Você está na página 1de 472

APOSTILA

APOSTILA 1
pg

05 27 43 71 85 111 129 141

BIOLOGIA 1

165 197 221 239 259 277 299 321

GEOGRAFIA D0 BRASIL

Sumrio
339 355 375 399 413 435 459
MATEMTICA 2

BIOLOGIA 2

GEOGRAFIA GERAL

BIOLOGIA 3

GRAMTICA

MATEMTICA 3

ESPANHOL

HISTRIA DO BRASIL

QUMICA 1

FILOSOFIA

HISTRIA GERAL

QUMICA 2

FSICA 1

HISTRIA DA ARTE

QUMICA 3

FSICA 2

INGLS

SOCIOLOGIA 1

FSICA 3

MATEMTICA 1

SOCIOLOGIA 2

Coordenao Geral Diagramao


Fernando Almeida

Rita de Cssia Rodrigues Oliveira

Instrutores
< Anglica Marim Lopes < Antnio Henrique Nogueira < Carlos Hiroji Hiroki < Caio Vitor Marques Miranda < Carlos Ricardo Rafalski Cunha < Debora Moreira < Diego Arajo < Diego Pianovski < Edson Da Costa Rodrigues < Eliza Carvalho da Costa < Francisco Paulo Caires Jr. < Gisele Nazrio Lima < Gustavo Andr Apendino < Ivan Vitor Dal Rovere < Jeniffer Modenuti < Jonas Passos da Silva < Jlio Csar Sacomori < Leonardo Tolentino < Mrcio Aurlio Pardo < Marina Rangel Ferro Pereira < Matheus Di Ostri Romagnolli < Matheus Gomes Fvaro < Mirella Samaha < Paulo Rodolpho Camargo < Renata Ruziska Pires < Rodrigo Dambrzio

BIOLOGIA 1
07 Nveis de organizao em Biologia .............. 08 A composio qumica dos seres vivos ....... 08 Exerccios .................................................... 09

01

INTRODUO A BIOLOGIA

pg

04

PROTENAS

pg

14

Papel das protenas: construo, enzimtico e de defesa ................... 15 Exerccios .................................................... 16

10 Exerccios .................................................... 10

02

CARBOIDRATOS

pg

19 Estrutura dos cidos nuclicos ...................... 19 Replicao do DNA ........................................ 19 Sntese de RNA ............................................ 19 Exerccios .................................................... 20

05

CIDOS NUCLICOS I

pg

12 Fosfolpidios ................................................... 12 Carotenoides ................................................. 12 Exerccios .................................................... 13

03

LPIDIOS

pg

22 Principais tipos de RNA ................................... 22 Sntese de protena ....................................... 22 Exerccios ..................................................... 23 Gabaritos ..................................................... 25

06

CIDOS NUCLICOS II

pg

INTRODUO A BIOLOGIA

UNIDADE 1 INTRODUO A BIOLOGIA


O QUE VIDA?
A biologia a disciplina que estuda os seres vivos, seus comportamentos e suas estruturas. Ns somos seres vivos, assim como um p de alface e um cogumelo. J uma rocha ou a gua (embora essencial vida) no um material vivo. Os seres vivos possuem uma composio qumica diferente e mais complexa que os seres no-vivos. Todo ser vivo composto por clulas e possui metabolismo, conjunto de reaes qumicas que mantm a homeostase (equilbrio dinmico) do organismo. Os seres vivos tambm reagem a estmulos externos. Entretanto a caracterstica mais fundamental a capacidade dos seres vivos de se reproduzir, multiplicar-se transmitindo suas caractersticas aos seus descendentes, que iro crescer desde o nascimento at a morte. Por ltimo pode-se citar uma caracterstica bastante marcante dos seres vivo; sua capacidade de adaptao, ou seja, conseguem se ajustar ao meio onde vivem.

TEORIA CELULAR

A teoria celular diz que todos os seres vivos so constitudos por clulas. Todas as clulas so constitudas de clulas prexistentes e h uma continuidade gentica (de caractersticas) entre as clulas, transferida de uma para a outra atravs da diviso celular. H organismos que so formados por uma nica clula, os unicelulares; e h aqueles que so compostos por vrias clulas, os pluricelulares. Nestes, existem diferentes tipos de clulas. O ser humano constitudo por vrios tipos celulares. Os neurnios, por exemplo, so clulas especializadas na transmisso de impulsos nervosos; as hemcias so clulas do sangue que, graas a sua forma, transportam o oxignio para as outras clulas do corpo (Figura 1.1). A forma da clula est sempre relacionada com a funo que exerce (Figura 1.2).

Figura 1.2: Existem diversas formas de clulas e sempre a forma est relacionada com a funo que ela exerce. Esta figura representa algumas clulas do corpo humano.

METABOLISMO: O MESMO QUE ATIVIDADE QUMICA

A palavra metabolismo significa conjunto de reaes qumicas de um organismo. Falamos em metabolismo energtico, quando nos referimos s reaes que liberam energia dentro da clula. Quando estamos descrevendo processos de construo de mais matria viva, para reparao e para crescimento, falamos em metabolismo plstico ou metabolismo estrutural. Alm dessas duas modalidades fundamentais do metabolismo, existe um grupo de reaes diretamente relacionado ao controle biolgico dos organismos, e por isso so chamadas de metabolismo de controle. Dessa forma, temos: 1 A energia para a vida. 2 A construo da matria viva. 3 Controle das reaes.

HOMEOSTASE
Figura 1.1: A estrutura da clula est relacionada com a funo que ela desempenha. As hemcias so clulas sanguneas responsveis pelo transporte de O2 para as outras clulas do corpo. O neurnio a clula nervosa responsvel pelo impulso nervoso.

a capacidade que os seres vivos possuem de se manterem estveis. Todo ser vivo regula as suas atividades internas em funo das condies do meio ambiente. Os mamferos, por exemplo, conseguem manter constantes a temperatura, a quantidade de gua no organismo, a concentrao de diversas substncias presentes no corpo, entre outros. A Esse equilbrio interno chamamos homeostase.

07

BIOLOGIA 1

INTRODUO A BIOLOGIA

NVEIS DE ORGANIZAO EM BIOLOGIA


Pensando-se em um ser vivo complexo como o homem, pode-se tomar o organismo como referncia. A anlise desse organismo revela a existncia de sistemas (por exemplo, o sistema digestrio) especializados em funes diferentes e integradas. Um sistema formado por um conjunto de rgos (no exemplo: boca, faringe, esfago, estmago, intestinos, fgado e pncreas). A anlise cuidadosa do estmago, utilizando microscpio, revela que este constitudo por uma sucesso de camadas, cada uma corresponde a um tecido, que outro nvel de organizao. A observao de um tecido ao microscpio, por exemplo, o do revestimento do estmago, mostra vrias clulas de forma e funes semelhantes, cada clula possui em seu interior organelas. A anlise bioqumica das organelas mostra que elas so compostas por um arranjo definido de molculas que, por sua vez, so formadas por tomos comuns a todos os seres vivos. Assim temos: Clulas: unidade bsica da vida composta por tomos e molculas qumicas. Tecidos: formados por tipos semelhantes de clulas agrupadas. rgos: formados por alguns tipos de tecidos agrupados. Sistemas: conjunto de rgos. Organismos: o conjunto de sistemas funcionando integradamente. A figura a seguir apresenta exemplos das estruturas do corpo humanos de acordo com os nveis de organizao.

COMPONENTES INORGNICOS

gua: A gua, a substncia qumica mais abundante dos seres vivos, um excelente solvente. Por este motivo a maioria dos outros componentes esto dissolvidos em gua. Isso facilita o transporte e permite que ocorram as reaes qumicas do metabolismo. Nos organismos terrestres a gua regula o equilbrio trmico, uma vez que ao evaporar-se retira calor das superfcies. A taxa de gua varivel, quanto mais ativo um tecido, maior a taxa de gua. Quanto mais jovem um organismo, tambm maior a taxa de gua. Ao longo da evoluo, os animais, para viverem na terra, desenvolveram adaptaes que evitam a desidratao. Sais Minerais: Os sais minerais podem ser encontrados sob a forma solvel (como ons, com funes diversas) ou na forma insolvel (fazendo, geralmente, parte de estruturas esquelticas).

ON Clcio (Ca 2+)

PAPEL DESEMPENHADO NA CLULA


Constituio do esqueleto; contrao muscular e ativador de enzimas. (ex. enzimas da coagulao sangunea). Faz parte da molcula de clorofila; necessrio, por tanto, para a fotossntese; componente de muitas coenzimas. Necessrio para o funcionamento normal de nervos e msculos. Presente na hemoglobina das clulas do sangue (hemcias), mioglobina e enzimas respiratrias. Fundamental para a respirao celular. Tem concentrao intracelular sempre mais baixa do que do lquido extracelular. A membrana plasmtica, por meio de transporte ativo bombeia o sdio para fora da clula. Essencial para a conduo do impulso nervoso. Mais abundante dentro da clula do que fora dela. Por transporte ativo, a membrana plasmtica absorve o potssio do meio externo. O Na+ e o K+ esto relacionados nos processos de contrao muscular e de conduo do impulso nervoso. Constituio do esqueleto, dos cidos nuclicos e da molcula de ATP.

Magnsio (Mg 2+)

Ferro (Fe 3+)

Sdio (Na +)

Potssio (K +)

Fosfato (PO4)

COMPONENTES ORGNICOS

A tabela a seguir apresenta as divises do metabolismo e mostras as substncias e organelas celulares relacionadas:

Figura 1.3: Nveis de organizao do corpo humano.

A COMPOSIO QUMICA DOS SERES VIVOS


COMPOSTOS INORGNICOS gua e Sais minerais COMPOSTOS ORGNICOS Carboidratos (acares); Lipdeos (leos e gorduras); Protenas e, cidos nuclicos (DNA e RNA)

08

BIOLOGIA 1

INTRODUO A BIOLOGIA
6. Em relao ao teor de gua nos tecidos dos vertebrados, assinale a alternativa CORRETA: a) Ser maior quanto maior for o seu metabolismo, e diminuir com o aumento da idade. b) Ser maior quanto maior for o seu metabolismo, e aumentar com o aumento da idade. c) Ser maior quanto menor for o seu metabolismo, e diminuir com o aumento da idade. d) Ser maior quanto menor for o seu metabolismo, e aumentar com o aumento da idade. e) O teor de gua no varia. 7. Dos componentes da matria viva, qual deles existe em maior quantidade em qualquer clula? a) Protenas d) gua b) Carboidratos e) Vitaminas c) cidos nuclicos 8. A gua encontrada nos compartimentos extracelulares (lquido intersticial) e transcelulares (dentro de rgo como bexiga e o estmago). Sobre a gua CORRETO afirmar: a) A quantidade que encontrada nos organismos invarivel de espcie para espcie. b) Com o passar dos anos existe um tendncia em aumentar seu percentual no corpo. c) importante fator de regulao trmica nos organismos. d) Em tecidos metabolicamente ativo inexistentes. e) Dificulta a realizao de reaes qumicas. 9. O macronutriente essencial ao desenvolvimento das plantas, por fazer parte da molcula de clorofila, : a) Ferro c) Zinco e) Magnsio b) Cobre d) Mangans 10. Que tipos de problemas pode apresentar uma pessoa que contm uma dieta pobre em ferro e em clcio? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 11. A transpirao, caracterstica de organismos terrestres, sempre implica o risco de desidratao, j que ocorre perda de gua, sob a forma de vapor, na superfcie do corpo. No entanto, trata-se de um mecanismo importante de regulao da temperatura. De que maneira essa regulao ocorre? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

EXERCCIOS
1. Complete as frases a seguir preenchendo cada espao com um dos termos relacionados a seguir: (1) clula (3) metabolismo (2) evoluo biolgica (4) reproduo a) ( ) o conjunto altamente organizado de transformaes qumicas que ocorrem em um ser vivo e envolvem substncias e energia. b) A capacidade de um ser vivo originar seres semelhantes a si chamada ( ). c) ( ) um compartimento membranoso no qual se localizam e atuam as substncias fundamentais a vida. d) O processo de mudana pelo qual os seres vivos vm passando, desde que surgiram na Terra, chama-se ( ) 2. (PUC Rio) Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de caractersticas que definem os sistemas viventes, duas dessas caractersticas assumem maior importncia para a preservao da vida no planeta. So elas: a) Composio qumica complexa e estado coloidal. b) Elevado grau de organizao e execuo das funes vitais. c) Manuteno da homeostase e alto nvel de individualidade. d) Consumo de energia e renovao contnua da matria. e) Capacidade de reproduo e hereditariedade. 3. Indique a alternativa que apresenta a seqncia lgica dos nveis de organizao dos seres vivos: a) Clula rgos tecidos sistemas organismo. b) Tecidos clulas rgos organismo sistemas. c) Clulas tecidos sistemas rgos organismo. d) Clulas tecidos rgos sistemas organismo. e) Sistemas clulas rgos tecidos organismo. 4. A manuteno da estabilidade do ambiente fisiolgico interno de um organismo exercida por diversos rgos. Por exemplo, os rins so responsveis, entre outras coisas, pela estabilidade dos nveis de sais, gua e acar do sangue. Assinale a opo que indica CORRETAMENTE o nome do mecanismo referido anteriormente: a) Homeotermia. d) Ontogenia. b) Homeostase. e) Etologia. c) Organognese. 5. A expresso metabolismo celular significa: a) O conjunto de reaes que permitem uma clula conseguir energia. b) O conjunto de reaes que permita que a clula cresa. c) Todas as reaes qumicas, qualquer que seja o tipo, que ocorra numa clula viva. d) A digesto de molculas grandes e sua desmontagem em molculas menores. e) A produo de mais matria viva pelos ribossomos.

09

CARBOIDRATOS

UNIDADE 2 CARBOIDRATOS
Os carboidratos sero as primeiras macromolculas, ou seja, molculas de tamanho superior, a serem estudados dentre constituintes orgnicos da clula. So utilizados principalmente como combustveis preferenciais das clulas e so divididos em trs categorias importantes: monossacardeos, as molculas mais simples; dissacardeos, constitudos da ligao de 2 monossacardeos e os polissacardeos, em que muitas molculas de monossacardeos esto ligadas entre si. Nomenclatura: monossacardeos normalmente tm, para cada tomo de carbono (C), dois tomos de hidrognio (H) e um de oxignio (O). Trioses: 3 tomos de C; Pentose: 5 tomos de C; Hexose: 6 tomos de C. As hexoses mais comuns so: glicose e frutose. A sacarose o acar da cana, um dissacardeo. O amido um polissacardeo de reserva vegetal, uma importante fonte de alimentao para os humanos.

Somente os monossacardeos podem ser absorvidos pelo sangue, quando chega, ao intestino. Assim, todos os carboidratos mais complexos (dissacardeos e polissacardeos) da nossa dieta tm que ser quebrado em monossacardeos pelo processo de digesto.

Nos sucos digestivos, produzidos pelas diversas regies do tubo digestrio, existem enzimas digestivas, substncias que aceleram o processo de digesto. Por no haver no nosso tubo digestivo a enzima celulase, a celulose no quebrada, logo no absorvida e, ento liberada nas fezes, sem mudanas qumicas. Sntese por desidratao: quando se une dois monossacardeos uma molcula de gua liberada, diz-se sntese por desidratao (perda de gua); Hidrolise: (hidro = gua; lise = quebra) quando uma molcula de dissacardeo reage com uma molcula de gua.

EXERCCIOS
1. Muitos dos alimentos que ingerimos, so constitudos por carboidratos, porm so molculas extremamente grandes que, para serem absorvidas pelo organismo precisam ser quebradas pelo processo de digesto. Assinale a alternativa em que todos os acares relacionados podem estar no tubo digestivo como no sangue de um mamfero: a) Frutose, galactose, glicose. b) Frutose, glicose, sacarose. c) Desoxirribose, amido, galactose. d) Maltose, sacarose, celulose. e) Pentose, lactose, glicose.

Toda reao de sntese/produo ou construo de molculas mais complexas chamado de ANABOLISMO. Do contrrio, todas reaes de degradao ou quebra chamado de CATABOLISMO, ambas fazem parte do METABOLISMO de todo ser vivo.

10

BIOLOGIA 1
2. (Adaptada UEL) Considere a seguinte frase: ____I____ um ___II__ de funo estrutural na parede das clulas ___III___. Para ser completado corretamente I, II e III devem ser substitudos por: a) Amido polipeptdeo animais. b) Celulose polipeptdeo animais. c) Celulose polissacardeo animal. d) Celulose polissacardeo vegetais. e) Amido polissacardeo vegetais. 3. (Adaptada UEL) Nos animais o glicognio armazenado, principalmente, nas clulas: a) Adiposas e musculares b) Hepticas e musculares c) Adiposas e sanguneas d) Heptica e adiposa e) Sanguneas e musculares 4. (Mackenzie-SP) As substncias que se destinam a fornecer energia, alm de serem responsveis pela rigidez de certos tecidos, sendo mais abundante nos vegetais, so os , sintetizados pelo processo de. A alternativa que preenche corretamente os espaos : a) Lipdeos, fotossntese b) cidos nuclicos, autoduplicao c) lcoois, fermentao d) cidos nuclicos, fotossntese e) Carboidratos, fotossntese 5. A respeito de hexoses e pentoses, podemos afirmar que ambas: a) Fazem parte da molcula de cido nuclico b) So carboidratos c) So polissacardeos d) Fazem parte do componente esqueltico da parede celular e) So protenas 6. (FGV-SP) Glicognio e celulose tm em comum, na sua constituio, molculas de: a) Aminocidos d) Protena b) cidos graxos e) Glicerol c) Carboidratos 7. (UEM 2009) Assinale o que for CORRETO. (01) Amido e glicognio so polissacardeos que atuam como substncias de reserva de energia. (02) Amido e glicognio so polissacardeos que, por hidrlise, produzem glicose. (04) Amido e glicognio so encontrados, principalmente, em razes e em caules de plantas.

CARBOIDRATOS
(08) Os glicdios com frmulas moleculares C7H12O6, C3H6O3 e C6H12O6 so, respectivamente, monossacardeo, monossacardeo e dissacardeo. (16) A gua, presente em 75% dos corpos dos seres vivos, tem, em seu alto calor especfico, uma das principais propriedades que proporciona variaes bruscas de temperatura no interior das clulas. 8. (Vunesp) Os acares complexos, resultantes da unio de muitos monossacardeos, so denominados polissacardeos. a) Cite dois polissacardeos de reserva energtica, sendo um de origem animal e outro de origem vegetal. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Indique um rgo animal e um rgo vegetal, onde cada um desses acares pode ser encontrado. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 9. Observe as frmulas moleculares de dois glicdios, representadas a seguir; um deles um monossacardeo, e o outro, um dissacardeo.

C7H14O7

C6H10O5

a) O que permite caracterizar essas duas substncias como glicdios? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Qual deles o monossacardeo? Por qu? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ c) Quanto ao nmero de carbonos, como eram as molculas que originaram o dissacardeo? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

11

LPIDIOS

UNIDADE 3 LPIDIOS
Os lipdeos, como leos e gorduras, so molculas que resultam da associao de cidos graxos e lcool; so insolveis em gua e podem ser simples ou complexos. Tm o papel de reserva energtica nos animais, a segunda fonte de energia, podendo servir como isolante trmico sob a pele na camada denominada hipoderme. armazenado nas clulas de gordura (adipcitos).

Figura 3.2: Esquema representativo de uma molcula de fosfolipdio. As membranas biolgicas so formadas por fosfolipdios organizados em duas camadas, nas quais se incrustam molculas de certas protenas. Essas membranas so elsticas porque as molculas de fosfolipdios podem mover-se livremente nelas, reorganizando-se sem perder o contato umas com as outras. Essa capacidade de reorganizao evita a ruptura das membranas e explica sua alta capacidade de regenerao.

Figura 3.3: Representao esquemtica da estrutura da membrana celular, mostrando a organizao dos fosfolpidios que a compe. Figura 3.1: Esquema representativo de uma molcula de colesterol.

CAROTENOIDES
Os carotenoides so pigmentos de cor vermelha, laranja ou amarela, insolveis em gua e solveis em leos e solventes orgnicos. Esto presentes nas clulas de todas as plantas, nas quais desempenham papel importante no processo de fotossntese. So importantes tambm para muitos animais. Por exemplo, a molcula de caroteno, um carotenoide alaranjado presente na cenoura e em outros vegetais, matria-prima para a produo da vitamina A, essencial a muitos animais. Essa vitamina importante, por exemplo, para nossa viso, pois precursora do retinal, uma substncia sensvel luz presente na retina dos olhos dos vertebrados.

FOSFOLPIDIOS
Uma classe especial de lipdios a dos fosfolipdios, os principais componentes das membranas celulares. Do ponto de vista qumico, um fosfolipdio um glicerdeo combinado a um grupo fosfato. A molcula de fosfolipdio lembra um palito de fsforo, com uma cabea eletricamente carregada, e uma haste sem carga eltrica, constituda por duas caudas de cido graxo.

12

BIOLOGIA 1

LPIDIOS
a) Maltase b) Protease c) Lipase d) Amilase e) Sacarase

EXERCCIOS
1. A hidrlise de determinada molcula produziu glicerol e cidos graxos; isso indica que a molcula hidrolisada era a) Uma protena. c) Um carboidrato. b) Um lipdio. d) Um cido nuclico. 2. (Especfica UEL 2008) No alvorecer da humanidade, e durante muito tempo da nossa histria, as refeies foram literalmente um vale tudo. Pelo fato dos seres humanos terem evoludo num mundo onde a disponibilidade de alimentos era apenas intermitente, a sobrevivncia exigiu que tivssemos a capacidade de armazenar energia para pocas de escassez. O tecido adiposo, familiarmente conhecido como gordura, o rgo especializado para essa tarefa. Nossa capacidade de armazenar gordura continua essencial vida e pode permitir que uma pessoa sobreviva fome por meses. Na histria humana recente, contudo, a quantidade de energia acumulada como gordura est aumentando em muitas populaes. Obesidade o nome que damos quando o armazenamento de gordura se aproxima de um nvel que compromete a sade de uma pessoa.
(SCIENTIFIC American. Especial: Alimentos, sade e nutrio. Out. 2007. p. 46.)

4. (UFPB) Para a construo de favos, as abelhas produzem certas quantidades de cera, substncia orgnica pertencente mesma categoria qumica daquelas encontradas como reserva nutritiva em sementes de soja, girassol e amendoim, ou em um dos componentes bsicos e fundamentais na estrutura das membranas celulares. A substncia orgnica em questo corresponde s (aos): a) Protenas d) Lipdios b) Acares e) Aminocidos c) Carboidratos 5. (UEL) O leo vegetal, componente do biodiesel, do grupo dos triglicerdeos, podendo ser extrado de vrias fontes, como amendoim, mamona, algodo e girassol. Sobre os triglicerdeos, CORRETO afirmar que: a) So substncias hidroflicas sintetizadas nos vacolos das clulas. b) So lipdios estruturais sintetizados nos cloroplastos das clulas. c) So lipdios que formam as membranas celulares. d) So lipdios de reserva nutritiva. e) So produtos diretos da fotossntese. 6. (EMESCOM) Arterioesclerose uma doena muito frequente e se caracteriza pela deposio de colesterol na camada ntima da parede das artrias. O colesterol : a) Um cido graxo saturado. b) Um cido graxo insaturado. c) Um fosfolipdio. d) Um lpide com quatro anis cclicos e uma cadeia lateral. e) Um triglicerdeo. 7. So exemplos de lipdios: fosfolipdios, esterides e carotenides. a) Cite um esteride importante e d sua funo: _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Cite um local de estocagem de lipdios em ani-mais e um em vegetais: _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Com base no texto e nos conhecimentos sobre o tema, analise as armativas a seguir: I. Restringir as gorduras insaturadas encontradas, por exemplo, na carne bovina, nos embutidos, na margarina, assim como nas gorduras de laticnios diminuem o risco de doena cardaca coronariana. II. O glicognio uma forma importante de armazenamento de energia, o que se justica por dois motivos bsicos: ele pode fornecer combustvel para o metabolismo de carboidrato muito rapidamente, enquanto a mobilizao de gordura lenta; e, talvez o mais importante, o glicognio pode prover energia sob condies anxicas. III. A totalidade de depsitos de gordura em adipcitos capaz de extensa variao, consequentemente, permitindo mudanas de necessidades do crescimento, reproduo e envelhecimento, assim como utuaes nas circunstncias ambientais e siolgicas, tais como a disponibilidade de alimentos e a necessidade do exerccio fsico. IV. O tecido adiposo aumenta: pelo aumento do tamanho das clulas j presentes quando o lipdeo adicionado, fenmeno este conhecido como hiperplasia; ou pelo aumento do nmero de clulas, fenmeno conhecido como hipertrofia. Assinale a opo que contm todas as armativas CORRETAS. a) I e III. c) III e IV. e) I, III e IV. b) II e III. d) I, II e IV. 3. (UFRJ) Recentemente, houve grande interes-se por parte dos obesos quanto ao incio da comercializao do medicamento Xenical no Brasil. Esse medicamento impede a metabolizao de um tero da gordura consumida pela pessoa assim, pode-se concluir que o Xenical inibe a acao da enzima:

13

BIOLOGIA 1
8. Os esteroides so lipdios importantes bem diferentes dos glicerdeos e das ceras. O colesterol um dos componentes mais conhecidos dos esteroides, devido a sua associao com as doenas cardiovasculares. No entanto, esse composto muito importante para o ser humano, uma vez que desempenha uma srie de funes. a) Cite duas funes do Colesterol no corpo humano. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Cite duas origens do colesterol encontrado no sangue humano. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ Formao da ligao peptdica:

PROTENAS

UNIDADE 4 PROTENAS
As protenas so encontradas em todos os seres vivos, inclusive nos vrus. Constituem os compostos orgnicos mais abundantes da matria viva. Quimicamente, so macromolculas complexas, formadas por aminocidos que se ligam por ligaes peptdicas.

Os aminocidos so unidades que, reunidas, constituem as protenas. Pode-se falar de protena quando a molcula tiver mais de 80 aminocidos, a ligao entre um menor nmero de aminocidos forma um polipeptdio. So conhecidos nos seres vivos, cerca de 20 tipos de aminocidos que participam da estrutura de suas protenas. Os vegetais so capazes de sintetizar todos os aminocidos que necessitam, porm os animais s conseguem sintetizar alguns. Assim, os aminocidos que os animais conseguem sintetizar so chamados naturais e aqueles que eles no conseguem, so chamados essenciais ou indispensveis. Veja a seguir os aminocidos naturais e essenciais para a espcie humana:

NATURAIS
Alanina Aspartato Asparagina Cistena Glutamato Glutamina Glicina Prolina Serina irosina

ESSENCIAIS
Arginina* Fenilalanina Histidina Isoleucina Leucina Lisina Metionina Treonina Triptofano Valina

ESTRUTURA DE UM AMINOCIDO

* essencial para indivduos jovens e em crescimento, mas no para adultos.

Quando ingerimos as protenas elas so quebradas em aminocidos para poderem ser absorvidas.

ESTRUTURA DAS PROTENAS

Quando nos referimos ao fio protico (nmero de aminocidos, tipos e a sequncia), estamos falando da sua estrutura primria. O enrolamento do fio sob a forma de uma hlice, denominado estrutura secundria. Falamos de estrutura terciria quando nos referimos forma espacial da molcula. Duas ou mais estruturas tercirias reunidas formam uma quaternria.

14

BIOLOGIA 1

PROTENAS

PAPEL DAS PROTENAS: CONSTRUO, ENZIMTICO E DE DEFESA


As protenas executam diversas funes importantes: construir a matria viva; catalisar reaes qumicas essenciais vida (enzimas); atuar na defesa do organismo (anticorpos); entre outras.

Note que cada enzima tem um valor especfico de pH em que tem a sua melhor atividade. A ptialina (ou amilase salivar) atua em pH 7,0 (neutro), a pepsina tem a sua atividade mais bem desempenhada com pH 2,0 (cido).

DEFESA

Anticorpos so estruturas de defesa de natureza protica, encontradas no sangue dos vertebrados. Os anticorpos, assim como as enzimas, seguem um modelo denominado chave-fechadura, ou seja, cada anticorpo (chave), se liga a um nico tipo de receptor (fechadura), cada anticorpo tem o seu receptor especfico.

CONSTRUO

Participam da estrutura dos tecidos a das clulas. Exemplos: colgeno (pele, cartilagem, ossos e tendes), miosina e actina (msculos), queratina (pele, cabelo e unhas), albumina (sangue) e fibrinognio (sangue), um dos constituintes da membrana plasmtica.

ENZIMTICO

Toda enzima uma protena. As enzimas so protenas especiais que aceleram / catalisam as reaes qumicas do organismo, possibilitando a vida. Como so protenas, dependem de uma temperatura e um pH ideais para trabalhar e possuem especificidade de substrato (atuam segundo o modelo chavefechadura). Um exemplo disso ocorre com as enzimas do tubo digestivo. A amilase salivar (ou ptialina), que age na boca, tem um pH timo ao redor de 7,0. Enzimas do estmago funcionam de uma forma tima em pH de valores baixos, ou seja, cidos. As enzimas que atua, no intestino funcionam em pH alcalino.

15

BIOLOGIA 1
Soros e vacinas: so produtos de origem biolgica (chamados imunobiolgicos) usados na preveno e tratamento de doenas. A diferena entre esses dois produtos est no fato dos soros j conterem os anticorpos necessrios para combater uma determinada doena ou intoxicao, enquanto que as vacinas contm agentes infecciosos incapazes de provocar a doena (a vacina incua), mas que induzem o sistema imunolgico da pessoa a produzir anticorpos, evitando a contrao da doena. Portanto, o soro curativo, enquanto a vacina , essencialmente, preventiva, ou seja, aps o contato com o agente causador seja ele na forma da vacina ou pela prpria contaminao com a doena, ser formada a chamada memria imunolgica, o corpo caso seja atacado pelo mesmo agente futuramente, saber quais anticorpos produzir para se proteger.

PROTENAS
Hormonal: Muitos hormnios so de natureza proteica, como por exemplo, a insulina. Nutritiva: Os aminocidos podem ser oxidados para a obteno de energia. A desnaturao pelo calor: ou seja, a deformao da molcula ocorre praticamente com todas as protenas. O corpo de um mamfero tem uma temperatura ao redor de 37C. Quando uma de suas enzimas colocada, por exemplo, a uma temperatura prxima de 50C ela desnatura, perde o seu arranjo espacial e sua funo biolgica.

(trecho retirado do informativo educativo da pgina do Instituto Butantan http://www.butantan.gov.br).

EXERCCIOS
1. A diferena entre os diversos aminocidos resulta: a) Do nmero de grupos COOH. b) Da substituio do grupo COOH por NH. c) Da substituio de um H de NH2 por OH2. d) Dos tomos ou grupo de tomos simbolizados por R. e) Do nmero de grupos NH2.

16

BIOLOGIA 1
2. Considerando-se a definio de enzimas, assinale a alternativa CORRETA: I. So catalisadores orgnicos, de natureza proteica, sensveis s variaes de temperatura. II. Substncias qumicas, de natureza lipdica, sendo sensveis s variaes de temperatura. III. Apresenta uma regio chamada rea ativa, a qual se adapta a molcula do substrato. So verdadeiras: a) I e III b) II somente c) III somente d) II, III e) I, II, III

PROTENAS
8. (UFAC) Assinale a alternativa correta de acordo com as preposies apresentadas: I. As molculas de protenas so formadas por uma sequncia de aminocidos II. Os carboidratos, os lipdeos e as protenas so os constituintes inorgnicos da clula III. A membrana plasmtica apresenta uma constituio lipoproteica. So VERDADEIRAS: a) Somente a I b) I e II c) Somente a II d) I e III e) Somente a III

3. Chama-se aminocido essencial ao aminocido que: a) S existe em determinados vegetais. b) sintetizado em qualquer organismo animal. c) No sintetizado no organismo humano. d) Tm funo semelhante das vitaminas. e) indispensvel para o metabolismo energtico. 4. So alimentos ricos em protena: a) Leite, soja e carne. b) Carne, caf e banana. c) Leite, mandioca e carne. d) Carne, banana e mandioca. e) Leite, ovo e farinha de milho. 5. Aps um longo tratamento mdico, em que o paciente perdeu muito peso, importante que a sua dieta seja enriquecida com carboidratos e protenas, para que ele possa voltar ao peso normal. Dentre as alternativas a seguir, aquela que relaciona alimentos ricos, respectivamente, em protenas e carboidratos : a) Carne e ovo b) Alface e po c) Mel e alface d) Carne e arroz e) Chocolate e suco de laranja 6. Uma pessoa excreta mais ureia quando come mais: a) Amido d) Gordura b) Protena e) Sacarose c) Glicose 7. Os fenilcetonricos tm falta de uma enzima do fgado responsvel pelo metabolismo do aminocido fenilalanina. Para que esta substncia no se acumule no sangue, sua dieta alimentar deve restringir, dentre os nutrientes mencionados a seguir: a) As protenas apenas b) Os carboidratos apenas c) As gorduras apenas d) As gorduras e os carboidratos e) As gorduras e as protenas

9. (UEM 2009) Com relao aos constituintes qumicos da matria orgnica, assinale o que for correto. (01) A unio entre dois aminocidos se d por uma reao de sntese por desidratao e as molculas resultantes so genericamente chamadas de peptdeos. (02) A vida na Terra baseia-se essencialmente no elemento hidrognio, tomo tetravalente, que constitui a estrutura bsica de todas as molculas orgnicas. (04) Na espcie humana, os ons de sdio (Na+) e de potssio (K+) so responsveis pelas alteraes eltricas na membrana plasmtica do neurnio durante o impulso nervoso. 08) Os seres humanos so capazes de produzir todos os vinte tipos de aminocidos necessrios para a composio das protenas. 10. (UEL 2010) Analise as armativas a seguir: I. As vacinas podem ser produzidas a partir de microorganismos atenuados ou mortos, toxinas neutralizadas, ou simplesmente utilizando componentes de cpsula, membrana ou parede bacterianas. II. A vacina inativada aquela em que o vrus encontra-se vivo, porm, sem capacidade de produzir a doena, e a vacina atenuada aquela que contm o vrus morto por agentes qumicos ou fsicos. III. Malria, tuberculose e ttano so doenas virais; caxumba, dengue e sarampo so doenas bacterianas, todas controladas por vacinao. IV. A imunizao um processo pelo qual se adquire imunidade ou proteo contra uma determinada doena infecciosa, seja aps adquirir a doena ou mediante a administrao de vacina. Assinale a alternativa CORRETA. a) Somente as armativas I e III so corretas. b) Somente as armativas I e IV so corretas. c) Somente as armativas II e IV so corretas. d) Somente as armativas I, II e III so corretas. e) Somente as armativas II, III e IV so corretas.

17

BIOLOGIA 1
11. De acordo com seus conhecimentos sobre protenas, responda: a) Qual a diferena entre aminocidos essenciais e naturais? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Cite 3 funes das protenas. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 12. O grfico a seguir relaciona o pH com a atividade da enzima tripsina (protease pancretica).

PROTENAS

Qual amostra corresponde ao cabelo? E a saliva? Indique qual contedo de cada uma das amostras permitiu a identificao do material analisado. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 14) (Adaptada UNICAMP 2010) Em famlias constitudas a partir da unio de primos em primeiro grau, mais alta a ocorrncia de distrbios genticos, em comparao com famlias formadas por casais que no tm consanguinidade. A fenilcetonria (FCU) um distrbio gentico que se deve a uma mutao no gene que expressa a enzima responsvel pelo metabolismo do aminocido fenilalanina. Na ausncia da enzima, a fenilalanina se acumula no organismo e pode afetar o desenvolvimento neurolgico da criana. Esse distrbio facilmente detectado no recmnascido pelo exame do pezinho. No caso de ser constatada a doena, a alimentao dessa criana deve ser controlada. Que tipos de alimento devem ser evitados: os ricos em carboidratos, lipdeos ou protenas? Justifique. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

a) Com qual valor de pH a atividade da tripsina mais alta? _________________________________________________ _________________________________________________ _________________________________________________ b) Com quais valores de pH a tripsina inativa? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 13. (Adaptada UNICAMP 2008) Para desvendar crimes, a polcia cientifica costuma coletar e analisar diversos resduos encontrados no local do crime. Na investigao de um assassinato, quatro amostras de resduos foram analisadas e apresentaram os componentes relacionados na tabela abaixo. Com base nos componentes identificados em cada amostra, os investigadores cientficos relacionaram uma das amostras, a cabelo, e as demais, a artrpode, planta e saliva.

18

CIDOS NUCLICOS I

UNIDADE 5 CIDOS NUCLICOS I


Na maioria dos organismos, as informaes genticas so armazenadas em molculas de DNA (cido desoxirribonuclico), um tipo de cido nuclico. Em alguns vrus, entretanto a informao hereditria carregada por outro cido nuclico, o RNA (cido ribonuclico). Os cidos nuclicos (DNA e RNA) so as molculas responsveis pelo armazenamento das informaes genticas e pelo controle dos processos vitais de todos os organismos vivos. So molculas gigantes constitudas de nucleotdeos. Cada nucleotdeo formado por 1 molcula de fosfato + 1 pentose (acar) + 1 base nitrogenada. Pentose Bases nitrogenadas Filamento de nucleotdeos

CIDO DESOXIRRIBONUCLICO (DNA)


desoxirribose Citosina, guanina, adenina e timina Duplo e complementares, presos um no outro pelas bases nitrogenadas, ligadas por pontes de hidrognio Ncleo (cromossomos e nuclolo), cloroplastos e mitocndrias.

CIDO RIBONUCLICO (RNA)


Ribose Citosina, guanina, adenina e uracila Simples

Localizao

Nuclolo, ribossomos, hialoplasma.

REPLICAO DO DNA
A replicao (tambm chamada de duplicao) do DNA controlada por vrias enzimas, que abrem a dupla hlice desenrolando e quebrando as pontes de hidrognio. A duplicao acontece em vrios pontos ao mesmo tempo e semiconservativa, ou seja, as molculas filhas tm uma hlice da molcula me e uma hlice nova, preservando o cdigo gentico. A unio dos nucleotdeos feita com a ao da enzima DNA Polimerase, obtendo assim duas molculas de DNA a partir de uma original. Durante o encaixe dos novos nucleotdeos, obrigatoriamente obedecido o emparelhamento A T e C G. Graas replicao do DNA, clulas podem se dividir e formar clulas-filhas com o mesmo material gentico. A replicao do DNA ocorre antes do incio da diviso celular, ou seja, durante um perodo de vida da clula conhecido como intrfase.

Figura 5.1: Representao esquemtica de um nucleotdeo.

ESTRUTURA DOS CIDOS NUCLICOS


Nos nucleotdeos do DNA, a pentose a desoxirribose, enquanto no RNA a ribose. Quanto s bases nitrogenadas, tanto o DNA quanto o RNA apresentam adenina, citosina e guanina. Somente o DNA, porm, contm timina, enquanto somente o RNA contm uracila.

Figura 5.3: Esquema da replicao do DNA. Cada dupla hlicefilha composta de uma fita velha e uma recm-sitetizada.

SNTESE DE RNA
Toda molcula de RNA formada durante a intrfase, tomado por molde uma cadeia de DNA. Esse processo conhecido como transcrio. Durante a transcrio, geralmente parte de uma molcula de DNA aberta (rompimento das pontes de hidrognio), e em seguida uma das fitas passa a servir de molde para que

Figura 5.2: Esquema dos nucleotdeos dos cidos nuclicos.

19

BIOLOGIA 1
ocorra o encaixe dos nucleotdeos livres de RNA. O processo semelhante ao que ocorre na replicao do DNA, mas no RNA a base nitrogenada complementar da adenina (A) a uracila (U) e no a timina (T). No final, a cadeia de RNA formada se desprende, enquanto as duas cadeias do DNA voltam a se unir, restabelecendo as pontes de hidrognio. A enzima necessria para que ocorra a transcrio chamada RNA polimerase.

CIDOS NUCLICOS I
3. (UEL 2001) Abaixo est representado o filamento I de uma molcula de cido nuclico presente no interior do ncleo de uma clula vegetal. Qual seria a sequncia correta encontrada na molcula de RNA, transcrita a partir do filamento II?

5.4: Na transcrio a enzima RNA polimerase comanda a formao da molcula de RNA a partir de um filamento de DNA (uma das cadeias de nucleotdeos). A sequncia de bases do RNA determinada pela sequncia de bases do DNA.

a) G-A-A-G-C-U b) G-U-U-G-C-A c) G-U-U-G-C-U d) C-U-U-C-G-A e) C-A-A-C-G-U 4. (UEL 2004) Em 2003 comemorou-se os 50 anos do modelo DNA, elaborado e proposto por Watson e Crick. Na poca, esses cientistas se basearam, principalmente, nas relaes entre as quantidades de bases nitrogenadas e o consequente emparelhamento especfico entre elas, estabelecendo o modelo de dupla hlice para o DNA. Analisando a molcula de DNA de uma clula animal, constatou-se que 30% de suas bases nitrogenadas eram constitudas por citosina. Relacionando esse valor com o emparelhamento especfico das bases, assinale a alternativa que apresenta os valores encontrados para as demais bases nitrogenadas. a) 20% de adenina, 40% de timina e 10% de guanina. b) 20% de adenina, 20% de timina e 30% de guanina. c) 30% de adenina, 20% de timina e 20% de guanina. d) 30% de adenina, 10% de timina e 30% de guanina. e) 40% de adenina, 10% de timina e 20% de guanina. 5. Uma cadeia de DNA apresenta a seguinte sequncia de bases numa certa regio de suas hlices: TAGCA. Este seguimento da cadeia poder produzir uma molcula de RNA com a seguinte sequncia: a) TAGCA ou AUCGU. b) AUCGU e UAGCU. c) TAGCA e ATCGT. d) AUCGU e UAGCA. e) TAGCA e ATCGT. 6. As estruturas citoplasmticas capazes de sintetizar suas prprias enzimas, por apresentarem DNA e RNA, so: a) Complexo de Golgi e lisossomos. b) Mitocndrias e cloroplastos. c) Mitocndrias e complexo de Golgi. d) Cloroplastos e complexo de Golgi. e) Mitocndrias e lisossomos.

TRANSCRIO REVERSA

Em 1970, os americanos Howard Martin Temin (19341994) e David Baltimore (1938-) descobriram que os vrus tumorais que contm RNA possuem uma enzima que catalisa a sntese de DNA a partir de um molde de RNA. A produo de DNA a partir de RNA chamada transcrio reversa, enquanto a enzima responsvel por isso denomina-se transcriptase reversa. Os vrus de RNA que possuem transcriptase reversa so conhecidos como retrovrus. Alm de alguns vrus tumorais, o HIV (vrus da imunodeficincia adquirida) tambm pertencem ao grupo dos retrovrus.

EXERCCIOS
1. A tabela mostra a composio das bases nitrogenadas pricas, adenina e guanina, nos DNAs do homem e do boi.

ADENINA GUANINA
Homem Boi 30,4% ? ? 21,0%

As porcentagens que esto faltando para o homem e para o boi so respectivamente: a) 19,6 e 29,0 d) 19,6 e 21,0 b) 21,0 e 30,4 e) 30,4 e 21,0 c) 29,0 e 30,4 2. DNA e RNA so encontrados em quantidades apreciveis, respectivamente: a) No ncleo; no citoplasma. b) No ncleo; no ncleo e no citoplasma. c) No ncleo; no ncleo. d) No ncleo e no citoplasma; no ncleo. e) No citoplasma e no ncleo; no citoplasma.

20

BIOLOGIA 1
7. (UEL 2011) Em 1953, James Watson e Francis Crick elucidaram a estrutura tridimensional da dupla hlice de DNA e postularam que o pareamento especfico de bases nitrogenadas sugere um possvel mecanismo de cpia para o material gentico. Baseado neste postulado, o processo de duplicao do DNA considerado como sendo semiconservativo porque: a) A dupla-hlice original permanece intacta e uma nova dupla-hlice formada. b) Os dois filamentos da dupla-hlice original se separam e cada um serve como molde para uma nova fita. c) Ambos os filamentos da dupla-hlice original se fragmentam e servem como moldes para sntese de novos fragmentos. d) Um dos filamentos da dupla-hlice original serve de cpia para as duas fitas de DNA. e) Os filamentos da dupla-hlice original permutam as suas fitas para servirem de cpias de DNA. 8. No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases devem existir nesse DNA e em quais propores? Justifique. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 9. Um determinado segmento da molcula de DNA apresenta a seguinte sequencia de bases: ACTCCGCTTAGG e TGAGGCGAATCC Qual poderia ser a sequncia de bases do RNA por ele produzido? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 10) Escreva a sequncia de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequncia: (5') ATGCCGTATGCATTGCATTC (3') _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

CIDOS NUCLICOS I
11. (UNICAMP 2007) Aps um surto de uma doena misteriosa (incio com febre, coriza, mal estar, dores abdominais, diarreia, manchas avermelhadas espalhadas pelo corpo) que acometeu crianas com at 5 anos de idade em uma creche, os pesquisadores da UNICAMP conseguiram sequenciar o material gentico do agente causador da doena e concluram que se tratava de um vrus. Um segmento dessa sequncia era UACCCGUUAAAG. a) Explique porque os pesquisadores concluram que o agente infeccioso era um vrus. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) D duas caractersticas que expliquem porque os vrus no so considerados seres vivos. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ c) Sabendo-se que a sequencia mostrada acima (UACCCGUUAAAG) dar origem a uma fita de DNA, escreva a sequencia dessa fita complementar. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 12. Cite as principais diferenas entre as molculas de DNA e RNA: _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

21

CIDOS NUCLICOS II

UNIDADE 6 CIDOS NUCLICOS II


Sabemos que tanto as caractersticas morfolgicas de um organismo como seu funcionamento dependem dos tipos de protenas que existem nesse organismo. E justamente controlando a fabricao dessas protenas (pela juno dos aminocidos naturais e essenciais) que o DNA controla todas as atividades da clula. O DNA possui informaes que esto contidas nos genes. Cada gene um trecho da molcula de DNA que atua como modelo para a fabricao de um RNA, o qual contm as informaes necessrias para a produo de uma protena. Assim, um gene uma poro da molcula de DNA capaz de codificar a sntese de uma protena. Temos ento a seguinte sequencia: A informao de um gene (DNA) transcrita para uma molcula de RNA e esta orienta a formao de uma protena. Esta protena determinar, sozinha ou juntamente com outras protenas, uma caracterstica do indivduo. Gene (DNA) RNA Protena Caracterstica do organismo

ses livres (anticdon), que iro parear com o primeiro segmento de 3 bases de RNAm (cdon). 5 O ribossomo se desloca sobre o RNAm, abrangendo as 3 bases seguintes: entra novo RNAt, trazendo outro aminocido. Os dois aminocidos se ligam atravs de ligao peptdica. Solta-se o primeiro RNAt. 6 Cada vez que o ribossomo se desloca sobre o RNAm abrangendo novo grupo de 3 bases, entra novo aminocido, construindo-se assim a cadeia polipeptdica. O conjunto de processos que ocorre ao nvel dos ribossomos chamado traduo. Resumo

PRINCIPAIS TIPOS DE RNA


H 3 tipos de RNA, todos fabricados no ncleo, a partir de dadas sequncias do DNA.

RNA Mensageiro (RNAM)


Leva o cdigo gentico (presente no DNA) da sequncia de aminocidos da protena at o ribossomo, no citoplasma.

RNA Transportador RNA Ribossmico (RNAT) (RNAR)


Locomove-se do ncleo para o citoplasma Locomove-se do ncleo para transportar os para o citoplasma aminocidos at o a fim de formar o ribossomo para formar ribossomo. a protena na sequncia trazida pelo RNAm.

SNTESE DE PROTENA
O processo de sntese de uma cadeia poli-peptdica consiste em unir aminocidos de acordo com a sequncia de cdons do RNAm. Como essa sequncia determinada pelas bases do DNA (gene) que serviu de molde ao RNAm, a sntese de protena representa, portanto, a traduo da informao do gene, sendo por isso chamada de traduo gnica. Principais eventos da sntese proteica: 1 Uma poro de DNA que corresponde a um gene fabrica uma molcula de RNAm. Este processo dito transcrio. 2 O RNAm com sua sequncia transcrita do DNA, sai do ncleo e permanece no citoplasma. 3 Molculas de RNAt, tambm feitas no ncleo, difundem-se no citoplasma, onde se ligam cada uma a um determinado aminocido. Lembre-se de que o RNAt tem sequncia de 3 bases que lhe confere a especificidade. A esta sequncia chamamos anticdon. 4 Um ribossomo se liga a uma extremidade do RNAm, abrangendo dois segmentos com 3 bases cada. Esta sequncia de 3 bases do RNAm chamamos de cdon. A se prender um determinado RNAt (ligado ao seu aminocido) pelas suas 3 ba-

Figura 6.1: Em um gene, a sequncia de bases de uma das cadeias do DNA transcrita na forma de uma molcula de RNAm, que, por sua vez, ser traduzida em uma cadeia polipeptdica. Cada trinca de bases no RNAm (cdon) corresponde a um aminocido na protena. As abreviaturas indicam os aminocido: triptofano (Trp), fenilalanina (Phe), glicina (Gly) e serina (Ser). (Baseado em Campbell, N. e cols., 1999).

Figura 6.2: Representao esquemtica do incio da sntese de uma protena. O ribossomo est associado ao RNAm, e o primeiro RNAt, transportando metionina, ocupa o sitio P. o segundo RNAt, transportando fenilalanina, vai ocupar o stio A e os dois aminocidos iro se unir pela ligao peptdica. O ribossomo deslocar, ento, uma trinca sobre o RNAm e o processo se repetir. (Adaptado de AMABIS, J.M & MARTHO
G.R. Fundamentos de Biologia Moderna. 4. ed. So Paulo: Moderna, 2006).

22

BIOLOGIA 1

CIDOS NUCLICOS II
Sobre a protena fluorescente GFP, composta por 238 aminocidos, foram feitas as seguintes afirmaes: I. O RNA mensageiro da GFP contm 238 cdons com sentido e pelo menos um cdon sem sentido, que sinaliza o sinal PARE na sntese proteica. II. A regio do DNA que codifica os 238 aminocidos composta por 714 nucleotdeos. III. A insero de um par de bases na regio de cdigo do gene GFP uma mutao que altera o quadro de leitura na traduo dessa protena. Est CORRETO o que se afirma em: a) I, somente. d) II e III, somente. b) I e II, somente. e) I, II e III. c) II, somente. 4. (UFMS) Os nossos feijes esto cada vez mais nutritivos e fornecem boas doses de protenas e minerais. A novidade o desenvolvimento por pesquisadores de variedades com alta biodisponibilidade de seus aminocidos, ou seja, a capacidade que estes tm de ser mais bem aproveitados pelo organismo humano [Fonte: Revista Sade, junho 2008]. Na figura abaixo, est representada parte de uma protena qualquer com seus cdons correspondentes. A sequncia de DNA complementar do DNA molde que deu origem a essa protena :

EXERCCIOS
1. O quadro abaixo contm um segmento de DNA, os cdons e os anticdons correspondentes.

