Observe o quadro que contm a representao do sistema nervoso e do corao de alguns grupos de vertebrados. Essa representao foi feita de forma aleatria, no mostrando correspondncia entre sistema nervoso e corao para cada grupo nem apresentando seqncia evolutiva.

100 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

( ) O corao um rgo essencialmente muscular cuja funo a propulso do sangue atravs do organismo. ( ) Nas aves e nos mamferos o corao completamente dividido em 4 cmaras: 2 aurculas e 2 ventrculos. ( ) Dietas alimentares ricas em gorduras podem comprometer o dimetro dos vasos sangneos importantes, facilitando a incidncia do enfarto do miocrdio. ( ) O transporte dos nutrientes e oxignio para todas as clulas do organismo uma das funes do sangue. VVVV 1124. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Durante os primeiros 4.700 anos da histria escrita da humanidade, desconhecia-se o fato mais elementar sobre o sangue - que ele circula. Foram William Harvey (1578-1657) e Marcello Malpighi (1628-1694) que, no sculo XVII, demonstraram esse fato. O conhecimento sobre a importncia evolutiva dos sistemas circulatrios, sua estrutura e as funes orgnicas a eles relacionadas permite afirmar: (01) O fato de o sangue circular atende necessidade de distribuio de substncias s diversas partes do organismo. (02) A manuteno da corrente sangnea dentro de artrias, capilares e veias caracteriza o sistema circulatrio fechado. (04) O sistema circulatrio foi fundamental para o sucesso evolutivo dos animais pluricelulares. (08) As funes exercidas atravs do sistema circulatrio prescindem da presena de clulas no sangue. (16) Um sistema circulatrio aberto dispensa a presena de uma estrutura propulsora do sangue. (32) A presena de pigmentos sangneos est associada funo protetora do sistema circulatrio. 01 + 02 + 04 = 07 1125. Aps um traumatismo, um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. Recuperou-se e passou a viver normalmente. A parte retirada era a) o fgado. b) o diafragma. c) a hipfise. d) o pncreas. e) o bao. [E] 1126. Leia o trecho com ateno: O corao apresenta quatro cmaras, duas aurculas e dois ventrculos e, nesse caso, no se misturam sangue arterial e venoso. A circulao dupla, o que permite melhor controle da presso arterial. O sistema circulatrio mais eficiente, possibilitando uma chegada rpida dos alimentos aos tecidos, garantindo, assim, o controle da temperatura corprea. Qual da alternativas a seguir apresenta um animal que no se relaciona com o trecho descrito? a) guia b) preguia c) pingim d) ornitorrinco e) cobra [E] 1127. As afirmaes a seguir se referem circulao do sangue no nosso organismo. Est correto afirmar que: a) "veias" so vasos que levam o sangue para fora do corao; b) o sangue sai do corao atravs das aurculas; c) para voltar a um certo ponto o sangue passa duas vezes pelo corao; d) "artrias" so vasos que levam o sangue para o corao; e) as vlvulas fornecem o retorno do sangue s aurculas. [C] 1128. No que se refere ao tipo de corao, os animais podem apresentar o corao dividido em 2,3 e 4 cavidades, classificando-se respectivamente como: a) mamferos, peixes, aves; b) peixes, anfbios, aves; c) anfbios, rpteis, mamferos; d) peixes, aves, anfbios; e) mamferos, peixes, rpteis. [B] 1129. O corao humano formado por: a) 1 aurcula e 2 ventrculos. b) 2 aurculas e 2 ventrculos. c) 2 aurculas e 1 ventrculo. d) 2 trios e 2 aurculas. e) 1 aurcula e 1 ventrculo. [B] 1130. Uma pessoa ao ser transportada para uma, regio de alta altitude, onde a atmosfera rarefeita, sofrer: a) aumento do nmero de leuccitos; b) diminuio do nmero de plaquetas; c) aumento do nmero de hemceas; d) aumento do nmero de plaquetas; e) a pessoa nada sofrer. [C] 1131. Ler atentamente as 3 afirmativas referentes atuao das hemcias, I - O gs carbnico combina-se com a hemoglobina formando carbo-hemoglobina II - Nos pulmes, a hemoglobina liberta gs carbnico e recebe oxignio

A alternativa que apresenta a associao correta encontrada em peixes a) I 4 b) II 3 c) III - 2 d) III 4 e) IV l [B] 1118. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Sobre os processes fisiolgicos: ( ) a circulao nos peixes fechada, simples e completa, enquanto nos anfbios dupla e incompleta, com mistura de sangue arterial e venoso; no homem, fechada, dupla e completa; ( ) nos rins, a reabsoro tubular um processo passivo para todas as substncias, exceto gua, sendo controlada pelo ADH (hormnio antidiurtico); ( ) no arco reflexo, a resposta motora a um estmulo no depende da percepo consciente; ( ) a hematose um processo que ocorre nos alvolos pulmonares; ( ) o FSH (hormnio folculo estimulante) estimula o amadurecimento do folculo, o qual produz estrgenos, que estimulam a produo de FSH, num exemplo de retroalimentao negativa. VFVVF 1119. As fibras que compem o tecido muscular cardaco so: a) lisas, anastomosadas e de contrao voluntria; b) estriadas, anastomosadas e de contrao involuntria; c) estriadas, no anastomosadas e de contrao involuntria; d) estriadas, anastomosadas e de contrao voluntria; e) lisas, anastomosadas e de contrao involuntria. [B] 1120. Com relao circulao humana, analise as afirmativas a seguir e assinale a opo correta: I) O sangue venoso, que contm o dixido de carbono excretado pelas diversas clulas do organismo, passa pelo corao e, circulando por veias, vai at os pulmes. II) Substncias no utilizadas pelas clulas e que podem prejudicar o organismo quando acumuladas, passam para o sangue e so eliminadas pelos rins e pulmes. III) A nvel dos alvolos pulmonares, o dixido de carbono liberado e o oxignio absorvido pelo sangue. O sangue arterial volta ao corao circulando por veias e da bombeado para todo o corpo via artrias. a) Todas esto corretas. b) Apenas a I est correta. c) Apenas a I falsa. d) Esto corretas a I e II. e) Todas so falsas. [C] 1121. Em relao ao sistema circulatrio dos mamferos, podemos afirmar que: a) as hemcias so circulares, anucleadas e o corao formado por quatro cavidades b) as hemcias so ovais, nucleadas e o corao formado quatro cavidades c) as hemcias so ovais, anucleadas e o corao formado trs cavidades d) as hemcias so circulares, nucleadas e o corao formado quatro cavidades e) as hemcias so circulares, anucleadas e o corao formado por trs cavidades [A] 1122. Um estudante observou que um determinado vaso sangneo apresentava paredes espessas e que o sangue que circulava em seu interior era de um vermelho escuro. Podemos afirmar corretamente que o vaso em questo era a: a) veia pulmonar, que leva sangue venoso do corao para o pulmo. b) veia cava, que traz sangue venoso do corpo em direo ao corao. c) veia pulmonar, que leva sangue arterial do pulmo para o corao. d) artria pulmonar, que leva sangue venoso do corao para o pulmo. e) artria pulmonar, que leva sangue arterial do pulmo para o corao. [D] 1123. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. Problemas do corao esto entre os principais fatores de mortalidade em nosso pas. Os itens a seguir referem-se direta ou indiretamente a este rgo, julgue-os.

101 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

III - Nos vasos capilares, atravs da linfa, o oxignio liberado da hemoglobina e chega s clulas e assinalar: a) se apenas I estiver correta b) se apenas II estiver correta c) se II e III estiverem corretas d) se I e III estiverem corretas e) se as 3 afirmativas estivarem corretas [E] 1132. Numere a segunda coluna de acordo com a primeira e assinale a alternativa que apresenta a ordem correta. 1 - Conduzem o sangue do corao para as diversas partes do corpo. 2 - Permitem a grande irrigao sangnea com todas as clulas do corpo. 3 - Coletam o sangue das diversas partes do corpo e conduzem-no de volta ao corao. ( ) Veias ( ) Artrias ( ) Capilares a) 2, 1, 3 b) 2, 3, 1 c) 3, 1, 2 d) 3, 2, 1 e) 1, 3, 2 [C] 1133. Em relao aos animais vertebrados, considere as seguintes caractersticas: I- Sangue arterial separado do venoso nas aurculas e misturado no ventrculo II- Presena de um nico ventrculo. III- Pelo corao passa apenas sangue venoso. Peixes e anfbios tm em comum: a) I e II. b) apenas I. c) apenas II. d) apenas II e III. e) I, II e III. [C] 1134. Considerando-se os sistemas circulatrios de um caramujo, de um sapo e de um cachorro, INCORRETO afirmar que: a) o corao do sapo apresenta trs cavidades e o do cachorro possui quatro. b) em todos eles possvel encontrar um corao impulsionando o sangue pelo corpo. c) as lacunas so espaos observados no sistema circulatrio do caramujo, mas inexistente no sapo e no cachorro. d) o caramujo e o sapo apresentam circulao dupla incompleta e o cachorro tem circulao dupla completa. e) em todos eles o sistema circulatrio est associado ao transporte, tanto de alimentos como de gases respiratrios. [D] 1135. Corao com trs cavidades, dois trios e um ventrculo. O trio direito recebe sangue venoso, o trio esquerdo recebe sangue arterial, misturando-se no ventrculo. Isso encontrado exclusivamente nos a) anfbios. b) peixes. c) rpteis. d) ofdios e peixes. e) peixes e anfbios. [A] 1136. Entre os principais agentes poluidores do ar atmosfrico destaca-se o monxido de carbono (CO), que um gs venenoso, inodoro e incolor, liberado profusamente pela queima de combustvel em automveis. Um dos efeitos desse poluente na sade humana a) diminuio da capacidade de formao de anticorpos no sangue. b) irritao nas mucosas do aparelho respiratrio, causando doenas como asma, bronquite e enfisema pulmonar. c) asfixia provocada pela inutilizao da molcula de hemoglobina no transporte dos gases respiratrios. d) Perturbaes cardacas em casos extremos de exposio prolongada. e) aumento da incidncia de cncer pulmonar. [C] 1137. O corao dos anfbios possui a) um trio e um ventrculo, ambos sem septos. b) um trio com septo parcial e um ventrculo sem septo. c) um trio e um ventrculo, ambos com septos parciais. d) dois trios e um ventrculo. e) dois trios e dois ventrculos. [D] 1138. O deslocamento de um atleta para locais de grande altitude pode acarretarlhe algumas alteraes no organismo. A curto prazo, provoca modificaes da atividade respiratria e, a longo prazo, produz alteraes sangneas. Assim, este indivduo apresenta a) hiperventilao e diminuio do nmero de hemcias. b) hiperventilao e aumento do nmero de hemcias. c) hipoventilao e diminuio do nmero de hemcias. d) hipoventilao e aumento do nmero de hemcias. e) isoventilao e manuteno do nmero de hemcias. [B] 1139. A sstole do(a) .................... lana sangue, atravs da(s) ......................... para os pulmes, .......................... . 1 - Veias Pulmonares Direita.

2 - Veia Cava Superior. 3 - trio Direito. 4 - Ventrculo Direito. 5 - Veia Cava Inferior. 6 - Ventrculo Esquerdo. 7 - trio Esquerdo. 8 - Veias Pulmonares Esquerda. 9 - Artria Pulmonar. 10 - Aorta.

Assinale a alternativa cujos termos preenchem corretamente as lacunas da afirmativa anterior. a) 4 - 9 - onde ocorrer a hematose. b) 6 - 10 - de onde ir para todo o corpo. c) 3 - 2 e 5 - onde ocorrer a hematose. d) 7 - 1 e 8 - onde ser oxigenado. e) 6 - 10 - onde ser oxigenado. [A] 1140. A hipotermia pode ser utilizada em algumas intervenes cirrgicas. Entre estas podemos citar a cirurgia cardaca. Quais as vantagens de submetermos um organismo hipotermia? I - A circulao fica muito reduzida. II - O sangramento mnimo. III - H uma elevao da taxa metablica. Quais esto corretas? a) Apenas I b) Apenas II c) Apenas III d) Apenas I e II e) Apenas II e III [D] 1141. O colesterol um importante constituinte das membranas celulares, estando relacionado sntese dos hormnios esterides e sais biliares. No plasma ele encontrado ligado a corpsculos lipoproticos conforme mostra a figura:

LDL - (Low Density Lipoprotein ou lipoprotena de baixa densidade) HDL - (High Density Lipoprotein ou lipoprotena de alta densidade) Considere a afirmativa: - H uma relao direta entre as taxas de colesterol no sangue e a incidncia de ateromas, tromboses e infartos. Marque a opo que apresenta concluso correta acerca desta afirmativa. a) Concentraes de HDL e LDL no possuem importncia na avaliao da predisposio para o infarto. b) Alta concentrao de HDL e baixa LDL significam pequeno risco de infarto. c) Alta concentrao de LDL e baixa de HDL significam menor risco de infarto. d) O aumento das taxas de colesterol depende somente da alimentao e no influenciado por fatores genticos, estresse, fumo e diminuio de atividade fsica. e) A afirmativa incorreta, pois no h provas significativas que correlacionem os nveis de colesterol com a incidncia de tromboses e infartos. [B] 1142. As figuras a seguir mostram o corao de um mamfero em diferentes fases de seu funcionamento.

102 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

De acordo com o esquema, correto afirmar que a) a estrutura I representa a artria aorta, que conduz sangue arterial a partir do ventrculo direito do corao. b) a estrutura II representa as veias cavas, que transportam sangue venoso ao trio direito. c) a estrutura III indica as veias pulmonares, que conduzem sangue venoso a partir do ventrculo direito. d) a estrutura IV refere-se artria pulmonar, que leva sangue arterial ao trio esquerdo. e) nas estruturas I e II as taxas de O2 e CO2 sofrem profundas alteraes, quando o sangue passa pelo corao, e este fenmeno denomina-se hematose. [B] 1148. Alguns jogos da Taa Libertadores da Amrica so realizados na cidade de La Paz, situada a 3635m de altitude. Os jogadores do Rio de Janeiro transportados para esta cidade podem apresentar o seguinte processo: a) reduo do nmero de leuccitos. b) aumento de leuccitos e aumento da presso sangnea. c) reduo da presso sangnea. d) reduo do nmero de hemcias. e) aumento do nmero de hemcias. [E] 1149. DROGA ANTICNCER TESTADA COM SUCESSO "Os cientistas Hong Li e He Lu usaram angiostatina, endostatina e a protena uroquinase geneticamente modificada. Esta ltima acelera a angiognese (desenvolvimento de vasos que alimentam as clulas), mas com a manipulao do gene da protena, foi possvel obter o efeito inverso: a fabricao de uma molcula que bloqueia o tumor". A ao normal da uroquinase de acelerar a angiognese se exerce, primordialmente, sobre as seguintes clulas: a) musculares b) endoteliais c) leucocitrias d) fibroblsticas [B] 1150. No sangue, existem fragmentos citoplasmticos possuidores de uma enzima, a tromboplastina, que, em presena de ons clcio, converte a protrombina em trombina. Esses corpsculos so denominados de: a) Hemcias. b) Moncitos. c) Plaquetas. d) Neutrfilos. e) Basfilos. [C] 1151. Observe a figura a seguir, que representa o desenho esquemtico de um corao humano:

Representam, respectivamente, o final da sstole auricular e o incio da sstole ventricular as figuras a) I e II b) II e III c) III e I d) III e IV e) IV e III [D] 1143. A funo do ndulo sinoatrial no corao humano : a) regular a circulao coronariana. b) controlar a abertura e fechamento da vlvula tricspide. c) funcionar como marcapasso, controlando a ritmicidade cardaca. d) controlar a abertura e fechamento da vlvula mitral. e) controlar a presso diastlica da aorta. [C] 1144. Dois animais, A e B, tm sistema circulatrio aberto. O sistema respiratrio de A traqueal, e o de B, branquial. Com base nessa descrio, escolha a alternativa correta. a) A pode ser uma barata e B pode ser um peixe. b) A pode ser um gafanhoto e B pode ser um mexilho. c) A pode ser um caracol e B pode ser uma mariposa. d) A pode ser uma minhoca e B pode ser uma aranha. e) A pode ser uma aranha e B pode ser uma planria. [B] 1145. Aps o processo de trocas gasosas nos pulmes, o sangue retorna ao corao atravs: a) do sistema porta-heptico b) das veias pulmonares c) das cartidas d) das artrias pulmonares [B] 1146. O esquema a seguir representa o corao humano em corte longitudinal.

So vasos que transportam sangue venoso: a) 1, 2 e 3 b) 1 e 2 apenas c) 1 e 4 apenas d) 2 e 3 apenas e) 2 e 4 apenas [B] A regio que controla a freqncia dos batimentos cardacos, denominada ndulo sino-atrial, est indicada por a) I b) II c) III d) IV e) V [C] 1147. A figura refere-se a um esquema simplificado do sistema circulatrio de um mamfero. 1152. Assinale o animal cujo sistema circulatrio NO tm a funo de transporte de gases: a) Minhoca. b) Barata. c) Polvo. d) Lagosta. e) R. [B] 1153. O esquema abaixo representa o corao humano.

103 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

64. nas aves o sangue que chega ao trio esquerdo rico em CO2 enquanto o sangue chega ao trio direito rico em O2. FFFVFFF 1159. Ao passar pelas vilosidades do intestino delgado, o sangue de uma pessoa alimentada a) perde gs oxignio e ganha aminocidos. b) perde gs oxignio e perde glicose. c) ganha gs oxignio e ganha aminocidos. d) ganha gs carbnico e perde glicose. e) perde gs carbnico e ganha aminocidos. [A] 1160. Um animal X, recentemente descoberto, apresenta as caractersticas abaixo quanto respirao e circulao. X possui respirao area, efetuada atravs de uma estrutura respiratria fina e ramificada, a qual fica alojada em uma cavidade respiratria interna. Existem 5 (cinco) orifcios externos para a entrada de ar nessa cavidade, comunicando-se com ela atravs de tubos reforados por anis de quitina. Um pequeno conjunto de msculos auxilia na expanso e retrao da cavidade respiratria, possibilitando a entrada e a sada do ar ambiental. As trocas gasosas ocorrem entre a estrutura respiratria e inmeros vasos sangneos a ela associados, cujo sangue contm pigmentos que auxiliam no transporte dos gases respiratrios. Esses vasos sangneos so ramificaes de um vaso principal que transporta o sangue bombeado pelo corao. Este sangue, aps a oxigenao, retorna por um outro vaso ao corao, onde se mistura ao sangue venoso. Com relao s caractersticas descritas acima, correto afirmar: 01) A estrutura respiratria de X, fina e ramificada, facilita as trocas gasosas no animal, pela diminuta espessura a ser atravessada pelos gases e pela grande superfcie de contato entre ar e sangue. 02) O fato de a estrutura respiratria de X ficar alojada numa cavidade respiratria est diretamente relacionado ao hbito da respirao area desse animal. 04) A presena de pigmentos transportadores de gases respiratrios no sangue permite classificar X unicamente como animal vertebrado. 08) O vaso de X que transporta o sangue do corao at a estrutura respiratria tem funo anloga das veias pulmonares dos vertebrados. 16) Os msculos que promovem alterao de volume da cavidade respiratria de X desempenham uma funo anloga do diafragma, no homem. 32) A circulao de X do tipo dupla e completa, como aquela existente nas aves e mamferos. VVFFVF 1161. Uma pessoa excreta mais uria quando come mais: a) amido. b) protena. c) sacarose. d) gordura. e) glicose. [B] 1162. O sangue de um mamfero que chega veia cava inferior, vindo do fgado, contm, relativamente, grande quantidade de: a) oxignio e de uria. b) gs carbnico e de uria. c) uria e pequena de gs carbnico. d) gs carbnico e pequena de uria. e) de oxignio e pequena de uria. [B] 1163. Indique a alternativa em que a estrutura do aparelho excretor no corresponde encontrada no organismo relacionado: a) planria ------------------------ clulas-flama. b) ameba -------------------------- vacolo pulstil. c) minhoca ------------------------ nefrdios. d) homem adulto ---------------- rim mesonefro. e) gafanhoto --------------------- tbulos de Malpighi. [D] 1164. Nos tbulos do nfron h intenso transporte ativo. Portanto, as clulas das paredes desses tbulos so ricas em: a) mitocndrias. b) DNA. c) lisossomos. d) ribossomos. e) retculo endoplasmtico. [A] 1165. Recentemente descobriu-se que, quando aumenta a presso nos trios (aurculas) cardacos, estes secretam um hormnio - o fator atrial - que tem ao direta sobre os nfrons, as unidades filtradoras dos rins. Entre outros efeitos, o fator atrial produz dilatao da arterola aferente, combinada com a constrio da arterola eferente (veja o esquema a seguir que representa um nfron).

O sangue que deixa o ventrculo direito (VD) e o que deixa o ventrculo esquerdo (VE) iro, respectivamente, para a a) artria pulmonar e para a artria aorta. b) artria pulmonar e para a veia pulmonar. c) artria aorta e para a artria pulmonar. d) artria aorta e para a veia pulmonar. e) veia pulmonar e para a artria aorta. [A] 1154. So funes do sistema linftico: I - drenagem de lquidos dos tecidos; II - reteno de partculas estranhas e clulas mortas; III - proteo do organismo contra agentes infecciosos. Est(o) CORRETA(S) a) I e II. b) I e III. c) II e III. d) I, II e III. e) apenas III. [D] 1155. Indique a opo que contm somente seres vivos que apresentam os sistemas circulatrios ABERTOS. a) polvos, mexilhes e ostras b) ostras, lulas e mariscos c) mexilhes, lulas e polvos d) mariscos, mexilhes e ostras [D] 1156. A respeito das minhocas, correto afirmar que: a) so pseudocelomadas. b) tm sistema circulatrio fechado. c) so de sexos separados. d) tm digesto intracelular. e) tm desenvolvimento indireto. [B] 1157. A figura a seguir mostra o corao de um mamfero.

Assinale a alternativa correta: a) 3, 4 e 5 so artrias que levam o sangue do corao para outras partes do corpo. b) 1, 2 e 5 so veias que trazem o sangue venoso do corpo para o corao. c) 5 so veias que levam o sangue do corao para os pulmes. d) 4 uma artria que leva o sangue do corao para as demais partes do corpo. e) 3 e 4 transportam o sangue arterial. [D] 1158. Relativo ao sistema circulatrio nos vertebrados, correto afirmar que 01. no corao dos peixes s passa sangue arterial. 02. nos anfbios a circulao simples e completa. 04. nos rpteis em geral o corao apresenta 4 cavidades, sendo 2 trios e 2 ventrculos. 08. nas aves e nos mamferos a circulao dupla e completa. 16. a artria aorta dirigida para a esquerda nas aves e para a direita nos mamferos. 32. nos mamferos o sangue venoso proveniente do corpo chega ao trio esquerdo pela veia safena.

104 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Dessas informaes, pode-se deduzir que a secreo de fator atrial provoca: a) maior filtrao glomerular, formao de mais urina, diminuio da presso sangnea. b) menor filtrao glomerular, formao de mais urina, diminuio da presso sangnea. c) maior filtrao glomerular, formao de menos urina, elevao da presso sangnea. d) menor filtrao glomerular, formao de menos urina, elevao da presso sangnea. e) menor filtrao glomerular, formao de mais urina, elevao da presso sangnea. [A] 1166. Uma pessoa excreta mais uria quando come mais: a) amido. b) protena. c) glicose. d) gordura. [B] e) sacarose.

1170. Considere as listas a seguir referentes a estruturas e funes do sistema excretor humano. I. nfron II. bexiga III. uretra IV. ureter a. conduo de urina para o meio externo b. produo de urina c. armazenamento de urina d. conduo de urina at o rgo armazenador Assinale a alternativa que associa corretamente cada estrutura sua funo. a) Ia, IIb, IIIc, IVd b) Ib, IIc, IIIa, IVd c) Ib, IId, IIIc, IVa d) Ic, IIa, IIId, IVb e) Id, IIc, IIIb, Iva [B] 1171. A abelha, a cobra e o pardal tm em comum: a) circulao aberta. b) cordo nervoso ventral. c) desenvolvimento direto. d) queratina produzida pela epiderme. e) excreo de cido rico. [E] 1172. Com relao aos mecanismos de excreo desenvolvidos durante a evoluo dos seres vivos, todas as afirmativas esto corretas, EXCETO a) As traquias dos insetos eliminam produtos nitrogenados. b) O sistema excretor funciona de modo a manter constante a composio do sangue. c) Os protonefrdios so os rgos de excreo das planrias. d) Os protozorios e os porferos realizam a excreo por difuso. e) Os rins, assim como os pulmes e a pele, participam da excreo no homem. [A] 1173. O sangue, nos mamferos, filtrado a nvel da(os): a) cpsula de Bowman; b) tbulos contornados proximais; c) tbulos contornados distais; d) ala de Henle; e) ductos coletores. [A] 1174. No homem, vrias substncias presentes no sangue chegam ao nfron, atravessam a cpsula de Bowman e atingem o tbulo renal. Vrias dessas substncias so, normalmente, reabsorvidas, isto , do nfron elas so lanadas novamente no sangue, retornando a outras partes do corpo. Entre essas substncias normalmente reabsorvidas, no nvel do nfron podem ser citadas: a) gua e uria. b) gua e glicose. c) glicose e uria. d) gua e cido rico. e) aminocidos e uria. [B] 1175. Foram analisadas amostras de urina de cinco pessoas. A composio dessas amostras a seguinte: I. cido rico, glicose, gua e cloreto de sdio II. uria, cido rico, gua e cloreto de sdio III. protenas, uria, gua e glicose IV. uria, cido rico, glicose, gua e cloreto de sdio V. uria, protenas, gua e cloreto de sdio A amostra que corresponde a um indivduo normal a a) V b) IV c) III d) II e) I [D] 1176. Em caso de hipertenso, recomenda-se uma dieta sem sal porque este atua a) diminuindo o volume de sangue circulante. b) aumentando o volume de sangue circulante. c) reduzindo o calibre dos vasos sangneos. d) dilatando o calibre dos vasos sangneos. e) obstruindo os capilares arteriais com placas de ateroma. [B] 1177. A ingesto de bebidas alcolicas inibe a liberao do hormnio responsvel pelo aumento da permeabilidade das membranas das clulas dos tbulos renais. Com isso, diminuda a reabsoro: a) passiva de gua, o que diminui a concentrao sangnea e concentra a urina. b) passiva de gua, o que aumenta a concentrao sangnea e dilui a urina. c) passiva de gua, o que diminui a concentrao sangnea e dilui a urina. d) ativa de gua, o que aumenta a concentrao sangnea e dilui a urina. e) ativa de gua, o que diminui a concentrao sangnea e concentra a urina. [B]

1167. Vinte pessoas normais beberam, cada uma, 2 litros de gua num intervalo de 2 horas. A seguir temos os grficos que registram as mdias das variaes dos volumes urinrios e das concentraes do hormnio anti-diurtico (ADH) no sangue em funo do tempo.

A anlise dos grficos permite concluir que a) o hormnio ADH tem efeito diurtico, o que faz aumentar o volume urinrio. b) o volume urinrio no tem nenhuma relao com a secreo do hormnio ADH. c) h uma relao diretamente proporcional entre a concentrao do hormnio ADH e o volume urinrio. d) o aumento do volume urinrio influi sobre os rins, inibindo a secreo do hormnio ADH. e) h uma relao inversamente proporcional entre a concentrao do hormnio ADH e o volume urinrio. [E] 1168. A excreo est relacionada eliminao de substncias prejudiciais resultantes do metabolismo. Dos rgos citados a seguir, assinale aquele que NO est associado a esta funo. a) Pulmes. b) Fgado. c) Rins. d) Pele. e) Pncreas. [E] 1169. Os tubares acumulam uria no sangue, como artifcio de sobrevivncia ao meio marinho, porque: a) a gua do mar hipotnica em relao ao seu meio interno, o que favorece a desidratao. b) os vacolos pulsteis das clulas branquiais no so eficientes na expulso do excesso de gua absorvida. c) tornando-se isotnicos em relao ao mar, a osmorregulao controlada. d) o sangue elimina os sais absorvidos pelo intestino por osmose. e) h excessiva eliminao de urina, e a perda da uria diminui a concentrao de sais no sangue. [C]

105 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1178. A respeito do sistema excretor, correto afirmar que: a) uma lagartixa excreta predominantemente uria. b) alm da eliminao de excretas, esse sistema responsvel pela osmorregulao. c) os rins de anfbios, como em qualquer vertebrado, retiram excretas somente do sangue. d) planrias por serem aquticas, no apresentam estruturas especializadas em excreo. e) como aqutica, a excreo de uma baleia igual de um peixe. [B] 1179. Assinale a alternativa que relaciona, respectivamente, os tipos de aparelhos excretores que so observados em mamferos, aves e insetos: a) rins, rins e tbulos de Malpighi. b) nefrdios, rins e tbulos de Malpighi. c) rins, rins e glndulas verdes. d) clulas-flama, rins e rins. e) rins, rins e rins. [A] 1180. Qual o tipo de sistema excretor observado em minhocas? a) rins. b) tbulos de Malpighi. c) glndulas verdes. d) glndulas coxais. e) nefrdios [E] 1181. A manuteno da estabilidade do ambiente fisiolgico interno de um organismo exercida por diversos rgos. Por exemplo, os rins so responsveis, entre outras coisas, pela estabilidade dos nveis de sais, gua e acar do sangue. Assinale a opo que indica corretamente o nome do mecanismo referido anteriormente: a) Homeotermia. b) Homeostase. c) Organognese. d) Ontogenia. e) Etologia. [B] 1182. Observe os seguintes esquemas, que representam estruturas excretoras.

d) acumulam altas taxas de uria no sangue e a eliminam gradativamente pelas brnquias. e) eliminam grandes quantidades de gua pelo intestino e eliminam o excesso de sais pelas brnquias. [A] 1185. A reabsoro de gua pelos rins regula a osmorregularidade do sangue, graas ao de um hormnio produzido pela hipfise. Esse hormnio : a) somatotrofina. b) epinefrina. c) secretina. d) hormnio antidiurtico. e) hormnio luteinizante. [D] 1186. Em qual dos ambientes a seguir vivem vertebrados cujo principal produto de excreo amnia? a) Deserto. b) Floresta mida. c) Floresta temperada. d) Mar. e) Cerrado. [D] 1187. Considere as afirmativas a seguir: I - Todos os animais aquticos excretam amnia por no apresentarem problemas quanto obteno de gua. II - O cido rico, por ser o excreta menos solvel em gua, eliminado principalmente por animais terrestres como aves e rpteis. III - Os mamferos excretam uria porque, apesar de serem terrestres em sua maioria, geralmente so vivparos e tm bom suprimento de gua. Ento: a) todas as afirmativas so verdadeiras. b) somente a afirmativa I verdadeira. c) somente as afirmativas I e II so verdadeiras. d) somente as afirmativas II e III so verdadeiras. e) somente a afirmativa II verdadeira. [D] 1188. Relacione as colunas a seguir , identificando corretamente os tipos de estruturas excretoras dos animais: 1 - ameba 2 - rato 3 - minhoca 4 - planria 5 - gafanhoto ( ) tubos de Malpighi ( ) nefrdios ( ) rins ( ) vacolo pulstil ( ) clulas-flama A ordem correta, na segunda coluna, de cima para baixo, a) 2 - 1 - 5 - 3 - 4 b) 5 - 3 - 2 - 1 - 4 c) 4 - 1 - 2 - 5 - 3 d) 1 - 4 - 2 - 3 - 5 e) 5 - 4 - 3 - 2 1 [B] 1189. Peixes e anfbios adultos possuem em comum: a) corao dotado de duas cmaras: um trio e um ventrculo. b) respirao branquial. c) rins mesonfricos (torcicos). d) fecundao interna. e) intestino terminando em cloaca. [C] 1190. Um dos mecanismos de homeostase do nosso organismo, remover excretas resultantes das atividades celulares. Assinale a alternativa cujos excretas provm do metabolismo das PROTENAS: a) aminocidos, CO2 e uria b) uria, fezes e amnia c) suor, cido rico e aminocido d) cido rico, uria e amnia [D] 1191. Observe a figura a seguir.

Assinale a alternativa correta: a) A estrutura 1 retira excretas do celoma do animal. b) A estrutura 2 encontrada em animais como as tnias. c) A estrutura 2 pode retirar excretas tanto do celoma quanto do sangue. d) A estrutura 1 pode ser encontrada em guas-vivas. e) As estruturas 1 e 2 so encontradas em artrpodos. [C] 1183. Atravs da placenta, estrutura que contm tecidos da me e do embrio, o organismo materno fornece oxignio e nutrientes, recolhendo, tambm, os resduos do metabolismo do embrio. Em condies normais, o mecanismo de trocas materno-fetal ocorre: a) por uma circulao nica materno-fetal, isto , o sangue da me entra em contato direto com o do embrio. b) por livre difuso, em que a oxigenao, nutrio e remoo de excretas so feitas atravs de trocas entre a circulao fetal e materna. c) por transporte ativo, em que o sangue do embrio atrai os nutrientes e o oxignio do sangue materno. d) pela ao de hormnios gonadotrficos, que fazem o transporte dos elementos do sangue materno para o fetal. e) pelo lquido da bolsa d'gua, que recebe os nutrientes e oxignio do sangue materno, difundindo-os at o sangue do embrio. [B] 1184. As brnquias em peixes sseos marinhos, alm da funo respiratria, tm papel excretor e osmorregulador. A respeito das adaptaes de peixes sseos marinhos ao meio em que vivem, podemos afirmar que: a) bebem gua salgada, que absorvida no intestino, e eliminam o excesso de sais pelas brnquias. b) eliminam, pelas brnquias, grandes quantidades de gua e o excesso de sais. c) absorvem gua salgada pelas brnquias e eliminam o excesso de sais por essas estruturas.

Nela esto representadas clulas caractersticas do sistema excretor dos a) insetos. b) aneldeos.

106 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) moluscos. d) nematelmintos. e) platelmintos. [E] 1192. "Exame confirma doping de jogador" Foi positivo o resultado da contraprova do exame de urina realizado. A presena de substncias txicas na urina resultam de um processo realizado no rim a que se denomina: a) reabsoro tubular. b) absoro tubular. c) filtrao glomerular. d) reabsoro ativa. e) excreo glomerular. [C] 1193. O hormnio ADH atua sobre os tbulos renais promovendo absoro de gua do filtrado glomerular. A deficincia na secreo desse hormnio faz com que a pessoa produza a) muita urina, com alta concentrao de excrees. b) muita urina, com baixa concentrao de excrees. c) pouca urina, com alta concentrao de excrees. d) pouca urina, com baixa concentrao de excrees. e) quantidade normal de urina, com alta concentrao de excrees. [B] 1194. Conforme noticiado na imprensa em abril de 1996, as mortes de pacientes submetidos hemodilise em um hospital de Caruaru, Pernambuco, foram devidas presena de algas azuis na gua utilizada nos aparelhos de hemodilise. A provvel ao das algas azuis foi a a) competio pelo O2 livre no sangue levando cianose. b) formao de colnias levando obstruo de vasos sangneos. c) liberao de toxinas na gua provocando leses hepticas. d) utilizao do nitrognio das protenas acarretando deficincia nutricional. [C] 1195. So vertebrados homeotrmicos, cuja excreo de produtos nitrogenados ocorre principalmente na forma de cido rico, a) somente as aves. b) somente os mamferos. c) as aves e os mamferos. d) as aves e os rpteis. e) os anfbios adultos e os mamferos. [A] 1196. - Eliminao das clulas sangneas que esto velhas demais. - Formao de uria. - Armazenamento de energia para qualquer eventualidade. - Maior glndula do corpo humano. Todas essas caractersticas tpicas de um super-orgo esto relacionadas ao (): a) bao. b) rim. c) pncreas. d) fgado. e) hipfise. [D] 1197. Os rins so rgos relacionados com excreo e controle hdrico. Das estruturas a seguir, todas apresentam a mesma funo dos rins, EXCETO: a) os vacolos contrteis. b) os cnidcitos. c) as clulas-flama. d) os nefrdios. e) as glndulas verdes. [B] 1198. Produzido pelo hipotlamo e eliminado na circulao sangnea pelo lobo posterior da hipfise, o hormnio ADH ir atuar: a) na bexiga. b) na uretra e na bexiga. c) no bacinete. d) nos ureteres e na uretra. e) nos tbulos contornados distais. [E] 1199. A tabela a seguir indica as quantidades ( em porcentagem) de excretas nitrogenados na urina de dois animais.

IV. O animal (a) pode ser uma tartaruga e (b) pode ser um sapo. Dessas afirmaes, so corretas SOMENTE a) I e III b) II e IV c) I, II e III d) I, III e IV e) II, III e IV [D] 1200. A estrutura excretora encontrada em aneldeos, platelmintos, anfbios, crustceos e aracndeos , respectivamente, a) nefrdio, clulas-flama, rim, glndula verde, tbulos de Malpighi. b) clulas-flama, nefrdio, rim, tbulos de Malpighi, glndula verde. c) glndula verde, nefrdio, rim, clulas-flama, tbulos de Malpighi. d) nefrdio, rim, glndula verde, tbulos de Malpighi, clulas-flama. e) tbulos de Malpighi, glndula verde, nefrdio, clulas-flama, rim. [A] 1201. Deixe o xixi do Maradona em paz, droga! (FOLHA DE S. PAULO/97) O teste antidoping, que freqentemente aparece nas notcias dos jornais, feito a partir do exame da urina de atletas. Isso se torna possvel porque atravs do nfron - unidade funcional dos rins - executada a tarefa de: a) absorver glicose b) eliminar catablitos c) secretar aminocidos d) filtrar glbulos sangneos [B] 1202. Considere os grupos de animais: - o grupo (a), correspondente aos crustceos que regulam a osmolaridade de seus lquidos corporais somente em uma faixa estreita de variaes de osmolaridade do meio ambiente; - o grupo (b), correspondente maioria dos invertebrados marinhos que esto em equilbrio osmtico com o meio ambiente; - o grupo (c), correspondente aos vertebrados marinhos que regulam ativamente a osmolaridade de seus lquidos corporais. O grfico, a seguir, representa a relao entre a osmolaridade dos lquidos corporais e a osmolaridade do meio ambiente em que se encontram estes trs grupos de animais:

A relao entre a osmolaridade do meio ambiente e a osmolaridade dos lquidos corporais dos animais correspondentes aos grupos (a), (b) e (c) est representada, respectivamente, pelas linhas indicadas por: a) III, II, I b) III, I, II c) II, I, III d) II, III, I e) I, II, III [B] 1203. Considere dois indivduos adultos, metabolicamente normais, designados por A e B. O indivduo A tem uma dieta rica em protenas e pobre em carbohidratos. O indivduo B, ao contrrio, tem uma dieta pobre em protenas e rica em carbohidratos. Pode-se prever que na urina do indivduo A exista a) menor concentrao de uria que na urina de B e que a concentrao de glicose seja a mesma na urina de ambos. b) maior concentrao de uria que na urina de B e que no se encontre glicose na urina de ambos. c) maior concentrao de uria e maior concentrao de glicose que na urina de B. d) menor concentrao de uria e menor concentrao de glicose que na urina de B. e) a mesma concentrao de uria e glicose que a encontrada na urina de B. [B] 1204. Observe a figura a seguir, relativa ao esquema de um nfron:

Sobre esses dados, fizeram-se as seguintes afirmaes: I. O animal (a) provavelmente vive em habitat terrestre e o animal (b), em habitat aqutico ou de transio entre gua e terra. II. A urina de (a) rica em cido rico, altamente txico, que necessita de grande quantidade de gua para ser eliminado. III. A urina de (b) rica em substncias solveis e muito txicas.

107 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

A ingesto de bebidas alcolicas provoca a reduo de ADH, o hormnio antidiurtico, armazenado na neuro-hipfise, que ir alterar a permeabilidade dos componentes: a) 1 e 5 b) 2 e 4 c) 3 e 1 d) 4 e 5 e) 5 e 2 [D] 1205. Considere a frase a seguir, "Nos mamferos, as clulas eliminam ...I... para o sangue e, no fgado, essa substncia transformada em ...II..." Para complet-la corretamente, necessrio substituir I e II, respectivamente, por a) uria e amnia. b) uria e cido rico. c) cido rico e uria. d) amnia e cido rico. e) amnia e uria. [E] 1206. A poro do nfron assinalada com um asterisco na figura corresponde estrutura

a) Artria aorta, ureter e veia cava. b) Veia cava, ureter e artria aorta. c) Veia cava, uretra e artria aorta. d) Artria aorta, uretra e veia cava. e) Artria aorta, uretra e veia porta. [A] 1209. A degradao dos aminocidos ingeridos na alimentao gera como subproduto a amnia. Nos mamferos, a amnia transformada em uria. Esse processo ocorre a) no pncreas. b) no fgado. c) nos rins. d) na bexiga urinria. e) no bao. [B] 1210. O grfico a seguir apresenta duas curvas que indicam o que acontece com o metabolismo de animais: uma para animais que mantm constante a temperatura do corpo e outra para animais cuja temperatura do corpo igual do ambiente.

a) onde ocorre a ultrafiltrao do plasma sangneo. b) com funo de excretar o excesso de sal, observada em rpteis e aves. c) onde ocorre reabsoro de glicose e aminocidos. d) responsvel pela formao de urina concentrada, observada em aves e mamferos. e) onde ocorre secreo de substncias estranhas ao organismo. [D] 1207. Assinale a alternativa correta quanto aos produtos de excreo em animais. a) A amnia ocorre, principalmente, em animais terrestres. b) A uria ocorre, principalmente, nas formas aquticas de gua doce. c) O cido rico ocorre, principalmente, em formas aquticas marinhas. d) A uria dissolvida em gua ocorre em moluscos terrestres, insetos e alguns rpteis, formando urina. e) O cido rico em forma pastosa ocorre em insetos, alguns rpteis e aves, sendo eliminado junto com as fezes. [E] 1208. O esquema adiante, representa o aparelho excretor humano. As setas A e B indicam o sentido do fluxo sangneo. Os nmeros 1, 2 e 3 indicam, respectivamente:

Que animais tm curvas do tipo Y? a) Camundongo, canrio e r. b) Caranguejo, lula e pescada. c) Elefante, baleia e avestruz. d) Gaivota, pescada e jacar. e) Baleia, tubaro e pescada. [B] 1211. Cada uma das curvas do grfico adiante mostra a correlao entre a temperatura corporal de um vertebrado (A ou B) e a temperatura do ambiente.

Os animais A e B podem ser respectivamente: a) coelho e lagarto. b) pombo e cavalo. c) sapo e jacar. d) lagartixa e gato. e) tartaruga e galinha. [A] 1212. Vinte pessoas normais beberam, cada uma, 2 litros de gua num intervalo de 2 horas. A seguir temos os grficos que registram as mdias das variaes dos

108 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

volumes urinrios e das concentraes do hormnio anti-diurtico (ADH) no sangue em funo do tempo.

A anlise dos grficos permite concluir que a) o hormnio ADH tem efeito diurtico, o que faz aumentar o volume urinrio. b) o volume urinrio no tem nenhuma relao com a secreo do hormnio ADH. c) h uma relao diretamente proporcional entre a concentrao do hormnio ADH e o volume urinrio. d) o aumento do volume urinrio influi sobre os rins, inibindo a secreo do hormnio ADH. e) h uma relao inversamente proporcional entre a concentrao do hormnio ADH e o volume urinrio. [E] 1213. A temperatura do corpo da maioria dos animais acompanha a variaes da temperatura do ambiente. Temperaturas muito baixas podem determinar a paralisao das atividades do animal e, at mesmo, sua morte. Animais que conseguem manter a temperatura do corpo e nveis ideais do metabolismo, apesar das variaes do ambiente so os(as): a) tubares. b) sapos. c) cobras. d) baleias. e) jacars. [D] 1214. Os tubares acumulam uria no sangue, como artifcio de sobrevivncia ao meio marinho, porque: a) a gua do mar hipotnica em relao ao seu meio interno, o que favorece a desidratao. b) os vacolos pulsteis das clulas branquiais no so eficientes na expulso do excesso de gua absorvida. c) tornando-se isotnicos em relao ao mar, a osmorregulao controlada. d) o sangue elimina os sais absorvidos pelo intestino por osmose. e) h excessiva eliminao de urina, e a perda da uria diminui a concentrao de sais no sangue. [C] 1215. Observe a figura a seguir.

Com base na anlise dessa ilustrao, pode-se concluir: (01) Os animais representados exibem a mesma capacidade de regulao trmica. (02) Em animais endotrmicos, a fonte preferencial de calor para o corpo o metabolismo. (04) Animais exotrmicos mantm uma relao direta entre a temperatura do corpo e a do ambiente. (08) A disponibilidade de alimento permite a regulao trmica em rpteis. (16) A endotermia uma vantagem evolutiva para animais terrestres. (32) Adaptaes na superfcie do corpo dos mamferos esto associadas sua condio de animais endotrmicos. (64) Animais exotrmicos e endotrmicos apresentam as mesmas caractersticas anatmicas e fisiolgicas quanto ao sistema circulatrio. 02 + 04 + 16 + 32 = 54 1208. Em um ambiente com temperatura mantida constante em 18C, qual dos animais a seguir necessitar maior consumo de alimento em relao ao tamanho de seu corpo? a) Sapo. b) Jacar. c) Sabi. d) Tubaro. e) Jararaca. [C] 1209. Quando temperatura dos animais podem ser: (1) pecilotrmico (2) homeotrmicos. Classifique os animais: rato, pato, cobra, sapo, tubaro, de acordo com a temperatura. a) 1 - 2 - 1 - 2 - 1; b) 1 - 1 - 2 - 2 - 2; c) 2 - 2 - 2 - 1 - 1; d) 2 - 1 - 2 - 1 - 2; e) 2 - 2 - 1 - 1 - 1; [E] 1210. Uma pessoa ao ser transportada para uma, regio de alta altitude, onde a atmosfera rarefeita, sofrer: a) aumento do nmero de leuccitos; b) diminuio do nmero de plaquetas; c) aumento do nmero de hemceas; d) aumento do nmero de plaquetas; e) a pessoa nada sofrer. [C] 1211. Todos os seres vivos mantm um ambiente interno estvel, mesmo quando as condies ambientais externas apresentarem variaes. Essa estabilidade, denominada _____I_____, garantida por um conjunto de reaes qumicas ordenadas, que constituem o _____II_____. Assim, cada ser vivo mantm a sua prpria vida e, atravs do processo de _____III_____, garante a sobrevivncia de sua espcie. Assinale a alternativa que contm os termos que preencham, corretamente, as lacunas I, II e III. a) I = metabolismo; II = homeostase; III = reproduo b) I = metabolismo; II = reao a estmulos do ambiente; III = reproduo c) I = reao a estmulos do ambiente; II = reproduo; III = adaptao d) I = homeostase; II = metabolismo; III = reproduo e) I = homeostase; II = reproduo; III = adaptao [D] 1212. A manuteno da estabilidade do ambiente fisiolgico interno de um organismo exercida por diversos rgos. Por exemplo, os rins so responsveis, entre outras coisas, pela estabilidade dos nveis de sais, gua e acar do

O animal representado vive em regies ridas e possui urina muito hipertnica em relao ao sangue. Todas as alternativas apresentam adaptaes desse animal ao meio ambiente, EXCETO a) Ausncia de transpirao mesmo em altas temperaturas. b) Eliminao de amnia como produto nitrogenado. c) Eliminao de fezes praticamente desidratadas. d) Eliminao de pouca gua na urina. e) Hbitos noturnos e ocupao de buracos na terra durante o dia. [B] 1216. Mamferos aquticos, como os cetceos, possuem um espesso revestimento de tecido adiposo com importante funo para a) facilitar a flutuao. b) proteo contra predadores. c) evitar perda de calor. d) evitar perda de gua. e) moldar o corpo, tornando-o mais hidrodinmico. [C] 1207. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. A figura a seguir ilustra a relao entre a temperatura ambiente e a temperatura corporal de dois animais.

109 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

sangue. Assinale a opo que indica corretamente o nome do mecanismo referido anteriormente: a) Homeotermia. b) Homeostase. c) Organognese. d) Ontogenia. e) Etologia. [B] 1213. As brnquias em peixes sseos marinhos, alm da funo respiratria, tm papel excretor e osmorregulador. A respeito das adaptaes de peixes sseos marinhos ao meio em que vivem, podemos afirmar que: a) bebem gua salgada, que absorvida no intestino, e eliminam o excesso de sais pelas brnquias. b) eliminam, pelas brnquias, grandes quantidades de gua e o excesso de sais. c) absorvem gua salgada pelas brnquias e eliminam o excesso de sais por essas estruturas. d) acumulam altas taxas de uria no sangue e a eliminam gradativamente pelas brnquias. e) eliminam grandes quantidades de gua pelo intestino e eliminam o excesso de sais pelas brnquias. [A] 1214. As afirmativas a seguir so relacionadas aos mecanismos termorreguladores presentes em seres homeotrmicos: I - A manuteno da temperatura corprea importante, porque a hipotermia e a hipertermia causam avarias no funcionamento enzimtico. II - Em baixas temperaturas ambientais, a vasodilatao perifrica diminui o fluxo sanguneo, implicando o aquecimento das partes externas do corpo, que passam calor para os tecidos internos. III - Em altas temperaturas ambientais, um fator bsico de regulao a sudorese, pois a gua do suor evapora, retirando calor da pele, o que no permite que a temperatura do corpo se eleve muito. Assinale a(s) afirmativa(s) correta(s): a) Apenas I, b) Apenas I e I; c) Apenas I e III. d) Apenas II e III. e) I, II e III. [C] 1215. Observe o desenho a seguir e assinale a alternativa que preenche corretamente os espaos da frase a seguir.

Entre essas caractersticas NO se inclui a) fecundao interna. b) homeotermia. c) oviparidade. d) respirao pulmonar. [B] 1219. O grfico a seguir representa como um determinado tipo de animal reage s variaes de temperatura do ambiente. Para manifestar essa reao, seu corpo lana mo de mecanismos fisiolgicos diferenciados em locais de clima quente e de clima frio.

A organela indicada no desenho o ............., responsvel pela eliminao do excesso de ............. que entra por ............. em uma clula que vive em um meio ............. em relao ao seu citoplasma. a) vacolo pulstil; gua; osmose; hipotnico. b) vacolo digestivo; sais minerais; osmose; hipertnico. c) vacolo pulstil; gua; transporte ativo; hipertnico. d) vacolo digestivo; sais minerais; difuso; hipertnico. e) vacolo pulstil; sais minerais; transporte ativo; hipertnico. [A] 1216. Qual das seguintes alternativas apresenta apenas animais homeotrmicos? a) Tucano, jacar, jararaca. b) Peru, capivara, tamandu. c) Lagartixa, morcego, tatu. d) Perereca, sabi, tartaruga. e) Peixe-boi, coelho, camaleo. [B] 1217. A vantagem dos animais homeotermos em relao aos pecilotermos est em que os primeiros: a) mantm temperaturas sempre mais baixas que aquelas temperatura do meio. b) mantm temperaturas sempre mais altas que aquelas temperatura do meio. c) podem variar sua temperatura corporal de acordo com a necessidade. d) mantm a temperatura do corpo constante, favorecendo o metabolismo. e) quando as temperaturas so muito baixas, elevam a temperatura corporal. [D] 1218. Os animais a seguir representados so bastante diferentes na sua aparncia, mas apresentam vrias caractersticas comuns.

Assinale a opo que apresenta corretamente os mecanismos fisiolgicos adequados a cada uma das situaes. a) CLIMA QUENTE - contrao dos vasos sangneos superficiais. CLIMA FRIO: eriamento de plos e penas. b) CLIMA QUENTE - dilatao de vasos sangneos superficiais. CLIMA FRIO: respirao ofegante. c) CLIMA QUENTE: diminuio da circulao abaixo da pele. CLIMA FRIO: tremor do corpo. d) CLIMA QUENTE: respirao ofegante. CLIMA FRIO: dilatao de vasos sangneos superficiais. e) CLIMA QUENTE: aumento da sudorese. CLIMA FRIO: contrao dos vasos sangneos superficiais. [E] 1220. As aves no possuem glndulas sudorparas e mantm a temperatura do corpo constante. A estratgia adaptativa utilizada por esses animais, quando a temperatura ambiente est muito alta, o aumento de a) perda de gua na expirao. b) metabolismo de carboidratos. c) quantidade de gs carbnico no sangue. d) consumo de oxignio. [A] 1221. Considere as seguintes funes do tegumento dos animais em geral: I. proteger o organismo II. realizar trocas gasosas III. secretar substncias lubrificantes IV. manter a temperatura do corpo Com relao pele dos vertebrados, pode-se verificar em todos os grupos a) apenas I b) apenas I e II c) apenas I e III d) apenas I, II e III e) I, II, III e IV [A] 1222. A adaptao dos animais a diversos ambientes fez com eles lanassem mo de diferentes mecanismos fisiolgicos como modos de aproveitamento de energia. Em relao fisiologia animal, julgue os itens que se seguem. (0) Nas aves e nos mamferos, as gorduras funcionam como isolamento trmico, impedindo a perda de calor pela pele.