Para preench-lo corretamente os algarismos I, II, III e IV devem ser substitudos, por: a) GAC, TAA, AGT e CTG d) GTC, AUU, UCA e GUC b) GTC, ATT, TCA e GUC e) CTG, ATT, TCA e CUG c) CTG, AUU, UCA e CUG. 2. (UEL 2011) Em uma populao, foi identificado um indivduo que possui resistncia gentica a um vrus que provoca uma importante doena. Em um estudo comparativo, verificou-se que esse indivduo produz uma protena que confere tal resistncia, com a seguinte sequncia de aminocidos: serina-tirosinacistena-valina-arginina. A partir da tabela de cdigo gentico, a seguir:

Considerando que o RNA mensageiro deste gene contm: 46,7% de uracila; 33,3% de guanina; 20% de adenina e 0% de citosina, assinale a alternativa que apresenta a sequncia CORRETA de bases da fitamolde deste gene. a) TCA - ATA - ACA - CAA - TCC b) TCA - ATA - ACG - CAT - TCC c) TCA - ATG - ACA - CAT - TGG d) AGU - UAU - UGU - GUU - AGG e) AGC - UAC - UGC -CAA- CGA 3. (PUC CAMPINAS) Para responder esta questo considere o texto abaixo. TRIO VENCE NOBEL DE QUMICA POR PROTENA BRILHANTE Dois norte-americanos e um japons venceram o prmio Nobel de Qumica de 2008 pela descoberta de uma protena brilhante de guas-vivas, como a de Aequorea victoria. Essa protena se tornou uma das ferramentas mais usadas na biocincia moderna, pois com sua ajuda, os pesquisadores desenvolveram maneiras de observar processos outrora invisveis, como o desenvolvimento de clulas nervosas no crebro ou como as clulas cancergenas se espalham. O forte tom de verde da protena da gua-viva aparece sob as luzes azul e ultravioleta, o que permite que os pesquisadores iluminem tumores cancergenos em crescimento e mostrem o desenvolvimento do mal de Alzheimer no crebro ou o crescimento de bactrias nocivas.
(http://www.estadao.com.br/vidae/not_vid256033,0.htm, acessado em 08/10/2008).

a) AUGGCCUUGGAGGGCUCGUGG. b) UACCGGAACCUCCCGAGCACC. c) TACCGGAACCTCCCGAGCACC. d) ACCAGCCCGCTCAACCGGTAC. e) ATGGCTTTAGAAGGCTCATGG. 5. (UFPI) No desenho abaixo aparece o aparato principal do processo de traduo. Analise as informaes e marque a alternativa correta.

23

BIOLOGIA 1
a) O cdigo gentico consiste de trincas de nucleotdeos chamadas de anticdons. b) O cdon AUG do tRNA indica o incio da traduo. c) Os aminocidos so transportados pelo mRNA e ligados em uma ordem especfica no tRNA. d) O tRNA possui um cdon complementar ao cdon do mRNA. e) Os aminocidos so ligados quimicamente pela ligao peptdica que acontece nos ribossomos.

CIDOS NUCLICOS II

6. (PUC MG) O esquema abaixo representa processos e componentes celulares envolvidos na expresso gnica, ou seja, transcrio e traduo.

a) Que resultado a anlise mostrou em relao paternidade do Filho 1? E do Filho 2? Justifique. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Num teste de paternidade, poderia ser utilizado apenas o DNA mitocondrial? Por qu? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Qual o papel do RNA mensageiro e do RNA transportador na sntese de protenas? _________________________________________________ _________________________________________________

Assinale a alternativa INCORRETA. a) O nuclolo uma regio nuclear densa devido s altas concentraes de cidos ribonucleicos produzidos por transcrio. b) As tradues dependem de transcries, mas as transcries no dependem de tradues. c) Diferentes RNAt so produzidos no ncleo celular, mas cada um deles s pode carregar um aminocido especfico. d) Uma molcula de RNAm pode ser utilizada para a sntese de vrias molculas de uma protena.

7. (UNICAMP 2009) Testes de paternidade comparando o DNA presente em amostras biolgicas so cada vez mais comuns e so considerados praticamente infalveis, j que apresentam 99,99% de acerto. Nesses testes podem ser comparados fragmentos do DNA do pai e da me com o do filho. Um teste de DNA foi solicitado por uma mulher que queria confirmar a paternidade dos filhos. Ela levou ao laboratrio amostras de cabelos dela, do marido, dos dois filhos e de um outro homem que poderia ser o pai. Os resultados obtidos esto mostrados na figura abaixo.

_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 9. Sabendo que o cdon de RNAm CAU, conclumos que: o anticdon do RNAt correspondente a este cdon o ______________. a sequncia de bases do DNA responsvel por este cdon ______________.

24

GABARITOS

GABARITOS
UNIDADE 1
1. a) 3 b) 4 c) 1 d) 2 2. e 6. a 3. d 7. d 4. b 8. c 5. c 9. e

precursor para a biossntese de vrios hormnios (cortisol, aldosterona, testosterona, progesterona etc). b) Animais: tecido adiposo. Vegetais: sementes e frutos. 8. a) O colesterol participa da formao da membrana plasmtica das clulas e atua como precursor de hormnios sexuais. b) O colesterol pode ter origem exgena, quando ingerido com alimentos como o ovo e o leita, e endgena, quando fabricado pelo fgado.

10. Dieta pobre em ferro = anemia Dieta pobre em clcio = problemas sseos 11. A transpirao o principal mecanismo de perda de calor do corpo humano, sendo este o mecanismo primordial de regulao da temperatura do corpo. A evaporao do suor permite o resfriamento do corpo, possibilitando que a superfcie do corpo (e da a temperatura interna) possa alcanar temperaturas menores do que a ambiente, dissipando o calor gerado pelo prprio metabolismo corporal e garantindo manuteno da temperatura corporal interna em torno de 36C.

UNIDADE 4
1. d 4. a 6. b 2. a 5. d 7. a 8. d 10. b 3. c

UNIDADE 2
1. a 4. e 2. d 5. b 3. b 6. c

9. 05 (01, 04)

7. 03 (01, 02) 8. a) Polissacardeo reserva animal = glicognio Polissacardeo reserva vegetal = amido b) Fgado no animal; parnquima de reserva no vegetal. 9. a) O que permite caracterizar essas duas substncias como glicdios a presena de tomos de carbono, hidrognio e oxignio. Por isso tambm so chamados de carboidratos. b) O monossacardeo o C7H14O7 cuja frmula qumica representada por Cn(H2O)n. c) O monossacardeo que deu origem ao dissacardeo C6H10O5 foi o C3H6O3.

11. a) Aminocidos naturais = tambm chamados de aminocidos no essenciais, so produzidos pelo prprio organismo. Aminocidos essenciais = so os aminocidos que os animais no conseguem produzir, mas so obrigatrios na fabricao das protenas, portanto devem ser retirados dos alimentos. b) As protenas so os compostos orgnicos com maior nmero de funes nos seres vivos. A versatilidade funcional das protenas deve-se ao grande nmero de estruturas diferentes que elas podem possuir. Algumas dessas funes so: estrutural, hormonal, receptora, transportadora, contrtil, armazenadora, toxina, protetora e enzimtica. 12. a) A maioria da reaes catalisadas por enzimas dependem do pH do meio em que elas acontecem. Cada enzima tem um pH timo, na qual a sua atividade mxima, no caso da tripsina o valor de pH = 8. b) A atividade enzimtica decresce quando a soluo fica mais cida ou mais bsica do que seu pH timo, assim os valores em que a tripsina se torna inativa, segundo o grfico, seria pH = 6 e pH = 12. 13. Amostra 1: Planta clorofila Amostra 2: Saliva ptialina Amostra 3: Artrpode quitina Amostra 4: Cabelo queratina 14. Todos os alimentos para os fenilcetonricos devem conter uma baixa concentrao de fenilalanina para garantir a sade do paciente. Portanto, alimentos de origem proteica devem ser evitados, visto que a fenilalanina um aminocido essencial.

UNIDADE 3
1. b 4. d 2. b 5. d 3. c 6. d

7. a) Os esteroides so amplamente distribudos nos organismos vivos e incluem os hormnios sexuais, a vitamina D e os esteris, tais como o colesterol. O colesterol faz parte da estrutura das membranas celulares, sendo tambm um

25

BIOLOGIA 1

GABARITOS

UNIDADE 5
1. a 5. d 2. b 6. b 3. d 7. b 4. b

UNIDADE 6
1. c 4. e 2. a 5. e 3. e 6. b

8. Guanina = 18%, Adenina = 32% Timina = 32%, as bases nitrogenadas ocorrem nessa proporo porque h pareamento especfico de guanina-citosina e adeninatimina, assim os valores de cada par de bases nitrogenadas devem ser iguais. 9. Poderia ser as sequncias: UGAGGCGAAUCC ou ACUCCGCUUAGG 10. (3)TACGGCATACGTAACGTAAG(5) 11. a) Os pesquisadores conseguiram concluir que o agente infeccioso era um vrus, pela presena da base nitrogenada uracila no material gentico. Os vrus so seres muito simples e pequenos (medem menos de 0,2 m), formados basicamente por uma cpsula proteica envolvendo o material gentico, que, dependendo do tipo de vrus, pode ser o DNA, RNA ou os dois juntos (citomegalovrus). b) Os vrus no so considerados seres vivos porque no possuem caractersticas como a habilidade de importar nutrientes e energia do ambiente, no tem metabolismo prprio, so parasitas intracelulares obrigatrios. c) UACCCGUUAAAG (RNA) ATGGGCAATTTC (fita de DNA) TACCCGTTAAAG (fita complementar)

7. a) O resultado mostrou que o Filho 1 filho biolgico do outro homem porque apresenta duas bandas (segmentos de DNA) tambm encontradas nesse homem, enquanto as outras duas se referem a segmentos de DNA herdados da me. O Filho 2 filho do marido, j que as bandas referentes a esse filho so encontradas tanto no resultado referente me quanto naquele correspondente ao marido. b) No, porque o DNA mitocondrial tem informaes s do genoma materno, proveniente das mitocndrias do gameta materno (vulo). No seria possvel, portanto, detectar os fragmentos de DNA mitocondrial de origem paterna. 8. O RNA mensageiro est envolvido com a transferncia de informaes genticas do DNA ao local onde ocorrer a sntese de protenas, os ribossomos. J o RNA transportador consiste em uma molcula dobrada sobre si mesma, responsvel pelo de aminocidos ate os ribossomos para que ocorra a sntese proteica. Sua aparncia semelhante a uma folha de trevo. 9. O anticdon do RNAt correspondente a este cdon o GUA. A sequncia de bases do DNA responsvel por este cdon GTA.

12.

26

BIOLOGIA 2
29 Vrus, um caso a parte ............................. 29 Categorias taxonmicas ............................... 29 Conceito moderno de espcie.................. 29 Regras de nomenclatura dos animais ........ 30 Sistema de classificao natural e artificial ....................................... 30 Exerccios .................................................... 30

01

CLASSIFICAO DOS SERES VIVOS

pg

36 Platelmintos ................................................. 36 Classe Turbellaria ........................................ 36 Exerccios .................................................... 37

04

FILO PLATHELMINTHES

pg

31 Organizao do corpo ................................. 32 Exerccios .................................................... 32

02 03

FILO PORIFERA

pg

38 Classe Trematoda ...................................... 38 Classe Cestoda .............................................. 39 Exerccios .................................................... 40

05

PARASITOSES CAUSADAS POR PLATYHELMINTES

pg

33 Classe Hidrozoa ........................................... 34 Classe Scyphozoa ........................................ 34 Classe Anthozoa .......................................... 34 Exerccios .................................................... 35

FILO CNIDRIA

pg

41 Exerccios .................................................... 42 Gabaritos ...................................................... 42

06

FILO NEMATODA

pg

CLASSIFICAO DOS SERES VIVOS

UNIDADE 1 CLASSIFICAO DOS SERES VIVOS


Desde o tempo de Aristteles os seres vivos foram agrupados e classificados na tentativa de melhor compreender a natureza: seres com sangue ou sem sangue; aquticos, voadores ou terrestres; presena de corpo mole ou de corpo duro; estes foram alguns critrios utilizados nas classificaes dos seres vivos. Por muitos sculos a natureza foi dividida nos reinos Animal e Vegetal apenas. Com o desenvolvimento da Biologia, notadamente no campo da evoluo biolgica, e principalmente em decorrncia dos avanos dos estudos microscpicos, percebeu-se que havia em nosso mundo mais do que aquilo que o olho era capaz de perceber e que a diversidade de organismos em nosso planeta devia-se a processos biolgicos. Novos critrios de classificao que extrapolavam as simples observaes surgiram: tipos celulares, similaridades em molculas como protenas, hormnios e DNA so alguns exemplos. Os bilogos passaram a adotar a filogenia (histria evolutiva) como norteadora das classificaes biolgicas. Existem muitas formas de dividir o mundo vivo. De tempos em tempos novas divises aparecem, pois os estudos prosseguem e novas informaes surgem. Adotaremos uma das muitas divises existentes em que os seres vivos agrupam-se em cinco reinos: Monera, Protista, Fungi, Plantae e Animalia. Mas podemos encontrar divises de seis at sete reinos, nesses casos vrus e algas constituiriam um reino a parte.

REINO ANIMALIA

O reino Animalia rene os animais, seres eucariontes, multicelulares e hetertrofos. Os animais apresentam clulas bem diferenciadas, que formam tecidos e rgos corporais distintos. Esse reino inclui desde animais simples, como as esponjas, at animais complexos, como os mamferos, grupo ao qual pertencemos.

VRUS, UM CASO A PARTE


Os vrus no so includos em nenhum dos cinco reinos. No apresentam clulas, sendo constitudos por uma ou poucas molculas de cido nuclico, que pode ser DNA ou RNA, envoltas por molculas de protenas.

CATEGORIAS TAXONMICAS
A descrio de todos os seres vivos (vegetais e animais) e suas classificaes dentro das diversas categorias constituem partes da Biologia que se chamam Taxonomia (ramo que se ocupa de nomenclaturas e identificaes) e Sistemtica (estudo da filogenia dos organismos), que trabalham em conjunto. A filogenia traa a relao de parentesco evolutivo entre os grupos de seres vivos. Os seres vivos so includos nas seguintes categorias de classificao: Reinos Filos Classes Ordens Famlias Gneros Espcies Os reinos ocupam a categoria taxonmica (ou txon) mais abrangente e espcies a mais detalhada. Seres do mesmo gnero obrigatoriamente pertencem mesma famlia, mesma ordem e assim por diante. Por outro lado, seres de classes diferentes jamais podero ser enquadrados numa mesma ordem ou famlia. Ex: o cavalo (Equus caballus) pertence ao gnero Equus, juntamente com o asno (E. asinus) e a zebra (E. zebra). O gnero Equus faz parte da famlia Equidae. Essa famlia mais a famlia Tapiridae (das antas) e Rhinocerotidae (dos rinocerontes) fazem parte da ordem Perissodactyla. Essa ordem mais a ordem Artiodactyla (girafas, porcos, hipoptamos etc) fazem parte da classe Mammalia (mamferos). Os mamferos fazem parte do filo Chordata, juntamente com os peixes, anfbios, aves etc. Todos os animais fazem parte do reino Animalia.

REINO MONERA

O reino Monera rene seres vivos unicelulares e procariontes: as bactrias e as cianobactrias, estas ltimas tambm chamadas de cianofceas. No reino Protista esto includos os protozorios, seres eucariontes, unicelulares e hetertrofos, e as algas, seres eucariontes, unicelulares ou multicelulares, e auttrofos fotossintetizantes. As algas multicelulares so includas nesse reino porque tm organizao simples, com pouca ou nenhuma diferenciao entre as clulas que formam seu corpo.

REINO PROTISTA

REINO FUNGI

O reino Fungi inclui seres eucariontes, unicelulares ou pluricelulares, que se assemelham s algas na organizao e na reproduo, mas que diferem delas por serem hetertrofos. Em alguns sistemas de classificao os fungos so includos entre os protistas. A tendncia moderna, porm, classific-los em um reino separado.

REINO PLANTAE

O reino Plantae rene as plantas, seres eucariontes, multicelulares e auttrofos fotossintetizantes. As plantas tm clulas diferenciadas, que formam tecidos corporais bem definidos. Musgos, samambaias, pinheiros e plantas frutferas so os principais grupos que compem o reino Plantae ou Vegetal.

CONCEITO MODERNO DE ESPCIE


Espcie a categoria taxonmica bsica do sistema de classificao biolgica. Atualmente define-se espcie (do latim species, tipo) como o conjunto de seres semelhantes, capazes de se cruzar em condies naturais, deixando descendentes frteis. A ressalva em condies naturais importante, pois

29

BIOLOGIA 2
existem espcies cujos membros podem se cruzar e produzir descendentes frteis em condies artificiais de cativeiro, nunca se cruzando, porm, em condies naturais. Espcies semelhantes so reunidas em categorias taxonmicas maiores, os gneros. Gneros com caractersticas semelhantes so agrupados em categorias maiores, as famlias. Estas, por sua vez, so agrupadas em categorias ainda mais abrangentes, as ordens. Ordens so reunidas em classes, classes so reunidas em filos, e filos so reunidos em reinos. Alguns autores costumam chamar os filos vegetais de divises.

CLASSIFICAO DOS SERES VIVOS

EXERCCIOS
1. Assinale abaixo a sequncia que apresenta a ordem decrescente correta das categorias taxonmicas: a) Reino-filo-classe-ordem-gnero-famlia-espcie. b) Reino-famlia-filo-ordem-classe-gnero-espcie. c) Reino-ordem-filo-classe-famlia-gnero-espcie. d) Reino-filo-ordem-classe-famlia-gnero-espcie. e) Reino-filo-classe-ordem-famlia-gnero-espcie. 2. correto afirmar que dois animais que fazem parte da mesma ordem obrigatoriamente pertencero ______, e dois animais pertencentes _______ sempre tero maior semelhana entre si. a) mesma classe mesma espcie b) mesma famlia ao mesmo gnero c) Ao mesmo gnero mesma famlia d) Ao mesmo gnero mesma espcie e) mesma espcie mesma classe 3. Um pesquisador estudou uma clula ao microscpio eletrnico, verificando a ausncia de ncleo e de compartimentos membranosos. Com base nessas observaes, ele concluiu que a clula pertence a: a) Uma bactria b) Uma planta c) Um animal d) Um fungo e) Um vrus 4. Um organismo eucaritico, multicelular, autotrfico, pode pertencer ao grupo: a) Dos fungos b) Das bactrias c) Dos moluscos d) Dos ciliados e) Da soja e dos feijes 5. Diagramas que mostram as relaes de parentesco evolutivo entre os seres vivos so chamados: a) rvores filogenticas b) rvores genealgicas c) rvores taxonmicas d) Diagramas sistemticos e) n.d.a. 6. Com base nas regras de nomenclatura, indique a alternativa incorreta: a) Homo sapiens b) Trypanossoma Cruzi c) Rana esculenta marmorata d) Rhea americana americana e) Anopheles Nyssurhynchus darlingi

REGRAS DE NOMENCLATURA DOS ANIMAIS


At o sculo XVIII, os nomes dos animais eram muito complicados. Neste sculo, o botnico sueco Carl Line, ou simplesmente Lineu, estabeleceu uma srie de regras para dar nome aos animais, que foram depois oficializadas e so utilizadas at hoje. Existem no total nove regras bsicas de nomenclatura. As principais so: 1 regra: o nome dos animais deve ser escrito em latim, sendo obrigatrio dois nomes no mnimo (Binomial). O primeiro o do gnero e o segundo o do epteto de espcie. Os dois nomes em conjunto foram o nome da espcie. Ex: Pulex irritans (pulga). 2 regra: o nome do gnero deve ser escrito sempre com a inicial maiscula. Ex: Pulex. 3 regra: o nome da espcie deve ser escrito com a inicial minscula. Quando nome de pessoa, o emprego da inicial maiscula ou minscula indiferente. Homo sapiens, Trypanosoma cruzi (Cruzi). 4 regra: quando existem subespcies, o seu nome deve ser escrito depois da espcie com inicial minscula, mesmo que seja nome de pessoa. Rhea americana darwing. (Trinomial). 5 regra: o nome cientfico sempre deve estar em destaque no texto, preferencialmente em itlico ou sublinhado.

SISTEMA DE CLASSIFICAO NATURAL E ARTIFICIAL


Sabemos que classificar os seres vivos consiste em reuni-los em grupos, de acordo com caractersticas comuns. As primeiras classificaes baseavam-se puramente na observao. Logo, os animais podiam ser classificados conforme o meio de locomoo em: voadores, saltadores, nadadores, etc. Percebese imediatamente a falta de consistncia destas classificaes: assim, no mesmo grupo, podem ser classificados animais completamente diferentes como um inseto e uma ave, entre os voadores; uma pulga e um canguru, entre os saltadores, etc. Tais classificaes, chamadas artificiais, esto hoje abandonadas. Hoje usamos as classificaes naturais, baseadas na evoluo, observao e experimentao, utilizando com menor relevncia dados morfolgicos, fisiolgicos e comportamentais.

30

BIOLOGIA 2
7. Explique porque alguns autores no consideram os vrus como sendo seres vivos. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Qual a diferena fundamental entre os seres do Reino Monera com os demais quatro reinos da natureza? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

FILO PORIFERA
A sustentao garantida pela presena de um mesnquima gelatinoso (meso-hilo), interno camada de pinaccitos. No mesnquima esto mergulhadas espculas de calcrio ou silcio, e clulas indiferenciadas ou amebcitos. Os amebcitos so clulas mveis que participam da digesto, alm de desempenharem funo de transporte de alimentos ou diferenciao em gametas. Sustentao: o principal carter para a classificao das esponjas. interno, situando-se entre as duas camadas celulares. Pode ser mineral e/ou orgnico. Esqueleto mineral: constitudo por espculas calcrias e silicosas. Esqueleto orgnico: constitudo por uma rede de fibras de espongina (uma protena). A esponja de banho feita com esponjas apenas o esqueleto orgnico destes animais. Sistema digestivo: ausente e a digesto exclusivamente intracelular, realizada pelos coancitos e amebcitos. Sistema excretor: ausente. As clulas eliminam por difuso seus catablitos diretamente para o meio externo. Sistema respiratrio: no existe, a respirao aerbia, e cada clula realiza diretamente com o meio as trocas gasosas. Sistema circulatrio: tambm ausente. Amebcitos (clulas que possuem movimento amebide) no mesnquima realizam as funes desse sistema. Podem ser divididos em: Escleroblastos: clulas que secretam as espculas minerais. Cada eixo de espcula formado por um escleroblasto. Arquecitos: amebcitos que realizam vrias funes: recebem, digerem e fazem circular o alimento, alm de formar elementos reprodutivos: espermatozides, vulos e gmulas. Sistema nervoso: no existe. Sistema reprodutor: as esponjas reproduzem-se sexuadamente e/ou assexuadamente, sendo a maioria hermafrodita ou monica (algumas espcies possuem sexos separados). As estruturas de reproduo so temporrias, elaboradas a custa de clulas da camada mdia. A reproduo pode ser: Assexuada: feita por regenerao, brotamento ou gemulao. Nas esponjas, a capacidade de regenerao muito grande, a ponto de ser usada para a fabricao comercial de esponjas de banho. O brotamento consiste na formao de expanses no corpo da esponja (broto), que originaro novos indivduos. A gemulao ocorre em pocas em que o ambiente desfavorvel. Formam-se estruturas denominadas gmulas, que se constituem de uma parede que envolve um grupo de amebcitos. A parede formada por espculas especiais denominadas anfidiscos. Em ambiente propcio, a gmula forma uma nova esponja. Sexuada: ocorre com fecundao interna e desenvolvimento indireto. Quando falamos em desenvolvimento indireto, isto implica a existncia de uma forma intermediria entre o ovo e o adulto que se denomina larva. Nas esponjas, a larva se chama anfiblstula.

UNIDADE 2 FILO PORIFERA


O filo porifera rene animais conhecidos como porferos ou esponjas.Essas denominaes devem-se a uma das principais caractersticas do grupo:apresentar o corpo perfurado por inmeros poros microscpicos. Suas clulas formam agregados frouxos, no constituindo tecidos verdadeiros, rgos diferenciados e cavidade digestiva, alm de a digesto ocorrer apenas dentro das clulas. Por essa razo foram por muito tempo considerados como pertencentes ao sub-reino Parazoa. Os porferos so animais aquticos, predominantemente marinhos. Vivem nos mares, em qualquer profundidade, fixados em rochas ou no solo submarino. Por essa razo so denominados ssseis.

CARACTERSTICAS GERAIS:

Possuem corpo assimtrico ou com simetria radial. Seu corpo apresenta forma de vaso,com uma cavidade interna denominada espongiocele, e uma abertura no na superfcie sculo. O revestimento externo se faz pela epiderme constituda por uma camada de clulas achatadas, os pinaccitos. A espongiocele revestida por coancitos: clulas com flagelos envoltos por uma formao membranosa, cujos batimentos criam corrente de gua, que entra pelos poros e sai pelo sculo (abertura superior). Os coancitos fagocitam as partculas alimentares trazidas pelas correntes de gua.

31

BIOLOGIA 2

FILO PORIFERA
2. (UFPR) Invertebrados fixos, diploblsticos com mesoglia, sem rgos, com digesto exclusivamente intracelular, com larva ciliada livre-nadante. Trata-se de: a) Protozorios b) Espongirios c) Equinodermos d) Nematelmintos e) Celenterados 3. (UFPR) Relacione as colunas e assinale a alternativa correta: (1) Coancitos (2) trio (3) Mesnquima (4) Cnidoblastos (5) Amebcitos

Organizao celular das esponjas. Note-se que alm das clulas j descritas, existem clulas especiais e perfuradas de modo a deixarem fluir gua atravs de si. So os porcitos, que so clulas tubulosas, percorridas por uma perfurao cnica.

( ( ( ( (

) Cavidade central das esponjas. ) Clulas de defesa dos celenterados. ) Mesoglia, abaixo da epiderme. ) Digesto intracelular dos porferos. ) Clulas com diversas funes nas esponjas. a) 2 4 5 1 3 b) 5 3 2 1 4 c) 5 2 3 1 4 d) 2 4 3 5 1 e) 2 4 3 1 5

ORGANIZAO DO CORPO
O corpo das esponjas apresenta-se organizado em trs graus de complexidade crescente: scon, scon e lucon. Observe os esquemas seguintes e note o aumento da superfcie revestida de coancitos (superfcie negra) em contato com a gua. Quando a gua penetra numa esponja do tipo leuconide, percorre inmeras cmaras revestidas de coancitos, demorando mais para abandonar o corpo do animal, o que lhe permite maior assimilao dos nutrientes ambientais, se o compararmos com os outros dois tipos.

4. Sobre os porferos qual das afirmativas abaixo VERDADEIRA? a) So organismos invertebrados que possuem corpo com simetria bilateral e superfcie porosa. b) So organismos invertebrados, com corpo sustentado somente por fibras de espongina, que possuem coancitos como tipo celular caracterstico. Vivem principalmente em ambiente marinho. c) So organismos conhecidos popularmente como esponjas, que possuem vida aqutica, principalmente no mar, e se reproduzem exclusivamente de forma sexuada. d) So organismos conhecidos popularmente como esponjas, que possuem vida aqutica, principalmente em gua doce, e vivem fixados a um substrato. e) So organismos invertebrados, com corpo sustentado por espculas ou fibras que possuem coancitos como tipo celular caracterstico e vivem principalmente em ambiente marinho. 5 . (UFPI) Indique as caractersticas que tornam os organismos do filo Porifera bem diferentes daqueles de outros filos animais: a) No podem se reproduzir. b) As formas adultas so ssseis. c) No respondem a estmulos externos. d) Alimentam-se atravs de mecanismos de filtrao. e) Suas clulas no so organizadas em tecidos.

Organizao do corpo das esponjas (A) scon, (B) scon, (C) lucon)

EXERCCIOS
1. (UFV-MG) O principal papel dos coancitos nos porferos : a) Transportar as substncias para todo o animal. b) Originar elementos reprodutivos. c) Formar o esqueleto do animal. d) Provocar a circulao da gua no animal. e) Dar origem a outros tipos de clulas.

32

BIOLOGIA 2
6. (FURG/2008) Assinale a alternativa que apresenta a funo dos tipos celulares de Porfera. a) A digesto do alimento realizada pelos coancitos, e os nutrientes so distribudos pelos pinaccitos. b) Os coancitos so responsveis pela fagocitose das partculas alimentares. c) Os amebcitos so responsveis somente pela produo das espculas. d) Os porcitos so as clulas que circundam a abertura do sculo, por onde entra a gua para a espongiocele. e) Os pinaccitos formam o tecido presente entre a parede externa do corpo e a parede da espongiocele. 7. Explique o mecanismo e as finalidades da circulao de gua na estrutura do corpo de um porfero. De que constituda a sustentao do corpo dos porferos? Cite algumas funes atribudas aos amebcitos. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Explique o processo de nutrio de um porfero. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

FILO CNIDRIA
So conhecidos como guas-vivas e anmonas-do-mar, representando as duas formas corpreas distintas dos cnidrios: medusa e plipo, respectivamente. Os corais tm a forma polipide, assim como as anmonas. Os plipos vivem no fundo dgua. So fixos ou movimentam-se lentamente. As medusas so flutuantes e muito mveis. Praticamente todos so urticantes (queimam a pele quando algum se encosta nos tentculos).

Representao esquemtica das suas formas de vida dos cnidrios

CARACTERSTICAS GERAIS:

Os cnidrios so animais diblsticos de simetria radial. Na estrutura da parede do corpo de um celenterado, observamos trs camadas de fora para dentro: A epiderme, a mesoglia e a gastroderme. Nelas, encontram-se clulas de diversos tipos. A mesoglia, no entanto, no possui clulas. uma fina lmina de substncia gelatinosa. Atravs dela, ramificaes de clulas nervosas fazem a comunicao entre as clulas sensitivas da epiderme e as clulas epitlio-musculares, cujas contraes do movimentos ao corpo do animal. As clulas mais notveis na estrutura de um cnidrio so os cnidcitos ou cnidoblastos. Eles so clulas especializadas para a defesa, contendo uma pequena cpsula (nematocisto) capaz de projetar para fora um estilete canaliculado como agulha de injeo e inocular, na pele do animal que lhe tocar, uma substncia paralisante ou irritante. Isso justifica as queimaduras sofridas por alguns banhistas durante o banho de mar.

UNIDADE 3 FILO CNIDRIA


Cnidaria, do grego: knide (urtiga, urticante). Os animais dotados de tecidos organizados so chamados histozorios. Os primeiros histozorios na escala de evoluo dos animais so os cnidrios ou celenterados. Eles j possuem, inclusive, alguns rgos e sistemas. O sistema nervoso, por exemplo, comea a aparecer, embora constitudo por clulas que se dispem num retculo difuso por todo o corpo. Neles, j se evidenciam gnadas, isto , rgos especializados na formao de gametas (clulas reprodutoras).

Cnidcito antes e depois de disparar

33

BIOLOGIA 2
Na gastroderme, h clulas que produzem enzimas digestivas, que so lanadas na cavidade gastrovascular, para a digesto extracelular. Essas so as clulas glandulares. Contudo, as clulas flageladas captam fragmentos nutritivos e os transferem s clulas epitlio-digestivas, em cujos vacolos ocorre a digesto intracelular. Como voc v, os cnidrios promovem, ao mesmo tempo, tanto a digesto intracelular quanto a digesto extracelular. A respirao realizada diretamente por cada clula, assim como a excreo dos metablitos(difuso). Algumas classes podem secretar um exoesqueleto crneo ou calcrio.

FILO CNIDRIA

CLASSE HIDROZOA
Nos hidrozorios a forma polipide que predomina no ciclo de vida. Na maioria das espcies os plipos originam, assexuadamente, pequenas medusas de vida relativamente curta; estas se reproduzem sexuadamente, originando novos plipos, que fecham o ciclo. Physalia ou caravela um exemplo de hidrozorio em que os plipos e medusas altamente modificados vivem associados em colnias, especializados para a alimentao, proteo, reproduo, flutuao ou natao. Hidra: Gnero de plipos solitrios sem fase meduside no ciclo de vida. Obelia: constitui tambm um exemplo clssico de hidrozorio que, na fase colonial fixa, apresenta plipos de nutrio (gastrozides) e de reproduo assexuada (gonozides). A colnia sustentada por um exoesqueleto tubular e quitinoso. Nos plipos de reproduo brotam pequenas medusas, livres e sexuadas, que se locomovem por contraes rtmicas da umbrela. No h dimorfismo sexual entre as medusas. A fecundao externa, o desenvolvimento indireto, com larvas ciliadas chamadas plnulas.

Representao do ciclo de vida de um scyphozoario.

CLASSE ANTHOZOA
Os indivduos dessa classe apresentam apenas a forma polipide. Vivem isolados ou em colnias. Alm do ciclo de vida sexual simples (plipos gametas zigoto larvas ciliadas plipos...), h reproduo assexuada por brotamento e por fragmentao. A esta classe pertencem as anmonas (actnias ou dlia-domar), plipos isolados que atingem o maior tamanho entre os antozorios, e os corais, que so constitudos por plipos geralmente pequenos e agrupados, apoiados sobre base esqueltica compacta de carbonato de clcio. A maioria das espcies dos corais calcrios so coloniais, podendo crescer seja em pequenos blocos seja em formaes mais extensas chamadas recifes. Os corais formadores de recifes vivem em guas rasas (menos de 100 metros), claras e quentes (acima de 20 C).

CLASSE SCYPHOZOA
Os cifozorios apresentam geralmente as formas polipide e meduside. As formas predominantes do ciclo de vida so as medusas, que nesta classe so chamadas guas-vivas. Algumas chagam a ter quase dois metros de dimetro, em contraposio aos plipos, que so diminutos. So exclusivamente marinhos. Exemplo: Aurelia sp. O plipo em miniatura chamado cifstoma. Ao se reproduzir, o cifstoma divide-se transversalmente (estrobilizao), assumindo o aspecto de pratinhos ou taas empilhados. Cada taa uma medusa jovem chamada fira, que se destaca e cresce at a fase adulta. As medusas adultas, de sexos separados, reproduzem-se e originam, aps fecundao interna, larvas ciliadas, que se transformaro em cifstomas. Representao esquemtica do ciclo de vida de um hydrozoa

34

BIOLOGIA 2

FILO CNIDRIA
a) Clula com um tipo de rede que permite a filtrao de partculas presentes na gua. b) Clula capaz de disparar descargas eltricas nas presas. c) Clula que produz muco adesivo que permite a captura do alimento. d) Clula que contm uma cpsula cheia de lquido urticante e um filamento protctil. e) Clula capaz de gerar calor que queima os tecidos da presa e permite a sua captura. 6. (UERJ) A viso de uma medusa, um delicado domo transparente de cristal pulsando, sugeriu-me de forma irresistvel que a vida gua organizada.
Jacques Cousteau ("Vida Simples", outubro de 2003).

EXERCCIOS
1. (VUNESP/SP) Sobre os celenterados so feitas 3 afirmativas. Observe-as: I. A maioria dos cnidrios tem habitat aqutico, sendo poucas as espcies de habitat terrestre, as quais so representadas por plipos. II. Os cnidrios so urticantes e, para isso, dispem de muitas clulas especializadas chamadas coancitos. III. Alguns cnidrios se reproduzem por alternncia de geraes, quando ento os plipos do medusas e as medusas do plipos. Assinale: a) Se apenas uma afirmativa estiver correta. b) Se as afirmativas I e II estiverem corretas. c) Se as afirmativas I e III estiverem corretas. d) Se as afirmativas II e III estiverem corretas. e) Se as trs afirmativas estiverem corretas. 2. As estruturas anatmicas cnidoblastos e coancitos so encontradas, respectivamente, em: a) Espongirios e equinodermas b) Celenterados e espongirios c) Platelmintos e celenterados d) Crustceos e celenterados e) Celenterados e platelmintos 3. (FUVEST/SP). A Grande Barreira de Recifes se estende por mais de 2.000 km ao longo da costa nordeste da Austrlia e considerada uma das maiores estruturas construdas por seres vivos. Quais so esses organismos e como eles formam esses recifes? a) Esponjas - custa de secrees calcrias. b) Celenterados - custa de espculas calcrias e silicosas do seu corpo. c) Plipos de cnidrios - custa de secrees calcrias. d) Porferos - custa de material calcrio do terreno. e) Cnidrios - custa do material calcrio do solo, como a gipsita. 4. (F. M. ltajub/MG) A clula tpica dos celenterados o: a) Cnidoblasto. b) Coancito. c) Amebcito. d) Neurnio. e) Solencito. 5. (FURG-JULHO/2008) Os cnidrios so animais de estrutura corporal relativamente simples e de hbito predador. O cnidcito a principal estrutura que rene os organismos neste filo, e utilizada no ataque e na defesa. Marque a alternativa que melhor define este tipo de clula.

A analogia proposta refere-se grande proporo de gua no corpo das medusas. No entanto, uma caracterstica importante do filo ao qual pertencem a presena de cnidcitos ou cnidoblastos, clulas que produzem substncias urticantes. Dois animais que pertencem ao mesmo filo das medusas esto indicados em: a) Hidra - craca b) Hidra - esponja c) Anmona do mar - coral d) Anmona do mar - esponja e) Esponja - anmonas. 7. De que formado o esqueleto dos corais rgidos? que classe pertencem? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. O que estrobilizao? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

35

FILO PLATHELMINTHES

UNIDADE 4 FILO PLATHELMINTHES


Platelmintos so animais do filo Platyhelminthes (do grego platy = achatado + helmins = verme), pertencente ao reino Animalia. So considerados vermes, tais como o so considerados os integrantes dos filos Nematelmintos e Aneldeos. Popularmente os vermes so associados a bichos compridos, esbranquiados e de aspecto repugnante que causam mal ao homem. Embora em muitos casos esteja prximo da realidade, essa descrio certamente no coincide com o conceito biolgico de verme. Muitos animais que no se enquadram nessa caracterizao, como a minhoca, por exemplo, pertencem ao grupo dos vermes. Por outro lado, animais que se confundem, pela aparncia, com vermes, como as larvas de mosca, na realidade pertencem a grupo biolgico de organizao mais complexa. O grande grupo dos vermes (que por no ser uma categoria taxonmica inclui organismos bem diversos como planria, solitria, esquistossomo, lombriga, oxiro, ancilstomo, minhoca e sanguessuga) engloba trs filos principais: Platelmintos: achatados e sem nus. Nematelmintos: cilndricos, com boca e nus. Aneldeos: de corpo segmentado.

percorrem caminhos mais curtos atingindo com maior facilidade as camadas de clulas mais profundas. Os platelmintos so os animais mais simples na escala zoolgica a apresentarem simetria bilateral verdadeira. Tambm so os primeiros a apresentarem um princpio de cefalizao, isso significa que j existe neles um esboo da cabea, onde se concentram os rgos dos sentidos e a parte principal do sistema nervoso. Todos tm tubo digestrio incompleto, isto , no apresentam nus, e a nica abertura do tubo digestivo para o exterior serve igualmente como boca e como nus funcional. Os platelmintos possuem musculatura, sistema excretor e sistema reprodutor bem definidos. A reproduo pode ser assexuada ou sexuada. Neste caso quase todas as espcies so hermafroditas, havendo apenas algumas espcies diicas (ex: Schistosoma mansoni). A fecundao interna, com desenvolvimento direto ou incluindo estgios larvais. Com exceo da fmea do esquistossomo, que cilndrica, todos os platelmintos tm o corpo achatado dorsoventralmente. Eles se dividem em trs classes. a primeira Turbellaria, ser vista neste unidade e as demais, por possurem representantes que causadores de parasitoses, estaro na prxima unidade.

CLASSE TURBELLARIA

PLATELMINTOS

Representao esquemtica de uma planria. Em C representao do sistema nervoso. Em D representao de sistema genital. Esta classe compreende os platelmintos de vida livre que habitam a gua doce, o mar e o solo mido. O exemplo tpico de turbelrio a planria, um verme de vida livre de pequenino porte,com uma epiderme rica em clulas glandulares as quais secretam muco e presena de clios vibrteis na parte inferior do corpo. Quando dentro da gua, seus clios provocam um movimento de agitao, um pequeno turbilho, que justifica o nome Turbellaria. Nas planrias, o sistema nervoso j se mostra mais aperfeioado em relao ao que vimos nos celenterados. As clulas nervosas no formam apenas uma rede difusa pelo corpo, mas j renem em certos pontos constituindo gnglios nervosos, dos quais partem filetes que se irradiam para todo o organismo. H tambm uma concentrao evidente de neurnios na regio da cabea, formando os gnglios cerebrais. Tambm o sistema excretor bem definido - protonefrdios.

Representantes dos grupos de Platelmintos Os Platelmintos (do grego platys, chato, e helmins, vermes) so animais que integram o grupo dos vermes achatados. Apesar de os platelmintos se desenvolverem embrionariamente at a fase de gstrula tridrmica, no sofrem, entretanto, diviso do mesoderma em dois folhetos, de cuja separao resultaria o celoma. Assim, apesar de triploblsticos, eles se mantm acelomados. Alm disso,os sistemas circulatrio e respiratrio esto ausentes, sendo que ambos os processos ocorrem por simples difuso pela parede do corpo,quando as substncias

36

BIOLOGIA 2
Existem clulas especiais - as clulas-flama e os solencitos, que sugam a gua com resduos metablicos dos tecidos vizinhos, lanando essa excreo para o exterior, atravs de um sistema de canalculos. Esses canalculos se abrem em pequenos poros na superfcie do corpo. A maior parte da excreo, porm, realizada por simples difuso atravs da superfcie corporal. As planrias possuem na cabea um par de ocelos ou manchas ocelares, como se fossem dois pequenos olhos aparentemente vesgos. Esses minsculos globos tm uma estrutura primitiva, onde terminam ramificaes de clulas fotorreceptoras, recobertas, entretanto, por um epitlio pigmentado. Assim, tais rgos no permitem s planrias distinguir nitidamente os contornos das coisas, mas to-somente o vulto delas. Voc deve perceber, porm, que esse foi o primeiro passo da Natureza no sentido de instalar olhos, estruturas especializadas para a viso na cabea dos animais. As planrias so sempre hermafroditas, isto , cada animal tem os dois sexos. Contudo, elas s se reproduzem por fecundao cruzada. bastante conhecida, tambm, a elevada capacidade de regenerao dos turbelrios. Uma planria segmentada com uma lmina pode originar diversas outras planrias - uma de cada segmento. O tubo digestrio incompleto. Compe-se de boca posterior (situada na regio mediana do corpo), faringe prottil (que pode projetar-se para fora, como quem inverte a manga de um palet, a fim de englobar alimentos) e intestino. No h estmago nem nus. O intestino trifurcado e cada ramo termina em fundo fechado. Os detritos no aproveitados so regurgitados pela boca.

FILO PLATHELMINTHES
O esquema representa o processo respiratrio em planrias. Assinale a afirmao incorreta sobre esse tipo de respirao. a) O ser apresenta poucas camadas de clulas, possibilitando a difuso gasosa. b) O sangue auxilia no transporte de gases para as clulas. c) A difuso clula a clula possibilita o aporte de O2 a todas as clulas. d) A superfcie de contato com o ambiente extensa, permitindo as trocas. e) As trocas gasosas se processam por diferena de concentrao. 3. Existem animais que no possuem rgo ou sistema especializado em realizar trocas gasosas. Na respirao, a absoro do oxignio e a eliminao do gs carbnico ocorrem por difuso, atravs da superfcie epidrmica. o caso da: a) Planria d) Barata b) Ostra e) Aranha c) Drosfila 4. Os platelmintos so animais que apresentam o corpo achatado e sua espessura, quase desprezvel, proporciona uma grande superfcie em relao ao volume, o que lhes traz vantagens. A forma achatada desses animais relaciona-se diretamente com a ausncia dos sistemas: a) Digestivo e excretor. b) Respiratrio e circulatrio. c) Excretor e circulatrio. d) Digestivo e secretor. e) Secretor e nervoso. 5. Dugesia tigrina um verme que possui o corpo achatado dorsoventralmente. Apesar de inferior, ele apresenta uma caracterstica evoluda. Trata-se da(o): a) Simetria bilateral b) Hermafroditismo c) Ausncia de celoma d) Corpo segmentado e) Sistema digestrio completo 6. (UEG) Com base em alguns conceitos bsicos de Anatomia e Embriologia possvel a separao dos animais em diferentes grupos. Preencha o quadro a seguir indicando a classificao dos grupos animais de acordo com a caracterstica solicitada.

EXERCCIOS
1. (Unisa SP) Analise as proposies: I. Na planria,o oxignio e o gs carbnico da respirao so,respectivamente absorvidos e eliminados por toda superfcie corporal. II. Na planria,as percepes s variaes da intensidade luminosa so devidas atuao dos ocelos. III. Na planria,o corao situa-se na parte ventral da cabea. a) I,II,e III so verdadeiras. b) I e III so verdadeiras e II falsa. c) II e III so verdadeiras e I falsa. d) I e II so verdadeiras e III falsa. e) I,II e III so falsas. 2. (Cesgranrio)

_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

37

PARASITOSES CAUSADAS POR PLATYHELMINTES

UNIDADE 5 PARASITOSES CAUSADAS POR PLATYHELMINTES


CLASSE TREMATODA
a segunda classe dos vermes platelmintos. Com a exceo da fmea do esquistossomo, que cilndrica, todos tm o corpo achatado dorsoventralmente. Em geral, tm um formato lembrando o de uma folha de rvore, e tm o corpo revestido por uma cutcula resistente secretada pela epiderme. Apresentam duas ventosas - uma anterior, com funo de boca, e outra mediana, com finalidade de fixao. So vermes adaptados vida parasitria, podendo ser ectoparasitas ou endoparasitas. Por isso, causam doenas integrantes do grupo das verminoses no homem e em outros animais.

Casal de Tremtodas em cpula. Note as ventosas de ambos e o Canal ginecforo do macho.

ESQUISTOSSOMOSE
O Schistosoma mansoni uma espcie diica. A fmea fica abrigada em um sulco que h no corpo do macho.Os adultos vivem nas veias do fgado humano onde se alimentam e se acasalam. A postura dos ovos ocorre no intestino do hospedeiro. Os ovos so dotados de um espinho que perfura os capilares do intestino, e so eliminados pelas fezes. Encontrando a gua, esses ovos libertam embries chamados miracdios. Esses embries ciliados, de dimenses microscpicas, nadam procura de um hospedeiro intermedirio, algumas espcies de caramujo (ex: Biomphalaria glabrata). Os miracdios penetram no caramujo e dentro dele se reproduzem, passando pelas fases de esporocistos e, depois, de cercrias. A multiplicao das cercrias acaba causando a morte do caramujo. A, ento, elas passam gua, onde ficam, com suas caudas bifurcadas, nadando ativamente. So quase microscpicas. O simples contato da pele de uma pessoa com a gua infestada de cercrias o suficiente para a contaminao. As cercrias atravessam a pele, causando uma discreta coceira no local (segundo o ditado popular: se nadou e depois coou porque pegou). Caem na circulao sangunea e seguem, carregadas pelo sangue, para as veias do intestino, onde se desenvolvem, dando novos esquistossomos, com cerca de 10 a 15 mm de comprimento. O combate esquistossomose, uma das maiores endemias brasileiras, consiste no extermnio dos moluscos (caramujos), que so os hospedeiros intermedirios do parasita, e na orientao s pessoas para no terem contato com a gua em locais suspeitos e contaminados. preciso, tambm, orientar as populaes da zona rural para no defecarem no campo nem lanarem seus dejetos nos rios e ribeires, ensinando-lhes a fazerem fossas higinicas, como meio de evitar a poluio das guas e a propagao da doena.

38

BIOLOGIA 2

PARASITOSES CAUSADAS POR PLATYHELMINTES


As tnias so popularmente conhecidas por solitrias porque geralmente cada doente tem apenas uma no intestino. Todavia, isso no impede que uma pessoa seja portadora de mais de uma tnia ao mesmo tempo. As tnias podem medir desde alguns milmetros at vrios metros de comprimento. Possuem ventosas na cabea, com as quais se fixam parede intestinal para no serem eliminadas com as fezes. A Taenia saginata possui 4 ventosas e pode chegar a mais de 10m de comprimento. A Taenia solium apresenta, alm das 4 ventosas, uma coroa de ganchos quitinosos chamada rosto ou rostelum, o que torna muito mais difcil a sua eliminao. Ela , contudo, menor que a anterior, chegando, no mximo, a 6 metros. Ambas tm o homem como hospedeiro definitivo. Mas cada uma tem o seu hospedeiro intermedirio prprio - o boi para a T. saginata, e o porco para a T. solium. Nos hospedeiros intermedirios esses vermes evoluem apenas at a fase de larva. Essa larva, que mais parece uma pipoquinha branca, o cisticerco. A ingesto pelo homem da carne mal cozida, contendo cisticercos vivos, permite a aquisio da doena - a tenase (ou solitria). A ingesto acidental de ovos embrionados de Taenia solium por humanos pode permitir que neles se desenvolva a larva - o cisterco -, provocando a doena chamada cisticercose. A cisticercose pode ocorrer em rgos importantes, como o crebro, o globo ocular ou o fgado, assumindo gravidade notvel.

CLASSE CESTODA
Os cestdios formam a terceira classe de platelmintos. O corpo achatado e longo como uma fita, da o nome (do grego kestos, fita). So parasitas intestinais do homem e de outros animais. Os principais exemplos so a Taenia solium, a Taenia saginata e a Taenia echinococcus (esta ltima tambm chamada Echinococcus granulosus).

Representaes esquemticas de (a) Taenia soliume (b) Taenia saginata

Ciclo de vida de Taenia solium.

39

BIOLOGIA 2
O corpo da tnia dividido em cabea ou esclex, colo e tronco ou estrbilo. As ventosas da cabea s tm utilidade para a fixao. No atuam como boca. Alis, os cestdios no possuem qualquer rudimento de sistema digestrio. A sua nutrio se faz por difuso direta do alimento pela vasta superfcie corporal. O estrbilo segmentado em anis ou proglotes. Num mesmo anel, encontram-se rgos reprodutores de ambos os sexos. Isso quer dizer que as tnias so sempre hermafroditas. Elas podem realizar a autofecundao ou praticar a fecundao cruzada.

PARASITOSES CAUSADAS POR PLATYHELMINTES


Os ltimos anis do corpo de uma tnia so maiores e contm milhares de ovos embrionados. Eles so eliminados com as fezes. A tnia Echinococcus granulosus parasita de ces e muito pequena (3 a 5 mm). Ocasionalmente, sua larva pode parasitar a espcie humana, causando a hidatidose, uma espcie de tumor quase do tamanho de um coco-da-baia, cheio de lquidos, que se desenvolve no crebro, no pulmo etc. Como a cisticercose, tambm uma doena muito grave.

PRINCIPAIS PLATELMINTOS PATOGNICOS PARASITAS DO HOMEM


DOENA PARASITA E DISTRIBUIO LOCALIZAO NO HOSPEDEIRO
Schistosoma mansoni (Oriente mdio, frica, amrica do Sul, especialmente no Brasil) Adultos: nos vasos do sistema porta intra-hepticos. Estgios intermedirios: encistados em caramujos de gua doce.