110 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(1) Um dos fatores que garantem a sobrevivncia dos rpteis em ambientes desrticos, onde o alimento escasso, que eles utilizam a energia solar para o aquecimento do corpo. (2) As funes desempenhadas pelos sistemas digestivo, muscular e excretor, no homem, so exercidas, na ameba, pelo vacolo digestivo, pelo vacolo contrtil e pelos pseudpodes, respectivamente. (3) A taxa metablica dos animais homeotermos diretamente proporcional sua massa corporal. Itens corretos: 0 e 1 Itens errados: 2 e 3 1223. Considere os mecanismos relacionados com a manuteno da temperatura corporal do homem. I - Relaxamento dos msculos involuntrios. II - Diminuio da taxa de metabolismo. III - Contraes musculares involuntrias. IV - Respirao ofegante. V - Aumento da taxa de metabolismo. Os mecanismos que permitiro manter a temperatura corporal de um homem em uma sauna, submetida a uma temperatura acima de 40C so, apenas, a) III, IV e V. b) I, II e V. c) I, II e IV. d) I, IV e V. e) II, III e IV. [C] 1224. Durante o vero, deparamo-nos com temperaturas ambientais muito elevadas, que provocam elevao da temperatura corporal, desencadeando respostas reguladoras. Escolha, entre as alternativas a seguir, a que apresenta o conjunto correto de respostas reguladoras desencadeadas pela elevao da temperatura corporal. a) Aumento da presso arterial e sudorese b) Constrio das arterolas da pele e tremores c) Dilatao das arterolas da pele e sudorese d) Arritmia cardaca e tremores e) Diminuio da presso arterial e tremors [C] 1225. O grfico abaixo refere-se relao entre a temperatura corporal de dois grupos de animais e a temperatura do ambiente.

d) jacar, pardal e anta. e) cachorro, cascavel e canrio. [C] 1227. Os rpteis, por dependerem do calor do meio ambiente para se aquecerem e por variar a temperatura de seus corpos conforme as variaes da temperatura do ambiente, podem ser chamados, respectivamente, de animais a) homeotrmicos, pecilotrmicos. b) pecilotrmicos, ectotrmicos. c) ectotrmicos, homeotrmicos. d) heterotrmicos, endotrmicos. e) ectotrmicos, heterotrmicos. [E] 1228. Reservas de carboidratos nos msculos esquelticos ficam na forma de: a) glicognio. b) maltose. c) ATP. d) sacarose. e) glicose. [A] 1229. Nos diversos tipos de invertebrados, encontramos diferentes estruturas relacionadas com a locomoo. Associe os grupos de invertebrados com as estruturas ou mecanismos locomotores e, depois, assinale a alternativa que apresenta a correlao CORRETA. (I) aneldeos (II) celenterados (III) equinodermos (IV) insetos voadores (1) asas, geralmente membranosas (2) esqueletos hidrosttico (3) musculatura esqueltica (4) sistema ambulacral a) I - 4; III - 3 b) II - 2; IV - 4 c) I - 2; III - 4 d) II - 3; III - 1 e) I - 4; IV 1 [C] 1230. Considere os tipos de fibras musculares e as aes a seguir: I. cardaca II. estriada III. lisa a) contrao involuntria e lenta. b) contrao voluntria, em geral vigorosa. c) contrao involuntria e rpida. Assinale a alternativa que associa corretamente os tipos de fibras musculares com sua respectiva ao. a) Ia, IIb, IIIc b) Ia, IIc, IIIb c) Ib, IIc, IIIa d) Ic, IIa, IIIb e) Ic, IIb, IIIa [E] 1231. Associar os msculos com as funes que desempenham, A - bceps B - costureiro C - trapzio D - deltoide E - trceps I - movimenta a perna para a frente II - sua contrao levanta o brao III - flexiona o antebrao sobre o brao IV - sua contrao levanta o ombro V - sua contrao distende o antebrao Assinale a resposta cuja associao est correta: a) A - I / B - II / C - III / D - V / E - IV b) A - II / B - V / C - I / D - III / E - IV c) A - III / B - I / C - IV / D - II / E - V d) A - V / B - III / C - II / D - IV / E - I e) A - IV / B - II / C - I / D - III / E IV [C] 1232. As afirmaes a seguir, referem-se aos trs tipos de tecido muscular humano. I - Todos apresentam as miofibrilas, que so estruturas proticas com capacidade de contrao. II - Como conseqncia da contratilidade, esses tecidos apresentam clulas com grande quantidade de mitocndrias. III - Actina e miosina so as protenas responsveis pela contrao desses tecidos, num processo que necessita da presena de ons clcio e magnsio. Assinale: a) se todas estiverem corretas. b) se apenas I e II estiverem corretas. c) se apenas I e III estiverem corretas. d) se apenas II e III estiverem corretas. e) se apenas III estiver correta. [A] 1233. Reservas de carboidrato nos msculos ficam na forma de

Com o auxlio do grfico, julgue os itens seguintes. (1) Algumas ordens de animais que fazem parte do grupo I apresentam fecundao externa. (2) Do ponto de vista evolutivo, os animais do grupo II so inferiores aos do grupo I. (3) Animais do grupo II podem possuir o corpo coberto de escamas ou de penas. (4) No corao de animais do grupo I, ocorre mistura de sangue rico em O2 e rico em CO2. FVFF 1226. O grfico a seguir mostra o consumo de oxignio de certos animais em funo da temperatura ambiente.

Exemplos de animais que apresentam curvas como a do grfico so: a) cavalo, sapo e papagaio. b) baleia, ona e pintassilgo. c) sapo, r e tartaruga.

111 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) glicognio. d) sacarose. [A]

b) lactose. e) glicose.

c) amido.

1234. No processo de contrao e relaxamento muscular, o elemento mineral mais diretamente presente o: a) clcio b) iodo c) mercrio d) ferro [A] 1235. Considere a figura a seguir. O animal nela representado locomove-se da mesma maneira que

Sobre o assunto, correto afirmar: 01) No adulto, o msculo estriado cardaco, quando lesado, regenerado a partir do tecido epitelial adjacente, o qual tem grande capacidade de regenerao. 02) O oxignio que o organismo recebe durante a realizao de atividade fsica distribudo pelo sangue atravs do plasma sangneo. 04) A contrao do msculo estriado cardaco importante para que o sangue circule no interior dos vasos. 08) O msculo estriado esqueltico, muito trabalhado nas academias para a obteno de um melhor resultado esttico, depende do sistema nervoso para se contrair. 16) No caso de um atleta, alm da atividade fsica, uma alimentao equilibrada se faz necessria. Os nutrientes encontrados nos alimentos ingeridos so absorvidos pelos vasos sangneos do tecido epitelial de revestimento do intestino. 32) Para que um indivduo consiga realizar exerccios de musculao, a estrutura ssea muito importante, pois o esqueleto um conjunto de estruturas rgidas em que se ligam as fibras do msculo estriado cardaco. 64) As glndulas sudorparas, responsveis pela excreo do suor, so importantes durante a atividade fsica, pois eliminam do organismo resduos metablicos e ajudam a manter constante a temperatura corprea. FFVVFFV 1241. Reservas de carboidratos no fgado ficam na forma de: a) amido. b) glicognio. c) sacarose. d) lactose. e) glicose. [B] 1242. Com o ttulo "Boca Livre", a Revista Veja, Edio 1928, Ano 26, n 30, de 28 de julho de 1993, pgina 55, publicou artigo sobre uma nova droga ainda em testes, o Orlistat, desenvolvido pelo laboratrio Hoffmann-La Roche. A reportagem diz que essa droga "...bloqueia (uma fatia dessas) enzimas, impedindo que elas desdobrem as enormes molculas de gordura em fragmentos menores. Assim, a gordura no tem como atravessar as paredes do intestino e no chega corrente sangnea." As enzimas que o Orlistat bloqueia correspondem s: a) proteases. b) lipases. c) amilases. d) lactases. e) peptidases. [B] 1243. Os animais, salvo raras excees, alimentam-se a partir da incorporao do material nutriente atravs do sistema digestivo. Quanto a esse processo, no homem, incorreta a afirmao: a) A saliva amolece os alimentos e inicia a quebra do amido com auxlio da ptialina. b) A digesto de protenas inicia-se no estmago, por ao da pepsina. c) Os sais biliares emulsionam as gorduras, facilitando a ao das lipases. d) O suco intestinal, composto por diversas enzimas, quebra o alimento em molcula simples, para que possam ser absolvidas. e) As molculas so absorvidas no intestino grosso, que apresenta vilosidades e microvilosidades celulares, que aumentam a rea de absoro. [E] 1244. No processo digestivo, as molculas orgnicas devem ser quebradas em molculas mais simples para que possam ser absorvidas. Dentre elas, o amido um carboidrato: a) cuja digesto inicia na boca por ao da ptialina. b) digerido pela lipase no duodeno. c) que forma um complexo vitamnico que absorvido, sem digesto, na regio do intestino delgado. d) extremamente simples e, por isso absorvido, sem alteraes, na regio do intestino delgado. e) digerido no estmago por ao do cido clordrico. [A] 1245. Uma das doenas mais comuns entre as tripulaes que participaram das grandes navegaes apresenta, como sintomas, hemorragia nas mucosas, sob a pele e nas articulaes. Essa doena, causada pela falta de vitamina C, conhecida como: a) beribri. b) anemia. c) escarlatina. d) escorbuto. e) raquitismo. [D] 1246. Com relao s cries dentrias, pode-se dizer que: a) todas as cries produzem, inicialmente, sensaes dolorosas que tendem a desaparecer medida que a destruio atinge a dentina. b) uma vez instaladas, aconselhvel o uso do fio dental no seu tratamento. c) o resultado de interao entre dente, bactrias patognicas e dieta alimentar. d) sua evoluo no afeta outras partes do organismo. e) as cries que se instalam em dentes da primeira dentio no necessitam ser tratadas, uma vez que esses dentes sero substitudos pelos dentes da dentio permanente. [C] 1247. As________ so compostos formados por ________unidos (as) por ligaes ________e as _______so ________ orgnicos, de natureza _______sensveis s variaes de temperatura. Os termos que corretamente preenchem as lacunas so, respectivamente,

a) um peixe. d) um camaro. [E]

b) um caracol. e) uma medusa.

c) uma planria.

1236. Os "canhoneiros", como so chamados os chutadores mais potentes, constituem um pequeno e seleto grupo entre os jogadores de futebol. A velocidade de contrao do sistema muscular dos "canhoneiros" extremamente alta. Eles j nasceram com msculos super-rpidos, embora um bom programa de treinamento possa aumentar consideravelmente a potncia de um jogador de chute mdio, bem como de qualquer atleta. SUPERINTERESSANTE, 1988. Considerando essas informaes, julgue os itens que se seguem. (1) A potncia do chute depende da quantidade de terminaes nervosas em cada grupo de clulas musculares. (2) O mesmo tipo de clula muscular que proporciona o chute encontrado tambm no msculo cardaco. (3) O volume das fibras musculares aumenta com uma atividade muscular de esforo. (4) Alguns msculos, quando se est dormindo, mantm-se em um estado de pequena contrao. CECC 1237. "... diz com que pernas eu devo seguir ... se na baguna do teu corao, meu sangue errou de veia e se perdeu ..." (trecho da letra da msica "Eu Te Amo", de Chico Buarque). Neste poema, Chico Buarque cita vrios componentes do corpo humano. Considerando aspectos histolgicos, correto afirmar: ( ) Para que as pernas se movimentem necessria a atuao do sistema nervoso. ( ) Os vasos sangneos so revestidos internamente pelo endotlio, um tecido epitelial de revestimento que possui uma nica camada de clulas, facilitando a troca de nutrientes e catablitos entre o sangue (na regio dos capilares) e os tecidos. ( ) O tabagismo contribui para o surgimento de patologias cardacas e tambm pode modificar o epitlio das vias respiratrias. ( ) O sangue um importante meio de transporte para hormnios, os quais atuam no controle de secreo de vrias glndulas. ( ) A realizao de um movimento til, como caminhar, s possvel porque a musculatura estriada esqueltica unida ao esqueleto. ( ) As clulas do sangue relacionadas com o processo de defesa do organismo so os leuccitos. Os eritrcitos participam do transporte de gases e hormnios no ser humano. VVVVVF 1238. Um animal que s possui musculatura longitudinal e que usa a presso hidrosttica do lquido pseudocelomtico como antagonista da musculatura pode ser uma a) minhoca. b) lombriga. c) planria. d) anmona. e) estrela-do-mar. [B] 1239. O elemento qumico fundamental no processo de contrao e relaxamento muscular o: a) mercrio b) clcio c) enxofre d) argnio [B] 1240. "S uma pessoa com bom condicionamento cardiovascular ter energia suficiente para suportar uma carga de exerccios de musculao", diz o professor Ney Pereira, coordenador do Curso de Ps-Graduao em Educao Fsica e Fisioterapia da Universidade Gama Filho - RJ."

112 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) gorduras - protenas - peptdicas - enzimas - acares - lipdica. b) protenas - aminocidos - energticas - gorduras - compostos - protica. c) protenas - aminocidos - peptdicas - enzimas - catalisadores - protica. d) enzimas - aminocidos - hdricas - protenas - catalisadores - lipdica. e) protenas - acares - proticas - enzimas - acares - enzimtica. [C] 1248. Alm de sua funo digestiva, o pncreas atua ativamente na coordenao hormonal, j que tambm uma glndula endcrina. Assinale a opo que apresenta respectivamente os papis digestivo e de coordenao. a) Emulso de gorduras e liberao de aldosterona. b) Liberao de pepsina e produo de gastrina. c) Acidificao do quimo e liberao de tripsina. d) Desaminao de aminocidos e produo de insulina. e) Desdobramento do amido e produo de glucagon. [E] 1249. Em 16/08/94 o jornal FOLHA DE SO PAULO apresentou uma reportagem sobre a vitamina A. O artigo dava destaque s conseqncia benficas de suplemento peridico dessa vitamina. Porm abordava, tambm, problemas causados pela ingesto excessiva da mesma, e doenas provenientes de sua ingesto deficitria. A vitamina A, por sua "natureza qumica", armazena seu excesso ingerido em determinado "rgo" do corpo humano gerando problemas orgnicos, bem como sua falta acarreta "problemas carenciais". Com base na afirmao destacada, assinale a opo correta que relaciona, respectivamente, a natureza qumica, o rgo acumulador do excesso e a hipovitaminose (problema carencial), correspondentes a esta vitamina. a) lipossolvel, fgado e cegueira noturna. b) lipossolvel, bao e bcio endmico. c) lipossolvel, pncreas e escorbuto. d) hidrossolvel, pncreas e beriberi. e) hidrossolvel, fgado e raquitismo. [A] 1250. A carncia de vitaminas representadas por I, II e III produz avitaminoses cujos sintomas so, respectivamente, escorbuto, raquitismo e cegueira noturna. Que alternativa apresenta as vitaminas correspondentes aos nmeros I, II e III? a) I - vit. C ,II - vit. D, III - vit. E b) I - vit. E ,II - vit. B, III - vit. A c) I - vit. C ,II - vit. D, III - vit. A d) I - vit. A ,II - vit. B, III - vit. E e) I - vit. C ,II - vit. B, III - vit. A [C] 1251. Enzimas que atuam em pH alcalino sobre gorduras, em pH neutro sobre carboidratos e em pH cido sobre protenas podem ser encontradas, respectivamente: a) no pncreas, na boca e no estmago. b) no pncreas, na vescula biliar e no estmago c) na vescula biliar, na boca e no duodeno. d) na boca, no pncreas e no estmago. e) no pncreas, na boca e no duodeno. [A] 1252. Aps uma cirurgia de emergncia, devido presena de grande quantidade de clculos biliares, uma pessoa teve retirada a sua vescula biliar. Portanto, podese esperar que a) a bile passar a ser lanada diretamente na corrente sangnea. b) a secreo da bile ser feita de forma contnua, no se restringindo aos perodos de digesto. c) no haver mais produo da bile. d) o emulsionamento das gorduras ficar a cargo apenas das lipases do suco pancretico e do suco entrico. e) o emulsionamento das gorduras ocorrer no jejuno, local da liberao da bile. [B] 1253. Realizou-se um experimento com quatro tubos de ensaio. Colocou-se: tubo I: ptialina + amido; tubo II: colocou-se ptialina + sacarose; tubo III: colocou-se pepsina + manteiga e tubo IV: colocou-se pepsina + carne + HC. Deve-se observar digesto somente nos tubos a) I e II b) I e III c) I e IV d) II e III e) II e IV [C] 1254. Para demonstrar experimentalmente a digesto de protenas no estmago de mamferos, mais adequado colocar um fragmento de carne com gua, em um recipiente em agitao constante e mantido a 36C, adicionando-se APENAS a) bicarbonato de sdio. b) pepsina e bicarbonato de sdio. c) pepsina e cido clordrico. d) cido clordrico. e) pepsina. [C]

1255. Observe o esquema que representa a obteno de energia por um vertebrado. Com base nesse esquema e em seus conhecimentos sobre o assunto, INCORRETO afirmar-se que

a) a energia produzida est armazenada na glicose. b) a etapa 1 extracelular. c) a liberao de CO2 ocorre na etapa 2. d) as etapas 1 e 2 envolvem participao de enzimas. e) o O2 participa da formao de gua na etapa 2. [A] 1256. Observe o quadro a seguir. Com base nesse quadro, INCORRETO afirmar-se que

a) o leite de jumenta o mais parecido com o leite humano. b) o leite de cabra tem cerca de 3,5 vezes mais protenas do que o leite humano. c) o leite em p o que mais se assemelha ao leite de vaca. d) o leite de vaca o mais gorduroso. e) os leites de vaca e de cabra so mais energticos do que o leite humano. [D] 1257. Observe as figuras referentes ao tubo digestivo de dois animais A e B. Em relao aos animais que apresentam esses tubos digestivos, INCORRETO afirmar-se que

a) a interao com microrganismos para obteno de energia fundamental para o animal A. b) o animal A um consumidor primrio. c) o animal B pode pertencer ao terceiro nvel trfico. d) o animal B possui estruturas especializadas para matar e dilacerar suas presas. e) os animais A e B apresentam relao de competio por alimento. [E] 1258. Todas as afirmativas referem-se s vantagens do leite materno para os recm-nascidos, EXCETO a) Contm anticorpos que aumentam as defesas. b) Contm hormnios adequados ao desenvolvimento. c) Dispensa preparao prvia. d) Possui maior digestibilidade porque coagula em pequenos flocos. e) Possui vitamina D e ferro em quantidade suficiente ao desenvolvimento. [B]

113 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1259. A pasteurizao, tcnica de esterilizao parcial de alimentos, como o leite e os sucos industrializados, consiste em a) aquecer a mais de 200C, durante 15 minutos, para destruir esporos e fungos. b) aquecer at 75C e resfriar bruscamente, entre 0 e 2C, visando eliminar bactrias patognicas. c) resfriar a 0C, durante 15 horas, que resultar em morte de todos os tipos de vrus. d) transformar o lquido em pasta, por centrifugao contnua e resfriada, para desnaturar protenas txicas. e) utilizar conservantes bactericidas e fungicidas os quais no alteram o sabor. [B] 1260. Observe a figura.

Nessa figura esto representadas glndulas do sistema digestivo cuja enzima tpica atua sobre um substrato que resulta num produto. A alternativa que mostra a relao correta entre o substrato e seu respectivo produto a) amido e maltose. b) gorduras e cidos graxos. c) lactose e galactose. d) peptdeos e aminocidos. e) sacarose e glicose. [A] 1261. Observe as figuras em que esto representados trs grupos de seres vivos.

( ) Os ruminantes, entre os quais citamos bois e cabras, durante vrias horas do dia apenas cortam os vegetais e os engolem sem mastigao. ( ) Na primeira cmara estomacal (rmen), que funciona como armazenadora, ocorre uma intensa fermentao, proporcionada por uma abundante flora bacteriana. ( ) Pouco a pouco, o alimento passa para a 2 cmara (retculo) onde compactado em massas mais ou menos esfricas e, por inverso voluntria do peristaltismo do esfago, essas massas voltam boca e s ento demoradamente mastigadas. ( ) Numa segunda deglutio passa diretamente para a terceira cmara (Omaso ou coagulador) onde atua o suco gstrico digerindo os alimentos e parte das bactrias simbinticas que digerem celulose, passando o alimento para a 4 e ltima cmara - o abomaso. ( ) no Abomaso (folhoso) que termina a digesto e onde ocorre uma intensa ao mecnica e continua a fermentao. VVVFF 1264. Na digesto intracelular, formam-se no interior do citoplasma celular os VACOLOS DIGESTIVOS, que derivam da associao de: a) fagossomas e pinossomos. b) fagossomas e ribossomas. c) lisossomas e orgnulos intracitoplasmticos. d) ribossomas e vesculas de pinocitose. e) lisossomas e fagossomas. [E] 1265. Atravs da digesto, as molculas orgnicas, que so grandes e complexas devem ser hidrolisadas para serem absorvidas. Dentre elas, o amido um carboidrato: a) cuja digesto comea na boca pela ao da lipase salivar. b) formado por cerca de 30.000 molculas de glicose, do mesmo tamanho que o glicognio e a celulose. c) que forma um complexo, que absorvido pelo intestino delgado, depois da combinao. d) digerido pela amilase salivar, na primeira etapa, produz maltose que, pela ao da maltase, produz 2 molculas de glicose. e) digerido no estmago pela ao do cido gstrico e carboidratases diversas. [D] 1266. A desnutrio ou a subnutrio infantil um grave problema de sade pblica, principalmente em pases subdesenvolvidos, porque ela provoca a carncia de algumas substncias que so essenciais ao organismo humano, entre elas as vitaminas. Analise as proposies a seguir relacionadas a algumas vitaminas, suas funes, suas fontes usuais e as doenas causadas por suas deficincias. I) O cido flico age sobretudo na sntese de nucleoprotenas e sua deficincia causa danos principalmente no processo de maturao das hemcias, levando anemia. As frutas ctricas representam a nica fonte natural de cido flico. II) O caroteno atua na formao de pigmentos visuais e na manuteno estrutural dos epitlios. sintetizado principalmente por enterobactrias e sua deficincia leva cegueira noturna e ao ressecamento da pele. III) A vitamina D age no desenvolvimento dos ossos e obtida principalmente de leo de peixes, fgado e leite e tambm pela ao da luz solar sobre a pele. Sua deficincia provoca o raquitismo. a) Apenas a I verdadeira. b) Apenas II verdadeira. c) Apenas a III verdadeira. d) Esto corretas a I e a II. e) Esto corretas a II e a III. [C] 1267. Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos.Nos ltimos anos, tem sido crescente o uso indiscriminado de medicamentos base de vitaminas. Sobre essas substncias reguladoras do metabolismo correto afirmar que: 01. o excesso de vitaminas hidrossolveis pode trazer problemas porque se acumulam no organismo atingindo nveis de toxicidade; 02. as vitaminas lipossolveis dissolvem-se bem em gorduras e no se acumulam no organismo; 04. so lipossolveis as vitaminas A, D, E e K;

Indique a alternativa que apresenta o grupo de seres vivos com digesto exclusivamente intracelular. a) apenas 1. b) apenas 2. c) apenas 3. d) 1 e 2. e) 2 e 3. [A] 1262. Os sintomas a seguir numerados se referem aos efeitos mais marcantes da carncia de algumas vitaminas no organismo humano. I. Deformao no esqueleto e anomalias da dentio. II. Secura da camada crnea do globo ocular e deficincia visual em ambiente de luz fraca. III. Dificuldade de coagulao do sangue. IV. Inflamao da pele e das mucosas, com sangramento. Esses sintomas esto associados, respectivamente, carncia das vitaminas a) D, E, C e A b) K, A, B e D c) B, K, A e C d) B, D, K e A e) D, A, K e C [E] 1263. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa.Tendo a figura como um elemento ilustrador, analise as proposies apresentadas com relao digesto nos ruminantes.

114 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

08. normalmente, no h a menor necessidade de tomar medicamentos base de vitaminas quando o indivduo recebe uma dieta variada, com carne, leite, legumes, verduras e frutas; 16. as vitaminas D e K so utilizadas para retardar o envelhecimento, pois funcionam como antioxidantes, reparando, assim, os danos causados pelos radicais livres. 08 + 04 = 12 1268. Quando uma clula fagocita uma partcula: a) a digesto das substncias fagocitadas ocorre por meio de um processo exgeno clula em estruturas chamadas de desmossomos b) h formao de pseudpodes contendo enzimas proteolticas e cidos nuclicos c) a digesto das substncias fagocitadas feita pelas enzimas encontradas nos lisossomos d) a digesto das substncias fagocitadas ocorre no retculo endoplasmtico rugoso com a participao dos ribossomos [C] 1269. Indique a opo que contenha, apenas, enzimas digestivas liberadas pelo pncreas: a) amilase, pepsina b) tripsina, quimotripsina c) pepsina, tripsina d) lactase, amilase [B] 1270. Relacione a coluna 1 com a coluna 2, relativas s vitaminas e seus efeitos carenciais: Coluna 1 I. Vitamina "A" II. Vitamina "D" III. Vitamina "B" IV. Vitamina "C" Coluna 2 ( ) xeroftalmia ( ) polineurite ( ) raquitismo ( ) escorbuto Indique a opo que contenha, na coluna 2, a sua correlao com a coluna 1, de cima para baixo: a) I, II, III e IV b) I, III, II e IV c) III, I, II e IV d) IV, I, II e III [B] 1271. Uma pessoa que tenha sofrido uma cirurgia para retirada do estmago dever ter prejuzo, principalmente, na digesto de : a) protenas. b) amido. c) lipdios. d) cidos nuclicos. e) vitaminas. [A] 1272. Num experimento, foram montados 3 tubos de ensaio conforme o esquema a seguir. Sabendo-se que a catalase uma enzima presente no fgado, que acelera a reao de quebra da gua oxigenada em gua e oxignio, assinale a alternativa ERRADA.

d) faringe - esfago - pncreas - fgado e) esfago - vescula biliar - fgado estmago [B] 1274. Com relao s vitaminas, assinale a alternativa CORRETA: a) a vitamina K encontrada em vegetais folhosos e no alho, mas tambm sintetizada naturalmente pela flora bacteriana do intestino delgado. b) todas as vitaminas so substncias orgnicas que pertencem ao grupo das aminas. c) uma das funes da vitamina A aumentar a absoro intestinal de clcio e fosfato. d) cegueira noturna um sintoma caracterstico de deficincia de vitamina B1 (tiamina). e) a beribri, uma espcie de neurite, causada pela deficincia da vitamina E. [A] 1275. No sistema digestivo de mamferos, uma das funes do suco pancretico : a) neutralizar a acidez do alimento que chega ao estmago. b) emulsificar as gorduras para torn-las solveis. c) converter as gorduras em cidos graxos e glicerol. d) decompor protenas e carboidratos pela ao da lipase pancretica. e) facilitar a digesto do bolo alimentar pelas enzimas da bile. [C] 1276. Em uma amostra retirada do tubo digestivo de uma pessoa que se alimentara h duas horas, foram encontrados lipdios, peptdios e maltose, em pH baixo. Pode-se concluir que o material foi coletado a) da boca. b) do esfago. c) do duodeno. d) do estmago. e) do intestino grosso. [D] 1277. Em qual das alternativas a seguir as trs funes mencionadas so realizadas pelo fgado? a) Regular o nvel de glicose no sangue, transformar amnia em uria, produzir bile. b) Regular o nvel de glicose no sangue, transformar amnia em uria, secretar quimotripsina. c) Regular o nvel de glicose no sangue, produzir cido clordrico, secretar quimotripsina. d) Produzir bile, transformar amnia em uria, produzir cido clordrico. e) Produzir bile, produzir cido clordrico, secretar quimotripsina. [A] 1278. Os meios de comunicao, recentemente, divulgaram que a venda de carne para a populao caiu em 60%, sem haver aumento no consumo de aves e peixes. Este fato preocupante porque indica que foi reduzida a ingesto de nutrientes com funo plstica, que so: a) glicdios b) lipdios c) vitaminas d) sais minerais e) protenas [E] 1279. A energia que usamos para realizar os movimentos provm da degradao dos alimentos que ingerimos. Entre os nutrientes que ingerimos, indique o mais utilizado na produo desta energia: a) protena; b) carboidrato; c) lipdio; d) sais minerais; e) gua. [B] 1280. As crianas que vivem nas regies afetadas pela seca so as maiores vtimas da FOME, pois as protenas, os minerais e as vitaminas, de que necessitam para crescer e repor as energias gastas, esto praticamente ausentes de sua dieta alimentar. Assinale a alternativa que apresenta doenas causadas, respectivamente, pela falta de FERRO e VITAMINA A. a) raquitismo e anemia. b) escorbuto e cegueira-noturna. c) cegueira-noturna e raquitismo. d) anemia e cegueira-noturna. e) anemia e escorbuto. [D] 1281. Assinale a alternativa que relaciona um alimento rico em vitamina C (cido ascrbico) a) arroz. b) feijo. c) carne. d) laranja. e) alface. [D] 1282. Quais so os alimentos ricos em vitamina A (retinol e betacaroteno)? a) arroz e feijo. b) fgado e alface. c) gema de ovo e cenoura. d) macarro e agrio. e) camaro e sardinha. [C] 1283. Marque a alternativa que indica o alimento mais rico em protenas: a) feijo b) alface c) cenoura d) carne e) arroz

a) O tubo A apresentar um borbulhamento, indicativo da liberao de oxignio. b) No tubo B no haver borbulhamento, pois a fervura do fgado desnaturou a catalase presente. c) No tubo C no haver borbulhamento, pois a alterao de pH tambm pode desnaturar as enzimas. d) O aumento da quantidade de gua oxigenada no tubo A ser sempre acompanhado do aumento na velocidade da reao. e) Se o fgado do tubo A estiver triturado, a reao ser mais intensa, pois haver maior superfcie de contato entre a enzima e o seu substrato. [D] 1273. O alimento, no sistema digestivo humano, percorre os seguintes rgos, antes de chegar ao intestino delgado: a) faringe - laringe - diafragma - estmago b) boca - faringe - esfago - estmago c) boca - traquia - fgado - intestino grosso

115 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[D] 1284. Qual o alimento mais rico em calorias? a) fgado de boi. b) agrio. d) sardinha e) feijo. [C] c) macarro.

c) pelo fgado. d) pela mucosa gstrica. e) pelo esfago. [A] 1293. A figura a seguir indica as diversas etapas do processo que uma ameba realiza para obter alimento.

1285. funo da bile, suco produzido pelo fgado, armazenado na vescula biliar e lanado no intestino: a) Digerir carboidratos. b) Emulsionar protenas. c) Digerir lipdios. d) Emulsionar lipdios. e) Digerir vitaminas. [D] 1286. No sofrem digesto: a) sais minerais, gua e cidos nuclicos. b) sais minerais, gua e vitaminas. c) sais minerais, cidos nuclicos e protenas. d) gua, protenas e polissacardeos. e) gua, protenas e lipdios. [B] 1287. Qual dos alimentos a seguir tem funo basicamente energtica? a) mel b) bife c) cenoura d) sal e) ovo [A] 1288. A xeroftalmia caracterizada pela secura da camada crnea do globo ocular. A xeroftalmia determinada por uma deficincia de vitamina: a) A b) B c) C d) D e) E [A] 1289. Entre as pessoas muito pobres, a deficincia calrica e protica est comumente associada deficincia de vitaminas e sais minerais. Assinale a alternativa que indica os efeitos causados pela deficincia ou ausncia das vitaminas A, D e de FERRO. a) raquitismo, cegueira noturna, distrofia muscular. b) raquitismo, escorbuto, hemorragia. c) anemia, esterilidade, raquitismo. d) cegueira noturna, hemorragia, escorbuto. e) cegueira noturna, raquitismo, anemia. [E] 1290. Uma determinada enzima, retirada de um rgo do aparelho digestivo de um mamfero, foi distribuda igualmente em 8 tubos de ensaio. o tipo de alimento e o pH de cada tubo esto informados na tabela a seguir.

A organela que se funde ao fagossomo contm a) produtos finais da digesto. b) enzimas que sintetizam carboidratos. c) enzimas digestivas. d) enzimas da cadeia respiratria. e) reservas energticas. [C] 1294. A pepsina, a bile e a tripsina so produzidas, respectivamente, pelo: a) estmago, pncreas e fgado b) estmago, fgado e pncreas c) fgado, pncreas e estmago d) pncreas, estmago e fgado e) pncreas, fgado e estmago [B] 1295. Ces a que se extraram o pncreas passaram a apresentar sintomas similares aos do diabetes humano. Com o duto pancretico amarrado, apenas distrbios digestivos. A experincia nos permite concluir que: a) o pncreas apresenta a funo de glndula digestiva com exclusividade. b) a funo primordial do pncreas em ces secretora. c) tanto a funo digestiva como a funo hormonal so funes inerentes ao pncreas. d) o diabetes humano pode ser causado por leses no duto pancretico. e) o pncreas responsvel pela produo de gastrina. [C] 1296. A bile apresenta importncia digestiva, porque: a) seus pigmentos (bilirrubina e biliverdina) fazem hidrlise de gorduras. b) seus pigmentos daro a cor tpica das fezes. c) cria condies, atravs de alcalinizaes, para o bom funcionamento das enzimas pancreticas e intestinais. d) cria condies, atravs de seus sais biliares, para a tripsina emulsionar as gorduras. e) associa suas enzimas s enzimas do pncreas e do intestino delgado, para completar o trabalho digestivo. [C]

Os tubos de ensaio foram mantidos a 37C e aps 10 horas observou-se digesto do alimento apenas no tubo III. Com base nesses dados, possvel concluir que a enzima utilizada e o rgo de onde foi retirada so, respectivamente, a) amilase pancretica e intestino. b) maltase e estmago. c) tripsina e intestino. d) ptialina e boca. e) pepsina e estmago. [E] 1291. Considere o seguinte texto: "... o rgo responsvel pela digesto (...) acha-se escondido na profundidade de nosso abdmen, bem protegido, colado na parede l atrs (...) uma pequena massa que pesa menos de 100 g, mas constitui um laboratrio maravilhoso (...) seus sucos so to poderosos que so capazes de atacar qualquer tipo de comida (...)" O rgo, a que o texto se refere, a) o intestino delgado. b) a vescula biliar. c) o estmago. d) o pncreas. e) o fgado. [D] 1292. Tiflossole e cecos intestinais so estruturas presentes no tubo digestivo de alguns animais. Nos seres humanos, suas funes so desempenhadas: a) pelas vilosidades e microvilosidades intestinais. b) pelo estmago.

1297. As enzimas atuam de forma mais eficiente quando o pH do meio ideal. O grfico a seguir representa a ao de trs enzimas.

Pode-se afirmar que a enzima: a) A produzida sob a forma de zimognio. b) A desdobra polissacardeos em dissacardeos. c) B desdobra lipdios em cidos graxos. d) B produzida sob estmulo da gastrina. e) C inicia a digesto de protdios. [A]

116 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1298. Num tubo de ensaio, mantido a 37C, foram colocados, pela ordem, suco gstrico de um animal. Mg(OH)2 e um pedao de carne. Analise as seguintes afirmativas: I - O Mg(OH)2 no interfere na reao do suco gstrico. II - A carne no deve ser digerida pois rica em protenas, cuja digesto s ocorre no intestino delgado. III - A pepsina presente no suco gstrico no ir digerir a carne, pois houve uma alterao no pH. IV - Este tubo poderia ser mantido a qualquer temperatura, pois ela no interfere na ao de enzimas. Est(o) correta(s): a) Somente a afirmativa I. b) As afirmativas I e II. c) Somente a afirmativa III. d) As afirmativas III e IV. e) As afirmativas I e IV. [C] 1299. Considere a seguinte esquema do sistema digestivo humano.

1305. A bile, produzida pelo fgado, tem como funo a) lubrificar a mucosa intestinal. b) emulsionar as gorduras. c) digerir as protenas. d) provocar a contrao da vescula biliar. e) estimular a secreo gstrica. [B] 1306. Observe as funes a seguir: I - Estimula a sntese do colgeno II - Estimula a migrao qumica III - Facilita a absoro do ferro IV - Participa da fosforilao oxidativa V - Aumenta a disponibilidade energtica Indique a opo que contm a vitamina detentora de todas as funes anteriores: a) vitamina K b) vitamina D c) vitamina B12 d) vitamina C [D] 1307. As enzimas tripsina, ptialina e lipase, tm, respectivamente, como substrato: a) protena, gordura e carboidrato b) gordura, carboidrato e protena c) protena, carboidrato e gordura d) carboidrato, protena e gordura [C] 1308. Os esquemas a seguir mostram as quantidades relativas de protenas (P) e de lipdios (L) em diversos tipos de carnes.

Os rgos que produzem enzimas digestivas que digerem protenas so: a) 1, 4 e 5. b) 1, 4 e 6. c) 4, 5 e 6. d) 1, 3 e 7. e) 2, 3 e 8. [C] 1300. A remoo de um rgo de um animal reduziu a capacidade de digerir lipdios, protenas e amido e provocou aumento da taxa de glicose no sangue. Esse rgo a) a glndula adrenal. b) o pncreas. c) a tireide. d) a paratireide. e) a hipfise. [B] 1301. A digesto dos Porferos (esponjas) intracelular e realizada por clulas chamadas a) arquecitos. b) porcitos. c) coancitos. d) pinaccitos. e) amebcitos. [C] 1302. O amido um carboidrato presente no po, no macarro, na batata e nas massas em geral. A digesto desse polissacardeo a) inicia-se na boca, pela ao da amilase salivar, e termina no estmago, com a ao do suco gstrico. b) tem incio e trmino na boca, com a ao da amilase salivar. c) inicia-se na boca, com a ao da amilase salivar, e termina no intestino delgado, com a ao da amilase pancretica. d) inicia-se na boca, com a ao da amilase salivar, e termina no estmago, com a ao da amilase pancretica. e) inicia-se na boca, com a ao da amilase salivar, e termina no pncreas, com a ao da amilase pancretica. [C] 1303. Os fenilcetonricos tm falta de uma enzima do fgado responsvel pelo metabolismo do aminocido fenilalanina. Para que essa substncia no se acumule no sangue, sua dieta alimentar deve restringir, dentre os nutrientes mencionados a seguir, a) as protenas apenas. b) os carboidratos apenas. c) as gorduras apenas. d) as gorduras e os carboidratos. e) as gorduras e as protenas. [A] 1304. A comunicao da vescula biliar com o intestino delgado feita pelo ducto biliar, que libera a bile. Se por algum motivo houver uma obstruo do ducto biliar, o que poder ocorrer? a) A pepsina perder sua atividade. b) A digesto dos carboidratos ocorrer mais rapidamente. c) Produzir uma alcalinizao do intestino. d) A digesto dos lipdios ser mais lenta. e) Haver mais tripsina atuando sobre os lipdios. [D] Assinale a nica opo que NO est de acordo com o processo digestivo no homem. a) A colecistocinina desencadeia o esvaziamento da vescula biliar no duodeno. b) A secretina estimula a liberao do suco pancretico no duodeno. c) A gastrina propicia o aumento das secrees gstricas com seu contedo proteoltico. d) A vescula biliar libera suas enzimas lipolticas estimulada pela colecistocina. e) O pncreas, estimulado pela secretina, possibilita a alcalinizao do intestino delgado.

Uma pessoa com colesterol elevado deve abster-se de ingerir a) frango e ganso. b) frango e porco. c) ganso e porco. d) frango e coelho. e) porco e coelho. [C] 1309. Graas nutrio, o ser vivo faz a reconstruo das partes desgastadas e forma tambm novas clulas no interior do corpo durante o perodo de crescimento. Esse processo conhecido como crescimento por: a) intuscepo. b) aposio. c) deposio. d) fermentao. e) catabolismo. [A] 1310. O esquema a seguir representa interaes hormonais que auxiliam na liberao de secrees no sistema digestivo humano.

117 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[D] 1311. Leia o texto a seguir, escrito por Jons Jacob Berzelius em 1828. "Existem razes para supor que, nos animais e nas plantas, ocorrem milhares de processos catalticos nos lquidos do corpo e nos tecidos. Tudo indica que, no futuro, descobriremos que a capacidade de os organismos vivos produzirem os mais variados tipos de compostos qumicos reside no poder cataltico de seus tecidos." A previso de Berzelius estava correta, e hoje sabemos que o "poder cataltico" mencionado no texto deve-se a) aos cidos nuclicos. b) aos carboidratos. c) aos lipdios. d) s protenas. e) s vitaminas. [D] 1312. Esta tabela mostra o teor de protenas, carboidratos e lpides em alguns alimentos, expresso em gramas por 100g de peso seco. Em relao bile, podemos afirmar corretamente que produzida no rgo: a) I e armazenada no rgo II. b) I e secretada para o rgo IV. c) I e contm enzimas que digerem as gorduras. d) II e armazenada no rgo I. e) II e secretada para o rgo IV. [A] 1316. Considere as seguintes etapas da digesto. I - Absoro de nutrientes. II - Adio de cido clordrico ao suco digestivo. III - Incio da digesto das protenas. IV - Adio da bile e do suco pancretico ao suco digestivo. V - Incio da digesto do amido. Dentre esses processos, ocorrem no intestino delgado apenas a) I e IV. b) I e III. c) II e III. d) II e IV. e) III e V. [A] 1317. Assinale a alternativa em que h uma correspondncia correta da segunda coluna com o enunciado da primeira coluna: Primeira Coluna I - Tem funo no processo digestivo e armazena glicognio II - Digesto de protenas III - Tripsina IV - Absoro de sais V - Ptialina Segunda Coluna ( ) Intestino grosso ( ) Boca ( ) Pncreas ( ) Fgado ( ) Estmago a) IV, II, III, I e V b) IV, V, III, I e II c) II, IV, III, V e I d) V, IV, III, I e II [B] 122. Observe os conceitos a seguir, relativos aos aspectos anatmicos de rgos da digesto, no homem: I - Se classificam em partidas, sublinguais e submandibulares II - um canal de contraes voluntrias que desloca o alimento para o esfago III - Realiza movimentos peristlticos involuntrios, com o objetivo de deslocar o bolo alimentar para o estmago a) glndulas salivares, intestino e esfago b) lngua, intestino e esfago c) lngua intestino e faringe d) glndulas salivares, faringe e esfago [D] 1318. "Cerca de 27 milhes de brasileiros tm intolerncia ao leite por deficincia na produo de uma enzima do intestino." Sobre a enzima citada no artigo, e as enzimas em geral, podemos afirmar que: a) aumentam a energia de ativao necessria para as reaes. b) atuam de forma inversamente proporcional ao aumento da temperatura. c) so altamente especficas em funo de seu perfil caracterstico. d) so estimuladas pela variao do grau de acidez do meio. e) so consumidas durante o processo, no podendo realizar nova reao do mesmo tipo. [C] 1319. Consideram-se aminocidos essenciais para um determinado animal, aqueles a) de que ele necessita e sintetiza a partir de outras substncias. b) de que ele necessita mas no consegue sintetizar, tendo que receb-los em sua dieta. c) de que ele necessita apenas nas primeiras etapas de seu desenvolvimento.

Com base nos dados da tabela, assinale a alternativa que contm a dieta mais adequada para um jogador de futebol antes de uma competio. a) Arroz com farinha de mandioca. b) Arroz com toucinho. c) Carne seca com farinha de mandioca. d) Carne seca com toucinho. [A] 1313. Esta tabela refere-se ao teor de minerais e vitaminas, expressos em mg por 100g de parte comestvel de alguns alimentos.

Com base nos dados dessa tabela, assinale a alternativa que contm uma recomendao alimentar INADEQUADA. a) Abacate para pessoas que sofrem de bri-bri. b) Couve para algum com osteoporose e xeroftalmia. c) Goiaba para quem sofre de escorbuto. d) Gro-de-bico para pessoas anmicas. [A] 1314. Na aula de Biologia, o professor pediu a seus alunos que analisassem a seguinte afirmao relativa fisiologia da digesto: "A pepsina e a tripsina so enzimas proteolticas produzidas no estmago e atuam preferencialmente em meio cido". Essa afirmao a) esta correta. b) est incorreta, j que as duas enzimas no so proteolticas. c) est incorreta, j que as duas enzimas atuam preferencialmente em meio alcalino. d) est incorreta, j que apenas a pepsina produzida no estmago e atua preferencialmente em meio cido. e) est incorreta, j que apenas a tripsina produzida no estmago e atua preferencialmente em meio cido. [D] 1315. O esquema a seguir apresenta partes do aparelho digestivo humano com rgos numerados de I a V.

118 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) obtidos diretamente a partir de vegetais, que so os nicos organismos a sintetiz-los. e) resultantes da degradao de suas prprias protenas. [B] 1320. - Eliminao das clulas sangneas que esto velhas demais. - Formao de uria. - Armazenamento de energia para qualquer eventualidade. - Maior glndula do corpo humano. Todas essas caractersticas tpicas de um super-orgo esto relacionadas ao (): a) bao. b) rim. c) pncreas. d) fgado. e) hipfise. [D] 1321. O sufocamento por alimento responsvel por quase 3.000 mortes, anualmente, nos EUA, mais do que os acidentes com armas de fogo ou avies. O sufocamento ocorre quando uma poro do alimento bloqueia o(a): a) brnquio. b) esfago. c) glote. d) laringe. e) faringe. [C] 1322. Muitas pessoas consomem alimentos dietticos para perder peso. Mas podem incorrer no erro de comer um chocolate sem acar, rico em calorias, e engordar sem saber. Uma portaria de maio de 1996 do Ministrio da Sade define como "diet" o alimento especialmente formulado para pessoas com necessidades especficas e no necessariamente para emagrecer. Um leite para criana, por exemplo, pode ser diettico no pela quantidade de calorias, mas por possuir nutrientes especiais para o desenvolvimento do beb. "Diet" pode ser um sal sem cloreto de sdio, um po que no contenha glten ou um cereal enriquecido com fibras. Ao contrrio do que se pensa, "diet" no quer dizer que o alimento seja sem acar. J o produto "light" pode ter 30% a menos e gordura, acar ou protena, comparado composio normal, mas no especfico para um tipo de necessidade, como o "diet". Nem todos os "lights" so recomendados para diabticos. Com o auxlio do texto, julgue os itens seguintes. (1) Caloria uma unidade de medida que indica a quantidade de gordura dos alimentos. (2) Sal "diet" sem cloreto de sdio pode ser recomendado para pessoas com presso alta ou com determinados problemas renais. (3) Um alimento sem fenilalanina pode ser classificado como "diet". (4) Um produto "light" que possua glicose ou amido no indicado para um diabtico. ECCC 1323. Qual cirurgia comprometeria mais a funo do sistema digestrio e por qu: a remoo dos vinte e cinco centmetros iniciais do intestino delgado (duodeno) ou a remoo de igual poro do incio do intestino grosso? a) A remoo do duodeno seria mais drstica, pois nele ocorre a maior parte da digesto intestinal. b) A remoo do duodeno seria mais drstica, pois nele ocorre a absoro de toda a gua de que o organismo necessita para sobreviver. c) A remoo do intestino grosso seria mais drstica, pois nele ocorre a maior parte da absoro dos produtos do processo digestrio. d) A remoo do intestino grosso seria mais drstica, pois nele ocorre a absoro de toda a gua de que o organismo necessita para sobreviver. e) As duas remoes seriam igualmente drsticas, pois, tanto no duodeno quanto no intestino grosso, ocorrem digesto e absoro de nutrientes e de gua. [A] 1324. Algumas pessoas se submetem a uma cirurgia de diminuio do estmago, como auxiliar no processo de emagrecimento. Esse procedimento tem como finalidade: a) a diminuio da digesto de gorduras e carboidratos, processo que ocorre nesse rgo. b) a diminuio da superfcie de absoro de nutrientes. c) fazer com que o indivduo se sinta saciado com menor quantidade de alimento. d) aumentar a velocidade dos movimentos peristlticos, eliminando mais rpido o bolo fecal. e) alterar o pH do meio, dificultando a digesto total do alimento. [C] 1325. A ____________ uma enzima proteoltica do ___________ que surge a partir de um precursor, _______________, quando em meio_________. Assinale a opo que completa perfeitamente as lacunas da sentena anterior. a) pepsina, suco gstrico, pepsinognio, cido. b) ptialina, suco gstrico, amilase salivar, cido. c) gastrina, suco gstrico, glicognio, cido. d) mucina gstrica, estmago, pepsinognio, bsico. e) amilase pancretica, intestino, amilase salivar, bsico. [A] 1326. A figura ilustra um modelo do sistema "chave-fechadura", onde observamos enzima, substrato e produto do sistema digestivo humano.

a) Se o substrato fosse uma protena que estivesse sendo degradada no estmago, qual seria a enzima especfica e o produto obtido neste rgo? b) Se a digesto de um determinado alimento ocorresse no intestino delgado e os produtos obtido fossem glicerol e cidos graxos, quais seriam, respectivamente, o substrato e a enzima? a) Enzima do suco gstrico: Pepsina. A degradao de protenas no estmago resulta em molculas menores denominadas peptdeos. Aps a digesto dos peptdeos no intestino delgado formam-se os aminocidos que podem ser absorvidos e utilizados pelo organismo. b) Substrado: Lipdios Enzima: Lipase pancretica e Lipase entrica. 1327. Os msculos envolvidos no deslocamento do corpo e nos movimentos do sistema digestivo so, respectivamente, dos tipos a) estriado e liso. b) esqueltico e estriado. c) liso e estriado. d) liso e esqueltico. e) estriado cardaco e liso. [A] 1328. Comparando-se o aparelho digestivo dos mamferos herbvoros - como, por exemplo, a cabra - com o aparelho digestivo dos mamferos carnvoros, observase geralmente a) presena de maior nmero de dentes e de rmen. b) presena de dentes mais aplanados e de rmen. c) presena de menor nmero de dentes e ausncia de estmago. d) presena de dentes mais pontiagudos e de estmago. e) presena de dentes mais escuros e ausncia de rmen. [B] 1329. Um mdico holands observou, no final do sculo XIX, que galinhas alimentadas com arroz polido, ou descascado, apresentavam os sintomas de uma doena conhecida como beribri, que era curada com a ingesto da pelcula, ou casca, retirada dos gros do arroz. A substncia necessria em pequenas quantidades na dieta para evitar o beribri, a vitamina denominada: a) E b) C c) B1 d) A [C] 1340. O aumento de peso considerado um fator determinante do aparecimento de hipertenso arterial em crianas e adolescentes. Todas as alternativas apresentam procedimentos recomendados para abaixar a presso arterial, EXCETO a) Estimular o consumo de fibras vegetais nas refeies. b) Praticar atividades fsicas regulares. c) Evitar o consumo dirio de carnes vermelhas. d) Usar queijo curado em uma das refeies dirias. [D] 1341. Na produo de compotas, devem ser adotadas algumas medidas para evitar-se a contaminao do alimento por microrganismos. Todas as alternativas apresentam medidas que podem garantir a assepsia desse processo, EXCETO a) A adio de conservantes, para impedir o crescimento dos microrganismos. b) A manuteno do meio aquoso, para evitar o crescimento de bactrias. c) A fervura, para desinfeco dos recipientes em que os doces sero guardados. d) A retirada do ar no momento de se fechar o recipiente que contm o doce. [B] 1342. Tomando uma grande dose de vitamina A, uma pessoa pode suprir suas necessidades por vrios dias; porm, se fizer o mesmo em relao vitamina C, no ter o mesmo efeito, necessitando de reposies dirias dessa vitamina. Essa diferena na forma de administrao se deve ao fato de a vitamina: a) A ser necessria em menor quantidade. b) A ser sintetizada no prprio organismo. c) A ser lipossolvel e ficar armazenada no fgado. d) C ser mais importante para o organismo. e) C fornecer energia para as reaes metablicas. [C] 1343. A hemorragia decorrente da ingesto de trevo doce por bovinos e ovinos se deve ao dicumarol, substncia presente nesse vegetal e que exerce ao antagonista vitamina a) E b) B12 c) B1 d) K [D]

119 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1344. A ingesto de alimentos gordurosos (frituras, por exemplo) provoca a secreo de bile, e esta promove o emulsionamento das gorduras, facilitando a ao da lipase. Marque a opo que contm o hormnio estimulante da secreo da bile e o rgo onde ele produzido. a) Hormnio: secretina; rgo: pncreas; b) Hormnio: secretina; rgo: fgado; c) Hormnio: colecistocinina; rgo: vescula; d) Hormnio: colecistocinina; rgo: duodeno; [D] 1345. No nosso organismo, a falta de bile no intestino delgado dificulta a digesto, principalmente de: a) amido. b) gorduras. c) protenas. d) vitaminas. e) enzimas. [B] 1346. Durante o processo de digesto de alimentos pelo homem, observa-se uma variao do pH ao longo do aparelho digestivo. Considerando essa variao, podemos dizer que o pH: a) na boca cido, no estmago alcalino e neutro no intestino. b) na boca e no estmago cido, tornando-se prximo ao neutro do intestino. c) na boca alcalino, no estmago neutro e no intestino cido. d) na boca prximo ao neutro, no estmago torna-se cido e no intestino volta a ser alcalino. e) tende a apresentar uma tendncia geral acidificao. [D] 1347. VITAMINAS "Megadoses de desconfiana" Utilizao de tratamento alternativos e prticas de terapia ortomolecular provocam polmica entre mdicos. Algumas vitaminas, entre elas o cido ascrbico e o tocoferol ou vitamina E, so preconizadas em doses elevadas pelos defensores da chamada medicina ortomolecular, com o objetivo de prevenir uma srie de doenas provocadas, segundo eles, por um acmulo de radicais livres no organismo. A utilizao com essa finalidade est baseada na seguinte propriedade qumica dos compostos citados: a) oxidante b) redutora c) detergente d) emulsionante [B] 1348. A invertase a enzima que hidrolisa a sacarose em glicose e frutose. Incubou-se, em condies adequadas, essa enzima com sacarose, de tal forma que a concentrao inicial, em milimoles por litro, do dissacardeo fosse de 10mM. Observe os grficos a seguir:

tornando-a lisa. Assinale a alternativa que descreve a(s) conseqncia(s) dessa leso. a) Diarria e emagrecimento, pois a superfcie de absoro de nutrientes diminui. b) Diarria por incapacidade de emulsionar e digerir lipdios. c) Diarria e desidratao por dificuldade de reabsoro de gua. d) Desnutrio por incapacidade de digesto de carboidratos e de protenas. e) Anemia devida hemorragia apresentada. [A] 1353. Ao passar pelas vilosidades do intestino delgado, o sangue de uma pessoa alimentada a) perde gs oxignio e ganha aminocidos. b) perde gs oxignio e perde glicose. c) ganha gs oxignio e ganha aminocidos. d) ganha gs carbnico e perde glicose. e) perde gs carbnico e ganha aminocidos. [A] 1354. Segundo estudo feito na Etipia, crianas que comiam alimentos preparados em panelas de ferro apresentaram uma reduo da taxa de anemia de 55 para 13%. Essa reduo pode ser explicada pelo fato de que o ferro, a) aquecido, ativa vitaminas do complexo B presentes nos alimentos prevenindo a anemia. b) contido nos alimentos, se transforma facilmente durante o cozimento e absorvido pelo organismo. c) oriundo das panelas, modifica o sabor dos alimentos, aumentando o apetite das crianas. d) proveniente das panelas, misturado aos alimentos e absorvido pelo organismo. [D] 1355. Aps um acidente automobilstico uma pessoa teve que se submeter a uma cirurgia que lhe removeu uma parte de seu corpo. Aps a recuperao passou a viver normalmente. A parte retirada era: a) o fgado. b) o pncreas. c) a hipfise. d) o bao. e) o diafragma. [D] 1356. O hormnio folculo-estimulante induz as clulas foliculares a liberar estrgeno, responsvel pelo crescimento do endomtrio. As estruturas relacionadas com a descrio acima so: a) hipfise, tiride e testculo. b) hipfise, ovrio e tero. c) tiride, supra-renal e tero. d) pncreas, ovrio e supra-renal. e) pncreas, tiride e testculo. [B] 1357. Nos testes de gravidez, a substncia cuja presena pesquisada na urina : a) o hormnio folculo estimulante. b) o hormnio luteinizante. c) a gonadotrofina corinica. d) o estrgeno. e) a progesterona. [C] 1358. Glndula de grande importncia na regulao endcrina geral, pois controla, direta ou indiretamente, outras glndulas, atravs de seus hormnios trficos. A frase refere-se: a) hipfise. b) tireide. c) s supra-renais. d) s paratireides. e) ao pncreas. [A] 1359. O diabete inspido e o diabete melito resultam, respectivamente, da deficincia: a) do lobo posterior da hipfise (ou do hipotlamo) e do pncreas. b) do pncreas e do crtex adrenal. c) do lobo anterior da hipfise e do crtex adrenal. d) do pncreas e da tiride. e) do lobo anterior da hipfise e do pncreas. [A] 1360. Qual das glndulas endcrinas relacionadas a seguir precisa de iodo como matria prima? a) hipfise b) adrenais c) tiride d) ovrios e) testculos [C] 1361. Dentre as glndulas relacionadas a seguir, a que no tem a sua secreo regulada diretamente por hormnios hipofisrios : a) a tiride b) as adrenais c) os ovrios d) o pncreas e) os testculos [D]

Aquele que melhor representa a variao das concentraes, em funo do tempo de incubao, da sacarose e da glicose, o de nmero: a) 4 b) 3 c) 2 d) 1 [C] 1349. NO apresentam tubo digestivo completo: a) Platelmintos. b) Nematdeos. c) Moluscos. d) Aneldeos. e) Aracndeos. [A] 1350. Uma pessoa cujas glndulas gstricas no esto produzindo cido clordrico, certamente ter dificuldades na digesto de a) amido. b) vegetais. c) acares. d) gorduras. ) protenas. [E] 1351. A especificidade enzimtica consiste na: a) energia de ativao da enzima b) vulnerabilidade da enzima de desnaturar-se a temperaturas altas c) exclusividade da enzima de somente atuar em seu substrato d) capacidade da enzima de "identificar" o pH especfico que propicie a reao [C] 1352. A celase uma doena caracterizada pela intolerncia ao glten presente em trigo, centeio e aveia. Nas pessoas que apresentam essa doena, o glten provoca a atrofia da mucosa que reveste internamente o intestino delgado,

120 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1362. Um paciente adulto procurou um endocrinologista porque estava com baixo peso, metabolismo basal muito alto, nervosismo e globo ocular saliente (exoftalmia). A disfuno hormonal que poderia ser responsvel pelo quadro apresentado pelo paciente envolve: a) o pncreas. b) a paratireide. c) a adrenal. d) a tiride. e) a supra-renal. [D] 1363. O grfico a seguir representa as variaes das concentraes plasmticas de dois hormnios ovarianos durante o ciclo menstrual de uma mulher.

c) Progesterona e Estrgeno. d) Luteinizante e Testosterona. e) Testosterona e Estrgeno. [E] 1367. Alm de sua funo digestiva, o pncreas atua ativamente na coordenao hormonal, j que tambm uma glndula endcrina. Assinale a opo que apresenta respectivamente os papis digestivo e de coordenao. a) Emulso de gorduras e liberao de aldosterona. b) Liberao de pepsina e produo de gastrina. c) Acidificao do quimo e liberao de tripsina. d) Desaminao de aminocidos e produo de insulina. e) Desdobramento do amido e produo de glucagon. [E] 1368. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Numa situao de perigo, um animal fica em estado de alerta (defesa). O comportamento apresentado depende de uma srie de reaes que envolvem diversos sistemas orgnicos. Com relao a esse estado, correto afirmar que: 01) O sistema nervoso ter papel decisivo no preparo do animal para enfrentar o perigo ou realizar a fuga. 02) Haver liberao de adrenalina, ocorrendo aumento da presso arterial e maior irrigao dos msculos e do crebro. 04) A freqncia respiratria aumentar, pois o animal necessitar de mais oxignio para o seu metabolismo. 08) A reao imediata do animal frente ao perigo depender diretamente do sistema linftico. 16) A freqncia cardaca aumentar para melhorar a irrigao sangnea dos tecidos. 01 + 02 + 04 + 16 = 23 1369. "Durante uma excurso a cavalo que fiz nos arredores de uma vila de Gois, senti-me de repente como, que num pas fantstico. Um tero das pessoas que encontrei tinha uma enorme bola no pescoo, [...] Os matutos no compartilhavam meu espanto. J esto acostumados com o "papo" ou "bcio endmico". A anomalia citada no texto est associada hipofuno de uma glndula endcrina, devido carncia de uma substncia. Esta glndula e esta substncia so, respectivamente: a) hipfise e mercrio. b) tireide e iodo. c) paratireides e clcio. d) pncreas e insulina. e) adrenais e adrenalina. [B] 1370. OSTEOPOROSE AFETA 25% DAS MULHERES NA MENOPAUSA. Para preveno da osteoporose recomendam-se, entre outras medidas, caminhadas e sol. Esse tratamento preventivo leva o organismo a produzir a) estrognios, que reduzem a atividade osteoclstica dos ossos. b) estrognios, que so necessrios para uma maior absoro de clcio e de fosfato nos ossos. c) vitamina A, que o radical prosttico de enzimas que atuam na absoro de clcio e fsforo. d) vitamina C, necessria nos processos de cicatrizao das fraturas, por aumentar a atividade osteoblstica dos ossos. e) vitamina D, que aumenta a absoro do clcio pelo intestino. [E] 1371. A hipfise NO exerce influncia sobre a) o testculo. b) a tireide. d) o pncreas. e) o ovrio. [D] c) as adrenais.

Quais so, respectivamente, os hormnios A e B? a) Luteinizante e folculo-estimulante. b) Folculo-estimulante e luteinizante. c) Luteinizante e progesterona. d) Progesterona e estrgeno. e) Estrgeno e progesterona. [C] 1364. Recentemente descobriu-se que, quando aumenta a presso nos trios (aurculas) cardacos, estes secretam um hormnio - o fator atrial - que tem ao direta sobre os nfrons, as unidades filtradoras dos rins. Entre outros efeitos, o fator atrial produz dilatao da arterola aferente, combinada com a constrio da arterola eferente (veja o esquema a seguir que representa um nfron).

Dessas informaes, pode-se deduzir que a secreo de fator atrial provoca: a) maior filtrao glomerular, formao de mais urina, diminuio da presso sangnea. b) menor filtrao glomerular, formao de mais urina, diminuio da presso sangnea. c) maior filtrao glomerular, formao de menos urina, elevao da presso sangnea. d) menor filtrao glomerular, formao de menos urina, elevao da presso sangnea. e) menor filtrao glomerular, formao de mais urina, elevao da presso sangnea. [A] 1365. No esquema a seguir,(I) indica a passagem de glicose do sangue para o fgado e (II) a passagem de glicose do fgado para o sangue. Os hormnios que controlam as passagens I e II so, respectivamente: (I) sangue fgado (II) fgado sangue a) adrenalina; aldosterona. b) insulina; aldosterona. c) insulina; glucagon. d) glucagon; insulina e) aldosterona; adrenalina. [C] 1366. Na puberdade, ocorrem alteraes morfo-fisiolgicas e comportamentais, no homem e na mulher. Tais alteraes decorrem da ao hormonal que determina o aparecimento dos caracteres sexuais secundrios. Os hormnios responsveis por tais alteraes so, respectivamente, a) ACTH e ADH. b) Progesterona e Luteinizante.

1372. Os hormnios que estimulam a tireide e as gnadas dos mamferos so produzidos a) pela paratireide. b) pela adeno-hipfise. c) pela neuro-hipfise. d) pelo crtex da supra-renal. e) pela medula da supra-renal. [B] 1373. Observe o esquema que representa seco de uma regio de testculo humano.

121 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

( ) O Paratormnio remove o clcio da matriz ssea, levando-o ao plasma. ( ) Um excesso de Tirocalcitonina no organismo descalcifica os ossos, tornandoos mais sujeitos a fraturas. ( ) O Paratormnio responsvel pela remoo do clcio do plasma e por sua incorporao matriz ssea. ( ) Os hormnios Paratormnio e Tirocalcitonina mantm as taxas de clcio e fsforo no plasma sangneo regulando as trocas desses elementos entre a matriz ssea e o plasma. VVFFV 1377. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. O Sistema Endcrino um dos sistemas reguladores do corpo. A respeito deste sistema e de seus componentes: ( ) as glndulas so tecidos epiteliais especializados para secreo; ( ) os hormnios, por serem transportados pelo sangue, apresentam ao em todos os tecidos do corpo; ( ) o FSH E o LH so dois hormnios produzidos pelo hipotlamo; ( ) o hormnio do crescimento (somatotropina) produzido na hipfise; ( ) a Insulina e o Glucagon so dois hormnios relacionados com o metabolismo da glicose, e so produzidos no Pncreas. VFFVV 1378. As funes sexuais femininas so reguladas pelos hormnios: folculo estimulante (FSH), luteinizante (LH), estrgeno (estradiol) e progesterona. Considere as seguintes afirmaes relacionadas a tais hormnios: I - Os hormnios folculo estimulante (FSH) e progesterona so produzidos pela adenohipfise. II - A ovulao ocorre quando o nvel do hormnio luteinizante (LH) atinge seu valor mais elevado. III- O hormnio progesterona atinge seu valor mximo aps a ovulao. Podemos dizer que: a) Somente a afirmao I est correta. b) Somente a afirmao II est correta. c) As afirmaes I e II esto corretas. d) As afirmaes II e III esto corretas. e) Todas as afirmaes esto corretas. [D] 1379. Associe corretamente as duas colunas relacionando os hormnios e sua ao principal e assinale a alternativa que traz a seqncia correta dos nmeros. 1) Ocitocina 2) Tiroxina 3) Insulina 4) Adrenalina 5) Progesterona ( ) desenvolve a parede uterina para a implantao do ovo e mantm a gravidez; ( ) contrai a musculatura uterina; ( ) eleva a presso arterial; ( ) controla a glicose no sangue; ( ) eleva o metabolismo basal. a) 5, 4, 1, 3 e 2; b) 1, 5, 4, 3 e 2; c) 5, 1, 4, 3 e 2; d) 1, 4, 2, 3 e 5; e) 5, 1, 2, 3 e 4. [C] 1380. Analise as proposies a seguir e assinale a opo correta: I) Um dos hormnios produzidos pela glndula supra-renal refora a ao dos nervos simpticos e estimula a degradao do glicognio heptico e muscular. II) Os hormnios tireoidianos atuam no crescimento e desenvolvimento do indivduo; a glndula que os produz atua no metabolismo do iodo. III) A testosterona e a androsterona so hormnios sexuais masculinos produzidos pelas clulas de Leydig localizadas entre os tbulos seminferos. a) esto corretas apenas I e III; b) todas esto erradas; c) apenas a I falsa; d) esto corretas apenas I e II; e) todas esto corretas. [E] 1381. Acerca do diabetes melito, importante doena crnica do homem, INCORRETO afirmar que; a) a presena de glicose na urina importante sinal b) fator de risco para o enfarte do miocardio c) sempre se deve, primariamente, a doenas do fgado d) leva poliria [C] 1382. "Durante todo o ano de 1995, o governo deixou de fornecer iodato de potssio aos fabricantes de sal. O iodo essencial para o ser humano. Problemas, porm, s se manifestam em populaes subnutridas, que no incluem em sua alimentao produtos do mar, uma rica fonte natural de iodo." Assinale a alternativa que apresenta, respectivamente, o nome da glndula afetada e a doena provocada pela falta desse elemento.

Com base no esquema e em seus conhecimentos sobre o assunto, CITE a) o nmero total de cromossomos existentes nas clulas indicadas pelos nmeros 1 e 4. b) uma funo das clulas indicadas pelos nmeros 5 e 6. c) o(s) nmero(s) correspondente(s) (s) clula(s) que sofre(m) ao do hormnio folculo estimulante (FSH) e as que sofre(m) ao do hormnio luteinizante (ICSH). d) o(s) nmero correspondente(s) (s) clula(s) que tero sua funo primordial impedida pela vasectomia e as que sero afetadas pelo uso de plula anticoncepcional masculina de efeito semelhante s j existentes para as mulheres. a) Espermatozide (cel. 1) n=23, Espermtide (cel. 2) n=23, Espermatcito I (cel. 3 ) 2n=46 e Espermatognia (cel. 4) 2n=46. b) Clulas de Leydig (5) produzem testosterona, Clulas de Sertoli (6) contribuem para o amadurecimento dos espermatozides. c) Sofrem ao do FSH as espermatognias (4) e ao do LH as clulas de Leydig (5). d) Espermatozides (cel. 1) e Espermatognias (cel. 4). 1374. Considere as seguintes funes de controle do sistema endcrino: I. concentrao de clcio e fsforo. II. crescimento geral do corpo. III. atividade das gnadas. IV. metabolismo do acar no corpo dos mamferos. As glndulas que correspondem a estas funes so, respectivamente, a) paratireides - hipfise - hipfise - pncreas. b) tireide - hipfise - hipfise - pncreas. c) paratireides - hipfise - hipfise - timo. d) supra-renal - hipfise - timo - pncreas. e) hipfise - supra-renal - pncreas - tireide. [A] 1375. Relacione a afirmao com o grfico "O glucagon tem efeito inverso ao da insulina aumentando o nvel de glicose no sangue, pois atua estimulando a transformao de glicognio em glicose no fgado"

Os dados para construo deste grfico foram registrados a partir do instante zero, quando a pessoa ingeriu 50mL de soluo glicosada. Podemos afirmar que, no momento a) B, a taxa de glucagon baixa nas pessoas normais. b) B, a taxa de glucagon alta nas pessoas normais. c) C, a taxa de glicose baixa em decorrncia da diminuio de glucagon ou do consumo metablico. d) A, a taxa de glicose baixa em decorrncia do aumento da taxa de glucagon ou do consumo metablico. e) A, a taxa de glucagon alta porque a de glicose est normal. [A] 1376. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Vrios fatores interagem no processo de formao e estruturao definitiva dos ossos, sendo muito importantes a nutrio (vitamina D, clcio e fsforo) e os hormnios da tireide e paratireides. Em relao a estes fatores, analise as proposies a seguir. ( ) O hormnio Tirocalcitonina remove clcio do plasma sangneo, incorporando-o matriz ssea.

122 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) adeno - hipfise e nanismo b) tireide e bcio c) supra-renal e doena de Cushing d) pncreas e 'diabetes mellitus' e) neuro-hipfise e 'diabetes insipidus' [B] 1383. O ADH um hormnio produzido pela _____, responsvel pela osmorregulao. A ingesto de gua _____ a produo desse hormnio, _____ a eliminao de urina. Assinale a alternativa que preenche correta e ordenadamente os espaos. a) hipfise - inibe - aumentando b) supra-renal - estimula - diminuindo c) hipfise - estimula - diminuindo d) tireide - inibe - diminuindo e) pncreas - inibe aumentando [A] 1384. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. As glndulas endcrinas apresentam como caracterstica distintiva a ausncia de ducto, por essa razo os hormnios por ela secretados so diretamente lanados corrente sangnea. Existem 6 glndulas endcrinas de grande importncia no funcionamento do organismo e outras de menor relevncia. Sobre essas 6 glndulas endcrinas, julgue os itens. ( ) Uma das funes da hipfise anterior ou adeno hipfise secretar o hormnio de crescimento. ( ) A glndula tireide, situada na parte interior do esfago, tem como funo a produo de FSH e LH. ( ) O pncreas contm milhares de ilhotas de Langerhans. Estas ilhotas so constitudas por vrios tipos celulares, entre elas as clulas alfa relacionada secreo de glucagon e as clulas beta, ligadas secreo de insulina. VFV 1385. O hormnio responsvel pelo aumento da concentrao de glicose no sangue a) a epinefrina. b) a ocitocina. c) a insulina. d) a tiroxina. e) o glucagon. [E] 1386. comum ouvir expresses como estas: "Meu corao disparou", "Fiquei to nervoso que comecei a suar", "Senti a boca seca". Estas reaes so caractersticas de um estado emocional alterado, e so controladas sob a ao do(s): a) sistema nervoso autnomo. b) sistema nervoso somtico. c) hormnios da tireide. d) nervos do cerebelo. e) centro nervoso medular. [A] 1387. A concentrao de glicose no sangue depende da atuao de dois hormnios, como mostra o esquema a seguir:

1389. O aumento da glndula tireide, acarreta uma doena muito comum chamada bcio. Esta doena relaciona-se com a falta de: a) ferro; b) clcio; c) fluor; d) iodo; e) enxofre. [D] 1390. A eliminao do excesso de acar pela urina chama-se: a) tetania. b) doena de Addison. c) cretinismo. d) diabete. e) nanismo. [D] 1391. A glndula__________se localiza na regio do pescoo, na frente da traquia, sendo responsvel pela produo do hormnio __________, cuja funo __________. O aumento do volume dessa glndula conhecido como__________. Assinale a alternativa que preenche correta e respectivamente as lacunas do texto: a) tireide; FSH; o controle do crescimento; diabetes b) hipfise; ACTH; a estimulao das supra-renais; bcio c) tireide; tiroxina; o controle do metabolismo; bcio d) adrenal; insulina; o controle da taxa de glicose; diabetes e) paratireide; TSH; o controle do metabolismo de clcio; tetania [C] 1392. Glndula endcrina localizada no pescoo e responsvel, atravs de seus hormnios, pela regulao do metabolismo do corpo humano. O texto refere-se (ao) a) tiride. ) pncreas. c) hipfise. d) paratiride. e) timo. [A] 1393. O iodo um elemento qumico abundante em alimentos como os frutos-domar. Esse elemento essencial para a produo dos hormnios da glndula endcrina denominada a) pncreas. b) ovrio. ) tiride. d) hipfise. e) timo. [C] 1394. A regulao das concentraes dos elementos qumicos sdio e cloro desempenhado pelos mineralocorticides. Aldosterona um exemplo destes hormnios produzidos pela(s) a) ilhotas pancreticas. b) hipfise. c) glndulas paratirides. d) glndulas adrenais. e) tiride. [D] 1395. A glndula endcrina responsvel pela regulao do nvel de clcio e fsforo no sangue humano (so) a) as paratirides. b) os ovrios. c) as supra-renais. d) a hipfise. e) o timo. [A] 1396. As glndulas so estruturas formadas por agrupamentos de clulas epiteliais que se multiplicam e penetram no tecido conjuntivo subjacente. Como exemplos de glndulas excrinas, mescrinas e endcrinas temos, respectivamente: a) Salivares, Hipfise e Sebceas b) Salivares, Pncreas e Tireide c) Tireide, Fgado e Hipfise d) Sebceas, Pncreas e Salivares e) Sebceas, Hipfise e Fgado [B] 1397. Assinale a opo que indica os hormnios que atuam na liberao do vulo (ovcito secundrio): a) ocitocina e estradiol b) estradiol e progesterona c) progesterona e folculo estimulante d) luteinizante e gonadotrofina e) folculo estimulante e luteinizante [E] 1398. Ces a que se extraram o pncreas passaram a apresentar sintomas similares aos do diabetes humano. Com o duto pancretico amarrado, apenas distrbios digestivos. A experincia nos permite concluir que: a) o pncreas apresenta a funo de glndula digestiva com exclusividade. b) a funo primordial do pncreas em ces secretora. c) tanto a funo digestiva como a funo hormonal so funes inerentes ao pncreas. d) o diabetes humano pode ser causado por leses no duto pancretico. e) o pncreas responsvel pela produo de gastrina. [C] 1399. A reabsoro de gua pelos rins regula a osmorregularidade do sangue, graas ao de um hormnio produzido pela hipfise. Esse hormnio : a) somatotrofina. b) epinefrina.

Estes hormnios, representados pelas letras A e B, so respectivamente: a) insulina e glucagon. b) insulina e adrenalina. c) adrenalina e glucagon. d) adrenalina e insulina. e) glucagon e insulina. [A] 1388. Se uma pessoa leva um susto, seus vasos sangneos se contraem (fica branca) e seu corao acelera os batimentos (dispara). Isto acontece porque: a) as glndulas supra-renais liberam no sangue uma grande quantidade de adrenalina b) o pncreas libera no sangue uma grande quantidade de insulina c) o pncreas libera no duodeno uma grande quantidade de suco pancretico d) as glndulas sudorparas se contraem repentinamente e) a hipfise libera no sangue uma grande quantidade de hormnio gonadotrpico [A]

123 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) secretina. d) hormnio antidiurtico. e) hormnio luteinizante. [D] 1400. A remoo de um rgo de um animal reduziu a capacidade de digerir lipdios, protenas e amido e provocou aumento da taxa de glicose no sangue. Esse rgo a) a glndula adrenal. b) o pncreas. c) a tireide. d) a paratireide. e) a hipfise. [B] 1401. O hormnio feminino responsvel pela ovulao denomina-se a) progesterona. b) estrgeno. c) testosterona. d) folculo estimulante (FSH). e) luteinizante (LH). [E] 1402. Os recentes avanos da Biotecnologia tm permitido a produo dos chamados Anticorpos Monoclonais, cujas aplicaes se ampliam, j movimentando um mercado gerador de centenas de milhes de dlares anuais. Uma das utilizaes mais freqentes se relaciona pesquisa da gonadotrofina corinica no sangue. Tal tcnica permite a deteco desta substncia, mesmo quando presente em pequenas concentraes. A presena da gonadotrofina no sangue humano representa: a) Diagnstico positivo para Hipertiroidismo. b) Diagnstico positivo para Hipotiroidismo. c) Diagnstico negativo para Hiperglicemia. d) Diagnstico positivo para Pancreatite. e) Diagnstico positivo para Gravidez. [E] 1403. A secreo do hormnio de crescimento STH produz quais dos seguintes efeitos? a) liplise amenta, absoro clcio aumenta e sntese protica diminui. b) liplise aumenta, absoro clcio aumenta e sntese protica amenta. c) liplise diminui, absoro clcio diminui, sntese protica diminui. d) liplise diminui, absoro clcio amenta e sntese prottica amenta. e) liplise aumenta, absoro clcio diminuiu, sntese protica diminuiu. [B] 1404. "Suave caminho de volta ao sono natural" Novas pesquisas condenam o uso de comprimidos de melatonina e mdicos defendem a receita tradicional contra insnia: medidas antiestresse e dieta sem cafena. (MARINHO, Antnio, In: O Globo, Jornal da Famlia, 25/08/96) O texto produzido alerta para o uso indiscriminado e abusivo de melatonina como medicamento. Esta substncia normalmente produzida pelo organismo e tem efeito sobre vrios rgos e sistemas. Seus nveis de concentrao so finamente regulados para as diferentes situaes biolgicas. Havendo interferncia externa neste processo de "feedback", podem ocorrer alteraes orgnicas indesejveis. A melatonina produzida na: a) pineal b) hipfise c) tireide d) paratireide e) adrenal [A] 1405. " (...) At a menopausa, as mulheres contam com uma proteo natural inexistente no metabolismo masculino. ................ - o hormnio sexual produzido nos ovrios. Sua presena no sangue reduz os nveis de colesterol "ruim" (o LDL e o VLDL), aumenta os de colesterol "bom" (HDL) e ajuda a preservar a parte interna das artrias." Assinale a alternativa que preenche corretamente a lacuna do texto. a) a aldosterona b) a insulina c) a testosterona d) a adrenalina e) o estrgeno [E] 1406. O esquema a seguir faz parte do ciclo menstrual humano:

Considerando-se os hormnios I, II, III e IV e suas funes, podemos afirmar corretamente: Observe: FSH = hormnio folculo estimulante LH = hormnio luteinizante a) I o LH, II o FSH b) III e IV agem sobre o tero c) II o chamado hormnio da gestao d) I progesterona e IV o estrgeno [B] 1407. Associe os hormnios da coluna superior com as glndulas que os produzem, apresentadas na coluna inferior. I - paratirina II - aldosterona III - glucagon IV - ocitocina V - somatotrfico VI - triiodotironina ( ) hipfise ( ) tireide ( ) paratireides ( ) supra-renais ( ) pncreas A seqncia correta da coluna inferior : a) I, II, III, IV, V b) IV, VI, I, II, III c) V, VI, I, II, III d) V, VI, I, IV, III e) VI, V, IV, III, II [C] 1408. O estresse, a chamada doena do sculo, no exclusiva da espcie humana. Certamente voc j viu algumas fmeas defendendo seus filhotes, um animal em fuga de um predador ou ainda um animal acuado e que deve enfrentar o agressor para sobreviver. Essas situaes tpicas de estresse esto associados ao seguinte par de fatores. a) atropina sistema nervoso parassimptico. b) adrenalina sistema nervoso simptico. c) adrenalina sistema nervoso somtico. d) noradrenalina sistema nervoso central. e) noradrenalina sistema nervoso somtico. [B] 1409. Relacione o hormnio sua funo: 1. Testosterona 2. Ocitocina 3. Insulina 4. Somatotrfico 5. Estrgeno ( ) estimula o crescimento. ( ) estimula a contrao de musculatura uterina. ( ) responsvel pelos caracteres sexuais masculinos. ( ) regula a taxa de glicose. ( ) responsvel pelos caracteres sexuais femininos e pelo desenvolvimento da parede uterina. Marque a alternativa que contm a seqncia CORRETA encontrada: a) 1, 2, 3, 4 e 5. b) 4, 2, 1, 3 e 5. c) 2, 4, 3, 5 e 1. d) 1, 4, 5, 3 e 2. e) 3, 1, 4, 5 e 2. [B] 1410. O hormnio ADH atua sobre os tbulos renais promovendo absoro de gua do filtrado glomerular. A deficincia na secreo desse hormnio faz com que a pessoa produza a) muita urina, com alta concentrao de excrees. b) muita urina, com baixa concentrao de excrees. c) pouca urina, com alta concentrao de excrees. d) pouca urina, com baixa concentrao de excrees. e) quantidade normal de urina, com alta concentrao de excrees. [B] 1411. Esta tabela contm os valores de alguns hormnios, dosados no sangue de uma mulher, e os intervalos de valores considerados normais, expressos em unidades internacionais.

124 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) I [D]

b) I e II

c) II e III d) I e III

1416. Assinale a alternativa que associa corretamente uma glndula endcrina com um dos seus respectivos hormnios e o principal problema causado pela deficincia do mesmo. a) Hipfise: secreta o ADH (hormnio antidiurdico), cuja deficincia causa excesso de acar no sangue. b) Pncreas: secreta insulina, cuja deficincia causa diabete melito. c) Tireide: secreta tiroxina, cuja deficincia causa ativao do metabolismo. d) Adrenal: secreta paratormnio, cuja deficincia causa tetania muscular. e) Ovrios: secreta progesterona, cuja deficincia causa ausncia dos caracteres sexuais femininos. [B] Entre os possveis distrbios que a mulher pode apresentar NO se inclui a) a alterao do ciclo menstrual. b) a disfuno hipofisria. c) o aumento da diurese. d) o aumento do metabolismo basal. [D] 1412. Sabe-se que populaes de regies do Brasil Central tm, como principal fonte de iodo, o sal de cozinha. Amostras de sal refinado, analisadas recentemente pelo Instituto Adolfo Lutz de So Paulo, mostraram ndices de iodo muito inferiores aos exigidos pela legislao brasileira. Entre os distrbios provocados pela utilizao prolongada desse tipo de sal pela populao NO se inclui a) a deficincia mental nas crianas. b) o aumento do metabolismo. c) o atraso do crescimento das crianas. d) o crescimento excessivo da tireide. [B] 1413. So exemplos de glndulas excrinas e endcrinas, respectivamente, a(s): a) tireide e as paratireides. b) hipfise e as sebceas. c) salivares e a tireide. d) sudorparas e as mamrias. e) adrenais e a tireide. [C] 1414. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos. Foi encontrado o dirio de um naturalista, em que ele descreve os padres de sobrevivncia, crescimento corpreo e crescimento populacional de uma espcie de sabi e de uma de tatuzinho-de-jardim, representados respectivamente na figura a seguir pelos nmeros I e II, em um ecossistema preservado. Alguns desses dados esto representados graficamente adiante: Considere S = sobrevivncia 1417. Os grficos mostrados na figura abaixo representam as variaes nos nveis dos hormnios hipofisrios e ovarianos durante o ciclo menstrual da mulher.

Com o auxlio dos grficos, julgue os seguintes itens. (1) O primeiro dia do ciclo menstrual corresponde ao primeiro dia da menstruao. (2) O aumento da taxa de FSH induz o desenvolvimento dos folculos ovarianos. (3) No momento da ovulao, as taxas de estrgenos e de LH esto elevadas. (4) Os grficos ilustram a situao que ocorre em mulheres que esto sob efeito de plulas anticoncepcionais. CCCE . Produzido pelo hipotlamo e eliminado na circulao sangnea pelo lobo posterior da hipfise, o hormnio ADH ir atuar: a) na bexiga. b) na uretra e na bexiga. c) no bacinete. d) nos ureteres e na uretra. e) nos tbulos contornados distais. [E] . Observe o desenho a seguir, que representa um corpo humano com a indicao de algumas glndulas.

Com base nos grficos anteriores, correto afirmar: 01) Na curva de crescimento populacional do sabi, observa-se a existncia de mecanismos controladores internos na populao (crescimento autolimitante). 02) Na curva do crescimento corpreo do tatuzinho-de-jardim, os intervalos marcados com B correspondem a perodos subseqentes muda do exoesqueleto quitinoso. 04) Os padres de crescimento corpreo do sabi e do tatuzinho-de-jardim so similares. 08) Pela anlise das curvas de sobrevivncia, o sabi apresenta alta mortalidade no perodo inicial do cicio de vida, ao contrrio do tatuzinho-de-jardim, que apresenta baixa mortalidade nesse mesmo perodo. 02 1415. Observe as assertivas a seguir, relativas a alguns hormnios com o seu respectivo efeito principal: I - PROLACTINA: Estimula a produo de leite nas glndulas mamrias. II - TESTOSTERONA: Estimula os caracteres primrios femininos. III - ADRENALINA: Aumenta a presso arterial e o ritmo cardaco. So assertivas corretas somente:

A disfuno das glndulas indicadas com as letras A, B, C e D pode acarretar, respectivamente, a) nanismo, taquicardia, cretinismo e diabetes. b) cretinismo, bcio, nanismo e diabetes. c) gigantismo, bcio, diabetes e taquicardia. d) nanismo, bcio, taquicardia e diabetes. e) cretinismo, gigantismo, diabetes e taquicardia. [D] . O esquema adiante contm dados sobre a funo endcrina na mulher.

125 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Com base nesse esquema, correto afirmar: ( ) A glndula X, ou hipfise, produz, entre outros, o hormnio H1, ou adrenocorticotrpico (ACTH). ( ) O ovrio produz H2 ou estrgeno, se for estimulado pelo hormnio folculoestimulante (FSH), proveniente da glndula X. ( ) O hormnio luteinizante (LH) capaz de manter a produo de progesterona pelo corpo lteo ovariano. ( ) A glndula Z, ou adrenal, pode liberar tambm a adrenalina, um hormnio importante no preparo do organismo para reaes de alarme e fuga. ( ) A descamao da parede interna uterina, ou menstruao, devida unicamente a uma queda nos nveis plasmticos de estrgeno. ( ) Altos nveis plasmticos dos hormnios tireoidianos levam a uma reduo na produo do hormnio estimulante da tireide (TSH) por X, fenmeno denominado retroalimentao negativa e essencial na homeostase do organismo. ( ) O funcionamento altamente integrado do sistema endcrino permite respostas mais rpidas se comparadas quelas mediadas pelo sistema nervoso. VVVVFVF 1421. Matria publicada em jornal dirio discute o uso de anabolizantes (apelidados de "bombas") por praticantes de musculao. Segundo o jornal, os anabolizantes so hormnios que do uma fora extra aos msculos. Quem toma consegue ganhar massa muscular mais rpido que normalmente. Isso porque uma pessoa pode crescer at certo ponto, segundo sua herana gentica e independentemente do quanto ela se exercite. Um professor de musculao diz: "Comecei a tomar bomba por conta prpria. Ficava nervoso e tremia. Fiquei impotente durante uns seis meses. Mas como sou lutador de vale-tudo, tenho que tomar". A respeito desta matria, dois amigos fizeram os seguintes comentrios: I. O maior perigo da auto-medicao seu fator anabolizante, que leva impotncia sexual. II. O crescimento corporal depende tanto dos fatores hereditrios quanto do tipo de alimentao da pessoa, se pratica ou no esportes, se dorme as 8 horas dirias. III. Os anabolizantes devem ter mexido com o sistema circulatrio do professor de musculao, pois ele at ficou impotente. IV. Os anabolizantes so mais perigosos para os homens, pois as mulheres, alm de no correrem o risco da impotncia, so protegidas pelos hormnios femininos. Tomando como referncia as informaes da matria do jornal e o que se conhece da fisiologia humana, pode-se considerar que esto corretos os comentrios: a) I, II, III e IV. b) I, II e IV, apenas. c) III e IV, apenas. d) II e III, apenas. e) I, II e III, apenas. [D] 1422. Um estudante leu uma reportagem a respeito de uma mulher norteamericana que cometeu um crime, mas foi absolvida por apresentar tenso prmenstual (TPM). Interessado no assunto, o estudante leu que a TPM afeta 35% das mulheres em idade reprodutiva e que seus sintomas mais freqentes so irritabilidade, ansiedade, tenso, depresso, fadiga, choro fcil, cansao e dor nas mamas. Os sintomas psquicos da TPM parecem estar relacionados a uma diminuio da serotonina, uma substncia neurotransmissora, em resposta s alteraes dos hormnios sexuais. O aumento da serotonina, por sua vez, pode acontecer pela prtica de exerccios fsicos. Os sintomas fsicos da TPM parecem estar relacionados com as alteraes hormonais tpicas da segunda metade do ciclo menstrual.

FIGURA I - Alteraes hormonais hipofisrias e ovarianas no decorrer do ciclo menstrual. FIGURA II - Concentrao relativa dos hormnios excretados na urina da mulher no decorrer da gravidez (Figuras adaptadas de Amabis e Martho. BIOLOGIA E SADE HUMANAS. p. 101-3.) Com o auxlio das informaes obtidas pelo estudante, julgue os itens abaixo. (1) Logo aps a ovulao, ocorre um aumento dos nveis de progesterona. (2) As alteraes dos nveis de estrgenos que ocorrem antes da menstruao ou logo aps o parto, ilustradas nas figuras I e II, podem levar a mulher a estados de depresso. (3) A reposio hormonal pode aliviar problemas de depresso para a mulher em menopausa. (4) Os nveis de hormnios produzidos pelos ovrios so controlado pelo sistema nervoso. (5) Inexiste correlao entre a produo de substncias neurotransmissoras e a produo do hormnio LH. VVVVF 1423. Um estudante leu uma reportagem a respeito de uma mulher norteamericana que cometeu um crime, mas foi absolvida por apresentar tenso prmenstual (TPM). Interessado no assunto, o estudante leu que a TPM afeta 35% das mulheres em idade reprodutiva e que seus sintomas mais freqentes so irritabilidade, ansiedade, tenso, depresso, fadiga, choro fcil, cansao e dor nas mamas. Os sintomas psquicos da TPM parecem estar relacionados a uma diminuio da serotonina, uma substncia neurotransmissora, em resposta s alteraes dos hormnios sexuais. O aumento da serotonina, por sua vez, pode acontecer pela prtica de exerccios fsicos. Os sintomas fsicos da TPM parecem estar relacionados com as alteraes hormonais tpicas da segunda metade do ciclo menstrual.

FIGURA I - Alteraes hormonais hipofisrias e ovarianas no decorrer do ciclo menstrual. FIGURA II - Concentrao relativa dos hormnios excretados na urina da mulher no decorrer da gravidez (Figuras adaptadas de Amabis e Martho. BIOLOGIA E SADE HUMANAS. p. 101-3.) Em relao ao texto e s figuras, julgue os itens que se seguem. (1) Por serem estimulantes, o caf, o lcool e o fumo podem diminuir os sintomas da TPM. (2) As dores nas mamas, referidas no texto e possivelmente causadas por maior reteno de gua, podem ser atenuadas pela ingesto de alimentos salgados. (3) Os hormnios estrgeno e FSH esto em altas concentraes no sangue de mulheres em perodos frteis. (4) O pico de gonadotrofina corinica mostrado na figura II comumente observado nas mulheres que utilizam plulas anticoncepcionais. FFFF 1424. Analise as frases a seguir. I. As clulas que revestem o folculo de Graaf, antes da maturao do vulo, produzem o hormnio 1, estimuladas pelo hormnio 2 da hipfise. II. Aps a ovulao, forma-se o corpo lteo por estmulo do hormnio 3 da hipfise. III. O corpo lteo secreta o hormnio 4.

126 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Os hormnios 1, 2, 3 e 4 so, respectivamente: a) progesterona, hormnio folculo estimulante, hormnio luteinizante e estrgeno. b) hormnio folculo estimulante, estrgeno, progesterona e hormnio luteinizante. c) hormnio folculo estimulante, progesterona, estrgeno e hormnio luteinizante. d) estrgeno, progesterona, hormnio folculo estimulante e hormnio luteinizante. e) estrgeno, hormnio folculo estimulante, hormnio luteinizante e progesterona. [E] 1425. O grfico abaixo representa as variaes de determinados hormnios no sangue de um animal durante alguns dias.

glandular. Assinale a alternativa que apresenta o nome da glndula que produz o hormnio de crescimento: a) Pncreas. b) Hipfise. c) Tireide. d) Rim. e) Fgado. [B] 1430. Na urina de uma mulher foi verificada a presena de gonadotrofina corinica. Essa substncia indica que a mulher a) est menstruada. b) est grvida. c) tem diabetes. d) tem falta de clcio. e) tem metabolismo basal baixo. [B] 1431. Assinale a(s) alternativa(s) em que a relao GLNDULA, PRODUTO e FUNO est(o) correta(s). 01. tireide - calcitonina - dificulta a remoo de clcio de ossos. 02. hipotlamo - tiroxina - estmulo nervoso. 04. crtex da supra-renal - adrenalina - metabolismo da glicose. 08. medula da supra-renal - cortisol - vasoconstrio. 16. pncreas - insulina - reduz concentrao de glicose no sangue. 32. paratireide - antidiurtico - vasoconstrio. 64. adeno-hipfise - adrenocorticotrfico - estimula o crtex da adrenal. VFFFVFV

a) A que classe de vertebrado deve pertencer esse animal? b) Identifique os eventos ocorridos nos momentos indicados pela: b1) seta I. b2) seta II. c) Suponha a administrao de alta dose de progesterona e estrognio na corrente sangnea desse animal antes do incio do ciclo. Como conseqncia disso, o que aconteceria com as taxas de: C1) FSH? C2) LH? a) Mamferos. B1) Ovulao. B2) Nidao; implantao de embrio no tero; formao de placenta (qualquer um deles). C1) Diminuiria. C2) Diminuiria. 1426. O clcio desempenha papel importante em vrios processos fisiolgicos do homem. Por isso, indispensvel a manuteno dos nveis plasmticos de clcio em estreitos limites, o que ocorre com a participao de alguns hormnios. Acerca do exposto acima, pode-se afirmar: a) A diminuio da concentrao plasmtica de clcio um fator de estmulo para a liberao de calcitonina pelas clulas parafoliculares da tireide. b) A diminuio da concentrao plasmtica de clcio um fator de estmulo para a liberao do paratormnio pelas paratireides. c) A elevao da concentrao plasmtica de clcio um fator de estmulo para a liberao de triiodotironina e tiroxina pela tireide. d) A elevao da concentrao plasmtica de clcio um fator de estmulo para a liberao de aldosterona pelo crtex das adrenais. e) A diminuio da concentrao plasmtica de clcio um fator de estmulo para a liberao de adrenalina pela medula das adrenais. [B] 1427. A produo do hormnio luteinizante estimula as clulas intersticiais ou de "Leydig" a liberar um hormnio que, por sua vez, responsvel pela manuteno dos caracteres sexuais. Qual das alternativas a seguir, corresponde, corretamente ao que est descrito no texto? a) A HIPFISE produz o HORMNIO LUTEINIZANTE que estimula os TESTCULOS a produzirem TESTOSTERONA. b) Os TESTCULOS produzem o HORMNIO LUTEINIZANTE que estimula a HIPFISE a produzir ESTRGENO. c) O HORMNIO LUTEINIZANTE estimula os TESTCULOS a produzirem ESTRGENO que estimula a HIPFISE. d) O HORMNIO LUTEINIZANTE estimula os OVRIOS a produzirem PROGESTERONA que estimula a HIPFISE. e) O HIPOTLAMO produz o HORMNIO LUTEINIZANTE que estimula a HIPFISE a produzir TESTOSTERONA. [A] 1428. As plulas anticoncepcionais femininas possuem substncias que: a) provocam a morte dos espermatozides na entrada do colo do tero. b) inibem o batimento flagelar dos espermatozides. c) tornam a parede do vulo impenetrvel para o espermatozide. d) provocam o fechamento das tubas uterinas. e) impedem a ocorrncia do fenmeno da ovulao. [E] 1429. O homem cresce, de um modo geral, at prximo aos 20 anos. O crescimento em altura do indivduo coordenado, principalmente, por atividade

1432. O esquema adiante representa, de maneira simplificada, as inter-relaes do sistema nervoso. Assinale a alternativa correta em relao anlise desse esquema:

a)1 representa uma fibra sensorial do sistema nervoso somtico. b) 2 representa uma fibra motora do sistema nervoso simptico c) 1 e 4 representam fibras motoras do sistema nervoso autnomo. d) 3 e 4 representam fibras do sistema nervoso autnomo. e) 3 representa uma fibra motora e 4 uma fibra sensorial. [D] 1433. Dendritos so estruturas que a) transmitem o impulso para outras clulas nervosas ou para rgos efetores. b) nascem do corpo celular por uma regio piramidal. c) so clulas em cujas terminaes h liberao de mediadores qumicos responsveis pelas sinapses. d) so prolongamentos dos neurnios que conduzem o impulso nervoso para o corpo celular. e) contm em seu interior o axnio. [D] 1434. Um indivduo, aps sofrer leso em seu cerebelo poder desempenhar todas as funes a seguir, EXCETO: a) lembrar-se do nome de um amigo. b) retirar a mo, se espetada por um alfinete. c) resolver, mentalmente um problema matemtico. d) pular corda. e) ouvir msica. [D] 1435. Se uma pessoa sofrer leso no hipotlamo, de se esperar que apresente problemas de a) memria e inteligncia. b) mastigao, deglutio, fonao. c) coordenao motora, postura e equilbrio. d) viso, audio e olfato. e) temperatura corporal, sono e apetite. [E] 1436. No homem, o controle dos movimentos respiratrios exercido: a) pelo crebro. b) pelo cerebelo. c) pelo bulbo. d) pela medula. e) pela hipfise. [C] 1437. Qual dos seguintes comportamentos envolve maior nmero de rgos do sistema nervoso? a) Salivar ao sentir o aroma de comida gostosa.

127 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) Levantar a perna quando o mdico toca com martelo no joelho do paciente. c) Piscar com a aproximao brusca de um objeto. d) Retirar bruscamente a mo ao tocar um objeto muito quente. e) Preencher uma ficha de identificao. [E] 1438. Foram feitas trs afirmaes com relao evoluo do sistema nervoso dos invertebrados. Julgue-as. I - Verifica-se uma centralizao e cefalizao j nos Porferos (Espongirios). II - As medusa so os primeiros invertebrados a apresentarem centralizao do sistema nervoso. III - Aneldeos e Artrpodes possuem sistema nervoso ganglionar em posio ventral. Est(o) correta(s) a(s) afirmativa(s): a) I e II b) II e III c) I e III d) II e) III [E] 1439. Foi seccionada uma rea do sistema nervoso de um mamfero. Em seguida, constatou-se que o referido animal no manteve seu equilbrio corpreo, permanecendo deitado no cho. A rea seccionada em questo faz parte: a) do bulbo. b) do cerebelo. c) do hipotlamo. d) das meninges. e) do sistema nervoso autnomo. [B] 1440. A figura a seguir mostra os componentes de um arco reflexo.

d) N2 e cerebelo. [C]

e) CO2 e cerebelo.

1445. Todas as alternativas apresentam modalidades j verificadas de interao de seres vivos com o meio ambiente, EXCETO a) A capacidade de certos peixes se defenderem com campo eltrico. b) A orientao das abelhas pela posio do sol. c) A orientao dos morcegos por ultra-som. d) A percepo pelas cobras da radiao infravermelha emitida por presas. e) A viso estereoscpica em anfbios. [E] 1446. Rede nervosa e gnglios nervosos constituem dois tipos primitivos de sistema nervoso encontrados, respectivamente, em a) esponja e sanguessuga. b) hidra e planria. c) lombriga e caracol. d) minhoca e medusa. e) paramcio e borboleta. [B] 1447. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Sobre os processes fisiolgicos: ( ) a circulao nos peixes fechada, simples e completa, enquanto nos anfbios dupla e incompleta, com mistura de sangue arterial e venoso; no homem, fechada, dupla e completa; ( ) nos rins, a reabsoro tubular um processo passivo para todas as substncias, exceto gua, sendo controlada pelo ADH (hormnio antidiurtico); ( ) no arco reflexo, a resposta motora a um estmulo no depende da percepo consciente; ( ) a hematose um processo que ocorre nos alvolos pulmonares; ( ) o FSH (hormnio folculo estimulante) estimula o amadurecimento do folculo, o qual produz estrgenos, que estimulam a produo de FSH, num exemplo de retroalimentao negativa. VFVVF 1448. O sentido da audio formado por mecanorreceptores. Alm de "ouvir sons", o ouvido tambm responsvel por: a) olfato b) equilbrio c) gustao d) tato e) viso [B]

No esquema anterior, o neurnio de associao e o corpo celular do neurnio sensorial esto localizados, respectivamente a) na substncia cinzenta e no gnglio. b) na substncia cinzenta e na raiz ventral. c) no gnglio e na raiz ventral. d) no gnglio e na substncia cinzenta. e) na raiz ventral e no gnglio. [A] 1441. Vegetais e animais possuem clulas que, mesmo sendo estruturalmente diferentes, apresentam as mesmas funes. No entanto, existe um tipo celular que desempenha uma funo que exclusiva dos animais. Esta funo de: a) reproduo. b) sustentao. c) secreo glandular. d) conduo de lquidos internos. e) conduo de estmulos nervosos. [E] 1442. Os anestsicos, largamente usados pela Medicina, tornam regies ou todo o organismo insensvel dor porque atuam: a) nos axnios, aumentando a polarizao das clulas. b) nas sinapses, impedindo a transmisso do impulso nervoso. c) nos dendritos, invertendo o sentido do impulso nervoso. d) no corpo celular dos neurnios, bloqueando o metabolismo. e) na membrana das clulas, aumentando a bomba de sdio. [B] 1443. Em relao evoluo do sistema nervoso dos invertebrados so feitas as afirmaes a seguir: I) Ocorre uma centralizao e uma cefalizao medida que animal se torna mais complexo. II) A maioria desses animais apresenta tubo nervoso de localizao ventral. III) As medusas so os primeiros animais a terem um controle central de mensagens. Est(o) correta(s) a(s) afirmativa(s): a) apenas I. b) apenas I e II. c) apenas I e III. d) apenas II e III. e) I, II e III. [B] 1444. "As alteraes no ritmo dos movimentos respiratrios, que ocorrem durante a realizao de atividades fsicas intensas, devem-se influncia da concentrao elevada de ........(I)........ sobre o ........(II)........." Para completar corretamente a frase anterior, deve-se substituir I e II, respectivamente, por a) O2 e bulbo. b) CO e bulbo. c) CO2 e bulbo.