PATOLOGIA
Fibrose heptica; obstruo de vasos portas pelos ovos, causando aumento do fgado e bao, com prejuzo funcional; hipertenso portal e ascite (barriga-dgua). Sintomas variados: clicas abdominais, dor de fome, mal estar, diarria, flatulncia, nuseas, aumento ou diminuio do peso e do apetite, sonolncia, insnia, fraqueza, irritabilidade, palidez. Neurocisticercose: hipertenso intracraniana, convules, distrbios psquicos, alteraes visuais.

TRANSMISSO
Ovos nas fezes humanas; o segundo estgio de larvas aquticas (cercrias) penetra atravs da pele.

Esquistossomose

Tenase

Taenia solium e Taenia saginata (cosmopolitas)

Intestino

Ingesto de carne de porco ou de boi mal cozida contendo cisticercos (larvas).

Cisticercose

Larva da Taenia solium (cosmopolita)

Tecido nervoso, globo ocular, tecido subcutneo e muscular.

Ingesto de ovos de T. solium (hortalias, gua, mos contaminadas pelas fezes) ou passagem de ovos liberados das proglotes no tubo digestivo para a circulao

EXERCCIOS
1. (F.M.Santos/SP) Nos platelmintos da classe Cestoda no existe: a) Sistema nervoso. b) Sistema digestrio. c) Sistema excretor. d) Hermafroditismo. e) Auto-fecundao. 2. (CESGRANRIO-RJ) O combate ao caramujo Biomphalaria glabrata nas guas de nossos riachos uma medida profiltica contra a: a) Doena de Chagas. b) Esquistossomose. c) Malria. d) Leishmaniose. e) Febre amarela. 3. (UFMG) Organismos que apresentam corpo dividido em proglotes, com esclex na parte anterior, sem tubo digestivo, podem parasitar o homem atravs de: a) Contato com gua contaminada. b) Ingesto de carne mal cozida. c) Ps descalos. d) Picada de inseto. e) Transfuso de sangue. 4. Existe uma frase popular usada em certas regies, relativa a lagos e audes: "Se nadou e depois coou, porque pegou". Esta frase refere-se infeco por: a) Plasmodium vivax. b) Trypanosoma cruzi. c) Schistosoma mansoni. d) Taenia sollium. e) Ancylostoma duodenale. 5. Observe a figura a seguir e assinale a alternativa ERRADA:

40

BIOLOGIA 2
a) A imagem nos mostra o ciclo da Taenia saginata, pois seu hospedeiro intermedirio o boi. b) Uma tnia adulta vive presa parede do intestino delgado, onde ocorre sua autofecundao. c) Quando as fezes de uma pessoa contaminada so depositadas no solo por falta de instalaes sanitrias adequadas, os ovos desse verme podem contaminar gua e verduras e ser ingerido pelo porco ou pelo boi. d) Uma vez no corpo do hospedeiro intermedirio, o ovo do verme eclode liberando o cisticerco, que se aloja nos msculos do animal. Nos msculos ele cresce e assume o aspecto de uma bolsa cheia de lquido chamado de oncosfera. e) O diagnstico dessa doena feito atravs de exames de fezes. 6. Observe as frases abaixo e depois marque a alternativa que contenha as palavras que as completem. I.Os platelmintos so animais _ ___________________ e acelomados. II. Os platelmintos no apresentam sistema circulatrio e _________________ diferenciado. III. O sistema________________ dos platelmintos mais desenvolvido que o dos cnidrios. IV. As tnias so _______________. V. Os platelmintos so classificados nas classes turbelrios, trematdeos e ___________. a) Triblsticos, respiratrio, nervoso, monoicas, cestdeos. b) Diblsticos, excretor, respiratrio, dioicas, cestodea. c) Triblsticos, excretor, circulatrio, hermafrofitas, cestdeos. d) Triblsticos, nervoso, respiratrio, dioicas, nematos. e) Diblsticos, nervoso, excretor, monoicas, nematelmintos. 7. Na doena conhecida como cisticercose, o homem pode fazer o papel de hospedeiro intermedirio no ciclo evolutivo da Taenia solium (tnia). Por que Isto acontece? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. O que muda nas medidas profilticas nos ciclos da Esquistossomose e no da Tenase? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ Representao de Nematoda em corte transversal. Na figura est esquematizado o corte transversal de uma lombriga, para que voc note alguns detalhes de organizao do corpo do animal. A maioria do pseudoceloma do animal est preenchido com os aparelhos digestrio e reprodutor. Os cordes nervosos surgem no dorso e no ventre, enquanto que de cada lado do corpo est um canal excretor. Entre os dois cordes nervosos e os canais excretores esto situados os msculos longitudinais, envolvidos pela epiderme com cutcula. Tegumento: constitudo por um epitlio simples, revestido por uma cutcula por ele mesmo secretada. Sustentao: inexiste no animal. Sistema muscular: constitui-se de uma camada de msculos longitudinais situada logo abaixo da epiderme. Sistema digestrio: os nematelmintos so os primeiros animais da escala zoolgica a apresentar tubo digestrio completo (isto , com duas aberturas: boca e nus). Possui as seguintes estruturas, pela ordem: boca, faringe(muscular e destinada suco) e intestino longo, que culmina no nus. Sistema circulatrio: ausente neste grupo. A circulao se faz atravs dos lquidos do pseudoceloma.

UNIDADE 6 FILO NEMATODA


Os nematelmintos so vermes cilndricos. Constituem-se num dos grupos mais diversos e abundantes do planeta. Apesar de serem mais conhecidos pelas doenas que provocam, so importantes para a manuteno do equilbrio da natureza. No aspecto embriolgico, so triblsticos (possuem ectoderme, mesoderme e endoderme). Apesar de possurem cavidade interna no corpo, esta no se caracteriza como um verdadeiro celoma, pois ela no completamente revestida de mesoderme (e sim parcialmente, sendo o restante limitado por endoderme), razo por que so chamados pseudocelomados. O exemplo a ser estudado o gnero Ascaris, dos quais o tipo mais conhecido a lombriga.

41

BIOLOGIA 2
Sistema respiratrio: tambm inexiste nos nematelmintos. As trocas gasosas se efetuam por difuso. Sistema excretor: consiste em dois canais longitudinais que terminam num poro excretor. As estruturas excretoras so os protonefrdeos. Sistema neurossensorial: o sistema nervoso consta de um anel nervoso central situado ao redor da faringe, do qual emergem fibras longitudinais que percorrem todo o corpo do animal. Sistema reprodutor: na maioria das ocasies o animal diico, isto , cada indivduo possui aparelho genital de um nico tipo. O macho possui testculos, vescula seminal (que armazena os espermatozides), canal ejaculador e, em lugar de pnis, espculas penianas que unem seu corpo ao da fmea durante a cpula. Os genitais femininos constam de ovrio, oviduto (canal que sai do ovrio), tero e vagina, esta ltima se abrindo no poro genital feminino. A fecundao interna e o desenvolvimento direto. Lembre-se: existem excees.

GABARITOS
UN 1
1.e 2.b 3.a 4.e 5.a 6.e 7. Muitos autores no consideram os vrus como sendo seres vivos porque eles so acelulares, e s apresentam atividades metablicas quando esto hospedados em clulas vivas sendo, por isso, considerados apenas sistemas moleculares autorreplicativos no vivos. 8. Apresentar pobreza de endomembranas, como por exemplo, organelas e envoltrio nuclear.

UN 2

1.d

2.b

3.d

4.e

5.e

6.b

7. A circulao ocorre em sentido unidirecional, sendo porcito, trio e sculo. A sustentao dos porferas, por sua vez, realizada pelas espculas. Quanto aos amebcitos, estes podem apresentar vrias funes, desde digestivas, at a de se diferenciar em outras clulas constituintes das esponjas. 8. Os porferos se alimentam absorvendo partculas orgnicas do meio que passam pelos seus poros. Suas clulas, chamadas coancitos, possuem flagelos que, ao impulsionar gua pelo corpo do porfero, capturam o alimento e liberam as excretas pelo sculo, maior abertura do porfero. O alimento capturado por fagocitose e pinocitose e digerido ou transferido para clulas chamadas amebcitos. Assim, distribuem os nutrientes por todo o porfero.

EXERCCIOS
1. (UEL-2005) Nematdeos so animais vermiformes de vida livre ou parasitria, encontrados em plantas e animais, inclusive no homem. Sobre as caractersticas presentes em nematdeos, considere as afirmativas a seguir. I. Corpo no-segmentado coberto por cutcula. II. Trato digestrio completo. III. rgos especializados para circulao. IV. Pseudoceloma. Esto CORRETAS apenas as afirmativas: a) I e III c) II e III b) I e IV d) I, II e IV e) II, III e IV

UN 3 1.d

2.b

3.b

4.a

5.d

6.c

7. O esqueleto rgido dos corais formado de calcrio, CaCO3, Estes pertentem a classe Anthozoa. 8. a fragmentao do corpo de um animal metazorio, formando segmentos (estrbilos) que originam novos indivduos.

2. Na tabela abaixo, o sinal (+) indica a presena da caracterstica, enquanto o sinal (-) indica a ausncia dessa caracterstica. Observe atentamente a tabela e assinale a alternativa que se aplica aos nematelmintos. SISTEMAS Digestivo Circulatrio Respiratrio Excretor Nervoso a) + --+ + b) -+ --+ c) -+ -+ -d) --+ -+ e) + + + + +

UN 4

1.d

2.b

3.a

4.b

5.a

6. Cnidrios: Simetria radial. Dois folhetos embrionrios. Acelomados; Platelmintos: Simetria bilateral. Trs folhetos embrionrios. Acelomados.

UN 5

1.b

2.b

3.b

4.c

5.d

6.a

3. A maioria dos nematdios so diicos e apresentam dimorfismo sexual. O macho normalmente tem a extremidade posterior do corpo recurvada para auxliar na cpula, a fmea sempre maior que o macho, tem a extremidade posterior do corpo reta. Em relao a reproduo deste organismos INCORRETO afirmar que: a) A fecundao interna b) Alguns so hermafroditas c) Alguns podem se reproduzir por partenognese d) A reproduo na maioria das espcies assexuada. e) Os ovos so depositados no ambiente

7.Isso acontece porque o homem pode ingerir o ovo acidentalmente, passando a se tornar assim, o hospedeiro intermedirio, caso no qual pode se desenvolver uma doena chama Neurocisticercose. 8. Mudam as maneiras profilticas principais, como comer carne crua ou mal passada, no caso da tenase, e a de evitar entrar em lagoas contaminadas como no caso da esquistossomose.

UN 6

1.d 2.a 3.d

42

BIOLOGIA 3
45 Conceitos bsicos em ecologia ................. 45 Os componentes de um ecossistema .......... 45 Cadeias alimentares ................................... 45 Nvel trfico ................................................ 46 Teia alimentar ............................................. 46 Exerccios .................................................... 46

01

ECOLOGIA I

pg

04

SUCESSES ECOLGICAS

pg

58

Quanto s foras que direcionam o processo .......................... 58 Quanto natureza o substrato na origem do processo ................................... 58 Exerccios .................................................... 59

02

ECOLOGIA 2

pg

47

O fluxo de energia e matria nos ecossistemas ......................... 47 As pirmides ecolgicas ............................... 47 Pirmides de nmeros ............................... 48 Pirmides de biomassa ............................ 48 Ciclos biogeoqumicos .............................. 48 Ciclo da gua .............................................. 48 Ciclo do carbono ........................................ 49 Ciclo do oxignio ........................................ 49 Ciclo do nitrognio .................................... 49 Exerccios .................................................... 50

60 Caractersticas gerais dos vrus ............... 60 Doenas causadas por vrus ........................ 60 Reproduo viral ......................................... 61 Exerccios .................................................... 62

05

VRUS

pg

54 Relaes intra-especficas ...................... 54 Relaes interspecficas .............................. 54 Exerccios .................................................... 56

03

RELAES ENTRE OS SERES VIVOS

pg

65 Estrutura da clula bacteriana ................. 65 Formatos da clula bacteriana .................... 65 Doenas causadas por bactrias ............. 65 Reproduo bacteriana ............................ 65 Classificao dos procariontes .............. 66 Importncia ................................................. 67 Exerccios .................................................... 67 Gabaritos ...................................................... 69

06

REINO MONERA

pg

ECOLOGIA I

UNIDADE 1 ECOLOGIA I
CONCEITOS BSICOS EM ECOLOGIA
A ecologia uma cincia que tem se tornado muito importante ultimamente devido interferncia do homem sobre os ecossistemas e sobre os desequilbrios ecolgicos s vezes ocorridos. Por isso, cada vez mais urgente conhecer a estrutura e o funcionamento da natureza a fim que sejam propostas solues racionais de utilizao dos recursos. Existem certos conceitos e nomenclatura necessrios para facilitar o estudo e o entendimento dos processos ecolgicos: Populao: o conjunto de indivduos de uma mesma espcie que vivem juntos, numa mesma rea geogrfica, durante certo perodo de tempo. Comunidade (biocenose): o conjunto de diferentes populaes que interagem em determinado ambiente fsico. So considerados os fatores biticos. Bitopo: o conjunto de fatores qumicos e fsicos de determinado ambiente. So considerados os fatores abiticos. Ecossistema: o entrelaamento entre a biocenose (comunidades) e o bitopo (meio ambiente). a palavra tcnica que quer dizer natureza, onde os seres vivos trocam entre si matria e energia num determinado ambiente. Habitat: o local, rea ou regio em que vive determinado organismo. Diramos que o habitat o endereo dos organismos. Exemplo: O habitat das minhocas a terra mida; o habitat dos tubares a gua salgada. Nicho ecolgico: o papel desempenhado por um organismo dentro do ecossistema em que ele vive. O nicho uma referncia ao modo de vida do indivduo. Ex: a minhoca cava tneis debaixo da terra e se alimenta de partculas de matrias orgnicas. Pode subir superfcie noite ou quando h excesso de gua no solo. Os tubares so predadores, vivem em pequenos grupos em regies claras e aquecidas do mar. Ectone: Regio de transio entre dois ecossistemas diferentes, onde geralmente ocorre grande diversidade de espcie, uma vez que ali podem se desenvolver seres dos 2 ecossistemas vizinhos, alm de possuir espcies prprias. Bioma: Grande ecossistema, com flora, fauna e clima prprios. Biosfera: Conjunto de todos os ecossistemas do planeta. Compreende a poro de terra biologicamente habitada. Biociclos: Subdiviso da biosfera em 3 pores ou biociclos: talassociclo - biociclo marinho; limnociclo biociclo dulccola; e epinociclo biociclo terrestre.

Nveis de organizao em ecologia.

OS COMPONENTES DE UM ECOSSISTEMA
Os ecossistemas apresentam dois componentes fundamentais: os fatores abiticos (bitopo), representado pelos ambientes fsico e qumico, e os fatores biticos (biocenose), representados pelos seres vivos. Os fatores abiticos podem ser fsicos, como a temperatura, a luz, a umidade, os ventos e a radiao solar; ou qumicos como os nutrientes presentes no solo e na gua. Dentre os fatores fsicos tem destacada importncia radiao solar, porque por meio dela que os vegetais clorofilados realizam a fotossntese, transformando a energia luminosa em energia qumica, e ainda liberando o oxignio para a atmosfera. Vale lembrar que a energia qumica a nica forma de energia aproveitvel pelos demais seres vivos. Os fatores biticos so divididos em dois grandes grupos: os organismos auttrofos, que so capazes de sintetizar seus prprios nutrientes a partir de compostos inorgnicos, e os organismos hetertrofos, que obtm seus nutrientes atravs do rearranjo ou decomposio da matria orgnica sintetizada direta ou indiretamente pelos auttrofos.

CADEIAS ALIMENTARES
atravs das cadeias alimentares que a matria orgnica transferida aos indivduos. Podemos definir cadeia alimentar como a sequncia linear de seres vivos em que um serve de alimento para o outro.

45

BIOLOGIA 3

ECOLOGIA I
(08) Comunidade o conjunto de organismos de mesma espcie que vivem em determinado espao. (16) Populao o conjunto de organismos que exploram o mesmo nicho ecolgico. 3. (Ufpr-2014) O estudo de cadeias trficas importante para a compreenso das relaes entre organismos em um ambiente. Uma forma de estud-las pela produtividade, em biomassa, em cada nvel da cadeia. Supondo a existncia de uma cadeia, num ambiente aqutico, com trs comunidades de organismos (vegetao, herbvoros e carnvoros) em equilbrio, qual dos grficos representa a variao dessas comunidades, em biomassa (g/m2), em funo da disponibilidade de luz? a)

NVEL TRFICO
A posio que um ser vivo ocupa em uma cadeia alimentar denominada nvel trfico. Assim, os produtores so os seres vivos que produzem matria orgnica para todos os organismos do ecossistema (clorofilados, auttrofos) Os consumidores (ou hetertrofos) podem ser primrios ou de primeira ordem (herbvoros), secundrios ou de segunda ordem, etc. Dizem que um animal onvoro quando ele pode se alimentar tanto de vegetais quanto de carne. Os decompositores ocupam o ltimo nvel de transferncia de energia entre os organismos. Eles degradam tanto os produtores quanto os consumidores. Decompositores ou saprfitos: So organismos hetertrofos capazes de decompor os restos dos seres vivos, devolvendo ao ambiente os componentes abiticos que formavam os organismos. Ex: bactrias e fungos.

TEIA ALIMENTAR
Da superfcie de cadeias alimentares surge a teia alimentar, que pode ser definida como o fluxo de matria que passa, num ecossistema, dos produtores aos consumidores por numerosos caminhos que se cruzam.

EXERCCIOS
1. (UEM-2013) Uma das questes mais intrigantes no estudo da Ecologia a questo da energia e suas modificaes. Ela pode seguir vrios caminhos em uma teia trfica. Sobre a energia utilizada pelos organismos, CORRETO afirmar que : (01) ela se perde definitivamente no interior dos seres vivos. (02) a energia transferida de um nvel trfico para outro e retorna integralmente ao ecossistema pela ao dos organismos decompositores. (04) a quantidade de energia que um nvel trfico recebe superior que ser transferida para o seguinte. (08) ela no volta mais aos seres vivos, uma vez liberada para o mundo fsico, na forma de calor. (16) ela ser usada tambm na produo de substncias orgnicas, ficando armazenada na forma qumica. 2. (UEM-2013) Analise as afirmaes abaixo e assinale a(s) alternativa(s) CORRETA(S). (01) Ecossistema define o complexo sistema de interrelaes entre os fatores biticos e abiticos. (02) Biocenose o conjunto de seres vivos de espcies diferentes que vivem em um determinado espao, mantendo relacionamento. (04) Hbitat o papel que o organismo desempenha dentro do seu ecossistema. b)

c)

d)

46

BIOLOGIA 3
e)

ECOLOGIA 2
a) Fitoplncton so organismos macroscpicos de vida longa, com pouca energia disponvel. b) Zooplncton so organismos macroscpicos de vida longa, com muita energia disponvel. c) A maior quantidade de energia est disponvel nos produtores primrios.

4. (UEL-2003) Em um ribeiro foram pescados dois peixes muito semelhantes, exceto pela colorao das nadadeiras. Um bilogo informou que pertenciam ao mesmo gnero; eram, porm, de espcies diferentes e apresentavam dietas distintas. O peixe com as nadadeiras claras alimentava-se de moluscos e crustceos que viviam no fundo do ribeiro, e o outro, cujas nadadeiras eram avermelhadas, comia folhas de plantas e insetos aquticos. Com base nessas informaes, correto AFIRMAR: a) Os dois peixes viviam em hbitats diferentes, mas ocupavam o mesmo nicho. b) Os dois peixes viviam no mesmo hbitat e ocupavam o mesmo nicho. c) Os dois peixes viviam em hbitats diferentes e ocupavam nichos diferentes. d) Os dois peixes viviam no mesmo hbitat, mas ocupavam nichos diferentes. e) Os dois peixes viviam no mesmo nicho, mas ocupavam hbitats diferentes. 5. (UEL-2012) A prtica da queimada, utilizada por agricultores para facilitar o plantio, tem efeitos prejudiciais para o solo. Assinale a alternativa que apresenta CORRETAMENTE o efeito da alta temperatura no solo durante a queimada. a) Incorporao do carbono em compostos orgnicos produzidos em altas temperaturas. b) Perda de nitrognio causada pela sua incorporao em compostos insolveis, formados pelas cinzas. c) Aumento da concentrao de ons hidrognio, levando acidez e diminuio do oxignio. d) Eliminao de microrganismos responsveis pelo processo de degradao da matria orgnica. e) Absoro de monxido de carbono e compostos inorgnicos pelas bactrias nitrificantes, causando baixa fertilidade do solo. 6. (UEL) Uma cadeia alimentar marinha de quatro nveis trficos pode ser composta pelos seguintes elementos: Fitoplncton como produtores, zooplncton como consumidores primrios, anchovas como consumidoras secundrias e atuns como consumidores tercirios. Com base no texto e nos conhecimentos sobre cadeias alimentares marinhas, correto afirmar:

d) Atuns so consumidores de vida curta, devido baixa disponibilidade de energia interna. e) O nvel de energia da cadeia determina os ciclos de vida dos produtores.

UNIDADE 2 ECOLOGIA 2
O FLUXO DE ENERGIA E MATRIA NOS ECOSSISTEMAS
Os alimentos (compostos orgnicos) tm a funo de fornecer matria prima para o crescimento, reproduo desenvolvimento e reparaes nos seres vivos, alm de ser a fonte de energia para a realizao de seus processos vitais. Os seres auttrofos so capazes de sintetizar seus prprios nutrientes atravs da fotossntese. Esse processo consegue fixar apenas 1 a 2% da energia solar que chega superfcie terrestre. Tal energia luminosa convertida em energia qumica e fica disponvel aos seres hetertrofos. Estes a obtm e a gastam pelo processo de respirao. dessa maneira que a luz do sol, fixada pelos auttrofos, transmitida sob forma de energia qumica aos demais seres vivos. Entretanto, medida que passa pelos consumidores, essa energia diminui, porque parte dela usada nos processos vitais e outra parte perde-se sob forma de calor. Conclui-se que sempre restar uma parcela menor de energia disponvel para o prximo consumidor. Na transferncia de energia entre os seres vivos no h reaproveitamento da energia libertada; por isso diz-se que ela unidirecional e ocorre sob forma de fluxo de energia. Entretanto, a matria pode ser reciclada, isto , os elementos qumicos que constituem a matria viva so reutilizados na construo de novos seres. A esse processo d-se o nome de ciclo da matria ou ciclo biogeoqumico.

AS PIRMIDES ECOLGICAS
Cada nvel trfico de uma cadeia alimentar utiliza parte da matria para seu prprio consumo antes de servir ao prximo nvel. Admite-se que apenas 10% da energia contida em cada nvel trfico de um ecossistema se transfira para o prximo nvel. Com isso podemos representar os ecossistemas atravs das pirmides de nmeros, pirmides de biomassa e pirmides de energia, que expressam quantitativamente as cadeias alimentares.

47

BIOLOGIA 3

ECOLOGIA 2

PIRMIDES DE NMEROS
Indicam o nmero de indivduos em cada nvel.

Pirmide de energia.

CICLOS BIOGEOQUMICOS
Vimos anteriormente que a energia transferida de modo unidirecional, e portanto no pode haver reaproveitamento daquilo que foi liberado. J a matria pode ser reciclada. Fala-se, ento, em ciclo da matria ou ciclo biogeoqumico. Os elementos qumicos carbono, hidrognio, oxignio e nitrognio so chamados organgenos (formadores dos organismos). Juntos, eles compem cerca de 97% da matria viva. Antes da existncia de qualquer ser vivo na Terra. Esses elementos j existiam, do mesmo modo que continuam a existir, mesmo depois da morte dos organismos. Conclui-se, ento, que os corpos apenas tomam emprestados da natureza a matria que os formam. Um dia, toda essa matria dever ser devolvida ao meio ambiente, e poder ser reutilizada na construo de um outro se vivo qualquer. Neste captulo abordaremos esses movimentos cclicos de elementos e substncias, que passam do mundo vivo para o mundo no-vivo (e vice-versa). Sero destacados os ciclos bio-geoqumicos da gua, do carbono, do oxignio e do nitrognio.

Pirmide de nmeros.

PIRMIDES DE BIOMASSA
A biomassa ou massa orgnica a quantidade de matria viva em um ecossistema. De um modo geral, a biomassa dos produtores maior que a dos herbvoros, que maior que a dos carnvoros.

CICLO DA GUA
A maior parte da gua na natureza est sob estado lquido (mares, rios, lagos, solo e no interior dos corpos dos animais e vegetais). Encontramos ainda gua no forma slida e uma pequenssima quantidade em forma de vapor. Essa pequena quantidade de vapor origina-se por evaporao e transpirao, que neste ciclo chamaremos de evapotranspirao. Para evaporar, a gua absorve energia (principalmente energia solar). O vapor comea a subir para a atmosfera e, medida que sobe, vai se resfriando e se condensando, e voltando ao estado lquido, que se precipita chuva. No solo, a gua pode ir atravessando camadas e atingir o lenol fretico, e posteriormente alcanar um rio ou riacho. Parte da gua precipitada pode ficar retida no solo e ser absorvida pelos sistema radiculares das plantas. Nos vegetais, a perda da gua ocorre por transpirao, sudao e por transferncia alimentar cadeia de consumidores. Os animais obtm a gua por ingesto direta, ou ainda indiretamente, pela ingesto de alimentos que contm gua. A eliminao da mesma ocorre de vrios modos, quer pela eliminao de fezes e urina, quer pela transpirao, sudorese e respirao. Podemos notar que, neste ciclo, a gua est em constante mudana de estado fsico e h permanente troca, dessa substncia entre a atmosfera, a superfcie terrestre e todos os seres vivos.

Pirmide de biomassa.

PIRMIDES DE ENERGIA
As Pirmides de energia so as mais aceitas pelos ecologistas porque elas consideram a biomassa acumulada por unidade de rea ou de volume, por unidade de tempo.

48

BIOLOGIA 3

ECOLOGIA 2

CICLO DO OXIGNIO
No s no ar, sob forma de substncia simples (O2) que se encontra o oxignio. Este participa tambm da molcula de gua, de gs carbnico e de incontveis compostos orgnicos. Dois processos opostos mantm a taxa de oxignio constante no ambiente: a respirao e a fotossntese. Praticamente todo o O2 na atmosfera e na hidrosfera oriundo da fotossntese, onde a gua decomposta e o oxignio dela libertado. A respirao um processo contnuo, realizado por animais e vegetais, de dia e de noite. Esse processo consome o oxignio e devolve gs carbnico. Este ltimo reinicia a fotossntese nos seres clorofilados. O oxignio pode tambm participar da formao da camada de oznio (O3). A presena desta camada na atmosfera imprescindvel para a manuteno da vida na terra porque sua ao filtrante impede que a radiao ultravioleta atinja a crosta terrestre. Os raios ultravioleta so nocivos porque podem causar alteraes genticas em todos os seres vivos.

Ciclo da gua.

CICLO DO CARBONO
possvel encontrar o gs carbnico (CO2) na atmosfera ou ento dissolvido em guas superficiais (mares, rios e lagos). Em ambos os casos, a proporo do gs de aproximadamente 0,03%. Os seres clorofilados retiram o CO2 da gua e do ar e com ele realizam a fotossntese, reduzindo-o a (CH2O)n, que se polimeriza e se transforma em aucares (glicose, frutose, sacarose). Estes aucares sero utilizados pelo prprio fotossintetizante ou sero cedidos aos hetertrofos. O processo de oxidao da glicose a respirao, e atravs desta reao o CO2 ser devolvido atmosfera ou aos rios, mares e lagos. Tambm a decomposio da matria orgnica libera CO2. O corpo de organismos mortos, seja na gua ou na terra, sofre oxidao e, com isso, ocorre formao de gs carbnico. Outra fonte importante de produo de CO2 a queima de combustveis fsseis (petrleo e carvode-pedra). O grande aumento de consumo de combustveis, atualmente, tem elevado a taxa de gs carbono na atmosfera, o que deixa preocupados os ambientalistas, pois o futuro da Terra pode ser catastrfico em virtude de aumento da quantidade de calor retido (efeito estufa). Vale ressaltar que nas combustes pode ser eliminado um outro produto que contm carbono: tratase do CO, o monxido de carbono. Esta substncia incolor e inodora, porm extremamente txica. Ela pode matar o homem em poucos minutos, pois forma um composto estvel com a hemoglobina, o que impede a oxigenao normal dos tecidos. Ciclo do Carbono

CICLO DO NITROGNIO
A porcentagem de gs nitrognio na atmosfera relativamente grande: cerca de 78%. Entretanto, a maioria absoluta dos seres vivos no conseguem fix-lo. bom lembrar que o nitrognio imprescindvel na formao dos aminocidos, que compem as protenas. Como ento, os vegetais obtm no nitrognio? Ele deve ser fixado em forma de nitratos. Isso s possvel graas a trs tipos de microorganismos encontrados no solo: fixadores de nitrognio, os decompositores e as bactrias nitrificantes. As bactrias do gnero Rhizobium rotineiramente se associam s razes de leguminosas (feijo, soja, ervilha, alfafa), formando ndulos, e vivem com os referidos vegetais uma relao de mutualismo. J se sabe que as cianofceas e alguns fungos do grupo dos actinomicetos tambm so capazes de fixar o nitrognio; estes ltimos ocorrem em ndulos nas razes de leguminosas e no-leguminosas, como o caso da araucria. Os organismos decompositores como o Clostridium putrificum, o Bacilus subtilis e o gnero Proteus decompem as protenas dos restos cadavricos e dos excrementos em proteoses, peptonas, polipeptdeos e aminocidos. Vrios produtos intermedirios vo surgindo e principalmente a amnia (NH3) e os ons amnio (NH+4 ) sofrem ao de bactrias nitrificantes (Nitrosomonas sp e Nitrosococcus sp), que oxidam a amnia em cido nitroso que, em contato com outras substncias do solo origina os nitritos, neste momento entram em ao as bactrias ntricas (nitrobacter), as quais oxidam nitritos em nitratos. dessa forma que os vegetais superiores obtm os nitratos imprescindveis sua nutrio. As bactrias desnitrificantes do solo so capazes de decompor a uria e a amnia libertando o nitrognio molecular (N2) para a atmosfera, fechando assim o ciclo do nitrognio na natureza.

49

BIOLOGIA 3

ECOLOGIA 2

EXERCCIOS
1. (UFPR/ 2010) Abaixo esto representados trs exemplos de cadeias alimentares e trs pirmides que expressam o nmero relativo de indivduos em cada nvel, numa situao de equilbrio ecolgico. Relacione as cadeias alimentares com as pirmides. Assinale a alternativa que apresenta a numerao correta de cima para baixo. 2. (UEL 2007) - Analise os grficos a seguir.

Com base nos grficos e nos conhecimentos sobre o tema, assinale a alternativa que define corretamente qual dos grficos descreve o padro esperado de variao da biomassa com o tempo, para que em um ecossistema ocorra uma retirada lquida de carbono da atmosfera: a) O grfico 1, pois, com a mortalidade e a reduo da biomassa, o carbono ser incorporado ao solo na forma de matria orgnica. b) O grfico 2, pois, com o aumento da biomassa, haver mais carbono atmosfrico sendo retirado do ar. a) 1 2 3. b) 1 3 2. c) 3 1 2. d) 2 1 3. e) 3 2 1. c) O grfico 2, pois, com o aumento da biomassa, haver tambm uma maior taxa de respirao.

50

BIOLOGIA 3

ECOLOGIA 2

d) O grfico 3, pois indica o que ocorreria em uma floresta madura, como na Amaznia. e) Em qualquer das trs situaes representadas pelos grficos poderia haver retirada lquida, dependendo apenas da taxa respiratria. 3. (UEL- 2006) H uma estreita relao entre as variveis: estao do ano, temperatura, reproduo e disponibilidade de alimentos. Fatores, tais como o efeito estufa e o aumento na temperatura, podem levar a um desequilbrio no ambiente, com consequente alterao na relao entre essas variveis. Analise o grfico a seguir sobre uma espcie de pssaro que, aps a ecloso, precisa se alimentar de uma certa quantidade de lagartas para desenvolver penugem.

Fonte: Scientific American Brasil, ano 2, n. 21, p. 79, fev. 2004.

Com base no texto, no grfico e nos conhecimentos sobre o tema, CORRETO afirmar: a) Na fase de desajuste, a quantidade de ovos diminuiu drasticamente durante a postura. b) Com a antecipao do perodo do pico de biomassa de lagartas na situao de desajuste, os pssaros passaram a se reproduzir mais cedo. c) A situao de desajuste mostra que, devido ao aumento da temperatura, os pssaros migraram para outro ambiente. d) A situao de desajuste mostra que o nmero de lagartas aumentou muito, causando um srio desequilbrio na cadeia alimentar, pois a quantidade de produtores no foi suficiente para aliment-las. e) A situao de desajuste mostra que as necessidades alimentares dos filhotes ficaram comprometidas, visto que o pico de biomassa de lagartas aconteceu mais cedo. 4. (UEL-2006) No pas onde 47,8% dos municpios no tinham servios de esgotamento sanitrio, segundo o Censo 2000, e 44,7% dos domiclios no esto ligados rede coletora, o esgoto a cu aberto o pior problema ambiental. Foi apontado como fator poluente por 1.031 (46%) dos 2.263 municpios que declararam sofrer danos ambientais que atingem diretamente a populao.
(Folha de Londrina, Londrina, 18 maio 2005. Caderno Cidadania.)

Em razo de a maior parte das cidades brasileiras ter redes de esgotos e estaes de tratamento insuficientes, grande parte dos resduos orgnicos produzidos pelas populaes acabam por ser lanados em rios e/ou lagos, levando ao processo denominado eutrofizao. Assinale a alternativa que indica, CORRETAMENTE, a forma seqencial na qual esse processo ocorre: a) Aumento do nmero de bactrias aerbias, diminuio do oxignio, excesso de matria orgnica, decomposio anaerbia, produo de gases txicos. b) Produo de gases txicos, aumento do nmero de bactrias aerbias, diminuio do oxignio, excesso de matria orgnica, decomposio anaerbia. c) Decomposio anaerbia, excesso de matria orgnica, aumento do nmero de bactrias aerbias, diminuio do oxignio, produo de gases txicos. d) Produo de gases txicos, decomposio anaerbia, diminuio do oxignio, aumento do nmero de bactrias aerbias, excesso de matria orgnica. e) Excesso de matria orgnica, aumento do nmero de bactrias aerbias, diminuio do oxignio, decomposio anaerbia, produo de gases txicos.

51

BIOLOGIA 3

ECOLOGIA 2

5. (Unicamp 2014) Os diagramas abaixo ilustram a frequncia percentual de indivduos com diferentes tamanhos de bico, para duas espcies de tentilhes (gnero Geospiza) encontradas em trs ilhas do arquipelago de Galpagos, no oceano Pacfico. As frequncias de indivduos com bicos de diferentes profundidades (indicadas pelas setas) so mostradas para cada espcie, em cada ilha. Sabendo-se que ambas as espcies se alimentam de sementes, indique a interpretao correta para os resultados apresentados.

a) Trata-se de um exemplo de cooperao entre as duas espcies, que procuram por alimento juntas, quando esto em simpatria. b) Trata-se de um exemplo de deslocamento de caracteres resultante de competio entre as duas espcies na situao de simpatria. c) Trata-se de um exemplo de predao mtua entre as espcies, levando excluso de G. fuliginosa na ilha Daphne, e de G. fortis na ilha Los Hermanos. d) Trata-se de um caso de repulsa mtua entre as duas espcies, sendo mais perceptvel nas ilhas Daphne e Los Hermanos. 6. (Fuvest-2014) Considere a situao hipottica de lanamento, em um ecossistema, de uma determinada quantidade de gs carbnico, com marcao radioativa no carbono. Com o passar do tempo, esse gs se dispersaria pelo ambiente e seria incorporado por seres vivos. Considere as seguintes molculas: I. Molculas de glicose sintetizadas pelos produtores. II. Molculas de gs carbnico produzidas pelos consumidores a partir da oxidao da glicose sintetizada pelos produtores. III. Molculas de amido produzidas como substncia de reserva das plantas. IV. Molculas orgnicas sintetizadas pelos decompositores. Carbono radioativo poderia ser encontrado nas molculas descritas em: a) I, apenas. b) I e II, apenas. c) I, II e III, apenas. d) III e IV, apenas. e) I, II, III e IV.

7. (F.C.CHAGAS) A biofixao do nitrognio atmosfrico realizada por certas espcies de: a) Bactrias, apenas d) Bactrias e nematides b) Nematides, apenas e) Bactrias e cianobactrias. c) Cianobactrias, apenas 8. (Uerj-2014) O ciclo do nitrognio extremamente importante para os seres vivos. Esse elemento faz parte de diversos compostos orgnicos, como protenas e cidos nucleicos. Na tabela, h exemplos de formas qumicas do nitrognio incorporadas por alguns seres vivos.

SERES VIVOS Plantas

COMPOSTO NITROGENADO orgnico inorgnico amnia (Nh3) nitrato (No3) aminocidos amnia (Nh3) nitrato (No3) nitrito (No2) -

bactrias animais

No ciclo do nitrognio, as bactrias desnitrificantes esto relacionadas funo apontada em: a) Converso da amnia em nitrito. b) Produo de nitrato a partir da amnia. c) Liberao de gs nitrognio para o ambiente. d) Incorporao de nitrognio molecular em aminocidos. 9. (Uerj 2014) Com as chuvas intensas que caram na cidade do Rio de Janeiro em maro de 2013, grande quantidade de matria orgnica se depositou na lagoa Rodrigo de Freitas. O consumo biolgico desse material contribuiu para a reduo a zero do nvel de gs oxignio dissolvido na gua, provocando a mortandade dos peixes.

52

BIOLOGIA 3
Os dois principais grupos de seres vivos envolvidos no processo de diminuio da taxa de oxignio disponvel so: a) Algas e bactrias. b) Plantas e bactrias. c) Algas e microcrustceos. d) Plantas e microcrustceos. 10. (UFPR 2010) Algumas populaes de humanos tm sua dieta baseada em carne de peixe. Para as populaes que vivem beira de rios poludos por mercrio, por exemplo, mais prejudicial comer peixes carnvoros do que peixes herbvoros porque: a) Os peixes carnvoros se alimentam de qualquer tipo de organismo, aumentando a chance de contaminao por substncias txicas alm do mercrio. b) Os peixes herbvoros no ficam expostos ao mercrio por muito tempo, diminuindo as chances de contaminar os humanos. c) Os peixes carnvoros ficam expostos tambm ao mercrio presente no ar. d) Os peixes carnvoros acumulam o mercrio em seu organismo quando se alimentam de outros organismos, inclusive os peixes herbvoros. e) Os peixes herbvoros no acumulam mercrio em seus tecidos. 11. (UEL 2011) A Produtividade Primria Bruta (PPB) o total de matria orgnica produzida pelos organismos fotossintticos de um ecossistema, como, por exemplo, um grande lago. Parte dessa matria orgnica produzida gasta na respirao celular (R), e apenas a quantidade de energia que sobra fica armazenada na biomassa, constituindo a Produtividade Primria Lquida (PPL). Assim, temos que: PPL = PPB - R. Inicialmente, mediu-se a quantidade de O2 dissolvido existente em uma garrafa transparente e outra escura, ambas contendo gua de um lago, fechadas e mantidas em ambiente iluminado. Aps um perodo, mediu-se novamente o volume de O2 dissolvido na gua das duas garrafas. Considerando que a quantidade de biomassa (g/cm3) de fitoplncton a mesma em ambas as amostras, assinale a alternativa que explica por que necessrio realizar este teste com os dois tipos de garrafas para calcular a PPB do lago. a) A diminuio da quantidade de O2 dissolvido na garrafa escura indica quanto O2 consumido na respirao na garrafa clara, portanto a PPB o valor de O2 obtido na garrafa escura somado ao valor encontrado na garrafa clara. b) O aumento da quantidade de O2 dissolvido na garrafa clara indica quanto O2 liberado da fotossntese e consumido na respirao na garrafa escura, portanto a PPB o valor de O2 obtido na garrafa clara subtrado do valor encontrado na garrafa escura. Figura B

ECOLOGIA 2
c) A diminuio da quantidade de O2 dissolvido na garrafa escura indica quanto O2 liberado da fotossntese na garrafa clara, portanto a PPB o valor de O2 obtido na garrafa escura subtrado do valor encontrado na garrafa clara. d) O aumento da quantidade de O2 dissolvido na garrafa escura indica quanto O2 consumido na fotossntese na garrafa clara, portanto a PPB o valor do O2 obtido na garrafa clara somado ao valor encontrado na garrafa escura. e) A diminuio da quantidade de O2 dissolvido na garrafa clara indica quanto O2 consumido na respirao na garrafa escura, portanto a PPB o valor de O2 obtido na garrafa escura subtrado ao valor encontrado na garrafa clara. 12. (UFPR/ 2011) Competio um processo que envolve duas ou mais espcies que utilizam os mesmos recursos. Nicho, habitat e nvel trfico so conceitos utilizados para se descrever a associao de uma espcie com o meio (bitico e abitico) em que vive. Esses conceitos so fundamentais para a compreenso do ecossistema. Considerando os conceitos de nicho, habitat e nvel trfico, defina qual deles o mais eficiente na deteco de processos de competio entre duas espcies, justificando porque ele superior aos outros dois. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 13. (UNICAMP/ 2010) Os seres vivos tm nveis de organizao acima do organismo, e a Ecologia a rea da Biologia que estuda as relaes entre os organismos e destes com o ambiente em que vivem. Dentre os vrios nveis de organizao podem ser citados a Populao, a Comunidade e o Ecossistema. a) As figuras abaixo representam a biomassa de nveis trficos em dois tipos de ecossistemas. Relacione cada uma das figuras com um ecossistema. Justifique. b) Explique como o dixido de enxofre (SO2), liberado na atmosfera por diversas indstrias, pode afetar as populaes dos diferentes nveis trficos da pirmide A.

Figura A

53

BIOLOGIA 3
14. (Uerj-2014) Em seu processo de fixao biolgica, o gs atmosfrico nitrognio convertido em compostos inorgnicos nitrogenados. Um exemplo desse mecanismo de converso ocorre na relao simbitica entre bactrias do gnero Rhizobium e razes de leguminosas. Indique duas vantagens dessa relao simbitica, uma para a planta e outra para a bactria. Em seguida, cite o on nitrogenado usado preferencialmente pelas plantas no processo de fixao e nomeie uma das molculas, encontradas nas clulas vegetais, que incorpora esse on. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

RELAES ENTRE OS SERES VIVOS


Colnias: Nas colnias os indivduos se encontram anatomicamente unidos. Como nas sociedades, as colnias tambm podem ser isomorfas. Nestes casos no h diviso de trabalho entre os participantes (Ex: falsos corais, como a gorgnia, e os corais-verdadeiros). Nas colnias heteromorfas h vrios indivduos diferentes. O cnidrio conhecido por caravela (Physalia) contm indivduos especializados em flutuao, reproduo e defesa.

UNIDADE 3 RELAES ENTRE OS SERES VIVOS


Em uma comunidade os indivduos mantm relaes entre si, estabelecendo influncias mtuas em suas vidas. As interaes podem ser do tipo intra-especficas (entre indivduos da mesma espcie) ou interespecficas (entre indivduos de espcies diferentes). Podem ainda ser harmnicas (no h prejuzo para nenhum dos indivduos associados) ou desarmnicas (h prejuzo para pelo menos um dos associados). No entanto, quando analisamos o ecossistema integral, nenhuma relao desarmnica porque tudo o que ocorre contribui para a conservao do equilbrio ecolgico. Exemplo de colnia - caravela.

RELAES INTRA-ESPECFICAS DESARMNICAS

Canibalismo: O canibalismo uma relao desarmnica em que um ser mata outro de sua espcie para dele se alimentar. Apesar de raro no reino animal, pode ocorrer em populaes onde houve grande aumento em sua densidade demogrfica, funcionando assim como um fator regulador do aumento populacional. Entre os insetos (como o louva-a-deus) e entre as aranhas comum que a fmea devore o macho aps a cpula.

RELAES INTRA- ESPECFICAS


RELAES INTRA-ESPECFICAS HARMNICAS
Sociedades: A principal caracterstica das sociedades que os indivduos esto anatomicamente separados, mas em unio permanente. Pode-se notar ntida diviso de trabalho entre os indivduos. Se estes forem morfologicamente modificados, fala-se em sociedade heteromorfa (Ex. insetos sociais: abelhas, formigas e cupins). Se no houver modificaes morfolgicas entre os indivduos, a sociedade isomorfa (Ex: sociedade humana).

RELAES INTERSPECFICAS
As relaes interespecficas podem ser harmnicas ou desarmnicas:

RELAES INTERESPECFICAS HARMNICAS

Exemplo de sociedade Formigueiro.

Mutualismo e protocooperao: So dois tipos de relao em que os organismos se beneficiam mutualmente. A diferena entre eles que na proto-cooperao os participantes podem viver independentemente, enquanto que no mutualismo a unio obrigatria. Um exemplo clssico de protocooperao o do paguro e a anmona-do-mar. O paguro costuma habitar conchas, e a anmona se alimenta atravs dos cnidoblastos que podem ser produz substncias urticantes que tambm afugentam predadores. O paguro, deslocando-se, melhora a captao de alimentos pela anmona, e a anmona protege o paguro. Tambm os pssaros que se alimentam dos carrapatos dos bois constituem um exemplo de protocooperao: Eles encontram alimento fcil, enquanto os bois se livram dos ectoparasitas. J um exemplo de mutualismo o caso dos lquens, unio de algas com certos fungos. A alga possui clorofila e capaz de fotossintetizar alimentos para ela e para o fungo. Este capaz de reter gua e sais minerais indispensveis para ambos. Um importante caso de mutualismo o que ocorre entre os ruminantes e as bactrias que produzem celulase. Enquanto os ruminantes oferecem alimentos e abrigo em seu tubo digestivo, as

54

BIOLOGIA 3
bactrias produzem celulase, enzima indispensvel na converso de celulose em glicose. Alguns protozorios tambm so capazes de digerir a celulose. No caso do cupim, este contm protozorios flagelados em seu sistema digestivo, possibilitando a utilizao da madeira como alimento.

RELAES ENTRE OS SERES VIVOS


Sinfilia: um tipo especial de relao que h entre as formigas e os pulges. Sabe-se que estes ltimos sugam a seiva elaborada dos vegetais at comearem a eliminar gua aucarada pelos seus intestinos. As formigas capturam pulges e os mantm cativos em seus formigueiros, oferecendo-lhes, parte vivas de vegetais para que eles produzam os aucares de que necessitam. Embora tenha caractersticas de hostilidade, uma vez que os pulges so mantidos em cativeiro, a sinfilia considerada uma relao harmnica, pois os pulges tambm so beneficiados pela facilidade de encontrarem alimentos. Alm disso, as formigas dispensam-lhes bons tratos. Alguns autores usam o termo escravagismo e esclavagismo para designar a sinfilia.

Exemplo de protocooperao. Inquilinismo e comensalismo: So dois tipos de associao em que apenas um dos participantes se beneficia. O outro, porm, no sofre qualquer tipo de prejuzo. No inquilinismo, um dos indivduos recebe proteo do outro, que nada sobre. Ex: O fierster, um pequeno peixe, vive no interior do pepino-do-mar e s sai para alimentar. Um outro exemplo clssico de inquilinismo o caso da relao existente entre as orqudeas ( e tambm as bromlias) e as rvores, sobre as quais se instalam. Ao contrrio de que muitas pessoas pensam, as orqudeas e as bromlias no so parasitas, uma vez que nada retiram da rvore; elas apenas vivem sobre galhos e troncos, em lugares altos, onde encontram condies ideais ao seu desenvolvimento. Por isso so chamadas plantas epfitas (epi = em cima), e esse tipo de inquilinismo denominado epifitismo. As orqudeas obtm a gua necessria ao seu metabolismo absorvendo o vapor dgua da atmosfera atravs do velame, uma adaptao especial da epiderme radicular. As bromlias, por sua vez, apresentam escamas absorventes, que so modificadas da epiderme foliar e cuja funo a absoro de gua (seja das chuvas ou da umidade do ar).

Exemplo de sinfilia.

RELAES INTERESPECFICAS DESARMNICAS

Amensalismo ou antibiose: Trata-se de uma relao desarmnica em que indivduos secretam substncias que inibem ou impedem o desenvolvimento de outras espcies no local. O caso mais conhecido o dos antibiticos produzidos pelos fungos, a que impedem a multiplicao das bactrias. A mar vermelha (proliferao de certas algas planctnicas) produz substncias txicas em seu metabolismo que, lanadas nas guas, matam outros seres que esto ao redor. Hoje sabe-se que as folhas de alguns pinheiros produzem substncias que, ao se acumularem no solo, no permitem a a germinao de qualquer semente, impossibilitando o surgimento de outros vegetais debaixo destas rvores. Predatismo: um tipo de relao desarmnica em que um indivduo captura e mata outro (de espcie diferente) para alimentar-se. Todos os carnvoros so predadores. Ex: o leo, o lobo, o tigre, a ona, o gavio e a guia. O predador pode atacar tambm as espcies vegetais. Neste caso d-se o nome de herbivorismo. Ex: gafanhotos e savas. Os casos em que o predador um vegetal so raros, mas as plantas carnvoras aprisionam insetos e se utilizam deles como alimentos. Parasitismo: o tipo de relao desarmnica entre espcies diferentes em que um deles, o parasitas, vive no corpo do outro, o hospedeiro, e dele retira os alimentos. O parasita prejudica o hospedeiro e pode inclusive mat-lo. Os ectoparasitas vivem fixados na parte externa do corpo do hospedeiro (piolho, carrapato, cravo, bicho-de-p e sarna) enquanto os endoparasitas habitam o interior do corpo do hospedeiro (plasmdio e tripanossoma). Alguns autores no consideram vermes intestinais como endoparasitas porque, embora vivam no interior do organismo,

No comensalismo, um dos participantes da associao se beneficia com alimentos, enquanto o outro no sofre qualquer perda ou prejuzo. Ex: o peixe-piloto vive ao redor do tubaro, aproveitando os restos de comida que escapam da boca deste predador. No nosso intestino vive a Entamoeba colli, comendo nossos restos alimentares, sem, contudo nos causar qualquer dano.

55

BIOLOGIA 3
no vivem no interior de tecidos. Alm disso, o tubo digestivo comunica-se diretamente com o meio externo, fazendo os parasitas ali encontrados serem classificados como ectoparasitas. Vertebrados e vegetais superiores podem ser parasitas em rarssimos casos. A lampria possui boca circular com a qual se fixa em animais aquticos maiores, como o tubaro, e deles retira sangue, que seu alimento. O cip-chumbo, vegetal da flora brasileira, retira a seiva elaborada de outras plantas sobre as quais est fixado, usando para isso finssima razes sugadores denominadas haustrios. A erva-de-passarinho considerada hemiparasita porque tambm capaz de fotossintetizar, apesar de sugar a seiva elaborada da planta hospedeira. As orqudeas, que nascem no alto de rvore e troncos no so parasitas; so apenas plantas epfitas (que vivem sobre outras para melhor aproveitamento do espao). Mimetismo: O mimetismo (do grego mimetis = imitao) uma adaptao morfolgica que certas espcies apresentam, e que consiste do meio ambiente, de modo que, passando desapercebidas (disfaradas), obtm vantagens para que a espcie no seja dizimada por predadores ou ainda facilite a aproximao presa. O mimetismo pode der resumido como a arte de camuflagem. No mimetismo homocrnico, o indivduo imita a cor do ambiente onde vive. o caso dos ursos polares, dos arminhos, das raposas e lebres rticas que, devido a pelagem branco se confundem com a neve, e no nosso caso um dos vrios exemplos o bicho-pau, que mimetiza galhos secos:

RELAES ENTRE OS SERES VIVOS


outro, mais perigoso. o caso da falsa-coral, cobra muito parecida com a coral verdadeira, e ainda a borboleta-coruja, em cujas asas existem manchas que lembram os olhos de uma coruja.