1449. O sistema nervoso autnomo dividido em simptico e parassimptico. Os hormnios que atuam controlando as atividades de ambos so, respectivamente: a) insulina e adrenalina b) adrenalina e glucagon c) tiroxina e acetilcolina d) glucagon e adrenalina e) adrenalina e acetilcolina [E] 1450. A labirintite uma inflamao e um de seus principais sintomas so distrbios de equilbrio como a tontura, que impede a pessoa de se locomover e at mesmo de se levantar. Assinale a alternativa que apresenta a estrutura afetada. a) cclea b) canais semicirculares c) cerebelo d) janela oval e) trompa de Eustquio [B] 1451. Examine a seguinte lista de eventos que ocorrem durante a propagao de um impulso nervoso: I. Neurotransmissores atingem os dendritos. II. Neurotransmissores no liberados pelas extremidades do axnio. III. O impulso se propaga pelo axnio. IV. O impulso se propaga pelos dendritos. V. O impulso chega ao corpo celular. Que alternativa apresenta a seqncia temporal correta desses eventos? a) V - III - I - IV - II b) I - IV - V - III - II c) I - IV - III - II - V d) II - I - IV - III - V e) II - III - I - IV V [B] 1452. Os esquemas a seguir mostram, de forma simplificada, a conduo do impulso nervoso:

128 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) cerebelo; CO2; carboemoglobina c) bulbo; CO2; bicarbonato d) cerebelo; O2; oxiemoglobina e) crebro; CO2; bicarbonato [C] 1458. Em alguns acidentes em provas automobilsticas, tm-se dado como causa de leses srias ou morte do piloto a desacelerao violenta sofrida pelo encfalo, mesmo que no haja fratura da caixa craniana. Porm, h um mecanismo de proteo do encfalo, responsvel por absorver os choques mecnicos, exercido: a) pelas meninges. b) pelo lqido cefalorraquidiano. c) somente pela aracnide. d) tanto pela aracnide como pela dura-mter. e) somente pela dura-mter. [B] 1459. O sentido do tato proporcionado pela presena de corpsculos neuroepiteliais situados nas estruturas da pele e das mucosas. Os corpsculos que percebem as sensaes de frio e presso, nessa ordem, denominam-se: a) Ruffini e Krause b) Ruffini e Vater-Paccini c) Ruffini e Meissner d) Krause e Vater-Paccini e) Krause e Meissner [D] 1460. A observao do desenho a seguir nos permite concluir que, na passagem do impulso nervoso pelas sinapses, ocorre:

Sabe-se que, no neurnio em repouso, h grande quantidade de ons sdio no meio externo e de potssio no meio interno (1). No momento em que o estmulo nervoso se propaga (2), ocorre alterao de permeabilidade da membrana com intensa entrada de Na e discreta sada de K, o que leva o meio interno a ficar "positivo" e o meio externo a ficar "negativo". Aps a passagem do estmulo (3), normaliza-se a permeabilidade da membrana e a situao inicial retomada. Assinale a alternativa incorreta com relao ao mecanismo acima descrito: a) esse mecanismo no depende de consumo de ATP (energia) para se realizar. b) esse mecanismo depende do processo de respirao celular para se realizar. c) nesse mecanismo, est envolvido movimento de entrada e de sada de ons do neurnio. d) nesse mecanismo, constata-se a existncia de transporte ativo de ions. e) nesse mecanismo, constata-se inverso do estado eltrico da membrana do neurnio. [A] 1453. A noo de equilbrio e postura do corpo nos fornecida: a) pela janela oval do ouvido interno; b) pelos canais semicirculares do ouvido mdio; c) pelo estribo do ouvido mdio; d) pelos canais semicirculares do ouvido interno; e) pelo estribo do ouvido interno. [D] 1454. O cerebelo, rgo do Sistema Nervoso Central, responsvel - entre outras funes - pela a) viso. b) coordenao motora. c) salivao. d) cor da pele. e) audio. [B] 1455. A unidade estrutural e funcional do Sistema Nervoso humano (so) a) as fibras estriadas. b) os glomrulos. c) os hepatcitos. d) os neurnios. e) as hemceas. [D] 1456. O grfico a seguir mostra a variao do potencial da membrana do neurnio quando estimulado.

a) a liberao de mediadores qumicos ou de neurormnios. b) o contato direto do axnio de uma clula com os dendritos de outra clula. c) o fenmeno da bomba de sdio e potssio entre as clulas. d) a troca de cargas eltricas ao nvel das sinapses. e) o envolvimento da bainha de mielina, que atua como um isolante eltrico. [A] 1461. Uma doena degenerativa do cerebelo humano provocar alteraes, provavelmente, a) nos movimentos respiratrios. b) no equilbrio do corpo. c) na memria e no raciocnio. d) na viso e na audio e) nos batimentos cardacos. [B] 1462. Para que um impulso nervoso possa ser transmitido de um neurnio a outro, necessria a liberao, na fenda sinptica, de mediadores qumicos. Um desses mediadores a a) insulina. b) tirosina. c) vasopressina. d) acetilcolina. e) histamina. [D] 1463. O ritmo respiratrio, que depende da quantidade de determinado gs no sangue, controlado pelo bulbo. Desta forma, considere as seguintes afirmaes: I - No caso de esforo fsico, h uma diminuio da quantidade de oxignio dissolvido no plasma, percebida pelo bulbo, o que provoca aumento do ritmo respiratrio. II - Por estmulo do bulbo, ocorre contrao do diafragma e conseqente aumento do volume pulmonar, o que fora a entrada de ar. III - O controle exercido pelo bulbo inconsciente. Ento apenas: a) I est correta. b) II est correta. c) I e III esto corretas. d) II e III esto corretas. e) I e II esto corretas. [D] 1464. No esquema a seguir, 1, 2 e 3 so, respectivamente, neurnios

O potencial de ao para. um determinado neurnio: a) varia de acordo com a intensidade do estmulo, isto , para intensidades pequenas temos potenciais pequenos e para maiores, potenciais maiores. b) sempre o mesmo, porm a intensidade do estmulo no pode ir alm de determinado valor, pois o neurnio obedece 'lei do tudo ou nada'. c) varia de acordo com a 'lei do tudo ou nada. d) aumenta ou diminui na razo inversa da intensidade do estmulo. e) sempre o mesmo, qualquer que seja o estmulo, porque o neurnio obedece "lei do tudo ou nada". [E] 1457. O controle da freqncia respiratria humana feito pelo __________ baseado na taxa de __________ sangneo, que transportado principalmente na forma de __________ . Assinale a alternativa que preenche correta e respectivamente os espaos da frase anterior. a) crebro; O2; oxiemoglobina

129 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) motor, associativo e sensorial. b) sensorial, motor e associativo. c) sensorial, associativo e motor. d) motor, sensorial e associativo. e) associativo, sensorial e motor. [A] 1465. A funo do ndulo sinoatrial no corao humano : a) regular a circulao coronariana. b) controlar a abertura e fechamento da vlvula tricspide. c) funcionar como marcapasso, controlando a ritmicidade cardaca. d) controlar a abertura e fechamento da vlvula mitral. e) controlar a presso diastlica da aorta. [C] 1466. A sinapse : a) um tipo de fibra muscular envolvida no processo de contrao cardaca. b) uma clula sangnea envolvida na liberao de tromboplastina para o processo de coagulao. c) um tipo de reproduo sexuada, que envolve a formao de gametas, realizada por protozorios ciliados. d) uma regio de contato entre a extremidade do axnio de um neurnio e a superfcie de outras clulas. e) um fenmeno que explica o fluxo de seiva bruta em espermatfitas. [D] 1467. Possuem sistema nervoso, EXCETO: a) Agnatos. b) Cnidrios. d) Porferos. e) Moluscos. [D] c) Aneldeos.

a) I - axnio; II - dendritos; III - corpo celular b) I - axnio; II - corpo celular; III - dendritos c) I - dendritos; II - axnio ; III - corpo celular d) I - corpo celular; II - axnio; III - dendritos e) I - corpo celular; II - impulso nervoso; III sinapse [D] 1470. O reflexo patelar ou rotuliano envolve a participao seqencial dos seguintes componentes: a) rgo receptor, via aferente, via eferente e rgo efetor. b) rgo receptor, neurnios associativos e rgo efetor. c) rgo receptor, via aferente, neurnios associativos, via eferente e rgo efetor. d) via aferente e via eferente. e) rgo receptor, neurnios associativos, via eferente e rgo efetor. [A] 1471. Observando o esquema abaixo, que representa um neurnio em repouso, podemos afirmar que, nestas condies:

1468. O filme "O leo de Lorenzo" conta a histria de um menino afetado por uma doena chamada leucodistrofia, que leva a deficincias auditivas, visuais e motoras. Essas deficincias devem-se destruio da bainha de mielina das clulas nervosas. Analise a figura a seguir, referente a uma clula nervosa na qual alguns componentes foram numerados de 1 a 4 Assinale a alternativa que contm o nmero correspondente bainha de mielina.

a) se a membrana do neurnio for atingida por um estmulo, as quantidades de ons Na+ e K+ dentro e fora da membrana se igualam. b) devido diferena de cargas entre as faces externa e interna, o neurnio est polarizado. c) a ocorrncia do impulso nervoso depende de estmulos de natureza eltrica. d) a quantidade de ons K+ menor na parte interna do neurnio devido sua sada por osmose. e) as concentraes dos ons Na+ e K+ se fazem sem gasto de energia, sendo exemplo de transporte ativo. [B] 1472. A figura abaixo mostra como o sistema nervoso regula a movimentao de um membro do corpo humano. Com o auxlio dela, julgue os itens seguintes.

a) 1 [C]

b) 2

c) 3

d) 4

1469. Esto numeradas de I a III, no esquema a seguir as partes fundamentais do neurnio, que so, respectivamente:

(1) Embora a movimentao dos membros seja habitualmente voluntria, a figura mostra um ato reflexo. (2) As setas A e B indicam o sentido de conduo da informao nervosa. (3) O corpo celular do neurnio motor est localizado dentro do sistema nervoso central. (4) O movimento da perna depende da liberao de mediadores qumicos nas sinapses nervosas e neuromusculares.

130 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

CECC 1473. A figura representa um arco-reflexo: o calor da chama de uma vela provoca a retrao do brao e o afastamento da mo da fonte de calor. Imagine duas situaes: em A seria seccionada a raiz dorsal do nervo e em B, a raiz ventral.

Considere as seguintes possibilidades relacionadas transmisso dos impulsos nervosos neste arco-reflexo: I - A pessoa sente a queimadura, mas no afasta a mo da fonte de calor. II - A pessoa no sente a queimadura e no afasta a mo da fonte de calor. III - A pessoa no sente a queimadura, mas afasta a mo da fonte de calor. Indique quais dessas possibilidades aconteceriam na situao A e na situao B, respectivamente, a) A - I; B - II. b) A - I; B - III. c) A - II; B - I. d) A - II; B - III. e) A - III; B - II. [C] 1474. A respeito da sinapse representada abaixo, correto afirmar que:

Com base nesses esquemas, fizeram-se as afirmaes a seguir. I. O sistema nervoso da planria pode ser considerado mais evoludo que o da hidra. II. A hidra possui um centro nervoso, que envia ordens para todas as partes do corpo, enquanto a planria no apresenta centralizao do sistema nervoso. III. O sistema nervoso da hidra difuso e o da planria ganglionar. Dessas afirmaes, somente a) I correta. b) II correta. c) III correta. d) I e III so corretas. e) II e III so corretas. [D] 1477. Segundo a revista britnica New Scientist, a doena "da vaca louca", que se acreditava acometer apenas bovinos, atinge tambm habitantes da Papua, na Nova Guin, afetando clulas do crebro e causando descontrole motor. As figuras numeradas a seguir indicam relaes das clulas do sistema nervoso com outras estruturas.

a) s est presente no sistema nervoso central. b) o impulso nervoso passa de 2 para 1. c) a liberao das substncia presentes em 3 determina a passagem de impulso de um neurnio para outro. d) as substncias presentes em 3 so produzidas exclusivamente nas clulas desse sistema. e) possvel haver contato fsico entre 1 e 2. [C] 1475. O dinitrofenol (DNP) uma substncia que interfere na produo de ATP. Se uma clula receber uma dose dessa substncia, o processo de_______ ser prejudicado e conseqentemente essa clula no poder_______. Assinale a alternativa que preenche correta e respectivamente as lacunas da frase anterior. a) fotossntese; se reproduzir b) respirao celular; gerar impulsos nervosos c) respirao celular; realizar osmose d) fotossntese; realizar difuso e) respirao celular; realizar trocas gasosas [B] 1476. As figuras a seguir esquematizam o sistema nervoso de uma hidra e de uma planria.

A relao existente entre as clulas do sistema nervoso central e aquelas responsveis pela atividade motora, prejudicada quando a referida doena ocorre, est representada na figura de nmero: a) 1 b) 2 c) 3 d) 4 [B] 1478. Podemos analisar a organizao morfofuncional do sistema nervoso dos vertebrados quando observamos a reao do indivduo ao tocar com a mo um objeto muito quente: a musculatura do esqueleto estimulada e ele retrai a mo da fonte de calor. Esse fenmeno pode ser explicado pela atuao dos componentes da seguinte estrutura: a) arco reflexo b) cordo nervoso ventral c) eixo hipotlamo- hipfise d) rede nervosa epidrmica [A] 1479. O vestibular um momento decisivo na vida do estudante, o qual pode apresentar uma certa ansiedade antes e durante as provas. Nesse momento, o organismo sofre intensas alteraes fisiolgicas. Como um exemplo de alterao estimulada pelo sistema nervoso simptico, podese citar a(o): a) contrao da bexiga. b) contrao da pupila. c) diminuio da presso sangnea. d) aumento da freqncia cardaca. e) aumento da peristalse intestinal. [D] 1480. Um motorista infrator, ao dirigir, na Via Costeira, em alta velocidade, perdeu o controle do carro numa curva, sofrendo um acidente. Ao chegar ao prontosocorro, diagnosticou-se uma isquemia cerebral (bloqueio da circulao nas artrias que fornecem sangue ao encfalo) no lobo frontal do crebro. Como conseqncia, poder haver comprometimento da capacidade do motorista para a) piscar sob o estmulo de uma luz intensa. b) salivar ao sentir o aroma de uma comida.

131 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) preencher uma ficha de identificao. d) sentir dor ao encostar num ferro quente. [C] 1481. Um gato com uma leso no cerebelo, ter dificuldade de a) respirar. b) alimentar-se. c) eliminar excretas. d) equilibrar-se. e) produzir anticorpos. [D] 1482. So clulas MAIS DIFERENCIADAS e com MENOR capacidade de reproduo: a) neurnios b) epiteliais de revestimento c) hepatcitos d) fibroblastos [A] 1483. Relacione as estruturas apontadas na figura adiante com as respectivas funes.

no entanto, reproduzem-se rapidamente, embora lancem um pequeno nmero de gametas na gua. A explicao para esse fato que as hidras apresentam um acelerado processo de reproduo: a) assexuada por diviso binria. b) assexuada por esporulao. c) assexuada por brotamento. d) sexuada por autofecundao. e) sexuada por partenognese. [C] 1490. Os gmeos univitelinos e os gmeos fraternos originam-se, respectivamente: a) de um vulo fecundado por um espermatozide e de um vulo fecundado por dois espermatozides. b) de um vulo fecundado por um espermatozide e de dois vulos fecundados por dois espermatozides. c) da fuso de dois vulos com dois corpsculos polares e de um vulo fecundado por dois espermatozides. d) de um vulo fecundado por dois espermatozides e de dois vulos fecundados por dois espermatozides. e) da fuso de dois vulos com dois corpsculos polares e de dois vulos fecundados por dois espermatozides. [B] 1491. A esterilizao masculina chamada vasectomia um mtodo contraceptivo que s deve ser utilizado por homens que no desejam mais ter filhos, pois sua reverso muito difcil. O processo da vasectomia consiste em: a) inutilizar os tubos seminferos para que os espermatozides no sejam mais produzidos. b) seccionar os canais deferentes, no sendo mais possvel eliminao dos espermatozides. c) remover a vescula seminal para que o smen fique bastante diminudo. d) inocular hormnios nos testculos para dificultar a ereo do pnis. e) alterar o funcionamento da prstata, reduzindo a quantidade de espermatozides produzida. [B] 1492. Observe as figuras que representam espermatozides de vrios tipos de animais. Todas as alternativas contm parmetros que podem diferenciar esses espermatozides, EXCETO

( ) controle das emoes, percepo sensorial e controle motor. ( ) controle da respirao, digesto e batimentos cardacos. ( ) controle do equilbrio e tnus muscular. ( ) liga os hemisfrios cerebrais ao cerebelo. A seqncia encontrada, de cima para baixo, : a) 1, 3, 4, 2. b) 3, 2, 1, 4. c) 4, 2, 1, 3. d) 2, 1, 4, 3. e) 3, 4, 2, 1. [C] 1484. Nos testes de gravidez, a substncia cuja presena pesquisada na urina : a) o hormnio folculo estimulante. b) o hormnio luteinizante. c) a gonadotrofina corinica. d) o estrgeno. e) a progesterona. [C] 1485. Dois irmos se originam de blastmeros provenientes de um mesmo zigoto. Pode-se afirmar que os mesmos so gmeos: a) univitelinos e, obrigatoriamente, do mesmo sexo. b) univitelinos, podendo ser de sexos diferentes. c) fraternos e, obrigatoriamente, do mesmo sexo. d) fraternos, podendo ser de sexos diferentes. e) fraternos e, obrigatoriamente, de sexos diferentes. [A] 1486. Alguns seres vivos, como as abelhas e os pulges, conseguem produzir indivduos sem que a fmea receba o espermatozide para fecundar o vulo. Este fenmeno chamado de: a) poliembrionia. b) partenognese. c) metagnese. d) nidao. e) filogenia. [B] 1487. Inicialmente o plipo reproduz-se assexuadamente, por brotamento, originando as medusas. Estas formaro gametas que depois se uniro para a formao dos zigotos. Dos zigotos surgem larvas que nadam livremente at se fixarem para dar incio a novos plipos. Esse tipo de reproduo, denominado metagnese, ocorre nos a) celenterados. b) porferos. c) aneldeos. d) moluscos. e) artrpodes. [A] 1488. 'Apis melifera' a espcie utilizada pelos apicultores do Vale do Paraba para produzir mel, prpolis, gelia real e outros produtos. Seus vulos, se fecundados, do origem: a) somente s fmeas frteis. b) somente aos machos frteis. c) somente s fmeas estreis. d) s fmeas frteis e s estreis. e) somente aos machos estreis. [D] 1489. No processo evolutivo foram selecionados os seres de fecundao externa que liberam uma grande quantidade de gametas para o meio ambiente. As hidras,

a) A dimenso da cabea. b) O formato da cabea. c) O grau de ploidia. d) O tamanho da cauda. e) O volume do citoplasma. [C] 1493. A ocorrncia de gravidez na adolescncia tem aumentado consideravelmente. O conhecimento e o uso adequado de mtodos contraceptivos podem reverter esse problema. Em relao a esses mtodos, CORRETO afirmar-se que a) o diafragma impede a nidao da mrula. b) o dispositivo intra-uterino, D.I.U, impede a chegada dos espermatozides ao tero. c) o mtodo hormonal feminino, plula, impede a ovulao. d) o mtodo de tabela eficiente se forem evitadas relaes sexuais entre o l2 e o l4 dia do ciclo. e) o preservativo masculino, camisinha, tem ao espermicida. [C] 1494. Observe a figura em que se representa um fenmeno biolgico.

132 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Todas as alternativas apresentam benefcios resultantes desse fenmeno, EXCETO a) Aumento da aerao no solo. b) Aumento da eficincia na ciclagem dos nutrientes na agricultura. c) Aumento do nmero de consumidores favorecendo o fluxo de energia. d) Maior disponibilidade de alimento para os peixes. e) Manuteno da diversidade no ecossistema. [D] 1495. Uma senhora deu luz dois gmeos de sexos diferentes. o marido, muito curioso, deseja saber informaes sobre o desenvolvimento de seus filhos, a partir da fecundao. O mdico respondeu-lhe, corretamente, que: a) dois vulos foram fecundados por um nico espermatozide. b) um vulo, fecundado por um espermatozide, originou um zigoto, o qual dividiuse em dois zigotos, formando dois embries. c) um vulo foi fecundado por dois espermatozides, constituindo dois embries. d) dois vulos, isoladamente, foram fecundados, cada um por um espermatozide, originando dois embries. e) o uso de medicamentos durante a gestao causou alteraes no zigoto, dividindo-o em dois. [D] 1496. O desenvolvimento de um novo ser a partir de gametas femininos no fecundados, pode ser observado em alguns insetos e plantas, porm muito raro em mamferos. Esse tipo de reproduo conhecido como: a) Partenognese. b) Brotamento. c) Gametognese. d) Cissiparidade. e) Esquizognese. [A] 1497. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Clones so seres vivos obtidos pelo desenvolvimento de clulas retiradas de indivduos j existentes. A clonagem um processo que vem sendo desenvolvido rapidamente com vrios organismos e, em humanos, encontra barreiras de ordem tica. Sobre esse processo CORRETO afirmar: 01. Os clones so como irmos gmeos fraternos do doador das clulas. 02. O material gentico do doador das clulas e do clone idntico. 04. Se o doador das clulas possuir um defeito gentico, como o albinismo, seu clone possuir, tambm, essa anomalia. 08. rgos transplantados do clone para o doador das clulas sero sempre rejeitados. 16. J existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. 32. Se o doador de clulas sofrer a perda de um membro antes de ser realizada a clonagem, o organismo originado posteriormente, por esse processo, nascer sem o referido membro. 02 + 04 = 06 1498. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. Antigamente no Brasil era comum famlias com nmero elevado de filhos. Hoje, vrios fatores culturais, econmicos, sociais influenciam a opo dos casais por um nmero reduzido de filhos. Existem vrios mtodos de contracepo, sobre eles julgue os itens. ( ) As plulas anticoncepcionais podem ser usadas para inibir o desenvolvimento dos folculos ou ento bloquear o processo de ovulao. ( ) A laqueadura consiste na retirada do tero. ( ) O condon, popularmente conhecido como camisinha, considerado um mtodo contraceptivo de barreira, sendo tambm de enorme eficincia no controle de doenas sexualmente transmissveis. VFV 1499. Observe a figura da clula representada a seguir e assinale a alternativa INCORRETA:

a) o flagelo, indicado pelo nmero 3, a estrutura responsvel pela locomoo. b) uma clula formada a partir da diferenciao de uma espermtide, aps a meiose de uma espermatognia. c) o ncleo, indicado pelo nmero 2, o local onde se encontra o material gentico. d) representa um gameta masculino, o qual produzido no epiddimo. e) o acrossomo, indicado pelo nmero 1, a vescula que contm enzimas necessrias penetrao no vulo. [D] 1500. Considere os processos adiante: I. reproduo assexuada II. reproduo sexuada III. produo de indivduos geneticamente idnticos IV. meiose Na formao de clones de organismos pluricelulares ocorrem, necessariamente, APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV [D] 1501. Os gmeos Renato e Marcelo e as gmeas Cristina e Fernanda originaramse de zigotos distintos. J Eduardo e Rodrigo desenvolveram-se a partir de blastmeros originados de um mesmo zigoto. Assinale a alternativa correta relativa aos gmeos citados: a) Os trs pares de gmeos so fraternos. b) Os trs pares de gmeos so univitelinos. c) Dois dos pares de gmeos so fraternos. d) Apenas Eduardo e Rodrigo so gmeos fraternos. e) Apenas os gmeos Renato e Marcelo e as gmeas Cristina e Fernanda so univitelinos. [C] 1502. So tipos de reproduo assexuada: a) conjuno, bipartio e partenognese; b) diviso mltipla, brotamento e bipartio; c) fecundao, conjuno e regenerao; d) conjuno, diviso mltipla e bipartio; e) bipartio, fecundao e partenognese. [B] 1503. A capacidade de regenerar rgos perdidos tanto maior quanto: a) mais desenvolvido for o ser vivo. b) menos desenvolvido for o ser vivo. c) mais inteligente for o ser vivo. d) mais bem adaptado for o ser vivo. e) maior o metabolismo do ser vivo. [B] 1504. Observe a legenda; 1. trompa de falpio 2. testculo 3. duto ejaculador 4. vagina 5. canal deferente 6. epiddimo 7. uretra 8. tero Para que a fecundao ocorra, o espermatozide dever percorrer: a) 2 - 6 - 5 - 3 - 7 - 4 - 8 - 1 b) 6 - 5 - 4 - 3 - 7- 8 - 1 - 2 c) 4 - 7 - 6 - 5 - 1 - 2 - 3 - 8 d) 3 - 2 - 5 - 7 - 6 - 4 - 8 - 1 e) 1 - 2 - 3 - 4 - 5 - 6 - 7 8 [A] 1505. O DIU (dispositivo intra-uterino) um contraceptivo que tem como ao principal: a) matar os espermatozides. b) impedir que os espermatozides cheguem ao vulo. c) impedir a ovulao.

133 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) matar o vulo no momento da ovulao. e) impedir que o embrio se fixe parede interna do tero. [A] 1506. As Classes de Vertebrados em que se observa fecundao interna so: a) peixes, anfbios e rpteis. b) anfbios, rpteis e aves. c) rpteis, aves e mamferos. d) anfbios, rpteis e mamferos. e) peixes, anfbios e mamferos. [C] 1507. Assinale a opo que indica os hormnios que atuam na liberao do vulo (ovcito secundrio): a) ocitocina e estradiol b) estradiol e progesterona c) progesterona e folculo estimulante d) luteinizante e gonadotrofina e) folculo estimulante e luteinizante [E] 1508. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Considerando os conceitos gerais sobre Embriologia, correto afirmar que: 01) Nos espermatozides, as mitocndrias situadas na regio intermediria so as "centrais de energia" para a intensa atividade motora do flagelo. 02) Nos marsupiais os filhotes nascem prematuramente e completam seu desenvolvimento na bolsa marsupial. 04) A penetrao de um nico espermatozide no vulo caracteriza a monospermia. H casos de polispermia, ou seja, entrada de mais de um espermatozide no vulo, e isto caracteriza a formao de gmeos. 08) Na segmentao do ovo ocorrem muitas mitoses, resultando muitos blastmeros de tamanhos cada vez menores. 16) O mnio o anexo embrionrio que se constitui numa bolsa preenchida pelo lquido amnitico e que tem por funo proteger o embrio contra choques mecnicos e desidratao. 01 + 02 + 08 + 16 = 27 1509. Indivduos hermafroditas costumam garantir a variabilidade gentica atravs de: a) partenognese. b) fecundao cruzada. c) autofecundao. d) brotamento. e) estrobilizao. [B] 1510. Da gestao de uma mulher nasceram duas crianas. Sobre o fato foram levantadas algumas hipteses. Assinale a CORRETA. a) Se as crianas forem de sexos diferentes, sua origem foi por poliembrionia b) Se forem dois meninos, pode ter ocorrido poliembrionia. c) Se forem univitelinos, sua origem foi a poliovulao. d) Se forem crianas idnticas, originaram-se pelo fenmeno da poliovulao. e) Se as crianas forem do mesmo sexo, ento, certamente, ocorreu o fenmeno da poliembrionia. [B] 1511. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Sobre os aspectos principais da embriologia dos cordados, correto afirmar que: 01 - mnio, alantide e saco vitelnico so exemplos de anexos embrionrios. 02 - O sexo do indivduo estabelecido por ocasio da fecundao. 04 - Denomina-se anfimixia o fenmeno da fuso dos pr-nucleos masculino e feminino. 08 - A sequncia das fases no desenvolvimento embrionrio : zigoto, segmentao, gstrula e blstula. 16 - O tipo de segmentao depende, entre outros fatores, da quantidade de vitelo acumulada no ovo. 32 - Os mamferos so animais diploblsticos, pois seus tecidos originam-se da ectoderme e endoderme. 01 + 02 + 04 + 16 = 23 1512. O hormnio feminino responsvel pela ovulao denomina-se a) progesterona. b) estrgeno. c) testosterona. d) folculo estimulante (FSH). e) luteinizante (LH). [E] 1513. Os recentes avanos da Biotecnologia tm permitido a produo dos chamados Anticorpos Monoclonais, cujas aplicaes se ampliam, j movimentando um mercado gerador de centenas de milhes de dlares anuais. Uma das utilizaes mais freqentes se relaciona pesquisa da gonadotrofina corinica no sangue. Tal tcnica permite a deteco desta substncia, mesmo quando presente em pequenas concentraes. A presena da gonadotrofina no sangue humano representa:

a) Diagnstico positivo para Hipertiroidismo. b) Diagnstico positivo para Hipotiroidismo. c) Diagnstico negativo para Hiperglicemia. d) Diagnstico positivo para Pancreatite. e) Diagnstico positivo para Gravidez. [E] 1514. Em uma comparao sob o ponto de vista de favorecimento evolutivo e adaptao, a reproduo sexuada mais importante que a assexuada. Qual das alternativas a seguir, com relao reproduo sexuada, melhor justifica esta afirmativa? a) Sempre se processa aps meiose que produz gametas. b) exclusiva de forma de vida mais evoluda. c) D origem a um maior nmero de descendentes. d) Permite uma maior constncia no genoma dos descendentes. e) Promove uma maior variabilidade gentica na populao [E] 1515. A fecundao o processo reprodutivo que se desencadeia pela fuso do gameta masculino com o feminino. Marque a opo que apresenta o trajeto correto do espermatozide desde o local de sua produo at o local onde acontece a fecundao. a) Testculo Epiddimo Ducto Deferente Uretra Vagina tero Tuba Uterina. b) Testculo Epiddimo Tbulo Eferente Uretra Vagina tero Tuba Uterina Ovrio. c) Testculo Ducto Deferente Epiddimo Uretra Vagina tero Tuba Uterina Ovrio. d) Testculo Ducto Deferente Prstata Uretra Vagina tero Tuba Uterina. e) Testculo Epiddimo Tbulo Eferente Uretra Vagina tero Tuba Uterina. [A] 1516. " (...) At a menopausa, as mulheres contam com uma proteo natural inexistente no metabolismo masculino. ................ - o hormnio sexual produzido nos ovrios. Sua presena no sangue reduz os nveis de colesterol "ruim" (o LDL e o VLDL), aumenta os de colesterol "bom" (HDL) e ajuda a preservar a parte interna das artrias." Assinale a alternativa que preenche corretamente a lacuna do texto. a) a aldosterona b) a insulina c) a testosterona d) a adrenalina e) o estrgeno [E] 517. A figura a seguir mostra um tero humano contendo dois embries em desenvolvimento.

Esses gmeos possuem em comum a) somente o mnio. b) somente a placenta. c) somente o crio. d) somente o crio e a placenta. e) a placenta, o crio e mnio. [D] 1518. Bactrias formam clones desde o incio da vida na Terra" Hoje, algumas espcies de tatus produzem, por clonagem, de quatro a doze filhotes. Esse tipo de clonagem possvel porque: a) a fmea produz um grande nmero de ovos. b) os zigotos formados so conseqncia de meioses constantes. c) o zigoto formado capaz de se dividir vrias vezes. d) a grande produo de gametas masculinos garante o desenvolvimento de zigotos. e) as mitoses existentes em cada zigoto so conseqncia de recombinao gnica. [C] 1519. Falando sobre reproduo de metazorios, o Prof. Francisco dispunha de cinco animais para uma aula prtica:

134 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1 - 'Schistossoma mansoni' 2 - mosca 3 - bolacha-da-praia 4 - sapo 5 - tartaruga O Prof. Francisco pediu aos seus alunos que construssem uma tabela, separando aqueles animais que tinham fecundao interna e externa. Marque a alternativa que contm a separao CORRETA: a) Interna: 1, 3 e 5 - Externa: 2 e 4 b) Interna: 3, 4 e 5 - Externa: 1 e 2 c) Interna: 1, 2 e 5 - Externa: 3 e 4 d) Interna: 2, 4 e 5 - Externa: 1 e 3 e) Interna: 4 e 5 - Externa: 1, 2 e 3 [C] 1520. Dois estudantes, nadando numa lagoa, observaram alguns organismos na gua e estabeleceram o seguinte dilogo: " - Olha os girinos, filhotes de sapo. - No so girinos, so alevinos. - Mas. . . O que so alevinos? - So filhotes de peixe, animais diicos." Com base nesse dilogo e em seus conhecimentos biolgicos, INCORRETO afirmar que a) os alevinos so etapas do desenvolvimento dos peixes. b) os girinos so etapas de metamorfose. c) os peixes realizam fecundao cruzada. d) os sapos realizam fecundao interna. [D] 1521. Observe o esquema que representa parte do sistema reprodutor feminino. [B] 1524. Para que uma populao sobreviva s mudanas que o ambiente sofre ao longo do tempo, necessrio que seus indivduos a) apresentem variabilidade gentica. b) cruzem-se com outros, de espcies diferentes e mais vigorosas. c) apresentem apenas reproduo assexuada. d) sofram os efeitos do isolamento geogrfico ou do isolamento reprodutivo. e) adquiram novas caractersticas hereditrias, por influncia do ambiente em modificao. [A] 1525. Assinale a alternativa correta quanto fecundao externa. a) uma forma de reproduo assexuada. b) Tem de ocorrer necessariamente na gua. c) Representa economia na formao de gametas. d) Leva sempre a um desenvolvimento direto sem fase larval. e) Ocorre unicamente em invertebrados. [B] 1526. LIXO DE PROVETA "Aproximadamente 3.3000 embries humanos congelados foram dissolvidos em gua e lcool na Inglaterra. Os chamados bebs de proveta, apesar de serem fecundados em frascos de vidro, so mais tarde transferidos para o tero da mulher. A estrutura embrionria que funcionar como rgo de respirao e excreo do embrio o(a): a) alantide. b) mnio. c) crion. d) saco vitelnico. e) placenta. [E] Momentos aps a ejaculao, vrios espermatozides percorrem a mucosa do tero e dirigem-se para uma das trompas. Parte destes espermatozides encontram o vulo e liberam enzimas que enfraquecem as barreiras que o envolvem. Um espermatozide entra em contato com a superfcie do vulo, e as membranas celulares e os ncleos de ambos se fundem. a) Quais so os fenmenos ocorridos em I e II, respectivamente? b) Qual o nome da fase do desenvolvimento embrionrio representada em III, e qual o processo de diviso celular ocorrido at a implantao observada em IV? a) I - ovulao, II - fecundao ou fertilizao. b) III - mrula e o processo de diviso celular que ocorre at a implantao do embrio a mitose. 1522. A vasectomia tem sido um dos recursos procurados atualmente por homens que no desejam ter filhos. A eficcia desse mtodo anticoncepcional deve-se a. a) impedimento da ejaculao. b) ausncia de espermatozides no smen. c) impedimento da produo de espermatozides. d) alterao do controle hormonal. [B] 1523. Um professor apresentou classe o seguinte problema: - Qual dever ser a variao do peso de um ovo de galinha, durante o processo de desenvolvimento embrionrio do pintinho, at um dia antes de seu nascimento? Os alunos apresentaram diferentes respostas expressas pelas curvas a seguir. Assinale a alternativa que mais se aproxima da resposta correta. 1527. Pela observao do esquema a seguir, podemos concluir que o zango foi originado por:

a) gametognese. b) partenognese. c) gemulao. d) conjugao. e) brotamento. [B] 1528. Em relao reproduo humana, julgue os seguintes itens. (0) Os testculos precisam de uma temperatura maior que a corporal para produzirem os espermatozides. (1) A obstruo total dos canais deferentes leva esterilidade masculina. (2) A plula anticoncepcional torna os espermatozides menos capazes de fecundar um vulo, alm de agir na parede do tero, impedindo a fixao do ovo. (3) Os hormnios que regulam o ciclo menstrual geralmente favorecem a ocorrncia da ovulao por volta da metade do ciclo. (4) A formao dos gametas femininos inicia-se na puberdade. Itens corretos: 1 e 3 Itens errados: 0, 2 e 4 1529. As figuras abaixo mostram as principais partes dos gametas masculino (em A, com aumento de 1.250 vezes) e feminino (em B, com aumento de 200 vezes).

135 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Considerando os dados relativos s figuras apresentadas, julgue os itens que se seguem. (1) A estrutura I pobre em enzimas. (2) A energia necessria para o batimento do flagelo provm da estrutura II. (3) Na espcie humana, a produo dos gametas representados pela figura A muito maior que a dos representados pela figura B. (4) No processo de fecundao, a membrana celular da clula B sofre significativas modificaes. ECCC 1530. Os grficos mostrados na figura abaixo representam as variaes nos nveis dos hormnios hipofisrios e ovarianos durante o ciclo menstrual da mulher.

II - cirurgia para a extrao dos vulos maduros (cerca de oito); III - fecundao "in vitro" dos vulos por espermatozides; IV - introduo de cerca de quatro dos embries resultantes no tero da mulher; e V - congelamento dos embries restantes em N lquido, na maioria das vezes. Mesmo com esse procedimento, utilizando-se vrios embries, a gravidez ocorre em cerca de apenas 30% dos casos, nas clnicas mais avanadas. Considerando o exposto anteriormente, julgue os itens que se seguem. (0) A probabilidade de nidao ser maior ou menor, dependendo da fase do ciclo menstrual em que se encontra a mulher que recebe os embries. (1) O passo I necessrio porque, normalmente, s amadurecem dois vulos por ms, um em cada ovrio. (2) Se, no passo IV, houver nidao de dois embries, haver o nascimento de gmeos idnticos. (3) O passo V preserva os embries pela drstica diminuio do metabolismo desses. Itens corretos: 0 e 3 Itens errados: 1 e 2 1533. Para os namorados que este ms esto celebrando a paixo, a atrao fsica um boto mgico que s o amor capaz de ligar. Mas, para os cientistas, o desejo sexual um processo bioqumico que desequilibra rapidamente todo o corpo, diagnosticvel por vrios sintomas. No se consegue tirar os olhos "daquela" pessoa, o corao dispara, as mos suam, d vontade de falar pelos cotovelos, as pernas ficam meio bambas, a fome desaparece e preciso suspirar profundamente para respirar melhor. Com o auxlio do texto, julgue os itens seguintes. (1) Os sintomas do desejo sexual dependem de fatores psicolgicos, que variam de um indivduo para outro, para que sejam desencadeados. (2) Receptores tteis e quimiorreceptores permitem ao sistema nervoso perceber o afago e o perfume da pessoa amada. (3) A palidez que uma pessoa pode apresentar ao ser paquerada conseqncia da interao dos sistemas nervoso e circulatrio. (4) A coordenao endcrina provoca respostas mais rpidas que a coordenao nervosa. (5) O apaixonado ofega porque perde o controle voluntrio do ritmo da respirao. Itens corretos: 1, 2 e 3 Itens errados: 4 e 5 1534. Observe o esquema a seguir, que ilustra a formao de gmeos:

Com o auxlio dos grficos, julgue os seguintes itens. (1) O primeiro dia do ciclo menstrual corresponde ao primeiro dia da menstruao. (2) O aumento da taxa de FSH induz o desenvolvimento dos folculos ovarianos. (3) No momento da ovulao, as taxas de estrgenos e de LH esto elevadas. (4) Os grficos ilustram a situao que ocorre em mulheres que esto sob efeito de plulas anticoncepcionais. CCCE 1531. Aps ser fecundado, o vulo humano passa a se chamar ovo e multiplica-se para formar o embrio. Inicialmente, so duas, depois, quatro clulas, que, com o passar do tempo, originam os rgos e os sistemas. A figura abaixo ilustra embries humanos com diferentes idades.

Os indivduos que se desenvolvero, a partir dos embries assinalados no esquema, resultam, na maioria dos casos, da fertilizao de: a) um ovcito por um espermatozide b) dois ovcitos por um espermatozide c) um ovcito por dois espermatozides d) dois ovcitos por dois espermatozides [D] 1535. O fenmeno da fecundao humana envolve o espermatozide em uma srie de eventos seqenciais at a penetrao no ovcito, conforme esquema a seguir:

Com o auxlio do texto e da figura, julgue os itens que se seguem. (1) A fecundao promove aumento da variabilidade gentica. (2) O embrio de 18 dias formou-se por diferenciao celular do zigoto e subsequente proliferao deste. (3) Aos 24 dias de idade, o embrio constitudo por trs folhetos embrionrios, que originaro os tecidos do organismo. (4) A ao das drogas psicotrpicas e medicamentosas muito mais prejudicial ao embrio aps a oitava semana de gravidez. CEEE 1532. O tema da fecundao "in vitro" tem aparecido com freqncia nos meios de comunicao, seja pelo uso por pessoas famosas, seja pelo debate tico suscitado, por exemplo, pela destruio massiva de embries humanos. Basicamente, a tcnica de fecundao "in vitro" consiste nos seguintes passos: I - induo de superovulao na mulher com o uso de hormnios; Das regies que normalmente devem ser atravessadas pelo espermatozide para que ocorra a fecundao, aquela que envolve o fenmeno de reao acrosmica : a) a zona pelcida

136 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) o espao perivitelino c) a membrana plasmtica d) a camada de clulas foliculares [A] 1536. A eficincia dos mtodos anticoncepcionais mais utilizados pode ser verificada observando-se o quadro a seguir:

b) inibem o batimento flagelar dos espermatozides. c) tornam a parede do vulo impenetrvel para o espermatozide. d) provocam o fechamento das tubas uterinas. e) impedem a ocorrncia do fenmeno da ovulao. [E] 1540. H casos em que vulos no fecundados do origem a um animal. Nesse caso, ocorre o que se denomina de: a) neotenia. b) gonocorismo. c) protandria. d) partenognese. e) fecundao cruzada. [D] 1541. A figura a seguir est relacionada com a reproduo de um certo protozorio:

a) Explique por que o mtodo da tabela um dos menos seguros. b) O mtodo da plula anticoncepcional diferencia-se dos demais em relao forma pela qual se evita a gravidez. Explique por qu. a) Porque o ciclo menstrual das mulheres no sempre regular. b) A plula o nico mtodo que impede a liberao do gameta atravs de hormnios que interferem no ciclo menstrual. 1537. Observe as figuras. Assinale a alternativa que corresponde ao tipo de reproduo exemplificado: a) cissiparidade. b) conjugao. c) brotamento. d) partenognese. e) esquizogonia. [A] 1542. Em 1998, comemorou-se os 20 anos de nascimento de Louise Brown, o primeiro "beb de proveta". Esta conquista biolgica foi possvel devido aos avanos cientficos acumulados sobre o processo de fecundao. Entretanto, aspectos bsicos da reproduo humana so ainda desconhecidos por alguns estudantes. Analise as frases a seguir, obtidas em provas de Biologia, e assinale a nica CORRETA: a) A entrada de dois espermatozides em um nico ovcito originar gmeos. b) Gmeos idnticos originam-se a partir da fecundao de um ovcito por um espermatozide. c) A fertilizao natural ocorre normalmente no tero da me. d) A zona pelcida sempre removida do ovcito antes da fecundao. e) Se o cromossomo X estiver no espermatozide fecundante, o beb ser masculino. [B] 1543. Na urina de uma mulher foi verificada a presena de gonadotrofina corinica. Essa substncia indica que a mulher a) est menstruada. b) est grvida. c) tem diabetes. d) tem falta de clcio. e) tem metabolismo basal baixo. [B] 1544. Em 1978, registrou-se o nascimento do primeiro beb gerado 'in vitro'. Desde ento, alguns aspectos ticos importantes vm sendo discutidos em relao s conseqncias da aplicao de tcnicas de reproduo humana assistida sobre o equilbrio gentico de populaes humanas. Todas as alternativas apresentam procedimentos que podem alterar esse equilbrio gentico, EXCETO a) Clonagem b) Doao de embries c) Seleo de embries d) Seleo de sexo [B] 1545. Observe as figuras.

Com base nas figuras e em conhecimentos sobre o assunto, INCORRETO afirmar que a) a corte sexual um comportamento adaptativo necessrio para ovulao da galinha. b) o comportamento do macho estimulado pela ao da testosterona. c) o agachamento sexual facilita o encontro das cloacas para introduo do smen na fmea. d) o macho se diferencia da fmea quanto ao tamanho da crista e das penas e pelo canto. [A] 1538. Com o auxlio da figura abaixo, na qual so apresentadas etapas do desenvolvimento do embrio e do feto humanos, julgue os itens seguintes.

(1) A frase "a ontogenia repete a filogenia" vlida para todas as etapas de desenvolvimento mostradas na figura. (2) O perodo de organognese inicia-se aps 28 dias da fecundao. (3) Durante as etapas da gravidez mostradas na figura, o organismo da mulher apresenta modificaes hormonais profundas. (4) No incio do desenvolvimento embrionrio, as divises celulares acontecem aps as clulas atingirem crescimento mximo. FFVF 1539. As plulas anticoncepcionais femininas possuem substncias que: a) provocam a morte dos espermatozides na entrada do colo do tero.

137 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Os animais representados nessas figuras possuem sistema reprodutor masculino e feminino. Portanto um nico indivduo dessas espcies que sobreviva capaz de reconstituir toda a populao. Assim sendo, esses animais devem apresentar todas as seguintes caractersticas, EXCETO a) Autofecundao b) Fecundao interna c) Hermafroditismo d) Reproduo assexuada [D] 1546. Leia o texto abaixo, que parte de uma matria jornalstica com o ttulo "Clonagem Recomendada para Estudos". "A clonagem de embries humanos est perto de ser aprovada no Reino Unido para a pesquisa mdica, permanecendo proibido o uso da tcnica para fins reprodutivos em seres humanos (...). A clonagem de um ser vivo consiste em obter uma cpia idntica dele sem reproduo sexuada (...)." (Folha de S. Paulo, 09/12/98.) Sobre reproduo dos seres vivos, correto afirmar: 01) A combinao de material paterno com materno, que ocorre na reproduo sexuada, introduz maior variabilidade gentica nas populaes. 02) Em seres que se reproduzem assexuadamente, os descendentes so geneticamente iguais, uma vez que o processo se baseia na mitose. 04) Somente organismos unicelulares se reproduzem assexuadamente. 08) A entrada do espermatozide no gameta feminino provoca a ativao do ovo e desencadeia o processo de segmentao. 16) Os ovos humanos tm grande quantidade de vitelo, que assegura o desenvolvimento do novo ser. 32) O processo de clonagem tem como resultado a reconstituio de 2n de material gentico da prpria espcie no zigoto formado. VVFVFV 1547. A respirao aerbica fornece como produtos finais a) cido pirvico e gua. b) cido pirvico e oxignio. c) gs carbnico e gua. d) oxignio e gua. e) oxignio e gs carbnico. [C] 1548. No homem, o controle dos movimentos respiratrios exercido: a) pelo crebro. b) pelo cerebelo. c) pelo bulbo. d) pela medula. e) pela hipfise. [C] 1549. Aps um acidente automobilstico uma pessoa teve que se submeter a uma cirurgia que lhe removeu uma parte de seu corpo. Aps a recuperao passou a viver normalmente. A parte retirada era: a) o fgado. b) o pncreas. c) a hipfise. d) o bao. e) o diafragma. [D] 1550. O grfico a seguir apresenta duas curvas que indicam o que acontece com o metabolismo de animais: uma para animais que mantm constante a temperatura do corpo e outra para animais cuja temperatura do corpo igual do ambiente.

Que animais tm curvas do tipo Y? a) Camundongo, canrio e r. b) Caranguejo, lula e pescada. c) Elefante, baleia e avestruz. d) Gaivota, pescada e jacar. e) Baleia, tubaro e pescada. [B] 1551. Clulas de certos organismos possuem organelas que produzem ATPs e os utilizam na sntese de substncia orgnica a partir de dixido de carbono. Essas organelas so: a) os lisossomos. b) os mitocndrios. c) os cloroplastos. d) o sistema de Golgi. e) os nuclolos. [B] 1552. Observe o grfico adiante:

Os pontos A e B podem corresponder, respectivamente, a: a) elefante e rato. b) boi e cavalo. c) elefante e baleia. d) coelho e lebre. e) rato e hipoptamo. [E] 1553. A energia liberada em uma seqncia de reaes ao longo da cadeia respiratria utilizada na converso do ADP+Pi em ATP. Essa seqncia de reaes denominada: a) gliclise. b) ciclo de Calvin. c) fosforilao oxidativa. d) ciclo de Krebs. e) fermentao. [C] 1554. Considere os esquemas a seguir, nos quais as setas indicam absoro ou eliminao de gs.

138 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

Qual a alternativa que identifica corretamente a substncia absorvida ou eliminada? a) (I) O2, (II) O2, (III) O2, (IV) CO2. b) (I) O2, (II) CO2, (III) CO2, (IV) CO2. c) (I) O2, (II) CO2, (III) O2, (IV) O2. d) (I) CO2, (II) CO2, (III) CO2, (IV) O2. e) (I) CO2, (II) O2, (III) CO2, (IV) O2. [C] 1555. Um atleta, participando de uma corrida de 1500 m, desmaiou depois de ter percorrido cerca de 800m, devido oxigenao deficiente de seu crebro. Sabendo-se que as clulas musculares podem obter energia por meio da respirao aerbica ou da fermentao, nos msculos do atleta desmaiado deve haver acmulo de: a) glicose. b) glicognio. c) monxido de carbono. d) cido ltico. e) etanol. [D] 1556. As trocas gasosas entre os organismos e o ambiente em que estes vivem podem ocorrer de diversas maneiras. A seguir, esto indicados os processos de respirao que ocorrem em determinados animais. Assinale a alternativa incorreta a) golfinho pulmonar b) planria cutnea e branquial c) minhoca cutnea d) r adulta cutnea e pulmonar e) gafanhoto traqueal [B] 1557. Jogadores de futebol que vivem em altitudes prximas do nvel do mar sofrem adaptaes quando jogam em cidades de grande altitude. Algumas adaptaes so imediatas, outras s ocorrem aps uma permanncia de pelos menos 3 semanas. Qual alternativa inclui as reaes imediatas e as que podem ocorrer a longo prazo? a) IMEDIATAS: aumentam a freqncia respiratria, os batimentos cardacos e a presso arterial. A LONGO PRAZO: diminui o nmero de hemcias. b) IMEDIATAS: diminuem a freqncia respiratria e os batimentos cardacos; aumenta a presso arterial. A LONGO PRAZO: aumenta o nmero de hemcias. c) IMEDIATAS: aumentam a freqncia respiratria e os batimentos cardacos; diminui a presso arterial. A LONGO PRAZO: diminui o nmero de hemcias. d) IMEDIATAS: aumentam a freqncia respiratria, os batimentos cardacos e a presso arterial; diminui a presso arterial. A LONGO PRAZO: aumenta o nmero de hemcias. e) IMEDIATAS: aumentam a freqncia respiratria, os batimentos cardacos e a presso arterial. A lONGO PRAZO: aumenta o nmero de hemcias. [D] 1558. Analise a seguinte equao qumica: Ba(OH)2 + CO2 + H2O => BaCO3 + 2H2O Obs.: BaCO3 forma um precipitado branco em soluo. Relacione-a com o fato descrito a seguir e assinale a alternativa, correta. "Uma criana soprou, com um canudinho de plstico, o ar de seu pulmo num copo com uma soluo transparente de hidrxido de brio e notou que a soluo ficou branca." a) O ar que sai dos pulmes contm oxignio em menor quantidade, porm o suficiente para reagir com a soluo, formando carbonato de brio. b) O ar que entra nos pulmes contm gs carbnico que reage com o oxignio e, quando volta, reage com a soluo, formando carbonato de brio. c) O ar que entra nos pulmes contm oxignio que reage com o gs carbnico e, quando volta, reage tambm com a soluo, formando carbonato de brio. d) O ar que sai dos pulmes contm gs carbnico que reage com a soluo, formando carbonato de brio. e) O ar que sai dos pulmes contm gs carbnico e oxignio. Estes, ao entrarem na soluo, reagem entre si, facilitando a formao do hidrxido de brio. [D] 1559. A partir de registros fsseis, sabe-se que no Perodo Jurssico a 200 milhes de anos atrs, haviam cerca de 300 Famlias de insetos; enquanto entre os quadrpedes haviam cerca de 100 Famlias. A partir do Perodo Cretceo, h cerca de 100 milhes de anos at o Perodo Tercirio, mais recente, o nmero de Famlias de Insetos quadruplicou enquanto o nmero de Famlias de quadrpedes apenas dobrou. Percebe-se que os insetos constituem um grupo bastante bem sucedido na conquista do ambiente terrestre. Uma das caractersticas que possibilitou essa adaptao foi a presena de: a) respirao traqueal. b) circulao fechada. c) fecundao externa. d) tubo digestivo incompleto. e) carapaa permevel.

[A] 1560. O termo hipxia refere-se condio na qual a disponibilidade ou a utilizao de oxignio est reduzida. Os indivduos B, C, D e E, relacionados na tabela a seguir, esto submetidos, a diferentes formas de hipxia. O indivduo A tem metabolismo de oxignio normal. Considere que o peso, o sexo e a idade de todos os indivduos so os mesmos.

a) Qual dos indivduos est sofrendo as conseqncias de uma dieta pobre em ferro? Qual apresenta insuficincia cardaca e circulao deficiente? Em que dados voc baseou suas concluses? b) Qual deles est sofrendo de envenenamento que impede suas clulas de usar o oxignio? Justifique a resposta. c) Observa-se uma acelerao da freqncia respiratria quando sobe o nvel de gs carbnico. Explique como isso acontece. a) O paciente C porque apresenta hemoglobina abaixo do normal, D porque est com um dbito cardaco baixo. b) O paciente E porque a taxa de oxignio no sangue venoso muito prxima taxa observada no sangue arterial. c) O gs carbnico estimula o bulbo raquidiano a aumentar a freqncia respiratria, 1561. Considerando-se os principais processos energticos que ocorrem nos seres vivos, podemos corretamente afirmar que: a) o autotrofismo uma caracterstica dos seres clorofilados b) o heterotrofismo impossibilita a sobrevivncia dos seres aclorofilados c) a fotossntese e a respirao aerbica so processos que produzem sempre as mesmas substncias qumicas d) a fermentao um processo bioqumico que no produz qualquer forma de energia e) apenas a fermentao alcolica, produz cido pirvico [A] 1562. Considere as seguintes caractersticas: I. epitlio fino II. superfcie mida III. vascularizao intensa IV. epitlio impermeabilizado A respirao pulmonar e a branquial tm em comum apenas a) I e II b) I e III c) III e IV d) I, II e III e) II, III e IV [D] 1563. Em qual dos pares citados ocorre respirao cutnea? a) Planria e barata. b) Planria e sapo. c) Planria e jacar. d) Barata e sapo. e) Barata e jacar. [B] 1564. "As alteraes no ritmo dos movimentos respiratrios, que ocorrem durante a realizao de atividades fsicas intensas, devem-se influncia da concentrao elevada de ........(I)........ sobre o ........(II)........." Para completar corretamente a frase anterior, deve-se substituir I e II, respectivamente, por a) O2 e bulbo. b) CO e bulbo. c) CO2 e bulbo. d) N2 e cerebelo. e) CO2 e cerebelo. [C] 315657. Observe o esquema que representa a obteno de energia por um vertebrado. Com base nesse esquema e em seus conhecimentos sobre o assunto, INCORRETO afirmar-se que

139 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1569. "A silicose uma doena muito comum em trabalhadores que lidam com amianto. Um dos componentes do amianto a slica, uma substncia inorgnica que forma minsculos cristais que podem se acumular nos pulmes. As clulas dos alvolos pulmonares afetadas por estes cristais acabam sofrendo autlise". Essa doena est relacionada com organides citoplasmticos denominados a) plastos b) lisossomos c) dictiossomos d) mitocndrias e) centrolos [B] 1570. Considere as afirmaes apresentadas a seguir. I. O rendimento energtico total de cada molcula de glicose degradada at 6CO e 6HO de 38 ATP (dois na Gliclise e trinta e seis nos processos Mitocondriais). II. A utilizao do oxignio se d nas cristas mitocondriais, como aceptor final de hidrognios. III. Em alguns microorganismos, o piruvato, proveniente da glicose, posteriormente metabolizado para produzir molculas de etanol. Com relao fermentao, pode-se afirmar que, das afirmaes, apenas a) a I est correta. b) a II est correta. c) a III est correta. d) a I e a III esto corretas. e) a II e a III esto corretas. [C] 1571. A respeito dos pigmentos respiratrios, correto afirmar: a) realizam o transporte de todo o CO2 b) aumentam a capacidade do sangue de transportar O2 c) nos vertebrados, esto dispersos no sangue d) nos invertebrados, encontram-se no interior das hemcias e) os dos crustceos chamam-se carboemoglobina [B] 1572. Considere as proposies a seguir referentes s trocas gasosas: 1. Hematose a transformao do sangue venoso em arterial. 2. A oxiemoglobina formada pela combinao do oxignio com a hemoglobina. 3. A maior parte do CO2 transportada pela hemoglobina. 4. A oxiemoglobina formada nos tecidos; desfaz-se nos pulmes. Est(o) correta(s) apenas: a) 1 e 2 b) 1 e 4 c) 3 d) 2 e) 1, 2, 4 [A] 1573. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Sobre a transformao e armazenamento de energia nas clulas: ( ) a gliclise anaerbia produz menos quantidade de ATP que a fosforilao oxidativa, por mol de glicose; ( ) no ciclo de Krebs (ciclo dos cidos tricarboxlicos) ocorre a produo gradual de eltrons e prtons, devido a presena das enzimas desidrogenases, ( ) na etapa fotoqumica de fotossntese, a clorofila se oxida, participando de um processo de oxirreduo; ( ) na fotossntese, o ATP se forma na etapa bioqumica, ou seja, na etapa com ausncia de luz; ( ) nas reaes de escuro (na fotossntese), que ocorrem no estroma, o NADP reduzido e o ATP produzidos nas reaes de claro so usados para oxidar dixido de carbono. VVVFF 1574. Observe o esquema a seguir e assinale a alternativa correta: Com base nesse esquema e em seus conhecimentos sobre o assunto, pode-se afirmar que a) a estrutura 3 caracterstica de animais de circulao fechada. b) a estrutura 6 representa uma artria e, junto com 7 participa da grande circulao. c) a funo de 2 realizada pela bexiga natatria no tubaro. d) o rgo 1 tpico de rpteis. e) o teor de 0 em 4 maior do que em 5. [A] 1568. Em alguns locais do corpo humano, existem epitlios extremamente ativos na troca de substncias com as cavidades por eles revestidas ou com o sangue. A alternativa que contm o local com epitlio menos ativo a) alvolos pulmonares. b) glndulas endcrinas. c) intestino delgado. d) intestino grosso. e) tbulos renais. [D]

a) a energia produzida est armazenada na glicose. b) a etapa 1 extracelular. c) a liberao de CO2 ocorre na etapa 2. d) as etapas 1 e 2 envolvem participao de enzimas. e) o O2 participa da formao de gua na etapa 2. [A] 1566. Observe os esquemas referentes a sistemas respiratrios animais. Com base nesses esquemas e em conhecimentos sobre o assunto, INCORRETO afirmar-se que

a) 1 e 2 so comuns a vertebrados e invertebrados. b) 3 independe do sistema circulatrio. c) 3 e 4 referem-se a animais que possuem mais disponibilidade de O2 no ambiente. d) 4 pode pertencer a um animal com corao tetracavitrio. e) O sistema branquial no se inclui entre os esquemas representados. [A] 1567. Observe o esquema que se refere ao sistema crdio-respiratrio de um determinado animal.

a) Trata-se da respirao traqueal, observada nos insetos. b) Trata-se da respirao cutnea, observada em rpteis. c) Trata-se da respirao cutnea, observada em aneldeos (oligoquetos) como a minhoca. d) Trata-se da respirao por brnquias, observada em anfbios.

140 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) Trata-se da respirao por filotraquias, observada em anfbios. [C] 1575. Observe a reao bioqumica apresentada a seguir e assinale a alternativa correta com relao a esse processo. 6C + 2ADP + 2P 2PlRUVATO + 2 ATP a) Trata-se da gliclise, que constitui numa srie de reaes enzimticas processadas no interior da mitocndria. b) Apresenta um alto rendimento energtico. c) Ocorre consumo de O2. d) O produto desta reao, piruvato, transformado em cido actico e este participa de outros processos bioenergticos, com alto rendimento em ATP. e) Este processo ocorre somente em clulas vegetais clorofiladas. [D] 1576. O exagero na prtica de exerccios fsicos leva a dores musculares fortes. Isso ocorre devido ao acmulo de: a) cido pirvico. b) cido lctico. c) cido ntrico. d) cido fosfoglicrico. e) cido flico. [B] 1577. Considere o esquema a seguir e indique a alternativa errada.

02. no perodo de maro a outubro, o consumo de oxignio mais alto e a captao do oxignio atravs dos pulmes aumenta vrias vezes e excede a que ocorre atravs da pele; 04. a captao de oxignio atravs da pele mantida praticamente constante ao longo do ano; 08. a captao de oxignio pelos pulmes nos meses de janeiro e dezembro , em termos de massa corprea, cerca de 40ml de oxignio/kg.h; 16. entre os meses de abril e maio, a captao total de oxignio pelas rs atinge seu valor mnimo. 01 + 02 + 04 + 16 = 23 1580. Marque a alternativa em que todas as estruturas anatmicas que, embora em organismo diferentes, esto ligadas mesma funo orgnica: a) brnquias - alvolos - traquias b) espcula - coluna vertebral - clula flama c) gnadas - cnidoblasto - notocorda d) bexiga natatria - rins ureteres [A] 1581. Dos animais a seguir, os nicos que apresentam respirao pulmonar so; a) minhoca, sapo e peixe b) golfinho, barata e cobra c) peixe-boi, jacar e pato d) baleia, aranha e peixe e) tartaruga, jacar e tubaro [C] 1582. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Respirao e fotossntese so processos opostos, de vital importncia para os seres vivos. O processo de respirao pode ser representado por: C6H12O6 + 6O2 6CO2 + 6H2O + ENERGIA (glicose) Com base nas informaes anteriores, pode-se afirmar: (01) Respirao uma reao de combusto. (02) Na fotossntese, as plantas usam dixido de carbono do ar atmosfrico para produzir acares, entre outras substncias. (04) A fotossntese uma reao de oxidao. (08) Durante a respirao, um mol de oxignio forma seis moles de dixido de carbono. (16) A respirao um processo exotrmico. 01 + 02 + 016 = 19 1583. As clulas musculares, quando submetidas a um esforo fsico intenso, podem obter energia a partir dos processos de a) fermentao e quimiossntese. b) respirao e quimiossntese. c) digesto e fermentao. d) digesto e quimiossntese. e) respirao e fermentao. [E] 1584. Um bombeiro, ao ser chamado para atender uma vtima de afogamento, tinha sua disposio trs recipientes numerados, cujos componentes e respectivas propores esto discriminadas a seguir: I. 100% de O2 II. 95% de O2 e 5% de CO2 III. 80% de N2 e 20% de O2 O procedimento mais correto seria utilizar o recipiente a) I porque o O2 puro supre as exigncias respiratrias dos tecidos. b) I porque o O2 puro estimula a medula ssea a produzir hemcias. c) II porque alm da porcentagem de O2, h o CO2 que estimula o bulbo a recomear os movimentos respiratrios. d) III porque alm do O2 praticamente a mesma do ar atmosfrico. e) III porque alm do O2, h o N2 que estimula o processo respiratrio e atua sobre o cerebelo. [C] 1585. Entre os animais de respirao cutnea, o oxignio atravessa a epiderme e transportado por vasos sangneos at os tecidos, em a) sapos e minhocas. b) lombrigas e rs. c) esponjas e medusas. d) planrias e minhocas. e) pererecas e planrias. [A] 1586. Uma das causas de dor e sensao de queimao nos msculos, decorrentes de esforo fsico intenso, a presena de muito cido lctico nas clulas musculares. Isso ocorre quando essas clulas a) realizam intensa respirao celular, com produo cido lctico. b) recebem suprimento insuficiente de gs oxignio e realizam fermentao. c) realizam intensa respirao celular produzindo excesso de ATP. d) recebem estmulos nervosos sucessivos e acumulam neurotransmissores. e) utilizam o acar lactose como fonte de energia. [B]

a) A fase (2) pode ser realizada tanto por auttrofos quanto por hetertrofos. b) As substncias de "b" so mais energticas que as de "a". c) A fase (1) pode ser realizada por alguns indivduos incapazes de efetuar a fotossntese. d) As substncias de "a" so orgnicas e resultantes do processo de sntese a partir de "b". e) Respirao, fotossntese, fermentao e putrefao so processos que podem estar envolvidos no esquema apresentado. [B] 1578. Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos. A MITOCNDRIA, que uma das mais importantes organelas celulares, possui DNA, RNA e ribossomos, o que a torna apta sntese protica. Dentre as alternativas a seguir, assinale as que exemplificam outros processos que ocorrem na mitocndria. 01. Ciclo de Krebs. 02. Intercmbio de substncias entre a clula e o meio. 04. Gliclise. 08. Fosforilao oxidativa. 16. Regulao osmtica da clula. 01 + 08 = 09 1579. Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos. Nas rs, os papis relativos da pele e dos pulmes na respirao se modificam de acordo com a poca do ano. Analise a figura a seguir, que mostra a captao de oxignio por esses dois rgos ao longo do ano, no hemisfrio norte, e assinale as alternativas corretas:

01. nos meses frios (dez/jan/fev) a captao de oxignio baixa e a pele capta mais oxignio do que os pulmes;

141 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1587. Em relao s etapas da respirao, provavelmente a gliclise foi a primeira a surgir porque: a) a etapa mais rica na produo de ATP. b) o O2 fundamental para que todo o processo ocorra. c) a maioria dos seres depende de O2 livre. d) os organismos primitivos devem ter surgido em atmosfera sem O2. e) a produo de ATP no se faz sem a molcula de O2. [D] 1588. Compare (I) fotossntese e (II) respirao. Assinale a alternativa cujos conceitos esto trocados (invertidos): a) (I) a energia armazenada; (II) a energia liberado; b) (I) o gs carbnico aproveitado; (II) o gs carbnico liberado; c) (I) s ocorre durante o dia; (II) ocorre durante o dia e a noite; d) (I) s ocorre nas plantas; (II) ocorre nos animais e plantas; e) (I) a reao libera gua; (II) a reao usa gua. [E] 1589. A seqncia correta das estruturas do sistema respiratrio : a) boca - fossas nasais - laringe - brnquio - traquia - faringe; b) fossas nasais - faringe - laringe - traquia - brnquio - pulmes; c) boca - faringe - pulmes - corao - traquia - brnquios; d) fossas nasais - faringe - laringe - pulmes corao traquia; e) boca - fossas nasais - pulmes - brnquios faringe traquia. [B] 1590. O mecanismo respiratrio dos animais est, muitas vezes, relacionado com o meio em que vive. Os animais aquticos tm geralmente respirao branquial e os terrestres, respirao pulmonar, alguns animais respiram tambm pelo tegumento ou pele (respirao cutnea), ou por meio de traquias. Assinale a seguir a seqncia de nomes de animais que tm, respectivamente, respirao cutnea, branquial e traqueal: a) sapo, baleia e homem. b) pingim, golfinho e borboleta. c) r, peixe e gafanhoto. d) minhoca, tubaro e morcego. e) gafanhoto, mexilho e baleia. [C] 1591. A equao simplificada a seguir, representa o processo de fermentao realizado por microorganismos como o 'Saccharomyces cerevisiae' (levedura). A B +C A, B e C so, respectivamente: a) glicose, gua e gs carbnico. b) glicose, lcool e gs carbnico. c) lcool, gua e gs carbnico. d) lcool, glicose e gs oxignio. e) sacarose, gs carbnico e gua. [B] 1592. Relacione a coluna I com a coluna II: Coluna I 1. fermentao alcolica 2. fermentao ltica 3. fermentao actica Coluna II ( ) fabricao de po ( ) produo de vinagre ( ) fabricao de queijos A seqncia correta, de cima para baixo, na coluna II : a) 1, 2, 3 b) 1, 3, 2 c) 2, 1, 3 d) 2, 3, 1 e) 3, 1, 2 [B] 1593. Brnquias e pulmes so rgos cuja estrutura reflete a funo que exercem. O contedo dessa afirmao baseia-se, principalmente, no fato de ambas apresentarem: a) estrutura ramificada, que possibilita grande superfcie de contato com a gua ou com o ar atmosfrico. b) estrutura compacta, que acarreta grande proteo das dobras por onde os gases se difundem. c) grande nmero de canais, o que faz com que o gs oxignio v diretamente para as clulas de todo o corpo. d) rica vascularizao, que permite ao organismo a eliminao rpida do gs oxignio. e) extensa rede de leuccitos, que estimula a maior captao de gases da gua ou do ar atmosfrico. [A] 1594. O processo qumico realizado por certos microorganismos e que tem como produtos finais lcool e gs carbnico denomina-se: a) fotossntese b) sudao c) respirao d) fermentao e) fotlise [D]

1595. A respirao um fenmeno representado por uma constante troca de gases entre os seres vivos e o meio ambiente. A maioria dos seres vivos desenvolveu estruturas especiais para absoro de oxignio e eliminao de dixido de carbono. Os vertebrados apresentam respirao a) cutnea, traqueal e pulmonar. b) traqueal e pulmonar. c) traqueal, branquial pulmonar. d) cutnea, branquial e pulmonar. e) cutnea, branquial, traqueal e pulmonar. [D] 1596. "Os ...(I)..., por no apresentarem pigmentos respiratrios no sangue, no apresentam associao entre os sistemas ...(II)... e ...(III)... ." Para completar corretamente essa frase, os espaos I, II e III devem ser preenchidos, respectivamente, por: a) insetos - respiratrio - circulatrio. b) nematides - respiratrio - circulatrio. c) aneldeos - respiratrio - excretor. d) moluscos - circulatrio - excretor. e) crustceos - circulatrio - excretor. [A] 1597. Durante a Preparao do po, para que a massa cresa, adiciona-se um pouco de fermento ('Saccharomyces sp'.). O crescimento da massa est relacionado com a: a) embebio da farinha pela gua eliminada pelo fungo. b) dilatao da massa em virtude da alta temperatura do forno. c) formao de vapor d'gua no interior da massa. d) formao de gs carbnico resultante da fermentao. e) proliferao extraordinria do fermento em funo da temperatura. [D] 1598. Um tcnico, ao colher o sangue de uma pessoa, preparar um esfregao e observar ao microscpio, constatou algumas coisas. Observe a figura a seguir e analise as afirmaes, destacando as verdadeiras:

I- As hemcias, vistas ao microscpio, so amareladas, porque so jovens (sem ncleo) e ainda no fabricaram hemoglobina. II- A hemoglobina das hemcias tanto se combina com o oxignio como com o gs carbnico, garantindo as trocas gasosas. III- O dixido de carbono um gs nocivo respirao, pois, ao combinar-se com a hemoglobina, forma um produto estvel impedindo o O2 de chegar s clulas. Est(o) correta(s) somente a(s) afirmativa(s): a) I b) II c) III d) I e II e) I e III [B] 1599. O controle da freqncia respiratria humana feito pelo __________ baseado na taxa de __________ sangneo, que transportado principalmente na forma de __________ . Assinale a alternativa que preenche correta e respectivamente os espaos da frase anterior. a) crebro; O2; oxiemoglobina b) cerebelo; CO2; carboemoglobina c) bulbo; CO2; bicarbonato d) cerebelo; O2; oxiemoglobina e) crebro; CO2; bicarbonato [C] 1600. O elemento carbono presente nas molculas que constituem os seres vivos restitudo ao ambiente, em forma aproveitvel pelas plantas, atravs da a) ao desnitrificadora de bactrias do solo. b) ao fotossintetizante de organismos produtores. c) respirao celular de produtores e consumidores. d) transformao da amnia em nitritos. e) liberao de gs oxignio pelas algas. [C] 1601. Assinale a alternativa que indica o comportamento da caixa torcica, dos msculos intercostais e do diafragma durante a expirao humana. a) A caixa torxica aumenta de volume, os msculos intercostais contraem-se e o diafragma abaixa.

142 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) A caixa torxica aumenta de volume, os msculos intercostais contraem-se e o diafragma levanta. c) A caixa torxica diminui de volume, os msculos intercostais contraem-se e o diafragma levanta. d) A caixa torxica diminui de volume, os msculos intercostais relaxam-se e o diafragma levanta. e) A caixa torxica diminui de volume, os msculos intercostais relaxam-se e o diafragma abaixa. [D] 1602. Os seres vivos podem obter energia por meio da respirao aerbica ou anaerbica. Sobre esses processos CORRETO afirmar que: a) na respirao aerbica no necessria a presena de oxignio; b) a respirao aerbica possui um rendimento energtico muito menor que a respirao anaerbica; c) a fermentao alcolica uma modalidade da respirao anaerbica; d) apenas seres pluricelulares promovem a respirao anaerbica; e) apenas organismos terrestres promovem a respirao aerbica. [C] 1603. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Os vrios rgos nos seres vivos trabalham interagindo uns com os outros de modo que o organismo, tanto animal como vegetal, funcione em harmonia e equilbrio. Portanto, sobre as funes nos animais e vegetais, correto afirmar que: 01 - A epiderme, parnquima palidico, estmatos e parnquima lacunoso so estruturas vegetais que servem respectivamente para proteo, fotossntese, trocas gasosas e fotossntese. 02 - No ser humano as aes inconscientes em resposta a estmulos sensoriais so chamadas de atos reflexos. 04 - A respirao aerbica a queima qumica de substncias obtidas pela nutrio, com liberao de energia, o que exige do organismo consumo de oxignio e resulta em eliminao de gs carbnico e gua. 08 - A ao da saliva e dos dentes sobre os alimentos ocorre apenas para facilitar deglutio. 16 - Quanto funo, as estruturas vegetais esclernquima e parnquima de reserva so equivalentes, respectivamente, ao sangue e ao tecido adiposo dos animais. 32 - Na respirao branquial dos peixes, a gua contendo O dissolvido entra pela boca e sai pelas fendas branquiais, sendo que nesse trajeto o O recolhido pela ampla vascularizao presente nas brnquias. 01 + 02 + 04 + 32 = 39 1604. Assinale a afirmativa correta sobre a maneira como os seres vivos retiram a energia da glicose: a) O organismo, como precisa de energia rapidamente e a todo tempo, faz a combusto da glicose em contato direto com o oxignio. b) Como a obteno de energia no sempre imediata, ela s obtida quando a glicose reage com o oxignio nas mitocndrias. c) A energia, por ser vital para a clula, obtida antes mesmo de a glicose entrar nas mitocndrias usando o oxignio no citoplasma, com liberao de duas (O2) molculas de ATP (gliclise). d) A energia da molcula de glicose obtida atravs da oxidao dessa substncia pela retirada de hidrognios presos ao carbono (desidrogenaes), que ocorre a nvel de citoplasma e mitocndrias. e) A obteno de molculas de ATP feita por enzimas chamadas desidrogenases (NAD) depois que a molcula de oxignio quebra a glicose parcialmente no hialoplasma (gliclise). [D] 1605. A relao superfcie/volume implica vrias conseqncias fisiolgicas. Assim, a taxa de troca com o ambiente diretamente proporcional superfcie de contato, e a massa proporcional ao volume; ou seja: maior volume, mais consumo de alimento e de oxignio. Com relao ao pargrafo anterior, so feitas as seguintes afirmativas: I - A estrutura respiratria de grandes animais apresenta dobramentos que aumentam a rea de absoro. II - Os animais de grande porte tm uma taxa metablica maior do que a dos pequenos. III - Em vrios animais, o aumento da superfcie se d em relao a dimenses lineares, e o volume aumenta em relao a dimenses cbicas. Quais esto corretas? a) Apenas I b) Apenas II c) Apenas I e II d) Apenas I e III e) Apenas II e III [D] 1606. O deslocamento de um atleta para locais de grande altitude pode acarretarlhe algumas alteraes no organismo. A curto prazo, provoca modificaes da atividade respiratria e, a longo prazo, produz alteraes sangneas. Assim, este indivduo apresenta a) hiperventilao e diminuio do nmero de hemcias. b) hiperventilao e aumento do nmero de hemcias. c) hipoventilao e diminuio do nmero de hemcias. d) hipoventilao e aumento do nmero de hemcias. e) isoventilao e manuteno do nmero de hemcias. [B]

1607. A uma condio padro de temperatura e de presso, 1 mol de um gs ocupa 22,3 litros de volume. Considerado que a solubilidade do dixido de carbono no plasma de 0,03 mmol/mmHg/litro de plasma, calcule esta solubilidade em mililitros/mm Hg/litro de plasma. a) 0,10 b) 1,37 c) 0,67 d) 2,34 e) 11,89 [C] 1608. Cigarros viram droga nos E.U.A. Washington - O presidente americano, Bill Clinton, deve anunciar amanh, que o cigarro passa a ser considerado uma droga que vicia, de acordo com a proposta da F.D.A. (Federal Drug Administration) .... Com relao ao fumo assinale a opo que encerra a afirmao INCORRETA. a) O fumo ocasiona problemas de sade, com sobrecarga do sistema crdiorespiratrio. b) Os fumantes "passivos" no apresentam risco de desenvolver doenas respiratrias ou mesmo cardiovasculares. c) O fumo afeta o sistema nervoso central, podendo ocasionar distrbios do sono. d) Existe uma forte correlao entre o cncer de pulmo e o hbito de fumar. e) Quando submetidas exposio de fumaa de cigarro, mesmo antes do nascimento, as crianas apresentam maior risco de sofrer morte sbita. [B] 1609. O ritmo respiratrio, que depende da quantidade de determinado gs no sangue, controlado pelo bulbo. Desta forma, considere as seguintes afirmaes: I - No caso de esforo fsico, h uma diminuio da quantidade de oxignio dissolvido no plasma, percebida pelo bulbo, o que provoca aumento do ritmo respiratrio. II - Por estmulo do bulbo, ocorre contrao do diafragma e conseqente aumento do volume pulmonar, o que fora a entrada de ar. III - O controle exercido pelo bulbo inconsciente. Ento apenas: a) I est correta. b) II est correta. c) I e III esto corretas. d) II e III esto corretas. e) I e II esto corretas. [D] 1610. Os mamferos aquticos apresentam adaptaes vida nesse ambiente, sendo uma delas a presena de MIOGLOBINA nas clulas musculares. Sabendo que a mioglobina semelhante hemoglobina, ento a presena daquela substncia nos msculos tem como objetivo: a) armazenar oxignio, permitindo que o animal permanea por mais tempo debaixo da gua sem respirar. b) melhorar o fluxo de sangue pelos msculos do animal, melhorando sua oxigenao. c) aumentar a presso sangnea, favorecendo contraes musculares, facilitando sua eliminao. d) retirar maior quantidade de gs carbnico das clulas musculares, facilitando sua eliminao. e) reduzir a quantidade de hemcias no sangue, permitindo a circulao mais rpida do mesmo. [A] 1611. Qual dentre as seguintes estruturas de um peixe pode ser considerada homloga ao pulmo de um anfbio? a) Bexiga natatria. b) Estmago. c) Cavidade branquial. d) Intestino. e) Nadadeiras mpares. [A] 1612. Analise o esquema simplificado a seguir:

As fases 1 e 2 do esquema resumem, respectivamente: a) fotossntese e fermentao b) respirao e fotossntese c) fermentao e respirao d) fotossntese e respirao [D] 1613. O esquema a seguir resume o consumo (X) e a produo (Y) de ATP, na gliclise, por molcula de glicose oxidada:

143 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[E] 1619. Dois animais, A e B, tm sistema circulatrio aberto. O sistema respiratrio de A traqueal, e o de B, branquial. Com base nessa descrio, escolha a alternativa correta. a) A pode ser uma barata e B pode ser um peixe. b) A pode ser um gafanhoto e B pode ser um mexilho. c) A pode ser um caracol e B pode ser uma mariposa. d) A pode ser uma minhoca e B pode ser uma aranha. e) A pode ser uma aranha e B pode ser uma planria. [B] 1620. A proibio do fumo em bares e restaurantes, adotada em So Paulo em 1995, com o intuito de proteger o no-fumante (fumante passivo), gerou grande polmica, inclusive jurdica. Todas as alternativas contm argumentaes sobre as aes da fumaa do tabaco que so comprovadamente aceitas, EXCETO a) causa problemas respiratrios, principalmente em crianas. b) contm monxido de carbono, que bloqueia a funo de certas clulas sangneas. c) contm nicotina que libera a adrenalina que despigmenta a pele. d) tem ao cancergena tanto para o fumante ativo quanto para o passivo. [C] 1621. Este grfico refere-se taxa metablica de cinco animais de diferentes pesos corporais em um determinado intervalo de tempo.

Os valores de X e Y so, respectivamente: a) 2 e 4 b) 4 e 2 c) 2 e 8 d) 8 e 4 [A] 1614. Considere as duas listas a seguir. I. cavalo - marinho II. tartaruga III. sapo a. pulmonar b. branquial c. cutnea A alternativa que relaciona corretamente cada animal a seu tipo de respirao a) I - a; II - b; III - c b) I - b; II - a; III - c c) I - b; II - c; III - a d) I - c; II - a; III - b e) I - c; II - b; III a [B] 1615. A observao da figura nos permite afirmar que:

Com base no grfico e em seus conhecimentos, correto afirmar que a) a digesto mais eficiente no cavalo do que no coelho. b) a taxa de consumo de oxignio maior no coelho do que no rato. c) a taxa de metablica depende da relao entre a superfcie e o volume corpreo. d) a taxa metablica diretamente proporcional ao peso corporal. [C] 1622. Os grficos a seguir mostram os efeitos do aumento de gs carbnico presente no ar inspirado por uma pessoa sobre a quantidade mdia de ar inspirado (grfico 1) e sobre a freqncia mdia de inspiraes por minuto (grfico 2)

a) a molcula de glicose sofrer um pequeno desdobramento com pouca produo de energia. b) a "desmontagem" da glicose se d pela remoo gradativa dos seus hidrognios (desidrogenao). c) NAD, FAD e O2 so substncias fundamentais no processo, j que funcionaram como aceptores intermedirios de hidrognio. d) a dupla membrana da figura constitui um fator importante para a ocorrncia do Ciclo de Krebs. e) a formao do cido pirvico ocorre principalmente na matriz mitocondrial. [B] 1616. Considere as seguintes etapas da respirao celular: I. Cadeia respiratria; II. Formao de Acetil-CoA; III. Ciclo de Krebs; IV. Glicose. Assinale a alternativa que contm a seqncia correta dos eventos da respirao celular: a) I, II, III e IV b) II, IV, III e I c) III, IV, I e II d) IV, II, III e I e) II, III, I e IV [D] 1617. As trocas gasosas no pulmo humano, em condies normais, ocorrem: a) nos alvolos. b) nos bronquolos. c) nos brnquios. d) na traquia. e) na laringe. [A] 1618. So doenas que podem ser provocadas ou agravadas pelo tabagismo, EXCETO: a) Cncer de pulmo. b) lcera gstrica. c) Enfarte do miocrdio. d) Enfisema pulmonar. e) Cirrose heptica.

A anlise dos dois grficos permite-se afirmar que a) o aumento da quantidade de ar inspirado e o aumento na freqncia de inspiraes independem da quantidade de gs carbnico presente no ar inspirado. b) o aumento da concentrao de gs carbnico no ar inspirado leva a um aumento na quantidade de ar inspirado e tambm a um aumento da freqncia de inspiraes. c) o aumento da concentrao de gs carbnico no ar inspirado leva a uma alterao na quantidade de ar inspirado e no provoca alterao na freqncia de inspiraes. d) o aumento da concentrao de gs carbnico no ar inspirado provoca diminuio de ventilao pulmonar, o que torna menos eficiente o aproveitamento de oxignio. e) quanto menor a concentrao de gs carbnico no ar inspirado, maior a ventilao pulmonar e, portanto, mais eficiente o aproveitamento de oxignio. [B] 1623. 6.000 a.C.: babilnios e sumrios utilizam lvedo para produzir cerveja.

144 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

4.000 a.C.: egpcios descobre como fazer po fermentado. Ainda na Antigidade: transformao do leite em iogurte e uso do mofo na elaborao de queijo. As informaes contidas no artigo anterior envolvem um processo biolgico fundamental para os seres vivos que o realizam. Todas as opes apresentam conceitos corretos sobre esse processo, EXCETO uma. Assinale-a. a) Na fabricao de iogurte e queijo o produto formado o cido lctico. b) Na fabricao de cerveja e po os produtos formados so etanol e gs carbnico. c) Nesse processo a molcula orgnica utilizada degradada a cido pirvico. d) O saldo energtico obtido, nos dois processos, de 2 ATP. e) Os seres que realizam este processo objetivam conseguir matria-prima para sua nutrio. [E] 1624. Associe as estruturas respiratrias a seguir com o respectivo grupo de animais. ESTRUTURAS RESPIRATRIAS I - pulmes saculiformes. II - pulmes parenquimatosos. III - sacos areos. IV - traquias. GRUPO DE ANIMAIS (P) aves. (Q) insetos. (R) anfbios. (S) rpteis. (T) minhocas. Assinale a opo que apresenta a associao correta. a) I - P; II - R; III - T; IV - S. b) I - P; II - T; III - S; IV - Q. c) I - R; II - S; III - P; IV - Q. d) I - R; II - Q; III - T; IV - P. e) I - S; II - R; III - Q; IV - P. [C] 1625. Considere os seguintes eventos relacionados com a respirao nos vertebrados terrestres: I. entrada do ar nos pulmes com auxlio da movimentao das costelas II. bombeamento do ar para o interior dos pulmes atravs da diminuio do espao da cavidade bucal III. passagem do ar, que penetra nos pulmes, para os sacos areos IV. penetrao do ar em uma enorme quantidade de alvolos pulmonares Ocorrem nas aves, APENAS a) I e II b) I e III c) II e III d) II e IV e) I, III e IV [B] 1626. Comparando o esquema dos dois processos metablicos abaixo representados, podemos afirmar que o(a):

II - GLICOSE CIDO PIRVICO ACETIL COENZIMA A CICLO DE KREBS. Considerando os processos anteriormente apresentados, julgue os itens a seguir. (0) I e II ocorrem nas clulas musculares. (1) I ocorre com pequena intensidade nos neurnios. (2) O rendimento energtico obtido em I maior do que o obtido em II. (3) Em termos evolutivos, II anterior a I. Itens corretos: 0 e 1 Itens errados: 2 e 3 1629. O ciclo a seguir esquematizado envolve duas importantes estruturas celulares I e II.

correto afirmar que a) as estruturas celulares I e II ocorrem apenas nos vegetais. b) as estruturas celulares I e II ocorrem nos animais e vegetais. c) a estrutura celular I ocorre apenas nos vegetais, e a II, apenas nos animais. d) a estrutura celular I ocorre apenas nos vegetais, e a II ocorre nos animais e vegetais. e) a estrutura celular I ocorre nos animais e vegetais, e a II ocorre apenas nos vegetais. [E] 1630. As clulas de nosso msculos executam, em condies normais, a respirao aerbica. Porm, durante um esforo muscular intenso, se o organismo no consegue fornecer gs oxignio suficiente para a respirao celular, as clulas musculares trabalham anaerobicamente. Esse processo anaerbico provoca dor e sensao de queimao nos msculos devido ao acmulo de: a) cido ltico. b) cido ascrbico. c) cido pirvico. d) cido actico. e) acetil-CoA. [A] 1631. Leia atentamente a afirmao a seguir e assinale a alternativa que contm os termos que preenchem, corretamente, os espaos I, II e III. A renovao de ar nas superfcies respiratrias necessria para que sejam garantidas as trocas gasosas entre o animal e seu ambiente. ...(I)... a estratgia utilizada por ...(II)... para garantir a ocorrncia de tal processo, denominado ...(III)... . a) (I) movimentao de apndices modificados, (II) peixes, (III) ventilao. b) (I) movimentao de apndices modificados, (II) peixes, (III) respirao. c) (I) variao de volume da caixa torcica, (II) peixes, (III) ventilao. d) (I) variao de volume da caixa torcica, (II) mamferos, (III) respirao. e) (I) variao de volume da caixa torcica, (II) mamferos, (III) ventilao. [E] 1632. A respirao aerbica se processa em trs etapas distintas: Gliclise, Ciclo de Krebs e Cadeia Respiratria, que visam liberao de energia a partir da quebra de molculas orgnicas complexas. Assinale a alternativa correta com relao a essas etapas. a) Atravs da cadeia respiratria, que ocorre nas cristas mitocondriais, h transferncia dos hidrognios transportados pelo NAD e pelo FAD, formando gua. b) Das etapas da respirao, a gliclise uma rota metablica que s ocorre nos processos aerbios, enquanto o ciclo de Krebs ocorre tambm nos processos anaerbios. c) O ciclo de Krebs e a gliclise ocorrem no citoplasma. d) No ciclo de Krebs, uma molcula de glicose quebrada em duas molculas de cido pirvico. e) A utilizao de O2 se d no citoplasma, durante a gliclise. [A] 1633. Considere o processo representado pela equao C6H12O6+2ADP+2P C2H5OH+2CO2+2ATP. A esse respeito, julgue os itens a seguir. (1) Durante esse processo, ocorre variao de energia. (2) A produo de lcool a partir da garapa de cana-de-arcar ocorre segundo o processo representado na equao. (3) A libertao de CO2 durante esse processo permite que ele seja empregado no processo de fabricao de pes.

a) aceptor final de hidrognios, na fermentao, o oxignio. b) molcula de glicose totalmente degradada, na fermentao. c) fermentao encontrada na maioria dos seres vivos unicelulares. d) formao de ATP na cadeia respiratria s ocorre na respirao. e) formao de cido pirvico uma exclusiva da respirao. [D] 1627. A presena de oprculo, estrutura que recobre as brnquias em peixes sseos, permite eficincia nas trocas gasosas mesmo com o peixe parado. Isto porque o oprculo possibilita melhor captao de oxignio devido (ao): a) quebra das molculas de gua. b) entrada de gua pela brnquias. c) retirada de gases da bexiga natatria. d) transporte ativo realizado por esta estrutura. e) maior contato de gua com as brnquias. [E] 1628. A glicose o acar mais usado pelas clulas vivas na obteno de energia. Seu metabolismo pode seguir, entre outros, os seguintes processos: I - GLICOSE CIDO PIRVICO CIDO LTICO,

145 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(4) O composto C2H5OH, resultante desse processo, um inibidor do sistema nervoso central. (5) As clulas musculares dos vertebrados realizam esse processo. CCCCE 1634. A evoluo dos vertebrados do meio aqutico para o ambiente terrestre foi acompanhada de modificaes morfofisiolgicas no aparelho respiratrio. Com relao a esse tema, julgue os itens que se seguem. (0) Nos anfbios, a pele constitui um importante auxiliar na respirao, devido ao fato de a taxa de oxignio ser maior no ar do que na gua. (1) Os peixes utilizam, para respirar, o oxignio dissolvido na gua. (2) A fecundao, nos rpteis, externa e dependente de gua; nos anfbios, no. (3) Nos mamferos, os pulmes alveolares atingem a mxima complexidade entre os vertebrados. Itens corretos: 1 e 3 Itens errados: 0 e 2 1635. O grfico mostra o resultado de um experimento onde se avaliou o consumo de oxignio de uma soluo, pela mitocndria, em presena de adenosina difosfato (ADP) e adenosina trifosfato (ATP).

Assinale a alternativa que indica a relao entre o processo de produo de energia e a respectiva substncia resultante. a) Em I o processo fermentao e a letra X indica a substncia gua. b) Em I o processo respirao e a letra X indica a substncia lcool. c) Em II o processo fermentao e a letra Y indica a substncia gua. d) Em II o processo respirao e a letra Y indica a substncia lcool. e) Em I o processo respirao e a letra X indica a substncia gua. [E] 1638. Observe a figura.

Logo aps cortar-se o cordo umbilical, o beb comea a respirar ar atmosfrico. O principal estmulo para desencadear esse primeiro movimento respiratrio do beb a) a falta de sangue, que deixa de pressionar o corao. b) o excesso de nitrognio atmosfrico (N2), que estimula diretamente o pulmo. c) o excesso de gs carbnico (CO2), que estimula diretamente o bulbo. d) o excesso de uria no sangue, que o torna mais bsico. [C] 1639. Observe os esquemas a seguir: A partir deste resultado, podemos afirmar que, em relao taxa de consumo de oxignio, ocorre: a) aumento pela adio de ATP e produo ADP b) aumento pela adio de ADP e produo de ATP c) diminuio pela adio de ATP e produo de ADP d) diminuio pela adio de ADP e produo de ATP [B] 1636. Analise os esquemas a seguir que reproduzem alguns dos tipos de estruturas respiratrias presentes nos animais.

A estrutura onde ocorrem as trocas gasosas nos insetos est representada no esquema de nmero: a) 1 b) 2 c) 3 d) 4 [B] 1637. No esquema a seguir os algarismos I e II referem-se a dois processos de produo de energia. As letras X e Y correspondem s substncias resultantes de cada processo.

Assinale a alternativa que explica corretamente a diferena de rendimento energtico entre os processos 1 e 2. a) O processo 1 pode ser uma das etapas da fotossntese, produzindo lcool etlico, enquanto que o processo 2 a respirao aerbica e libera muita energia na forma de ATP. b) O processo 1 pode ser uma das etapas da respirao aerbica, produzindo lcool etlico, enquanto o processo 2 a fotossntese e libera muita energia na forma de ATP. c) O processo 1 anaerbico, e parte da energia fica no lcool etlico, enquanto o processo 2 aerbico, e a energia vem da glicose decomposta em gua e gs carbnico. d) O processo 1 aerbico, e parte da energia fica no lcool etlico, enquanto que o processo 2 anaerbico, e a energia vem da degradao da glicose em gua e gs carbnico. e) O processo 1 um tipo de fermentao com baixa produo de ATP, ficando a energia no gs carbnico liberado, enquanto que o processo 2 uma fermentao completa, liberando energia na forma de 38 ATP. [C] 1640. Considere a seguinte frase sobre respirao: "O ar entra nos pulmes quando ocorre ...(I)... do diafragma, ...(II)... dos msculos intercostais e conseqente ...(III)... da presso ...(IV)... ." Para complet-la corretamente , I, II, III e IV devem ser substitudos, respectivamente, por a) contrao - contrao - aumento - interna b) contrao - contrao - diminuio - interna c) contrao - relaxamento - aumento - externa d) relaxamento - contrao - diminuio - externa e) relaxamento - relaxamento - aumento interna [B] 1641. O grfico a seguir mostra as curvas de dissociao do oxignio. A curva indica a concentrao relativa de oxignio preso hemoglobina em diferentes tenses ou concentraes de oxignio.

146 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) O ciclo das pentoses ocorre nos nmeros I, II e III. [C] 1647. A casca do ovo da galinha permevel para gases, mas impermevel para a gua no estado lquido. Um ovo que pesa 60 gramas, comea a ser incubado. Durante os 21 dias de incubao, o embrio retira 8,6g de oxignio do ambiente e devolve atmosfera 8,8g de dixido de carbono e 8,8 g de vapor d'gua. Antes da ecloso, esse ovo deve pesar, em gramas, a) 33,8 b) 42,6 c) 51,0 d) 60,0 e) 68,6 [C] 1648. A estrutura a seguir, na forma como est representada, refere-se a:

O animal cujo sangue tem mais capacidade de ligar e carrear o oxignio : a) girino b) homem c) elefante d) camundongo [A] 1642. A troca gasosa de oxignio e gs carbnico nos alvolos se faz: a) atravs de pinocitose do fluido bronquiolar pelo capilar. b) por diferena de tenso desses gases entre o alvolo e o capilar. c) atravs da associao desses gases com protenas transportadoras no bronquolo. d) pela ao de enzimas que aumentam o poder de penetrao dos gases no capilares. e) por transporte ativo, que envolve a ao de permeases. [B] 1643. Assinale o animal que NO possui respirao cutnea: a) Estrela-do-mar. b) Gafanhoto. c) Planria. d) Nematdeo. e) Porfero. [B] 1644. Considere o esquema a seguir, referente ao processo respiratrio de uma clula eucariota: Glicose (I) cido Pirvico (II) Acetil CoA (III) Ciclo de Krebs (IV) Cadeia Respiratria (V) Assinale a afirmativa INCORRETA: a) Para que I se transforme em II, necessrio o gasto de ATP. b) As fases I e II ocorrem fora da mitocndria. c) Na converso de II para III, no h produo local de ATP. d) Em IV ocorre liberao de CO2 e formao local de ATP. e) Em V h quebra da molcula de gua, com liberao de oxignio. [E] 1645. Assinale o animal cujo sistema circulatrio NO tm a funo de transporte de gases: a) Minhoca. b) Barata. c) Polvo. d) Lagosta. e) R. [B] 1646. O processo de respirao celular pode ser dividido em trs etapas bsicas. O esquema a seguir representa uma mitocndria inserida no hialoplasma, com as indicaes I, II e III.

a) um aminocido essencial com funo enzimtica na clula. b) um nucleotdeo que participa da estrutura qumica dos cidos nuclicos. c) um nucleosdeo estvel que participa da estrutura qumica dos cidos nuclicos. d) um carboidrato no hidrolisvel que atua no metabolismo celular. e) um nucleotdeo que participa de reaes bioqumicas como fornecedor de energia. [E] 1649. Muitas academias de ginstica estimulam seus alunos a passar horas "malhando pesado", o que pode acarretar fadiga muscular e dores. Esses sintomas devem-se a) diminuio da concentrao do ATP e conseqente acmulo de cido ltico nas fibras musculares, devido gliclise anaerbia. b) ao rompimento das fibras musculares, o que impede o deslizamento das miofibrilas. c) a estimulaes repetidas e involuntrias que produzem uma contrao muscular uniforme mantida. d) queda na concentrao plasmtica de ons clcio, impedindo a interao entre a miosina e a actina. e) exausto da substncia neurotransmissora acetilcolina na placa motora. [A] 1650. Relacione a coluna I (sistema respiratrio) com a coluna II (classe de animais). COLUNA I (1) Traquias (2) Brnquias COLUNA II ( ) Chilopoda ( ) Insecta ( ) Crustcea ( ) Diplopoda Indique a opo que contm a seqncia correta, de cima para baixo, na coluna II. a) 1,1, 2, 1 b) 1, 2, 2,1 c) 2, 1, 1, 2 d) 2, 1, 2, 2 [A] 1651. Com relao energtica da clula, correto afirmar que 01. uma clula muscular passa a transformar cido pirvico em cido lctico em condies anaerbicas. 02. o processo quer permite as clulas retirar a energia acumulada nos compostos orgnicos a respirao celular. 04. tanto o processo de respirao aerbica como a fermentao ocorre em trs etapas: glicose, ciclo de Krebs e cadeia respiratria. 08. lipdios e protenas no so utilizados como combustveis pela clula, mesmo na ausncia de glicose. 16. a partir de 2 molculas de glicose so produzidas 6 molculas de piruvato e 12 molculas de ATP. 32. a gliclise e o ciclo de Krebs ocorrem no interior das mitocndrias. VVFFFF 1652. No que se refere respirao celular, assinale a alternativa correta. a) A respirao celular divide-se em trs fases: a Gliclise (que ocorre no citoplasma), o Ciclo de Krebs (que ocorre na mitocndria) e a Cadeia Respiratria (que ocorre na mitocndria). b) A Gliclise a fase aerbica da respirao que consiste na degradao da glicose at a formao do cido pirvico. c) Na Gliclise, h a oxidao de molculas de NAD em NADH2 e ADP, sendo essa a fase mais energtica da respirao celular dos mamferos.

Observe o esquema e assinale a afirmativa CORRETA: a) A fosforilao oxidativa ocorre no nmero III. b) A gliclise ocorre no nmero I. c) O ciclo de Krebs ocorre no nmero II. d) A etapa fotoqumica ocorre nos nmeros I e II.

147 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

d) No Ciclo de Krebs, o gs-carbnico liberado da transformao do cido pirvico em cido ctrico, processo que consome 2 ATPs. e) Na Cadeia Respiratria, o FAD ganha H+ e se transforma em FADH2, liberando CO2 e H2O. [A] 1653. Em uma situao experimental, camundongos respiraram ar contendo gs oxignio constitudo pelo istopo 18O. A anlise de clulas desses animais dever detectar a presena de istopo 18O, primeiramente, a) no ATP. b) na glicose. c) no NADH. d) no gs carbnico. e) na gua. [E] 1654. Observe o grfico, que representa o gasto de energia de uma pessoa andando em marcha e correndo em uma esteira rolante, na posio horizontal, em aclive e em declive.

d) ecdisona. [D]

e) adrenalina.

1658. A tatuagem, um adorno corporal utilizado entre jovens do mundo inteiro, consiste na aplicao de pigmentos intradrmicos. O pigmento utilizado no processo a) degradado pelos mastcitos ao longo do tempo. b) fagocitado pelos histicitos da pele e permanece indefinidamente. c) fica impregnado na substncia fundamental do tecido epitelial. d) forma, por deposio, uma nova camada sob a membrana basal. e) tinge as fibras colgenas da pele. [C] 1659. Considere as caractersticas a seguir. I. epiderme pluriestratificada II. epiderme muito queratinizada III. corpo revestido com escamas epidrmicas. Para os rpteis a) apenas I verdadeira. b) apenas II verdadeira. c) apenas I e II so verdadeiras. d) apenas II e III so verdadeiras. e) I, II e III so verdadeiras. [E] 1660. Considere os seguintes anexos da pele de vertebrados: I. penas das aves II. escamas de peixes III. escamas de cobras e lagartos IV. unhas e cascos de mamferos So de origem epidrmica a) apenas I, II e III b) apenas I, II e IV c) apenas I, III e IV d) apenas II, III e IV e) I, II, III e IV [C] 1661. Tecido formado por uma ou mais camadas celulares, sem vascularizao, com pouqussima substncia intercelular, muitas estruturas de adeso das clulas, podendo ter funo de absoro ou secreo. A descrio se refere ao tecido: a) cartilaginoso. b) muscular. c) nervoso. d) epitelial. e) adiposo. [D] 1662. Os terminaes nervosas da pele relacionados percepo da dor so as (os) a) corpsculos de Vater-Paccini. b) corpsculos de Krause. c) terminaes livres. d) corpsculos de Meissner. e) corpsculos de Ruffini. [C] 1663. Os terminaes nervosas da pele relacionados percepo do calor so as (os) a) corpsculos de Vater-Paccini. b) corpsculos de Krause. c) terminaes livres. d) corpsculos de Meissner. e) corpsculos de Ruffini. [E] 1664. Os terminaes nervosas da pele relacionados percepo do frio so as (os) a) corpsculos de Vater-Paccini. b) corpsculos de Krause. c) terminaes livres. d) corpsculos de Meissner. e) corpsculos de Ruffini. [B] 1665. Os terminaes nervosas da pele relacionados percepo da presso so as (os) a) corpsculos de Vater-Paccini. b) corpsculos de Krause. c) terminaes livres. d) corpsculos de Meissner. e) corpsculos de Ruffini. [A] 1666. Os terminaes nervosas da pele relacionados percepo do tato so as (os) a) corpsculos de Vater-Paccini. b) corpsculos de Krause. c) terminaes livres. d) corpsculos de Meissner.

Considerando-se os dados desse grfico, todas as seguintes afirmativas esto corretas, EXCETO a) Do ponto de vista energtico, correr nem sempre implica maior gasto de energia do que andar (marchar). b) Durante a corrida, qualquer que seja a inclinao da esteira, se a velocidade de 12km/h, o consumo energtico o mesmo. c) Mesmo quando uma pessoa est parada, seu consumo energtico no nulo. d) Durante a corrida, qualquer que seja a inclinao da esteira, a relao entre a velocidade e captao de oxignio linear. [B] 1655. Um animal X, recentemente descoberto, apresenta as caractersticas abaixo quanto respirao e circulao. X possui respirao area, efetuada atravs de uma estrutura respiratria fina e ramificada, a qual fica alojada em uma cavidade respiratria interna. Existem 5 (cinco) orifcios externos para a entrada de ar nessa cavidade, comunicando-se com ela atravs de tubos reforados por anis de quitina. Um pequeno conjunto de msculos auxilia na expanso e retrao da cavidade respiratria, possibilitando a entrada e a sada do ar ambiental. As trocas gasosas ocorrem entre a estrutura respiratria e inmeros vasos sangneos a ela associados, cujo sangue contm pigmentos que auxiliam no transporte dos gases respiratrios. Esses vasos sangneos so ramificaes de um vaso principal que transporta o sangue bombeado pelo corao. Este sangue, aps a oxigenao, retorna por um outro vaso ao corao, onde se mistura ao sangue venoso. Com relao s caractersticas descritas acima, correto afirmar: 01) A estrutura respiratria de X, fina e ramificada, facilita as trocas gasosas no animal, pela diminuta espessura a ser atravessada pelos gases e pela grande superfcie de contato entre ar e sangue. 02) O fato de a estrutura respiratria de X ficar alojada numa cavidade respiratria est diretamente relacionado ao hbito da respirao area desse animal. 04) A presena de pigmentos transportadores de gases respiratrios no sangue permite classificar X unicamente como animal vertebrado. 08) O vaso de X que transporta o sangue do corao at a estrutura respiratria tem funo anloga das veias pulmonares dos vertebrados. 16) Os msculos que promovem alterao de volume da cavidade respiratria de X desempenham uma funo anloga do diafragma, no homem. 32) A circulao de X do tipo dupla e completa, como aquela existente nas aves e mamferos. VVFFVF 1656. A temperatura do corpo da maioria dos animais acompanha a variaes da temperatura do ambiente. Temperaturas muito baixas podem determinar a paralisao das atividades do animal e, at mesmo, sua morte. Animais que conseguem manter a temperatura do corpo e nveis ideais do metabolismo, apesar das variaes do ambiente so os(as): a) tubares. b) sapos. c) cobras. d) baleias. e) jacars. [D] 1657. Durante o vero, podemos ouvir, com freqncia, o canto das cigarras, que um som emitido pelos machos para atrair as fmeas ao acasalamento. Nesse mesmo perodo, observamos exoesqueletos de cigarras presos s rvores, que popularmente so mencionados como cigarras "estouradas" de tanto cantar. Sabe-se que, na verdade, o resultado do crescimento que ocasiona as "mudas" nos insetos.O hormnio responsvel pelas "mudas" nos insetos o(a): a) feromnio. b) cido abcsico. c) auxina.