Exemplo de mimetismo.

EXERCCIOS
1. (Unicamp-2014) Os insetos, especialmente aqueles com modo de vida social, esto entre os animais mais abundantes na Terra. So insetos sociais, que vivem em colnias: a) Formigas, borboletas, besouros. b) Abelhas melferas, formigas, cupins. c) Besouros, abelhas melferas, moscas. d) Cupins, liblulas, cigarras. 2. (UFPR 2014) Pesquisadores da Universidade da Flrida esto realizando testes para introduzir nos Estados Unidos o inseto Calophya latiforceps (conhecido como gralha-da-folha-da-aroeira), nativo do Brasil, para combater a invaso de aroeira, que est diminuindo a biodiversidade de diversas regies. Esse inseto alimenta-se de nutrientes da rvore, comprometendo seu crescimento. Esse processo o controle biolgico natural, que pode trazer risco para o ecossistema em que implantado quando o organismo usado para fazer o controle: a) Sofre mutao. b) No sobrevive no novo ambiente. c) Passa a comer outros vegetais. d) Adapta-se ao novo ambiente. e) Altera o ciclo biogeoqumico de nutrientes. 3. (UEL -2005) Algumas espcies de plantas do Cerrado brasileiro apresentam como caractersticas a baixa regenerao dos indivduos jovens prximos da planta me e tambm a manuteno de uma certa distncia entre os indivduos. Com base nessas informaes, assinale a alternativa que indica CORRETAMENTE a competio e o fator que ocorrem entre estes indivduos: a) Intraespecfica por gs carbnico. b) Interespecfica por gua. c) Intraespecfica por nutrientes. d) Interespecfica por polinizadores. e) Intraespecfica por oxignio.

Exemplo de mimetismo: bicho-pau. O mimetismo homotpico, ou Mleriano, uma manifestao em que o animal tem a forma de objetos do meio ambiente. O exemplo tpico deste mimetismo o bicho-pau, que se assemelha a gravetos e ramos de rvores. H ainda o mimetismo batesiano (em homenagem ao ingls Bates, o primeiro a descrev-los). Neste caso, um organismo imita

56

BIOLOGIA 3
4. (UFPR/ 2009) Associe os tipos de relao ecolgica da coluna da direita com as situaes apresentadas na coluna da esquerda. I. Um pssaro que se alimenta de carrapatos que vivem sobre grandes mamferos, como bois ou bfalos. II. Uma epfita (por exemplo, uma orqudea) que cresce sobre uma grande rvore. III. Uma rmora (ou peixe-piloto) que vive em associao com um tubaro, sendo transportada por ele e aproveitandose dos restos da alimentao do carnvoro. IV. Bactrias e protozorios que vivem no interior do intestino de cupins, onde digerem a celulose. ( ) Inquilinismo. ( ) Comensalismo. ( ) Protocooperao (ou cooperao). ( ) Mutualismo. Assinale a alternativa que apresenta a numerao correta da coluna da direita, de cima para baixo. a) I III II IV. d) II IV III I. b) IV II I III. e) I II IV III. c) II III I IV. 5. (F.C.CHAGAS) O fenmeno da mar vermelha ocorre em determinadas condies ambientais. Certas algas marinhas microscpicas de cor avermelhada produzem intensamente, formam enormes manchas vermelhas no mar. A grande concentrao de toxinas produzidas por essas algas provoca grande mortandade de animais marinhos. O fenmeno acima descrito constitui uma relao ecolgica do tipo. a) Mutualismo. d) Parasitismo. b) Competio. e) Amensalismo. c) Predatismo. 6. As espcies I e II ocupam o mesmo nicho e o mesmo habitat em uma comunidade. Qual a provvel consequncia para I da diminuio drstica de II, aps algumas geraes? a) Transforma se nicho ecolgico b) Extingue-se d) Diminui sua densidade c) No se altera e) Aumenta a sua densidade. 7. (UEL-2012) Os seres humanos modificam o ambiente para uso dos recursos naturais, criando impactos sobre os ecossistemas. O grfico a seguir mostra um exemplo hipottico da interferncia humana sobre a fauna local em um determinado rio com nascente na floresta nativa.

RELAES ENTRE OS SERES VIVOS


a) Com base no grfico, explique as variaes das populaes A e B. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) No contexto do exemplo dado na questo, esquematize uma cadeia alimentar em um ambiente aqutico de uma floresta nativa. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. (Fuvest 2014) Considere duas populaes das espcies A e B, que podem viver separadamente e que, se reunidas, estabelecem interaes interespecficas. Os grficos abaixo representam o crescimento dessas populaes. Espcie A

Espcie B

Considere que populaes das espcies A e B foram reunidas. a) Admitindo que a espcie A parasita da espcie B, represente, nas coordenadas do grfico abaixo, o que esperado para o crescimento da populao da espcie B.

57

BIOLOGIA 3
Espcie B

SUCESSES ECOLGICAS
b) Apresente trs exemplos de organismos representantes da classe dos anfbios. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

UNIDADE 4 SUCESSES ECOLGICAS


b) Admitindo que a espcie A comensal da espcie B, represente, nas coordenadas do grfico abaixo, o que esperado para o crescimento da populao da espcie B. Espcie B Caracteriza-se por alteraes graduais, ordenadas e progressivas no ecossistema resultante da ao contnua dos fatores ambientais sobre os organismos e da reao destes sobre o ambiente. O estgio mximo o Clmax, que se caracteriza por uma comunidade que expressa o mximo de desenvolvimento possvel do ecossistema sob as condies do local em que a sucesso ocorreu. Segundo isso, podemos ter os seguintes processos sucessionais:

QUANTO S FORAS QUE DIRECIONAM O PROCESSO


Sucesso autognica: mudanas ocasionadas por processos biolgicos internos ao sistema Sucesso alognica: direcionamento das mudanas por foras externas ao sistema (incndios, tempestades, processos geolgicos) 9. (UEL 2013) Leia o texto a seguir. A biodiversidade vem sofrendo quedas drsticas na riqueza e na abundncia de espcies de anfbios. No mundo, h mais de 7 mil espcies catalogadas, porm cerca da metade est ameaada e centenas podem estar extintas. Uma das principais causas desse quadro uma doena denominada quitridiomicose, transmissvel pela gua e causada pelo fungo Batrachochytrium dendrobatidis, que infecta a pele, principalmente, do abdmen, dos ps e dos dedos dos anfbios. As leses so visveis apenas com o auxlio de instrumentos pticos, e evidncias da molstia esto associadas a certas mudanas comportamentais do hospedeiro.
(Adaptado de: PEREIRA, P. L.; BCARES, E. Um fungo ameaa os anfbios. Cincia Hoje, v.47, n.279, 2011. p.64-65.)

QUANTO NATUREZA O SUBSTRATO NA ORIGEM DO PROCESSO


Sucesso primria: em substratos no previamente ocupados por organismos, como por exemplo, afloramentos rochosos, exposio de camadas profundas de solo, depsitos de areia, lava vulcnica recm solidificada. Sucesso secundria: em substratos que j foram anteriormente ocupados por uma comunidade e, consequentemente, contm restos de propgulos, detritos, ou seja, matria orgnica viva ou morta. Sucesso Secundria Vegetal: Quando uma planta morre necessrio ser substituda por outra, seja aps um desastre como queimadas, ou mesmo dentro de florestas, quando uma rvore cai ou morre por si. Para que isso ocorra, precisamos de grupos de espcies ideais para cada tipo de microclima. Sendo assim podemos dividir as espcies em grupos, segundo suas caractersticas: Pioneira: Espcies que dependem estritamente de luz para seu desenvolvimento, em todas as fases de sua vida.

a) Identifique e explique o tipo de interao ecolgica existente entre o fungo e o anfbio. Desconsiderando os fungos, explique um exemplo desse mesmo tipo de interao ecolgica entre o ser humano e outro organismo, com o respectivo nome da doena. _________________________________________________ _________________________________________________ _________________________________________________

58

BIOLOGIA 3
Elas iro germinar, crescer e ficarem adultas em clareiras ou ambiente com muita luz. Possuem esse nome, pois so as primeiras a aparecerem em rea desmatada. Secundria inicial e Secundria tardia: possuem caractersticas intermedirias entre Pioneira e Clmax, sendo que, atualmente, os autores nem separam entre inicial e tardia. Clmax: Espcies que podem viver a vida toda na sombra, ou seja, da germinao da semente a maturidade reprodutiva. So chamadas simplesmente de tolerantes.

SUCESSES ECOLGICAS
2. (UEL-2007) Assinale a alternativa que aponta corretamente os indcios de que a sucesso ecolgica chegou a um estgio de clmax: a) Cessam completamente as mudanas na biomassa. A riqueza de espcies atinge um patamar e permanece constante por centenas de milhares de anos. b) As propores da abundncia total representadas por cada espcie assumem um valor fixo e cessam as mudanas em tempo geolgico. c) As mudanas em todas as propriedades bsicas do ecossistema cessam completamente. d) Passa a ser impossvel detectar mudanas, por exemplo, na composio de espcies, aps poucos anos. e) As nicas mudanas que continuam so a especiao e a evoluo. 3. (Unesp 2014) A figura mostra uma antiga rea de cultivo em processo de recuperao ambiental.

EXERCCIOS
1. (UEL-2008) Analise a ilustrao a seguir:

(CAVALHEIRO, A. L. et al. A biologia na produo de sementes e mudas de espcies nativas: noes bsicas. Londrina: EDUEL, 2006. p.12.)

Com base na ilustrao e nos conhecimentos sobre sucesso secundria (ecolgica), analise as afirmativas a seguir: I. As espcies consideradas como pioneiras germinam em locais bem iluminados, crescem rpido, vivem pouco e a rvore adulta apresenta tamanho considerado pequeno ou mdio. II. As espcies consideradas secundrias iniciais podem germinar sombra e a rvore adulta apresenta tamanho considerado grande. III. As espcies consideradas secundrias tardias germinam e crescem em locais bem iluminados, vivem muito e o tamanho da rvore adulta considerado mdio. IV. As espcies consideradas clmax germinam sombra e crescem em locais bem iluminados, vivem muito e a rvore adulta apresenta tamanho considerado grande a muito grande. Assinale a alternativa que contm todas as afirmativas corretas. a) I e II. d) II, III e IV. b) II e IV. e) I, III e IV. c) I e III.

J os grficos representam alteraes que ocorrem nessa rea durante o processo de recuperao.

59

BIOLOGIA 3
Durante o processo de sucesso secundria da rea, em direo ao estabelecimento de uma comunidade clmax florestal, os grficos que representam o nmero de espcies de gramneas, a biomassa, o nmero de espcies de arbustos e a diversidade de espcies so, respectivamente: a) II, III, III e II. d) I, III, II e I. b) III, I, III e II. e) I, III, I e III. c) II, I, III e II. 4. (Fuvest 2014) Considere as seguintes comparaes entre uma comunidade pioneira e uma comunidade clmax, ambas sujeitas s mesmas condies ambientais, em um processo de sucesso ecolgica primria: I. A produtividade primria bruta maior numa comunidade clmax do que numa comunidade pioneira. II. A produtividade primria lquida maior numa comunidade pioneira do que numa comunidade clmax. III. A complexidade de nichos maior numa comunidade pioneira do que numa comunidade clmax. Est CORRETO apenas o que se afirma em: a) I. c) III. b) II. d) I e II. e) I e III. Alguns exemplos de vrus. 1 adenovrus; 2 vrus da poliomelite; 3 bacterifago; 4 vrus do mosaico-do-tabaco; 5 vrus da gripe.

VRUS

CARACTERSTICAS GERAIS DOS VRUS


Os vrus so partculas pequeninas. So visveis apenas no microscpio eletrnico. No tm metabolismo prprio e precisam invadir clulas vivas para se multiplicar. Por isso so chamados de parasitas intracelulares obrigatrios. So formados por uma cpsula protica (capsdeo), que envolve o material gentico. Dentro do capsdio encontram-se as molculas de material gentico que pode ser DNA (ex: vrus da herpes, resfriado e bacterifagos) ou RNA (ex: vrus da AIDS e gripe). Apesar de serem inertes fora da clula hospedeira, quando o vrus invade esta, passa a ter capacidade de reproduo, hereditariedade e mutao. So visveis apenas no microscpio eletrnico.

UNIDADE 5 VRUS

DOENAS CAUSADAS POR VRUS

Os vrus, de acordo com a teoria celular, no so considerados seres vivos, uma vez que no possuem clula. Dizemos ento que eles so acelulares. Os vrus so parasitas celulares obrigatrios, que atacam clulas de animais, de plantas, de fungos ou de bactrias. Quando fora da clula hospedeira, os vrus so completamente inertes e no se reproduzem. No interior da clula hospedeira, porm, um vrus pode originar centenas de novos vrus idnticos.

Charge.

60

BIOLOGIA 3
Como vimos, os vrus sempre invadem clulas de outros seres vivo para se reproduzir. Nas plantas e nos animais a infeco viral causa doenas. Um exemplo de doena de planta causada por vrus o mosaico-do-tabaco, doena que afeta as folhas das plantas de tabaco. As clulas dos seres humanos tambm so alvo de infeces virais. Alguns tipos de vrus so responsveis por doenas menos graves como resfriados, enquanto outros tipos causam doenas mais graves como a poliomielite (paralisia infantil). Algumas doenas causadas por vrus so: AIDS Varola Catapora Febre Amarela Sarampo Rubola Poliomielite Raiva Meningite Caxumba Gripe Dengue Herpes Os vrus so bastante especficos. Atacam poucos tipos ou apenas um tipo de clula especfico. Isso ocorre porque um determinado vrus s consegue infectar as clulas que possuem protenas em suas membranas que so complementares s protenas dos vrus, e permitir portanto, a ligao deste. O vrus da poliomielite, por exemplo, muito especfico e infecta apenas clulas nervosas, da mucosa da garganta e do intestino. J os vrus da rubola no possuem uma especificidade to alta e podem atacar tipos celulares mais diferenciados. Os vrus da gripe so bastante versteis, podendo infectar diversos tipos de clulas humanas e de diferentes animais, como patos, cavalos, porcos, aves, etc. Na maioria dos casos, essa capacidade devida ao fato de o vrus poder se ligar a substncias que esto presentes nas membranas das clulas desses organismos.

VRUS
A gripe contrada quando o vrus da gripe infecta as clulas do corpo, geralmente da via respiratria. A partcula viral penetra no citoplasma onde ocorre a digesto do capsdio por enzimas celulares, libertando o material gentico do vrus, que se multiplica e orienta a fabricao das protenas virais. O material gentico e a protena viral se unem e so expelidos da clula, levando fragmentos da membrana celular, que passam a constituir o envelope viral. No necessariamente h morte da clula hospedeira. O HIV tem um envelope externo formado por lipdios e protenas, contendo no interior o capsdio com duas molculas idnticas de RNA e algumas molculas da enzima transcriptase reversa, que permite a fabricao de DNA a partir das molculas de RNA. Por possuir essa enzima que atua ao reverso, esse vrus e outros semelhantes so chamados retrovrus. O HIV adere clula hospedeira e seu envelope se funde com a membrana celular, liberando o capsdio no interior do citoplasma, onde digerido. Ocorre a liberao do RNA viral e da transcriptase reversa, que produz um DNA a partir do RNA. O DNA formado penetra no ncleo da clula hospedeira e se integra a um dos cromossomos. Esse DNA passa a produzir RNA, que constituir o material gentico de novos vrus ou ser usado na sntese da protena do capsdio e da transcriptase reversa. A clula infectada, por ter o material gentico do vrus integrado a seus cromossomos, pode produzir partculas virais pelo resto da vida. Atacados pelo HIV, os linfcitos T auxiliares (ou clulas CD4) perdem a capacidade de defender o corpo, que passa a contrair infeces que no afetariam uma pessoa sadia.

REPRODUO VIRAL
A reproduo dos vrus bastante simples e ocorre em um curto perodo de tempo. Envolve dois processos bsicos: multiplicao do material gentico e sntese das protenas do capsdio (envoltrio protico que envolve o material gentico). Os vrus bacterifagos, tambm chamados fagos, so inofensivos aos animais, porm parasitam bactrias. Eles injetam apenas o miolo de cido nuclico na bactria, onde ele se reproduz e provoca a formao de numerosos fagos que acabam matando a clula.

Reproduo do vrus HIV, o vrus da AIDS.

Reproduo do vrus bacterifago.

61

BIOLOGIA 3
Reproduo do vrus influenza, o vrus da gripe.

VRUS

EXERCCIOS
1. Existem organismos que, apesar de possurem propriedades como a auto-reproduo, hereditariedade e mutao, so dependentes de clulas hospedeiras e, por isso, considerados parasitas obrigatrios. Tais organismos incluem: a) Procariontes e vrus. b) Bactrias e micoplasmas. c) Bactrias e vrus. d) Somente bactrias. e) Somente vrus. 2. Com relao constituio qumica dos vrus, assinale a alternativa CORRETA: a) DNA + RNA + protenas. b) DNA + protenas ou RNA + protenas. c) lipdios + protenas + DNA. d) somente protenas. e) glicdios + protenas. 3. A AIDS caracteriza-se por um conjunto de infeces oportunistas que se apresentam medida que h queda da imunidade do infectado. O que induz, sobremaneira, essa queda na imunidade a (o): a) Reduo dos linfcitos T. b) Aumento na taxa de glbulos vermelhos. c) Aumento no fluxo sanguneo. d) Aumento no nmero de macrfagos. 4. Com relao ao bacterifago, podemos afirmar que: a) A cpsula do bacterifago constituda de protenas e o miolo, de DNA. b) Somente o miolo de DNA injetado na bactria, nela multiplicando-se. c) A cpsula do bacterifago no penetra na bactria. d) Somente esto corretas as afirmativas a e c. e) Esto corretas as trs primeiras afirmativas. 5. (UEL 2007) Leia o texto a seguir. Faz um sculo que a comunidade cientfica muda repetidamente de ideia sobre a natureza dos vrus. Vistos originalmente como venenos, depois como substncias qumicas biolgicas, considera-se hoje que os vrus estejam numa regio cinzenta entre o vivo e o no vivo. S conseguem se replicar com a ajuda de clulas vivas e podem afetar profundamente o comportamento delas. A categorizao dos vrus como seres sem vida durante a maior parte da histria da biologia moderna teve uma consequncia indesejada: levou os pesquisadores a ignor-los no estudo da evoluo. Finalmente, no entanto, os cientistas esto comeando a entend-los como peas fundamentais da histria da vida. Com base no texto e nos conhecimentos sobre o tema, CORRETO afirmar. a) Nos vrus, a sntese se cidos nuclicos, protenas e outras atividades bioqumicas que possibilitem a sua multiplicao independem da clula hospedeira.

62

BIOLOGIA 3
b) Um vrus pode replicar-se para produzir milhares de partculas virais filhas e essa replicao se d por fisso binria e nas formas mais evoludas por mitose. c) As encefalopatias espongiformes transmissveis, como por exemplo,a doena da vaca louca, so causadas por um vrus que apresenta RNA. d) Os retrovrus, como por exemplo, o causador da hepatite B, so assim chamados porque o DNA genmico transcrito em RNA. e) A enorme populao dos vrus, combinada com suas taxas aceleradas de replicao e mutao, faz deles uma das maiores fontes de variao gentica. 6. (UFPR-2010) Na dcada de 1990 foram descobertas, no genoma de aves e mamferos, inmeras sequncias de DNA que tinham grande similaridade com os retrovrus infecciosos e por isso foram denominadas retrovrus endgenos (RVEs). Sabemos hoje que esses estranhos elementos constituem 8% do genoma humano.
(Fonte: Instituto Cincia Hoje coluna Deriva Gentica.) Sobre os retrovrus endgenos, considere as seguintes afirmativas:

VRUS
aconteceria se uma populao de vrus fosse submetida a vrias drogas, AZT, DDI e Piridinona, que atacassem o mesmo alvo. O alvo a enzima transcriptase reversa, que o HIV usa (...) para integrar seu genoma ao da clula infectada. (...). O resultado foi revolucionrio (...), o vrus acabou perdendo a capacidade de se multiplicar. (...). O tratamento s eficaz quando as drogas so ministradas conjuntamente (...)
(Folha de S.Paulo, 28/ 02/1993.)

Lembre-se de que cada droga reconhece e atua sobre uma regio especfica da enzima transcriptase reversa, e que as enzimas dependem de sua composio de aminocidos e estrutura espacial para exercer sua funo. a) Do ponto de vista evolutivo, e considerando a ao da seleo, explique o que ocorreria com a populao viral se fosse utilizada uma nica droga. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Por que o tratamento s se mostrou eficaz com a administrao conjunta das trs drogas? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 9. (UNESP-2004) A tabela apresenta dados sobre casos de pneumonia asitica (SARS) em quatro diferentes pases, num determinado dia da segunda quinzena de maio de 2003.

I. Retrovrus endgenos surgem a partir da evoluo de genes mutantes do prprio organismo. II. Para que esses elementos surjam, necessria a presena, em algum momento do processo, da enzima transcriptase reversa. III. Os retrovrus endgenos so encontrados no citoplasma das clulas infectadas. IV. A origem de retrovrus endgeno pode se dar a partir da infeco de organismos por vrus que possuem RNA como material gentico. Assinale a alternativa CORRETA. a) Somente a afirmativa II verdadeira. b) Somente as afirmativas I e III so verdadeiras. c) Somente as afirmativas II, III e IV so verdadeiras. d) Somente as afirmativas II e IV so verdadeiras. e) Somente as afirmativas I e IV so verdadeiras. 7. O vrus responsvel pela Aids um retrovrus.Qual o tipo de cido nuclico que constitui o material gentico dos retrovrus? A denominao retrovrus refere-se a que caracterstica desse vrus? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. (UNESP 2003) Darwin ajuda luta contra AIDS: Charles Darwin aprovaria. O novo tratamento contra a AIDS, em desenvolvimento na Universidade Harvard, promete um raro avano no combate doena. Mas, melhor ainda, pela primeira vez uma terapia est levando a srio a teoria da evoluo darwiniana, baseada no princpio da seleo natural (...). A equipe da Universidade resolveu testar o que

O estudo da evoluo da epidemia feito a partir da anlise das seguintes relaes: Entre incidncia e prevalncia, para avaliar uma possvel erradicao (fim da epidemia); Entre os nmeros de mortes e de recuperados, em relao prevalncia, para avaliar a eficincia no tratamento dos infectados. a) Analisando esta tabela, um pesquisador chegou s concluses corretas de que, naquele dia: Um dos quatro pases era o que estava mais distante da erradicao da epidemia; Outro pas era o que apresentava tratamento mais eficiente para os infectados. Quais eram esses pases, respectivamente? _________________________________________________ _________________________________________________

63

BIOLOGIA 3
b) Qual a diferena entre a pneumonia asitica e a pneumonia que mais comumente ocorre no Brasil, por exemplo, quanto aos seus agentes infecciosos? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 10. (UERJ-2004) A partir de fevereiro de 2003, uma doena infectocontagiosa Sndrome Respiratria Aguda Grave (SARS),at ento desconhecida,provocou surtos de pneumonia,principalmente em pases asiticos. No momento,existem evidncias de que o avano dessa epidemia parece ter sido contido. a) Cite o tipo do agente infeccioso isolado a partir de pacientes com SARS e uma outra doena causada por patgeno do mesmo tipo,mas transmitida por picada de mosquito. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Descreva o principal mecanismo de transmisso da SARS e a mais importante medida tomada pelas autoridades de sade pblica para tentar evitar o seu alastramento. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 11. (UFRJ-2003) Em 1928, Alexander Fleming isolou a penicilina a partir de culturas de fungos do gnero Penicilium. Primeiro antibitico conhecido, a penicilina foi produzida em larga escala para o combate s infeces bacterianas. Desde ento, inmeros outros antibiticos foram isolados de seres vivos ou sintetizados em laboratrio. Cada um destes antibiticos interfere em uma via do metabolismo das bactrias. Os antibiticos, porm, so inteis no combate s infeces por vrus. Explique por que os antibiticos no tm efeito contra os vrus. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 12. (UFSCAR-2010) A revista Veja publicou, em sua edio de 29/07/2009, a reportagem No h motivo para alarme onde citadados do Ministrio da Sade mostrando que a gripe comum matou, no mesmo perodo em 2008, 4.500 pessoas, contra 33 mortes causadas pelo vrus H1N1 em 2009. A mesma reportagem mostra que um estudo realizado com ratos comprovou que o vrus H1N1 tem dez vezes mais capacidade de infectar o tecido pulmonar do que o vrus da gripe comum.

VRUS
Desta forma, o problema maior da gripe causada por este vrus sua habilidade em conquistar hospedeiros e no sua letalidade. a) Quais so as principais atitudes individuais a serem tomadas para se evitar o contgio, amplamente veiculadas pelo Ministrio da Sade? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Sobre a reproduo do H1N1 no interior das clulas foi feita a seguinte afirmao: Sendo o H1N1 um vrus de RNA, a duplicao do genoma viral ocorre pela ao de uma enzima, a RNA polimerase, que catalisa a sntese de RNA a partir do DNA da clula hospedeira para a produo de novos vrus. Avalie se esta informao est correta ou no, justificando a sua resposta. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 13. (UNESP-2003) Uma equipe de futebol iria disputar uma partida em uma cidade atingida por epidemia de dengue. A diretoria do clube, aps uma breve visita s dependncias do hotel da cidade, tomou algumas providncias para preservar a sade dos membros da delegao, que iria se instalar dois dias antes do jogo naquela cidade. As instrues previamente transmitidas gerncia do hotel foram: 1 - instalao de telas em todas as janelas. 2 - desinfeco de todos os vasos sanitrios. 3 - instalao de ventiladores nos quartos, para dispersar os agentes patognicos da dengue. 4 - remoo dos vasos de bromlias da rea verde e dos corredores do hotel. 5. colocao de flor nos reservatrios de gua. a) Quais foram as instrues corretas para a preveno da dengue? Justifique. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Que outras doenas, alm da dengue, poderiam ser evitadas com as medidas indicadas na resposta a? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

64

REINO MONERA

UNIDADE 6 REINO MONERA


O Reino Monera (do grego moneres, nico, solitrio), inclui as bactrias e cianobactrias (ou cianofceas). So seres unicelulares (possuem apenas 1 clula) e procariontes (no possuem envoltrio nuclear ausncia de ncleo). Podem ser auttrofas (fotossintetizantes: cianobactrias, certas bactrias prpuras, etc; e quimiossintetizantes: Nitrosomonas e Nitrobacter, que participam da reciclagem do nitrognio em nosso planeta) ou hetertrofas (saprfitas, parasitas, etc). Grande parte das bactrias que conhecemos apresenta nutrio herettrofa, isto , seu alimento consiste em molculas orgnicas produzidas por outros seres vivos. A extrao do alimento a partir dessas molculas ocorre atravs de trs tipos diferentes de processos: respirao aerbica (vivem na presena de oxignio), respirao anaerbica ou fermentao (vivem na ausncia de oxignio). Algumas espcies so anaerbias facultativas, ou seja, respiram na presena de oxignio.

FORMATOS DA CLULA BACTERIANA


As clulas bacterianas esto entre as menores clulas existentes e podem ter as seguintes formas: Cocos: (micrococos, diplococos, estreptococos e estafilococos) Bacilos Vibries Espiroquetas Sarcina

ESTRUTURA DA CLULA BACTERIANA


A clula bacteriana uma clula procarionte tpica. Possui parede celular no celulsica, citoplasma com nucleide (DNA circular preso uma regio da membrana plasmtica chamada mesossomo) e ribossomos. bastante comum a presena de plasmdios, que so pequenas molculas de DNA circular, no ligado ao cromossomo espalhado pelo hialoplasma e que pode conferir resistncia a determinados antibiticos. Sua presena no essencial bactria. Algumas bactrias apresentam um envoltrio externo mucilaginoso constituindo uma cpsula, como o caso dos pneumococos, bactrias causadoras de pneumonia. Muitas espcies contm um ou mais flagelos, que so filamentos proticos ligados membrana e parede celular utilizados para deslocamento celular. Tipos de clulas bacterianas.

DOENAS CAUSADAS POR BACTRIAS


A maioria das espcies de bactrias de vida livre, vivendo em todos os ambientes. Algumas, como as cianobactrias so fotossintetizantes e participam como produtoras na cadeia alimentar. Outras so decompositoras e participam da reciclagem da matria orgnica na natureza. Existem ainda aquelas que so utilizadas na produo de iogurtes, queijos e etc. Apesar de a maior parte das bactrias serem inofensivas ao homem, algumas espcies parasitas causam doenas. Entre elas podemos citar: Difteria Pneumonia Coqueluche Ttano Bronquite Clera Tuberculose Lepra Sfilis Meningite Disenterias bacterianas

REPRODUO BACTERIANA

Estrutura da clula bacteriana.

65

BIOLOGIA 3
As bactrias se reproduzem assexuadamente por diviso binria. Nesse processo a bactria duplica seu nico cromossomo e se divide ao meio, originando duas novas bactrias idnticas. Certas bactrias dividem-se a cada 20 minutos, de modo que em poucas horas uma nica bactria pode produzir milhes de bactrias idnticas. Essa taxa elevada de duplicao responsvel pela variabilidade gentica existente em muitas espcies devido ocorrncia de mutaes. Algumas espcies, em condies adversas, podem formar um esporo que funciona como uma forma de resistncia, denominada de endosporo.

REINO MONERA
inadequadas e por tempo insuficiente, certamente ocorrer a seleo de linhagens previamente resistentes na populao de bactrias que se quer combater. Outros motivos que podem favorecer a seleo de variedades resistentes so o uso abusivo dessas drogas em hospitais e consultrios, alm da sua utilizao como aditivo em raes animais para engorda.

Reproduo assexuada por diviso binria.

Tipos de reproduo sexuada nas bactrias.

Microfotografia ao microscpio eletrnico mostrando a formao de endsporo na bactria Bacillus thuringiensis. Tambm podem ocorrer trs formas de reproduo sexuada. Na conjugao, duas bactrias trocam fragmentos de DNA, que pode atuar independentemente ou se ligar ao genoma da bactria que o recebeu. Na transduo ocorre a transferncia de um fragmento de DNA com a participao de um vrus. Na transformao, pequenos fragmentos de DNA presentes no meio em que vivem so absorvidos e se incorporam ao genoma bacteriano. Esses trs processos so pouco freqentes e aumentam a variabilidade gentica nas bactrias. Assim, uma bactria resistente a determinado antibitico poderia transferir essa resistncia a outra bactria, mesmo que sejam de espcies diferentes. Um mecanismo bastante importante que favorece a existncia de resistncia bacteriana a anti-biticos a ocorrncia de mutaes no material gentico desses microrganismos. O uso indiscriminado de antibiticos e sem critrios, favorecidos pela automedicao, podem contribuir para o aumento da resistncia bacteriana a essas drogas. Ingeridos em doses

CLASSIFICAO DOS PROCARIONTES


Os procariontes so divididos em dois grupos: Eubactrias e Arqueobactrias. No primeiro esto presentes a maioria das bactrias conhecidas, entre elas as causadoras de doenas e as cianobactrias. As Arqueobactrias (ou simplesmente Arqueas) so representadas por um nmero pequeno de espcies, que vivem em condies ambientais extremamente rigorosas. As metanognicas sintetizam metano, so anaerbias obrigatrias e vivem em lixes, pntanos e no trato digestrio de vacas e bois. As halfilas vivem em locais extremamente salinos, como, por exemplo, o mar Morto. As termfilas vivem em habitats de temperaturas elevadas, que podem atingir 105 C. As arqueas so consideradas evolutivamente mais avanadas que as demais bactrias.

CIANOBACTRIAS (CIANOFCEAS)

As cianobactrias eram antigamente chamadas cianofceas ou algas azuis e classificadas no grupo das algas. Nas classificaes modernas, esses organismos foram includos no grupo das eubactrias, pois, apesar de possurem pigmentos e processo

66

BIOLOGIA 3
fotossinttico semelhantes ao das algas, as cianobactrias tm sua organizao celular procarionte, como as demais bactrias. So todas auttrofas fotossintetizantes (responsveis pela maior parte da fotossntese) que, alm da clorofila a, possuem diversos outros pigmentos acessrios como carotenide, ficocianina (azul), ficoeritrina (vermelho). No entanto, suas clulas no possuem cloroplastos e os pigmentos encontram-se em tilacides perifricos. Assim como algumas bactrias, as cianofceas so tambm fixadoras de nitrognio. Elas vivem no mar, gua doce e no ambiente terrestre mido. H espcies que possuem clulas isoladas e outras que formam colnias de diferentes formatos. A reproduo similar a das outras bactrias.

REINO MONERA
3. (Uepa-2012) Artefato blico desenvolvido para espalhar agentes vivos, capazes de infectar um grande nmero de pessoas, chamado de arma biolgica, contendo vrus e bactrias modificados geneticamente em laboratrios, para se tornarem resistentes, matando ou incapacitando humanos, animais e plantas de uma nao adversria. Potencialmente, para este fim, destacam-se os bacilos Bacillus anthracis e Clostridium botulinum, os vrus da varola e o ebola. A respeito dos microorganismos destacados, afirma-se que: a) Pertencem ao mesmo reino por no apresentar material gentico envolvido pela carioteca. b) As bactrias pertencem ao mesmo gnero porque possuem forma esfrica. c) So auttrofos e s se reproduzem no interior de outras clulas. d) Formam esporos que so as estruturas de resistncia no ambiente externo. e) As bactrias possuem mesma forma e pertencem a gneros e espcies diferentes. 3. A bactria Streptococcus iniae afeta o crebro de peixes, causando a doena do peixe louco. A partir de 1955, os criadores de trutas de Israel comearam a vacinar seus peixes. Apesar disso, em 1997, ocorreu uma epidemia causada por uma bactria resistente vacina. Os cientistas acreditam que essa linhagem surgiu por presso evolutiva induzida pela vacina, o que quer dizer que a vacina: a) Induziu mutaes especficas nas bactrias tornando-as resistentes ao medicamento. b) Induziu mutaes especficas nos peixes, tornando-os suscetveis infeco pela outra linhagem de bactria. c) Causou enfraquecimento dos rgos dos peixes, permitindo sua infeco pela outra linhagem de bactria. d) Levou ao desenvolvimento de anticorpos especficos que, ao se ligarem s bactrias, tornaram-nas mais agressivas. e) Permitiu a proliferao de bactrias mutantes resistentes, ao impedir o desenvolvimento das bactrias da linhagem original. 4. A resistncia s drogas antimicrobianas um problema srio no combate as infeces. A principal causa do aparecimento de organismos resistentes o uso excessivo e inapropriado dos antibiticos, o que resulta na seleo de cepas de bactrias resistentes. Alm disso, a resistncia aos antimicrobianos pode ser passada de uma bactria para outra por meio da transferncia de material gentico. Baseado no texto e nos conhecimentos sobre o tema, assinale a alternativa que apresenta a estrutura que contm genes de resistncia a antimicrobianos: a) Pili b) Cpsula c) Plsmideo d) Flagelo e) Membrana citoplasmtica.

IMPORTNCIA
Recordamo-nos na maioria das vezes das bactrias como sendo causadoras de doenas (patognicas). Muitas, entretanto, so utilizadas pelo ser humano com inmeras finalidades e extremamente teis para o meio ambiente. As bactrias so amplamente utilizadas em processos industriais, como na produo de queijo e outros derivados do leite. Na produo de vinagre, so utilizadas bactrias do gnero Acetobacter que convertem o lcool do vinho em cido actico. A tecnologia do DNA recombinante ou Engenharia Gentica, tem permitido modificar geneticamente certas bactrias, fazendoas produzir substncias de interesse comercia, como a insulina e hormnio de crescimento humanos, produzidos por bactrias geneticamente modificadas. Um dos papis mais importantes desses seres vivos na natureza a decomposio da matria orgnica morta, permitindo a ciclagem dos nutrientes. Um nutriente muito importante para as plantas o nitrognio, e o seu ciclo s permitido graas a algumas espcies de bactrias (Rhizobium).

EXERCCIOS
1. Um estudante de Biologia, ao observar um microrganismo ao microscpio eletrnico, visualizou uma clula com material gentico disperso no citoplasma e ausncia de estruturas intracelulares, como mitocndria, retculo endoplasmtico e complexo de Golgi. Baseado no texto e nos conhecimentos sobre o tema, CORRETO afirmar que se tratava de: a) Vrus d) Bactria b) Fungo e) Alga c) Protozorio 2. D-se o nome de organismo auttrofo quele que: a) capaz de sintetizar seus prprios alimentos a partir da glicose. b) no realiza a fotossntese. c) depende do outro organismo vivo para a obteno de alimento. d) capaz de sintetizar seus prprios alimentos a partir de substncias qumicas inorgnicas. e) aquele que capaz de locomover-se na coluna dgua.

67

BIOLOGIA 3
5. Observe os esquemas abaixo.

REINO MONERA
Com base nas informaes do texto e em seus conhecimentos sobre biologia, assinale a alternativa CORRETA. a) O nmero expressivo de espcies de bactrias obtido com apenas 8% da cobertura vegetal restante indica que o nmero de espcies deveria ser muito superior ao estimado de 13 milhes caso a floresta estivesse mais conservada. b) Alm da Mata Atlntica ser conhecida pela grande biodiversidade de vegetais e animais, o estudo destaca a riqueza de espcies do reino protista presente nas folhas das rvores. c) O texto indica que toda a rica biodiversidade de bactrias, alm de ser espantosa pelo nmero, possui imenso potencial de aplicao imediata j identificado na pesquisa. d) O interesse da pesquisa sobre as bactrias da Mata Atlntica determinar o papel ecolgico que as substncias que produzem executam no ecossistema, para que essas bactrias possam ser combatidas. e) Para um nmero to grande de espcies a serem descritas, o sistema binomial de classificao de Lineu no suficiente e deve ser substitudo por outro sistema de classificao molecular. 8. (Uepa-2012) Artefato blico desenvolvido para espalhar agentes vivos, capazes de infectar um grande nmero de pessoas, chamado de arma biolgica, contendo vrus e bactrias modificados geneticamente em laboratrios, para se tornarem resistentes, matando ou incapacitando humanos, animais e plantas de uma nao adversria. Potencialmente, para este fim, destacam-se os bacilos Bacillus anthracis e Clostridium botulinum, os vrus da varola e o ebola. A respeito dos microorganismos destacados, afirma-se que: a) Pertencem ao mesmo reino por no apresentar material gentico envolvido pela carioteca. b) As bactrias pertencem ao mesmo gnero porque possuem forma esfrica. c) So auttrofos e s se reproduzem no interior de outras clulas. d) Formam esporos que so as estruturas de resistncia no ambiente externo. e) As bactrias possuem mesma forma e pertencem a gneros e espcies diferentes. 9. Surto de clera atinge centenas de pessoas na cidade paranaense de Paranagu. Num perodo de apenas 12 dias, mais de 290 habitantes da cidade de Paranagu,foram parar em hospitais com forte diarreia e uma perigosa desidratao.O clera voltou a atacar e com fora. a) Identifique o reino a que pertence o agente etiolgico do clera. _________________________________________________ _________________________________________________

Uma clula eucaritica est representada apenas em: a) I. c) III. e) II e em III. b) II. d) I e em II. 6. Das alternativas abaixo, assinale aquela em que as duas caractersticas sejam comuns a todos os indivduos do reino Monera. a) Ausncia de carioteca e parasitismo obrigatrio b) Presena de carioteca e ausncia de membrana plasmtica c) Ausncia de DNA e RNA e capacidade de sntese protica d) Ausncia de carioteca e capacidade de fotossntese e) Ausncia de carioteca e capacidade de sntese protica. 7. (UFPR/ Litoral-2010) Leia atentamente o artigo: Resultados preliminares de um estudo feito por quatro pesquisadores brasileiros e um norte-americano indicam que 97% das espcies de bactrias identificadas nas folhas das rvores da Mata Atlntica so desconhecidas pela cincia. A identificao das bactrias foi por um mtodo de reconhecimento de trechos especficos de DNA. Os dados sugerem que, apenas nesse bioma, pode haver at 13 milhes de espcies de bactrias, ou quase trs mil vezes mais do que o total conhecido hoje e isso porque s restam 8% da superfcie original da Mata Atlntica. O artigo publicado na Science relata apenas as primeiras concluses da equipe. No momento, eles j comearam o levantamento bacteriolgico em um nmero maior de espcies de plantas em outras reas da Mata Atlntica. Um dos objetivos futuros do trabalho explorar essas comunidades bacterianas. Cultiv-las, investigar se elas produzem alguma substncia de interesse farmacutico ou agrcola e determinar seu papel ecolgico, diz Lambais. As possibilidades so tantas que, quanto mais dados obtemos, mais se abre o leque de aproveitamento desses microrganismos.
(VERJOVSKY. Marina. Diversidade insuspeita: rvores da Mata Atlntica podem abrigar milhes de espcies de bactrias desconhecidas. Cincia Hoje online, 29 jun. 2006 Adaptado.)

68

BIOLOGIA 3
b) Cite duas formas de proteo contra essa doena. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 10) Os antibiticos e as vacinas fazem parte do arsenal da medicina, auxiliando-nos no combate s doenas provocadas por agentes infecciosos. Dentre essas doenas, podemos citar: tuberculose, gripe, hepatite, febre-amarela, gonorria. a) Das doenas citadas, para quais delas se prescreve tratamento com antibiticos? _________________________________________________ _________________________________________________ b) Porque os antibiticos so indicados para os casos de infeces cujos agentes so bactrias, enquanto as vacinas so indicadas para a preveno de infeces virais? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 11. (UNICAMP-2011) Doenas graves como o botulismo, a lepra, a meningite, o ttano e a febre maculosa so causadas por bactrias. As bactrias, no entanto, podem ser teis em tecnologias que empregam a manipulao de DNA, funcionando como verdadeiras fbricas de medicamentos como a insulina. a) Explique como a bactria pode ser utilizada para a produo de medicamentos. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) O botulismo e o ttano decorrem da ao de toxinas produzidas por bactrias que so adquiridas de diferentes formas pelos seres humanos. Como pode ocorrer a contaminao por essas bactrias? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 1. Soma: 28 2. Soma: 3 3. a 4. d 5. d 6. c

GABARITOS
UNIDADE 1

UNIDADE 2
1. c 2. b 3. e 4. e 5. b 6. e 7. a 8. c 9. a 10. d 11. a 12. Discursiva 13. Discursiva 14. Discursiva

UNIDADE 3
1. b 4. c 2. c 5. e 3. c 6. e

7. Discursiva 8. Discursiva 9. Discursiva

69

BIOLOGIA 3

GABARITOS
utilize mscaras cirrgicas para evitar a contami nao; no compartilhe talheres, copos, toalhas e objetos de uso pessoal; no use medicamentos antivirais sem a recomendao mdica. b) A informao est incorreta. Em nenhum mo mento, o DNA da clula hospedeira poder pro duzir cpias do RNA viral. 13. a) Instrues 1 e 4, porque impedem a disperso e proliferao dos mosquitos vetores. b) Febre amarela e malria.

UNIDADE 4
1. a 2. d 3. e 4. d

UNIDADE 5
1. e 3. a 5. e 2. b 4. e 6. d

7. O material gentico constituinte de retrovrus o RNA.O termo retrovrus refere-se ao fato de ele executar a transcrio ao contrrio,isto , produzir molculas de DNA de cadeia dupla a partir de molculas de RNA,pela ao da enzima transcriptase reversa. 8. a) Do ponto de vista evolutivo, o uso de uma nica droga aumentaria a probabilidade de serem selecionadas linhagens virais resistentes a esse medicamento, anulando o seu efeito. b) O uso conjunto das trs drogas pode ocasionar mudanas nos aminocidos, na estrutura espacial da enzima, no seu centro ativo etc., inativando a enzima e melhorando a eficcia do tratamento. 9. a) Respectivamente, M e L. b) O agente etiolgico da pneumonia asitica o corona vrus. O agente causador da pneumonia que mais comumente ocorre no Brasil uma bactria. 10. a) O agente um vrus .Outra doena causada por vrus a febre amarela,transmitida pela picada do mosquito Aedes aegypti,que o inocula atravs da saliva. b) O vrus causador da SARS transmitido pelo ar ou por objetos contaminados por partculas virais liberadas pelos portadores.A medida mais importante tomada pelas autoridades para evitar o alastramento da doena foi o completo isolamento das pessoas infectadas, at sua total recuperao. 11. Os vrus so parasitas celulares que no possuem metabolismo prprio. 12. a) A preveno da gripe H1N1 pode ser feita se guindo-se algumas recomendaes: quando tossir ou espirrar, cubra o nariz e a boca com um leno de papel, e jogue o leno num cesto de lixo; lave as mos com gua e sabo;

UNIDADE 6
1. d 3. e 5. d 7. a 2. d 4. c 6. e 8. e

9. a) Reino monera b) Transmitido pela gua contaminada por fezes de pessoas infectadas,causa fortes diarrias com desidratao e debilitao fsica. Uma das melhores formas de prevenir essa doena consiste em melhorar o saneamento bsico,com tratamento de gua e esgotos. 10. a) Antibiticos so prescritos para doenas causadas por bactrias,como tuberculose e gonorria. b) Antibiticos so substncias que afetam especificamente o metabolismo de clulas bacterianas como a sntese de DNA, de RNA, de protenas e da parede celular.Como os vrus so acelulares e utilizam o metabolismo da clula hospedeira,eles no so afetados por essas drogas. As vacinas estimulam o organismo a produzir anticorpos. 11. a) A bactria, fruto da manipulao de DNA, transgnica, isto , recebe, incorpora e expressa um gene que lhe estranho. Tal gene implantado tem a codificao gentica que leva sntese de uma protena com uso de interesse do ponto de vista mdico. b) O botulismo e o ttano so exemplos de infeces provocadas por bactrias que liberam exotoxinas. No caso do botulismo, a contaminao faz-se por intermdio de alimentos que apresentam a exotoxina botulnica, como, por exemplo, palmito em conserva. No ttano, a contaminao feita por esporos do Clostridium tetani, que adentra o organismo atravs de ferimentos na pele, feita por objetos contaminados.

70

ESPANHOL
73 Gramtica .................................................... 73 Ejercicios ..................................................... 74

01

INTRODUCCIN AL ESPAOL

pg

77 Gramtica .................................................... 78 Ejercicios ..................................................... 78

04

EL MUNDO INSLITO DE LA LITERATURA

pg

74 Gramtica .................................................... 75 Ejercicios ..................................................... 75

02

LA MSICA HISPANOAMERICANA

pg

80 Gramtica .................................................... 80 Ejercicios ..................................................... 80

05

TEATRO Y CINE ESPAOL E HISPANOAMERICANO

pg

76 Gramtica .................................................... 76 Ejercicios ..................................................... 77

03

LA PINTURA HISPNICA

pg

06

FIESTAS Y MANIFESTACIONES pg 82 CULTURALES

Gramtica .................................................... 82 Ejercicios ..................................................... 82

INTRODUCCIN AL ESPAOL

UNIDAD 1 INTRODUCCIN AL ESPAOL


nem insider, nem outsider, mas in-between. Num entre-lugar, entre culturas e tradies, o sujeito cultural hbrido fala a partir da fronteira ele um intelectual fronteirio ou da passagem entre espaos e tempos diferentes.

CASTELLANO O ESPAOL?

LA COLONIZACIN ESPAOLA

La colonizacin espaola de Amrica fue parte de un proceso histrico ms amplio, denominado posteriormente colonialismo, mediante el cual diversas potencias europeas se lanzaron a explorar regiones desconocidas para ellos que no figuraban en ninguna cartografa; descubrieron tierras y pueblos que cambiaron su visin del mundo entre los siglos XVI y XX. Con la transformacin de Espaa en un estado liberal, se inicia el desmembramiento del Imperio espaol en Amrica, trasladando de Espaa, y mezclando con Amrica, muchos de los aspectos socio-culturales, lingsticos, religiosos... As, fue criado en esas tierras, un nuevo pueblo con una nueva identidad: la identidad hispanoamericana.

El espaol naci en el reino de Castilla, por este motivo se denomin castellano. Cuando el castellano se expandi por otros reinos peninsulares y fue trado a Amrica, pas a denominarse espaol, aunque an hoy, especialmente en Sudamrica, el nombre castellano alterna con espaol. El espaol es la cuarta lengua del mundo por nmero de hablantes y la segunda como lengua de comunicacin internacional. Alrededor de 400 millones de personas distribuidas en 20 pases hablan espaol como lengua materna. Es uno de los idiomas oficiales de la ONU, UNESCO, UNIN EUROPEA y del MERCOSUR. Su importancia se debe, no solamente al nmero de hablantes, sino tambin a su extensin y a su difusin internacional.

GRAMTICA
EL ALFABETO
Slo hay una letra en el alfabeto espaol que no existe en el portugus, la letra ; ella sustituye, en casi todos los casos, la nh del portugus, ejemplo: compaa (esp.) - companhia (port.). Existe tambin, en algunos casos, diferencias de pronunciacin en las siguientes letras: d, e, g, j, l, o, r, s, t, v, x, z. A pesar de la cercana entre el espaol y el portugus, existen muchas diferencias en la escrita, ojo! No todo que parece lo es.

LOS ARTCULOS DETERMINANTES


Masculino EL LOS Feminino LA LAS

INDETERMINANTES
Masculino UN UNOS Feminino UNA UNAS

Artculo neutro LO El artculo neutro LO normalmente se antepone a adjetivos y adverbios. Nunca se usa antes de sustantivos. Ejemplo: Lo bueno de la vida son los amigos.