148 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) corpsculos de Ruffini. [D] 1667. O sentido do tato proporcionado pela presena de corpsculos neuroepiteliais situados nas estruturas da pele e das mucosas. Os corpsculos que percebem as sensaes de frio e presso, nessa ordem, denominam-se: a) Ruffini e Krause b) Ruffini e Vater-Paccini c) Ruffini e Meissner d) Krause e Vater-Paccini e) Krause e Meissner [D] 1668. As afirmativas a seguir so relacionadas aos mecanismos termorreguladores presentes em seres homeotrmicos: I - A manuteno da temperatura corprea importante, porque a hipotermia e a hipertermia causam avarias no funcionamento enzimtico. II - Em baixas temperaturas ambientais, a vasodilatao perifrica diminui o fluxo sanguneo, implicando o aquecimento das partes externas do corpo, que passam calor para os tecidos internos. III - Em altas temperaturas ambientais, um fator bsico de regulao a sudorese, pois a gua do suor evapora, retirando calor da pele, o que no permite que a temperatura do corpo se eleve muito. Assinale a(s) afirmativa(s) correta(s): a) Apenas I, b) Apenas I e I; c) Apenas I e III. d) Apenas II e III. e) I, II e III. [C] 1669. A origem embrionria da pele humana : a) ectodrmica e mesodrmica. b) ectodrmica e endodrmica. c) mesodrmica e endodrmica. d) somente ectodrmica. e) somente mesodrmica. [A] 1670. Considere as seguintes funes do tegumento dos animais em geral: I. proteger o organismo II. realizar trocas gasosas III. secretar substncias lubrificantes IV. manter a temperatura do corpo Com relao pele dos vertebrados, pode-se verificar em todos os grupos a) apenas I b) apenas I e II c) apenas I e III d) apenas I, II e III e) I, II, III e IV [A] 1671. Considere os mecanismos relacionados com a manuteno da temperatura corporal do homem. I - Relaxamento dos msculos involuntrios. II - Diminuio da taxa de metabolismo. III - Contraes musculares involuntrias. IV - Respirao ofegante. V - Aumento da taxa de metabolismo. Os mecanismos que permitiro manter a temperatura corporal de um homem em uma sauna, submetida a uma temperatura acima de 40C so, apenas, a) III, IV e V. b) I, II e V. c) I, II e IV. d) I, IV e V. e) II, III e IV. [C] 1672. Durante o vero, deparamo-nos com temperaturas ambientais muito elevadas, que provocam elevao da temperatura corporal, desencadeando respostas reguladoras. Escolha, entre as alternativas a seguir, a que apresenta o conjunto correto de respostas reguladoras desencadeadas pela elevao da temperatura corporal. a) Aumento da presso arterial e sudorese b) Constrio das arterolas da pele e tremores c) Dilatao das arterolas da pele e sudorese d) Arritmia cardaca e tremores e) Diminuio da presso arterial e tremores [C] 1673. A capacidade de coagulao do sangue muito reduzida nos portadores de hemofilia. Para os hemoflicos, um pequeno ferimento pode representar um grande risco. A protena sangnea que atua no processo de coagulao o(a): a) fibrinognio. b) pepsinognio. c) mucina. d) heparina. e) hemoglobina. [A] 1674. No tecido sangneo humano, a substncia intersticial liquida e os neutrfilos podem ser responsveis, respectivamente, a) pelo transporte de alimentos e transporte de oxignio. b) pelo transporte de gs carbnico e transporte de oxignio. c) pela produo de hemcias e fagocitose de elementos estranhos ao organismo.

d) pela fagocitose de elementos estranhos ao organismo e transporte de gs carbnico. e) pelo transporte de gs carbnico e fagocitose de elementos estranhos ao organismo. [E] 1675. A pessoa infectada pelo vrus da AIDS apresenta queda acentuada de imunidade devido reduo do nmero de a) linfcitos. b) neutrfilos. c) macrfagos. d) moncitos. e) hemcias. [A] 1676. A substncia que impede a coagulao do sangue humano nos vasos sanguneos (ou so) a) a trombina. b) a heparina. c) o fibrinognio. d) a vitamina K. e) ons de clcio. [B] 1677. Considere a seguinte situao: um neutrfilo aproxima-se de uma partcula slida, projeta pseudpodes em todas as direes, envolvendo-a. A seguir, fundem-se os pseudpodes e a partcula fica encerrada numa espcie de vescula. Este fenmeno denomina-se: a) fagocitose; b) pinocitose; c) cariocinese; d) diapedese; e) autofagia. [A] 1678. As clulas de defesa do corpo exercem o seu papel atravs da fagocitose e da produo de anticorpos. Como exemplo dessas clulas, podemos citar, respectivamente: a) linfcitos e neutrfilos. b) eosinfilos e eritrcitos. c) eritrcitos e leuccitos. d) leuccitos e macrfagos. e) macrfagos e linfcitos. [E] 20. Ler atentamente as 3 afirmativas referentes atuao das hemcias, I - O gs carbnico combina-se com a hemoglobina formando carbo-hemoglobina II - Nos pulmes, a hemoglobina liberta gs carbnico e recebe oxignio III - Nos vasos capilares, atravs da linfa, o oxignio liberado da hemoglobina e chega s clulas e assinalar: a) se apenas I estiver correta b) se apenas II estiver correta c) se II e III estiverem corretas d) se I e III estiverem corretas e) se as 3 afirmativas estivarem corretas [E] 1679. Temos a seguir, clulas do mesmo tecido.

Sobre estas clulas e seu tecido, ERRADO afirmar que: a) a clula "b" um leuccito, cuja funo principal a defesa do organismo. b) so clulas do tecido sangneo e so produzidas em rgos como o fgado e o bao. c) a clula "a" uma hemcia, que apresenta pigmento respiratrio, principal responsvel pelo transporte de oxignio. d) a anemia e a hemofilia so doenas caracterizadas por alteraes no funcionamento desse tecido. e) a linfa um tecido semelhante, com funes principais de transporte de lipdios e defesa, porm no apresenta a clula "a". [B] 1680. Componente do sangue responsvel pelo transporte de substncias como nutrientes, gases, hormnios, excretas e que executa tambm a defesa do corpo pois contm anticorpos. O texto refere-se ao (s) a) glbulos brancos. b) trombcitos (plaquetas). c) plasma. d) glbulos vermelhos. e) fibrinognio. [C]

149 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1681. Os componentes do sangue que tm a funo de defesa do organismo e de coagulao so, respectivamente: a) leuccitos e hemcias b) plaquetas e hemcias c) leuccitos e plaquetas d) plaquetas e leuccitos e) hemcias e plaquetas [C] 1682. Um tcnico, ao colher o sangue de uma pessoa, preparar um esfregao e observar ao microscpio, constatou algumas coisas. Observe a figura a seguir e analise as afirmaes, destacando as verdadeiras:

opes a seguir, marque, respectivamente, o nome de clula, o mecanismo de sada do vaso e destruio do invasor. a) Leuccito, diapedese e fagocitose. b) Leuccito, fagocitose e diapedese. c) Hemcia, diapedese e fagocitose. d) Plaqueta, fagocitose e diapedese. e) Plaqueta, diapedese e fagocitose. [A] 1685. Observe as trs afirmativas sobre o tecido hematopoitico e o sangue: I - O tecido hematopoitico possui como funo a produo de clulas do sangue. II - Os glbulos vermelhos so produzidos na medula ssea e, posteriormente, passam para a corrente sangnea. III - Os anticorpos so produzidos pelas plaquetas. Assinale a alternativa CORRETA. a) I, II e III so verdadeiras. b) I e II so verdadeiras. c) II e III so verdadeiras. d) I e III so verdadeiras. e) apenas II verdadeira. [B] 1686. A uma condio padro de temperatura e de presso, 1 mol de um gs ocupa 22,3 litros de volume. Considerado que a solubilidade do dixido de carbono no plasma de 0,03mmol/mmHg/litro de plasma, calcule esta solubilidade em mililitros/mm Hg/litro de plasma. a) 0,10 b) 1,37 c) 0,67 d) 2,34 e) 11,89 [C] 1687. As hemcias humanas foram selecionadas ao longo da evoluo de modo a que desempenhassem hoje em dia suas funes de maneira eficiente. Durante este processo evolutivo, as mitocndrias e os ncleos foram perdidos na fase madura. Quais dos processos biolgicos a seguir continuam a ocorrer, nas hemcias maduras, apesar desta adaptao? a) Cadeia transportadora de eltrons. b) Ciclo de Krebs. c) Gliclise. d) Replicao. e) Transcrio. [C] 1688. "No homem, o tecido hemocitopotico ou mielide produz, entre outras, clulas indiferenciadas que, levadas pelo sangue, vo se estabelecer nos rgos linfides. Essas clulas so precursoras dos linfcitos que so capazes de reconhecer antgenos atravs de anticorpos preexistentes em sua superfcie." A anlise do texto anterior levou um estudante s seguintes concluses: I. O tecido hemocitopotico mantm uma relao importante com o sistema imune. II. Clulas resultantes do tecido hemocitopotico participam da rejeio de transplantes incompatveis. III. Os linfcitos sempre atuam como clulas indiferenciadas. Dessas afirmaes, a) apenas I correta. b) apenas I e II so corretas. c) apenas I e III so corretas. d) apenas II e III so corretas e) I, II e III so corretas. [B] 1689. O cogulo sangneo se forma na superfcie do corpo e seca em contato com o ar, formado o que popularmente conhecemos como "casca de ferida". O esquema a seguir representa a formao do cogulo.

I- Atravs da contagem do nmero de leuccitos no campo do microscpio, podemos suspeitar que o paciente apresenta uma infeco. II- O elevado nmero de hemcias uma indicao de que o indivduo est doente. III- A contagem de hemcias e leuccitos no um indcio seguro para caracterizar uma infeco ou anemia. Est(o) correta(s) somente a(s) afirmativa(s): a) I b) II c) III d) I e II e) II e III [A] 1683. Um tcnico, ao colher o sangue de uma pessoa, preparar um esfregao e observar ao microscpio, constatou algumas coisas. Observe a figura a seguir e analise as afirmaes, destacando as verdadeiras:

I- As hemcias, vistas ao microscpio, so amareladas, porque so jovens (sem ncleo) e ainda no fabricaram hemoglobina. II- A hemoglobina das hemcias tanto se combina com o oxignio como com o gs carbnico, garantindo as trocas gasosas. III- O dixido de carbono um gs nocivo respirao, pois, ao combinar-se com a hemoglobina, forma um produto estvel impedindo o O2 de chegar s clulas. Est(o) correta(s) somente a(s) afirmativa(s): a) I b) II c) III d) I e II e) I e III [B] 1684. Um tcnico, ao colher o sangue de uma pessoa, preparar um esfregao e observar ao microscpio, constatou algumas coisas. Observe a figura a seguir

As substncias I e II correspondem, respectivamente, a: a) vitamina K e fibrinognio. b) protrombina e fibrinognio. c) protrombina e plaquetas. d) fibrinognio e protrombina. e) plaquetas e vitamina K. [B] O tecido sangneo de grande importncia na defesa do organismo, pois certos tipos de clulas podem sair dos capilares e destruir os agentes invasores. Nas 1690. Alm da sustentao do corpo, so funes dos ossos: a) armazenar clcio e fsforo; produzir hemcias e leuccitos. b) armazenar clcio e fsforo; produzir glicognio.

150 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) armazenar glicognio; produzir hemcias e leuccitos. d) armazenar vitaminas; produzir hemcias e leuccitos. e) armazenar vitaminas; produzir protenas do plasma. [A] 1691. Uma pancada na cabea leva freqentemente formao de um "galo" que pode ser explicado por a) extravasamento de plasma. b) formao de tecido cicatricial. c) formao de um calo sseo. d) proliferao de clulas do tecido epitetial. [A] 1692. Este quadro refere-se ao nmero de clulas sangneas, expresso em clulas/mm de sangue, encontradas nos exames de sangue de um indivduo normal e de um indivduo doente.

[C] 1698. So funes do sistema linftico: I - drenagem de lquidos dos tecidos; II - reteno de partculas estranhas e clulas mortas; III - proteo do organismo contra agentes infecciosos. Est(o) CORRETA(S) a) I e II. b) I e III. c) II e III. d) I, II e III. e) apenas III. [D] 1699. Pode(m) ser considerada(s) funo(es) dos ossos: I. Produzir queratina. II. Formar clulas do sangue. III. Atuar como local de reserva de minerais. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas II e III. e) I, II e III. [D] 1700. Ao se compararem os elementos envolvidos na trajetria do som no ouvido humano e em um aparelho de sonoplastia, podem ser feitas correlaes diversas. Assinale a alternativa que apresenta uma correlao INCORRETA a) Amplificador / Cclea no ouvido interno. b) Cabo de conexo do amplificador caixa de som / Nervo coclear. c) Cabo de conexo do microfone ao amplificador / Ossculos do ouvido mdio. d) Caixa de som / Cerebelo. e) Microfone / Ouvido externo e tmpano. [D] 1701. As estruturas anatmicas: canais semicirculares e utrculo, esto relacionados com a funo de equilbrio nos seres humanos. Tais estruturas localizam-se: a) na coluna vertebral b) no ouvido interno c) no hipotlamo d) no cerebelo [B] 1702. O sentido da audio formado por mecanorreceptores. Alm de "ouvir sons", o ouvido tambm responsvel por: a) olfato b) equilbrio c) gustao d) tato e) viso [B] 1703. A labirintite uma inflamao e um de seus principais sintomas so distrbios de equilbrio como a tontura, que impede a pessoa de se locomover e at mesmo de se levantar. Assinale a alternativa que apresenta a estrutura afetada. a) cclea b) canais semicirculares c) cerebelo d) janela oval e) trompa de Eustquio [B] 1704. A noo de equilbrio e postura do corpo nos fornecida: a) pela janela oval do ouvido interno; b) pelos canais semicirculares do ouvido mdio; c) pelo estribo do ouvido mdio; d) pelos canais semicirculares do ouvido interno; e) pelo estribo do ouvido interno. [D] 1705. Os terminaes nervosas da pele relacionados percepo da dor so as (os) a) corpsculos de Vater-Paccini. b) corpsculos de Krause. c) terminaes livres. d) corpsculos de Meissner. e) corpsculos de Ruffini. [C] 1706. Os canais semicirculares so estruturas presentes no ouvido interno humano, responsveis pelo senso de equilbrio. Nos peixes e em alguns invertebrados, essa funo desempenhada: a) pela linha lateral. b) pelo estatocisto. c) pelo ocelo. d) pelo corpsculo de Meissner. e) pela antena. [B] 1707. Quais so as funes realizadas pelos seguintes rgos sensoriais: Nariz e Globos Oculares, respectivamente? a) Olfato e audio. b) Olfato e viso. c) Viso e olfato. d) Paladar e viso. e) Paladar e audio. [B]

Entre as possveis alteraes apresentadas pelo indivduo doente, NO se inclui a) alergia. b) anemia. c) distrbio da coagulao. d) infeco. [B] 1693. Analise as afirmaes a seguir sobre um grupo de clulas pertencentes ao tecido hematopoitico. I - A destruio dessas clulas leva formao da bilirrubina. II - So clulas que permanecem na circulao no mximo por 120 dias. III - So clulas bicncavas com uma grande rea que permite a entrada de oxignio. As clulas a que se referem as afirmaes anteriores so os (as): a) linfcitos. b) eritrcitos. c) leuccitos. d) moncitos. e) plaquetas. [B] 1694. Alguns jogos da Taa Libertadores da Amrica so realizados na cidade de La Paz, situada a 3635m de altitude. Os jogadores do Rio de Janeiro transportados para esta cidade podem apresentar o seguinte processo: a) reduo do nmero de leuccitos. b) aumento de leuccitos e aumento da presso sangnea. c) reduo da presso sangnea. d) reduo do nmero de hemcias. e) aumento do nmero de hemcias. [E] 1695. Para a realizao de alguns processos fisiolgicos, o organismo humano tem a necessidade de ons de clcio. Dentre os mecanismos que dependem diretamente destes ons para sua realizao, temos: a) excreo de toxinas e atividade da tiride. b) digesto de alimentos bsicos e respirao. c) coagulao do sangue e contrao muscular. d) atividade neurolgica e oferta de O2 s clulas. e) crescimento dos ossos e atividade da hipfise. [C] 1696. A vitamina K - vitamina lipossolvel descoberta em 1939 - uma vitamina: a) que, como todas as vitaminas lipossolveis, deve ser ingerida em grandes quantidades, por ser considerada substrato energtico importante para as nossas clulas; b) importante para a sntese de rodopsina e sua carncia resulta em maior dificuldade de adaptao a ambientes mal iluminados; c) que participa ativamente da absoro intestinal do clcio e da sua fixao nos ossos e dentes; d) que participa ativamente da sntese do colgeno e sua carncia provoca escorbuto; e) essencial para a formao da protrombina e de alguns outros fatores envolvidos na coagulao sangnea. [E] 1697. No sangue, existem fragmentos citoplasmticos possuidores de uma enzima, a tromboplastina, que, em presena de ons clcio, converte a protrombina em trombina. Esses corpsculos so denominados de: a) Hemcias. b) Moncitos. c) Plaquetas. d) Neutrfilos. e) Basfilos.

151 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1708. No organismo humano, os receptores sensoriais responsveis pelos sentidos do olfato podem se classificados como a) propriorreceptores. b) mecanorreceptores. c) quimiorreceptores. d) fotorreceptores. e) termorreceptores. [C] 1709. Quais so as regies da lngua responsveis pela percepo dos sabores: a) doce: b) amargo: c) cido: d) salgado: a) Ponta b) Base c) Bordas d) Bordas laterais anteriores 1710. Quais so as funes realizadas pelos seguintes rgos sensoriais: Nariz e Globos Oculares, respectivamente? a) Olfato e audio. b) Olfato e viso. c) Viso e olfato. d) Paladar e viso. e) Paladar e audio. [B] 1711. Se um ser humano tiver uma leso no nervo glosso-farngeo, ter, como consequncia problemas com a) a locomoo. b) a audio. c) a viso. d) o olfato. e) o paladar. [E] 1712. Os animais possuem rgos dos sentidos que lhes permitem relacionaremse com o meio ambiente. Esses rgos podem ser classificados de vrias maneiras. Um dos sistemas de classificao os situa em categorias de acordo com o tipo de estmulo a que so sensveis. RELACIONE cada rgo dos sentidos de acordo com o estmulo a que sensvel. (I) quimiorreceptor (II) mecanorreceptor (III) fotorreceptor (IV) termorreceptor (1) tato (2) calor (3) odor (4) luz Assinale a alternativa CORRETA. a) I - 3; II - 1; III - 2; IV - 4 b) I - 4; II - 1; III - 3; IV - 2 c) I - 3; II - 1; III - 4; IV - 2 d) I - 3; II - 4; III - 1; IV - 2 e) I - 4; II - 2; III - 4; IV 1 [C] 1713. O diafragma de uma mquina fotogrfica corresponde, olho dos mamferos: a) crnea. b) ris. c) ao cristalino. d) ao humor aquoso. e) retina. [B] 1714. A viso um dos sentidos mais importantes para o homem. Assinale a alternativa correta sobre a estrutura do olho humano: a) a crnea pigmentada e d a cor do olho b) a ris contrtil e recobre o cristalino c) cones e bastonetes situam-se na esclertica d) o humor aquoso preenche todo o globo ocular e) a pupila uma pequena abertura do cristalino [B] 1715. Os invertebrados que possuem olhos estruturalmente semelhantes aos dos vertebrados so os a) insetos. b) aracndeos. c) crustceos. d) gastrpodos. e) cefalpodos. [E] 1716. Se forem comparados os elementos envolvidos nos processos de viso do olho humano e nos de elaborao de uma foto a partir de uma cmera fotogrfica, podem ser feitas algumas correlaes. Assinale a alternativa que apresenta uma correlao INCORRETA. a) Cmara escura - Globo ocular b) Diafragma - ris c) Filme - Retina d) Lente - Crnea e) Revelador Crebro [D] 1717. Se um ser humano tiver uma leso no nervo ptico, ter, como consequncia problemas com

a) a locomoo. d) o olfato. [C]

b) a audio. e) o paladar.

c) a viso.

1718. Num mamfero adulto, grande quantidade de clulas em diviso ocorre normalmente a) no msculo cardaco. b) na medula espinhal. c) no crebro. d) na medula ssea. e) nos msculos esquelticos. [D] 1719. Todas as alternativas apresentam componentes do corpo humano que possuem tecido muscular na sua estrutura fundamental, EXCETO a) as artrias. b) o corao. c) os alvolos pulmonares. d) os brnquios. e) os intestinos. [C] 1720. Os recifes so verdadeiras barreiras de depsitos calcrios que se formaram ao longo dos anos em vrias costas brasileiras. A constituio fsica dessas barreiras marinhas se deve ao acmulo de "esqueletos" de: a) crustceos b) algas c) espongirios d) celenterados [D] 1721. Relativamente teoria do tecido sseo, relacione, corretamente, a coluna 1 com a coluna 2: Coluna 1 (I) Osteognicas (II) Osteoclastos (III) Osteoblastos (IV) Ostecitos Coluna 2 ( ) Clulas sseas adultas ( ) Clulas sseas jovens ( ) Clulas que destrem e reabsorvem a matriz ( ) Clulas formadoras de osso Marque a opo que contm, de cima para baixo, a correlao certa na coluna 2: a) (IV), (II), (III), (I) b) (I), (II), (III), (IV) c) (I), (III), (II), (IV) d) (IV), (III), (II), (I) [D] 1722. A "linha lateral" dos peixes uma estrutura com sensibilidade: a) vibrao na gua b) a mudanas na temperatura c) presena da fmea d) a variaes na quantidade de oxignio e) a variaes de luminosidade [A] 1723. Em qual dos rgos a seguir so produzidas as clulas do sangue em um ser humano adulto: a) ossos. b) fgado. c) bao. d) pncreas. e) corao. [A] 1724. Para os msculos se contrarem e podermos realizar movimentos necessrio o fornecimento constante de energia. A fonte de energia para a contrao muscular a) o sangue. b) o impulso nervoso. c) o sono. d) o alimento. e) o relaxamento. [D] 1725. A quitina, substncia formadora do exoesqueleto dos insetos, atua nesses animais tambm garantindo a: a) rapidez do seu crescimento. b) diminuio da perda de gua. c) eficincia da respirao lacunar. d) adaptao reproduo gmica. e) adaptao circulao aberta. [B] 1726. constitudo por clulas uninucleadas que possuem ncleos centrais. Em seu citoplasma encontramos miofibrilas, formando discos claros e escuros. Para formar o tecido, essas clulas se colocam em continuidade umas com as outras, sendo que a adeso entre elas, feita pelos discos intercalares, apresenta contraes rpidas e involuntrias. Essa a descrio do tecido: a) epitelial. b) conjuntivo. c) muscular estriado cardaco. d) muscular liso. e) muscular estriado esqueltico.

152 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[C] 1727. O esqueleto dos equinodermos um: a) endoesqueleto ectodrmico quitinoso. b) endoesqueleto mesotrmico calcreo. c) exoesqueleto endodrmico calcreo. d) exoesqueleto ectodrmico quitinoso. e) exoesqueleto mesodrmico quitinoso. [B] 1728. Alm da sustentao do corpo, so funes dos ossos: a) armazenar clcio e fsforo; produzir hemcias e leuccitos. b) armazenar clcio e fsforo; produzir glicognio. c) armazenar glicognio; produzir hemcias e leuccitos. d) armazenar vitaminas; produzir hemcias e leuccitos. e) armazenar vitaminas; produzir protenas do plasma. [A] 1729. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos. Um feixe de clulas musculares estriadas, mantido em cultura com todas as condies ideais, foi submetido a vrias sries de contraes e relaxamentos (exerccio) por vrios dias consecutivos, seguido de um perodo de repouso (sem exerccio) de tambm alguns dias. Durante esses perodos quantificou-se o nmero de mitocndrias por clula, possibilitando a elaborao do grfico a seguir:

1733. Os msculos envolvidos no deslocamento do corpo e nos movimentos do sistema digestivo so, respectivamente, dos tipos a) estriado e liso. b) esqueltico e estriado. c) liso e estriado. d) liso e esqueltico. e) estriado cardaco e liso. [A] 1734. O nmero crescente de vtimas de osteoporose, perda de massa ssea que atinge sobretudo as mulheres na ps-menopausa, aumentando o risco de fraturas, leva a uma corrida por novas drogas e terapias. A massa ssea a que se refere o texto anterior se constitui principalmente de: a) cristais de fluorapatita b) escleroprotena queratina c) glicoprotenas cristalizadas d) fibras colgenas calcificadas [D] 1735. As afirmaes a seguir referem-se ao tecido muscular. I - Encontra-se em rgos viscerais e nas paredes dos vasos sangneos. II - Constitui a maior parte da musculatura dos vertebrados. III - Apresenta miofilamentos de actina e de miosina. IV- Possui numerosas estrias transversais. V - Contrai-se sempre involuntariamente. Assinale a alternativa que classifica corretamente cada tipo de tecido muscular quanto a essas caractersticas. a) ESTRIADO: I - IV CARDACO: I - III LISO: II - V b) ESTRIADO: I - IV CARDACO: I - III - V LISO: II - III - V c) ESTRIADO: I - III - IV CARDACO: III - IV LISO: II - IV - V d) ESTRIADO: II - III - IV CARDACO: III - IV - V LISO: I - III - V e) ESTRIADO: II - III - V CARDACO: I - IV - V LISO: I III [D] 1736. No processo de ossificao, o papel dos osteoclastos : a) Promover a deposio de clcio nas epfises. b) Reabsorver a matriz ssea. c) Revestir o peristeo. d) Reforar as suturas cranianas. e) Formar, por mitoses, os ostecitos. [B] 1737. Pode(m) ser considerada(s) funo(es) dos ossos: I. Produzir queratina. II. Formar clulas do sangue. III. Atuar como local de reserva de minerais. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas II e III. e) I, II e III. [D] 1738. Assinale a(s) proposio(es) que apresenta(m) atividades dependentes diretamente do tecido muscular para sua efetivao. 01. Mobilidade da lngua. 02. Ao enzimtica. 04. Inspirao. 08. Batimento cardaco. 16. Eriamento dos plos. 32. Sntese de carboidratos. 64. Contrao do tero. VFVVVFV 1739. A pata de uma anta, a asa de uma pomba, o brao de um homem, so entre si: a) homlogos porque realizam a mesma funo. b) homlogos porque possuem a mesma origem embrionria. c) anlogos porque possuem a mesma origem embrionria. d) anlogos porque realizam a mesma funo. e) homlogos e anlogos simultaneamente [B] 1740. Ordene as categorias de classificao biolgica de modo descendente a assinale a alternativa correta: a) Reino, Classe, Filo, Ordem, Famlia, Gnero, Espcie. b) Reino, Classe, Filo, Ordem, Gnero, Famlia, Espcie. c) Reino, Filo, Classe, Ordem, Famlia, Gnero, Espcie. d) Reino, Filo, Ordem, Classe, Famlia, Gnero, Espcie.

A partir desse grfico e de conhecimentos sobre o assunto enfocado, correto afirmar: 01) O nmero de mitocndrias por clula aumenta durante o exerccio porque a clula precisa de muito ATP, e a mitocndria que o produz. 02) H um nmero mnimo necessrio de mitocndrias por clula para manter o metabolismo desta, mesmo quando em repouso. 04) Se fosse sempre mantida a mesma carga de exerccios, o nmero de mitocndrias por clula aumentaria indefinidamente. 08) O nmero de mitocndrias aumenta nas clulas porque elas so fagocitadas do meio de cultura. 16) Quando cessa o exerccio, o excesso de mitocndrias removido pela digesto intracelular dessas organelas. 32) Se fosse tambm medido o consumo de oxignio destas clulas, o grfico seria semelhante ao obtido para o nmero de mitocndrias. 01 + 02 + 16 + 32 = 51 1730. Alguns invertebrados, no tendo outro tipo de esqueleto, conseguem sustentao de seus corpos atravs de cavidades corporais cheias de lquido. Entre eles esto as a) esponjas e os camares. b) planrias e os ourios-do-mar. c) estrelas-do-mar e as ostras. d) aranhas e as baratas. e) minhocas e as hidras. [E] 1731. Ao microscpio eletrnico nota-se que o tecido muscular cardaco no um sinccio e que suas fibras alongadas se unem entre si formando uma estrutura denomina-se: a) sarcmero. b) faixa isotrpica. c) faixa anisotrpica. d) Ndulos de Ranvier. e) discos intercalares. [E] 1732. Tecido conjuntivo denso, com predominncia de fibras colgenas orientadas paralelamente, portanto bastante resistente mas pouco elstico, o que forma a) os tendes. b) as mucosas. c) as cartilagens. d) a derme. e) os msculos. [A]

153 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) Reino, Filo, Classe, Ordem, Famlia, Espcie, Gnero. [C] 1741. Qual das alternativas apresenta um par de estruturas homlogas? a) Asa de papagaio e asa de borboleta. b) Carapaa de tartaruga e concha de caramujo. c) Nadadeira de peixe e asa de borboleta. d) Asa de ave e asa de morcego. e) Concha de mexilho e escama de peixe. [D] 1742. Critrios anatmicos, fisiolgicos e embrionrios servem tambm de base para estabelecer o grau de parentesco entre os seres e Conseqentemente, sua origem evolutiva. Sendo assim, permitem seu enquadramento nas categorias taxonmicas. Assinale a opo que NO apresenta uma justificativa correta no enquadramento dos Aneldeos como seres mais evoludos que os Cnidrios: a) O sistema circulatrio nos Aneldeos fechado, enquanto que os Cnidrios so desprovidos desse sistema. b) Os Aneldeos apresentam respirao cutnea indireta (com auxlio de sangue), j nos Cnidrios, as trocas gasosas se realizam por difuso. c) Aneldeos so animais triblsticos, enquanto que Cnidrios so diblsticos. d) Presena de tubo digestivo completo em Aneldeos, e incompleto em Cnidrios. e) Presena de sistema nervoso difuso nos Aneldeos, e ganglionar nos Cnidrios. [E] 1743. Em um trabalho de pesquisa, foram classificados dois mosquitos como sendo: 'Aedes (Stegomyia) aegypti' e 'Anopheles (Myzomya) gambiae'. O grau de semelhana entre esses mosquitos permite que sejam colocados no(a) mesmo(a) a) espcie b) subespcie c) gnero d) subgnero e) famlia [E] 1744. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Analise as proposies a seguir: ( ) embora lagosta, camaro a caranguejo sejam crustceos, e aranhas, escorpies e carrapatos sejam aracndeos, todos pertencem ao filo artrpoda; ( ) ciclstomos, vertebrados mais primitivos, com primrdios de vrtebras e sem crnio, assemelham-se muito aos peixes; ( ) os asquelmintos ou nematelmintos so vermes achatados dorsoventralmente, com tubo digestivo incompleto, entre os quais h muitas espcies parasitas com "Taenia"; ( ) enquanto os insetos apresentam quatro patas e corpo dividido em cefalotrax e abdome, os aracndeos tm seis patas e o corpo dividido em cabea, trax e abdome; ( ) os monotremos so os mamferos mais primitivos; neles no h placenta, tero e vagina. Eles apresentam caractersticas comuns a aves e rpteis. VVFFV 1745. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Analise os exemplares mostrados de 1 a 7 e as proposies apresentadas em relao classificao dos mesmos.

1747. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. Existem atualmente cerca de um milho de espcies de animais. Deste nmero aproximadamente 5% so vertebrados e os demais invertebrados, (Fonte: BARNES, R. D, 1984). Sobre os invertebrados, julgue os itens a seguir. ( ) O sanguessuga pertence ao Filo Annelida, ou seja, so animais metamricos vermiformes. ( ) Os escorpies so aracndeos, com excreo por tbulos de malpighi. ( ) As baratas pertencem ao Filo Arthropoda e apresentam respirao do tipo traqueal. ( ) As planrias pertencem ao Filo Porifera, com sistema nervoso difuso em forma de rede. VVVF 1748. O co domstico ('Canis familiaris'), o lobo ('Canis lupus') e o coiote ('Canis latrans') pertencem a uma mesma categoria taxonmica. Esses animais fazem parte de um(a) mesmo(a): a) gnero b) espcie c) subespcie d) raa e) variedade [A] 1749. Apresenta simetria bilateral, metameria e sistema nervoso dorsal: a) gafanhoto b) planria c) estrela-do-mar d) medusa e) anfioxo [E] 1750. Os Protistas, quando comparados com os Moneras, diferenciam-se por apresentarem clulas dotadas de elementos figurados e carioteca. Assinale a opo que apresenta um representante de cada um desses reinos: a) esponjas e cianofceas. b) algas e platelmintos. c) plasmdios e bactrias. d) leishmanias e insetos. e) estrelas-do-mar e diatomceas. [C] 1751. Considera-se que dois seres vivos pertencem mesma espcie quando: a) so estruturalmente semelhantes. b) se alimentam das mesmas coisas. c) so capazes de obter filhotes frteis. d) habitam o mesmo territrio. e) possuam o mesmo tipo sangneo. [C] 1752. Considere o quadro a seguir sobre algumas caractersticas encontradas entre os artrpodos.

A, B, C e D podem ser, respectivamente: a) cigarra, aranha, camaro e lagosta. b) sarna, percevejo, lagostim e lacraia. c) barata, piolho, cravo e piolho-de-cobra. d) gafanhoto, carrapato, siri e lacraia. e) escorpio, pulga, camaro e piolho-de-cobra. [D] 1753. O morcego pertence Classe dos Mamferos e Ordem dos: a) Roedores. b) Edentados. c) Primatas. d) Carnvoros. e) Quirpteros. [E] 1754. A baleia e o peixe-boi pertencem Classe dos Mamferos e, respectivamente, s Ordens: a) Roedores e Sirnios. b) Edentados e Cetceos. c) Cetceos e Primatas. d) Carnvoros e Sirnios. e) Cetceos e Sirnios. [E] 1755. Relacione as colunas a seguir: (1) bactria (2) fungo

( ) Em 1 temos um mamfero cetceo, pertencente subclasse eutheria . ( ) Em 2 mostrado um mamfero xenartro (Edentado) pertencentes subclasse eutheria. ( ) Em 3 temos um representante do filo celenterado (cnidrio), pertencente classe dos holoturides. ( ) Em 4 e 5 so mostrados rpteis das ordens lacertlios e quelnios, respectivamente. ( ) Em 6 temos um molusco gastrpodo e em 7 um molusco cefalpodo. VVFVF 1746. Marque a opo em que todas as espcimes pertencem ao mesmo grupo ou filo: a) esponja, hidra, estrela-do-mar e planria b) formiga, borboleta, aranha e abelha c) caranguejo, caracol, camaro e ostra d) minhoca, centopia, cobra e lesma [B]

154 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

(3) protozorio (4) gua-viva (5) roseira ( ) unicelular com ncleo verdadeiro ( ) decompositor sem ncleo verdadeiro ( ) produz flor, semente e fruto ( ) animal venenoso exclusivamente aqutico ( ) bolores (3)(1)(5)(4)(2) 1756. Classifique os organismos adiantes em seus respectivos reinos, relacionando as duas colunas (1) ameba (2) bactria (3) cogumelo (4) minhoca (5) samambaia ( ) Reino Monera ( ) Reino Protista ( ) Reino Animal ( ) Reino Vegetal ( ) Reino Fungos (2)(1)(4)(5)(3) 1757. O animal mais prximo do homem, do ponto de vista evolutivo o: a) sapo b) crocodilo c) pingim d) castor e) raias [D] 1758. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Classificando-se os seres vivos, possvel estabelecer uma ordem na diversidade da natureza, facilitando a sua compreenso. Assim, correto afirmar que: 01) O sistema binomial de nomenclatura adota a Espcie como unidade bsica de classificao. 02) Em taxionomia, uma Ordem engloba diversas Famlias, assim como um Gnero rene diferentes Espcies. 04) Um determinado vegetal, de acordo com a classificao vigente, pertencer obrigatoriamente a um Reino, a um Filo ou Diviso, a uma Classe, a uma Ordem, a uma Famlia, a um Gnero e a uma Espcie. 08) O Reino Protista engloba organismos unicelulares eucariontes, entre os quais se incluem protozorios e certas algas. 16) O Reino Fungi engloba os cogumelos, os liquens e as brifitas. 32) Os seres vivos pertencentes ao Reino Monera se caracterizam por serem todos unicelulares, com uma membrana nuclear bem estruturada. 01 + 02 + 04 + 08 = 15 1759. As categorias taxonmicas so ordenadas de modo ascendente. Assinale a alternativa que apresenta a seqncia correta: a) classe, ordem, gnero, famlia, espcie b) gnero, espcie, famlia, ordem, classe c) espcie, gnero, famlia, ordem, classe d) espcie, gnero, ordem, famlia, classe e) espcie, famlia, gnero, ordem, classe [C] 1760. Indique a que filos pertencem os animais cujas principais caractersticas esto relacionadas a seguir: I- Papo e moela (aparelho digestivo); siringe; ossos pneumticos; sacos areos; homeotrmicos; corao com quatro cavidades. II- Durante a metamorfose, tm respirao branquial, pulmonar e cutnea; corao com trs cavidades; pecilotrmicos; cloaca. a) I - peixes e II - anfbios b) I - aves e II - anfbios c) I - aves e II - rpteis d) I - rpteis e II - anfbios e) I - anfbios e II peixes [B] 1761. Considere as duas colunas a seguir. Grupos de invertebrados: I- cnidrios II- moluscos III- artrpodos IV- equinodermos Caractersticas: A- presena de exoesqueleto quitinoso B- simetria secundria penta-radiada C- corpo formado basicamente por cabea, p e massa visceral D- dois tipos morfolgicos de indivduos: plipos e medusas A alternativa que associa corretamente as duas colunas a) I - A, II - B. III - C, IV - D b) I - B, II - C. III - D, IV - A c) I - C, II - D. III - B, IV - A d) I - D, II - A. III - B, IV - C e) I - D, II - C. III - A, IV B

[E] 1762. Assinale a alternativa que apresenta uma caracterstica comum barata, minhoca e ao polvo. So todos: a) acelomados. b) deuterostmios. c) metazorios. d) pseudocelomados. e) de simetria radiada. [C] 1763. Qual das alternativas apresenta um par de estruturas homlogas? a) Asa de morcego e asa de borboleta. b) Carapaa de tatu e concha de caramujo. c) Nadadeira de peixe e asa de borboleta. d) Asa de ave e asa de morcego. e) Concha de caramujo e escama de peixe. [D] 1764. Um paleontlogo constatou inmeras semelhanas morfolgicas entre os fsseis X e Y, e grandes diferenas entre esses dois e um terceiro fssil Z.. Constatou tambm acentuada semelhana entre os fssil Z um quarto fssil W. Dentre as classificaes a seguir, qual apresenta maior concordncia com os dados? a) Os quatro fsseis pertencem mesma espcie, mas a gneros diferentes. b) Cada fssil pertence a um reino diferente. c) Os quatro fsseis pertencem ao mesmo filo, sendo que X e Y pertencem a um gnero e Z e W a outro gnero. d) Os quatro fsseis pertencem ao mesmo filo, sendo que X e Y pertencem a um reino e Z e W a outro reino. e) Os quatro fsseis pertencem ao mesmo gnero, sendo X e Y pertencem a um filo e Z e W a outro filo. [C] 1765. A lagosta, o polvo e o lrio-do-mar pertencem, respectivamente, aos filos: a) asquelmintos, aneldeos e artrpodes b) artrpodes, moluscos e equinodermos c) moluscos, asquelmintos e artrpodes d) moluscos, artrpodes e equinodermos e) artrpodes, equinodermos e asquelmintos [B] 1766. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Nesta questo faz-se referncia a vrios filos de animais invertebrados. Com base no s em caractersticas morfolgicas, mas tambm em sistemtica, correto afirmar que: 01 - O camaro, o caranguejo e o siri so moluscos comestveis. 02 - Os equinodermas so exclusivamente marinhos. 04 - Os aneldeos so animais de corpo cilndrico, no-segmentado. 08 - Devido existncia de um exoesqueleto quitinoso, os artrpodes sofrem o fenmeno das mudas ou ecdises durante o seu crescimento. 16 - Os insetos pertencem ao filo artrpoda e so os nicos invertebrados capazes de voar. 01 + 02 + 08 + 16 = 27 1767. O elo de ligao entre os invertebrados e os cordados superiores representado pelos protocordados, que apresentam as seguintes caractersticas: a) fendas branquiais, notocorda e encfalo. b) fendas branquiais, notocorda e acraniatos, c) fendas branquiais, acraniata e alantide. d) acraniatos, notocorda e encfalo. e) encfalo, alantide e tubo neural. [B] 1768. Considere as trs afirmaes a seguir a respeito dos animais vertebrados: I - O diafragma, msculo relacionado com a respirao, exclusivo do ser humano. II - mnio e alantide so anexos embrionrios presentes nos mamferos, aves e rpteis. III - Corao com quatro cavidades e circulao dupla e complexa ocorrem em aves e mamferos. Destas afirmaes, est(o) correta(s) apenas: a) I b) II c) I e II d) II e III e) I e III [D] 1769. Se reunirmos as famlias 'Canidae' (ces), 'Ursidae' (ursos), 'Hienidae' (hienas) e 'Felidae' (lees), veremos que todos so carnvoros, portanto, pertencem (ao) mesma(o): a) espcie. b) ordem. c) subespcie. d) famlia. e) gnero. [B] 1770. Com relao figura a seguir, podemos afirmar que a semelhana morfolgica entre os dois tipos de asas

155 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) o resultado da adaptao execuo de uma mesma funo. b) conseqncia da irradiao adaptativa. c) mostra homologia entre elas. d) comprova a ancestralidade comum. e) comprova a mesma origem embriolgica. [A] 1771. "Dinossauro gigante comia uma tonelada por dia". A descoberta do fssil gigantossauro na Patagnia mostrou ser esse um dos maiores dinos j encontrados pelos paleontlogos. Se buscarmos uma classificao para esses enormes mostrengos, poderemos cham-los de: a) vivparos. b) homeotrmicos. c) ovparos. d) placentrios. e) carnvoros. [C] 1772. Para demostrar aos seus alunos aspectos referentes segmentao, o Prof. Srgio dispunha de cinco animais para uma aula prtica: 1 - caracol 2 - minhoca 3 - estrela do mar 4 - ascdea 5 - pingim O Prof. Srgio pediu aos seus alunos que construssem uma tabela, separando os animais assegmentados e segmentados. Marque a alternativa que contm a separao CORRETA: a) Assegmentados: 1, 2 e 3 Segmentados: 4 e 5 b) Assegmentados: 1 e 3 Segmentados: 2, 4 e 5 c) Assegmentados: nenhum Segmentados: 1, 2, 3, 4 e 5 d) Assegmentados: 1, 2, 3 e 4 Segmentados: 5 e) Assegmentados: 1, 2, 3, 4 e 5 Segmentados: nenhum [B] 1773. Relacione os diagnsticos numerados de I a V com os filos de invertebrados designados de P a U. I - Animal filtrador, com nvel de organizao corporal simples. II- Animal com forma de plipo ou de medusa, formado por duas camadas celulares (diblstico). III- Animal de corpo achatado, formado por trs tecidos embrionrios (triblstico). IV - Animal de corpo fino e tubular, triblstico, cavidade corporal denominada pseudoceloma. V - Animal de corpo mole, com ou sem concha, triblstico, cavidade corporal denominada celoma. P. Porifera Q. Coelenterata R. Platyhelminthes S. Nemathelminthes T. Mollusca U. Annelida a) I - P; II - Q; III - R; IV - S; V - T b) I - P; II - Q; III - R; IV - T; V - S c) I - Q; II - T; III - P; IV - U; V - R d) I - U; II - T; III - S; IV - R; V - Q e) I - U; II - T; III - S; IV - T; V S [A] 1774. O 'Schistosoma mansoni' provoca, no homem, a esquistossomose, que uma doena muito comum no Brasil. Sabemos que o homem o hospedeiro definitivo, e que a profilaxia dessa doena pode ser feita tratando-se os esgotos, evitando-se o contato com guas infestadas e tentando-se eliminar os caramujos transmissores. O filo e a classe do agente causador da esquistossomose so, respectivamente, o: a) Platyhelminthes e a Trematoda. b) Platyhelminthes e a Turbellaria. c) Cnidria e a Hidrozoa. d) Cnidria e a Turbellaria. e) Cnidria e a Trematoda. [A] 1775. Analise os grupos de invertebrados apresentados a seguir e as caractersticas descritas. A alternativa que associa corretamente os grupos s caractersticas : a) I - 1, II - 2, III - 3, IV - 4, V - 5 b) I - 5, II - 1, III - 3, IV - 4, V - 2 c) I - 5, II - 1, III - 3, IV - 2, V - 4 d) I - 1, II - 5, III - 3, IV - 2, V - 4 e) I - 5, II - 1, III - 4, IV - 3, V - 2 [B] 1776. Na(s) questo (es) adiante, escreva no espao apropriado a soma dos itens corretos. Com relao aos conhecimentos de Zoologia, correto afirmar: 01) Os aneldeos so animais com metameria evidente e dotados de celoma. 02) Nos insetos, o processo de metamorfose pode dar-se de duas maneiras: incompleta, que compreende as fases de ovo, ninfa e adulto; e a completa, que compreende as fases de ovo, larva, pupa e adulto. 04) Os quilpodes ou centopias so animais terrestres com cabea e tronco longo. Na cabea apresentam um par de antenas e um par de olhos simples, e no tronco apresentam segmentos com um par de apndices em cada um deles. 08) A metagnese ou alternncia de geraes uma forma de reproduo que intercala fases sexuadas com fases assexuadas, sendo muito comum entre os animais do filo Cnidaria (ou Coelenterata). 16) Os polvos e lulas, moluscos da classe Cephalopoda, so animais exclusivamente marinhos, que possuem uma glndula produtora de tinta escura que pode ser usada quando o animal se encontra em perigo, pois essa tinta, turvando a gua, prejudica a viso e o olfato de eventuais predadores. 32) Nos peixes cartilaginosos e nos sseos existe um saco armazenador de gases, com posio dorsal, chamado bexiga natatria, que tem funo respiratria. 01 + 02 + 04 + 08 + 16 = 31 1777. Relacione os filos enumerados na coluna 1 com as respectivas afirmativas da coluna 2. Coluna 1 I - Protozorios II - Porferos III - Cnidrios IV - Platielmintos Coluna 2 ( ) Os cnidoblastos com nematocistos so utilizados para captura de alimentos e defesa. ( ) As tnias adultas so parasitas comuns no intestino do homem. ( ) Os coancitos so clulas flageladas que revestem a espongiocela. ( ) O plasmdio pode parasitar o homem causando a malria. ( ) Podem apresentar a forma de plipo ou medusa. ( ) So animais triploblsticos acelomados. ( ) So animais unicelulares e microscpicos. Assinale a alternativa com a seqncia correta a) III, IV, II, I, III, IV e I. b) III, IV, I, I, II, IV e I. c) I, IV, II, I, III, III e I. d) III, I, II, IV, III, II e II. e) III, IV, I, IV, II, IV e II. [A] 1778. Leia, atentamente, as afirmativas adiante sobre caractersticas de diferentes grupos animais: I - os moluscos so animais diploblsticos e celomados. II - os gastrpodos, geralmente, apresentam uma concha enrolada que protege a massa visceral. III - os aneldeos poliquetos caracterizam-se pela presena de parapdios com cerdas quitinosas. IV - nos aneldeos oligoquetos a forma larval chamada de trocfora. V - o sistema ambulacral nos equinodermos serve para locomoo e fixao do animal. VI - os equinodermos so triploblsticos, deuterostmios e celomados enteroclicos. Assinale a alternativa correta: a) I, II, III e IV esto corretas. b) I, II, IV, e VI esto corretas.

156 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) III, IV, V e VI esto corretas. d) II, III, V e VI esto corretas e) I, II, V e VI esto corretas. [D] 1779. Indique a opo correta, relativamente a algumas classes animais, o nmero de suas antenas e o tipo de respirao: a) Classe: insetos; Antenas: um par; Respirao: traqueal. b) Classe: crustceos; Antenas: um par; Respirao: traqueal. c) Classe: aracndeos; Antenas: dois pares; Respirao: branquial. d) Classe: diplpodos; Antenas: dois pares; Respirao: branquial. [A] 1780. O texto refere-se a exemplos de determinados animais, identificados por algarismos de I a V, e a algumas de suas principais caractersticas. Animal - I Caractersticas - Deuterostomado, com endoesqueleto calcreo e simetria radial. Animal - II Caractersticas - Acelomado, com sistema digestivo incompleto e simetria bilateral. Animal - III Caractersticas - Notocorda que persiste desde a fase embrionria at a fase adulta. Animal - IV Caractersticas - Massa visceral protegida pelo manto e presena de tentculos. Animal - V Caractersticas - Presena de quelceras e respirao filotraqueal. Pelas caractersticas apresentadas nos algarismos de I a V, conclumos que estes animais podem ser, respectivamente, a) ourio-do-mar, planria, gato, caracol e mosca. b) estrela-do-mar, planria, anfioxo, polvo e aranha. c) gua-viva, tnia, ascdia, lesma e camaro. d) lrio-do-mar, tnia, anfioxo, lula e escorpio. e) pepino-do-mar, planria, tunicados, ostra e escorpio. [B] 1781. Morcego, tartaruga, minhoca, camaro, barata so respectivamente: a) ave, anfbio, platelminto, inseto, crustceo. b) mamfero, anfbio, nematoda, crustceo, inseto. c) ave, rptil, aneldeo, mamfero, crustceo. d) rptil voador, anfbio, aneldeo, crustceo, aracndeo. e) mamfero, rptil, aneldeo, crustceo, inseto. [E] 1782. A enorme diversidade das formas de vida sempre encanta aqueles que tentam descrever e classificar espcies. A taxonomia moderna no leva em considerao apenas as caractersticas do animal, mas procura correlacion-las a outros organismos, baseando-se em estruturas hereditrias. Desse modo, medida que se analisam as variaes ocorridas na passagem do nvel de ESPCIE para o nvel do REINO, possvel observar que: a) diminui a diversidade biolgica b) diminui a relao de parentesco c) aumenta a semelhana histofisiolgica d) aumenta o nmero de estruturas comuns [B] 1783. Considere as caractersticas dos seguintes animais: I- gafanhoto: protostmio, celomado, com metameria e simetria bilateral; II- pepino-do-mar: deuterostmio, celomado, sem metameria e simetria radial; III- homem: deuterostmio, celomado, com metameria e simetria bilateral. A rvore filogentica que melhor representa as proximidades evolutivas entre esses animais est caracterizada na opo:

a) uma nova famlia com um novo gnero. b) somente uma nova espcie. c) um novo gnero com uma nova espcie. d) uma sub espcie. e) uma nova ordem com uma nova famlia. [C] 1785.

Na figura anterior, os animais classificados como moluscos, crustceos e celenterados ou cnidrios, respectivamente, so os de nmero: a) 1 e 6 - 2 e 3 - 4 e 5 b) 2 e 4 - 1 e 3 - 5 e 6 c) 5 e 6 - 1 e 4 - 2 e 3 d) 3 e 4 - 5 e 6 - 1 e 2 [D] 1786. Considerando: asa de morcego (1); asa de coleptero (2); asa de ave (3); asa de barata (4) so estruturas HOMLOGAS: a) 1, 2, 3 e 4. b) 1 e 2, apenas. c) 1 e 3, apenas. d) 1 e 4, apenas. e) 2 e 3, apenas. [C] 1787. A anlise de 3 organismos revelou as seguintes caractersticas: - animal 1 : corpo sem segmentao, cutcula dura e resistente, tubo digestivo completo, respirao cuticular e pseudocelomado. - animal 2 : corpo freqentemente recoberto por escamas, placas ou carapaa, respirao pulmonar, sem metamorfose, amniota e alantoidiano. - animal 3 : corpo segmentado, sistema circulatrio fechado, excreo por nefrdios, tubo digestivo completo e respirao cutnea. Pode-se identificar estes trs animais como pertencentes, respectivamente, s seguintes classes: a) Hirudinea, Insecta e Crustacea. b) Turbelaria, Pisces e Nematoda. c) Nematoda, Reptilia e Oligochaeta. d) Turbelaria, Reptilia e Insecta. e) Nematoda, Pisces e Cestoda. [C] 1788. Indique a opo que contm a CLASSE que, em todo o corpo, apresenta 3 pares de pernas (hexpodos) e 1 par de antenas (dceros). a) crustcea b) insecta c) arachnida d) chilopoda [B] 1789. Na coluna I, apresentada uma lista de invertebrados marinhos e, na coluna II, uma lista taxonmica. Coluna I 1. bolacha-da-praia ou corrupio 2. lesma-do-mar 3. coral 4. lula 5. caravela Coluna II a. Asteroidea b. Anthozoa c. Gastropoda d. Syphozoa e. Echinoidea f. Cephalopoda g. Porifera A associao correta a) 1a - 2c - 3d - 4e - 5g. b) 1e - 2c - 3b - 4f - 5d. c) 1e - 2f - 3b - 4c - 5d. d) 1a - 2c - 3b - 4f - 5d. e) 1e - 2f - 3g - 4c - 5b. [B] 1790. As figuras abaixo representam animais pertencentes a diferentes filos.

[D] 1784. Um entomlogo estudando a fauna de insetos da mata atlntica encontrou uma espcie cujos caracteres no se encaixavam naqueles caractersticos dos gneros de sua famlia. Isto levar o cientista a criar:

157 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

01. A figura 1 refere-se a um platelminto. 02. Os filos, representados por 1 e 2, apresentam simetria bilateral. 04. A principal caracterstica do filo representado na figura 3 o corpo segmentado em anis. 08. As moscas tambm fazem parte do filo representado pela figura 4. 16. Todos os filos apresentados pertencem ao grupo dos vertebrados. 32. O animal representado na figura 3 hermafrodita. 64. Todos os animais pertencentes aos filos representados por 2 e 4 so parasitas. FFVVFVF 1791. A figura mostra uma rvore filogentica dos grandes grupos de animais invertebrados.

Selecione, entre as alternativas abaixo, qual(is) constitui(em) procedimento(s) correto(s). 01) Usando as palavras ASSIMETRIA, DIPLOBLSTICO e CNIDOBLASTO, chega-se ao filo Cnidaria, constitudo de animais circulares e, portanto, assimtricos, apresentando dois tecidos no corpo. 02) Com a palavra ACELOMADO chega-se aos Platelmintos, mas, para encontrar o grupo Trematoda, tem-se que acrescentar as palavras PARASITA e ESCLEX. 04) A palavra METAMERIA sozinha no suficiente para caracterizar nenhum grupo zoolgico em particular. Para encontrar o txon Crustacea, necessrio acrescentar, por exemplo, APNDICES BIRREMES e CIRCULAO ABERTA. Por outro lado, para encontrar o grupo dos Poliquetos, deve-se adicionar PARAPDIO e CIRCULAO FECHADA. 08) Para encontrar informaes sobre os Insetos, pode-se combinar as seguintes palavras: EXOESQUELETO QUITINOSO, ASAS e TRAQUIAS. 16) A palavra DEUTEROSTOMIA suficiente para encontrar Chordata e para discrimin-lo de outros filos. 32) No existem palavras-chave para encontrar os Anfioxos, pois, como eles constituem o elo de ligao entre os invertebrados e vertebrados, todas as suas caractersticas aparecem tambm em pelo menos um destes grupos. 64) Para chegar a Aves, poderiam ser combinadas as palavras OVO, ENDOTERMIA e PENAS, mas nenhuma destas palavras sozinha seria suficiente. FFVVFFF 1794. Ausncia de rgo respiratrio, epiderme delgada, mida e densamente vascularizada para facilitar as trocas gasosas so caractersticas de: a) caracol b) hidra c) inseto d) minhoca e) ourio-do-mar [D] 1795. O que que a minhoca tem, e a mosca tambm? a) Sistema circulatrio fechado. b) Metameria. c) Respirao cutnea. d) Hermafroditismo. e) Desenvolvimento direto,. [B] 1796. Os aneldeos tm em comum: a) o habitat. b) as ventosas. d) os parapdios. e) as cerdas. [C] c) a segmentao.

Existe um filo animal, pouco mencionado nos livros de textos, chamado Gnathostomulida, cujos representantes atuais vivem entre os gros de areia de certas praias ocenicas. Os animais desse grupo no apresentam corpo segmentado nem cavidade corporal, mas certas espcies tm tubo digestivo completo, com boca e nus. Tais caractersticas sugerem que os gnatostomuldeos se separaram do tronco principal da rvore filogentica entre os grupos de: a) porferos e cnidrios. b) cnidrios e platelmintos. c) platelmintos e nematelmintos. d) nematelmintos e moluscos. e) moluscos e aneldeos. [C] 1792. O quadro apresenta uma amostragem hipottica de uma coleta de mosquitos realizada num parque.

1797. Critrios anatmicos, fisiolgicos e embrionrios servem tambm de base para estabelecer o grau de parentesco entre os seres e Conseqentemente, sua origem evolutiva. Sendo assim, permitem seu enquadramento nas categorias taxonmicas. Assinale a opo que NO apresenta uma justificativa correta no enquadramento dos Aneldeos como seres mais evoludos que os Cnidrios: a) O sistema circulatrio nos Aneldeos fechado, enquanto que os Cnidrios so desprovidos desse sistema. b) Os Aneldeos apresentam respirao cutnea indireta (com auxlio de sangue), j nos Cnidrios, as trocas gasosas se realizam por difuso. c) Aneldeos so animais triblsticos, enquanto que Cnidrios so diblsticos. d) Presena de tubo digestivo completo em Aneldeos, e incompleto em Cnidrios. e) Presena de sistema nervoso difuso nos Aneldeos, e ganglionar nos Cnidrios. [E] 1798. O esquema a seguir mostra parte de um animal.

Considerando-se os dados desse quadro, a biodiversidade de mosquitos expressa pelo nmero de a) espcies. b) famlias. c) indivduos. d) ordens. [A] 1793. Voc precisa fazer uma pesquisa sobre um grupo zoolgico no arquivo da biblioteca ou pela rede mundial de computadores, a INTERNET. Nas duas situaes voc recebeu instrues para fazer a procura por meio de palavraschave, isto , palavras que caracterizam o grupo que voc quer encontrar.

Uma tal organizao dos nefrdios, do sistema nervoso e do celoma encontra-se em a) minhocas. b) caramujos. c) gafanhotos. d) planrias. e) ourios-do-mar. [A] 1799. Vertebrados, aneldeos e alguns moluscos possuem sistema circulatrio fechado e hemoglobina como pigmento respiratrio. Nos aneldeos, a hemoglobina est localizada a) nas plaquetas. b) no lquido intersticial. c) no plasma. d) nos corpsculos.

158 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) nos glbulos vermelhos. [C] 1800. Observe a figura em que se representa um fenmeno biolgico.

Todas as alternativas apresentam benefcios resultantes desse fenmeno, EXCETO a) Aumento da aerao no solo. b) Aumento da eficincia na ciclagem dos nutrientes na agricultura. c) Aumento do nmero de consumidores favorecendo o fluxo de energia. d) Maior disponibilidade de alimento para os peixes. e) Manuteno da diversidade no ecossistema. [D] 1801. Num passado, no muito distante, um tipo de animal era vendido em barbearias e em boticrios para se fazer sangria. Acreditava-se que a sangria feita por esses animais podia curar uma grande srie de males que afligissem uma pessoa. Que animal era utilizado e a qual o filo pertence? a) lesma, do filo Molusca b) minhoca, do filo Annelida c) lesma, do filo Artrpoda d) sanguessuga, do filo Annelida e) amarelo, do filo Asquelminte [D] 1802. Animal dividido em segmentos, sem patas e capaz de cavar tneis transformando o solo em hmus (terra frtil). A descrio refere-se : a) centopia b) lesma c) minhoca d) caracol e) cobra [C] 1803. Aneldeos e artrpodos tm em comum: a) excreo por tbulos de Malpighi. b) respirao traqueal. c) corpo organizado em metmeros ou segmentos. d) sistema circulatrio fechado. e) sistema digestivo incompleto. [C] 1804. Assinale a alternativa que apresenta o nome de um ser vivo monico, com fecundao cruzada dupla. a) sapo b) cobra c) tnia d) minhoca e) gafanhoto [D] 1805. A ocorrncia de sistema circulatrio fechado, sangue com hemoglobina, trs folhetos embrionrios formando um celoma verdadeiro e corpo metamerizado so caractersticas que aparecem em conjunto pela primeira vez em: a) moluscos. b) aneldeos. c) insetos. d) platelmintos. e) vertebrados. [B] 1806. Os animais constituem um reino muito diversificado, no qual h grupos que apresentam caractersticas muitas vezes peculiares. Em relao aos animais, julgue os itens a seguir. (0) A grande capacidade adaptativa e reprodutiva dos insetos permite a eles sobrevivncia nos mais variados ambientes. (1) Camares, insetos, sapos e tartarugas apresentam fase larval durante o desenvolvimento embrionrio. (2) Quanto mais primitivo e jovem for o animal, maior a sua capacidade de regenerao. (3) Por serem hermafroditas, as minhocas tendem a apresentar pequena variabilidade gentica. (4) Os animais dependem, direta ou indiretamente das algas do fitoplncton marinho. Itens corretos: 0, 2 e 4 Itens errados: 1 e 3 1807. O esquema a seguir exemplifica o tipo de sistema nervoso constitudo de crebro composto de gnglios na extremidade anterior, cordo nervoso ventral duplo de gnglios e nervos segmentares.

Este tipo de sistema nervoso encontrado em: a) aneldeos b) turbelrios c) vertebrados d) equinodermos [A] 1808. Assinale a alternativa que contm uma caracterstica que surgiu entre os aneldeos e foi mantida pelos animais que apareceram mais tarde no processo evolutivo. a) Notocorda b) Fendas branquiais c) Mesoderma d) Simetria bilateral e) Celoma verdadeiro [E] 1809. A respeito das minhocas, correto afirmar que: a) so pseudocelomadas. b) tm sistema circulatrio fechado. c) so de sexos separados. d) tm digesto intracelular. e) tm desenvolvimento indireto. [B] 1810. Assinale a opo que associa corretamente as Classes do Filo Arthropoda apresentadas na coluna adiante, em algarismos arbicos, com as caractersticas morfolgicas apresentadas a seguir, em algarismos romanos: 1 - Insetos 2 - Crustceos 3 - Aracndeos 4 - Quilpodes 5 - Diplpodes I. corpo dividido em cabea, trax e abdome, hexpodes. II. corpo dividido em cabea e tronco: um par de patas por segmento do corpo. III. corpo dividido em cefalotrax e abdome: aparelho bucal mandibulado. IV. corpo dividido em cefalotrax e abdome: quelicerados. V. corpo dividido em cabea e tronco: dois pares de patas por segmento do corpo. a) I - 1; II - 4; III - 2; IV - 3; V - 5. b) I - 3; II - 2; III - 4; IV - 1; V - 5. c) I - 1; II - 5; III - 3; IV - 2; V - 4. d) I - 2; II - 4; III - 1; IV - 5; V - 3. e) I - 2; II - 5; III - 1; IV - 3; V - 4. [A] 1811. Os meios de comunicao tm veiculado inmeras reportagens em que equipes de sade visitam borracharias, depsitos de ferro-velho e at cemitrios, eliminando recipientes que possam reter guas de chuva. Esta condio propicia o aparecimento das seguintes doenas: a) doena de Chagas, encefalite e dengue. b) dengue, malria e esquistossomose. c) febre amarela, doena de Chagas e giardase. d) malria, giardase e amarelo. e) dengue, febre amarela e malria. [E] 1812. Alguns seres vivos, como as abelhas e os pulges, conseguem produzir indivduos sem que a fmea receba o espermatozide para fecundar o vulo. Este fenmeno chamado de: a) poliembrionia. b) partenognese. c) metagnese. d) nidao. e) filogenia. [B] 1813. O 'Anopheles', transmissor da malria, possui 3 pares de patas, 1 par de antenas e o corpo dividido em cfalo, trax e abdome, enquanto que o 'Boophilus', transmissor de doena em gado, possui 4 pares de patas, no tem antenas e o corpo dividido em cefalotrax e abdome. 'Anopheles'e 'Boophylus' pertencem, respectivamente, s classes:

159 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) Insecta e Crustacea. b) Insecta e Arachnida. c) Arachnida e Crustacea. d) Arachnida e Insecta. e) Crustacea e Arachnida. [B] 1814. Diversas espcies de insetos so consideradas nocivas ao homem por serem transmissoras de doenas. Associe a doena (coluna I) ao gnero (coluna II) a que pertencem as principais espcies que as transmitem, no Brasil. Coluna I 1 - Dengue 2 - Leishmaniose 3 - Filariose 4 - Doena de Chagas Coluna II ( ) Culex ( ) Triatoma ( ) Aedes ( ) Lutzomya Das alternativas a seguir, escolha aquela que corresponde seqncia correta obtida na coluna II: a) 1-3-2-4 b) 4-3-2-1 c) 3-4-1-2 d) 1-4-2-3 e) 1-4-3-2 [C] 1815. Vendo um mesmo animal, 3 pessoas observaram diferentes caractersticas. A pessoa A notou apndices articulados, a pessoa B constatou antenas e a pessoa C contou 6 patas. Que pessoas mencionaram caractersticas exclusivas de insetos? a) Apenas A. b) Apenas B. c) Apenas C. d) A e B. e) B e C. [C] 1816. Em um cupinzeiro, podem ser encontrados cupins com diferentes formas: operrios, soldados, machos alados e fmeas aladas. Assinale a alternativa que melhor se relaciona com a existncia dessas diferentes formas. a) Esses animais no vivem em sociedade. b) Esses animais disputam diferentes funes. c) Esses animais possuem diviso de trabalho. d) So necessrios cuidados diferenciados com o alimento fungo. e) As diferentes funes levam necessidade de diferentes formas. [C] 1817. 'Apis melifera' a espcie utilizada pelos apicultores do Vale do Paraba para produzir mel, prpolis, gelia real e outros produtos. Seus vulos, se fecundados, do origem: a) somente s fmeas frteis. b) somente aos machos frteis. c) somente s fmeas estreis. d) s fmeas frteis e s estreis. e) somente aos machos estreis. [D] 1817. O que que a minhoca tem, e a mosca tambm? a) Sistema circulatrio fechado. b) Metameria. c) Respirao cutnea. d) Hermafroditismo. e) Desenvolvimento direto,. [B] 1820. A partir de registros fsseis, sabe-se que no Perodo Jurssico a 200 milhes de anos atrs, haviam cerca de 300 Famlias de insetos; enquanto entre os quadrpedes haviam cerca de 100 Famlias. A partir do Perodo Cretceo, h cerca de 100 milhes de anos at o Perodo Tercirio, mais recente, o nmero de Famlias de Insetos quadruplicou enquanto o nmero de Famlias de quadrpedes apenas dobrou. Percebe-se que os insetos constituem um grupo bastante bem sucedido na conquista do ambiente terrestre. Uma das caractersticas que possibilitou essa adaptao foi a presena de: a) respirao traqueal. b) circulao fechada. c) fecundao externa. d) tubo digestivo incompleto. e) carapaa permevel. [A] 1821. "Substncia tirada do cinamomo elimina os parasitas dos barbeiros." Admitindo-se a hiptese de que essa droga atuasse tambm em outras espcies de insetos transmissores de endemias brasileiras, a NICA doena que NO seria beneficiada por esta medida profiltica a: a) Doena de Chagas. b) Leishmaniose. c) Malria. d) Filariose ou Elefantase. e) Ancilostomose. [E]

1822. Os insetos que possuem aparelho bucal representado nas figuras I, II, III e IV a seguir so, respectivamente:

a) abelha, pernilongo, borboleta e gafanhoto. b) abelha, mosca, barata, pernilongo. c) barata, borboleta, abelha, gafanhoto. d) borboleta, pernilongo, gafanhoto, mosca. e) pernilongo, abelha, borboleta, barata. [A] 1823. Durante o vero, podemos ouvir, com freqncia, o canto das cigarras, que um som emitido pelos machos para atrair as fmeas ao acasalamento. Nesse mesmo perodo, observamos exoesqueletos de cigarras presos s rvores, que popularmente so mencionados como cigarras "estouradas" de tanto cantar. Sabe-se que, na verdade, o resultado do crescimento que ocasiona as "mudas" nos insetos. O hormnio responsvel pelas "mudas" nos insetos o(a): a) feromnio. b) cido abcsico. c) auxina. d) ecdisona. e) adrenalina. [D] 1824. Duas formigas da mesma espcie se encontram e estabelecem o seguinte dilogo: FORMIGA 1: - Oi, aonde vai to depressa e to cheirosa? FORMIGA 2: - Ah! Estou nas nuvens, de tanta felicidade, pois vero e espero o meu prncipe encantado para o vo nupcial. FORMIGA 1 (PENSANDO EM VOZ ALTA): E eu, aqui, no maior cansao. Queria tanto ser como a formiga 2! Mas como!?

Com base nesse "dilogo", podemos dizer que a) a formiga 1 uma fmea operria que, apesar de trabalhar, frtil, podendo um dia se casar. b) a formiga 1 um macho operrio, espera da maturidade sexual. c) a formiga 1 s originar descendentes por partenognese. d) a formiga 2 uma rainha que, depois de fecundada, perde as asas e d incio formao de um novo formigueiro. e) a formiga 2 ser fecundada a cada vero de sua vida. [D] 1825. Entre os artrpodos, a presena de dois pares de antenas caracteriza os a) insetos. b) crustceos. c) aracndeos. d) diplpodos. e) quilpodos. [B] 1826. Com relao ao bicho de p, ao berne e ao piolho, CORRETO afirmar-se que a) so endoparasitas. b) so formas parasitas quando adultos. c) so hematfagos. d) so insetos. e) tm metamorfose completa. [D]

160 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1827. As formigas savas constituem sociedades organizadas em que as formigas rainhas, is, vivem cerca de quinze anos e produzem at quatro milhes de formigas-filhas. A fertilizao das rainhas realizada a) pelas operrias, no solo. b) pelos soldados, no ar. c) pelos soldados, no solo. d) pelos machos, bitus, no ar. e) pelos machos, bitus, no solo. [D] 1828. Observe as figuras que representam dois organismos.

1834. Foram analisados dois insetos, designados por A e B, com as seguintes caractersticas: A - apresenta dois pares de asas, tem aparelho bucal triturador e hemimetbolo. B - apresenta um par de asas, tem aparelho bucal picador e holometbolo. Os insetos A e B, anteriormente referidos, podem ser, respectivamente: a) gafanhoto e formiga. b) formiga e barata. c) mosca e besouro. d) gafanhoto e pernilongo. e) borboleta e pernilongo. [D] 1835. Existem atualmente cerca de um milho de espcies de animais. Deste nmero aproximadamente 5% so vertebrados e os demais invertebrados, (Fonte: BARNES, R. D, 1984). Sobre os invertebrados, julgue os itens a seguir. ( ) O sanguessuga pertence ao Filo Annelida, ou seja, so animais metamricos vermiformes. ( ) Os escorpies so aracndeos, com excreo por tbulos de malpighi. ( ) As baratas pertencem ao Filo Arthropoda e apresentam respirao do tipo traqueal. ( ) As planrias pertencem ao Filo Porifera, com sistema nervoso difuso em forma de rede. VVVF 1836. Considere os tipos de estruturas e os animais a seguir: I. nematocisto II. exoesqueleto quitinoso III. protonefrdio a) artrpodes b) cnidrios c) platielmintos Assinale corretamente cada tipo de estrutura com os animais que a apresentam. a) Ia, IIb, IIIc b) Ia, IIc, IIIb c) Ib, IIa, IIIc d) Ib, IIc, IIIa e) Ic, IIa, IIIb [C] 1837. Os jornais tm noticiado a grande invaso de cupins em diversos bairros em expanso na cidade. Isso ocorre devido ao acmulo de madeiras abandonadas pela construo civil. A sobrevivncia dos cupins na madeira, simplificando a celulose, s possvel pela associao desses insetos com: a) pulges. b) protozorios. c) fungos. d) lquens. e) bactrias. [B] 1838. Associe o artrpode com o seu rgo inoculador de veneno. I - aranha II - escorpio III - abelha IV - lacraia A - ferro B - garra C - quelcera D - agulho Assinale a alternativa que d a associao correta: a) I - B, II - C, III - D e IV - A b) I - C, II - D, III - A e IV - B c) I - B, II - C, III - A e IV - D d) I - D, II - C, III - A e IV - B e) I - D, II - B, III - A e IV C [B] 1839. As aranhas se diferenciam dos insetos, pois: a) possuem um esqueleto externo. b) possuem patas articuladas. c) no possuem antenas. d) so carnvoros. e) so terrestres. [C] 1840. Animal dividido em segmentos com 2 antenas, 6 patas e 2 asas. Estamos descrevendo uma a) borboleta. b) centopia. c) liblula. d) mosca. e) barata. [D] 1841. A quitina, substncia formadora do exoesqueleto dos insetos, atua nesses animais tambm garantindo a: a) rapidez do seu crescimento. b) diminuio da perda de gua. c) eficincia da respirao lacunar. d) adaptao reproduo gmica. e) adaptao circulao aberta. [B]

Em relao a esses organismos, todas as afirmativas so corretas, EXCETO a) Pertencem a populaes diferentes. b) So consumidores primrios ou secundrios. c) So da mesma classe do tatuzinho do jardim. d) So de habitat aqutico. e) So nocivos s plantas. [E] 1829. Uma abelha que tenha suas antenas extirpadas perde a capacidade de a) equilibrar o vo. b) perceber a cor das flores. c) perceber o odor das flores. d) perceber o sabor do nctar. e) retirar o nctar. [C] 1830. Dentre os diferentes Filos de invertebrados, vamos encontrar: cnidrios, platelmintos, aneldeos, moluscos e artrpodes. Assinale a alternativa que contenha um representante de cada grupo, na seqncia acima relacionada.: a) Corais - tnias - oxiros - lulas - lacraias. b) Caravelas - fascolas - ostras - scaris - baratas. c) Anmonas - planrias - minhocas - mariscos - escorpies. d) Medusas - tnias - nereis - mexilhes - sanguessugas. e) Esponjas - esquistossomas - minhocas - caracis - aranhas. [C] 1831. Marque a opo em que todas as espcimes pertencem ao mesmo grupo ou filo: a) esponja, hidra, estrela-do-mar e planria b) formiga, borboleta, aranha e abelha c) caranguejo, caracol, camaro e ostra d) minhoca, centopia, cobra e lesma [B] 1832. Um grupo de estudantes em um passeio na mata encontra um tipo de animal que apresenta as seguintes caractersticas: corpo dividido em cabea, trax e abdome, 6 patas no trax e um par de antenas bem visveis. Este animal trata-se de um: a) inseto b) crustceo c) molusco d) aracndeo e) aneldeo [A] 1833. As caractersticas acima, de artrpodos, esto presentes: I - Corpo dividido em cefalotrax e abdome. II - Quelceras e pedipalpos. III - Ausncia de antenas. IV - Quatro pares de patas. a) em todos os aracndeos. b) somente nas aranhas e escorpies. c) somente nas aranhas. d) somente nos caros. e) somente nos caros e carrapatos. [B]

161 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1842. Um aluno, da FEI, foi a um jantar, onde havia camaro, ostra, lula e lagosta. Esta refeio continha portanto: a) apenas peixes b) apenas crustceos c) apenas moluscos d) apenas crustceos e moluscos e) apenas peixes e moluscos [D] 1843. "Os ...(I)..., por no apresentarem pigmentos respiratrios no sangue, no apresentam associao entre os sistemas ...(II)... e ...(III)... ." Para completar corretamente essa frase, os espaos I, II e III devem ser preenchidos, respectivamente, por: a) insetos - respiratrio - circulatrio. b) nematides - respiratrio - circulatrio. c) aneldeos - respiratrio - excretor. d) moluscos - circulatrio - excretor. e) crustceos - circulatrio - excretor. [A] 1844. Aneldeos e artrpodos tm em comum: a) excreo por tbulos de Malpighi. b) respirao traqueal. c) corpo organizado em metmeros ou segmentos. d) sistema circulatrio fechado. e) sistema digestivo incompleto. [C] 1845. O cumpizeiro um exemplo de: a) biocenose b) colnia d) ecossistema e) sociedade [E] c) comunidade

c) presena de exoesqueleto. d) presena de patas articuladas. [A] 1850. Voc est vendo a figura esquematizada do corte longitudinal de um inseto.

As estruturas identificadas pelos algarismos 1, 2 e 3 so, respectivamente, a) gnglios cerebrides - corao - glndulas salivares. b) cecos gstricos - intestinos - tbulos de Malpighi. c) glndulas salivares - cordo nervoso - intestino posterior. d) corao - tbulos de Malpighi - cecos gstricos. e) corao - cordo nervoso - tbulos de Malpighi. [E] 1851. Com relao ao filo dos Artrpodes, pode-se afirmar que: I - so animais que apresentam apndices articulados, exoesqueleto rgido e sistema circulatrio fechado. II - nos crustceos, o exoesqueleto pode sofrer impregnao de sais de clcio. III - os insetos so mandibulados e caracterizam-se pela presena de trs pares de apndices locomotores. IV - os aracndeos so mandibulados e caracterizam-se pela presena de quatro pares de apndices locomotores. V - a principal caracterstica dos crustceos apresentar um par de antenas e dois pares de mandbulas. VI - nos insetos, a respirao traqueal e os tbulos de Malpighi realizam a excreo. Assinale a alternativa correta a) I, II, IV e V esto corretas. b) II, III e IV esto corretas. c) III, IV, V e VI esto corretas. d) IV, V e VI esto corretas. e) II, III e VI esto corretas. [E] 1852. Pela observao do esquema anterior, podemos concluir que o zango foi originado por:

1846. Um estudante encontrou um pequeno animal e resolveu lev-lo para sua aula de cincias. Ao chegar na sua aula, mostrou-o ao professor, que logo pediu que ele fizesse uma descrio deste ser para que pudesse ser identificado. O aluno verificou, com o auxlio de uma lupa de mo, que o pequeno animal apresentava o corpo dividido em trs partes, tinha seis patas, um par de antenas e s apresentava uma asa. Com esta descrio, o estudante pode concluir que o animal : a) um aneldeo b) um crustceo c) um molusco d) um aracndeo e) um inseto [E] 1847. A figura a seguir mostra o representante de um grupo de seres vivos bem adaptado na natureza.

Assinale a opo que indica trs caractersticas por esse "sucesso": a) Presena de quitina, capacidade de vo, respirao traqueal. b) Presena de quitina, formas hermafroditas, ovos megalcitos. c) Formas hermafroditas, ovos megalcitos, respirao traqueal. d) Ovos megalcitos, dimorfismo sexual, fecundao externa. e) Dimorfismo sexual, fecundao externa, capacidade de vo. [A] 1848. Recentemente, na regio da Grande Vitria, no Esprito Santo, tm surgido vrios casos de dengue. Essa doena transmitida por certos mosquitos quando sugam o sangue humano. Uma das estratgias de preveno dengue eliminar corpos d'gua nas regies urbanas, pois a se desenvolvem as larvas desses mosquitos. Com base no texto anterior, possvel concluir que o mosquito transmissor da dengue : a) ametbolo e hematfago. b) holometbolo e parasita. c) hemimetbolo e parasita. d) holometbolo e predador. e) hemimetbolo e predador. [B] 1849. No Brasil, so conhecidas vrias espcies de aranhas venenosas e de insetos vetores de doenas. Esses animais pertencem ao grupo dos artrpodes, que constituem mais de um milho de espcies, das quais cerca de novecentos mil so de insetos. O grande sucesso evolutivo dos insetos, quando comparados aos demais artrpodes, pode ser explicado pela seguinte adaptao: a) hbitos alimentares diversificados. b) pequeno porte. a) gametognese. d) conjugao. [B] b) partenognese. e) brotamento. c) gemulao.

1853. Os animais constituem um reino muito diversificado, no qual h grupos que apresentam caractersticas muitas vezes peculiares. Em relao aos animais, julgue os itens a seguir. (0) A grande capacidade adaptativa e reprodutiva dos insetos permite a eles sobrevivncia nos mais variados ambientes. (1) Camares, insetos, sapos e tartarugas apresentam fase larval durante o desenvolvimento embrionrio. (2) Quanto mais primitivo e jovem for o animal, maior a sua capacidade de regenerao. (3) Por serem hermafroditas, as minhocas tendem a apresentar pequena variabilidade gentica. (4) Os animais dependem, direta ou indiretamente das algas do fitoplncton marinho. Itens corretos: 0, 2 e 4 Itens errados: 1 e 3 1854. Mais de 4 mil taturanas esto sendo depiladas com pina e tesoura no Instituto Butant. O trabalho destina-se a fornecer matria-prima para a produo

162 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

do soro que age como antdoto contra o veneno da taturana assassina. 'Lonomia obliqua' o nome cientfico do inseto. Embora ela cause poucos acidentes no Estado de So Paulo, no Rio Grande do Sul chega a provocar 400 acidentes anuais. Prepara-se um macerado dos plos em meio lquido. Esse veneno ento injetado em cavalos em doses muito pequenas, mas sucessivas e crescentes. O prximo passo retirar o sangue do animal, a partir do qual preparado o soro a ser injetado nas vtimas. A maioria das lagartas que chegam de So Paulo vem parasitada. O parasita uma minscula vespa que coloca os ovos na taturana; as larvas da vespa alimentam-se da taturana, que acaba morrendo antes de se transformar em mariposa. Como a maioria das taturanas vindas do Sul no est parasitada, pensa-se que as vespas estariam indiretamente protegendo a populao de So Paulo. O ESTADO DE S. PAULO, 19/2/98 (com adaptaes). Com o auxlio dessa notcia, julgue os itens abaixo. (1) O texto incorre em erro ao classificar a taturana como inseto. (2) A taturana pertence espcie 'Lonomia'. (3) Com o procedimento descrito, o cavalo desenvolve anticorpos contra o veneno da taturana. (4) As "vespas estariam indiretamente protegendo a populao" por diminurem o nmero de taturanas em So Paulo. (5) Infere-se do texto que o Butant quer produzir uma vacina contra a taturana. EECCE 1855. Os artrpodes constituem um grupo de seres vivos bem varivel com relao sua organizao e processos metablicos. Uma caracterstica comum a todos eles : a) a fecundao interna com desenvolvimento indireto. b) o sistema digestivo completo. c) a presena de pigmento respiratrio no sangue. d) a presena de antenas. e) a excreo por tbulos de Malpighi. [B] 1856. No quadro anterior, sobre alguns tipos de artrpodes, I, II, III e IV devem ser substitudos, respectivamente, por:

1859. A figura ilustra algumas medidas preventivas de combate a um mosquito causador de doena que j atacou, desde o incio deste ano, mais de 90000 brasileiros, e que tem preocupado as autoridades sanitrias do pas (FARMAIS, ano 1, n12, p.24.).

Assinale a alternativa que inclui a doena cujo combate est representado na figura, bem como outras doenas tambm transmitidas por mosquitos vetores. a) Febre amarela, doena de Chagas, lcera de Bauru e clera. b) Malria, doena de Chagas, dengue hemorrgica e lcera de Bauru. c) Dengue, elefantase, malria e febre amarela. d) Elefantase, clera, esquistossomose e dengue hemorrgica. e) Dengue, amebase, amarelo e clera. [C] 1860. Marque a opo em que as duas classes esto corretamente associadas ao tipo de respirao e importncia.

a) hemocianina, tbulos de Malpighi, indireto e indireto. b) hemocianina, tbulos de Malpighi, direto e indireto. c) hemocianina, tbulos de Malpighi, direto e direto. d) ausente, tbulos de Malpighi, direto e indireto. e) ausente, glndulas verdes, direto e indireto. [B] 1857. Conta-se que o bilogo ingls J. B. S. Haldane, ao ser indagado por um grupo de telogos sobre o que poderia ser concludo sobre a natureza do Criador, a partir de um estudo da Sua criao, teria respondido: "Uma excessiva afeio por besouros". A partir da sentena do bilogo, podemos afirmar que: a) a diversidade biolgica desordenada, sendo os artrpodes os maiores representantes das espcies animais e, entre estes, 92% so insetos e, na sua maioria, besouros. b) o mundo orgnico bastante diversificado, entretanto o nmero de espcies pertencentes aos diferentes grupos taxonmicos no igual, e os artrpodes compreendem uma expressiva percentagem de todas as espcies animais. c) os artrpodes so a base da rvore evolutiva, tendo as outras espcies evoludo a partir desses. d) os besouros so, seguramente, a classe da maior diversidade, com grande variao de cores e formas, demonstrando um grande cuidado do Criador ao fazlos. e) os indivduos de uma mesma espcie mostram muitas variaes na forma e na fisiologia, e, os mais bem adaptados ao meio, sobrevivem seleo natural. [B] 1858. Doena de Chagas, Malria e Febre Amarela so doenas endmica em pases tropicais, incluindo o Brasil. Assinale o agente etiolgico e o vetor de cada uma delas, na ordem citada acima. a) 'Trypanossoma cruzi' e Triatoma; Plasmodium e Anophelis; Vrus e 'Aedes aegypti'. b) 'Trypanossoma cruzi' e Triatoma; Bacilo de Hansen e Anoplurus; Vrus e Culex. c) 'Leishmania brasiliensis' e Phlebotomus; 'Trypanossoma cruzi' e Triatoma; Bacilos e Hempteros. d) 'Ascaris lumbricoides' e Hemptero; Plasmodium e Anophelis; Estafilococos e 'Aedes aegypti'. e) 'Schistosoma mansoni' e Biomphalaria; Paramecium e Blaterdeos; 'Wuchereria bancrofti' e Culex. [A]

[A] 1861. Dos animais a seguir, caracterizam-se por apresentar metmeros, a) as planrias. b) os nematides. c) os caramujos. d) os camares. e) os pepinos-do-mar. [D] 1862. Estrutura, funo e grupo de animal, representados na figura a seguir, apresentam-se relacionados em

a) clula flama - respirao - insetos. b) tubos de Malpighi - respirao - aranhas. c) tubos de Malpighi - excreo - insetos. d) clula flama - excreo - aranhas. e) tubos de Malpighi - respirao - inseto. [C] 1863. Observe o ciclo reprodutivo da abelha domstica e assinale a alternativa CORRETA:

163 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

e) 'Wuchereria bancrofti'. [D] 1871. Considere a afirmao: "O ciclo de vida se completa em um nico hospedeiro". Trata-se de: a) 'Plasmodium falciparum'. b) 'Trypanosoma cruzi'. c) 'Schistosoma mansoni'. d) 'Taenia solium'. e) 'Ascaris lumbricoides'. [E] 1872. O 'Ancylostoma' um parasita intestinal que provoca o "amarelo", doena que se pode adquirir: a) por picada de um hemptero (barbeiro). b) comendo carne de porco mal cozida. c) comendo carne bovina contaminada. d) por picada de pernilongo. e) andando descalo. [E] 1873. A parasitose que tem seu agente causador, quando adulto, alojado preferencialmente no sistema linftico a: a) tenase b) elefantase c) cisticercose d) ascaridase e) esquistossomose [B] 1874. A figura a seguir mostra a contaminao do homem por um parasita.

Os nmeros 1, 2, 3 e 4 correspondem, respectivamente, a: a) partenognese, meiose, mitose e fecundao. b) meiose, fecundao, mitose e partenognese. c) fecundao, meiose, mitose e partenognese. d) fecundao, meiose, partenognese e mitose. e) meiose, partenognese, fecundao e mitose. [D] 1864. A regio ceflica de um caranguejo difere daquela de um besouro porque a do caranguejo possui a) dois pares de antenas, enquanto a do besouro possui s um par. b) um par de antenas, enquanto a do besouro possui dois pares. c) olhos compostos, enquanto a do besouro possui ocelos simples. d) ocelos simples, enquanto a do besouro possui olhos compostos. e) um par de mandbulas, enquanto a do besouro possui dois pares. [A] 1865. " preciso aniquilar, exterminar. No pode restar nada, nem poeira. A poeira, alis, um dos primeiros sinais da presena dessa praga que causa um prejuzo de 10 bilhes de dlares por ano em todo o mundo. preciso erradicar". A praga em questo so os cupins, e a sua erradicao dificultada pelos seguintes fatores: I - a rainha dos cupins fecundada durante o vo nupcial, armazenando os espermatozides durante toda a vida; II - o abdome da rainha sofre hipertrofia, o que permite a postura de milhares de ovos por dia; III - h substituio do rei ou da rainha, quando da morte ou retirada de um ou de ambos da colnia, devido ausncia do feromnio que inibe a funo reprodutora dos outros indivduos. Est(o) CORRETA(S) a) I e II. b) II e III. c) I e III. d) I, II e III. e) apenas III. [B] 1866. Indique a opo que contm a CLASSE que, em todo o corpo, apresenta 3 pares de pernas (hexpodos) e 1 par de antenas (dceros). a) crustcea b) insecta c) arachnida d) chilopoda [B] 1867. O bicho-pau, inseto do grupo dos gafanhotos, tem forma semelhante a um graveto. Outros insetos so parecidos com folhas devido sua forma e colorao. Esse fenmeno em que animais apresentam grande semelhana com o ambiente onde vivem, o que facilita esconderem-se de predadores ou presas, chamado de a) mutualismo. b) camuflagem. c) protocooperao. d) mimetismo. e) inquilinismo. [B] 1868. Em relao aos diferentes grupos animais, correto afirmar que 01. os vertebrados so diblsticos, acelomados e protostmicos. 02. os mamferos adultos apresentam rim do tipo pronfrico. 04. os gastrpodes apresentam rgos de percepo visual bem desenvolvidos. 08. os peixes sseos apresentam espirculos e nadadeira caudal heterocerca. 16. as aves apresentam circulao dupla e completa, e homeotermia. 32. os turbelrios so os nicos representantes parasitas entre os platielmintes. 64. os crustceos apresentam corpo dividido em cefalotrax e abdome e 2 pares de antenas. FFFFVFV 1869. No nematide Ascaris, a presso interna no repouso de 70cm de gua e chega a 400cm de gua quando o animal se locomove. Essas presses elevadas so mantidas, com economia de energia, pela existncia ao longo do corpo do animal de uma a) musculatura circular. b) musculatura longitudinal. c) musculatura circular e uma longitudinal. d) cutcula extremamente inelstica. e) exoesqueleto. [D] 1870. Representantes da Classe Nematoda so encontrados parasitando o tubo digestivo e outros rgos do homem. Das espcies a seguir, indique a que no pertence referida classe: a) 'Ascaris lumbricoides'. b) 'Necator americanus'. c) 'Ancylostoma duodenale'. d) 'Taenia saginata'.

A molstia causada por esse parasita a a) elefantase. b) ancilostomose. c) leishmaniose. d) ascaridase. e) esquistossomose. [B] 1875. A ingesto freqente de terra por crianas um comportamento que pode indicar a) anemia, como conseqncia de necatorase. b) desnutrio, por deficincia de minerais para reposio de energia. c) fome, pois a terra ingerida produzir sensao de saciedade. d) parasitose por Ascaris porque a ingesto de terra reduz a infestao. e) raquitismo, portanto as crianas buscam, instintivamente, o clcio necessrio ao seu crescimento. [A] 1876. Crianas que freqentavam um tanque de areia do condomnio onde residiam, apresentaram, praticamente ao mesmo tempo, uma parasitose conhecida popularmente como "bicho geogrfico" ou "larva migrans", cujo agente etiolgico o 'Ancylostoma braziliense'. Quais os animais a seguir relacionados poderiam ter sido responsveis pela contaminao da areia? a) Ratos e pssaros. b) Ratos e pombos. c) Morcegos e pombos. d) Cachorros e gatos. e) Papagaios e pombos. [D] 1877. Das doenas a seguir, as que no apresentam mosquito como hospedeiro intermedirio so: a) malria, esquistossomose e tenase b) Mal-de-Chagas, filariose e triquinose c) triquinose, esquistossomose e tenase d) febre amarela, amarelo e malria e) ascaridase, bicho-geogrfico e oxiurose [E] 1878. As verminoses so um grande problema de sade, principalmente nas populaes de baixa renda que geralmente vivem onde as condies sanitrias so precrias ou inexistentes. Sobre as verminoses, julgue os itens. ( ) A "barriga d'gua" causada pelo 'Schistosoma mansoni', cujo hospedeiro intermedirio o caramujo.

164 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

( ) Os cisticercos da 'Taenia sollium' so transmitidos ao homem pela carne do porco crua ou mal cozida. ( ) A lombriga asquelminte que se aloja principalmente no intestino. ( ) A ameba um nematoda que no homem causa a clera. VVVF 1879. Conforme o ciclo evolutivo, os parasitas so classificados em monogenticos e digenticos. No primeiro caso, quando seu ciclo se passa num nico hospedeiro e no segundo caso, quando se desenvolve em dois hospedeiros, o intermedirio e o definitivo. Um parasita considerado monogentico : a) 'Ascaris lumbricoides'. b) 'Taenia sollium'. c) 'Trypanosoma cruzi'. d) 'Leishmania brasiliensis'. e) 'Wuchereria bancrofti'. [A] 1880. Um analista clnico, ao fazer um exame de fezes de um paciente, observou, ao microscpio, ovos de um verme Asquelminto (ou Nematelminto). Seu diagnstico estaria INCORRETO se afirmasse ter encontrado ovos de: a) 'Enterobius' sp. (oxiros) b) 'Schistosoma' sp. c) 'Ancylostoma' sp. d) 'Ascaris' sp. e) 'Necator' sp. [B] 1881. Assinale a alternativa que apresenta parasitoses humanas causadas por parasitas pertencentes, unicamente, ao filo dos Nematelmintos. a) Tenase, Ascaridase e Dracunculose. b) Ascaridase, Amarelo e Elefantase. c) Esquistossomose, Amarelo e Tenase. d) Triquinose, Oxiurose e Esquistossomose. e) Ascaridase, Elefantase e Esquistossomose. [B] 1882. Nas alternativas indique a doena na qual o parasita causador NO necessita de um hospedeiro intermedirio: a) malria b) ascaridase c) dengue d) esquistossomose [B] 1883. Exemplos de molstias causadas por parasitas, que se manifestam apenas na espcie humana e cuja transmisso independe de hospedeiro intermedirio, so: a) ascaridase e ancilostomose. b) esquistossomose e malria. c) malria e ascaridase. d) ancilostomose e tenase. e) tenase e esquistossomose. [A] 1884. A elefantase ou filariose uma parasitose comum na regio amaznica. Sua profilaxia pode ser feita atravs do combate ao inseto vetor e do isolamento e tratamento das pessoas doentes. O agente causador e o hospedeiro intermedirio dessa parasitose so, respectivamente: a) 'Ascaris lumbricoides' e um mosquito do gnero Culex. b) 'Wuchereria bancrofti' e um mosquito do gnero Culex. c) 'Wuchereria bancrofti' e o caramujo. d) 'Schistosoma mansoni' e a filria. e) 'Ancylostoma duodenale' e a filria. [B] 1885. A figura a seguir representa o ciclo de vida de um verme parasita do organismo humano.

[A] 1886. Analise as informaes abaixo sobre as caractersticas de uma verminose. I- O parasita se apresenta no interior dos vasos linfticos da pessoa infestada. II- O hospedeiro intermedirio pertence ao filo do Artrpodos. III- Geralmente acarreta um derrame de linfa nos tecidos, provocando uma inchao. Tais caractersticas so pertinentes a: a) leishmaniose. b) filariose. c) ancilostomose. d) esquistossomose. e) ascaridiose. [B] 1887. Ao abrir o envelope com o resultado de seu exame parasitolgico de fezes, Jequinha leu: Positivo para ovos de 'Ascaris lumbricoides'. Qual das medidas preventivas de doenas parasitrias, relacionadas a seguir, NO deve ter sido observada por Jequinha na sua vida diria? a) Andar calado para que a larva no penetre pelos ps. b) Comer carne de porco ou de boi inspecionada e bem cozida. c) Lavar bem as mos e os alimentos antes das refeies. d) Colocar tela nas janelas para impedir a entrada do mosquito 'Culex'. e) No nadar em lagoas que tenham o caramujo 'Biomphalaria'. [C] 1888. Um animal que s possui musculatura longitudinal e que usa a presso hidrosttica do lquido pseudocelomtico como antagonista da musculatura pode ser uma a) minhoca. b) lombriga. c) planria. d) anmona. e) estrela-do-mar. [B] 1889. Considere o esquema a seguir, referente a parasitoses humanas.

I e II podem ser, respectivamente, a) malria e doena de Chagas. b) amarelo e amebase. c) doena de Chagas e malria. d) elefantase e amarelo. e) amebase e esquistossomose. [D] 1890. Inicialmente o plipo reproduz-se assexuadamente, por brotamento, originando as medusas. Estas formaro gametas que depois se uniro para a formao dos zigotos. Dos zigotos surgem larvas que nadam livremente at se fixarem para dar incio a novos plipos. Esse tipo de reproduo, denominado metagnese, ocorre nos a) celenterados. b) porferos. c) aneldeos. d) moluscos. e) artrpodes. [A] 1891. No processo evolutivo foram selecionados os seres de fecundao externa que liberam uma grande quantidade de gametas para o meio ambiente. As hidras, no entanto, reproduzem-se rapidamente, embora lancem um pequeno nmero de gametas na gua. A explicao para esse fato que as hidras apresentam um acelerado processo de reproduo: a) assexuada por diviso binria. b) assexuada por esporulao. c) assexuada por brotamento. d) sexuada por autofecundao. e) sexuada por partenognese. [C] 1892. A figura a seguir mostra o ciclo de vida da hidra.

O verme causador da parasitose e o transmissor so, respectivamente, a) a filria e um mosquito do gnero Culex. b) a filria e um mosquito do gnero Anopheles. c) o ancilstomo e um mosquito do gnero Culex. d) o ancilstomo e um mosquito do gnero Anopheles. e) o esquistossomo e um inseto do gnero Triatoma.

165 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

O texto refere-se a a) porferos com esqueleto calcreo . b) cnidrios hidrozorios. c) moluscos gastrpodes. d) porferos com esqueleto silicoso. e) cnidrios antozorios. [E] 1899. As estruturas anatmicas cnidoblastos e coancitos so encontradas, respectivamente, nos: a) espongirios e equinodermas b) celenterados e espongirios c) platelmintos e celenterados d) crustceos e celenterados [B] A anlise da figura leva s seguintes consideraes: I. A hidra reproduz-se tanto sexuada como assexuadamente. II. As larvas ciliadas tm vida livre. III. No ciclo de vida da hidra s existe a fase de plipo. Dessas consideraes, APENAS a) I correta. b) III correta. c) I e II so corretas. d) I e III so corretas. e) II e III so corretas. [D] 1893. Os recifes so verdadeiras barreiras de depsitos calcrios que se formaram ao longo dos anos em vrias costas brasileiras. A constituio fsica dessas barreiras marinhas se deve ao acmulo de "esqueletos" de: a) crustceos b) algas c) espongirios d) celenterados [D] 1894. Um organismo com as seguintes caractersticas: tubo digestivo incompleto, diblstico e com tecidos verdadeiros, pertence ao Filo: a) Cnidaria. b) Platyhelminthes. c) Porifera. d) Mollusca. e) Aschelminthes. [A] 1895. Assinale a estrutura anatmica encontrada apenas nos celenterados: a) p ambulacrrio b) cnidoblasto c) espcula d) clula-flama [B] 1896. As figuras adiante representam animais, numerados de 1 a 4 1900. Assinale a alternativa que relaciona animais Vertebrados que apresentam diafragma, plos e cordas vocais na laringe: a) Rpteis. b) Anfbios. c) Aves. d) Mamferos. e) Aracndeos. [D] 1901. Assinale a alternativa que relaciona apenas as Classes de Vertebrados que apresentam fecundao externa: a) Anfbios e Aves. b) Anfbios e Peixes. c) Peixes e Rpteis. d) Rpteis e Aves. e) Aves e mamferos. [B] 1902. Assinale a alternativa que relaciona apenas as classes de Vertebrados que apresentam fecundao interna e desenvolvimento direto: a) Peixes, Anfbios e Aves. b) Anfbios, Aves e Mamferos. c) Rpteis, Aves e Mamferos. d) Anfbios, Rpteis e Aves. e) Peixes, Anfbios e Rpteis. [C] 1903. Assinale a alternativa que relaciona apenas Vertebrados pecilotermos: a) cobra, pingim, r. b) jacar, salamandra, peixe-boi. c) tubaro, tartaruga, crocodilo. d) sapo, lagartixa, baleia. e) sardinha, perereca, canrio. [C] 1904. Assinale a alternativa que relaciona apenas Vertebrados homeotermos: a) cobra, pingim, r. b) jacar, salamandra, peixe-boi. c) tubaro, tartaruga, crocodilo. d) sapo, lagartixa, baleia. e) golfinho, homem, canrio. [E] 1905. Qual das alternativas a seguir relaciona animais invertebrados exclusivamente marinhos que apresentam notocorda: a) lampreia, feiticeira. b) anfioxo, ascdia. c) ourio-do-mar, anfioxo. d) ascdia, lampreia. e) feiticeira, ourio-do-mar. [B] Assinale a alternativa que contm o animal pertencente ao mesmo grupo das guas vivas, freqentes causadoras de queimaduras em banhistas no litoral brasileiro. a) 1 b) 2 c) 3 d) 4 [D] 1897. Uma colnia de plipos forma, por brotamento, pequenas medusas. Estas liberam gametas no ambiente, onde ocorre a fecundao. Do zigoto, surge uma larva ciliada, que d origem a uma nova colnia de plipos. A descrio anterior refere-se a um a) cnidrio, que apresenta alternncia de geraes. b) cnidrio, que apresenta exclusivamente reproduo sexuada. c) espongirio, que apresenta exclusivamente reproduo sexuada. d) espongirio, que apresenta alternncia de geraes. e) platielminte, que apresenta reproduo sexuada e assexuada, sem alternncia de geraes. [A] 1898. Considere o texto a seguir. "Os corais ptreos, ou corais verdadeiros, so os principais organismos formadores dos recifes coralneos, comuns na regio do Caribe e na Austrlia. Possuem um exoesqueleto de carbonato de clcio secretado pela epiderme do corpo, produzindo uma taa esqueltica dentro da qual o organismo se aloja." 1906. So mamferos tpicos da fauna dos cerrados do Brasil: a) ema, lobo-guar, ona-pintada. b) tamandu-bandeira, lobo-guar, tatu-canastra. c) veado-campeiro, zebra, tamandu-bandeira. d) ona-pintada, ema, tamandu-bandeira. e) veado-campeiro, avestruz, tatu-canastra. [B] 1907. Nos vertebrados, derme, pulmo e crebro so, respectivamente, de origem: a) mesodrmica. endodrmica e ectodrmica. b) ectodrmica, endodrmica e mesodrmica. c) mesodrmica, ectodrmica e endodrmica. d) endodrmica, ectodrmica e mesodrmica. e) ectodrmica, mesodrmica e endodrmica. [A] 1908. Tubaro, perereca, jacar, coruja e rato tm, respectivamente: a) 2, 3, 3, 4 e 4 cavidades no corao b) 2, 3, 4, 4 e 4 cavidades no corao c) 3, 3, 4, 4 e 4 cavidades na corao d) 3, 3, 3, 4 e 4 cavidades na corao e) 2, 3, 3, 3 e 4 cavidades na corao

166 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[B] 1909. Ao analisar detalhadamente uma baleia e um golfinho, um estudante fez as seguintes afirmaes: I - ambos apresentam esqueleto cartilaginoso; II - ambos apresentam mandbulas; III - apenas o golfinho apresenta homeotermia; IV - ambos apresentam glndulas mamrias. Esto corretas as afirmaes: a) I e II. b) I e III. c) II e III. d) III e IV. e) II e IV. [E] 1910. O grfico a seguir apresenta medidas da excreo de substncias nitrogenadas durante a metamorfose de certa espcie de sapos.

a) se somente I e II estiverem corretas. b) se somente I e III estiverem corretas. c) se somente II e IV estiverem corretas. d) se somente I, II e III estiverem corretas. e) se todas estiverem corretas. [E] 1915. Os gmeos univitelinos e os gmeos fraternos originam-se, respectivamente: a) de um vulo fecundado por um espermatozide e de um vulo fecundado por dois espermatozides. b) de um vulo fecundado por um espermatozide e de dois vulos fecundados por dois espermatozides. c) da fuso de dois vulos com dois corpsculos polares e de um vulo fecundado por dois espermatozides. d) de um vulo fecundado por dois espermatozides e de dois vulos fecundados por dois espermatozides. e) da fuso de dois vulos com dois corpsculos polares e de dois vulos fecundados por dois espermatozides. [B] 1916. A figura a seguir representa diferentes padres de corao de vertebrados. Qual a seqncia indica a ordem crescente da eficincia circulatria, com relao ao transporte de gases, conferida pelos trs coraes?

Os dados mostram que a excreo de a) amnia s ocorre nos primeiros dias de vida. b) uria comea a ocorrer por volta do centsimo dia. c) amnia predomina sobre a de uria em todo o perodo considerado. d) uria aumenta significativamente por volta do octagsimo dia. e) amnia e de uria faz-se em grande quantidade na fase larvria. [D] 1911. Observe o grfico adiante:

a) 1, 2, 3 d) 2, 1, 3 [E]

b) 1, 3, 2 e) 3, 1, 2

c) 3, 2, l

Os pontos A e B podem corresponder, respectivamente, a: a) elefante e rato. b) boi e cavalo. c) elefante e baleia. d) coelho e lebre. e) rato e hipoptamo. [E] 1912. Nos mamferos, pode-se encontrar sangue venoso: a) na aurcula direita, na artria pulmonar e na veia cava. b) no ventrculo direito, na veia pulmonar e na veia cava. c) na aurcula direita, na veia pulmonar e na artria aorta. d) na aurcula esquerda, na artria pulmonar e na veia cava. e) no ventrculo esquerdo, na veia pulmonar e na artria aorta. [A] 1913. O sistema circulatrio dos artrpodos diferencia-se do dos cordados por no transportar a) gases da respirao. b) hormnios. c) resduos orgnicos. d) nutrientes. e) gua. [A] 1914. Evolutivamente, o aparecimento dos anexos embrionrios permitiu aos vertebrados conquistar definitivamente o ambiente terrestre. Em aves e rpteis, essas estruturas tm a funo de I - evitar a dessecao do embrio em desenvolvimento. II - suprir o embrio de alimento. III - permitir a respirao do embrio. IV - armazenar as excrees. Assinale

1917. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. 01) O 'Schistosoma mansoni' um invertebrado parasita do ser humano e causador da doena de Chagas. 02) Os mamferos so animais vivparos, com exceo dos monotremos, que so ovparos. 04) O sistema ambulacrrio ou hidrovascular, presente nos equinodermos, relaciona-se exclusivamente com a locomoo desses animais. 08) A maioria das aves capaz de voar e, neste processo, alm das asas e msculos associados ao vo, so importantes a presena do ar nos pulmes e sacos areos e os ossos pneumticos. 16) Os anexos embrionrios (crio, mnio, alantide e saco vitelnico) permitiram aos rpteis e aves a conquista definitiva do meio terrestre. Alm de evitarem a dessecao do embrio em desenvolvimento, permitem sua respirao, supremno com alimentos e armazenam suas excrees. 32) A aranha-marrom, muito perigosa e comum em Curitiba, pertence ao filo Arthropoda, classe Arachnida. 02 + 08 + 16 + 32 = 58 1918. Uma das caractersticas dos peixes sseos a presena de a) bexiga natatria. b) ossos pneumticos. c) glndula uropigiana. d) escamas placides de origem dermoepidrmica. e) tecido adiposo subcutneo muito desenvolvido. [A] 1919. Comparando-se a estrutura e a fisiologia dos coraes dos vertebrados, podemos considerar vlida a seguinte afirmativa: a) no corao dos peixes passa apenas sangue venoso b) o corao dos anfbios dotado de. quatro cmaras, duas aurculas (ou trios) e dois ventrculos c) no corao das aves passa apenas sangue arterial d) o corao dos rpteis apresenta-se com trs cmaras, uma aurcula (ou trio) e dois ventrculos e) no corao dos mamferos, as duas aurculas (ou trios) recebem sangue venoso e os dois ventrculos recebem sangue arterial [A] 1920. Considere os seguintes itens: I. presena de quilha no esterno II. presena de glndula uropigiana III. msculos peitorais potentes IV. esqueleto com ossos slidos e pesados Constituem requisitos para as aves voadoras apenas a) I e II b) I e III c) I e IV d) II e III e) II e IV [B] 1921 Considere as estruturas a seguir:

167 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

I. plos II. escamas drmicas III. glndulas sebceas IV. glndulas sudorparas Um animal terrestre, que possui glndulas mamrias, poder apresentar tambm APENAS a) I e II b) II e III c) I, II e III d) I, III e IV e) II, III e IV [D] 1922. A figura a seguir se refere determinao do sexo em algumas espcies de tartarugas e lagartos. Com base nessa figura pode-se afirmar que

d) o animal B possui estruturas especializadas para matar e dilacerar suas presas. e) os animais A e B apresentam relao de competio por alimento. [E] 1925. Observe a figura a seguir.