73

ESPANHOL

LA MSICA HISPANOAMERICANA
4. La nica pregunta que encuentra respuesta en el texto es: a) Qu promedio de palabras fueron las preferidas por los internautas? b) Cuntos pases estn estudiando el espaol hoy en da? c) Cundo el espaol y el portugus fueron desarraigados de su propio entorno? d) Qu datos estadsticos expuestos estn vinculados a la celebracin? e) En qu pases la lengua espaola ha sido consagrada idioma oficial? 5. Basado en la alternativa correcta del ejercicio anterior, conteste esta pregunta con informaciones extradas del texto: _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 6. Encuentre palabras del portugus que correspondan a rincones y aoranza del espaol: _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

EJERCICIOS
1. La crisis actual en el mundo atinge ____ economa, ____ gobierno, ___ cultural y ____ social. a) la- el-lo-lo d) la-lo-lo-lo b) la-la-el-lo e) la-lo-el-lo c) el-el-lo-el 2. Completa con los artculos que corresponda: a) _______ vaca es _______ animal rumiante. b) Mi casa tiene _______ puerta de madera. c) ______ familia de Juan es grande. d) Pedro tiene ______ automvil nuevo. e) ______ avin sale a ____ nueve y media. f) Brasil es ______ pas muy grande. e) Tengo ____ caballo muy veloz. f) ______ artculos acompaan a ____ sustantivos. g) _______ equipo de Corinthians es mejor que ______ otros. Comprensin de texto: EL DA DEL ESPAOL EN TODOS LOS RINCONES DEL MUNDO El 20 de junio de 2009 se celebr en 43 pases de todo el mundo el Da del Espaol, con el objetivo de mostrar la importancia de este idioma hablado por 450 millones de personas y oficial en 21 pases. Se realizaron jornadas de puertas abiertas en centros de enseanza de espaol, a fin de incrementar la visibilidad de la lengua espaola en el mundo y crear un punto de encuentro para todos los hablantes de espaol. Se lanz una lluvia de palabras en espaol propuestas por los internautas, quienes prefirieron las relacionadas con la memoria y la aoranza. Por otro lado, tambin se present el informe sobre el estado de la lengua espaola en el mundo, donde se puso de manifiesto que dentro de tres generaciones el idioma espaol ser entendido por el 10% de la poblacin mundial y que, en el ao 2050, Estados Unidos ser el primer pas hispanohablante del mundo. Esta celebracin naci con vocacin de continuidad en el tiempo y sirve para conmemorar el valor del espaol como lengua de comunicacin internacional. Su proyeccin internacional, su vitalidad y potencial en esta sociedad del conocimiento quedan patentes en el hecho de haberse convertido en la segunda lengua ms estudiada en el planeta. Unidad y diversidad forman la expresin americana. Tanto la lengua espaola como la portuguesa se han originado en Hispania. Arrancadas de su suelo natal, fueron plantadas en las tierras nuevas, se juntaron a otras culturas y se transformaron en las modernas lenguas espaola y portuguesa. 3. La lectura del texto permite concluir CORRECTAMENTE que: a) El Da del Espaol es una conmemoracin con vistas a permanecer. b) La lengua espaola ser dominada por un 10% de los habitantes de todo el planeta. c) Los internautas prefirieron elegir las palabras memoria y aoranza. d) la celebracin consigui reunir espaoles de todo el mundo. e) en menos de veinte aos Estados Unidos ser el primero de los pases hispanohablantes.

UNIDAD 2 LA MSICA HISPANOAMERICANA


Hay diversos estilos musicales en latinoamrica, nacidos de la mezcla de elementos musicales europeus, africanos e indgenas. Hoy en da, generalmente se acepta que los ritmos latinos son sincrticos. Especficamente, las formas espanholas de composicin de cancinones, los ritmos africanos y la harmonia europea son partes fundamentales de la msica tropical latina, as como los gneros ms modernos como el rock, el heavy metal, el punk, el hip hop, el jazz y el reggae. La riqueza sonora desarrolla la variedad de danzas tpicas, abajo podrs conferir danzas espaolas y hispanoamericanas:

FLAMENCO

Forma de expresin artstica originada en Andaluca, que a lo largo de los aos se ha convertido en la ms conocida expresin de cultura espaola. Las tres principales herramientas del flamenco son: el canto, la guitarra y la danza. Sin embargo, ms importante que su historia y sus tcnicas, el flamenco es una actitud, es la manifestacin del alma de una persona.

74

ESPANHOL

LA MSICA HISPANOAMERICANA
El uso del vos 2 p.s.: El voseo se da en la mayor parte de Hispanoamrica, aunque en diferente grado. Su consideracin social tambin vara de unas regiones a otras. Alternan con el tuteo. Son reas de voseo generalizado la Argentina, el Uruguay y el Paraguay. Ej.: Vos ss divertido. El uso informal tuteo 2p.s.: Se usa, generalmente, entre amigos, familiares y conocidos. Para tutear es necesario que haya intimidad entre los hablantes. Es considerado un tratamiento informal. Ej.: T eres mi amigo. El uso formal - usted (ud.) 3p.s.: En Hispanoamrica y en Espaa se usa para el tratamiento formal, cuando hay poca intimidad o cuando el hablante se encuentra en una situacin comunicativa que exige formalidad. Es considerado un tratamiento formal. Ej.: Usted es gentil.

TANGO

Alrededor de 1880, en Buenos Aires, capital de la Argentina, inmigrantes de Europa y frica se reunan en los bares y burdeles en busca de unas copas y algo de compaa, y de sus dificultades naci el tango. La msica y el baile se inspiran fuertemente en muchas naciones de inmigrantes. El tango habla de una existencia fatal, en la que el dolor y la pena son el destino esperado. Fue Carlos Gardel el mximo exponente del tango argentino en el mundo.

REGGAETON

El reggaeton es un gnero musical procedente del reggae con influencias del hip hop, que se desarroll por primera vez en Panam hacia mediados de los aos 1980 y a comienzos de los aos 1990 en Puerto Rico, tiene como raz la comunidad jamaiquina junto a inmigrantes antillanos. El reggaetn pas de ser gnero clandestino, a ser uno de los principales gneros ms populares en Amrica Latina. Ya no s maana, El Original Yo no s si t no s si yo seguiremos siendo como hoy no s si despus de amanecer vamos a sentir la misma sed para que pensar y suponer, no preguntes cosas que no s yo no s... no se donde vamos a parar, eso ya la piel nos lo dir para que jurar y prometer algo que no est en nuestro poder yo no s lo que es eterno no me pidas algo que es del tiempo Yo no s maana, yo no s maana si estaremos juntos si se acaba el mundo yo no s si soy para ti si sers para mi si lleguemos amarnos o a odiarnos yo no s maana, yo no s maana quien va estar aqu De un caf pasamos al sof, de un botn a todo lo dems no pusimos reglas ni reloj, aqu estamos solos tu y yo todo lo que ves es lo que soy, no me pidas ms de lo que doy no... Yo no s maana, yo no s maana si estaremos juntos si se acaba el mundo yo no s si soy para ti si sers para mi si lleguemos amarnos o a odiarnos yo no s maana, yo no s maana quien va estar aqu.
Disponible en: http://www.vagalume.com.br/el-original/yo-no-se-manana. html#ixzz22hVpBw2z

EJERCICIOS
1. Abajo, identifica con una F las frases que contengan un grado de formalidad y con una I las frases que posean elementos informales. Dnde vive usted? ( ) Vivo en Barcelona y t dnde vives? ( ) Cmo se llama? ( ) En qu trabajas? ( ) Cul es tu direccin? ( ) Comprensin de texto:

GRAMTICA
LOS PRONOMBRES SUJETOS
Yo T l / Ella / Usted Nosotros (as) Vosotros (as) Ellos / Ellas / Ustedes

FE (Man) No puedo entender este mundo como es, que uno puede odiar herir y traicionar por qu? Cmo puede ser que haya gente que pueda matar por diferencia de opinin por tierra o por religin, no s (...) FE. Dame fe, dame alas, dame fuerza para sobrevivir, en este mundo. Cmo puede ser que haya tanta destruccin, en vez de resolver les enferma todo el poder. Que esto quede claro: Hay que amarnos como hermanos, Tenemos el valor, para darnos ms amor lo s, ya lo s. (...) El mundo puede cambiar slo hay que intentarlo, no hay que odiar, hay que amar (...) hay que intentar, hay que intentar no hay que perder la fe. Dame fe, dame alas, dame fuerza para sobrevivir, en este mundo. (...)

75

ESPANHOL
2. Sobre o texto, assinale o que for CORRETO. (01) O autor do texto est conformado, pois essas que matam por possurem opinies divergentes so comuns no mundo de hoje. (02) Na frase hay que amar, as partculas sublinhadas denotam a existncia do amor. (08) Em Cmo puede ser que haya tanta destruccin, ..., a palavra haya pode ser substituda por exista sem alterar o sentido da frase. (16) O autor solicita que lhe sejam dadas f e fora para sobreviver neste mundo. Soma:_____

LA PINTURA HISPNICA
6. Assinale a alternativa que contenha a pessoa verbal correspondente a frase abaixo: Ands siempre por los mismos caminos. ( ) T ( ) Vos ( ) Usted

7. Identifique nas frases abaixo as pessoas verbais: Cuando me levant an no eran las siete. _________________________________________________ Nadie os dijo que no lo contaseis. _________________________________________________ Fuimos a comer con ellos; lo dems no es asunto tuyo. _________________________________________________ Cuando te acuestas tarde, ests insoportable. _________________________________________________ Alguno de mis amigos no acudi a la cita para no molestaros. _________________________________________________ 8. Existe diferena de formalidade entre vosotros e ustedes? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Leia o trecho da letra de tango do argentino Carlos Gardel e em seguida responda as seguintes questes: Caminito que el tiempo ha borrado que juntos un da nos viste pasar he venido por ltima vez he venido a contarte mi mal. Caminito que entonces estabas bordeado de trbol y juncos en flor una sombra ya pronto sers una sombra lo mismo que yo. Desde que se fue triste vivo yo, caminito amigo, yo tambin me voy. Desde que se fue nunca ms volvi seguir sus pasos, caminito, adis. 3. A forma que o autor trata o Caminito formal ou informal? _________________________________________________ _________________________________________________ 4. Quem foi apagado? Por que? _________________________________________________ _________________________________________________ 5. Qual o motivo do expresso na cano para a composio desses versos? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

UNIDAD 3 LA PINTURA HISPNICA


La historia ha proporcionado a la pintura gran cantidad de episodios susceptibles de ser plasmados en un lienzo. De hecho, el gnero histrico ha sido en ciertas pocas, equiparable al religioso, mitolgico, paisajstico o retratstico. Adems de otras fuentes (arqueologa, textos, etc.). La pintura puede servirnos para ver en imgenes los sucesos que sucedieron antao y que no pudieron ser registrados en fotografa, vdeo o pelcula por no existir semejantes medios audiovisuales. Muchos nombres hispnicos tuvieron reconocimiento mundial por obtener xito en el arte de la pintura, como los espaoles: Diego Velzquez, El Greco, Francisco Goya, Joan Mir, Pablo Picasso, Salvador Dal y los mexicanos Frida Kahlo y Diego Rivera.

GRAMTICA
EL CAMBIO DE GNERO DEL ARTCULO = LOS HETEROHNRICOS
Delante de sustantivos femeninos que empiezan con A o HA tnicas, se usan artculos masculinos, para que la construccin sea eufnica. Ejemplo: El agua / Un alma

76

ESPANHOL

EL MUNDO INSLITO DE LA LITERATURA


Los premios sern notificados personalmente por la Galera a los ganadores, no podrn ser canjeados por su valor en metlico y cada concursante solo podr optar a un nico premio. El jurado podr declarar desierto alguno de los premios. 3. En la noticia se dice que el texto que acompae a la acuarela constar de un mnimo de 10 lneas. a) Verdadero b) Falso 4. En el texto se dice que la identidad del jurado se mantendr oculta hasta que se d a conocer el nombre del ganador. a) Verdadero b) Falso 5. Segn el texto, el nombre del ganador aparecer publicado en internet. a) Verdadero b) Falso 6. Mallorca e Menorca so: a) Cidades c) Distritos b) Pases d) Ilhas Las dos Fridas Frida Kalo 7. Quais pessoas podem participar do concurso? _________________________________________________ _________________________________________________ _________________________________________________ 8. Por quem ser analizado os trabalhos enviados? _________________________________________________ _________________________________________________ _________________________________________________

EJERCICIOS
1. Enseguida, completa con los artculos y sus contracciones adecuados el texto sobre Frida Kahlo: Marcada por ____ trgico accidente a ____ 18 aos y por ____ vida entera de sufrimientos fsicos, Frida consigui ser, an as, ____ gran pintora mexicana ____ siglo XX. Trgica, apasionada y genial, sintetiza ____ alma femenina de Amrica Latina con ____ arte sobre lienzos.

2. Intenta advinar los colores del cuadro de Frida marcndolos con una x: ( ) Amarrillo ( ) Marrn ( ) Azul ( ) Naranja ( ) Beige ( ) Negro ( ) Blanco ( ) Rojo ( ) Dorado ( ) Rosa ( ) Gris ( ) Verde ( ) Morado Comprensin de texto: CONCURSO DE PINTURA Prepara tu maleta y disponte a pasar unos das inolvidables en Mallorca y Menorca, unas islas llenas de encanto y exotismo inigualables, o una estancia privilegiada en el Pas vasco, porque estos son los premios que obtendrn los ganadores del concurso de pintura de la Galera de arte Joan Mir. En este concurso pictrico podrn participar todas las personas mayores de edad y residentes en espaa que estn interesadas en el tema de los viajes. Solo tendrn que enviar una acuarela de tema paisajstico con un comentario sobre la misma de no ms de 10 lneas de extensin. Optarn al premio todas las acuarelas recibidas entre el 2 de junio y el 30 de septiembre y el envo de las mismas se realizar a travs de correo postal a la siguiente direccin: Galera de arte Joan Mir. calle de Las Mercedes 16, 1c. 08040 Barcelona. Se deber indicar el nombre, el domicilio y el telfono del autor. No se admitirn seudnimos ni pinturas en las que no figuren todos los datos sealados. Las acuarelas recibidas sern valoradas por un jurado compuesto por profesionales relacionados con el mundo de la pintura. La identidad de los miembros del jurado no se har pblica hasta la emisin del fallo, que se publicar el 10 de noviembre.

UNIDAD 4 EL MUNDO INSLITO DE LA LITERATURA


Espaola e Hispanoameircana
EL BOOM LATINOAMERICANO .Gabriel Garca Mrquez .Jorge Luis Borges .Leopoldo Lugones .Julio Cortzar .Pablo Neruda .Alejo Carpentier .Carlos Fuentes .Octavio Paz . Mario Vargas Llosa

77

ESPANHOL
"La cueva", Fernando Iwasaki "CUANDO ERA NIO me encantaba jugar con mis hermanas debajo de las colchas de la cama de mis paps. A veces jugbamos a que era una tienda de campaa y otras nos creamos que era un igl en medio del polo, aunque el juego ms bonito era el de la cueva. Qu grande era la cama de mis paps! Una vez cog la linterna de la mesa de noche y le dije a mis hermanas que me iba a explorar el fondo de la cueva. Al principio se rean, despus se pusieron nerviosas y terminaron llamndome a gritos. Pero no les hice caso y segu arrastrndome hasta que dej de or sus chillidos. La cueva era enorme y cuando se gastaron las pilas ya fue imposible volver. No s cuntos aos han pasado desde entonces, porque mi pijama ya no me queda y lo tengo que llevar amarrado como Tarzn. He odo que mam ha muerto. 1. Qu pasa de inslito en el cuento? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. El cuento es narrado en qu persona? _________________________________________________ _________________________________________________

EL MUNDO INSLITO DE LA LITERATURA


Observaes: 1 Os possessivos so formas da lngua que indicam posse. Eles concordam em gnero e nmero com o elemento possudo, alm disso, podem ser colocados esquerda ou direita de um substantivo, o que faz com que existam diferentes formas sintticas para um mesmo possessivo: Mis hermanos / hermanos mos Tu bolgrafo / bolgrafo tuyo 2 As formas possessivas de 1 e 2 pessoas do plural (nuestro/ vuestro) no se alteram quando colocadas antes ou depois de um substantivo: nuestra casa / casa nuestra vuestros libros / livros vuestros

EJERCICIOS
3. Leia cuidadosamente o texto que e sublinhe os pronomes possessivos: Y sent la descarga elctrica del primer tacto levsimo de sus dedos acaricindome la frente y los ojos y despus sus manos recorrindome los prpados, las mejillas, mi bigote, mi barba, sus manos en mi nuca, sus dedos metidos bajo mi pelo y bajando de nuevo hasta la nuca, el cuello y los hombros, y deshaciendo rigideces y nudos, luego el rpido y diestro frotamiento del cuero cabelludo que hizo que toda mi cabeza se repletara de sangre nueva y picante. () y junto con tu pelo y con tus ojos descansados que ya no puedas abrir, y con tu nariz y tus orejas recortadas lo voy guardando todo en este maletn, junto con tu traje de terciopelo verde, tus zapatos, tus calcetines y todos los detalles de tu vestimenta para esta noche; y mira, ahora te abro y te quito la bata; pero, claro, no puedes mirar, y te hago ejercicios para que relajes tus brazos, ms y ms, sultalos bien, que as descansars, mi amor, sultalos bien, que ahora los pliego y los guardo, y ahora las piernas
DONOSO, Jos. Nueve novelas breves. Santiago de Chile: Editorial Antrtica, 1996. p. 75-6.

GRAMTICA
PRONOMBRES POSESIVOS MASCULINO
Persona 1 p.sg 2 p.sg 3 p.sg 1 p.pl 2 p.pl 3 p.pl su mi tu su SINGULAR mo tuyo suyo nuestro vuestro suyo sus mis tus sus PLURAL mos tuyos suyos

Nuestros Vuestros suyos

4. Retire do texto palavras que mencionem partes do corpo humano. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 5. Faa uma anlise da charge, refletindo sobre programas televisivos e revistas infantis. Alm disso, observe a posio dos possessivos, destacando-os.

FEMENINO
Persona 1 p.sg 2 p.sg 3 p.sg 1 p.pl 2 p.pl 3 p.pl su SINGULAR mi tu su ma tuya suya nuestra vuestra suya sus mis tus sus PLURAL mas tuyas suyas

Nuestras vuestras suyas

78

ESPANHOL
Comprensin de texto:

EL MUNDO INSLITO DE LA LITERATURA

Leia o fragmento que segue e responda: Sonatina () La princesa est triste qu tendr la princesa? Los suspiros escapan de su boca de fresa, que ha perdido la risa, que ha perdido el color. La princesa est plida en su silla de oro; est mudo el teclado de su clave sonoro; y en un vaso, olvidada, se desmaya una flor. () Piensa acaso en el prncipe de Golconda o de China, o en el que ha detenido su carroza argentina para ver de sus ojos la dulzura de luz, o en el rey de las islas de las rosas fragantes, o en el que es soberano de los claros diamantes, o en el dueo orgulloso de las perlas de Ormuz?
Rubn Daro. Prosas profanas. Madrid: Alianza,1992.

7. Qual o tema do poema? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 6. Complete com os possessivos de modo informal. I. ____ manuscrito habla sobre las antiguas culturas del oriente; el _____, en cambio, trata sobre la Grecia antigua II. Nunca ms disfrutaria de los _________. III. Lo______haba empezado a desmoronarse. IV. El tiempo es un naufragio donde uno puede reconocer a los ________. V. Quiero lo ______ en este instante. a) tu; mi; tuyos; nuestros; mos; suyo. b) tu; mo; suyos ;nuestro; suyos; mo. c) su; mi; mos ; suyo; tuyo; mi. d) mi; su; nuestro; mos; suyos; tuya. e) tuyo; mo; mos; tuya; sus; tu. Em seguida, leia o texto da autobiografia de Gabriel Garca Mrquez: Mi mtodo de entonces era distinto del que adopt despus como escritor profesional. Escriba slo con los ndices como sigo hacindolo pero no rompa cada prrafo hasta dejarlo a gusto como ahora , sino que soltaba todo lo que llevaba en bruto dentro de m. Pienso que el sistema estaba impuesto por las medidas del papel, que eran bandas verticales recortadas de las bobinas para imprenta, y que bien podan tener cinco metros. El resultado eran unos originales largos y angostos como papiros que salan en cascada de la mquina de escribir y se extendan en el piso a medida que uno escriba. El jefe de redaccin no encargaba los artculos por cuartillas, ni por palabras o letras, sino por centmetros de papel. Un reportaje de metro y medio, se deca. Volv a aorar este formato en plena madurez, cuando ca en la cuenta de que en la prctica era igual a la pantalla de la computadora.
(GARCA MRQUEZ, Gabriel. Vivir para contarla. 8. ed. Buenos Aires: Sudamericana, 2003. p. 123-124.)

_________________________________________________ 8. Comente os aspectos psicolgicos do personagem. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 9. No poema, existe a presena de metforas? Justifique sua resposta. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

79

ESPANHOL
10. Observe as seguintes afirmaes. I. O formato do papel que o autor utilizava acabava influenciando sua forma de escrever. II. O autor reconhece que na juventude tinha mais imaginao. III. Em virtude das caractersticas do papel utilizado, o chefe de redao pedia os artigos por centmetros de papel. IV. Desde o incio de sua carreira o autor separava e corrigia cuidadosamente cada pargrafo que escrevia. Esto CORRETAS apenas as afirmativas: a) I, II e IV d) I e III b) I, III e IV e) II e III c) II, III e IV

TEATRO Y CINE ESPAOL E HISPANOAMERICANO


Adjetivos Indefinidos so aqueles que se referem a pessoas ou coisas de maneira vaga ou indefinida. O adjetivo indefinido acompanha o substantivo. NADIE ningum NADA nada NINGUNO nenhum ALGUNO algum ALGUIEN algum ALGO algo NINGN nenhum ALGN algum UNO a gente VARIOS vrios CADA cada CUALQUIERA qualquer CUALESQUIERA quaisquer TODO(S), TODA (S) tudo, toda(s)

EJERCICIOS
1. Si la frase Yo a tu edad ya estaba explotando a alguien fuera colocada en negativa, la forma correcta sera: a) Yo a tu edad no estaba explotando nada. b) Yo a tu edad an estaba explotando a algunos. c) Yo a tu edad no estaba explotando nadie. d) Yo a tu edad no estaba explotando a cualquiera. e) Yo a tu edad an estaba explotando a ninguno. 2. Siempre tiene ........ que hacer. a) Alguno b) Algo c) Alguien d) Nada e) Todo 3. (PUC) El pronombre indefinido est correctamente empleado en: a) Te dar uno en cambio. b) Nadie dijo nada. c) Algn abri la puerta. d) Ella no estudi casi nadie. e) Te prestar algn libro. 4. Encontre no texto pronomes e adjetivos indefinidos: VALOR DE UNA SONRISA No cuesta nada y rinde mucho. Enriquece quien lo recibe, sin empobrecer quien lo da. Dura solamente un instante, mas sus efectos perduran para siempre. Nadie es tan rico que de l no precise; ni tan pobre que no lo merezca. Lleva la felicidad a todos y a toda parte. Es el smbolo de la amistad y de la buena voluntad. Es aliento para los desanimados, reposo para los cansados; rayo de sol para los tristes; resurreccin para los desesperados, No se compra ni se presta. Ninguna moneda del mundo puede pagar su valor. Como aquel que no sabe sonrer, No hay nadie que precise tanto de una sonrisa.

UNIDAD 5 TEATRO Y CINE ESPAOL E HISPANOAMERICANO


EL LABIRINTO DEL FAUNO Situada en el ao 1944, cuenta el apasionante viaje de Ofelia, una nia de 13 aos que junto a su madre, Carmen (Ariadna Gil), convaleciente a causa de un avanzado estado de gestacin, se traslada hasta un pequeo pueblo, en el que se encuentra destacado Vidal (Sergi Lpez), un cruel capitn del ejrcito franquista, nuevo marido de Carmen y por el que Ofelia no siente ningn afecto. La misin de Vidal es acabar con los ltimos vestigios de la resistencia republicana escondida en los montes de la zona. Tambin ah se haya el molino donde Vidal tiene situado su centro de operaciones, y en l les aguardan Mercedes (Maribl Verd), una joven que se encuentra a cargo de los dems miembros del servicio, y el doctor (Alex Angulo), quien se har cargo del delicado estado de salud de Carmen. Una noche Ofelia descubre las ruinas de un laberinto donde se encuentra con un fauno (Doug Jones), una extraa criatura que le hace una increble revelacin: Ofelia es en realidad una princesa, ltima de su estirpe, a la que los suyos llevan mucho tiempo esperando. Para poder regresar a su mgico reino, la nia deber enfrentarse a tres pruebas antes de la luna llena. En el transcurso de esta misin, fantasa y realidad se abrazan para dar rienda suelta a una maravillosa historia donde la magia que rodea a Ofelia nos transporta a un universo nico, lleno de aventuras y cargado de emocin.

GRAMTICA
PRONOMBRES INDEFINIDOS
So aqueles que substituem pessoas ou coisas de maneira vaga ou indefinida. O pronome indefinido no acompanha o substantivo.

80

ESPANHOL
5. Em sua opinio, qual palavra substituiria a palavra sorriso citada no texto. _________________________________________________ 6. Segundo o texto, qual a pessoa que mais necessita de um sorriso? _________________________________________________ Comprensin de texto: Algunas pelculas nos provocan sonrisas, pero sabes el valor de una sonrisa? CORAZN LLENO DE ALEGRA CURA COMO MEDICINA El poder de la risa Adems de hacernos ms felices, nos ayuda a prevenir las enfermedades y luchar contra ellas. Dicen que un minuto de risa equivale a 45 minutos de relajacin. No es algo que est comprobado cientficamente, pero se puede avalar con la experiencia de muchas personas que han decidido utilizar esta tcnica para aliviar algn problema. Lo que s est comprobado por los estudios realizados en Estados Unidos es que la risa provoca una serie de reacciones en el organismo. Entre ellas, la produccin y liberacin de varias sustancias bioqumicas: dopamina, un neurotransmisor que eleva el estado de nimo; serotonina, una endorfina con efectos calmantes y analgsicos, y adrenalina, que nos permite estar ms despiertos y receptivos y nos proporciona mayor creatividad. Un buen frmaco Su uso como terapia data de los primeros tiempos de la historia. La propia Biblia dice, Cuando un corazn est alegre, la vida es ms larga, pues un corazn lleno de alegra cura como una medicina. Por el contrario, un espritu triste lo desechan los huesos. No en vano, los expertos afirman que una persona triste o con depresin es ms propensa a sufrir enfermedades que una persona alegre. La tristeza atrae los virus, mientras que el buen humor los ahuyenta. La terapia de la risa o geloterapia no es tan slo un mtodo preventivo, sino que tambin facilita la recuperacin de los enfermos. As se reflejaba en la pelcula Patch Adams, basada en hechos reales, y en la que Robin Willians representaba el papel de un mdico que ayudaba a sus pacientes a luchar contra el cncer a travs de la risa. En Estados Unidos y Canad se practica desde los aos ochenta y, poco a poco, se han ido sumando otros pases como Suiza, Francia, Alemania y Espaa. Aunque en nuestro pas todava hay pocos terapeutas que apliquen este mtodo, se estn abriendo puertas en algunos centros pblicos. Cada vez nos remos menos: 3 minutos al da, frente a los 20 de nuestros abuelos. Expresin de inteligencia Confucio recomienda rerse doce veces al da para alcanzar la sabidura. En este sentido, el psicolgico Jos Elas, introductor de la risoterapia en Espaa, est convencido de que uno de los aspectos ms sorprendentes de esta tcnica es que al segundo

TEATRO Y CINE ESPAOL E HISPANOAMERICANO


mes la persona no slo ha cambiado su estado de nimo, sino tambin su forma de ver la vida. La mxima expresin de inteligencia es saber rerse. Lenguaje universal La risa es, en muchas ocasiones, ms eficaz que las palabras. Pertenece al mbito de la expresin corporal y permite una comunicacin ms all de los idiomas y las palabras. Gracias a ella se pueden relaj ar las tensiones que a veces crean las palabras y romper barreras de manera ms rpida que en el lenguaje hablado.
MILANI, Esther Maria. Listo: Espaol a travs de textos. So Paulo: Moderna, 2005.p.66

7. Segn el texto, slo es CORRECTO afirmar que: ( ) Est comprobado cientficamente que un minuto de risa equivale a tres cuartos de hora de relajacin. ( ) El uso teraputico de la risa slo fue practicado en los primeros tiempos de la historia. ( ) Suiza ha sido la pionera en el uso de la risa como tratamiento contra el cncer. ( ) En el pas del narrador el tratamiento de cncer a travs de la risa no es muy intenso todava. 8. Todas son ideas que se pueden extraer del texto, EXCEPTO: ( ) El mal humor aleja los virus, haciendo con que est ms propenso a padecer enfermedades ( ) Hay una relacin numrica entre la risa y la sabidura ( ) La alegra combate los virus y alarga la vida. ( ) La risa puede funcionar como medicina. 9. El poder de la risa es un texto: ( ) Que representa afirmaciones sin comprobaciones. ( ) Que habla de estticas desvinculadas de la salud. ( ) Cuyo narrador se incluye como personas que disfruta los efectos de este acto facial. ( ) Que representa algunas desventajas de la risa. 10. En el texto aparece algunos pronombres indefinidos. Escrbelos abajo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

81

FIESTAS Y MANIFESTACIONES CULTURALES

UNIDAD 6 FIESTAS Y MANIFESTACIONES CULTURALES

GRAMTICA
Te gustara tocarte el gordo?

LOS NUMERALES CARDINALES


0 cero 1 uno (un); una 2 dos 3 tres 4 cuatro 5 cinco 6 seis 7 siete 8 ocho 9 nueve 10 diez 11 once 12 doce 13 trece 14 catorce 15 quince 16 diecisis 17 diecisiete 18 dieciocho 19 diecinueve 20 veinte 21 veintiuno 22 veintids 23 veintitrs 24 veinticuatro 25 veinticinco

La fiesta popular no es solamente jolgorio, sino una parte de la historia de un pueblo que se manifiesta en cantos, danzas, procesiones, comidas, creencias y ritos. Espaa es un pas especialmente conocido por sus fiestas y tradiciones populares. Um ejemplo, son Los Sanfermines, celebrado en julio. Se trata de unas fiestas en las que participa gente de todo el mundo y en las que durante ms de una semana a cualquier hora del da o de la noche las calles rebosan de gente y alegra. Su momento lgido del da se da todas las maanas a las 8 cuando se celebran los populares encierros, en los que los toros corren por las calles de la ciudad rodeadas de mozos que demuestran su valor en esta peligrosa y pintoresca tradicin. Abajo es el calendrio festivo de Espaa: Enero: la celebracin de Los Reyes Magos. Febrero: los Carnavales. Marzo: Las Fallas de Valencia. Abril: se celebra la Semana Santa. Mayo: mes de Romeras. Junio: fiestas relacionadas con el fuego, la ms conocida es la de la noche de San Juan. Julio: Los Sanfermines. Agosto: 15 Asuncin de la Virgen. En Buol (Valencia), se desarrolla la Tomatina. Septiembre: la fiesta nacional de Catalua. Octubre: 12 se celebra la fiesta de la Virgen del Pilar, patrona de Espaa. Noviembre: 1 da de Todos los Santos. Diciembre: las Navidades; Nochevieja, que se despide el ao y se da la bienvenida al Nuevo Ao.

26 veintisis 27 veintisiete 28 veintiocho 29 veintinueve 30 treinta 31 treinta y uno(un) 32 treinta y dos 40 cuarenta 50 cincuenta 60 sesenta 70 setenta 80 ochenta 90 noventa 100 cien/ciento 200 docientos 300 trescientos 400 cuatrocientos 500 quinientos 600 seiscientos 700 setecientos 800 ochocientos 900 novecientos / as 1.000 mil 2.000 dos mil 100.000 cien mil 1.000.000 un milln

EJERCICIOS
1. Pon cada mes en su estacin correcta, segn el calendario brasileo: Otoo _________________________________________________ Invierno _________________________________________________ Primavera _________________________________________________ Verano _________________________________________________ Comprensin de texto: ESPAA: FIESTAS Y TRADICIONES Lo ms conocido mundialmente entre las tradiciones folclricas espaolas son ciertamente el Flamenco y los Toros. Las Corridas de Toros se encontrar en realidad por todo el pas, siendo internacionalmente los ms populares y conocidos espectculos los encierros que se celebran durante los Sanfermines en Pamplona. Pero las corridas de toros son una parcela que aparecer en Espaa en cualquier Fiesta.

82

ESPANHOL
Flamenco, de otro lado, es la tradicin folclrica del sur, en particular de Andaluca. Y es en esta tierra donde conocer las races del cante, la guitarra y el baile flamenco. En Abril se celebra la Feria de Abril, en Sevilla, una semana repleta de cante y baile, donde se bebe vino de Jerez y otros deliciosos caldos de la zona, acompaados de jamn y queso viejo entre otros manjares de la zona....as que al que le gusten estas cosas no debiera perdrselo; si es que encuentra alojamiento en estas fechas (tarea nada fcil), ahora bien, ya puestos a hacer el viaje, porqu no llegar unas dos semanas antes de la feria y disfrutar de la otra celebracin excepcional que la ciudad ofrece, la Semana Santa, con sus famosas cofradas. Otro acontecimiento que atrae a millones de personas a un pequeo pueblo situado en la provincia de Huelva, es El Roco, una romera a la aldea del mismo nombre donde se venera a la Virgen del Roco. En tradicionales y simples carretas adornadas y dentro del ms autntico tipismo flamenco acudirn multitudes, no slo de la zona sino de puntos muchos ms alejados, a pie, a caballo o en carreta, celebrando un espectculo nico, donde folclore y alegra se mezcla con religiosidad en una curiosa y colorida combinacin. Y como no, otra fiesta excepcional "Las Fallas de San Jos" en Valencia, que se celebran en Marzo, cuando toda la ciudad se convierte en un escenario enorme de fiesta y arte, con inmensas cantidades de la ms extraordinaria pirotecnia. Cerca de Valencia se encuentra la localidad de Buol, donde todos los aos, el ltimo mircoles de Agosto se celebra la Tomatina; la batalla de tomates ms grande del mundo. Ms de 40.000 personas, 100 toneladas de tomate, son cifras que indican la dimensin del evento, donde durante una hora se bombardea con tomates a todo el que se mueve. El inicio de esta tradicin es tan simple como jocoso, ya que se remonta a una pelea multitudinaria que ocurri en 1945 durante un desfile de "gigantes y cabezudos", parece que los habitantes no encontraron mejor armamento que los tomates que cogieron de un puesto de verduras all situado. Lo interesante de ello es que se ha convertido en un evento excepcional al que acuden miles de visitantes de diversos pases. Una semana salvaje se podr encontrar tambin en San Sebastin durante el mes de febrero, cuando se celebra La Tamburrada. Las fiestas ms tpicas de Madrid son las de "San Isidro", en Mayo. En estas fechas se celebran unas de las ms importantes corridas de toros del ao. El Carnaval tiene su popularidad en muy diversos puntos del pas, siendo muy conocidos el de Santa Cruz de Tenerife, por su belleza, el de Sitges y el de Cdiz.
Disponible en: http://www.red2000.com/spain/primer/1fest.html

FIESTAS Y MANIFESTACIONES CULTURALES


3. De acuerdo con el texto, NO es correcto afirmar: a) En Mayo se celebra la Feria de Abril, en Sevilla, y en abril, las fiesta de San Isidro, en Madrid. b) Las Fallas se San Jos, en Valencia, se celebran en el tercero mes del ao. c) El flamenco es un baile tradicional de Andaluca. d) Las corridas de toros estn por todo el pas. e) El Carnaval tiene su popularidad en muy diversos puntos del pas. 4. Segn el texto, la mayora de las fiestas ocurren: a) En primavera y verano b) Durante el invierno c) Durante todo el ao d) En marzo y abril e) En verano y otoo 5. De las principales fiestas que hay en Espaa, Cules tenemos en Brasil? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 6. Escucha la cancin del grupo Bacilos y completa con los numerales que falta: Yo solo quiero pegar en la radio, yo solo quiero pegar en la radio Estoy ya cansado de estar endeudado, de verte sufriendo por cada centavo, dejmoslo todo y vmonos para Miami. Voy a lo que voy, a volverme famoso a la vida de artista, a vivir de canciones vender ilusiones que rompan ___________ corazones. Coro: Yo solo quiero pegar en la radio, para ganar mi _____________ para comprarte una casa grande, en donde quepa tu corazn Yo solo quiero que la gente cante, por todos lados esta cancin, desde San Juan hasta Barranquilla desde Sevilla hasta Nueva York. Yo te repito que... Me van a escuchar, en la radio en la televisin y as ser mi ______________ Apenas lleguemos llamamos a Emilio, yo tengo un amigo, amigo de un amigo con lnea directa al cielo de tantas estrellas. Despus andaremos de aqu para all con Paulina Rubio y Alejandro Sanz. Tranquila querida, Paulina solo es una amiga. (Coro)

2. A partir de la lectura del texto, se puede afirmar que: a) Las corridas de toros no se encontrarn por todo el pas. b) Las Fallas de San Jos, en Valencia, se celebran en abril. c) El flamenco es un baile tradicionalmente del sur, en particular en Andaluca. d) En los encierros encontramos los toros para las corridas de toros. e) El flamenco es un baile tradicionalmente de todas las regiones espaolas.

83

ESPANHOL
Yo solo quiero que la gente cante por todos lados esta cancin desde Kabul hasta Curasao, desde Callao hasta Panam (Coro) Yo solo quiero que la gente cante por todos lados esta cancin desde Guayaquil a Santo Domingo, desde Tijuana hasta Salvador chale pa' delante o chale pa' all Que cha pa' delante.. cha pa' delante Ya quiero salir de esta bicicleta, salir a rumbear sin pensar en la cuenta, comprarte un vestido de Oscar de la Renta, tranquila que ah viene ____________ Yo solo quiero pegar en la radio (4x) (Coro) 7. Ahora vuelva en la cancin y subraya los verbos que te parezcan estar en el Presente de Indicativo.

FIESTAS Y MANIFESTACIONES CULTURALES

PRESENTE DE INDICATIVO
PRONOMBRE Yo T l Nosotros Vosotros Ellos 1 conj. escucho escuchas escucha escuchamos escuchis escuchan 2 conj. como comes come comemos comis comen 3 conj. vivo vives vive vivimos vivs viven

Algunos verbos irregulares: SER: soy, eres, es, somos, sois, son; IR: voy, vas, va, vamos, vais, van; HACER: hago, haces, hace, hacemos, hacis, hacen; SALIR: salgo, sales, sale, salimos, sals, salen; SABER: s, sabes, sabe, sabemos, sabis, saben; VER: veo, ves, ve, vemos, veis, ven; DAR: doy, das, da, damos, dais, dan; ESTAR: estoy, ests, estamos, estis, estn; CABER: quepo, cabes, cabe, cabemos, cabis, caben; OR: oigo, oyes, oye, omos, os, oyen; TENER: tengo, tienes, tiene, tenemos, tenis, tienen; VENIR: vengo, vienes, viene, venimos, vens, vienen.

84

FILOSOFIA
87 Mito ................................................................. 87 Passagem do mito para a filosofia ........ .. 87 O enfraquecimento dos mitos ................. .. 87 Origem e significado de filosofia ................. 87 Entendendo a mitologia grega ..................... 88 Exerccios ........................................................ 88

01

INTRODUO FILOSOFIA

pg

98 tica das virtudes ...................................... .. 98 O problema tico em Aristteles .............. 99 Exerccios ...................................................... 100

04 05 06

A TICA EM ARISTTELES

pg

A TICA NOS PERODOS ELENSTICO E MEDIEVAL A TICA EM KANT

pg

102
pg

91 O problema cosmolgico ........................... 91 Perodo Pr-Socrtico ................................. 91 O problema antropolgico ............................ 91 Exerccios ....................................................... 93

02

PRIMEIROS FILSOFOS

pg

103 Iluminismo ................................................... 104 A razo legisladora ................................... 104 As condies para o agir moral ................. 104 Liberdade e autonomia ............................. 105 Exerccios ..................................................... 105

95 Moral e tica ................................................. 95 A tica em Plato ......................................... 95 Exerccios ....................................................... 97

03

INTRODUO TICA

pg

108 Ao comunicativa .................................... 108 A razo instrumental ................................ 108 Exerccios ..................................................... 109

07

A TICA DO DISCURSO EM HABERMAS

pg

INTRODUO FILOSOFIA

UNIDADE 1 INTRODUO FILOSOFIA


CONTEXTO HISTRICO
Uma nova maneira de pensar e de conceber o mundo origina-se e se desenvolve na Grcia clssica, um mosaico de pequenas comunidades independentes que se espalhava junto ao Mediterrneo - da Jnia, na sia Menor, at o sul da Itlia. Essa disperso resultou das muitas invases de povos em busca de terras cultivveis. Apesar de geograficamente dispersa, a Grcia Antiga tem uma vida cultural relativamente homogenia, que se expressa na lngua comum, em formas de organizao poltica, em crenas religiosas semelhantes. Ali tomam corpo, no sc. VI a.C, as primeiras idias sobre as quais vai se erigir o pensamento ocidental.

A escrita: surge por influncia dos fencios gerando uma nova idade mental, isto estimulando rigor e uma clareza por parte de quem escreve. A moeda: foi inventada na Ldia a fim de facilitar o mercado martimo vigente na poca, tornando necessria porque, com o comrcio, os produtos passam a ter valor de troca, e transformam-se em mercadoria. Muito mais do que um instrumento de troca, a moeda um artifcio racional, uma conveno humana uma noo abstrata de valor que estabelece a medida comum entre valores diferentes. A lei escrita: a justia, at ento dependente da arbitrariedade dos reis ou da interpretao da vontade divina, codificada numa legislao escrita, sujeita discusso e modificao. A lei escrita passa a encarnar uma dimenso propriamente humana. Tal modificao expressa o ideal igualitrio que prepara a democracia nascente.

MITO
Desde que o homem passou a ter conscin-cia de si mesmo e do mundo que o cercava, ele procura entender a realidade, com os seus processos e etapas. Porm, o pensamento primitivo acontecia de modo diferente que o nosso atualmente. No havia raciocnio lgico e a realidade era explicada atravs dos mitos. O termo mito tem diversos significados. Pode significar: uma idia falsa como quando se diz o mito da superioridade racial dos germnicos difundido pelos nazistas; uma crena exagerada no talento de algum como em Elvis foi o maior mito da msica popular mundial ; ou ainda algo irreal, como o "mito do saci perer ". Para o estudo da filosofia, o mito refere-se s narrativas tradicionais, integrantes da cultura de um povo que utilizam elementos simblicos para explicar a realidade e dar sentido vida humana. Os mitos gregos eram transmitidos oralmente pelos aedos e rapsodos, cantadores ambulantes que davam forma potica aos relatos populares e os recitavam em praa pblica. Homero poeta grego, destacou-se por suas epopias, estrias que descreviam o perodo da civilizao grega e transmitiam valores da cultura, por meio dos deuses e antepassados. Desde cedo as crianas gregas decoravam as passagens de poemas como Ilada, que trata da guerra de Tria, e A Odissia que relata o retorno de Ulisses a taca, aps a guerra de Tria. Hesodo foi outro grande poeta obteve reconhecimento por sua obra Teogonia, que relata as origens do universo e dos deuses.

O ENFRAQUECIMENTO DOS MITOS


Nessa poca de constantes mudanas, os mitos passaram a perder seu lugar de destaque na sociedade grega e entraram num estgio de abatimento, a seguir alguns dos motivos que propiciaram essa baixa: A mitologia apenas narrava a sucesso de fenmenos divinos, naturais e humanos. por este fato que h um desenvolvimento do pensamento, justamente pela falta de uma teologia elaborada que fornea explicaes coerentes do mundo. Pelo fato dos deuses gregos terem caractersticas humanas: serem vingativos, egostas, etc., mostra que foram criados a partir de nossa semelhana. Havia vrios mitos diferentes para um mesmo fato, variando conforme as regies. As viagens martimas, que permitiram aos homens gregos descobrirem que os locais que os mitos diziam habitados por deuses e outras entidades sobrenaturais eram, na verdade, habitados por outros seres humanos. Tais viagens causaram o desencantamento do mundo, que passou, assim a exigir uma explicao sobre sua origem, explicao que o mito j no podia oferecer. No sculo VIII a.C. surge a Polis, cidades estados gregas. A polis era composta por uma regio urbana, onde ficavam a gora praa central que servia para reunies pblicas-, o templo e o mercado onde eram realizadas as trocas. Cada plis era um centro poltico, social e cultural. Nela a supremacia o logos (discurso, razo), vence quem sabe convencer, o saber deixa de ser sagrado e passa a ser objeto de discusso. Nasce a poltica, a tica e o cidado da polis, este participa dos destinos da cidade por meio da palavra. na polis que a democracia atinge seu apogeu, mas importante salientar que quando falamos em democracia, bom lembrar que a maior parte da populao se achava excluda do processo poltico, em Atenas, por exemplo, o nmero de habitantes giravam em torno de 500 mil, sendo que apenas 10% desse nmero eram considerados cidados.

PASSAGEM DO MITO PARA A FILOSOFIA


Por volta dos sc. VII e VI a.C a Grcia comea a passar por uma transformao socioeconmica, poltica e cultural da qual algumas mudanas culminam na democracia e consequentemente no surgimento da filosofia. Algumas novidades surgidas neste perodo so consideradas responsveis por estas mudanas:

87

FILOSOFIA

INTRODUO FILOSOFIA
deveria deixar o deus Hermes sempre satisfeito, para conseguir bons resultados em seu trabalho. INDICAES DE LEITURA Contos e lendas da mitologia grega De Claude Pouzadoux

ORIGEM E SIGNIFICADO DE FILOSOFIA


Quando se d a passagem da conscincia mtica para a racional, aparecem os primeiros sbios, sophos, em grego. Um deles chamado Pitgoras, que tambm era matemtico, usou pela primeira vez a palavra filosofia. Etimologicamente a palavra filosofia composta por outras duas palavras gregas: philo e sophia. Philo deriva-se de philia, que significa amizade, amor fraterno. Sophia quer dizer sabedoria. Filosofia significa, portanto, amizade pela sabedoria, amor e respeito pelo saber. Filsofo: o que ama a sabedoria, que tem amizade pelo saber, deseja conhecer. O saber filosfico designava, desde a Grcia antiga, a totalidade do conhecimento racional desenvolvido pelo homem. Abrangia, portanto, os mais diversos tipos de conhecimento, que hoje entendemos como pertencentes matemtica, astronomia, fsica, biologia, lgica, tica etc. Enfim, todo o conjunto de conhecimentos racionais integrava o universo do saber filosfico. O homem o nico animal que tem conscincia de si mesmo e da realidade que o cerca e capaz de refletir sobre as coisas. nessa principal caracterstica humana, a de reflexo que o homem se distingue dos animais e dos objetos. A filosofia tem, portanto, a funo de garantir ao homem seu espao no mundo, enquanto o homem refletir, questionar, procurar entender o que o cerca, a filosofia estar presente, no como algo distante da realidade mas pelo contrrio, como algo presente em nosso dia a dia. Fugir da filosofia o mesmo que fugir de nossa prpria natureza.

Link:www.botucatu.sp.gov.br/eventos/2007/conthistorias/bauhistorias/Contos%20e%20Lendas%20da%20 Mitologia%20Grega.pdf

INDICAES DE FILME Fria De Titns I E Ii Percy Jackson O Ladro De Raios Hrcules Tria 300 De Esparta Imortais

EXERCCIOS
1. (2003) Foi na Grcia de Homero que surgiu uma maneira at ento desconhecida de fazer poltica: o rei deixou de ser onipotente e seu poder foi paulatinamente partilhado e disputado entre os cidados. Era o incio de um fenmeno que se consolidaria a partir do sculo 6 a.C., na Atenas de Slon e Clstenes, e que se tornaria um dos fundamentos da civilizao ocidental: a democracia.
(Entrevista com Jean Pierre Vernant. Folha de S. Paulo, 31 out. 1999. Caderno Mais!, p. 4.)

TEXTO COMPLEMENTAR

Os gregos criaram vrios mitos para poder passar mensagens para as pessoas e tambm com o objetivo de preservar a memria histrica de seu povo. H trs mil anos, no havia explicaes cientficas para grande parte dos fenmenos da natureza ou para os acontecimentos histricos. Portanto, para buscar um significado para os fatos polticos, econmicos e sociais, os gregos criaram uma srie de histrias, de origem imaginativa, que eram transmitidas, principalmente, atravs da literatura oral. Grande parte destas lendas e mitos chegou at os dias de hoje e so importantes fontes de informaes para entendermos a histria da civilizao da Grcia Antiga. So histrias riqussimas em dados psicolgicos, econmicos, materiais, artsticos, polticos e culturais.

Com base no trecho da entrevista e nos conhecimentos sobre o tema, assinale a alternativa CORRETA. a) A afirmao de que o poder foi paulatinamente partilhado e disputado entre os cidados considera que na democracia grega todos os habitantes podiam eleger e ser eleitos para cargos polticos. b) A democracia grega foi um fenmeno isolado e, por isso, no teve influncia significativa nos rumos da poltica na civilizao ocidental. c) Os gregos desconheciam, at o governo de Slon e Clstenes, no sculo 6 a.C., qualquer forma de fazer poltica. d) A maneira at ento desconhecida de fazer poltica, a que o texto se refere, a democracia grega, que permitiu aos cidados participarem das questes relativas coletividade. e) Na democracia grega, que se consolidou a partir do sculo 6 a.C., o rei detinha o poder absoluto, decidindo sobre todas as questes pblicas. 2. (UEL2003) Zeus ocupa o trono do universo. Agora o mundo est ordenado. Os deuses disputaram entre si, alguns triunfaram. Tudo o que havia de ruim no cu etreo foi expulso, ou para a priso do Trtaro ou para a Terra, entre os mortais. E os homens, o que acontece com eles? Quem so eles?
(VERNANT, Jean-Pierre. O universo, os deuses, os homens. Trad. de Rosa Freire dAguiar. So Paulo: Companhia das Letras, 2000. p. 56.)

ENTENDENDO A MITOLOGIA GREGA


Os gregos antigos enxergavam vida em quase tudo que os cercavam, e buscavam explicaes para tudo. A imaginao frtil deste povo criou personagens e figuras mitolgicas das mais diversas. Heris, deuses, ninfas, tits e centauros habitavam o mundo material, influenciando em suas vidas. Bastava ler os sinais da natureza, para conseguir atingir seus objetivos. A pitonisa, espcie de sacerdotisa, era uma importante personagem neste contexto. Os gregos a consultavam em seus orculos para saber sobre as coisas que estavam acontecendo e tambm sobre o futuro. Quase sempre, a pitonisa buscava explicaes mitolgicas para tais acontecimentos. Agradar uma divindade era condio fundamental para atingir bons resultados na vida material. Um trabalhador do comrcio, por exemplo,

88

FILOSOFIA
O texto acima parte de uma narrativa mtica. Considerando que o mito pode ser uma forma de conhecimento, assinale a alternativa CORRETA. a) A verdade do mito obedece a critrios empricos e cientficos de comprovao. b) O conhecimento mtico segue um rigoroso procedimento lgico-analtico para estabelecer suas verdades. c) As explicaes mticas constroem-se de maneira argumentativa e autocrtica. d) O mito busca explicaes definitivas acerca do homem e do mundo, e sua verdade independe de provas. e) A verdade do mito obedece a regras universais do pensamento racional, tais como a lei de no-contradio. 3. (UEL2005) Sobre a passagem do mito filosofia, na Grcia Antiga, considere as afirmativas a seguir. I. Os poemas homricos, em razo de muitos de seus componentes, j contm caractersticas essenciais da compreenso de mundo grega que, posteriormente, se revelaram importantes para o surgimento da filosofia. II. O naturalismo, que se manifesta nas origens da filosofia, j se evidencia na prpria religiosidade grega, na medida em que nem homens nem deuses so compreendidos como perfeitos. III. A humanizao dos deuses na religio grega, que os entende movidos por sentimentos similares aos dos homens, contribuiu para o processo de racionalizao da cultura grega, auxiliando o desenvolvimento do pensamento filosfico e cientfico. IV. O mito foi superado, cedendo lugar ao pensamento filosfico, devido assimilao que os gregos fizeram da sabedoria dos povos orientais, sabedoria esta desvinculada de qualquer base religiosa. Esto CORRETAS apenas as afirmativas: a) I e II. c) III e IV. b) II e IV. d) I, II e III. e) I, III e IV.