O animal representado vive em regies ridas e possui urina muito hipertnica em relao ao sangue. Todas as alternativas apresentam adaptaes desse animal ao meio ambiente, EXCETO a) Ausncia de transpirao mesmo em altas temperaturas. b) Eliminao de amnia como produto nitrogenado. c) Eliminao de fezes praticamente desidratadas. d) Eliminao de pouca gua na urina. e) Hbitos noturnos e ocupao de buracos na terra durante o dia. [B] 1926. Observe o grfico.

a) a determinao do sexo nesses animais independente da localizao dos ovos no ninho e da poca da postura. b) a determinao do sexo, sob controle de temperatura, pode ser til em condies de manejo de espcies em extino. c) indivduos de sexo indeterminado, em tartarugas, so produzidos em temperaturas abaixo de 28C. d) temperatura maiores que 28C produzem fmeas tanto em tartarugas quanto em lagartos. e) machos so produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. [B] 1923. Observe o esquema referente ao sistema circulatrio de um vertebrado adulto representado na figura a seguir.Com base nesse esquema e em seus conhecimentos sobre o assunto, assinale a alternativa que contm o grupo de vertebrados nele apresentado. Com base nos dados do grfico, INCORRETO afirmar-se que a) o maior tempo de vida reprodutiva ocorre no homem. b) o tempo de gestao aumenta em funo da complexidade evolutiva do grupo. c) o tempo de infncia aumenta segundo o tempo de gestao. d) o tempo de vida do adulto aumenta conforme o tempo de gestao. e) o tempo de vida, aps a reproduo, igual entre os primatas. [E] 1927. Mamferos aquticos, como os cetceos, possuem um espesso revestimento de tecido adiposo com importante funo para a) facilitar a flutuao. b) proteo contra predadores. c) evitar perda de calor. d) evitar perda de gua. e) moldar o corpo, tornando-o mais hidrodinmico. [C] 1928. Observe a figura. a) Anfbios. [D] b) Aves. c) Mamferos. d) Peixes. e) Rpteis.

1924. Observe as figuras referentes ao tubo digestivo de dois animais A e B. Em relao aos animais que apresentam esses tubos digestivos, INCORRETO afirmar-se que

Com relao ao comportamento representado na figura, pode-se afirmar que ele a) depende do hormnio paratireoideano. b) ocorre em qualquer fase da vida da animal. c) representa a fecundao e desenvolvimento internos. d) resulta em eliminao simultnea de gametas. e) resulta em maior proteo da prole. [D] a) a interao com microrganismos para obteno de energia fundamental para o animal A. b) o animal A um consumidor primrio. c) o animal B pode pertencer ao terceiro nvel trfico. 1929. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Tendo a figura como um elemento ilustrador, analise as proposies apresentadas com relao digesto nos ruminantes.

168 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

a) uma ave caracterstica da caatinga que est em extino b) um rptil caracterstico do Nordeste c) uma ave de rapina caracterstica da Mata Atlntica d) uma ave de arribao que chega aos bandos de ano em ano nos sertes [A] 1933. Indique a opo que s contenha exemplos de animais pertencentes ordem CETCEA da classe Mammalia: a) baleia, golfinho e cachalote b) peixe-boi e rinoceronte c) cavalo, rinoceronte e zebra d) tatu, preguia e tamandu [A] 1934. Dos animais a seguir, os nicos que apresentam respirao pulmonar so; a) minhoca, sapo e peixe b) golfinho, barata e cobra c) peixe-boi, jacar e pato d) baleia, aranha e peixe e) tartaruga, jacar e tubaro [C] 1935. As aves apresentam asas e penas para voar. As asas e as penas no so as nicas estruturas responsveis pelo vo das aves. A outra estrutura, alm das asas e das penas, que tambm responsvel pelo vo: a) o pescoo, devido ser longo b) as patas, por serem finas c) o bico, devido a penetrao aerodinmica d) o esterno, que tem forma de quilha e facilita o vo e) o tamanho, por isso que as aves grandes no voam [D] 1936. Em relao ao sistema circulatrio dos mamferos, podemos afirmar que: a) as hemcias so circulares, anucleadas e o corao formado por quatro cavidades b) as hemcias so ovais, nucleadas e o corao formado quatro cavidades c) as hemcias so ovais, anucleadas e o corao formado trs cavidades d) as hemcias so circulares, nucleadas e o corao formado quatro cavidades e) as hemcias so circulares, anucleadas e o corao formado por trs cavidades [A] 1937. Uma caracterstica exclusiva dos cordados a presena de: a) simetria bilateral. b) notocorda. c) coluna vertebral. d) corpo segmentado. e) celoma. [B] 1938. O fato de peixes e anfbios depositarem seus ovos na gua permite que os seus embries, ao contrrio de rpteis e aves, no apresentem: a) placenta e alantide. b) saco vitelino e mnio. c) mnio e placenta. d) saco vitelino e alantide. e) mnio e alantide. [E] 1939. I - Trs tecidos embrionrios. II - Celoma e deuterostomia. III - Simetria bilateral no adulto. IV - Notocorda e sistema circulatrio fechado. Das afirmaes acima, mamferos e equinodermos tm em comum: a) I e III , somente. b) I , II e IV , somente. c) I , III e IV , somente. d) I e II , somente. e) I , II , III e IV. [D] 1940. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. A figura a seguir representa a estrutura interna de um ovo de ave. Indique as proposies CORRETAS, em relao s estruturas presentes.

( ) Os ruminantes, entre os quais citamos bois e cabras, durante vrias horas do dia apenas cortam os vegetais e os engolem sem mastigao. ( ) Na primeira cmara estomacal (rmen), que funciona como armazenadora, ocorre uma intensa fermentao, proporcionada por uma abundante flora bacteriana. ( ) Pouco a pouco, o alimento passa para a 2a cmara (retculo) onde compactado em massas mais ou menos esfricas e, por inverso voluntria do peristaltismo do esfago, essas massas voltam boca e s ento demoradamente mastigadas. ( ) Numa segunda deglutio passa diretamente para a terceira cmara (Omaso ou coagulador) onde atua o suco gstrico digerindo os alimentos e parte das bactrias simbinticas que digerem celulose, passando o alimento para a 4a e ltima cmara - o abomaso. ( ) no Abomaso (folhoso) que termina a digesto e onde ocorre uma intensa ao mecnica e continua a fermentao. VVVFF 1930. Na(s) questo(es) a seguir escreva nos parntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Na figura a seguir so mostrados alguns representantes de peixes condrctios e ostectios e apresentadas proposies cuja veracidade caber a voc assinalar.

( ) 1 e 3 so peixes cartilaginosos (condrctios). ( ) O exemplar 1 no pertence aos condrctios. ( ) 2 e 4 so peixes de esqueletos sseo (ostectios), animais de excepcional diversificao de formas, tamanhos, hbitos alimentares, etc. ( ) O exemplar 2 pertence ao grupo dos dipnicos, apresentando bexiga natatria com funo de pulmo. ( ) 1, 2 e 4 so actinoptergeos e pertencem, portanto, classe dos condrctios. VFVVF 1931. O meio ambiente incapaz de fornecer condies exigidas para a vida (nutrio reproduo e proteo) torna-se imprprio sobrevivncia dos seres vivos, acarretando o desequilbrio. Um agricultor com problemas de excesso de besouros no seu canavial resolveu introduzir na sua fazenda o sapo-boi, que se alimenta de besouros prejudiciais ao cultivo da cana de acar, considerando no existirem na regio espcies de animas aptos a devor-lo. O sapo-boi tambm se alimenta de insetos destruidores de moscas transmissoras de doenas, prolifera com muita facilidade e vive aproximadamente 40 anos, pondo, em mdia, 40 mil ovos por ano. Na sua opinio, o uso do sapo-boi no exemplo acima citado seria: a) perigoso, pois na regio no existem espcies que possam devor-lo. b) Inconveniente, pois causaria a eliminao de insetos favorveis a cultura de cana de acar. c) conveniente, pois causaria a eliminao dos insetos destruidores de moscas transmissoras de doenas. d) conveniente, uma vez que causaria a eliminao de vespas que se alimentam tambm de besouros. e) conveniente, pois na regio no existem outras espcies que possam devor-lo. [A] 1932. "CARCAR, pega, mata e come, CARCAR, mais coragem do que homem" CARCAR :

169 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

01. A presena do disco germinativo indica que o ovo est fecundado. 02. A clara absorvida durante o desenvolvimento embrionrio. 04. A casca porosa e permite a difuso de gases respiratrios (oxignio e gs carbnico). 08. A gema fornece nutrientes para o desenvolvimento do embrio. 01 + 02 + 04 + 08 = 15 1941. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Um dos gneros de ofdios encontrados em Santa Catarina o BOTHROPS, sendo um exemplo comum a jararaca. Leia as proposies a seguir e assinale as CORRETAS sobre as espcies do referido gnero. 01. So peonhentas. 02. Possuem olhos com pupila vertical. 04. A fosseta loreal est ausente. 08. Apresentam dentes inoculadores. 16. Costumam viver em locais extremamente frios e midos. 32. No existe um soro desenvolvido para neutralizar o veneno. 01 + 02 + 08 = 11 1942. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. Os anfbios so animais que podem sobreviver em vrios habitat, no entanto dependem da gua para reproduo. Sobre esses animais, julgue os itens. ( ) A maioria dos anfbios apresenta fecundao e desenvolvimento externo, portanto necessrio liberar grande quantidade de gametas para garantir a sobrevivncia da espcie. ( ) Certas espcies de sapo apresentam o hbito alimentar bem diversificado favorecendo a sua sobrevivncia em ambientes alterados, como tambm em reas urbanas. ( ) Os anfbios apresentam vulos do tipo telolcito que se caracterizam pela pequena quantidade de vitelo. VVF 1943. Na(s) questo(es) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. O Pantanal mato-grossense uma plancie periodicamente inundvel, onde encontramos vrias espcies faunsticas, algumas abundantes, outras raras e at ameaadas de extino, como por exemplo a arara azul. Sobre as caractersticas da fauna pantaneira, julgue os itens. ( ) Os tuiuis, aves-smbolo do Pantanal, so hermafroditas. ( ) As capivaras so mamferos roedores que apresentam membranas interdigitais que facilitam a locomoo na gua. ( ) Os jacars so rpteis que apresentam fecundao interna e desenvolvimento do filhote fora do corpo da me. FFV 1944. Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. A figura a seguir ilustra a relao entre a temperatura ambiente e a temperatura corporal de dois animais.

1946. Apresenta simetria bilateral, metameria e sistema nervoso dorsal: a) gafanhoto b) planria c) estrela-do-mar d) medusa e) anfioxo [E] 1947. Considere os seguintes anexos da pele de vertebrados: I. penas das aves II. escamas de peixes III. escamas de cobras e lagartos IV. unhas e cascos de mamferos So de origem epidrmica a) apenas I, II e III b) apenas I, II e IV c) apenas I, III e IV d) apenas II, III e IV e) I, II, III e IV [C] 1948. Em um ambiente com temperatura mantida constante em 18C, qual dos animais a seguir necessitar maior consumo de alimento em relao ao tamanho de seu corpo? a) Sapo. b) Jacar. c) Sabi. d) Tubaro. e) Jararaca. [C] 1949. Leia o trecho com ateno: O corao apresenta quatro cmaras, duas aurculas e dois ventrculos e, nesse caso, no se misturam sangue arterial e venoso. A circulao dupla, o que permite melhor controle da presso arterial. O sistema circulatrio mais eficiente, possibilitando uma chegada rpida dos alimentos aos tecidos, garantindo, assim, o controle da temperatura corprea.Qual da alternativas a seguir apresenta um animal que no se relaciona com o trecho descrito? a) guia b) preguia c) pingim d) ornitorrinco e) cobra [E] 1950. Leia as afirmaes a seguir: I - Os peixes so animais que no possuem temperatura corporal prpria (pecilotermos). Il - Apenas nos peixes dipnicos a bexiga natatria pode funcionar como um pulmo. III - Nos peixes a reproduo sempre feita por fecundao externa. Assinale a alternativa correta: a) I e II so verdadeiras; b) II e III so verdadeiras; c) I e III so verdadeiras; d) Todas so verdadeiras; e) Todas so falsas. [A] 1951. O que permite, principalmente, as aves voarem : a) possuir penas; b) ter os membros anteriores modificados; c) a forma aerodinmica de seu corpo; d) ter os sacos areos em comunicao com o pulmo; e) possuir ossos pneumticos. [C] 1952. Leia atentamente as afirmativas a seguir: I - A fecundao interna e o desenvolvimento de um ovo com casca, possibilitou aos rpteis a conquista do ambiente terrestre. II - Os anfbios so animais que, quando adultos, ainda dependem da gua principalmente, devido sua respirao cutnea. III - As glndulas mamrias que caracterizam os mamferos, sempre apresentamse aos pares. Assinale a alternativa correta: a) I e II so verdadeiras; b) II e III so verdadeiras; c) I e III so verdadeiras; d) Todas so verdadeiras; e) Todas so falsas. [D] 1953. Quando temperatura dos animais podem ser: (1) pecilotrmico (2) homeotrmicos. Classifique os animais: rato, pato, cobra, sapo, tubaro, de acordo com a temperatura. a) 1 - 2 - 1 - 2 - 1; b) 1 - 1 - 2 - 2 - 2; c) 2 - 2 - 2 - 1 - 1; d) 2 - 1 - 2 - 1 - 2; e) 2 - 2 - 1 - 1 - 1; [E] 1954. No que se refere ao tipo de corao, os animais podem apresentar o corao dividido em 2,3 e 4 cavidades, classificando-se respectivamente como: a) mamferos, peixes, aves; b) peixes, anfbios, aves;

Com base na anlise dessa ilustrao, pode-se concluir: (01) Os animais representados exibem a mesma capacidade de regulao trmica. (02) Em animais endotrmicos, a fonte preferencial de calor para o corpo o metabolismo. (04) Animais exotrmicos mantm uma relao direta entre a temperatura do corpo e a do ambiente. (08) A disponibilidade de alimento permite a regulao trmica em rpteis. (16) A endotermia uma vantagem evolutiva para animais terrestres. (32) Adaptaes na superfcie do corpo dos mamferos esto associadas sua condio de animais endotrmicos. (64) Animais exotrmicos e endotrmicos apresentam as mesmas caractersticas anatmicas e fisiolgicas quanto ao sistema circulatrio. 02 + 04 + 16 + 32 = 54 1945. Qual das caractersticas a seguir NO exclusiva dos mamferos? a) Ouvido mdio com trs ossculos. b) Glndulas sudorparas. c) Corao com quatro cmaras. d) Glndulas mamrias. e) Hemceas anucleadas e bicncavas. [C]

170 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) anfbios, rpteis, mamferos; d) peixes, aves, anfbios; e) mamferos, peixes, rpteis. [B] 1955. A "linha lateral" dos peixes uma estrutura com sensibilidade: a) vibrao na gua b) a mudanas na temperatura c) presena da fmea d) a variaes na quantidade de oxignio e) a variaes de luminosidade [A] 1956. O primeiro grupo de vertebrados a conquistar, definitivamente, o ambiente terrestre foi o grupo dos: a) anfbios. b) aves. c) primatas. d) mamferos. e) rpteis. [E] 1957. Ler atentamente as afirmativas a seguir: I - Os quirpteros so mamferos portadores de membranas que unem os dedos ao tronco e que funcionam como asas. II - Os monotremos so mamferos, ovparos, tm bico e patas com membranas entre os dedos. III - Os cetceos so mamferos com formato de peixes, so ovparos, de respirao branquial. e assinalar: a) se apenas I estiver correta b) se apenas II estiver correta c) se apenas III estiver correta d) se I e II estiverem corretas e) se I e III estiverem corretas [D] 1958. As afirmaes a seguir, referem-se aos animais vertebrados: I - O oviparidade caracterstica exclusiva das aves. II - Aves e mamferos so os nicos a possurem homotermia. III - A respirao pode ser pulmonar, branquial ou cutnea. Assinale: a) se todas estiverem corretas. b) se apenas I e II estiverem corretas. c) se apenas I e III estiverem corretas. d) se apenas II e III estiverem corretas. e) se nenhuma estiver correta. [D] 1959. Relaciona os animais vertebrados que possuem unhas. A alternativa correta : a) aves, peixes e mamferos. b) mamferos, anfbios e rpteis. c) rpteis, mamferos e peixes. d) anfbios, rpteis e aves. e) aves, rpteis e mamferos. [E] 1960. O esquema a seguir mostra trs tipos de rgos excretores: 1. Rim pronefro 2. Rim mesonefro 3. Rim metanefro

e) cutnea, branquial, traqueal e pulmonar. [D] 1962. Considere as seguintes estruturas: I. notocorda II. fendas branquiais A alternativa a seguir que indica corretamente a presena dessas estruturas durante o desenvolvimento embrionrio dos grupos de animais mencionados : a) Protocordados (I); Vertebrados de respirao branquial (II); Vertebrados de respirao pulmonar (I e II). b) Protocordados (I); Vertebrados de respirao branquial (I e II); Vertebrados de respirao pulmonar (II). c) Protocordados (I e II); Vertebrados de respirao branquial (II); Vertebrados de respirao pulmonar (I e II). d) Protocordados (I e II); Vertebrados de respirao branquial (I e II); Vertebrados de respirao pulmonar (I). e) Protocordados (I e II); Vertebrados de respirao branquial (I e II); Vertebrados de respirao pulmonar (I e II). [E] 1963. Indique a que filos pertencem os animais cujas principais caractersticas esto relacionadas a seguir: I- Papo e moela (aparelho digestivo); siringe; ossos pneumticos; sacos areos; homeotrmicos; corao com quatro cavidades. II- Durante a metamorfose, tm respirao branquial, pulmonar e cutnea; corao com trs cavidades; pecilotrmicos; cloaca. a) I - peixes e II - anfbios b) I - aves e II - anfbios c) I - aves e II - rpteis d) I - rpteis e II - anfbios e) I - anfbios e II peixes [B] 1964. Um animal apresenta as seguintes caractersticas: - pele com camada crnea fina e muitas glndulas mucosas - pulmes com poucas divises internas - corao onde ocorre mistura de sangue arterial e venoso Esse animal pode ser a) um sapo. b) uma cobra. c) um lagarto. d) uma baleia. e) um peixe pulmonado. [A] 1965. Em relao aos animais vertebrados, considere as seguintes caractersticas: I- Sangue arterial separado do venoso nas aurculas e misturado no ventrculo II- Presena de um nico ventrculo. III- Pelo corao passa apenas sangue venoso. Peixes e anfbios tm em comum: a) I e II. b) apenas I. c) apenas II. d) apenas II e III. e) I, II e III. [C] 1966. I- morcego II- jacar III- pingim IV- cavalo-marinho V- anfioxo Considerando-se os animais anteriores, assinale a alternativa correta. a) Apenas I e IV so cordados. b) Apenas I e III so cordados. c) Apenas I e V so cordados. d) Apenas I cordado. e) Todos so cordados. [E] 1967. Tiflossole e cecos intestinais so estruturas presentes no tubo digestivo de alguns animais. Nos seres humanos, suas funes so desempenhadas: a) pelas vilosidades e microvilosidades intestinais. b) pelo estmago. c) pelo fgado. d) pela mucosa gstrica. e) pelo esfago. [A] 1968. Tainhas (osteicties) e caes (condricties) fazem parte da superclasse dos peixes. Sobre esses animais, assinale a alternativa CORRETA. a) Nos condricties a boca ventral. b) Os osteicties possuem esqueleto cartilaginoso. c) Apenas os condricties possuem nadadeira caudal. d) Os osteicties no apresentam oprculo. e) Os osteicties reproduzem-se por meio de fecundao interna sem cpula.

Assinale a opo que identifica os vertebrados adultos que, respectivamente, apresentam os rgos 1, 2 e 3 em funcionamento: a) Anfbios, peixes e mamferos b) Anfbios, peixes e aves c) Aves, ciclstomos e anfbios d) Ciclstomos, anfbios e mamferos e) Ciclstomos, anfbios e peixes. [D] 1961. A respirao um fenmeno representado por uma constante troca de gases entre os seres vivos e o meio ambiente. A maioria dos seres vivos desenvolveu estruturas especiais para absoro de oxignio e eliminao de dixido de carbono. Os vertebrados apresentam respirao a) cutnea, traqueal e pulmonar. b) traqueal e pulmonar. c) traqueal, branquial pulmonar. d) cutnea, branquial e pulmonar.

171 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[A] 1969. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos.Sobre os aspectos principais da embriologia dos cordados, correto afirmar que: 01 - mnio, alantide e saco vitelnico so exemplos de anexos embrionrios. 02 - O sexo do indivduo estabelecido por ocasio da fecundao. 04 - Denomina-se anfimixia o fenmeno da fuso dos pr-nucleos masculino e feminino. 08 - A sequncia das fases no desenvolvimento embrionrio : zigoto, segmentao, gstrula e blstula. 16 - O tipo de segmentao depende, entre outros fatores, da quantidade de vitelo acumulada no ovo. 32 - Os mamferos so animais diploblsticos, pois seus tecidos originam-se da ectoderme e endoderme. 01 + 02 + 04 + 16 = 23 1970. Os primeiros vertebrados a conquistarem definitivamente o ambiente terrestre foram os rpteis, por apresentarem adaptaes que permitem "resolver", com eficincia, todos os problemas da vida fora da gua. Qual das afirmativas a seguir constitui um exemplo de adaptao dos rpteis vida fora da gua? a) Ovo provido de casca, fornecendo ao embrio proteo, suporte e alimento. b) Temperatura interna constante, o que lhes permite uma ampla distribuio geogrfica. c) Fecundao externa, com grande nmero de gametas, tanto produzidos pelo macho como pela fmea. d) Pele, que, mesmo grossa, ricamente vascularizada e permevel ao oxignio. e) Bexiga natatria que se comunica com a faringe e funciona como um pulmo primitivo. [A] 1971. O elo de ligao entre os invertebrados e os cordados superiores representado pelos protocordados, que apresentam as seguintes caractersticas: a) fendas branquiais, notocorda e encfalo. b) fendas branquiais, notocorda e acraniatos, c) fendas branquiais, acraniata e alantide. d) acraniatos, notocorda e encfalo. e) encfalo, alantide e tubo neural. [B] 1972. Considere as trs afirmaes a seguir a respeito dos animais vertebrados: I - O diafragma, msculo relacionado com a respirao, exclusivo do ser humano. II - mnio e alantide so anexos embrionrios presentes nos mamferos, aves e rpteis. III - Corao com quatro cavidades e circulao dupla e complexa ocorrem em aves e mamferos. Destas afirmaes, est(o) correta(s) apenas: a) I b) II c) I e II d) II e III e) I e III [D] 1973. Corao com trs cavidades, dois trios e um ventrculo. O trio direito recebe sangue venoso, o trio esquerdo recebe sangue arterial, misturando-se no ventrculo. Isso encontrado exclusivamente nos a) anfbios. b) peixes. c) rpteis. d) ofdios e peixes. e) peixes e anfbios. [A] 1974. Ao ser picado por uma cobra peonhenta, voc dever procurar recurso atravs de a) vacina, porque contm antgenos especficos. b) soro, porque estimula o organismo a produzir anticorpos. c) vacina, porque j contm anticorpos. d) soro, porque j contm anticorpos. e) vacina, porque estimula o organismo a produzir anticorpos. [D] 1975. Comparando-se evolutivamente, o animal mais prximo do homem a) o lagarto. b) o pingim. c) o sapo. d) o rato. e) o cao. [D] 1976. As caractersticas numeradas a seguir esto presentes nos animais vertebrados: I - glbulos vermelhos anucleados. II - reproduo por fecundao externa. III - ovos sempre protegidos por casca rgida. IV - produo de suor. V - presena de placenta. VI - corao com um s ventrculo. Nos mamferos, ocorrem apenas a) I - II IV b) I - II VI c) I - IV - VI d) I - IV V e) II - IV V [D] 1977. O corao dos anfbios possui a) um trio e um ventrculo, ambos sem septos.

b) um trio com septo parcial e um ventrculo sem septo. c) um trio e um ventrculo, ambos com septos parciais. d) dois trios e um ventrculo. e) dois trios e dois ventrculos. [D] 1978. Essencial para a vida terrestre, o surgimento de um ovo, com uma casca resistente e flexvel, com uma membrana interna e muito vitelo para nutrir o embrio, foi capaz de proteger a prole de um determinado animal contra a dessecao e o choque fsico durante o desenvolvimento embrionrio. O texto anterior se refere, na escala evolutiva, a que animal? a) peixe b) anfbio c) rptil d) ave e) mamfero [C] 1979. Um srio risco a que est exposto o trabalhador rural em nosso pas o de acidentes com animais peonhentos. Dentre estes um dos mais temveis e agressivos do gnero a cobra surucucu. Com relao surucucu, considere as proposies: 1 - Pertence ao gnero Bothrops e seu veneno tem potente ao neurotxica e coagulante. 2 - Pertence ao gnero Crotalus e seu veneno tem ao neurotxica e homoltica. 3 - Seu veneno tem ao proteoltica e coagulante e o antiofdico especfico o soro antibotrpico. 4 - O princpio ativo do seu veneno provoca intensa dor no local da inoculao, podendo haver gangrena, especialmente no caso de se utilizar torniquetes. As proposies que esto corretas so as indicadas por: a) 2 e 3 b) 1, 2 e 4 c) 3 e 4 d) 1 e 4 e) 2, 3 e 4 [C] 1980. Peixes e anfbios adultos possuem em comum: a) corao dotado de duas cmaras: um trio e um ventrculo. b) respirao branquial. c) rins mesonfricos (torcicos). d) fecundao interna. e) intestino terminando em cloaca. [C] 1981. Qual dentre as seguintes estruturas de um peixe pode ser considerada homloga ao pulmo de um anfbio? a) Bexiga natatria. b) Estmago. c) Cavidade branquial. d) Intestino. e) Nadadeiras mpares. [A] 1982. A estrutura dos dentes dos mamferos muito semelhante estrutura das escamas de a) cobras. b) esturjes. c) lambaris. d) tubares. e) pirambias. [D] 1983. Considere as duas listas a seguir. I. cavalo - marinho II. tartaruga III. sapo a. pulmonar b. branquial c. cutnea A alternativa que relaciona corretamente cada animal a seu tipo de respirao a) I - a; II - b; III - c b) I - b; II - a; III - c c) I - b; II - c; III - a d) I - c; II - a; III - b e) I - c; II - b; III a [B] 1984. Se reunirmos as famlias 'Canidae' (ces), 'Ursidae' (ursos), 'Hienidae' (hienas) e 'Felidae' (lees), veremos que todos so carnvoros, portanto, pertencem (ao) mesma(o): a) espcie. b) ordem. c) subespcie. d) famlia. e) gnero. [B] 1985. "Dinossauro gigante comia uma tonelada por dia". A descoberta do fssil gigantossauro na Patagnia mostrou ser esse um dos maiores dinos j encontrados pelos paleontlogos.Se buscarmos uma classificao para esses enormes mostrengos, poderemos cham-los de: a) vivparos. b) homeotrmicos. c) ovparos. d) placentrios. e) carnvoros. [C] 1986. No curso da evoluo, os primeiros vertebrados a conquistar efetivamente o ambiente terrestre foram a) os anfbios, cujos adultos respiravam por pulmes. b) as aves, que podiam voar por grandes distncias sobre os continentes.

172 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

c) os mamferos marsupiais, cujos embries se desenvolviam em uma bolsa de pele na barriga da me. d) os mamferos placentrios, cujos embries se desenvolviam no tero materno. e) os rpteis, cujos ovos podiam desenvolver-se fora do ambiente aqutico. [E] 1987. Dois estudantes, nadando numa lagoa, observaram alguns organismos na gua e estabeleceram o seguinte dilogo: " - Olha os girinos, filhotes de sapo. - No so girinos, so alevinos. - Mas. . . O que so alevinos? - So filhotes de peixe, animais diicos." Com base nesse dilogo e em seus conhecimentos biolgicos, INCORRETO afirmar que a) os alevinos so etapas do desenvolvimento dos peixes. b) os girinos so etapas de metamorfose. c) os peixes realizam fecundao cruzada. d) os sapos realizam fecundao interna. [D] 1988. Entre os peixes e os primeiros anfbios foram necessrios 40 milhes de anos de lenta e constante evoluo. Todas as alternativas contm adaptaes surgidas durante essa evoluo, EXCETO a) manuteno da pele mida. b) membros articulados. c) respirao pulmonar. d) termorregulao. [D] 1989. Os animais a seguir representados so bastante diferentes na sua aparncia, mas apresentam vrias caractersticas comuns.

[A] 1993. A figura representa um conhecido animal dos rios da Amaznia.

A caracterstica que permite inclu-lo na classe dos mamferos e exclu-lo das demais a) presena de plos. b) homeotermia. c) viviparidade. d) corao tetracavitrio. [A] 1994. Um professor apresentou classe o seguinte problema: - Qual dever ser a variao do peso de um ovo de galinha, durante o processo de desenvolvimento embrionrio do pintinho, at um dia antes de seu nascimento? Os alunos apresentaram diferentes respostas expressas pelas curvas a seguir. Assinale a alternativa que mais se aproxima da resposta correta.

[B] 1995. As aves no possuem glndulas sudorparas e mantm a temperatura do corpo constante. A estratgia adaptativa utilizada por esses animais, quando a temperatura ambiente est muito alta, o aumento de a) perda de gua na expirao. b) metabolismo de carboidratos. c) quantidade de gs carbnico no sangue. d) consumo de oxignio. [A] 1996. So vertebrados homeotrmicos, cuja excreo de produtos nitrogenados ocorre principalmente na forma de cido rico, a) somente as aves. b) somente os mamferos. c) as aves e os mamferos. d) as aves e os rpteis. e) os anfbios adultos e os mamferos. [A] 1997. A presena de oprculo, estrutura que recobre as brnquias em peixes sseos, permite eficincia nas trocas gasosas mesmo com o peixe parado. Isto porque o oprculo possibilita melhor captao de oxignio devido (ao): a) quebra das molculas de gua. b) entrada de gua pela brnquias. c) retirada de gases da bexiga natatria. d) transporte ativo realizado por esta estrutura. e) maior contato de gua com as brnquias. [E] 1998. A evoluo dos vertebrados do meio aqutico para o ambiente terrestre foi acompanhada de modificaes morfofisiolgicas no aparelho respiratrio. Com relao a esse tema, julgue os itens que se seguem. (0) Nos anfbios, a pele constitui um importante auxiliar na respirao, devido ao fato de a taxa de oxignio ser maior no ar do que na gua. (1) Os peixes utilizam, para respirar, o oxignio dissolvido na gua. (2) A fecundao, nos rpteis, externa e dependente de gua; nos anfbios, no. (3) Nos mamferos, os pulmes alveolares atingem a mxima complexidade entre os vertebrados. Itens corretos: 1 e 3 Itens errados: 0 e 2

Entre essas caractersticas NO se inclui a) fecundao interna. b) homeotermia. c) oviparidade. d) respirao pulmonar. [B] 1990. Um pesquisador, ao acompanhar o desenvolvimento de ovos de um determinado grupo de animais, encontrou as seguintes caractersticas. I - Presena de mnio e alantide. II - Grande quantidade de vitelo. III - Fragmentos de casca calcria. IV - cido rico armazenado no alantide. Baseado nessas caractersticas, o pesquisador concluiu que os ovos estudados poderiam ser de a) peixe ou anfbio b) ave ou rptil c) rptil ou anfbio d) peixe ou rptil e) ave ou anfbio [B] 1991. Indique a opo que contm a classe de animais cujo sistema digestrio apresenta o papo, o proventrculo e a moela. So de sexos separados e a fecundao interna. So ovparas e o ovo est sujeito a incubao: a) anfbios b) mamferos c) aves d) rpteis [C] 1992. "Sapos e rs esto desaparecendo numa velocidade jamais observada em pases onde sua ocorrncia era comum. Porm essa reduo tem sido observada em todo mundo." Esses animais, citados no artigo, pertencem classe dos vertebrados que apresenta: a) fecundao externa e respirao pulmonar e cutnea. b) pecilotermia e rins metanefros. c) metamorfose e circulao aberta. d) viviparidade e digesto intra e extracelular. e) ovo telolcito e saco vitelnico como nico anexo embrionrio.

173 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

1999. Consideradas as 5 classes de vertebrados, isto , peixes, anfbios, rpteis, aves e mamferos, as duas ltimas diferem das trs primeiras quanto: a) reproduo. b) temperatura corporal. c) respirao. d) aos tipos de anexos embrionrios. e) aos produtos de excreo. [B] 2000. Assinale o perodo da Era Paleozica em que surgiram os primeiros vertebrados conhecidos. a) Ordoviciano. b) Cambriano. c) Siluriano. d) Devoniano. e) Jurssico. [A] 2001. O esquema a seguir representa a seqncia evolutiva das classes dos vertebrados. Os nmeros indicados sobre as setas indicam formas de transio entre os grupos.

J nas reas planas, os cactos so um dos poucos vegetais que proliferam, pintando o areal com um verde plido. O texto anterior cita alguns exemplos de animais que vivem em Jurubatiba e podem ser classificados como: a) mamferos, peixes e aves, apenas. b) mamferos, peixes, aves e anfbios. c) rpteis, aves e anfbios apenas. d) mamferos, rpteis, peixes e aves. e) animais pertencentes a uma s classe. [D] 2005. Assinale a opo que contm exclusivamente caractersticas do grupo de aves representado pela figura a seguir:

mnio e respirao area na fase adulta surgiram pela respectivamente, em a) I e II b) II e III c) III e II d) IV e I e) V e III [C]

primeira vez,

2002. Dentre os filos animais relacionados a seguir, quais desenvolveram as melhores adaptaes para a conquista do ambiente terrestre? a) Celenterados e moluscos. b) Platelmintos e equinodermos. c) Artrpodos e cordados. d) Asquelmintos e porferos. e) Protozorios e aneldeos. [C] 2003. Considerando os animais ilustrados abaixo, correto afirmar:

a) terrcolas - esterno em "quilha" - bico epignato b) voadoras - ossos pneumticos - sistema digestivo terminando em cloaca c) corredoras - esterno sem "quilha" - bico do tipo paragnato d) dispersoras - pulmes com sacos areos - estmago com proventrculo e moela. [C] 2006. A figura a seguir mostra o esqueleto de um vertebrado.

( ) Todos os animais ilustrados acima pertencem fauna brasileira. ( ) Com exceo da lampreia e da cobra, os demais so tetrpodos. ( ) A capacidade de gerar calor internamente e manter a temperatura corporal uma das caractersticas que permitem aos mamferos sua existncia em ambientes to diferentes como o terrestre e o aqutico, em regies tropicais ou polares. ( ) A lampreia um animal que no apresenta mandbulas e sobrevive como parasita de peixes. ( ) As cobras so classificadas como rpteis e possuem escamas, respirao pulmonar, corao dividido em dois trios e dois ventrculos incompletamente separados, reproduo sexuada com sexos separados, fecundao interna e produo de ovo na maioria dos casos. ( ) A seqncia evolutiva correta : peixes anfbios rpteis aves mamferos. ( ) Todos os animais ilustrados acima so vertebrados e pertencem ao filo Chordata por apresentarem tubo nervoso dorsal, notocorda e fendas branquiais na faringe, pelo menos no incio de seu desenvolvimento embrionrio. FFVVVFV 2004. Alunos de uma escola no Rio de Janeiro so convidados a participar de uma excurso ao Parque Nacional de Jurubatiba. Antes do passeio, eles lem o trecho de uma reportagem publicada em uma revista: Jurubatiba ser o primeiro parque nacional em rea de restinga, num brao de areia com 31 quilmetros de extenso, formado entre o mar e dezoito lagoas. Numa rea de 14.000 hectares, ali vivem jacars, capivaras, lontras, tamandusmirins, alm de milhares de aves e de peixes de gua doce e salgada. Os peixes de gua salgada, na poca das cheias, passam para as lagoas, onde encontram abrigo, voltando ao mar na cheia seguinte. Nos terrenos mais baixos, prximos aos lenis freticos, as plantas tm gua suficiente para agentar longas secas.

O esqueleto em questo indica que se trata de um animal adaptado para a) cavar o solo. b) saltar. c) correr. d) rastejar. e) voar. [B] 2007. Dentre as transformaes que ocorreram nos anfbios na sua passagem para a vida terrestre, NO podemos citar: a) modificaes do corpo para andar em terra firme, mantendo-se a capacidade de nadar. b) a capacidade de pr ovos. c) desenvolvimento de pernas no lugar de nadadeiras. d) modificao na pele para exposio do ar. e) substituio de brnquias por pulmes. [B] 2008. Muitos aspectos do desenvolvimento embrionrio e das estruturas dos indivduos adultos mostram a existncia de semelhanas que evidenciam o processo evolutivo. A presena de fendas branquias e de mltiplos arcos articos nos embries de vrios grupos animais so exemplos desse fato. O registro fssil indica que os vertebrados de respirao branquial precederam os de respirao terrestre area. Dessa maneira, podemos dizer que a seqncia do aparecimento dos animais foi: a) peixes - anfbios - rpteis - aves b) anfbios - peixes - aves - rpteis c) rpteis - aves - peixes - anfbios d) aves - rpteis - anfbios peixes [A] 2009. a caracterstica que mostra uma adaptao dos anfbios vida terrestre: a) Pele mida. b) Fecundao externa. c) Pele com grande quantidade de glndulas mucosas. d) Ovos com envoltrio gelatinoso. e) Quatro apndices locomotores.

174 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

[E] 2010. Entre os vertebrados a seguir, assinale aquele que NO tetrpodo: a) Baleia. b) Tubaro. c) Perereca. d) Cobra. e) Pingim. [B] 2011. Sobre os peixes representados nas figuras anteriores, pode-se afirmar que,

[A] 2019. Alguns animais no possuem sistema ou rgo responsvel pelas trocas gasosas. Existem aqueles que absorvem oxignio e eliminam gs carbnico por difuso, atravs da superfcie epidrmica, como o caso da a) mosca. b) aranha. c) planria. d) lesma. e) estrela-do-mar. [C] 2020. Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. 01) O 'Schistosoma mansoni' um invertebrado parasita do ser humano e causador da doena de Chagas. 02) Os mamferos so animais vivparos, com exceo dos monotremos, que so ovparos. 04) O sistema ambulacrrio ou hidrovascular, presente nos equinodermos, relaciona-se exclusivamente com a locomoo desses animais. 08) A maioria das aves capaz de voar e, neste processo, alm das asas e msculos associados ao vo, so importantes a presena do ar nos pulmes e sacos areos e os ossos pneumticos. 16) Os anexos embrionrios (crio, mnio, alantide e saco vitelnico) permitiram aos rpteis e aves a conquista definitiva do meio terrestre. Alm de evitarem a dessecao do embrio em desenvolvimento, permitem sua respirao, supremno com alimentos e armazenam suas excrees. 32) A aranha-marrom, muito perigosa e comum em Curitiba, pertence ao filo Arthropoda, classe Arachnida. 02 + 08 + 16 + 32 = 58 2021. Se o blastporo de uma gstrula originar o nus do futuro animal, este poder ser a) um ourio-do-mar. b) um gafanhoto. c) uma minhoca. d) um coral. e) uma esponja. [A] 2022. Observe as figuras a seguir.

a) o peixe A possui tiflossole. b) o peixe B possui oprculo. c) o peixe A excreta principalmente uria. d) o peixe B possui nus. e) o peixe A excreta principalmente amnia. [E] 2012. Um mamfero, que apresenta pelagem escura durante o vero e pelagem branca, muito mais longa e espessa no inverno, est adaptado para viver a) em manguezais. b) no deserto do Saara. c) em florestas tropicais. d) na tundra canadense. e) nas savanas africanas. [D] 2013. No Pantanal Mato-Grossense, os jacars aquecem-se ao sol nas margens dos rios durante o dia e, como a gua esfria mais lentamente que a terra, submergem noite. Essa estratgia dos crocodilianos est relacionada ao fato de eles a) excretarem principalmente uria, composto nitrogenado com baixa toxicidade que necessita de gua para ser eliminado. b) serem ectotrmicos, dependendo de fontes externas de calor para a regulao da temperatura corprea. c) dependerem da gua para a fecundao e o desenvolvimento dos ovos. d) apresentarem o corpo revestido por uma pele grossa, com placas crneas, que evita a dessecao. e) no terem, em seus pulmes, superfcie suficiente para uma troca gasosa eficiente, necessitando realizar absoro de oxignio da gua do meio circundante, atravs da mucosa cloacal. [B] 2014. Os rpteis, por dependerem do calor do meio ambiente para se aquecerem e por variar a temperatura de seus corpos conforme as variaes da temperatura do ambiente, podem ser chamados, respectivamente, de animais a) homeotrmicos, pecilotrmicos. b) pecilotrmicos, ectotrmicos. c) ectotrmicos, homeotrmicos. d) heterotrmicos, endotrmicos. e) ectotrmicos, heterotrmicos. [E] 2015. Sabendo que um embrio apresenta notocorda, fendas branquiais e tubo nervoso dorsal, podemos afirmar com certeza que NO se trata de um: a) protocordado. b) vertebrado. c) cordado. d) equinodermo. e) cefalocordado. [D] 2016. Em relao aos diferentes grupos animais, correto afirmar que 01. os vertebrados so diblsticos, acelomados e protostmicos. 02. os mamferos adultos apresentam rim do tipo pronfrico. 04. os gastrpodes apresentam rgos de percepo visual bem desenvolvidos. 08. os peixes sseos apresentam espirculos e nadadeira caudal heterocerca. 16. as aves apresentam circulao dupla e completa, e homeotermia. 32. os turbelrios so os nicos representantes parasitas entre os platielmintes. 64. os crustceos apresentam corpo dividido em cefalotrax e abdome e 2 pares de antenas. FFFFVFV 2017. Assinale a alternativa que relaciona apenas animais exclusivamente marinhos: a) camaro, lagosta, caranguejo. b) lula, polvo, caramujo. c) estrela-do-mar, polvo, coral. d) camaro, polvo, ourio-do-mar. e) lagosta, caranguejo, pepino-do-mar. [C] 2018. Qual das opes a seguir relaciona apenas animais que possuem um sistema ambulacrrio para a locomoo, excreo e circulao: a) Equinodermas. b) Moluscos. c) Celenterados. d) Porferos. e) Protocordados.

Com relao aos animais representados, pode-se afirmar que a) dois deles apresentam tbulos de Malpighi como rgos de excreo. b) dois deles pertencem a grupos que possuem representantes de transmissores de doenas. c) todos apresentam boca derivada do blastporo. d) trs pertencem ao mesmo filo. e) trs so exclusivamente marinhos. [A] 2023. Alunos de uma escola de Belo Horizonte realizaram uma coleta de seres vivos nas guas do Crrego da Ressaca. Ao fazerem o relatrio, citaram a ocorrncia de alguns grupos de organismos. Todas as alternativas apresentam classificaes possveis, EXCETO a) Algas e crustceos. b) Bactrias e fungos. c) Equinodermas e poliquetas. d) Insetos e aneldeos. e) Moluscos e platelmintos. [C] 2024. Os animais A, B e C apresentam as seguintes caractersticas: A: ps ambulacrrios, espinhos no corpo e simetria radiada. B: cefalotrax, quelceras e exoesqueleto de quitina C: presena de rdula, massa visceral e concha A, B e C podem ser, respectivamente: a) pepino-do-mar, minhoca e polvo. b) aranha, pepino-do-mar e polvo. c) estrela-do-mar, aranha e caracol. d) estrela-do-mar, aranha e minhoca. e) minhoca, aranha e pepino-do-mar. [C] 2025. Das afirmaes abaixo, mamferos e equinodermos tm em comum: I - Trs tecidos embrionrios. II - Celoma e deuterostomia. III - Simetria bilateral no adulto. IV - Notocorda e sistema circulatrio fechado. a) I e III , somente.

175 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

b) I , II e IV , somente. c) I , III e IV , somente. d) I e II , somente. e) I , II , III e IV. [D] 2026. Nos diversos tipos de invertebrados, encontramos diferentes estruturas relacionadas com a locomoo. Associe os grupos de invertebrados com as estruturas ou mecanismos locomotores e, depois, assinale a alternativa que apresenta a correlao CORRETA. (I) aneldeos (II) celenterados (III) equinodermos (IV) insetos voadores (1) asas, geralmente membranosas (2) esqueletos hidrosttico (3) musculatura esqueltica (4) sistema ambulacral a) I - 4; III - 3 b) II - 2; IV - 4 c) I - 2; III - 4 d) II - 3; III - 1 e) I - 4; IV 1 [C] 2027. Quanto localizao do esqueleto, o ourio-do-mar comparvel a um a) tubaro. b) escorpio. c) caranguejo. d) besouro. e) caramujo. [A] 2028. Das caractersticas a seguir qual exclusiva dos Equinodermos? a) Sistema nervoso ganglionar. b) Aparelho digestivo completo. c) Sistema sensorial representado por antenas e olhos. d) Sistema hidrovascular. e) Presena de conchas em alguns representantes. [D] 2029. Simetria radial, lanterna de Aristteles, habitat exclusivamente marinho, so caractersticas do seguinte grupo: a) artrpodos; b) porferos; c) equinodermos; d) insetos; e) aracndeos. [C] 2030. Invertebrados que apresentam esqueleto interno de origem mesodrmica e simetria radial quando adultos so os a) celenterados. b) equinodermas. c) artrpodos. d) moluscos. e) porferos. [B] 2031. A lagosta, o polvo e o lrio-do-mar pertencem, respectivamente, aos filos: a) asquelmintos, aneldeos e artrpodes b) artrpodes, moluscos e equinodermos c) moluscos, asquelmintos e artrpodes d) moluscos, artrpodes e equinodermos e) artrpodes, equinodermos e asquelmintos [B] 2032. Considere as caractersticas reprodutivas a seguir. I. sexos separados II. dimorfismo sexual III. fecundao externa IV. desenvolvimento indireto Nos equinodermos ocorrem, geralmente, APENAS a) I e II b) II e III c) I, II e IV d) I, III e IV e) II, III e IV [D] 2033. O esqueleto dos equinodermos um: a) endoesqueleto ectodrmico quitinoso. b) endoesqueleto mesotrmico calcreo. c) exoesqueleto endodrmico calcreo. d) exoesqueleto ectodrmico quitinoso. e) exoesqueleto mesodrmico quitinoso. [B] 2034. O sistema hidrovascular exclusivo de um determinado filo de invertebrados desempenha funes de locomoo, fixao e captura de alimento, alm de contribuir decisivamente na respirao e na excreo. O filo a que se refere a descrio anterior : a) Nemathelminthes. b) Arthropoda. c) Echinodermata. d) Annelida. e) Mollusca. [C]

2035. Os invertebrados que possuem olhos estruturalmente semelhantes aos dos vertebrados so os a) insetos. b) aracndeos. c) crustceos. d) gastrpodos. e) cefalpodos. [E] 2036. Os moluscos bivalvos (ostras e mexilhes) so organismos economicamente importantes como fonte de alimento para o homem, por possuir alto valor nutritivo. Eles conseguem filtrar grandes volumes de gua em poucas horas, da serem comumente chamados "organismos filtradores", mas, em conseqncia, podem acumular, no seu trato digestivo, altas concentraes de microorganismos e compostos qumicos txicos, eventualmente presentes na gua onde vivem, assim pondo em risco a sade pblica e exercendo grande impacto social e econmico nas reas de sua criao. Assinale a afirmao correta. a) Os moluscos no possuem sistema digestivo. b) Os moluscos no possuem sistema nervoso ganglionar. c) Os mexilhes possuem concha com apenas uma valva. d) Nos mexilhes, as brnquias tm funo respiratria e importante papel na nutrio. e) Os moluscos so sempre hermafroditas. [D] 2037. Assinale a alternativa INCORRETA a respeito dos moluscos. a) So animais diploblsticos acelomados. b) Tm respirao braquial ou "pulmonar". c) Possuem o corpo constitudo, basicamente, por cabea, p e massa visceral. d) Tm excreo atravs de nefrdios. e) So de sexos separados ou hermafroditas. [A] 2038. Um aluno, da FEI, foi a um jantar, onde havia camaro, ostra, lula e lagosta. Esta refeio continha portanto: a) apenas peixes b) apenas crustceos c) apenas moluscos d) apenas crustceos e moluscos e) apenas peixes e moluscos [D] 2039. "... Os moluscos constituem um grupo muito bem sucedido na natureza. Ocupam vrios ambientes e exibem hbitos de vida bastante diversificados" (Trecho extrado do livro "Biologia" de Amabis e colaboradores, 1974, p.294). Em relao a esse filo e baseado na observao dos diferentes hbitos mostrados na figura, assinale a(s) proposio(es) VERDADEIRA(S).

01. Como caractersticas embrionrias so celomados, deuterostmios e apresentam simetria radial. 02. Os gastrpodos possuem no assoalho da faringe a rdula que utilizam para raspar o alimento. 04. A respirao branquial nos animais aquticos e pulmonar nos terrestres. 08. O grupo dos bivalvos compreende muitos animais comestveis e importantes economicamente, como os mexilhes, as ostras e os "escargots". 16. A figura representa o grupo dos bivalvos, que se caracterizam por apresentar uma concha formada por duas partes chamadas valvas, no interior das quais se encontra a cabea, diferenciada, o p e a massa visceral. 32. Baseado na figura podemos constatar que enquanto o 'Pecten' um animal de vida livre, a ostra e o Mytilus so fixos. 64. A lula um decpodo com o corpo afilado em forma de cone e a cabea com oito tentculos. FVVFFVF 2040. Existe uma frase popular usada em certas regies, relativa a lagos e audes: "Se nadou e depois coou, porque pegou". Esta frase refere-se infeco por: a) 'Plasmodium vivax'. b) 'Trypanosoma cruzi'. c) 'Schistosoma mansoni'. d) 'Taenia sollium'. e) 'Ancylostoma duodenale'. [C]

176 No estude BIOLOGIA, desfrute-a!!!

Prof. Leandro Gomes

2041. O 'Schistosoma mansoni' o agente etiolgico da esquistossomose, doena parasitria que atinge principalmente o homem. De seu ciclo evolutivo, participam caramujos do gnero Biomphalaria. Indique a que filos pertencem, respectivamente, a espcie em questo, seu hospedeiro definitivo e seu hospedeiro intermedirio: a) Trematoda, Mammalia e Gastropoda. b) Platyhelminthes, Primata e Mollusca. c) Planorbidae, Chordata e Gastropoda. d) Platyhelminthes, Chordata e Mollusca. e) Trematoda, Mammalia e Mollusca. [D] 2042. Na histria evolutiva aceita pela maioria dos zologos, o primeiro grupo de animais a apresentar simetria bilateral acompanhada de processo de cafalizao o dos a) porferos. b) cnidrios. c) artrpodes. d) platelmintos. e) equinodermos. [D] 2043. Um garoto nadou em uma "lagoa de coceira", comeu carne de boi mal cozida e caminhou descalo por um caminho de terra. Com essas atividades ele pode ter adquirido larvas de a) 'Wuchereria', 'Taenia solium' e 'Ascaris'. b) 'Wuchereria', 'Taenia saginata' e 'Ascaris' c) 'Schistosoma', 'Taenia solium' e 'Ascaris'. d) 'Schistosoma', 'Taenia solium&