INTRODUO FILOSOFIA
II. O palcio real, que centralizava os poderes militar e religioso, foi substitudo pela gora, espao pblico onde os problemas da plis eram debatidos. III. A palavra, utilizada na prtica religiosa e nos ditos do rei, perdeu a funo ritualista de frmula justa, passando a ser veculo do debate e da discusso. IV. A expresso filosfica tributria do carter pragmtico dos gregos, que substituram a contemplao desinteressada dos mitos pela tcnica utilitria do pensar racional. Esto CORRETAS apenas as afirmativas: a) I e III. b) II e IV. c) III e IV. d) I, II e III. e) I, II e IV. 5. (UEL2007) H, porm, algo de fundamentalmente novo na maneira como os Gregos puseram a servio do seu problema ltimo da origem e essncia das coisas as observaes empricas que receberam do Oriente e enriqueceram com as suas prprias, bem como no modo de submeter ao pensamento terico e casual o reino dos mitos, fundado na observao das realidades aparentes do mundo sensvel: os mitos sobre o nascimento do mundo.
Fonte: JAEGER, W. Paidia. Traduo de Artur M. Parreira. 3.ed. So Paulo: Martins Fontes, 1995, p.197.

Com base no texto e nos conhecimentos sobre a relao entre mito e filosofia na Grcia, CORRETO afirmar: a) Em que pese ser considerada como criao dos gregos, a filosofia se origina no Oriente sob o influxo da religio e apenas posteriormente chega Grcia. b) A filosofia representa uma ruptura radical em relao aos mitos, representando uma nova forma de pensamento plenamente racional desde as suas origens. c) Apesar de ser pensamento racional, a filosofia se desvincula dos mitos de forma gradual. d) Filosofia e mito sempre mantiveram uma relao de interdependncia, uma vez que o pensamento filosfico necessita do mito para se expressar. e) O mito j era filosofia, uma vez que buscava respostas para problemas que at hoje so objeto da pesquisa filosfica. 6. Tendo por base os estudos sobre os mitos, responda: Qual a definio de COSMOGONIA e a diferenciao de COSMOLOGIA. 7. Descreva a importncia dos mitos na Grcia antiga e como se deu a passagem do mito ao logos.

4. (UEL2006) Os poemas de Homero serviram de alimento espiritual aos gregos, contribuindo de forma essencial para aquilo que mais tarde se desenvolveria como filosofia. Em seus poemas, a harmonia, a proporo, o limite e a medida, assim como a presena de questionamentos acerca das causas, dos princpios e do porqu das coisas se faziam presentes, revelando depois uma constante na elaborao dos princpios metafsicos da filosofia grega.
(Adaptado de: REALE, Giovanni. Histria da Filosofia Antiga. v. I. Trad. Henrique C. Lima Vaz e Marcelo Perine. So Paulo: Loyola, 1994. p. 19.)

Com base no texto e nos conhecimentos acerca das caractersticas que marcaram o nascimento da filosofia na Grcia, considere as afirmativas a seguir. I. A poltica, enquanto forma de disputa oratria, contribuiu para formar um grupo de iguais, os cidados, que buscavam a verdade pela fora da argumentao.

89

FILOSOFIA

INTRODUO FILOSOFIA

90

PRIMEIROS FILSOFOS

UNIDADE 2 PRIMEIROS FILSOFOS

tambm realidade que se encontra em constante transformao. Portanto, saber o que a physis, procurar a origem das coisas que constituem a realidade, buscar um princpio substancial (onde tudo se origina, se encerra e pelo qual existem e subsistem todas as coisas) que fosse imortal e capaz de originar todos os seres infinitamente variados e diferentes do mundo. O princpio substancial que existe em todos os seres materiais, ou seja, a matria-prima de que so feitas todas as coisas existentes, ns o denominamos de arch. O objetivo dos primeiros filsofos compreende-se na busca da arch.

CAA AOS PR-SOCRTICOS

O PROBLEMA COSMOLGICO
A filosofia est diretamente ligada realidade. Os primeiros filsofos tm um problema a resolver, embora sejam solues puramente conceituais, no significa que seu pensamento esteja afastado da realidade. A filosofia est procurando saber qual o princpio ordenador do cosmos, ou seja, do universo. O mito neste momento, no serve mais para explicar a ordem do mundo, a que entra o pensamento racional para tentar uma explicao. Assim vai se delinear o primeiro problema a ser trabalhado pelos filsofos, os quais denominamos, filsofos pr-socrticos. O maior objetivo deste perodo filosfico era substituir a antiga Cosmogonia (explicao sobre a origem do universo baseada nos mitos) por uma Cosmologia (explicao racional e sistemtica das caractersticas do universo).

PERODO PR-SOCRTICO

_________________________________________________ _________________________________________________ _________________________________________________

O PROBLEMA ANTROPOLGICO
A fase inaugural da Filosofia grega conhecida como perodo pr-socrtico e compreende de Tales de Mileto (623-546 a.C.) at Scrates (468-399 a.C.). Os primeiros filsofos estavam em busca de uma explicao racional e sistemtica sobre a origem da Natureza e dos seres humanos, da physis. A physis, palavra grega que pode ser traduzida por natureza, possui um sentido mais amplo. Refere-se Aps este perodo que denominamos cosmolgico, teremos um outro momento muito importante para a filosofia ocidental. Inicia-se uma nova fase filosfica, caracterizada pelo interesse no prprio homem e nas relaes do homem com a sociedade. O problema central das investigaes torna-se antropolgico. Essa nova fase foi marcada, no incio, pelos sofistas e por Scrates, ambos sero estudados a seguir.

91

FILOSOFIA

PRIMEIROS FILSOFOS

SOFISTAS

SCRATES DE ATENAS

A charge da Mafalta remete reflexo levantada na ltima unidade, quando vemos a definio de Democracia e as ideias de Rousseau sobre o tema, voltamos a nos indagar sobre a eficcia dos sistemas polticos, claro, que a comicidade da charge sobre nossas prprias atitudes, passivas frente ao poder poltico, talvez corrompidos pela sociedade, nem notamos a graa da tirinha. A vitria de Atenas sobre os persas, em 479 a.C., marca tambm a consolidao da democracia na cidade. Uma base importante da democracia na cidade a educao, pela qual os cidados tornam-se capazes de participar da vida pblica. Numa sociedade em que os debates se do por meio de palavras, preciso ser um bom orador, saber argumentar. Dessa educao encarregaram-se os sofistas. O termo sofista significa sbio. Entretanto, com o decorrer do tempo, ganhou o sentido de impostor, devido, sobretudo, s crticas de Plato. Os sofistas eram professores viajantes - portanto, estrangeiros -, que por determinado preo, vendiam ensinamentos prticos de filosofia. Levando em considerao os interesses dos alunos, davam aulas de eloquncia e de sagacidade mental. Ensinavam conhecimentos teis para o sucesso nos negcios pblicos e privados. Alm disso, transmitiam todo um jogo de palavras, raciocnios que seria utilizado na arte de convencer as pessoas. Os ensinamentos dos sofistas favoreceram o surgimento de concepes relativistas sobre as coisas. No relativismo no existe uma verdade nica, absoluta, tudo relativo ao indivduo, ao momento e s circunstncias. Entre os sofistas podemos destacar dois que se tornaram ilustres por suas concepes: Protgoras de Abdera afirmava que o homem a medida de todas as coisas, inaugurando o subjetivismo. Grgias de Leontini aprofundou-se no subjetivismo relativista e defendeu o ceticismo absoluto afirmando que nada existia; se existisse, no poderia ser conhecido; mesmo que fosse conhecido, no poderia se ensinado.

Scrates (469 a.C. - 399 a.C.) considerado um marco na histria da filosofia. A ponto de os que vieram antes dele receberem o nome genrico de pr-socrticos e os que o sucederam, de ps-socrticos. O prprio Scrates, porm no deixou nada escrito, e o que se sabe dele e de seu pensamento vem dos textos de seus discpulos e de seus adversrios. Era filho de um escultor e de uma parteira, seu estilo de vida assemelhava-se, exteriormente, ao dos sofistas, embora no vendesse seus ensinamentos. No fundou uma escola, como os outros filsofos, realizando o seu ensinamento em locais pblicos, como uma espcie de pregador, exercendo um enorme fascnio sobre os homens de todas as idades, o que lhe custou inmeras averses e inimizades. O mtodo socrtico: Scrates simplesmente perguntava. No ensinava; queria aprender. Desenvolvia o saber filosfico conversando com as pessoas. Embora tenha sido confundido com os sofistas, Scrates travou uma profunda polmica com estes, pois procurava um fundamento para as interrogaes humanas, e definies para os conceitos, como por exemplo, para o belo, o bem , a justia. A pergunta essencial que Scrates tentava responder era: qual a essncia do homem? O autoconhecimento tornou-se um dos pontos fundamentais da filosofia socrtica. Conhece-te a ti mesmo, frase inscrita no Orculo de Delfos, era recomendao feita por Scrates a seus discpulos. Sua filosofia era desenvolvida mediante dilogos crticos com seus interlocutores. Esses dilogos podem ser divididos em dois momentos: Ironia: No grego, ironia quer dizer interrogao. De fato, Scrates interrogava seus interlocutores sobre aquilo que pensavam saber. No decorrer do dilogo, atacava as respostas das pessoas, procurando, com habilidade de raciocnio, evidenciar as contradies das afirmaes feitas por essas pessoas. Seu objetivo era demolir, nos discpulos, o orgulho, a arrogncia e a presuno do saber. Note-se que, s vezes, em suas simulaes irnicas, Scrates fingia at mesmo acolher como prprios os mtodos do interlocutor, especialmente quando era um homem de cultura, e brincava de engrandec-lo at o limite, para derrub-lo com a mesma lgica que lhes era prpria e amarr-lo na contradio.

92

FILOSOFIA
Scrates afirmava que o verdadeiro sbio aquele que admite a prpria ignorncia da a frase: "Sei que nada sei. A ironia socrtica tinha um carter purificador porque levava os discpulos a confessarem suas prprias contradies. Nessa fase do dilogo, a inteno fundamental de Scrates no era propriamente destruir o contedo das respostas dadas pelos interlocutores, mas assim como seu pai, ele esculpia as pessoas e as fazia tomar conscincia profunda de suas prprias respostas. Maiutica: Libertos do orgulho e da pretenso de que tudo sabiam, os discpulos podiam ento iniciar o caminho da reconstruo de suas prprias idias. Novamente Scrates lhes propunha uma serie de questes habilmente colocadas. Nesta segunda fase do dialogo, o objetivo de Scrates era ajudar seus discpulos a conceberem suas prprias idias. Assim transportava para o caminho da filosofia o exemplo de sua me, Fenareta, que, sendo parteira, ajudava a trazer crianas ao mundo. Por isso essa fase do dilogo socrtico destinada concepo de idias, era chamada de maiutica, termo grego que significa arte de trazer luz. Acusao de Scrates: Como ns vimos, Scrates dialogava com ricos e pobres, cidados e escravos, sem dar importncia posio socioeconmica das pessoas. O que importava eram as condies interiores de cada um. Para a democracia ateniense, Scrates era considerado subversivo, representando uma ameaa social, pois dirigia suas atenes para as pessoas sem fazer distines de classe. Isso contrariava os valores dogmticos da sociedade ateniense. Por isso foi acusado de ser injusto com os deuses da cidade e de corromper a juventude. No final do processo foi condenado a beber cicuta. Diante de seus juzes, no fim de sua vida, Scrates assumiu uma postura viril, imperturbvel, de quem nada teme, defendendo seus ideais e sem renunciar seus valores morais.

PRIMEIROS FILSOFOS
a) A tica, enquanto investigao racional do agir humano. b) A esttica, enquanto estudo sobre o belo na arte. c) A epistemologia, como avaliao dos procedimentos cientficos. d) A cosmologia, como investigao acerca da origem e da ordem do mundo. e) A filosofia poltica, enquanto anlise do Estado e sua legislao. 2. (UEL2003) Ainda sobre o mesmo tema, CORRETO afirmar que a filosofia: a) Surgiu como um discurso terico, sem embasamento na realidade sensvel, e em oposio aos mitos gregos. b) Retomou os temas da mitologia grega, mas de forma racional, formulando hipteses lgico-argumentativas. c) Reafirmou a aspirao atesta dos gregos, vetando qualquer prova da existncia de alguma fora divina. d) Desprezou os conhecimentos produzidos por outros povos, graas supremacia cultural dos gregos. e) Estabeleceu-se como um discurso acrtico e teve suas teses endossadas pela fora da tradio. 3. (UEL2004) Entre os fsicos da Jnia, o carter positivo invadiu de chofre a totalidade do ser. Nada existe que no seja natureza, physis. Os homens, a divindade, o mundo formam um universo unificado, homogneo, todo ele no mesmo plano: so as partes ou os aspectos de uma s e mesma physis que pem em jogo, por toda parte, as mesmas foras, manifestam a mesma potncia de vida. As vias pelas quais essa physis nasceu, diversificou-se e organizou-se so perfeitamente acessveis inteligncia humana: a natureza no operou no comeo de maneira diferente de como o faz ainda, cada dia, quando o fogo seca uma vestimenta molhada ou quando, num crivo agitado pela mo, as partes mais grossas se isolam e se renem.
(VERNANT, Jean-Pierre. As origens do pensamento grego. Trad. de sis Borges B. da Fonseca. 12.ed. Rio de Janeiro: Difel, 2002. p.110.)

INDICAO DE FILME Obrigado por fumar

EXERCCIOS
1. (UEL2003) Tales foi o iniciador da filosofia da physis, pois foi o primeiro a afirmar a existncia de um princpio originrio nico, causa de todas as coisas que existem, sustentando que esse princpio a gua. Essa proposta importantssima... podendo com boa dose de razo ser qualificada como a primeira proposta filosfica daquilo que se costuma chamar civilizao ocidental.
(REALE, Giovanni. Histria da filosofia: Antiguidade e Idade Mdia. So Paulo: Paulus, 1990. p. 29.)

Com base no texto, assinale a alternativa CORRETA. a) Para explicar o que acontece no presente preciso compreender como a natureza agia no comeo, ou seja, no momento original. b) A explicao para os fenmenos naturais pressupe a aceitao de elementos sobrenaturais. c) O nascimento, a diversidade e a organizao dos seres naturais tm uma explicao natural e esta pode ser compreendida racionalmente. d) A razo capaz de compreender parte dos fenmenos naturais, mas a explicao da totalidade dos mesmos est alm da capacidade humana. e) A diversidade de fenmenos naturais pressupe uma multiplicidade de explicaes e nem todas estas explicaes podem ser racionalmente compreendidas.

A filosofia surgiu na Grcia, no sculo VI a.C. Seus primeiros filsofos foram os chamados pr-socrticos. De acordo com o texto, assinale a alternativa que expressa o principal problema por eles investigado.

93

FILOSOFIA
4. (UEL2007) A filosofia grega parece comear com uma idia absurda, com a proposio: a gua a origem e a matriz de todas as coisas. Ser mesmo necessrio deter-nos nela e lev-la a srio? Sim, e por trs razes: em primeiro lugar, porque essa proposio enuncia algo sobre a origem das coisas; em segundo lugar, porque faz sem imagem e fabulao; e enfim, em terceiro lugar, porque nela, embora apenas em estado de crislida, est contido o pensamento: Tudo um. A razo citada em primeiro lugar deixa Tales ainda em comunidade com os religiosos e supersticiosos, a segunda o tira dessa sociedade e no-lo mostra como investigador da natureza, mas, em virtude da terceira, Tales se torna o primeiro filsofo grego.
Fonte: NIETZSCHE, F. Crtica Moderna. In: Os Pr-Socrticos. Traduo de Rubens Rodrigues Torres Filho. So Paulo: Nova Cultural, 1999. p. 43.

PRIMEIROS FILSOFOS
6. (2007) Leia o texto a seguir: Sim bem primeiro nasceu Caos, depois tambm Terra de amplo seio, de todos sede irresvalvel sempre dos imortais que tm a cabea do Olimpo nevado e Trtaro nevoento no fundo do cho de amplas vias e Eros: o mais belo entre Deuses imortais.
Fonte: HESODO. Teogonia. Traduo de Jaa Torrano. 3 ed. So Paulo: Iluminuras, 1995, p. 111.

Sobre o exposto acima, podemos AFIRMAR que se trata de um texto: I. Do perodo cosmolgico, que compreende as escolas prsocrticas, cujo interesse era perseguir a unidade que garantia a ordem do mundo e a possibilidade do conhecimento humano. II. De carter tico, cuja narrativa revela a preocupao com a conduta dos homens e dos deuses. III. De carter cosmognico, cuja reflexo busca tornar concebvel a origem das coisas e a fora que as produziu. IV. Anterior cosmologia filosfica, cuja narrativa reflete ainda a mentalidade mtica. Esto corretas apenas as afirmativas: a) I e III c) II e IV e) I, II e IV b) III e IV d) I, II e III 7. Sob luz dos filsofos naturalistas, descreva oque o conceito de arch. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Quais so as etapas do mtodo socrtico? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Com base no texto e nos conhecimentos sobre Tales e o surgimento da filosofia, considere as afirmativas a seguir. I. Com a proposio sobre a gua, Tales reduz a multiplicidade das coisas e fenmenos a um nico princpio do qual todas as coisas e fenmenos derivam. II. A proposio de Tales sobre a gua compreende a proposio Tudo um. III. A segunda razo pela qual a proposio sobre a gua merece ser levada a srio mostra o aspecto filosfico do pensamento de Tales. IV. O Pensamento de Tales gira em torno do problema fundamental da origem da virtude. A alternativa que contm todas as afirmativas CORRETAS : a) I e II d) I, II e IV b) II e III e) II, III e IV c) I e IV 5. (UEL2004) Mais que saber identificar a natureza das contribuies substantivas dos primeiros filsofos fundamental perceber a guinada de atitude que representam. A proliferao de ticas que deixam de ser endossadas acriticamente, por fora da tradio ou da imposio religiosa, o que mais merece ser destacado entre as propriedades que definem a filosoficidade.
(OLIVA, Alberto; GUERREIRO, Mario. Prsocrticos: a inveno da filosofia. Campinas: Papirus, 2000. p. 24.)

Assinale a alternativa que apresenta a guinada de atitude que o texto afirma ter sido promovida pelos primeiros filsofos. a) A aceitao acrtica das explicaes tradicionais relativas aos acontecimentos naturais. b) A discusso crtica das idias e posies, que podem ser modificadas ou reformuladas. c) A busca por uma verdade nica e inquestionvel, que pudesse substituir a verdade imposta pela religio. d) A confiana na tradio e na imposio religiosa como fundamentos para o conhecimento. e) A desconfiana na capacidade da razo em virtude da proliferao de ticas conflitantes entre si.

94

INTRODUO TICA

UNIDADE 3 INTRODUO TICA

Quando falamos de tica, um nmero importante de temas abordado: virtudes, juzos, conscincia, justia, liberdade, autonomia, razo, responsabilidade. Estas sero palavras que estaro sempre presentes em nossas reflexes.

ORIGEM DAS DISCUSSES TICAS E MORAIS

Dentre todos os seres vivos, o homem o nico que possui a capacidade de pensar antes de agir e buscar os motivos de suas aes. Perguntas do tipo: O que posso fazer? O que devo fazer? So questes que esto na base do comportamento humano, que so na verdade questes ticas. No nosso dia-a-dia, encontramos frequentemente diante de situaes nas quais a nossa deciso depende daquilo que consideramos bom, justo ou moralmente correto. Toda vez que isso ocorre estamos diante de uma deciso que envolve um julgamento moral da realidade, a partir do qual vamos nos orientar. Assim o homem age no mundo de acordo com valores, isto , para eles as coisas do mundo e as aes sobre o mundo no so indiferentes, no se equivalem, mas so hierarquizadas de acordo com as noes de bem e de justo que os homens compartilham em um determinado momento. O homem um ser moral, um ser que avalia sua ao e as aes dos outros homens a partir de valores.

MORAL E TICA
Os conceitos de moral e tica, embora sejam diferentes, so com frequncia usados como sinnimos. Isso acontece porque a etimologia dos termos semelhante: moral vem do latim mos, moris, que significa maneira de se comportar regulada pelo costume. tica vem do grego ethos, que tem o mesmo significado de costume. Moral: em sentido bem amplo, a moral o conjunto das regras de conduta admitidas em determinada poca ou por um grupo de homens. Nesse sentido, o homem moral aquele que age bem ou mal na medida em que acata ou transgride as regras do grupo. Como as comunidades humanas so distintas entre si, os valores morais podem ser distintos de uma comunidade para outra. tica: A tica ou filosofia moral a parte da filosofia que se ocupa com a reflexo a respeito das noes e princpios que fundamentam a vida moral. Como filosofia prtica, isto , disciplina terica com preocupaes prticas, a tica deve buscar aplicar o conhecimento sobre o aquilo que , para construir aquilo que deve ser. E, para isso, indispensvel boa parcela de conhecimento terico.

Na interpretao mtica do mundo o indivduo est inserido numa ordem preestabelecida, onde no h espao para questionamentos. A ordem social e as leis so impostas pelos deuses, que tem na religiosidade e f do povo, a prpria justificativa. Com o advento da filosofia, Scrates foi o primeiro a sustentar a existncia de um saber universalmente vlido, que decorre do conhecimento da essncia humana, a partir da qual se pode conceber a fundamentao de uma moral universal. Sendo a alma racional a essncia do homem, a tica inaugurada por Scrates racionalista. A moral por sua vez, surge para que a ao coletiva torne-se possvel, possibilitando as relaes entre os indivduos. Dois elementos fundamentais para a tica e moral se faro presentes na conscincia do homem grego: a razo e com ela a idia da liberdade. Razo: Na medida em que a razo humana substitui o mito na explicao do mundo, vo deixando de valer aquelas leis que eram impostas pelos deuses, afinal de contas os deuses no so mais a justificativa das coisas. Ser a razo mesma que dever verificar a validade de uma lei. Liberdade: Ao mesmo tempo vai surgindo a idia da liberdade. J que quando os deuses governam eles tm nas mos o destino dos indivduos, tudo estaria de antemo determinado pela vontade divina. Mas como agora a razo humana que compreende o mundo e a sociedade, ela tambm ser acompanhada pela prpria liberdade do indivduo, que pela prpria razo pode criar as leis e no se submeter tirania dos as divindades. A liberdade ser um tema muito discutido durante toda a histria da filosofia. Afinal quando podemos afirmar que realmente somos livres? Para responder essa pergunta foram desenvolvidas trs respostas diferentes: Para os adeptos do determinismo absoluto, a liberdade no existe, mera iluso, pois o homem sempre determinado, por sua natureza biolgica ou histrico-social; Para os adeptos da liberdade absoluta o homem sempre livre e est condenado a ser livre como afirma o existencialista Jean-Paul Sartre.

A TICA EM PLATO

95

FILOSOFIA
Plato (427-347 a C.) considerado um dos maiores filsofos da Grcia. Nascido em Atenas, pertencia a uma das mais nobres famlias atenienses. Seu nome verdadeiro era Arstcles, mas, devido a sua constituio fsica, recebeu o apelido de Plato, termo grego que significa de ombros largos. Foi discpulo de Scrates tendo-o como personagem principal de seus vrios dilogos. Fundou a escola filosfica Academia, nos jardins construdos por seu amigo Academus. Essa escola foi uma das primeiras instituies permanentes de ensino superior do mundo ocidental. Plato aprofundou-se nas questes acerca da diviso entre o mundo da verdade e mundo da falsidade, inaugurada por Parmnides. Esta diviso feita h mais de 2000 anos atrs marca ainda hoje profundamente a nossa cultura. Por exemplo, tanto para o cristianismo como para o islamismo, a vida que est alm deste mundo muito melhor e onde o bem pode ser encontrado, pois somente depois da morte quando encontrar Deus/Al que o sujeito poder ter uma vida plena, sem sofrimento. No que a concepo que Plato tem, seja crist, mas, que o cristianismo e outras religies absorveram as idias de Plato para explicar suas doutrinas. Plato acredita na existncia de um mundo sensvel (dos sentidos) e um mundo inteligvel (da razo). no mundo inteligvel que o verdadeiro conhecimento se encontra, e o modo como se deve viver ser de acordo com o que estiver no mundo inteligvel, ou seja, de acordo com a nossa razo. Chegamos ao elemento principal do pensamento de Plato, a razo. Ser a partir da razo que ser construda a tica platnica. A vida do ser humano deve estar submetida razo. Portanto o homem ideal para Plato, aquele que sabe governar sua vida de acordo com a razo, submetendo todos os seus instintos e paixes gerncia da racionalidade. Desse modo, este homem encontrar para si o Sumo Bem, que segundo Plato a maior de todas as idias. Este bem se revela na ordem do cosmos (mundo organizado) e quando o homem vive submetido sua razo, est reproduzindo em sua vida a harmonia a justia que coloca o mundo em ordem.

INTRODUO TICA
o alimento at s vestes e habitao. Em segundo lugar, so necessrios os servios de alguns homens responsveis pela guarda e defesa da Cidade. E em terceiro lugar, necessria a dedicao de alguns poucos homens que saibam governar adequadamente. A Cidade, portanto, necessita de trs classes sociais: a dos lavradores, artesos e comerciantes; a dos guerreiros; e a dos governantes. Plato afirma ainda que o Estado deve promover a educao a todos at os 20 anos de idade e a partir da seria feita uma seleo quase que natural, para que se pudesse organizar a comunidade nessas trs classes distintas. A primeira classe constituda de pessoas que estudaram durante 20 anos. Nelas prevalece o aspecto concupiscvel da alma, que caracterizada como alma de bronze. Essas pessoas deveriam dedicar-se agricultura, ao artesanato e ao comrcio. Cuidariam, portanto, da subsistncia da cidade. A segunda classe constituda de pessoas que estudaram durante 30 anos. Nelas prevalece a fora irascvel da alma, que caracterizada como alma de prata. Por possurem a virtude da coragem e fora, elas deveriam cuidar da defesa da cidade. A terceira classe constituda por pessoas que estudaram durante 50 anos, que tenham aprendido a conhecer e a contemplar o Bem. Nessas pessoas prevalece a alma racional, ou seja, de ouro. Cabem a elas o governo da cidade, por serem as mais sbias, seriam os mais justas tambm. Plato afirma que as nicas pessoas que poderiam contemplar o verdadeiro conhecimento e pudessem reger as coisas mediante a razo, seriam os filsofos, portanto, a Cidade ideal deveria ser governada por Filsofos. Desse modo a justia acontece no estado, pois, a razo do filsofo que governa. E do mesmo modo que a justia se d no estado ela se d no indivduo quando este se governa pela razo. Plato enxerga a sociedade como um todo onde cada um exerce a sua funo pelo bem do todo social. No h vida tica fora da cidade justa. No h espao para o individualismo na repblica platnica. Plato prope um modelo aristocrtico de poder, em que o poder confiado aos mais sbios, ou seja, prope uma sofocracia. Para Plato, cada classe social devia apenas dedicar-se sua funo e virtude especifica, s quando isto acontece que numa sociedade reina a harmonia e a felicidade. A finalidade do Estado educar os cidados na respectiva virtude, assegurando deste modo a sua felicidade. O sistema educativo encontra-se ao servio do Estado, e possui duas modalidades: Uma educao obrigatria, comum a todos at aos 20 anos. Tem por finalidade formar cidados no respeito pelas instituies e dedicados realizao das suas funes especficas. Nesta educao fazem parte, entre outras matrias, a msica (para permitir o controlo do homem das partes inferiores da alma) e a ginstica (para o controlo do corpo).

A JUSTIA

na obra A Repblica que Plato evidncias suas principais concepes tanto na tica, como na poltica, esttica, e epistemologia. Neste livro, Scrates, principal personagem do dilogo, tenta definir logo nos primeiros captulos o que a Justia. Seus questionamentos iro aos poucos descartando os conceitos imprprios de justia, que seus interlocutores tentam definir. At que seja necessrio construir uma cidade ideal, onde a justia se revela. nesta obra que se inaugura a discusso tica ocidental sobre como devemos viver. Para Plato devemos viver bem, o que implica em agir bem. No entanto, h condies que interferem na ao boa, so os impulsos e desejos que fogem da legislao da razo, portanto cabe ao homem subordin-los razo, como j havamos dito anteriormente. Vejamos ento, como Plato, atravs de Scrates, constri seu argumento sobre a justia, ao mesmo tempo em que fala como deve ser a cidade ideal.

A CIDADE JUSTA

Um Estado nasce porque cada um de ns autrquico, ou seja, no se basta a si mesmo e tm necessidade dos servios de outro homens. Em primeiro lugar, so necessrios os servios de todos aqueles que provm s necessidades materiais, desde

96

FILOSOFIA ALMA BRONZE PRATA OURO VIRTUDE MODERAO TEMPERANA FORA - VALOR SABEDORIA SABER PARTES DO CORPO VENTRE PEITO CABEA CLASSE PRODUTORES TRABALHADORES GUERREIROS GUARDIES FILSOFOS GOVERNAN-TES PARTES DA ALMA CONCUSPISCENTE APETITE IRASCVEL CORAGEM RACIONAL RAZO EDUCAO 20 ANOS 30 ANOS 50 ANOS

INTRODUO TICA
2. (2007) Em A Repblica, Plato analisa cinco formas de governo a fim de determinar qual delas a melhor e mais justa, isto , qual delas corresponde ao modelo de constituio idealizado por ele. Segundo Plato, o Estado a imagem amplificada do homem justo. Considere o seguinte dilogo entre Scrates e Adimanto, apresentado em A Repblica, Livro VIII. Scrates Sendo assim, diz: no o desejo insacivel daquilo que a democracia considera o seu bem supremo que a perde? Adimanto E que bem esse? Scrates A liberdade. [...] Adimanto Sim, isso o que se ouve muitas vezes. Scrates O que eu ia dizer h pouco : no o desejo insacivel desse bem, e a indiferena por todo o resto, que muda este governo e o obriga a recorrer tirania? Adimanto Como? Scrates Quando um Estado democrtico, sedento de liberdade, passa a ser dominado por maus chefes, que fazem com que ele se embriague com esse vinho puro para alm de toda a decncia, ento, se os seus magistrados no se mostram inteiramente dceis e no lhe concedem um alto grau de liberdade, ele castiga-os, acusando-os de serem criminosos e oligarcas. [...] E ridiculariza os que obedecem aos magistrados e trata-os de homens servis e sem valor. Por outro lado, louva e honra, em particular e em pblico, os governantes que parecem ser governados e os governados que parecem ser governantes. No inevitvel que, num Estado assim, o esprito de liberdade se estenda a tudo?
Fonte: PLATO. A Repblica. Traduo de Enrico Corvisieri. So Paulo: Nova Cultural, 1997, p. 280-281.

EXERCCIOS
1. (UEL2005) - Mas a cidade pareceu-nos justa, quando existiam dentro dela trs espcies de naturezas, que executavam cada uma a tarefa que lhe era prpria; e, por sua vez, temperante, corajosa e sbia, devido a outras disposies e qualidades dessas mesmas espcies.. - verdade. - Logo, meu amigo, entenderemos que o indivduo, que tiver na sua alma estas mesmas espcies, merece bem, devido a essas mesmas qualidades, ser tratado pelos mesmos nomes que a cidade.
(PLATO. A repblica. Trad. de Maria Helena da Rocha Pereira. 7 ed. Lisboa: Fundao Calouste Gulbenkian, 1993. p. 190.)

Com base no texto e nos conhecimentos sobre a justia em Plato, CORRETO afirmar: a) As pessoas justas agem movidas por interesses ou por benefcios pessoais, havendo a possibilidade de ficarem invisveis aos olhos dos outros. b) A justia consiste em dar a cada indivduo aquilo que lhe de direito, conforme o princpio universal de igualdade entre todos os seres humanos, homens e mulheres. c) A verdadeira justia corresponde ao poder do mais forte, o qual, quando ocupa cargos polticos, faz as leis de acordo com os seus interesses e pune a quem lhe desobedece. d) A justia deve ser vista como uma virtude que tem sua origem na alma, isto , deve habitar o interior do homem, sendo independente das circunstncias externas. e) Ser justo equivale a pagar dvidas contradas e restituir aos demais aquilo que se tomou emprestado, atitudes que garantem uma velhice feliz.

Com base no dilogo anterior e nos conhecimentos sobre as formas de governo analisadas por Plato, considere as seguintes afirmativas: I. A democracia a negao da justia, pois ela rejeita o princpio da escolha de governantes pelo critrio da capacidade especfica. II. A democracia uma forma de governo que, ao dar livre curso aos desejos suprfluos e perniciosos dos indivduos, se degenera em tirania. III. A democracia a mais bela forma de governo, pois privilegia a liberdade que o mais belo de todos os bens. IV. Na democracia, cada indivduo assume a sua funo prpria dentro da polis. Esto CORRETAS apenas as afirmativas: a) I e II b) II e III c) III e IV d) I, II e IV e) I, III e IV

97

FILOSOFIA
3. (UEL2003) Leia o texto, que se refere idia de cidade justa de Plato. Como a temperana, tambm a justia uma virtude comum a toda a cidade. Quando cada uma das classes exerce a sua funo prpria, aquela para a qual a sua natureza a mais adequada, a cidade justa. Esta distribuio de tarefas e competncias resulta do fato de que cada um de ns no nasceu igual ao outro e, assim, cada um contribui com a sua parte para a satisfao das necessidades da vida individual e coletiva. (...) Justia , portanto, no indivduo, a harmonia das partes da alma sob o domnio superior da razo; no estado, a harmonia e a concrdia das classes da cidade.
(PIRES, Celestino. Convivncia poltica e noo tradicional de justia. In: BRITO, Adriano N. de; HECK, Jos N. (Orgs.). tica e poltica. Goinia: Editora da UFG, 1997. p. 23.)

UNIDADE 4 A TICA EM ARISTTELES

Sobre a cidade justa na concepo de Plato, CORRETO afirmar: a) Nela todos satisfazem suas necessidades mnimas, e inexistem funes como as de governantes, legisladores e juzes. b) governada pelos filsofos, protegida pelos guerreiros e mantida pelos produtores econmicos, todos cumprindo sua funo prpria. c) Seus habitantes desejam a posse ilimitada de riquezas, como terras e metais preciosos. d) Ela tem como principal objetivo fazer a guerra com seus vizinhos para ampliar suas posses atravs da conquista. e) Ela ambiciona o luxo desmedido e est cheia de objetos suprfluos, tais como perfumes, incensos, iguarias, guloseimas, ouro, marfim, etc. 4. Qual o campo de discusso que diz respeito TICA? _________________________________________________ _________________________________________________ 5. Segundo Plato, como deve-se ocorrer a relao entre as almas? Qual alma deve prevalecer e porque? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Aristteles (384-322 a.C.) nasceu na cidade de Estagira na Macednia, foi discpulo de Plato e um dos principais sistematizadores do saber. Nicmaco, seu pai e tambm a quem dedicado o livro tica a Nicmaco, era mdico da corte de Filipe, rei da Macednia. O filho deste, o clebre Alexandre Magno, teve o prprio Aristteles como preceptor. A obra deste filsofo imensa e muito complexa. Muitos de seus escritos se perderam, mais temos livros seus que so de grande valor para a compreenso de seu pensamento. No entanto, o que nos interessa aqui, compreender os conceitos fundamentais de sua tica, que se encontram na obra, j citada, tica a Nicmaco. Para os gregos o homem antes de tudo um animal poltico, ou seja, impossvel conceber o homem fora de uma sociedade. O ser humano feito para viver em comunidade, da a grande preocupao de como o indivduo deve viver. Qual a finalidade do ser humano? Como se deve agir? Estas questes sero sempre interpretadas no contexto da plis grega (cidade), pois, o indivduo no superior cidade, mas, existe em funo dela. Para Aristteles todas as nossas aes tendem a um fim. Este fim um bem. O bem dito como supremo e do qual todas as aes humanas devem visar, a felicidade. A finalidade do homem est em ser feliz. A tica aristotlica , portanto, uma tica teleolgica, ou seja, tende a um fim: a felicidade. Ora, se todos os cidados alcanarem a felicidade, ento o Estado alcanar o bem supremo como um todo. Porm, para ser feliz, o homem deve viver de acordo com sua essncia, isto , de acordo com sua razo, com sua conscincia reflexiva. E orientando, os seus atos para uma conduta tica, a razo o conduzir a pratica da virtude.

TICA DAS VIRTUDES


A virtude representa o meio-termo, a justa medida de equilbrio entre o excesso e a falta de um atributo qualquer, sendo o excesso e a escassez, vcios. As virtudes so adquiridas com o hbito, por exemplo, aes justas tornamo-nos justos, aes corajosas, tornamo-nos corajosos, etc...

98

FILOSOFIA
Abaixo um quadro das doze virtudes que um indivduo deve possuir para alcanar a felicidade:

A TICA EM ARISTTELES
A vida contemplativa uma espcie de vida: auto-suciente, aquele que a possui j no deseja mais nada, embora isso no o impea de desfrutar de outros bens; que buscamos por si mesmo e no como meio para outra coisa; uma atividade contnua e duradoura. Mas Aristteles reconhece que o ideal de uma vida contemplativa contnua apenas possvel para os deuses; os seres humanos tm necessidades ligadas ao corpo. Portanto, a felicidade tambm pode ser encontrada mediante o exerccio da sabedoria prtica, que consiste em dominar as paixes e conseguir uma relao amvel e satisfatria com o mundo natural e social. Espera-se que o candidato apresente os trs tipos principais de vida para Aristteles: a vida dos prazeres prazer; a vida poltica honra; e a vida contemplativa razo. Aristteles assevera que a maioria das pessoas busca a vida dos prazeres o prazer , pois uma inclinao natural buscar o prazer e fugir da dor. A vida dos prazeres no se restringe apenas aos seres humanos, mas faz parte da vida de todos os animais, pois esses sentem apetites e desejos. Os apetites ou as coisas apetecidas no so boas nem ms; os apetites s se tornam maus se no estiverem mediados pela racionalidade sendo, assim, imoderados. A vida poltica escolhida pelos melhores, pois esses visam honra. A honra o objeto da vida poltica, no entanto, o problema que a honra depende mais de quem a d do que daquele que a recebe. No entanto, a felicidade deve ser constituda por algo que seja prprio a cada indivduo e no por algo que independa de um terceiro, assim, a vida de honra no pode proporcionar a mais alta felicidade. A felicidade mais perfeita para os seres humanos reside no exerccio da inteligncia teortica, isto , na contemplao. A vida contemplativa realiza o m prprio do ser humano. A vida contemplativa uma espcie de vida autosuciente, aquele que a possui j no deseja mais nada, embora isso no o impea de desfrutar de outros bens; uma espcie de vida que buscamos por si mesma e no como meio para outra coisa; uma atividade contnua e duradoura. Aristteles reconhece que o ideal de uma vida contemplativa contnua/duradoura apenas possvel para os deuses, pois os seres humanos tm necessidades ligadas ao corpo. Portanto, a felicidade tambm pode ser encontrada mediante o exerccio da sabedoria prtica, que consiste em dominar as paixes e conseguir uma relao amvel e satisfatria com o mundo natural e social. Alguns ainda procuram a riqueza, mas a riqueza apenas um meio, nunca um m. A riqueza algo externo ao ser humano e desejada por aquilo que pode proporcionar e no em si mesma. A riqueza uma condio prvia, pois oportuniza ao ser humano a possibilidade de se dedicar e a exercitar a atividade prpria da felicidade.

AS DOZE VIRTUDES
Excesso Confiana Prodigalidade Vulgaridade Libertinagem Vaidade Ambio Irascibilidade Adulao Zombaria Timidez Orgulho -------------Virtude Coragem Liberalidade Magnificncia Temperana Magnanimidade -------------Calma Amizade Espirituosidade Pudor Veracidade Justia Escassez Medo Avareza Mesquinhez Insensibilidade Modstia Desambio Grosseria Pacatez Rusticidade Despudor Descrdito Prprio --------------

Alm de colocar as virtudes como meio para a felicidade, Aristteles afirma que a felicidade s pode ser atingida pela pessoa que leva uma vida contemplativa, ou seja, que usa da razo para conhecer. Afinal o homem um animal racional.

O PROBLEMA TICO EM ARISTTELES


Aristteles revela que o ser humano pode escolher trs espcies fundamentais de vida: vida dos prazeres, a vida poltica e a vida contemplativa. A maioria busca o prazer vida dos prazeres , pois uma inclinao natural buscar o prazer e fugir da dor. A vida dos prazeres no se restringe apenas aos seres humanos, mas faz parte da vida de todos os animais, pois esses sentem apetites e desejos. Os apetites ou as coisas apetecidas no so boas nem ms; os apetites s se tornam maus se no estiverem mediados pela racionalidade sendo, assim, imoderados. A vida poltica escolhida pelos melhores, pois esses visam honra. A honra o objeto da vida poltica. O problema que a honra depende mais de quem a d do que daquele que a recebe. Se a felicidade deve ser constituda por algo que seja prprio a cada indivduo e no por algo que dependa de um terceiro, a vida de honra no pode proporcionar a mais alta felicidade. A felicidade mais perfeita para os seres humanos reside no exerccio da inteligncia teortica, isto , na contemplao. a vida contemplativa que realiza o m prprio do ser humano.

DICAS DE FILME A procura da felicidade

99

FILOSOFIA

A TICA EM ARISTTELES
3. (UEL 2003) A virtude pois uma disposio de carter relacionada com a escolha e consiste numa mediania...
(ARISTTELES. tica Nicmaco. Trad. de Leonel Vallandro e Gerd Bornheim. 4 ed. So Paulo: Nova Cultural, 1991. p. 33.)

EXERCCIOS
1. (UEL 2008) De acordo com Aristteles, a vida consagrada ao ganho, que tem como fim a riqueza, no a vida feliz. Portanto, a vida consagrada ao ganho identifica erroneamente o que o bem ou a felicidade.
(ARISTTELES. tica a Nicmaco. Traduo de Leonel Vallandro e Gerd Bornheim da verso inglesa de W. D. Ross. So Paulo: Nova Cultural, 1987. p. 12.)

Qual a principal razo invocada por Aristteles para rejeitar a vida que tem como fim ltimo a riqueza? a) A vida consagrada ao ganho apenas um meio e no um fim em si mesmo. b) O acmulo de bens exteriores representa uma agresso natureza. c) A busca de riqueza um fim acalentado por indivduos mesquinhos e egostas. d) A vida consagrada ao ganho modo de vida tpico do capitalismo. e) A riqueza torna as pessoas escravas do dinheiro e, portanto, infelizes. Leia o Texto VII e responda questo. TEXTO VII O Cauim uma bebida produzida a partir da mastigao da mandioca ou do milho por mulheres cuja saliva contribui para o seu fabrico. A preparao dessa bebida consiste em trs estgios bsicos: fermentao, amadurecimento e azedamento. Assim, em todos os rituais de passagem, em determinadas tribos indgenas, a presena do Cauim imprescindvel.
(Adaptado: SZTUTMAN, R. Cauinagem, uma comunicao embriagada - apontamentos sobre uma festa tipicamente amerndia. Disponvel em: <www.antropologia.com.br/tribo>. Acesso em: 17 jul. 2008.)

Com base no texto e nos conhecimentos sobre a virtude em Aristteles, assinale a alternativa CORRETA. a) A virtude o governo das paixes para cumprir uma tarefa ou uma funo. b) A virtude realiza-se no mundo das idias. c) A virtude a obedincia aos preceitos divinos. d) A virtude a justa medida de equilbrio entre o excesso e a falta. e) A virtude tem como fundamento a utilidade da ao. 4. (UEL-2004) - O que significa exatamente essa expresso antiquada: virtude? perguntou Sebastio. - No sentido filosfico, compreende-se por virtude aquela atitude de, na ao, deixar-se guiar pelo bem prprio ou pelo bem alheio esclareceu o senhor Barros. - O bem alheio? perguntou Sebastio. - Sim disse o senhor Barros. verdade que a coragem e a moderao so virtudes, em primeiro lugar, para consigo mesmo, mas tambm h outras virtudes, como a benevolncia, a justia e a seriedade ou confiabilidade, ou seja, a qualidade de ser confivel, que so disposies orientadas para o bem dos outros.
(TUGENDHAT, Ernst; VICUA, Ana Maria; LPES, Celso. O livro de Manuel e Camila: dilogos sobre moral. Trad. de Suzana Albornoz. Goinia: Ed. da UFG, 2002. p. 142.)

2. (2009) Nos rituais indgenas, a ingesto do cauim evoca a busca de um estado de prazer e de felicidade. Na tradio filosfica, a idia de felicidade foi abordada por Aristteles, na obra tica a Nicmacos. Considerando o pensamento tico de Aristteles, assinale a alternativa CORRETA. a) O interesse pessoal constitui o bem supremo a que visam todas as aes humanas, acima das escolhas racionais. b) A felicidade o bem supremo a que aspira todo indivduo pela experincia sensvel do prazer que se busca por ele mesmo. c) Todos os seres humanos aspiram ao bem e felicidade, que s podem ser alcanados pela conduta virtuosa, aliada vontade e escolha racional. d) Fim ltimo da existncia humana, a felicidade refere-se vida solitria do indivduo, desvinculada da convivncia social na polis. e) A felicidade do indivduo no pode ser alcanada pelo discernimento racional, mas to-somente pelo exerccio da sensibilidade.

Com base no texto, CORRETO afirmar: a) As aes virtuosas so reguladas por leis positivas, determinadas pelo direito, independentemente de um princpio de bem moral. b) A virtude limita-se s aes que envolvem outras pessoas; em relao a si prprio a ao independente de um princpio de bem. c) A ao virtuosa orientada por princpios externos que determinam a qualidade da ao. d) Ser virtuoso significa guiar suas aes por um bem, que pode ser tanto em relao a si prprio quanto em relao aos outros. e) As virtudes so disposies desvinculadas de qualquer orientao, seja para o bem, seja para o mal. 5. (UEL 2006) [...] uma pessoa age injustamente ou justamente sempre que pratica tais atos voluntariamente; quando os pratica involuntariamente, ela no age injustamente nem justamente, a no ser de maneira acidental. O que determina se um ato ou no um ato de injustia (ou de justia) sua voluntariedade ou involuntariedade; quando ele voluntrio, o agente censurado, e somente neste caso se trata de um ato de injustia, de tal forma que haver atos

100

FILOSOFIA
que so injustos mas no chegam a ser atos de injustia se a voluntariedade tambm no estiver presente.
(ARISTTELES. tica a Nicmaco. So Paulo: Nova Cultural, 1996. p. 207.)

A TICA EM ARISTTELES
Com base no texto e nos conhecimentos sobre a tica aristotlica, CORRETO afirmar: a) uma tica que desconsidera os valores culturais e a participao discursiva dos envolvidos na escolha da concepo de bem a ser perseguida. b) uma tica do dever que, ao impor normas de ao universais, transcende a concepo de vida boa de uma comunidade e exige o cumprimento categrico das mesmas. c) uma tica compreendida teleologicamente, pois o bem supremo, vinculado busca e realizao plena da felicidade, orienta as aes humanas. d) uma tica que orienta as aes por meio da bem-aventurana proveniente da vontade de Deus, porm sinalizando para a irrealizao plena do bem supremo nesta vida. e) uma tica que compreende o indivduo virtuoso como aquele que j nasce com certas qualidades fsicas e morais, em funo de seus laos sanguneos. 8. (UEL 2007) E justia aquilo em virtude do qual se diz que o homem justo pratica, por escolha pr-pria, o que justo, e que distribui, seja entre si mesmo e um outro, seja entre dois outros, no de maneira a dar mais do que convm a si mesmo e menos ao seu prximo (e inversamente no relativo ao que no convm), mas de maneira a dar o que igual de acordo com a proporo; e da mesma forma quando se trata de distribuir entre duas outras pessoas.
Fonte: ARISTTELES. tica a Nicmaco. Traduo de Leonel Vallandro e Gerd Bornheim da verso inglesa de W. D. Ross. So Paulo: Nova Cultural, 1987, p. 89.

Com base no texto e nos conhecimentos sobre a concepo de Justia em Aristteles, CORRETO afirmar: a) Um ato de justia depende da conscincia do agente e de ter sido praticado voluntariamente. b) A noo de justo desconsidera a discriminao de atos voluntrios e involuntrios quanto ao reconhecimento de mrito. c) A justia uma noo de virtude inata ao ser humano, a qual independe da voluntariedade do agente. d) O ato voluntrio desobriga o agente de imputabilidade, devido carncia de critrios para distinguir a justia da injustia. e) Quando um homem delibera prejudicar outro, a injustia est circunscrita ao ato e, portanto, exclui o agente. 6. (UEL 2005) A busca da tica a busca de um fim, a saber, o do homem. E o empreendimento humano como um todo, envolve a busca de um fim: Toda arte e todo mtodo, assim como toda ao e escolha, parece tender para um certo bem; por isto se tem dito, com acerto, que o bem aquilo para que todas as coisas tendem. Nesse passo inicial de a tica a Nicmacos est delineado o pensamento fundamental da tica. Toda atividade possui seu fim, ou em si mesma, ou em outra coisa, e o valor de cada atividade deriva da sua proximidade ou distncia em relao ao seu prprio fim.
(PAIXO, Mrcio Petrocelli. O problema da felicidade em Aristteles: a passagem da tica dianotica aristotlica no problema da felicidade. Rio de Janeiro: Ps-Moderno, 2002. p. 33-34.)

Com base no texto e nos conhecimentos sobre a tica em Aristteles, considere as afirmativas a seguir. I. O fim ltimo da ao humana consiste na felicidade alcanada mediante a aquisio de honrarias oriundas da vida poltica. II. A tica o estudo relativo excelncia ou virtude prpria do homem, isto , do fim da vida humana. III. Todas as coisas tm uma tendncia para realizar algo, e nessa tendncia encontramos seu valor, sua virtude, que o fim de cada coisa. IV. Uma ao virtuosa aquela que est em acordo com o dever, independentemente dos seus fins. Esto CORRETAS apenas as afirmativas: a) I e IV c) III e IV b) II e III d) I, II e III e) I, II e IV

De acordo com o texto e os conhecimentos sobre a justia em Aristteles, CORRETO afirmar: a) possvel que um homem aja injustamente sem ser injusto. b) A justia uma virtude que no pode ser considerada um meio-termo. c) A justia corretiva deve ser feita de acordo com o mrito. d) Os partidrios da democracia identificam o mrito com a excelncia moral . e) Os partidrios da aristocracia identificam o mrito com a riqueza. 9. (UEL 2007) Ora, ns chamamos aquilo que deve ser buscado por si mesmo mais absoluto do que aquilo que merece ser buscado com vistas em outra coisa, e aquilo que nunca desejvel no interesse de outra coisa mais absoluto do que as coisas desejveis tanto em si mesmas como no interesse de uma terceira; por isso chamamos de absoluto e incondicional aquilo que sempre desejvel em si mesmo e nunca no interesse de outra coisa.
Fonte: ARISTTELES. tica a Nicmaco. Traduo de Leonel Vallandro e Gerd Bornheim. So Paulo: Nova Cultural, 1987, 1097b, p. 15.

7. (UEL 2006) Aristteles foi o primeiro filsofo a elaborar tratados sistemticos de tica. O mais influente desses tratados, a tica a Nicmaco, continua a ser reconhecido como uma das obras-primas da filosofia moral. Ali nosso autor apresenta a questo que, de seu ponto de vista, constitui a chave de toda investigao tica: Qual o fim ltimo de todas as atividades humanas? (CORTINA, Adela; MARTNEZ, Emilio. tica. Trad. Silvana Cobucci Leite. So Paulo: Loyola, 2005. p. 57

De acordo com o texto e os conhecimentos sobre a tica de Aristteles, assinale a alternativa CORRETA:

101

FILOSOFIA
a) Segundo Aristteles, para sermos felizes suficiente sermos virtuosos. b) Para Aristteles, o prazer no um bem desejado por si mesmo, tampouco um bem desejado no interesse de outra coisa. c) Para Aristteles, as virtudes no contam entre os bens desejados por si mesmos. d) A felicidade , para Aristteles, sempre desejvel em si mesma e nunca no interesse de outra coisa. e) De acordo com Aristteles, para sermos felizes no necessrio sermos virtuosos. 10. (UEL 2007) Desde suas origens entre os filsofos da antiga Grcia, a tica um tipo de saber normativo, isto , um saber que pretende orientar as aes dos seres humanos.
Fonte: CORTINA, A.; MARTNEZ, E. tica. Traduo de Silvana Cobucci Leite. So Paulo: Edies Loyola, 2000, p. 9.

A TICA NOS PERODOS HELENSTICO E MEDIEVAL


12. O conceito de virtudes aparece na tica aristotlica, afim de direcionar o homem. Qual a direo que o homem deve seguir para se obter a felicidade? Como? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Com base no texto e na compreenso da tica aristotlica, CORRETO afirmar que a tica: a) Orienta-se pelo procedimento formal de regras universalizveis, como meio de verificar a correo tica das normas de ao. b) Adota a situao ideal de fala como condio para a fixao de princpios ticos bsicos, a partir da negociao discursiva de regras a serem seguidas pelos envolvidos. c) Pauta-se pela teleologia, indicando que o bem supremo do homem consiste em atividades que lhe sejam peculiares, buscando a sua realizao de maneira excelente. d) Contempla o hedonismo, indicando que o bem supremo a ser alcanado pelo homem reside na felicidade e esta consiste na realizao plena dos prazeres. e) Baseada no emotivismo, busca justificar a atitude ou o juzo tico mediante o recurso dos prprios sentimentos dos agentes, de forma a influir nas demais pessoas. 11. Porque a tica aristotlica chamada de eudaimonista? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

UNIDADE 5 A TICA NOS PERODOS ELENSTICO E MEDIEVAL

102

FILOSOFIA
Com a conquista da Grcia pelos macednicos (322 a.C.), tem incio o chamado perodo Helenstico. Devido expanso militar do Imprio de Alexandre Magno, o perodo helenstico caracterizou-se por um processo de interao entre cultura grega clssica e a cultura dos povos orientais conquistados. A produo filosfica desse perodo corresponde basicamente continuao das atividades das escolas platnica (Academia) e aristotlica (Liceu). H, porm, uma transformao em relao ao passado. Os valores gregos mesclam-se com as mais diversas tradies culturais. E o cidado no pode mais influir na vida poltica.

A TICA EM KANT

Assim, a filosofia volta-se para a vida interior do homem, pois sua realizao na vida exterior, como animal poltico, est interditada. Ao que diz respeito tica, destacam-se: O ceticismo: doutrina que afirma que no se pode obter nenhuma certeza a respeito da verdade, o que implica numa condio intelectual de dvida permanente e na admisso da incapacidade de compreenso de fenmenos metafsicos, religiosos ou mesmo da realidade. O epicurismo: sistema que propunha uma vida de contnuo prazer como chave para a felicidade, esse era o objetivo de seus ensinamentos morais. Para Epicuro de Samos, a presena do prazer era sinnimo de ausncia de dor, ou de qualquer tipo de aflio. O estoicismo: doutrina que prope que se deve viver de acordo com a lei racional da natureza e aconselha a indiferena (apathea) em relao a tudo que externo ao ser. O homem sbio obedece lei natural reconhecendo-se como uma pea na grande ordem e propsito do universo. J no perodo seguinte, o medieval, a viso teocntrica do mundo fez com que os valores religiosos impregnassem as concepes ticas, de modo que os critrios do bem e do mal se achavam vinculados f de dependem da esperana de vida aps a morte.

UNIDADE 6 A TICA EM KANT

103

FILOSOFIA
Modernidade filosfica caracteriza-se pelo antropocentrismo, isto , o homem colocado ao centro do universo. E ao homem, que esto voltadas as questes principais da filosofia, da cincia, da poltica e da tica. Neste momento existe a crena de que a razo, a cincia e a tecnologia tm condies de impulsionar a histria numa marcha contnua em direo verdade e melhoria da vida humana.

A TICA EM KANT

A RAZO LEGISLADORA
Em seus livros: Crtica da Razo Prtica e Fundamentao da metafsica dos Costumes, Kant apontam a razo como uma razo legisladora, capaz de elaborar normas universais, uma vez que a razo um predicado universal entre os homens. A razo humana no somente razo terica, ou seja, capaz de conhecer, mas tambm razo prtica, ou seja, capaz de determinar tambm a ao independentemente de fundamentos determinantes sensveis, como os impulsos, as carncias e paixes. As normas tm, portanto, a sua origem na razo. Em oposio a um moralizar precipitado, Kant afirma que a faculdade de agir no dada previamente segundo as leis da natureza, mas dada atravs do prprio sujeito. A faculdade de agir segundo leis subjetivas chama-se de vontade. A vontade no nada de irracional, mas algo racional. Pela vontade uma pessoa dotada de razo, distingue-se dos animais que agem somente segundo as leis dadas pela natureza. E por que ns realizamos atos contrrios razo? Kant diz que porque nossa vontade afetada pelas inclinaes, que so os desejos e as paixes, os medos. Por isso devemos educar a vontade para alcanar a boa vontade, que a vontade sempre guiada pela razo.

ILUMINISMO
O movimento cultural que cultivou esse otimismo na razo foi denominado de Iluminismo.

AS CONDIES PARA O AGIR MORAL


Pode-se dizer que todas as aes humanas so feitas por motivos, ou seja, h sempre algo que determina a vontade para que haja uma ao. Algo causa uma influncia sobre minha vontade levando-me a agir. Assim, vou jogar futebol porque gosto, e o gosto pelo futebol motiva a minha vontade fazendo-me ir ao campo. Enfim, nossa ao parte da vontade e a vontade determina-se por alguma coisa. Ento toda ao que parte da minha vontade, pode ser considerada uma ao moral? Para Kant, a vontade humana verdadeiramente moral quando regida por imperativos categricos. Os imperativos categricos consistem em lei morais, mandamentos universais, que devem ser seguidos. So exemplos de imperativos categricos: Age sempre de tal modo que trates a humanidade, tanto na tua pessoa como na do outro, como fim e no apenas como meio. Age apenas segundo uma mxima tal que possas, ao mesmo tempo querer que ela se torne lei universal. No primeiro exemplo eu devo tratar as pessoas no como uma meio para conseguir algo, mas sim como pessoas que por serem homens, no se confundem com outras coisas. No segundo exemplo, eu devo agir de uma maneira que a mxima (aquilo que me levou a agir) da minha ao possa tornar-se um princpio de legislao universal, ou seja, que sirva para todos sem contradio. *Todo imperativo se exprime pelo verbo dever, e pode ser hipottico ou categrico. Os hipotticos representam a necessidade prtica de uma ao possvel como meio de alcanar qualquer outra coisa que se quer (ou que possvel que se queira) (op.cit.: 124). Distingue-se do imperativo categrico porque neste a ao representada como boa em si, e no como meio para qualquer outra coisa caso do imperativo hipottico.

Immanuel Kant (1724-1804) nasceu na Prssia e por l viveu toda a sua vida. considerado o maior filsofo do Iluminismo Alemo. Kant ir dizer que o prprio homem capaz de encontrar em si mesmo as leis para agir moralmente. Inclusive para ele no h moralidade se a minha ao foi definida por algo que no sou eu mesmo. Toda tica e o direito partem de uma espcie de antropologia negativa, pois, dizem que o homem precisa de normas para corrigir-se para viver em sociedade. Kant situa-se nesse quadro, porm sua tica acaba mostrando uma grande confiana no poder da razo humana, para a emancipao. Kant um dos grandes defensores do Esclarecimento, ou seja, da ideia de que o homem pode e deve conhecer o mundo a natureza, para sair da menoridade e tornar-se responsvel pela prpria vida.

104

FILOSOFIA

A TICA EM KANT
A autonomia da razo para legislar deve supor a liberdade e o dever. Pois todo imperativo se impe como dever, mas a exigncia do imperativo livremente assumida pelo sujeito. Ou seja, eu poso segu-lo sim ou no. Deves, portanto, podes afirma Kant. Ser moralmente obrigado ter o poder de responder sim ou no regra moral, ter a liberdade de escolher entre o bem e o mal. A liberdade, portanto, torna-se fundamento e condio da lei moral, pois quando o sujeito age livremente, que ele est agindo de acordo com sua vontade e consequentemente, de acordo com sua razo, ou seja, agindo por dever. No h autonomia sem liberdade. INDICAES DE LEITURA O papel das inclinaes na filosofia moral de Kant
LINK: http://revistaseletronicas.pucrs.br/ojs/index.php/ veritas/article/viewFile/3967/2987

Kant expe quatro exemplos para demonstrar a validade do imperativo categrico: 1 Mesmo que uma pessoa desesperada deseje suicidar-se, destruir a prpria vida no pode constituir uma mxima que se queira aplicar como lei universal da natureza, j que vai contra qualquer princpio de conservao da vida. 2 Uma pessoa se v forada, por necessidade, a pedir dinheiro emprestado, porm sabe que no poder devolver o emprstimo, e assim mesmo promete faz-lo num prazo determinado. Tal mxima no pode, no entanto, tornar-se lei universal, posto que ningum mais acreditaria em qualquer promessa. Nem mesmo o devedor desejaria semelhante lei, que faria invivel qualquer novo pedido de emprstimo. 3 uma terceira pessoa, sabendo que porta talentos ainda no cultivados, vive o seguinte dilema: desenvolver seus dons ou continuar na vida ociosa, dispensando tais habilidades. Opta pelo cio. Contudo, ela no pode querer, na condio de ser racional, que essa mxima venha a ser lei universal da natureza, posto que os talentos trariam a ela o mesmo se aplica s demais pessoas novas possibilidades de melhoria de vida. 4 algum que vive na prosperidade e ao mesmo tempo v os outros em dificuldades pode at no querer ajud-los, mas no pode querer que tal princpio se torne lei universal da natureza ele pode vir a precisar de auxlio tambm.
*Fonte: www.eca.usp.br/nucleos/filocom/mauro.doc

EXERCCIOS
1.(2005) De acordo com a tica kantiana, o homem, e, de uma maneira geral, todo o ser racional, existe como fim em si mesmo e no como meio para o uso arbitrrio desta ou daquela vontade.
(Adaptado de: KANT, Immanuel. Fundamentao da metafsica dos costumes. Lisboa: Edies 70, 1995. p. 68.)

No Brasil contemporneo persiste a existncia de trabalhadores em situao anloga escravido. Sobre a explorao do trabalho humano, a partir da perspectiva kantiana, CORRETO afirmar: a) Todas as coisas tm um preo, podendo ser trocadas ou compradas, inclusive o ser humano. b) Em certas circunstncias, o ser humano pode ser entendido como meio submetido vontade de outros homens, considerados superiores. c) A apropriao de um ser humano por outro possvel, uma vez que um pode renunciar e alienar sua vontade em favor do outro. d) A dignidade um atributo do ser humano, o que assegura idntico valor e um mnimo de direitos a todos os homens. e) Em situaes extremas, a escravido a nica garantia da produo dos bens necessrios sobrevivncia do homem, sendo, portanto, legtima. 2. (UEL 2008) Para Kant, a moral no a doutrina que nos ensina como nos tornamos felizes, mas sim a doutrina que ensina como devemos agir para nos tornarmos dignos da felicidade.
(KANT, I. Crtica da razo prtica. Traduo de Artur Moro. Lisboa: Ed. 70, 1986. p. 149.)

LIBERDADE E AUTONOMIA

Kant afirma que quando a vontade determina-se pela razo pode-se dizer que ela determina-se a si prpria, ento existe autonomia, ou seja, a vontade d a si prpria a lei para agir, e no dependente de outros valores como, por exemplo, religiosos.

Com base nos conhecimentos sobre a moral em Kant, CORRETO afirmar:

105

FILOSOFIA
a) O indivduo que segue os mandamentos divinos por sincero amor a Deus digno da felicidade. b) digno da felicidade aquele que luta pela justia social. c) Kant considera ser papel da sociedade decidir quem digno da felicidade. d) digno da felicidade o indivduo que age segundo a autonomia da vontade. e) So dignos da felicidade os indivduos que agem por compaixo. 3. (UEL 2003) O imperativo categrico portanto s um nico, que este: Age apenas segundo uma mxima tal que possas ao mesmo tempo querer que ela se torne lei universal.
(KANT, Immanuel. Fundamentao da metafsica dos costumes. Trad. de Paulo Quintela. Lisboa: Edies 70, 1995. p. 59.)

A TICA EM KANT
5. (UEL 2004) Ser caritativo quando se pode s-lo um dever, e h alm disso muitas almas de disposio to compassivas que, mesmo sem nenhum outro motivo de vaidade ou interesse, acham ntimo prazer em espalhar alegria sua volta, e se podem alegrar com o contentamento dos outros, enquanto este obra sua. Eu afirmo porm que neste caso uma tal ao, por conforme ao dever, por amvel que ela seja, no tem contudo nenhum verdadeiro valor moral, mas vai emparelhar com outras inclinaes, por exemplo o amor das honras que, quando por feliz acaso, topa aquilo que efetivamente de interesse geral e conforme ao dever, consequentemente honroso e merece louvor e estmulo, mas no estima; pois sua mxima falta o contedo moral que manda que tais aes se pratiquem no por inclinao, mas por dever.
(KANT, Immanuel. Fundamentao da metafsica dos costumes. Trad. de Paulo Quintela. So Paulo: Abril Cultural, 1980. p. 113.)

Segundo essa formulao do imperativo categrico por Kant, uma ao considerada tica quando: a) Privilegia os interesses particulares em detrimento de leis que valham universal e necessariamente. b) Ajusta os interesses egostas de uns ao egosmo dos outros, satisfazendo as exigncias individuais de prazer e felicidade. c) determinada pela lei da natureza, que tem como fundamento o princpio de autoconservao. d) Est subordinada vontade de Deus, que preestabelece o caminho seguro para a ao humana. e) A mxima que rege a ao pode ser universalizada, ou seja, quando a ao pode ser praticada por todos, sem prejuzo da humanidade. 4. (UEL 2004) Quando a vontade autnoma, ela pode ser vista como outorgando a si mesma a lei, pois, querendo o imperativo categrico, ela puramente racional e no dependente de qualquer desejo ou inclinao exterior razo. [...] Na medida em que sou autnomo, legislo para mim mesmo exatamente a mesma lei que todo outro ser racional autnomo legisla para si.
(WALKER, Ralph. Kant: Kant e a lei moral. Trad. de Oswaldo Giacia Jnior. So Paulo: Unesp, 1999. p. 41.)

Com base no texto e nos conhecimentos sobre o dever em Kant, CORRETO afirmar: a) Ser compassivo o que determina que uma ao tenha valor moral. b) Numa ao por dever, as inclinaes esto subordinadas ao princpio moral. c) A ao por dever determinada pela simpatia para com os seres humanos. d) O valor moral de uma ao determinado pela promoo da felicidade humana. e) no propsito visado que uma ao praticada por dever tem o seu valor moral. 6. (UEL 2005) na verdade conforme ao dever que o merceeiro no suba os preos ao comprador inexperiente, e quando o movimento do negcio grande, o comerciante esperto tambm no faz semelhante coisa, mas mantm um preo fixo geral para toda a gente, de forma que uma criana pode comprar em sua casa to bem como qualquer outra pessoa. -se, pois servido honradamente; mas isto ainda no bastante para acreditar que o comerciante tenha assim procedido por dever e princpios de honradez; o seu interesse assim o exigia; mas no de aceitar que ele alm disso tenha tido uma inclinao imediata para os seus fregueses, de maneira a no fazer, por amor deles, preo mais vantajoso a um do que outro.
(KANT, Immanuel. Fundamentao da metafsica dos costumes. Trad. de Paulo Quintela. So Paulo: Abril Cultural, 1980. p. 112.)

Com base no texto e nos conhecimentos sobre autonomia em Kant, considere as seguintes afirmativas:

I. A vontade autnoma, ao seguir sua prpria lei, segue a razo pura prtica. II. Segundo o princpio da autonomia, as mximas escolhidas devem ser apenas aquelas que se podem querer como lei universal. III. Seguir os seus prprios desejos e paixes agir de modo autnomo. IV. A autonomia compreende toda escolha racional, inclusive a escolha dos meios para atingir o objeto do desejo. Esto corretas apenas as afirmativas: a) I e II d) I, II e III b) I e IV e) II, III e IV c) III e IV

Com base no texto e nos conhecimentos sobre o conceito de dever em Kant, considere as afirmativas a seguir, sobre a ao do merceeiro. I. uma ao correta, isto , conforme o dever. II. moral, pois revela honestidade na relao com seus clientes. III. No uma ao por dever, pois sua inteno egosta. IV. honesta, mas motivada pela compaixo aos semelhantes. Esto CORRETAS apenas as afirmativas: a) I e II c) II e IV b) I e III d) I, III e IV e) II, III e IV

106

FILOSOFIA
Leia os textos a seguir e responda s questes 06 e 07. O direito natural se embasa [...] em princpios a priori da razo e , portanto, cognoscvel a priori pela razo de todo o homem, enquanto que o direito positivo estatutrio e procede da vontade do legislador. O primeiro h de servir como critrio racional do segundo, j que mister buscar na razo o critrio do justo e do injusto, enquanto que o direito positivo diz o que direito.
(KANT, Immanuel. La metafsica de las Costumbres. 2. ed. Trad. Adela Cortina Orts e Jess Conill Sancho. Madri: Tecnos, 1994. p. XLIII.)

A TICA EM KANT
emprestaro nada se no prometer firmemente pagar em prazo determinado. Sente a tentao de fazer a promessa; mas tem ainda conscincia bastante para perguntar a si mesma: No proibido e contrrio ao dever livrar-se de apuros desta maneira? Admitindo que se decida a faz-lo, a sua mxima de ao seria: Quando julgo estar em apuros de dinheiro, vou pedilo emprestado e prometo pag-lo, embora saiba que tal nunca suceder.
Fonte: KANT, I. Fundamentao da Metafsica dos Costumes. Traduo de Paulo Quintela. So Paulo: Abril Cultural, 1980, p. 130.

Para Estados, em relao uns com os outros, no pode haver, segundo a razo, outro meio de sair do estado sem leis, que contm pura guerra, a no ser que eles, exatamente como homens individuais, desistam de sua liberdade selvagem (sem lei), consintam com leis pblicas de coero e assim formem um (certamente sempre crescente) Estado dos Povos (civitas gentium), que por fim viria a compreender todos os povos da terra.
(KANT, Immanuel. A paz perptua. Trad. Marco Antnio Zingano. Porto Alegre: L&PM, 1989. p. 42.)

De acordo com o texto e os conhecimentos sobre a moral kantiana, considere as afirmativas a seguir: I. Para Kant, o princpio de ao da falsa promessa no pode valer como lei universal. II. Kant considera a falsa promessa moralmente permissvel porque ela ser praticada apenas para sair de uma situao momentnea de apuros. III. A falsa promessa moralmente reprovvel porque a universalizao de sua mxima torna impossvel a prpria promessa. IV. A falsa promessa moralmente reprovvel porque vai de encontro s inclinaes sociais do ser humano. A alternativa que contm todas as afirmativas CORRETAS : a) I e II b) I e III c) II e IV d) I, II e III e) I, II e IV 10. (UEL 2005) Tudo na natureza age segundo leis. S um ser racional tem a capacidade de agir segundo a representao das leis, isto , segundo princpios, ou: s ele tem uma vontade. Como para derivar as aes das leis necessria a razo, a vontade no outra coisa seno razo prtica. Se a razo determina infalivelmente a vontade, as aes de um tal ser, que so conhecidas como objetivamente necessrias, so tambm subjetivamente necessrias, isto , a vontade a faculdade de escolher s aquilo que a razo independentemente da inclinao, reconhece como praticamente necessrio, quer dizer bom.
(KANT, Immanuel. Fundamentao da metafsica dos costumes. Trad. de Paulo Quintela. Lisboa: Edies 70, 1995. p. 47.)

7. (UEL 2006) Com base nos textos e nos conhecimentos sobre o Direito Natural em Kant, CORRETO afirmar: a) Modifica-se conforme as diversas compreenses de cada poca histrica e de acordo com a variabilidade dos arranjos sociais. b) A semelhana entre direito natural e direito positivo reside no fato de que ambos se fundamentam no direito estatal. c) constitudo pela liberdade e serve de critrio racional para o direito positivo, o qual deve efetiv-lo na forma da lei. d) descaracterizado de sentido, pois todo direito positivo e tem sua origem na vontade do legislador. e) Sujeita-se ao direito positivo e dele extrai a sua legitimidade, modificando-se com o passar do tempo. 8. (UEL 2006) Sobre a concepo de justia em Kant, CORRETO afirmar: a) definida pelo direito positivo e nele encontra sua fonte, prescindindo de qualquer outro parmetro de legitimidade. b) Resulta da definio estatutria do direito, sob a forma da lei estabelecida nos cdigos jurdicos e confirmada pelas aes dos Estados. c) Coincide com a vontade do legislador, a partir da qual so definidos os parmetros racionais de gesto dos Estados. d) Ampara-se em parmetros racionais a priori que embasam o direito natural e que devem se converter em leis pblicas de coero. e) Configura-se com base em valores comuns partilhados tradicionalmente em cada ordenamento jurdico-poltico. 9. (UEL 2007) Na segunda seo da Fundamentao da Metafsica dos Costumes, Kant nos oferece quatro exemplos de deveres. Em relao ao segundo exemplo, que diz respeito falsa promessa, Kant afirma que uma pessoa v-se forada pela necessidade a pedir dinheiro emprestado. Sabe muito bem que no poder pagar, mas v tambm que no lhe

Com base no texto e nos conhecimentos sobre a liberdade em Kant, considere as afirmativas a seguir. I. A liberdade, no sentido pleno de autonomia, restringe-se independncia que a vontade humana mantm em relao s leis da natureza. II. A liberdade configura-se plenamente quando a vontade humana vincula-se aos preceitos da vontade divina. III. livre aquele que, pela sua vontade, age tanto objetivamente quanto subjetivamente, por princpios que so vlidos para todos os seres racionais.

107

FILOSOFIA
IV. A liberdade a capacidade de o sujeito dar a si a sua prpria lei, independentemente da causalidade natural. Esto CORRETAS apenas as afirmativas: a) I e II b) II e III c) III e IV d) I, II e IV e) I, III e IV 11. Qual a definio kantiana para imperativo categrico? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 12. O que e como se d o esclarecimento em Kant? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ Jurgen Habermas (1929) filsofo alemo, inicialmente sofreu influncia da Escola de Frankfurt, mas dela se desligou para percorrer itinerrio prprio. Desenvolveu ento a Teoria da Ao Comunicativa, que fornece os elementos para a compreenso da tica do Discurso.

UNIDADE 7 A TICA DO DISCURSO EM HABERMAS

AO COMUNICATIVA
A teoria da ao comunicativa recorre razo para sua fundamentao. Embora sofra influncia de Kant, Habermas se fundamenta no conceito de razo comunicativa. Ou seja, o sujeito em Habermas descentrado, porque a razo comunicativa supe o dilogo, a interao entre os indivduos do grupo, mediada pela linguagem pelo discurso. A razo comunicativa mais rica por ser processual, construda a partir da relao entre os sujeitos, enquanto seres capazes de se posicionarem criticamente diante das normas. Nesse caso a validade das normas no deriva de uma validade abstrata e universal, nem depende da subjetividade de cada um, mas do consenso encontrado a partir do grupo, do conjunto dos indivduos. Portanto a subjetividade se transforma em intersubjetividade. A Ao Comunicativa supe o entendimento entre os indivduos, que procuram pelo uso de argumentos racionais, convencer o outro (ou se deixar convencer) a respeito da validade da norma: instaura-se a o mundo da sociabilidade, da espontaneidade, da solidariedade, da cooperao. A tica discursiva de Habermas uma aposta na linguagem e na capacidade de entendimento entre as pessoas na busca de uma tica universal, baseada em valores vlidos e aceitos por todos.

A RAZO INSTRUMENTAL
Habermas sendo ligado Escola de Frankfurt teve contato com a crtica herana Iluminista. Esta crtica faz aluso ideia de que a razo em vez de emancipar o homem teria lanado-o

108

FILOSOFIA
novamente num mito, o mito da confiana cega no progresso cientfico, que levou ao desenvolvimento de uma faceta da razo, denominada, razo instrumental. Esta questo ser mais aprofundada quando estudarmos esttica.

A TICA DO DISCURSO EM HABERMAS


2. (UEL2005) As instncias do Poder, que os cidados acreditavam terem instalado democraticamente, esto, sob o peso da crtica, em vias de perder sua identidade. A opinio no lhes confere mais o certificado de conformidade que a legitimidade deles exige. Jurgen Habermas [...] v nessa situao um problema de regulao. A opinio pblica, abalada em suas crenas mais firmes, no d mais sua adeso s regulaes que o direito constitucional ou, mais amplamente, o direito positivo do Estado formaliza.
(GOYARD-FABRE, Simone. O que democracia?. Trad. de Cludia Berliner. So Paulo: Martins Fontes, 2003. p. 202-203.)

INDICAES DE LEITURA VII colquio habermas: habermas e interlocues


Link:http://coloquioshabermas2010.Files.Wordpress. Com/2012/04/anais.Pdf

EXERCCIOS

Com base no texto e nos conhecimentos sobre os Estados Democrticos de Direito na contemporaneidade, correto afirmar: a) A atual identidade das instncias do poder confirmada pela crtica. b) Legalidade e legitimidade das instncias de poder so coincidentes nos Estados Democrticos de Direito. c) A regulao das instituies de poder deve ser independente da opinio pblica. d) A legitimidade das instncias de poder deve ser baseada no direito positivo. e) A opinio pblica que deve dar legitimidade s instncias de poder. 3. ( UEL 2006) [...] Somente ordenamentos polticos podem ter legitimidade e perd-la; somente eles tm necessidade de legitimao. [...] dado que o Estado toma a si a tarefa de impedir a desintegrao social por meio de decises obrigatrias, liga-se ao exerccio do poder estatal a inteno de conservar a sociedade em sua identidade normativamente determinada em cada oportunidade concreta. De resto, esse o critrio para mensurar a legitimidade do poder estatal, o qual se pretende durar deve ser reconhecido como legtimo.
(HABERMAS, Jurgen. Para a reconstruo do Materialismo Histrico. 2. ed. Trad. Carlos Nelson Coutinho. So Paulo: Brasiliense, 1990. p. 219-221.)

(www.miguelportas.net/blog/?p=117rato>.Acesso em: 4 jun. 2008.)

1. (2009) A utilizao de organismos geneticamente modificados, j presente em alimentos como soja e milho, remete para a questo dos limites ticos da pesquisa. Tendo presente a obra de Jurgen Habermas, CORRETO afirmar. a) O debate sobre as consequncias ticas da cincia, especialmente da biotecnologia, deve ocorrer a posteriori para no atrapalhar um possvel progresso resultante das novas descobertas cientficas. b) A pesquisa com seres humanos, sobretudo quando envolve a possibilidade futura de intervenes teraputicas e de aperfeioamento, requer que se faa uma clara distino entre eugenia positiva e negativa. c) Para que a cincia progrida e as pesquisas avancem na direo de novas descobertas, a cincia necessita estar sintonizada com o princpio da neutralidade cientfica. d) Diante da insero dos laboratrios de pesquisa na lgica de mercado, caso seja possvel alterar geneticamente caractersticas dos bebs, caber aos pais estabelecer limites ticos para as possibilidades oferecidas. e) O ritmo lento da produo legislativa frente rapidez das novas descobertas cientficas torna sem sentido estabelecer limites tico-normativos para questes que envolvem a cincia.

Com base no texto, CORRETO afirmar que a legitimidade do Estado em Habermas: a) uma necessidade que se impe por meio da vontade do soberano, pois este o nico capaz de dispor de garantias sociais para todos. b) Reside na preservao da identidade da sociedade como forma de assegurar a integrao social. c) uma exigncia que, uma vez conquistada, adquire perenidade sem se exaurir ao longo da histria. d) atingida pelo uso do poder econmico ou da fora blica, elementos esses que podem se perder facilmente. e) Conta de forma imprescindvel com os parmetros da vontade divina no estabelecimento de valores comumente vivenciados.

109

FILOSOFIA
4. (UEL 2006) Uma moral racional se posiciona criticamente em relao a todas as orientaes da ao, sejam elas naturais, auto-evidentes, institucionalizadas ou ancoradas em motivos atravs de padres de socializao. No momento em que uma alternativa de ao e seu pano de fundo normativo so expostos ao olhar crtico dessa moral, entra em cena a problematizao. A moral da razo especializada em questes de justia e aborda em princpio tudo luz forte e restrita da universalidade.
(HABERMAS, Jurgen. Direito e democracia: entre facticidade e validade. v. I. Trad. Flvio Beno Siebeneichler. Rio de Janeiro: Tempo Brasileiro, 1997. p. 149.)

A TICA DO DISCURSO EM HABERMAS


6. (2008) De acordo com a tica do discurso, os argumentos apresentados a fim de validar as normas [...] tm fora de convencer os participantes de um discurso a reconhecerem uma pretenso de validade, tanto para a pretenso de verdade quanto para a pretenso de retido. [...] Ele [Habermas] defende a tese de que as normas ticas so passveis de fundamentao num sentido anlogo ao da verdade.
(BORGES, M. de L.; DALLAGNOL, D. ; DUTRA, D. V. tica. Rio de Janeiro: DP&A, 2002, p. 105.)

Com base no texto e nos conhecimentos sobre a moral em Habermas, CORRETO afirmar: a) A formao racional de normas de ao ocorre independentemente da efetivao de discursos e da autonomia pblica. b) O discurso moral se estende a todas as normas de aes passveis de serem justificadas sob o ponto de vista da razo. c) A validade universal das normas pauta-se no contedo dos valores, costumes e tradies praticados no interior das comunidades locais. d) A positivao da lei contida nos cdigos, mesmo sem o consentimento da participao popular, garante a soluo moral de conflitos de ao. e) Os parmetros de justia para a avaliao crtica de normas pautam-se no princpio do direito divino. 5. (UEL 2007) De acordo com a tica do Discurso, uma norma s deve pretender validez quando todos os que possam ser concernidos por ela cheguem (ou possam chegar), enquanto participantes de um Discurso prtico, a um acordo quanto validez dessa norma.
Fonte: Habermas, J. Conscincia moral e agir comunicativo. Traduo de Guido A. de Almeida. Rio de Janeiro: Tempo Brasileiro, 1989, p.86.

Assim, correto afirmar que a tica do discurso defende uma abordagem cognitivista da tica.

(HABERMAS, J. Conscincia moral e agir comunicativo. Traduo Guido Antonio de Almeida. Rio de Janeiro: Tempo Brasileira, 1989. p. 62 e 78.)

Sobre o cognitivismo da tica do discurso, CORRETO afirmar: a) A tica do discurso procura dar continuidade abordagem cognitivista j presente em Kant. b) A abordagem cognitivista da tica do discurso assume a impossibilidade de validao das normas morais. c) A abordagem cognitivista da tica do discurso se apia no conhecimento da utilidade das aes tal como pretendia Jeremy Bentham. d) A abordagem cognitivista da tica do discurso procura dar continuidade s teses aristotlicas sobre a retrica. e) A tica do discurso, ao abordar a tica de um ponto de vista cognitivista, segue as teorias emotivistas e decisionistas. 7. Qual o papel do discurso na tica habermasiana? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Escreva a critica que Habermas faz razo instrumental, e qual modo de utilizao da razo ele prope. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Com base no texto e nos conhecimentos sobre a tica do Discurso de Habermas, assinale a alternativa correta: a) O princpio possibilitador do consenso deve assegurar que somente sejam aceitas como vlidas as normas que exprimem um desejo particular. b) Nas argumentaes morais basta que um indivduo reflita se poderia dar seu assentimento a uma norma. c) Os problemas que devem ser resolvidos em argumentaes morais podem ser superados apenas monologicamente. d) O princpio que norteia a tica do discurso de Habermas expressa-se, literalmente, nos mesmos termos do imperativo categrico kantiano. e) Uma norma s poder ser considerada correta se todos os envolvidos estiverem de acordo em dar-lhe o seu consentimento.

110

FSICA 1
113 Conceitos ....................................................... 113 Vetores .......................................................... 113 Vetor ............................................................... 113 Operao com vetores ............................... 113 Exerccios .................................................... 115

01 CINEMTICA E VETORES

pg

121 Velocidade angular ................................... 122 Acelerao .................................................... 122 Acelerao angular ................................... 122 Grandezas lineares e angulares ............ 122 Exerccios .................................................... 123

04

MOVIMENTOS CIRCULARES

pg

116 Equao horria do MRU ......................... 116 Encontro de mveis ...................................... 116 Exerccios .................................................... 117

02

MOVIMENTO RETILNEO UNIFORME (MRU)

pg

124 Acelerao da gravidade (g) ...................... 124 Queda livre .................................................... 124 Lanamento vertical para cima ou para baixo .................................................... 124 Lanamento horizontal ............................. 125 Exerccios .................................................... 125

05

QUEDA LIVRE

pg

03

MOVIMENTO RETILNEO pg UNIFORMENTE VARIADO (MRUV) 118

Funo horria do espao ....................... 119 Exerccios .................................................... 120

126 Velocidade angular .................................... 126 Exerccios ..................................................... 127 Gabaritos ..................................................... 128

06

MOVIMENTOS NUM PLANO

pg

CINEMTICA E VETORES

UNIDADE 1 CINEMTICA E VETORES


Cinemtica a parte da fsica que estuda o movimento.

Se o corpo sai da posio A e vai para B; o S = S-S0 ser SB-SA > 0 (deslocamento progressivo); porm se ele for de B para A; o S= SA- SB < 0 (deslocamento retrgrado). O deslocamento independe da trajetria.

CONCEITOS
Um corpo definido como ponto material quando seu tamanho desprezvel em relao ao tamanho de seu movimento, quando se pode represent-lo como um nico ponto ao invs de represent-lo por inteiro. Exemplos: Uma formiga atravessando uma ponte. A terra no seu movimento de translao. Um foguete na imensido do espao. S podemos considerar um corpo como um ponto material se todos os pontos desse corpo tiverem uma mesma trajetria. Um corpo ser definido como corpo extenso quando seu tamanho em relao trajetria for considervel. Exemplos: Um trem atravessando uma ponte. Um carro ao efetuar uma ultrapassagem. Referencial: um ponto material ou corpo extenso a partir do qual possvel realizar observao de fenmenos fsicos e at mesmo descrev-los Repouso e Movimento: Um mesmo corpo pode estar em repouso ou em movimento, pois depende do referencial adotado. O Repouso ocorre quando o objeto em estudo no varia sua posio, enquanto no Movimento ocorre uma variao da posio com o tempo. Exemplo: Um nibus que est se movimento para um pedestre tambm est em repouso para os passageiros. Posio ou localizao: para saber a posio de um objeto necessrio conhecer um referencial. Exemplos: Estou 3 quarteires do calado. A chave est no armrio da cozinha Deslocamento (S): o quanto e para qual direo o corpo muda de posio Exemplo: Estava 3 quarteires do calado, agora estou 4. Trajetoria: a unio de todas as posies que o objeto ocupou em determinado tempo, ou seja, a linha sobre a qual o corpo se movimentou. Analise:

NO CONFUNDA (distancia X deslocamento) A distncia percorrida pela trajetria 3 a maior, mas seu deslocamento o mesmo, pois a sua variao de posio (S) tem o mesmo valor que os outros caminhos.

VETORES
GRANDEZAS
Escalares: so grandezas que para serem representadas elas precisam apenas do modulo e unidade. Ex: massa, volume, densidade, temperatura, comprimento, velocidade escalar, presso, energia, distancia, presso, tempo, quantidade de movimento.

Vetoriais: so grandezas que precisam ser representadas no espao, que dependem de uma direo, sentido alm do mdulo. Ex: fora, velocidade vetorial, acelerao, deslocamento, posio, campo eltrico. So representadas pelos vetores.

VETOR
Definio: representa-se um vetor por um segmento orientado de reta que apresenta mdulo (ou intensidade), direo e sentido. Ex: 3N (mdulo), horizontal (direo), para direita (sentido).

DIREO, SENTIDO E MDULO.

Direo: Qualquer vetor projeta-se em uma direo, formando um ngulo com a direo previamente orientada (x) as direes podem ser: horizontal, vertical, e diagonal, ou ainda escrita em funo de . Sentido: Toda direo tem apenas dois sentidos possveis, por exemplo: na direo horizontal, temos o sentido da esquerda para a direita e da direita para a esquerda. Em um plano cartesiano denotamos positivo e negativo. Mdulo: O mdulo corresponde apenas intensidade, ao valor do vetor. O mdulo representado sempre positivo.

OPERAO COM VETORES


Quando fazemos alguma operao com vetores devemos considerar as trs caractersticas pertencentes a eles: mdulo, direo e sentido. Toda operao gera uma resultante que tambm deve ter as trs caractersticas acima.

113

FSICA 1

CINEMTICA E VETORES
resoluo Regra dos vetores consecutivos (Mtodo Poligonal)

Dados os modelos dos vetores

e .

A resultante S o vetor com origem na origem do vetor a e extremidade na extremidade do vetor b . Mdulo: 1 cm Direo: horizontal Sentido: para a esquerda c) Direes diferentes (vetores concorrentes): Quando os vetores tm direes diferentes, surge um ngulo entre eles, assim os meios anteriores no so vlidos, ento surgem outros mtodos. Regra do paralelogramo: Serve somente para dois vetores de cada vez, consiste em construir um paralelogramo com origem comum. Exemplo:

a) Mesma direo e sentido: Neste caso, somamos os mdulos dos vetores. A soma, neste caso, gera a mxima resultante possvel. o sentido resultante o mesmo dos dois vetores.

resoluo A regra dos vetores consecutivos, consiste em traar os vetores na sequncia (Mtodo Poligonal).

A resultante S tem origem na origem do vetor a e extremidade na extremidade do vetor b . mdulo: 7 cm Direo: horizontal Sentido: para a direita b) Mesma direo e sentidos opostos: Neste caso, subtramos os mdulos dos vetores. A subtrao, neste caso, gera a mnima resultante possvel. O sentido resultante, sempre ser o do vetor de maior mdulo. Exemplo: Regra do polgono: Este mtodo eficiente para mais de dois vetores e consiste em colocar os vetores uma a um, de forma que a extremidade de um, coincida com a origem de outro. O vetor resultante o que se obtm ligando a origem do primeiro com a extremidade do ltimo. Regra da projeo dos vetores: Consiste em decompor os vetores num plano cartesiano e somar suas decomposies segundo os eixos X e Y e ento, obteremos uma resultante em x (Vx ) e outra em y (Vy ).

114

FSICA 1
Para se decompor o vetor V1 em vetores unitrios devemos escrever as projees Vx e Vy em funo de V1.

CINEMTICA E VETORES
2. Um vetor A e dado por: A = 8,0 x +6,0 y onde x e y so os vetores de um sistema de coordenadas cartesianas em um plano. Qual o mdulo do vetor A ? _________________________________________________ _________________________________________________ _________________________________________________ 3. No esquema da figura abaixo tem-se um hexgono regular. Chamado F aos mdulos dos vetores AB e AF , pode-se afirmar que sua soma vetorial (resultante) tem para mdulo:

OBS: a soma vetorial de Vx e Vy obtm o vetor V1.

EXERCCIO RESOLVIDO

_________________________________________________ _________________________________________________ _________________________________________________ 4. (ENEM) Os pombos-correio foram usados como mensageiros pelo homem no passado remoto e at mesmo mais recentemente, durante a Segunda Guerra Mundial. Experimentos mostraram que sua orientao depende de vrios fatores, entre eles a orientao pelo campo magntico da Terra. Num experimento, um im fixo na cabea de um pombo foi usado para criar um campo adicional ao da Terra. A figura abaixo mostra a di-reo dos vetores dos campos magnticos do im B| e da Terra BT. O diagrama quadriculado representa o espao em duas dimenses em que se d o deslocamento do pombo. Partindo do ponto O, o pombo voa em linha reta na direo e no sentido do campo magntico total e atinge um dos pontos da figura marcados com um crculo cheio. Nessas condies, o mdulo do vetor de deslocamento do pombo vale : a) 6m b) 8m c) 10m d) 14m e) 15m

EXERCCIOS
1. Na figura abaixo esto desenhados dois vetores (x e y ). Estes vetores representam deslocamentos sucessivos de um corpo. Qual o mdulo do vetor igual a x + y ?

115

FSICA 1
5. Determine a intensidade da resultante do sistema de foras aplicadas ao corpo nos seguintes casos:

MOVIMENTO RETILNEO UNIFORME (MRU)


Marque a opo que melhor representa a resultante dessas dez foras.

UNIDADE 2 MOVIMENTO RETILNEO UNIFORME (MRU)


Velocidade a rapidez com que o deslocamento ocorre, matematicamente a velocidade depende do deslocamento, e como a posio depende de um referencial a velocidade tambm depender de um referencial. Exemplo: Dois carros emparelhados em uma pista de corrida esto 180km/h em relao ao solo, mas esto parados um em relao ao outro.

6. Nas situaes esquematizadas a seguir, a resultante das foras que agem sobre cada corpo tem a direo do eixo x.

Se S for positivo a velocidade tambm ser, portanto o movimento ser progressivo, a favor da orientao. Determinar em cada caso: a) A intensidade da resultante das foras que agem sobre o corpo. b) A intensidade da fora F . Se S for negativo a velocidade tambm ser, portanto o movimento ser regressivo, contra a orientao.

EQUAO HORRIA DO MRU


Se um corpo se move com uma velocidade constante sem mudar sua trajetria, dizemos que ele est em um Movimento Retilneo Uniforme; e podemos prever sua posio em funo do tempo. Atravs da equao:

7. (UECE) Considere as dez foras representadas pelos vetores vistos na figura.

Admitindo-se t0=0 como o inicio da contagem e multiplicando cruzado obtm-se:

ENCONTRO DE MVEIS
J que podemos prever a posio de moveis ao longo do tempo, podemos prever tambm o encontro de dois mveis. Imaginando que se eles se encontrarem vo se encontrar numa mesma posio.

116

FSICA 1

MOVIMENTO RETILNEO UNIFORME (MRU)


4. (F.C.CHAGAS) Um trem de 200 m. de comprimento com velocidade escalar de 60 km/h, gasta 36 s, para atravessar a uma ponte. A extenso da ponte em metros de: a) 200 c) 500 e) 800 b) 400 d) 600 5. Dois barcos partem simultaneamente de um mesmo ponto, seguindo direes perpendiculares entre si. Sendo de 30 km/h e 40 km/h suas velocidades, a distncia entre eles aps 6 minutos ser (em km)? a) 7 c) 300 e) 420 b) 1 d) 5 6. Dois motociclistas A e B partem de um mesmo ponto de uma estrada reta com velocidades escalares constantes de 36km/h e 108km/h. Sabendo que se movem ambos em movimento progressivo e que B parte 3 segundos aps a partida de A , determine: a) O instante do encontro em relao a partida de B. _________________________________________________ _________________________________________________ _________________________________________________ b) A posio do encontro. _________________________________________________ _________________________________________________ _________________________________________________ 7. Numa corrida de carros, suponha que o vencedor gastou 1h e 30 min para completar o circuito, desenvolvendo uma velocidade mdia de 240 km/h, enquanto um outro carro, o segundo colocado, desenvolveu a velocidade mdia de 236 km/h. Se a pista tem 30 km, quantas voltas o carro vencedor chegou frente do segundo colocado? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Um policial em treinamento dispara uma bala com velocidade 200 m/s em direo a um alvo. Aps 2,7 s contados a partir do disparo, ele ouve o impacto do projtil contra o alvo. Determine a distncia do policial ao alvo. Despreze a resistncia do ar no movimento do projtil e considere a velocidade do som no ar igual a 340 m/s. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

ANLISE GRFICA

EXERCCIO RESOLVIDO
Um carro se desloca de Florianpolis SC a Curitiba PR. Sabendo que a distncia entre as duas cidades de 300 km e que o percurso iniciou as 7 horas e terminou ao meio dia, calcule a velocidade mdia do carro durante a viagem: S = (posio final) (posio inicial) S = (300 km) (0 km) S = 300 km E que: t = (tempo final) (tempo inicial) t = (12 h) (7h) t = 5 h

Ento:

EXERCCIOS
1. Um nibus passa pelo quilmetro 30 de uma rodovia s 6h, e s 9h e 30 min passa pelo quilmetro 240. Qual a velocidade mdia desenvolvida pelo nibus nesse intervalo de tempo? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. Um mvel desloca-se em trajetria retilnea com movimento determinado pela equao s = 20 + 5t (SI). A posio do mvel em t = 6s : a) 5m c) 25m e) n.d.a. b) 20m d) 30m 3. Duas cidades A e B, distam entre si de 400 km. Da cidade A, parte um mvel P dirigindo-se cidade B. No mesmo instante, parte de B um mvel Q dirigindo-se a A. Os mveis P e Q executam movimentos uniformes e suas velocidades escalares so de 30 km/h e 50 km/h, respectivamente. Qual ser a distancia do ponto de encontro cidade A, em km? a) 120 c) 200 e) 270 b) 150 d) 250

LINKS RECOMENDADOS www.vestibular1.com.br/revisao/mru.doc www.nordesttino.com/word/simulado_fisica_MRU.htm

117

MOVIMENTO RETILNEO UNIFORMENTE VARIADO (MRUV)

UNIDADE 3 MOVIMENTO RETILNEO UNIFORMENTE VARIADO (MRUV)


Aprendemos como funciona o MRU, porm sabemos que no nosso dia a dia poucos movimentos tem velocidade constante. Porm quando um carro (inicialmente parado no semforo) arranca, aps o sinal ficar verde, ele no executa um movimento com velocidade constante, mas executa um movimento diferente, que ser assunto desta unidade. Quando o carro arranca, sua velocidade zero, mas com o passar do tempo sua velocidade aumenta, caracterizando um Movimento Retilneo Uniformemente Variado. A acelerao corresponde taxa de variao de velocidade, e obtida pelo quociente entre v e t:

Considerando t0=0 e isolando a velocidade (v) obteremos uma equao que poder nos dizer qual o valor da velocidade em qualquer instante, o que nada mais do que a Funo horria da velocidade.

V = velocidade V0= Velocidade inicial a = Acelerao t = tempo do percurso

ANLISE GRFICA

A funo 1 uma funo do primeiro grau, pois o expoente de t 1.

Na matemtica o a corresponde ao coeficiente angular que numericamente igual a tan = -tan porm o a da equao 2 corresponde ao a da equao 3 que a acelerao, portanto ambos tem a mesma propriedades.

Analogamente o coeficiente linear da funo ( b) ser igual a V0 . Outra peculiaridade do grfico que ab rea, numericamente igual a variao de espao no intervalo de tempo escolhido.

Sabemos tambm, matematicamente, que a mdia das velocidades obtm a velocidade mdia (para a = cte)

Essas particularidades podem ser observadas nas figuras mostradas a seguir.

118

FSICA 1

MOVIMENTO RETILNEO UNIFORMENTE VARIADO (MRUV)

FUNO HORRIA DO ESPAO


Na equao 4, substituindo em v a equao 1, e em vm a da velocidade mdia obtm-se:

ANLISE GRFICA

A funo horria do espao uma funo do segundo grau em t, e graficamente representada por uma parbola. A concavidade dessa parbola vai estar voltada para cima quando o sinal da acelerao for positivo, e vai estar voltada para baixo quando o sinal da acelerao for negativo.

Onde: S = Posio final do percurso So = posio inicial do percurso Vo = velocidade inicial do percurso a = acelerao t = tempo total do percurso O ponto assinalado com * representa a mudana de sentido do movimento.

O vrtice da parbola, chamamos de Q, e esse ponto indica o local onde o valor da velocidade igual a zero, ou seja, o mvel para. No MRUV, a acelerao uma funo constante com o tempo, podendo ser positiva ou negativa:

No grfico, a rea numericamente igual a variao da velocidade no intervalo de tempo determinado.

RESUMO DOS GRFICOS DO MRUV

Equao de Torricelli

119

FSICA 1

MOVIMENTO RETILNEO UNIFORMENTE VARIADO (MRUV)


3. Uma partcula est em movimento, obedecendo funo horria X = 5 2t + t2, em unidades do Sistema Internacional de Unidades. A partcula sofrer reverso da velocidade na posio e no instante: a) 13m e -2s c) 5m e -2s e) 4m e 1s b) 8m e -1s d) 5m e 0s 4. Um mvel executa um M.R.U.V. parte do repouso e adquire, ao fim de 5s, a velocidade de 18km/h. Que distncia, em metros, percorreu o mvel durante esse tempo? a) 10,5m c) 12,5m e) 14,5m b) 11,5m d) 13,5m 5. Um automvel parte do repouso e submetido a uma acelerao constante de 5m/s2 durante 4 segundos. Qual desacelerao que ele deve sofrer, a partir desse instante, para voltar ao repouso a 100 metros da posio inicial, ser, em m/s2: a) 5 b) 8 c) 2 d) 10 6. O diagrama a seguir mostra a variao ocorrida na velocidade de um mvel em funo do tempo.

EXERCCIO RESOLVIDO
1. (UFPE) Uma bala que se move a uma velocidade escalar de 200m/s, ao penetrar em um bloco de madeira fixo sobre um muro, desacelerada at parar. Qual o tempo que a bala levou em movimento dentro do bloco, se a distncia total percorrida em seu interior foi igual a 10cm? Apesar de o problema pedir o tempo que a bala levou, para qualquer uma das funes horrias, precisamos ter a acelerao, para calcul-la usa-se a Equao de Torricelli. v2 = v02 + 2a s 2 0 (200)2 + 2a(0-0,1) Observe que as unidades foram passadas para o SI (10cm = 0,1m)

A partir da, possvel calcular o tempo gasto

EXERCCIOS
1. dado o movimento cuja velocidade escalar varia em funo do tempo, segundo a expresso V = 8 2t, unidades do SI. Tabele essa funo de 0 a 8 s. e faa sua representao grfica. Determine com o auxilio do grfico: a) A acelerao escalar _________________________________________________ b) O instante em que o mvel muda de sentido _________________________________________________ 2. (PUC) Um mvel parte do repouso e desloca-se em movimento retilneo sobre um plano horizontal. O grfico representa a acelerao em funo do tempo.Sabendo-se que em t = 0 s a velocidade nula, qual a velocidade no instante t = 5 s. ? a) Calcule a acelerao escalar mdia desse mvel entre os instantes 0 e 4 segundos. _________________________________________________ _________________________________________________ b) Calcule a acelerao escalar mdia desse mvel entre os instantes 0 e 6 segundos. _________________________________________________ _________________________________________________ c) Calcule o deslocamento total do veiculo. _________________________________________________ _________________________________________________ 7. (UFRJ-RJ) Dois mveis A e B tm equaes horrias respectivamente iguais a: SA = 80 - 5t e SB = 10 + 2t2, em que SA e SB esto em metros e t em segundos. Pode-se afirmar que: a) Os mveis A e B tm posies iniciais respectivamente iguais a 10m e 80m. b) O movimento de A progressivo e de B, retrgrado. c) Os movimentos de A e B tm velocidades constantes. d) Ambos tm movimentos progressivos. e) O mvel A tem velocidade constante e B acelerao constante.

a) 36 m/s b) 6 m/s

c) 24 m/s d) 15 m/s

e) 30 m/s

120

FSICA 1
8. (UMC) Com a vigncia do novo Cdigo Brasileiro de Trnsito, atravessar o sinal vermelho constitui infrao gravssima. Ao perceber um semforo fechado frente, o motorista de um carro, movendo-se a 20 m/s, freia com acelerao escalar constante de mdulo igual a 5,0 m/s2. A distncia mnima do carro ao semforo para no ocorrer a infrao e o tempo gasto durante a freada so, respectivamente: a) 40m e 4,0s c) 35m e 3,0s e) 45m e 4,5s b) 38,5m e 4,0s d) 30m e 3,0s 9. Numa via com neblina, dois automveis encontram-se frente a frente quando esto a 200 m um do outro, com velocidades opostas de 72 km/h e 108 km/h. Nesse momento, comeam a frear com desaceleraes constantes de 4 m/s2 e 5 m/s2, respectivamente. a) Os carros iro colidir na posio x = 100 m b) Os carros iro colidir na posio x = 75 m c) Os carros iro colidir na posio x = 125 m d) Os carros iro colidir aps 3 segundos e) Os carros no iro colidir 10. (Udesc) Um caminho tanque desloca-se numa estrada reta com velocidade constante de 72,0 km/h. Devido a um vazamento, o caminho perde gua razo de uma gota por segundo. O motorista, vendo um obstculo, freia o caminho uniformemente, at parar. As manchas de gua deixadas na estrada esto representadas na figura a seguir.

MOVIMENTOS CIRCULARES

UNIDADE 4 MOVIMENTOS CIRCULARES


Imaginemos um carro de corrida que entra em uma curva com velocidade constante. Ele executa o MRU, mas mesmo assim o piloto sente uma acelerao puxando pra fora. Como explicar tal fenmeno? A resposta est no seu tipo de movimento, um movimento circular (MCU). Para um corpo executar um movimento circular necessrio que uma fora o puxe, ou vire-o, necessrio uma fora para variar o vetor velocidade deste corpo. Esta fora chamada de resultante centrpeta e tem valor igual expresso:

Onde R = raio da cirfunferncia.

O valor do mdulo da desacelerao durante a frenagem do caminho (em m/s2) : a) 4,0 c) 4,4 e) 3,4 b) 2,2 d) 2,8

LINKS RECOMENDADOS www.slideshare.net/Pibid/mruv www.scribd.com/doc/15270362/05-Prof-Miky-Graficosdo-MU-e-MUV-wwwprofmikywordpresscom

Esta fora F acelera o corpo para o centro da circunferncia, importante reassaltar que a fora muda o vetor velocidade, mas no altera o seu mdulo, portanto o mdulo da velocidade constante apesar de seu vetor ser varivel. Perodo (T) Define-se perodo como o tempo necessrio para que o mvel complete uma volta. Mede-se o perodo em segundos, no SI. Frequncia (f) o nmero de voltas que o mvel executa em uma unidade de tempo. A freqncia ser indicada por f e, no SI, ser medida em hertz(Hz), que equivale antiga unidade rotao por segundo.

TEXTO COMPLEMENTAR

Deduo Torricelli: Isolando o tempo da funo horria da velocidade (1) e substituindo na funo horria do espao, vamos obter uma equao independente do tempo.

121

FSICA 1

MOVIMENTOS CIRCULARES

VELOCIDADE ANGULAR
Qualquer velocidade definida pela frmula:

GRANDEZAS LINEARES E ANGULARES


Para convertermos grandezas angulares em lineares, usamos a seguinte regra prtica:

Grandeza linear = grandeza angular X raio


Assim temos:

Mas se quisssemos saber a velocidade em funo do arco ? Nossa velocidade seria (velocidade angular) e nosso deslocamento seria (a variao de ngulo em um intervalo de tempo).

M C U

ACELERAO
Se em um MCU existe uma fora resultante (fora centrpeta) existe tambm uma acelerao centrpeta que obtida da equao (1) e da primeira lei de Newton:

No MCU temos: Velocidade linear (V) constante Velocidade angular () constante Equaes: Linear: S = S0+vt Angular: = o + t Relaes: S= . R; V= . R

POLIAS

Em casos de polias deve-se imaginar que a velocidade linear ser constante, mas a velocidade angular ser diferente,

Que na figura representada pelo vetor an.

EXERCCIO RESOLVIDO
1. Transforme : 120 rpm em Hz Resoluo:

Porm imaginemos o caso de um piloto que entra acelerando na curva. Neste caso o MCU passa a ser variado e a acelerao passa a ser representada pelo vetor at.(MCUV) A acelerao tangencial obedece as frmulas anteriores do MRUV Acelerao tangencial, linear ou escalar a acelerao que indica a variao do mdulo da velocidade. Tem mesma direo da velocidade! Acelerao centrpeta Indica a variao da direo da velocidade. sempre perpendicular acelerao tangencial.

2. Um disco efetua 30 voltas em um minuto. Determine a frequncia em Hz e rpm. Resoluo:

3. Um satlite artificial demora 2 horas para completar 1/4 de volta em torno da Terra. Qual , em horas, o perodo do movimento do satlite suposto peridico? Resoluo:

ACELERAO ANGULAR
A acelerao angular, assim como a escalar, uma taxa de variao da velocidade por unidade de tempo, assim: tempo AB = 2 horas T = 2 h 4 = 8 horas

122

FSICA 1

MOVIMENTOS CIRCULARES
7. (AMAN) Um ponto material parte do repouso e se desloca sobre um plano horizontal em trajetria circular de 5,0 metros de raio com acelerao angular constante. Em 10 segundos o ponto material percorreu 100 metros. A velocidade angular do ponto material neste instante vale: a) 16 rad . s1 d) 2,0 rad . s1 1 b) 4,0 rad . s e) 0,40 rad . s1 1 c) 20 rad . s 8. (FUND. CARLOS CHAGAS) Uma roda gira em torno de seu eixo, de modo que um ponto de sua periferia executa um movimento circular uniforme. Excetuando o centro da roda, correto afirmar que: a) Todos os pontos da roda tm a mesma velocidade escalar; b) Todos os pontos da roda tm acelerao centrpeta de mesmo mdulo; c) O perodo do movimento proporcional frequncia; d) todos os pontos da roda tm a mesma velocidade angular; e) O mdulo da acelerao angular proporcional distncia do ponto ao centro da roda.

EXERCCIOS
1. Um ponto material percorre uma circunferncia em movimento uniforme gastando 0,1s para completar cada volta. Qual a velocidade angular do movimento? a) 60 rad/s c) 70,8 rad/s e) NDA b) 62,8 rad/s d) 80,8 rad/s 2. (UEL-PR) Um antigo relgio de bolso tem a forma mostrada na figura ao lado, com o ponteiro dos segundos separado dos outros dois.

A velocidade angular do ponteiro dos segundos, cujo comprimento 0,50cm, em rad/s, e a velocidade linear de um ponto na extremidade de tal ponteiro, em cm/s, so, respectivamente, iguais a: a) 2 e c) /30 e /15 e) /60 e 2 b) 2 e 4 d) /30 e /60 3. Um avio que voa horizontalmente efetua um giro com velocidade 720 km/h. Determine o raio mnimo de giro para que a acelerao a que est submetido o piloto no seja superior a 10 vezes o valor da acelerao da gravidade. Considere g = 10 m/s2. a) 400m c) 200m e) NDA b) 20m d) 40m 4. Duas polias, ligadas por uma correia, tm 30 e 60cm de raio. A primeira efetua 50rpm. Qual a frequncia da outra em Hz?

TEXTO COMPLEMENTAR
Centrpeta X Centrfuga
Cuidado para no confundir fora centrifuga com centrpeta, as duas apresentam sentidos opostos, muito importante saber suas diferenas e entender sua existncia. Quando um nibus faz uma curva, o cho exerce uma fora nas rodas, para dentro da curva, virando o nibus, fazendo-o virar; esta a fora centrpeta, ela necessria para que o mesmo faa curvas. A fora centrifuga (a fora que joga para fora), exige um estudo mais cuidadoso, na verdade no exemplo do nibus ela pode no existir. Na verdade a fora centrifuga uma pseudo-fora, ou uma fora inercial. Se estivssemos em um helicptero, parado e pudssemos ver o nibus passar, ns veramos apenas a fora do motor, do atrito e a fora das rodas (fora centrpeta). No veramos a fora centrifuga porque ela no existe. Mas quando estamos no nibus sentimos uma espcie de fora nos jogar para fora, por que isto acontece? Quando estamos no helicptero estamos em um referencial chamado inercial, um referencial sem acelerao, lembre-se de que nosso helicptero estava parado. Portanto e como na realidade ns no vemos fora centrfuga. Mas quando estamos no nibus o nosso nibus est acelerando para dentro da curva, portanto estamos em um referencial no inercial, em um referencial acelerado. Por isso ns sentimos a sensao de que existe uma fora nos empurrando para fora da curva, por isso pensamos que existe uma fora centrifuga. Portanto a fora centrpeta considerada uma fora inercial, uma fora que tenta manter o estado de inrcia, apesar de o principio da inrcia (que ser futuramente estudado melhor) no exercer nenhuma fora, por isto dizemos que ela ela uma pseudo-fora.
Fontes: www.e-escola.pt/topico.asp?id=53 www.efisica.if.usp.br/mecanica/universitario/cinematica_v/aceler_ centripeta_mov/

_________________________________________________ _________________________________________________ 5. Uma nave espacial de 100 toneladas, orbita a terra a uma velocidade de 8000m/s2 com um raio de 6400km, estime a fora gravitacional. _________________________________________________ _________________________________________________ 6. Uma criana brinca em um carrocel, que executa um MCU.A criana tem massa 40kg, est a 2m do centro do carrocel, e consegue exercer uma fora de 160N. _________________________________________________ _________________________________________________

123

QUEDA LIVRE

UNIDADE 5 QUEDA LIVRE


ACELERAO DA GRAVIDADE (g)
Quando voc solta um corpo qualquer de determinada altura, ele est partindo do repouso. Mas percebe-se, que com o passar do tempo, em sua queda, ele ganha velocidade, e fica cada vez mais rpido, o que significa que ele est sob ao de uma acelerao, que se fizermos uma analise das foras veremos que apenas a fora gravitacional o puxa, por isso chamamos de acelerao da gravidade. Portanto, podemos dizer que acelerao da gravidade uma grandeza vetorial, vertical, e quase sempre dirigira para baixo, e cujo mdulo, verificou-se experimentalmente, que vale aproximadamente, 9,8065 m/s2, mas vamos frequentemente usar o valor 10 m/s2. Se deixarmos cair de uma certa altura, uma pedra e uma pena, percebe-se que a pedra cair mais rapidamente, certo ? Depende...Se considerar, que estamos ao ar livre, a afirmao verdadeira, pois o ar oferece uma resistncia maior pena do que pedra, e, portanto, retarda a sua queda. Mas e se desconsiderarmos o ar, o que acontece? Bom essa hiptese, totalmente possvel, chama-se queda livre, e acontece no vcuo (ausncia total de ar), ou quando a resistncia do ar desprezvel. Neste caso, tanto a pedra como a pena, estariam sob a ao nica da acelerao da gravidade, que igual para todos os corpos, e, portanto, os dois cairiam simultaneamente. Em outras palavras, quando nos referirmos a queda livre, sempre estar desconsiderando a ao do ar, o que quer dizer que o tempo de queda para qualquer corpo igual, no importa seus pesos!

Considerando V0=0, e considerando g como acelerao teremos uma equao que nos prediz o tempo ou a velocidade.

LANAMENTO VERTICAL PARA CIMA OU PARA BAIXO


Quando lanamos um corpo para cima, verticalmente, percebemos que com o passar do tempo, ele diminui sua velocidade, at parar e comear a cair, ganhando velocidade novamente. Isso acontece, porque na subida, ele est contra a gravidade, e consequentemente, num movimento retardado. J na descida, ele est a favor da gravidade, e, portanto, num movimento acelerado. Neste movimento podemos usar tambm as equaes do MRUV, pois o movimento continua variado e podemos considerar g=cte. Apenas devemos tomar muito cuidado com a nossa orientao. Se lanarmos um corpo para cima e orientarmos a velocidade de lanamento como positiva devemos orientar a acelerao gravitacional como negativa pois estas grandezas vetoriais tem sentidos contrrios.

QUEDA LIVRE
Para equacionarmos uma queda devemos imaginar a seguinte situao: temos uma pedra na (posio) altura inicial que vai iniciar um MRUV em direo ao solo. Agora podemos estimar o tempo, altura, velocidade da queda. Se quisermos saber a altura do lanamento, em funo do tempo devemos substituir nossos dados na equao a seguir.

Quando o corpo atinguir sua altura mxima a gravidade anula sua velocidade, ou seja, o corpo para de subir para comear a descer, a velocidade nula (no a acelerao).

O tempo que a pedra leva para subir o mesmo que ela leva para descer. E pode ser estimado em funo da velocidade inicial pela frmula: Obs: este o tempo de subida o tempo total ser 2.ts. Se o corpo est apenas sob ao da gravidade e tem tempos iguais, tanto na subida como na descida, podemos afirmar, que o mdulo da velocidade, quando o corpo passa por um mesmo ponto, igual. Ou seja, a mesma velocidade que ele subir ele desce. Se nosso mesmo corpo for lanado para baixo de uma certa altura com uma velocidade v0 devemos pensar que tanto a velocidade quanto a acelerao esto em um mesmo sentido. Portanto podemos usar as equaes do MRUV, lembrando apenas que devemos tomar cuidado ao orientar qualquer problema de lanamento.

Mas sabe-se que S = H, que a velocidade inicial nula, e nossa acelerao ser a gravidade.

Ou se substituirmos em Torricelli:

Se quisermos saber o tempo podemos substituir nossos dados na seguinte equao:

124

FSICA 1

QUEDA LIVRE

Lembrando apenas que as equaes anteriores tem a funo de facilitar os calculos, mas as 3 equaes do MRUV, so fundamentais e resolvem qualquer problema, pois afinal as outras derivam dela.

LANAMENTO HORIZONTAL

EXERCCIOS
1. (UECE) Uma pedra, partindo do repouso, cai de uma altura de 9,8 m. Despreza-se a resistncia do ar e adota-se g = 10 m/s. A velocidade da pedra ao atingir o solo vale: _________________________________________________ Quando lanamos um corpo horizontalmente de uma determinada altura, podemos observar que a posio do corpo varia em dois eixos. Para facilitar o estudo vamos imaginar que na verdade o movimento real a composio de dois movimentos, MRU no eixo horizontal e MRUV na vertical. a) Queda livre, na direo vertical (onde atua g) b) MRU, na direo horizontal (sem acelerao) Portanto se resolvermos dois problemas separados de MRU e MRUV poderemos resolver qualquer problema de lanamento horizontal. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. (IME-RJ) Uma pedra cai de um balo que sobe com velocidade constante de 10m/s. Se a pedra demora 10s para atinge o solo, isto significa que, no instante em que se iniciou a queda, o balo estava a uma altura de (use g = 10 m/s2): a) 5000m c) 6000m e) 400m b) 600m d) 500m 3. De um lugar situado a 125 m acima do solo, lana-se um corpo, horizontalmente, com velocidade igual a 10 m/s (g=10 m/s2). Podemos afirmar que o alcance e o tempo gasto para o corpo atingir o solo valem, respectivamente: _________________________________________________ _________________________________________________ _________________________________________________ 4. (MACK-SP) Estando a certa altura do solo, um estudante lana uma esfera A verticalmente para cima e outra, B, verticalmente para baixo, com velocidade de mesmo mdulo. Desprezando a resistncia do ar, ao chegar no solo: a) A esfera A tem velocidade de mdulo maior que a de B. b) A esfera B tem velocidade de mdulo maior que a de A. c) As velocidades das duas esferas so diferentes e dependem da altura. d) As velocidade das duas esferas so iguais. e) A esfera de maior massa tem maior velocidade.

EXERCCIO RESOLVIDO

125

FSICA 1
5. (UFRJ) Um corpo em queda livre abandonado da janela do prdio demora 4s para atingir o solo. Qual a altura em que o corpo foi abandonado? _________________________________________________ _________________________________________________ 6. (UFPR) Uma bola rola sobre uma mesa horizontal de 1,225 m de altura e vai cair num ponto do solo situado distncia de 2,5 m, medida horizontalmente a partir da beirada da mesa. Qual a velocidade da bola, em m/s, no instante em que ela abandonou a mesa? (g = 9,8 m/s2). _________________________________________________ _________________________________________________ 7. (UFPA) Em um local onde a acelerao da gravidade vale 10 m/s, deixa-se cair livremente uma pedra de uma altura de 125 m, em direo ao solo. Dois segundos depois, uma segunda pedra atirada da mesma altura. Sabendo que essas duas pedras atingiram o solo ao mesmo tempo, a velocidade com que a segunda pedra foi atirada vale: _________________________________________________ _________________________________________________ Do triangulo OAB temos a relao:

MOVIMENTOS NUM PLANO


Da mesma forma que o lanamento horizontal, o lanamento oblquo est sob atuao apenas da gravidade e tambm pode ser considerada uma composio de outros dois movimentos: a Lanamento vertical, na direo vertical (onde atua g) b MRU, na direo horizontal (sem acelerao) Ainda vale lembrar, que a trajetria do mvel ser uma parbola e que a velocidade inicial pode ser decomposta segundo as direes vertical e horizontal, como na figura abaixo:

LINKS RECOMENDADOS www.portalsaofrancisco.com.br/alfa/queda-livre/ queda-livre.php www.fisica .net/mecanicaclassica/lancamento_ vertical_e_queda_livre.pdf www.feiradeciencias.com.br/sala04/04_44.asp

O mdulo da velocidade pode ser obtido novemente pelo teorema de Pitgoras: J que sabemos cada componente podemos utiliza-las em seus respectivos movimentos.

UNIDADE 6 MOVIMENTOS NUM PLANO


Quando um jogador de futebol v o goleiro adiantado, ele procura dar um chapu no goleiro, ele procura jogar a bola a uma altura maior que a do goleiro, mas que passe depois debaixo da trave. Esse movimento da bola, que o jogador faz, chamado de lanamento oblquo.

TEMPO DE SUBIDA

Para y no cume da trajetria Vy = o:

Obs: O tempo que calculamos o tempo necessrio apenas para subir, o tempo total ser 2.tsubida

LANAMENTO OBLQUO
Quando nosso jogador chuta a bola, ele imprime a ela uma velocidade em ngulo alfa com a horizontal, ou seja ele chuta a bola para cima e para frente simultaneamente.

ALTURA MXIMA

Se quisssemos saber a altura mxima poderamos substituir a Vy = o no MRUV.

Ou ainda:

126

FSICA 1

MOVIMENTOS NUM PLANO


3. (OSEC-SP) Um corpo lanado obliquamente para cima, formando um ngulo de 30 com a horizontal. Sabe-se que ele atinge uma altura mxima hmx = 15 m e que sua velocidade no ponto de altura mxima v = 10 m/s. Determine a sua velocidade inicial. Adotar g = 10 m/s. _________________________________________________ _________________________________________________ 4. (FEI-SP) Um objeto voa numa trajetria retilnea, com velocidade v = 200 m/s, numa altura H = 1500 m do solo. Quando o objeto passa exatamente na vertical de uma pea de artilharia, esta dispara um projtil, num ngulo de 60 com a horizontal. O projtil atinge o objeto decorrido o intervalo de tempo Dt. Adotar g = 10 m/s2. Calcular a velocidade de lanamento do projtil. _________________________________________________ _________________________________________________ _________________________________________________ 5. (AFA) Um projtil lanado com velocidade inicial de 100 m/s, formando um ngulo de 45 com a horizontal. Supondo g = 10,0 m/s2, qual ser o valor do alcance e a altura mxima atingidos pelo projtil? Despreze a resistncia do ar. _________________________________________________ _________________________________________________ _________________________________________________ 6. (Faap-SP) Um projtil lanado para cima com ngulo de tiro 60 tem velocidade de 30 m/s no ponto culminante de sua trajetria. Calcule a velocidade do projtil ao retornar ao solo. (Dados: sen 60 = 0,87; cos 60 = 0,50. _________________________________________________ _________________________________________________ _________________________________________________ 7. (UECE) Num lugar em que g = 10 m/s2, lanamos um projtil com a velocidade inicial de 100 m/s formando com a horizontal um ngulo de elevao de 30. A altura mxima ser atingida aps: a) 3 s b) 4 s c) 5 s d) 10 s 8. (Fesp-SP) Lana-se um projtil com velocidade de 40 m/s, formando um ngulo 30 com a horizontal.Desprezando-se a resistncia do ar, ele atingir a altura mxima aps: a) 1 s c) 3 s e) 5 s b) 2 s d) 4 s 9. (EFOA-MG) Um corpo lanado obliquamente do solo, atingindo a altura mxima igual a 10 m e realizando alcance horizontal igual a 40 m. Podemos afirmar que o ngulo de tiro : a) 30 c) 60 e) 90 b) 45 d) 65

ALCANCE

O alcance (D) ser a distancia percorrida pelo projetil no eixo x entre alturas iguais da parbola.

porm

EXERCCIO RESOLVIDO
1. (Cefet-CE) Um aluno do Cefet em uma partida de futebol lana uma bola para cima, numa direo que forma um ngulo de 60o com a horizontal. Sabendo que a velocidade na altura mxima 20m/s, podemos afirmar que a velocidade de lanamento da bola, em m/s, ser: a) 10 b) 17 c) 20 d) 30 e) 40 Resoluo: Vimos que no ponto mais alto da trajetria a velocidade na vertical (Vy) nula, ou seja, o objeto tem apenas velocidade na horizontal (Vx) que neste caso vale, ento, 20 m/s. Sendo assim: Vx = cos . V 20 = cos 60o . V 20 = . V Ou seja, . V = 20 V = 20 . 2/1 V = 40m/s Obtemos como resposta a alternativa E.

EXERCCIOS
1. (STA CASA-SP) Um canho, em solo plano e horizontal, dispara uma bala, com ngulo de tiro de 30. A velocidade inicial da bala 500 m/s. Sendo g = 10 m/s2 o valor da acelerao da gravidade no local, qual a altura mxima da bala em relao ao solo, em km? _________________________________________________ _________________________________________________ 2. (PUCC-SP) Calcular o alcance de um projtil lanado por um morteiro com velocidade inicial de 100 m/s, sabendo-se que o ngulo formado entre o morteiro e a horizontal de 30. Adotar g = 10 m/s. _________________________________________________ _________________________________________________

LINK RECOMENDADO www.fisicamoderna.blog.uol.com.br/arch2007-0902_2007-09-08.html

127

GABARITOS

GABARITOS
UNIDADE 1
CINEMTICA E VETORES
1. 5cm 2. 10 3. f 4. c 5. a)12N 6. a) 30.3N 7. a b)13N c)15N b)60N

UNIDADE 4
MOVIMENTOS CIRCULARES
1. b 4. 0,25Hz 5. 10GN=109N=peso 6. 20m/s 7. b 8. d 2. d 3. a

UNIDADE 5
QUEDA LIVRE
1. v=14m/s 2. d 3. 50m e 5s 4. d 5. 80m 6. 5m/s b)20m 7. 26,6m/s

UNIDADE 2
MOVIMENTO RETILNEO UNIFORME (MRU)
1. 60km/h 2. e 3. b 4. b 5. d 6. a)1,5s 7.1/5 8. 340m

UNIDADE 6
MOVIMENTOS NUM PLANO
1. 3125m 2. 870m 3. 34,6m/s 4. 400m/s 5. 1000m;250m 6. 60m 7. c 8. b 9. b

UNIDADE 3
MOVIMENTO RETILNEO UNIFORMENTE VARIADO (MRUV)
1. e 3. c 5. a 2. b 4. e 6. d

7. a (obs: o caminho comea a frear s no instante t = 2s) 8. a 9. e 10. a

128

FSICA 2
131 Classificao das ondas ............................. 131 Exerccios .................................................... 131 132 Perodo (t) e Frequncia (f) ....................... 132 Equao fundamental da ondulatria ............ 132 Velocidade da propagao ........................... 132 Exerccios .................................................... 132 133 Reflexo ........................................................ 133 Refrao ....................................................... 133 Difrao ........................................................ 133 Polarizao de ondas ................................ 133 Princpio da superposio ...................... 134 Ondas estacionrias ..................................... 134 Exerccios .................................................... 134

01 02

ONDAS

pg

ONDAS PERIDICAS

pg

135 Ondas sonoras ............................................. 135 Velocidade do som ...................................... 135 Distino dos sons ........................................ 135 Exerccios .................................................... 135

04

ACSTICA

pg

03

REFLEXO E REFRAO DE ONDAS

pg

136 Cordas vibrantes ........................................ 136 Harmnicos ................................................. 136 Tubos sonoros ............................................ 136 Exerccios .................................................... 137 137 Efeito Doppler ............................................... 137 Ressonncia acstica ................................. 138 Reflexo de ondas sonoras ........................... 138 Exerccios .................................................... 138 Gabaritos ..................................................... 140

05

CORDAS VIBRANTES E TUBOS SONOROS

pg

06

FENMENOS ACSTICOS

pg

ONDAS

UNIDADE 1 ONDAS
Onda o movimento causado por uma perturbao que se propaga atravs de um meio.

EXERCCIOS
1. Na Nas ltimas dcadas, o cinema tm produzido inmeros filmes de fico cientfica com cenas de guerras espaciais, como Guerra nas Estrelas. Com exceo de 2001, Uma Odissia no Espao, essas cenas apresentam exploses com estrondos impressionantes, alm de efeitos luminosos espetaculares, tudo isso no espao interplanetrio. a) Comparando Guerra nas Estrelas, que apresenta efeitos sonoros de exploso, com 2001, Uma Odissia no Espao, que no os apresenta, qual deles est de acordo com as leis da Fsica? Explique sua resposta. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) E quanto aos efeitos luminosos apresentados por ambos, esto de acordo com as leis Fsicas? Justifique. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. Explique a diferena entre a uma onda transversal e uma onda longitudinal. _________________________________________________ _________________________________________________ _________________________________________________

CLASSIFICAO DAS ONDAS


QUANTO NATUREZA
Onda mecnica: precisa de um meio natural para se propagar. Elas no se propagam no vcuo portanto. Ex: onda sonora (som) ou uma onda em uma corda. Onda eletromagntica: no precisa de um meio material para se propagar. Ex: ondas de luz ou radio.

QUANTO DIREO DA VIBRAO

Ondas Transversais: So aquelas que possuem vibraes perpendiculares direo da propagao.

Ondas Longitudinais: As vibraes coincidem com a direo da propagao.

_________________________________________________ 3. Qual a nica coisa que uma onda pode transportar? _________________________________________________ _________________________________________________ 4. Ondas mecnicas podem ser do tipo transversal, longitudinal, ou mistas. Numa onda transversal, as partculas do meio. a) No se movem. b) Movem-se numa direo perpendicular direo de propagao da onda. c) Movem-se numa direo paralela direo de propagao da onda. d) Realizam movimento retilneo uniforme. e) N.d.a 5. Quando uma gota de chuva cai sobre uma poa d'gua, forma-se um pulso que se propaga por sua superfcie. Esse pulso transversal ou longitudinal? _________________________________________________ _________________________________________________

QUANTO DIREO DA PROPAGAO:

Unidimensionais: Propagam-se numa s direo. Ex: ondas em corda. Bidimensionais: Propagam-se num plano. Ex: ondas na superfcie de um lago. Tridimensionais: So aquelas que se propagam em todas as direes. Ex: ondas sonoras no ar atmosfrico.

131

ONDAS PERIDICAS

UNIDADE 2 ONDAS PERIDICAS


Ondas perodicas so aquelas que recebem pulsos peridicos, ou seja, recebem pulsos em intervalos de tempo iguais. Portanto, passam por um mesmo ponto com a mesma frequncia.

VELOCIDADE DA PROPAGAO
A velocidade da propagao da onda depende tambm da densidade linear da corda () e da fora da trao.

EXERCCIOS
1. Uma onda tem frequncia de 10Hz e se propaga com velocidade de 400m/s. Qual o seu comprimento de onda? _________________________________________________ _________________________________________________ 2. O eco de um grito ouvido por uma pessoa 5s aps ela ter gritado. A velocidade do som no ar de aproximadamente 330 m/s. Calcule a distncia que se encontra da pessoa a superfcie onde o som foi refletido. _________________________________________________ _________________________________________________

= comprimento da onda, calculada em metros (m). a = Amplitude

PERODO (T) E FREQUNCIA (F)


Perodo: o tempo gasto para que a onda realize uma oscilao completa. dado em segundos (s) e representado pela letra T. Frequncia: a frequncia, representada como f, corresponde ao numero de oscilaes completas em determinado tempo:

3. Um pulso produzido na superfcie da gua propaga-se mantendo a forma circular. Coloque falso (F) ou verdadeiro (V) nas afirmativas abaixo. ( ) O pulso transversal. ( ) O pulso bidimensional.

( ) A velocidade de propagao do pulso a mesma em todas as direes da superfcie da gua. 4. Considere uma pessoa batendo periodicamente em um ponto da superfcie de um lquido. Uma onda passa a se propagar nessa superfcie. Portanto podemos afirmar que: I. A velocidade de propagao (v) da onda na superfcie de um lquido depende do meio. Assim, em lquidos diferentes (gua, leo etc.) teremos velocidades de propagao diferentes. II. A distncia entre duas cristas sucessivas o comprimento de onda . III. A frequncia (f) da onda igual freqncia da fonte que deu origem onda. IV. As grandezas v, f e esto relacionadas pela equao = v/f e, portanto, como v constante para um dado meio, quanto maior for f, menor ser o valor de neste meio. Assinale a alternativa correta: a) Apenas as afirmativas I, II e IV so corretas. b) Apenas as afirmativas I, e III so corretas. c) Apenas as afirmativas I, III e IV so corretas. d) Apenas as afirmativas II e IV so corretas. e) Ae todas as afirmativas forem corretas.

a frequncia pode ainda ser calculada como o inverso do perodo:

Uma oscilao por segundo (1/s) dada como Hertz (Hz) no sistema internacional.

EQUAO FUNDAMENTAL DA ONDULATRIA


A velocidade de uma onda calculada a partir de seu comprimento () e o perodo (T), que nada mais do que o tempo que ela leva para completar sua oscilao. Sendo assim temos que a velocidade (v) de uma onda ser igual razo entre seu comprimento e o perodo:

Mas como vimos: Sendo assim, chegamos nossa equao fundamental, comumente representada como: V=f. Sendo calculada em m/s no Sistema Internacional (S.I.).

132

REFLEXO E REFRAO DE ONDAS

UNIDADE 3 REFLEXO E REFRAO DE ONDAS


e outros fenmenos

REFLEXO
Ocorre quando a onda, aps incidir num segundo meio de caractersticas diferentes, volta a se propagar no meio original.

A difrao tambm ocorre quando as ondas encontram um pequeno obstculo elas se abrem e tendem a contorn-lo. A difrao da luz tambm pode ser observada tanto pela tendncia de contornar obstculos, aparecendo na forma de franjas claras e escuras, como pela abertura do feixe depois de atravessar uma fenda estreita.

POLARIZAO DE ONDAS
o fenmeno no qual uma onda transversal, vibrando em vrias direes, tem uma de suas direes de vibrao selecionada, enquanto as vibraes nas demais direes so impedidas de passar por um dispositivo, denominado polarizador. A polarizao um fenmeno exclusivo das ondas transversais, no podendo ocorrer com as ondas longitudinais. Assim, as ondas luminosas, que so transversais, podem ser polarizadas, ao contrrio das ondas sonoras, que no se polarizam, por serem longitudinais.

REFRAO
Ocorre quando a onda passa de um meio para outro de caractersticas diferentes. Devido mudana, a velocidade e o comprimento se modificam. Ex: onda do mar passando do fundo para o raso. Obs: A frequncia no se altera porque esta depende apenas da fonte. Logo:

s vezes, um segundo polarizador usado para confirmar a polarizao do primeiro: ele chamado analisador. Se um segundo polarizador colocado de modo que polarize em uma direo perpendicular do primeiro, a onda impedida de propagar-se e diz-se ento que eles esto cruzados. Como dissemos anteriormente, a luz uma onda transversal, portanto podemos dizer que ela emitida em todas as direes. Sendo assim, seus campos eltricos e magnticos so produzidos em todas as direes, porm esses campos sempre so perpendiculares direo de propagao. Vejamos a figura abaixo:

DIFRAO
A difrao um fenmeno tipicamente ondulatrio. As ondas na gua, ao passar pelo orifcio de um anteparo, abrem-se ou difratam-se, formando um feixe divergente. Em 1803, Young realizou uma experincia demonstrando que a luz possua natureza ondulatria. Ele a fez passar por uma abertura estreita e constatou que, num anteparo instalado do outro lado, no surgia simplesmente uma linha ntida, mas sim um conjunto de faixas luminosas de diferentes intensidades. Isso mostrava que a luz sofria difrao, tal como ocorria com as ondas sonoras ou as de um lago. Se ela fosse constituda de partculas, esse comportamento seria impossvel. Na figura acima vemos que quando a onda passa pelo primeiro polarizador, ela se propaga em uma nica direo. Portanto, nesse caso, dizemos que a onda foi polarizada. Se em um segundo momento acrescentarmos outro material polarizador cujas fendas esto dispostas perpendicularmente direo de propagao da luz polarizada, veremos que tais ondas no atravessam o cristal. Sendo assim, podemos dizer que a polarizao uma propriedade das ondas transversais.

133

FSICA 2

REFLEXO E REFRAO DE ONDAS

PRINCPIO DA SUPERPOSIO
Ocorre pela superposio de duas ou mais ondas.

ONDAS ESTACIONRIAS
So ondas resultantes da superposio de duas ondas com: Mesma frequncia. Mesma amplitude. Mesmo comprimento de onda. Mesma direo. Sentidos opostos. Ao atingirem a extremidade fixa, elas se refletem, voltando com sentido contrrio ao anterior. Dessa forma, as perturbaes se superpem s outras que esto chegando parede, originando o fenmeno das ondas estacionrias.

Caracterstica: amplitude varivel de ponto para ponto, isto , pontos que no se movimentam (amplitude nula).

EXERCCIOS
1. Quando duas ondas interferem, a onda resultante apresenta sempre pelo menos uma mudana em relao s ondas componentes. Tal mudana se verifica em relao (ao): a) Comprimento da onda d) Frequncia b) Perodo e) Fase c) Amplitude 2. Quando um feixe de luz atravessa uma fenda estreita, como por exemplo nossos dedos pouco antes de se tocarem, possvel ver reas mais claras e mais escuras nessa rea, como se fossem franjas. D o nome desse fenmeno e explique-o. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 3. A figura mostra dois pulsos ideais, x e y, idnticos e de amplitude a, que se propaga com velocidade em uma corda, cuja extremidade P fixa. No instante em que ocorrer a superposio, o pulso resultante ter amplitude:

a) a

b) 2a

c) a/2

d) zero

4. Nos esquemas a seguir temos a representao de um pulso que se propaga em uma corda. O lado 1 representa o pulso incidente e o lado 2 representa o pulso aps ocorrido o fenmeno de reflexo, refrao ou ambos. Diante do exposto julgue os itens.

134

FSICA 2

ACSTICA

ALTURA

Ao contrario do senso comum, altura tem a ver com a frequncia do som. devido a diferentes alturas que temos sons graves (baixa frequncia) e sons agudos (alta frequncia).

INTENSIDADE

Sevido a ela que podemos diferenciar um som forte de um fraco. A intensidade erradamente chamada altura no senso comum. Podemos calcular a intensidade fsica (I) de um som da seguinte forma: I: intensidade E: quantidade de energia A: rea atravessada pela E t: variao do tempo Ainda quanto intensidade temos a intensidade auditiva, ou nvel sonoro (), definido por:

5. Julgue os itens a seguir. ( ) Uma onda polarizada transversal. ( ) O fenmeno que melhor caracteriza uma onda transversal e a distingue de uma onda longitudinal a polarizao. ( ) As ondas sonoras no apresentam efeito de polarizao como a luz, porque elas so longitudinais. ( ) A difrao um dos fenmenos que prova que a luz formada por ondas transversais.

Sendo I0 o limiar de audibilidade humana, equivalente a 1012 W/m2. A unidade do nvel sonoro o bel (B).

TIMBRE

UNIDADE 4 ACSTICA
ONDAS SONORAS
Como j sabemos, a onda sonora uma onda mecnica, necessitando portanto de um meio material para se propagar. Alm disso, a onda sonora classifica-se como longitudinal. As ondas sonoras so propagadas em um meio material, chegando aos pavilhes auditivos, que ao atingirem o tmpano (membrana auditiva) ocasionam vibraes de mesma frequncia, que so ento enviadas ao crebro na forma de estmulos nervosos. As ondas sonoras propagam-se com diversas frequncias, mas o ouvido humano s capaz de reconhecer aquelas que vo de 20Hz at 20KHz (20000Hz).

O timbre o que permite diferenciar sons de mesma altura e intensidade. Depende do instrumento ou origem do som. o que torna, por exemplo, a mesma palavra com mesma intensidade e altura diferente entre um homem e uma mulher.

EXERCCIOS
1. O som uma onda mecnica que se propaga no ar com uma velocidade varivel, conforme a temperatura local. Supondo que em um lugar essa velocidade seja 340m/s. Se um auto-falante, ao vibrar sua membrana neste local, emite 1 250 pulsos por segundo: a) Determine a frequncia de vibrao da membrana, em Hertz. _________________________________________________ _________________________________________________ b) Determine o perodo de vibrao. _________________________________________________ _________________________________________________ c) Determine o comprimento de onda da onda sonora, em metros. _________________________________________________ _________________________________________________ d) Sabendo-se que a velocidade do som no ar varia com a temperatura segunda a relao v = 330 + 0,61 . , sendo em graus Celsius e a velocidade em metros por segundo. Qual a temperatura local? _________________________________________________ _________________________________________________

VELOCIDADE DO SOM
A velocidade do som depender do meio em que ele se propagar.

V SLIDO > V LQUIDO > V GS

DISTINO DOS SONS


Podemos diferenciar um som de outro graas a trs propriedades:

135

FSICA 2
2. Um coral com cem pessoas, sendo elas homens, mulheres e crianas, mesmo que cante a mesma nota numa mesma potencia ainda ser capaz de ser distinguido cada voz que dele participa. Explique o porqu. _________________________________________________ _________________________________________________ _________________________________________________ 3. Um homem anda paralelamente a uma linha frrea com velocidade de 1,5 m/s, um trem se desloca em sua direo com velocidade de 20 m/s, o homem ouve o apito do trem com frequncia de 683 Hz. Sendo a velocidade do som no ar igual a 340 m/s, qual a frequncia do apito emitido pelo trem? _________________________________________________ _________________________________________________ _________________________________________________ 4. Os sons audveis pelo ouvido humano resultam de movimentos vibratrios cujas frequncias so compreendidas entre 16 Hz e 20000 Hz. Sabendo-se que a 20C a velocidade de propagao do som na gua 1450 m/s e no ar 344 m/s. Calcular: a) Os comprimentos de onda correspondentes s frequncias mxima e mnima no ar e na gua. _________________________________________________ _________________________________________________ b) A relao entre os comprimentos de onda na gua e no ar. _________________________________________________ _________________________________________________

CORDAS VIBRANTES E TUBOS SONOROS

Como entre dois ns (ponto sem vibrao) teremos sempre um ventre, poderemos generalizar: , onde n o nmero de fusos.

Ainda a frequncia da vibrao poder ser dada como

sendo v a velocidade de propagao da onda que dada por: , sendo F a fora que a corda est tencionada e u a densidade linear da corda.

UNIDADE 5 CORDAS VIBRANTES E TUBOS SONOROS


CORDAS VIBRANTES
No nosso cotidiano encontramos uma infinidade de instrumentos de cordas vibrantes, como a guitarra eltrica, o violo, violino e o piano. So instrumentos com diversas cordas, cada uma com uma densidade e calibre diferente e constante, e permanecem tracionadas. Quando uma corda dessas percutida, ela passa a vibrar, transferindo essa energia para o ar ao seu redor e gerando ondas sonoras de mesma frequncia.

TUBOS SONOROS
Assim como as cordas vibrantes, existem muitos instrumentos musicais classificados como como tubos sonoros. Temos, por exemplo, a flauta, obo, trompete, berrante e outros... Suas frequncias fundamentais esto representadas abaixo:

HARMNICOS
Na figura a seguir iremos mostrar os possveis harmnicos em uma corda vibrante. Deve-se notar que as extremidades sero sempre nodos, assim no iro vibrar.

136

FSICA 2

FENMENOS ACSTICOS
A parte vibrante das cordas do violino de Bruna mede 35 cm de comprimento, como mostrado nesta figura:

Considerando essas informaes, a) CALCULE a velocidade de propagao de uma onda na corda mi desse violino. Os tubos fechados possuem apenas harmnicos mpares assim: _________________________________________________ _________________________________________________ _________________________________________________ b) Considere que a corda mi esteja vibrando com uma frequncia de 680 Hz. DETERMINE o comprimento de onda, no ar, da onda sonora produzida por essa corda. Velocidade do som no ar = 340 m/s _________________________________________________ _________________________________________________ _________________________________________________

EXERCCIOS
1. (PUC-PR) Numa certa guitarra, o comprimento das cordas (entre suas extremidades fixas) de 0,6 m. Ao ser dedilhada, uma das cordas emite um som de frequncia fundamental igual a 220 Hz. Marque a proposio verdadeira: a) Se somente a tenso aplicada na corda for alterada, a frequncia fundamental no se altera. b) A distncia entre dois ns consecutivos igual ao comprimento de onda. c) O comprimento de onda do primeiro harmnico de 0,6 m. d) A velocidade das ondas transversais na corda de 264 m/s. e) As ondas que se formam na corda no so ondas estacionrias. 2. Uma corda de 90 cm presa por suas extremidades, em suportes fixos, como mostra a figura.

UNIDADE 6 FENMENOS ACSTICOS


EFEITO DOPPLER
O efeito Doppler a alterao da frequncia sonora percebida pelo observador em virtude do movimento relativo de aproximao ou afastamento entre a fonte e o observador. Um exemplo tpico do efeito Doppler o caso de uma ambulncia com a sirene ligada quando ela se aproxima ou se afasta de um observador. Quando ela se aproxima do observador o som mais agudo e quando ele se afasta o som mais grave. Esse um fenmeno caracterstico de qualquer propagao ondulatria, e ele muito mais presente no cotidiano do que pensamos. O Efeito Doppler utilizado para medir a velocidade de objetos atravs de ondas que so emitidas por aparelhos baseados em radiofrequncia ou lasers como, por exemplo, os radares. Na astronomia esse fenmeno utilizado para medir a velocidade relativa das estrelas e outros objetos celestes em relao ao planeta Terra. E na medicina o efeito doppler utilizado nos exames de ecocardiograma para medir a direo e a velocidade do fluxo sanguneo ou do tecido cardaco. O efeito Doppler no ocorre somente com o som. Como foi dito, esse fenmeno caracterstico de propagaes ondulatrias, ou seja, possvel observar esse fenmeno com qualquer tipo de onda. Dessa forma, podemos observar o efeito Doppler com a luz, que tambm uma onda. Para esse caso, o fenmeno do efeito Doppler se manifesta na mudana de cor que percebida pelo observador, uma pessoa, por exemplo, que se aproxima de um sinal de trnsito que est vermelho, percebe a colorao vermelha mais intensa se ela estiver parada, pois a frequncia de onda luminosa maior do que quando a pessoa est em movimento.

Assinale a alternativa que contm os trs comprimentos de onda mais longos possveis para as ondas estacionrias nesta corda, em centmetros. a) 90, 60 e 30 c) 120, 90 e 60 b) 180, 90 e 60 d) 120, 60 e 30 3. Em uma harpa, a corda de maior comprimento possui 50 cm. Qual o comprimento mximo de uma onda estacionaria que um musico pode atingir nesse instrumento? _________________________________________________ _________________________________________________ 4. (UFMG-MG) Bruna afina a corda mi de seu violino, para que ela vibre com uma freqncia mnima de 680 Hz.

137

FSICA 2
Podemos mensurar qual ser a frequncia aparente para um observador a partir da formula:

FENMENOS ACSTICOS
O intervalo de tempo entre as recepes das duas ondas ser, portanto, igual a t = t1 t2. Dependendo do valor desse intervalo de tempo, perceberemos um dos trs fenmenos: reforo, reverberao ou eco. Reforo: quando t = t1 t2 = 0, as duas ondas sonoras sero recebidas quase simultaneamente pelo ouvido, e este perceber um som mais intenso. Reverberao: se o obstculo estiver mais afastado, de modo que o intervalo de tempo entre a chegada das ondas no seja desprezvel, mas seja menor que o tempo de resoluo de nossa orelha, 0,1 s, ento, quando da chegada da onda refletida, o som direto ainda estar persistindo na orelha do ouvinte, que ter a sensao de um prolongamento da sensao auditiva. Eco: se o obstculo estiver ainda mais afastado, ento as duas ondas sonoras atingiro o ouvido com um intervalo de tempo maior ou igual a 0,1 s, e o ouvinte perceber distintamente os dois sons.

Sendo que f a frequncia aparente para o observador e Vl e Vs as velocidades de um ouvinte e de uma fonte em relao ao ar respectivamente.

RESSONNCIA ACSTICA
A Ressonncia Acstica gerada quando uma fonte emite um som de frequncia igual frequncia de vibrao natural de um receptor. Como em todo tipo de ressonncia, ocorre uma espcie de amplificao do som, aumentando a intensidade deste. Um exemplo clssico foi a ponte de Tacoma, que entrou em colapso nos Estados Unidos na primeira metade do sculo XX. A ponte, feita essencialmente de concreto, possui uma frequncia natural de vibrao que pode ser chamado de X. O vento muito forte fez a ponte vibrar nessa frequncia X, causando a ressonncia e fazendo a ponte de concreto e ao torcer como se fosse feita de borracha, at entrar em colapso e se destruir.

EXERCCIOS
1. Quando uma ambulncia, com sirene ligada, se aproxima de um observador, este percebe: a) Aumento da intensidade sonora e da frequncia. b) Aumento da intensidade sonora e diminuio da frequncia. c) Mesma intensidade sonora e mesma frequncia. d) Diminuio da altura e variao no timbre sonoro. e) Variao no timbre e manuteno da altura. 2. Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. O alarme de um automvel est emitindo som de uma determinada frequncia. Para um observador que se aproxima rapidamente desse automvel, esse som parece ser de .................... frequncia. Ao afastar-se, o mesmo observador perceber um som de .................... frequncia. a) Maior igual d) Menor maior b) Maior menor e) Igual menor c) Igual igual 3. Um trem se aproxima, apitando, a uma velocidade de 10 m/s em relao plataforma de uma estao. A frequncia sonora do apito do trem 1,0 kHz, como medida pelo maquinista. Considerando a velocidade do som no ar como 330 m/s, podemos afirmar que um passageiro parado na plataforma ouviria o som com um comprimento de onda de: a) 0,32 m c) 0,34 m e) 340 m b) 0,33 m d) 33 m 4. Considere a velocidade mxima permitida nas estradas como sendo exatamente 80 km/h. A sirene de um posto rodovirio soa com uma frequncia de 700 Hz, enquanto um veculo de passeio e um policial rodovirio se aproximam emparelhados. O policial dispe de um medidor de frequncias sonoras. Dada a velocidade do som, de 350 m/s, ele dever multar o motorista do carro quando seu aparelho medir uma frequncia sonora de, no mnimo: a) 656 Hz c) 655 Hz e) 860 Hz b) 745 Hz d) 740 Hz

REFLEXO DE ONDAS SONORAS


PERSISTNCIA AUDITIVA
A sensao auditiva que sentimos em nosso ouvido quando ouvimos um barulho equivale a uma onda sonora que permanece nele por aproximadamente 0,1 segundos. Esse intervalo de tempo de sensao auditiva denominado tempo de persistncia auditiva. Caso outra onda sonora atinja nosso ouvido dentro desse intervalo de tempo, no saberemos distinguir o segundo som do primeiro. Para a compreenso de fenmenos acsticos decorrentes da reflexo de ondas sonoras e a persistncia auditiva observe a figura abaixo:

Nela estamos considerando uma fonte sonora, um ouvinte e uma parede (que pode refletir as ondas sonoras). O ouvinte recebe, em instantes diferentes, a onda direta I e a onda refletida II, emitidas pela mesma fonte. Sendo t1 e t2 os instantes em que as ondas atingem a orelha, admitindo t0 = 0 no momento da emisso da particular frente de onda, h um intervalo de tempo t = t1 t2 entre as recepes.

138

FSICA 2

FENMENOS ACSTICOS

Rascunho

139

GABARITOS

GABARITOS
UNIDADE 1
1. a) Odisseia est de acordo, pois como as ondas sonoras so classificadas como ondas mecnicas, elas no podem se propagar no espao interplanetrio, que constitudo de vcuo apenas. b) sim, ambos esto de acordo com as leis da fsica, haja vista que ondas eletromagnticas se propagam inclusive no vcuo. 2. Ondas Transversais: So aquelas que possuem vibraes perpendiculares direo da propagao. Ondas Longitudinais: As vibraes coincidem com a direo da propagao. 3. Apenas energia 4. b 5. Transversal 2. Isso se deve ao timbre. 3. 640Hz 4. a) max. ar=21,5 m Min. ar=0,0172 m max. agua=90,625 m min. Agua=0,0725 m b. 4,2

UNIDADE 5
1. d 2. b 3. 1 m 4. a) 476 m/s b) 50 cm.

UNIDADE 2
1. 40m 2. 825m 3. F,F,V 4. e

UNIDADE 6
1. a 2. b 3. a 4. b

UNIDADE 3
1. c 2. Isso ocorre devido difrao, onde o trajeto de uma onda alterado ao passar por uma fenda estreita. 3. d 4. V V F V 5. V V V F

UNIDADE 4
1. a) f= 1250Hz b) T= 8.104 s c) 0,272m d) 16,4 C

140

143 Grandezas macro x micro .......................... 143 Estados da matria ..................................... 143 Equilbrio trmico .......................................... 143 Escalas termomtricas ............................ 144 Escalas relativas ........................................ 144 Escala absoluta (Kelvin) ................................ 144 Comparao entre as escalas ................ 144 Exerccios .................................................... 145 146 Calor sensvel e latente .............................. 146 Capacidade trmica .................................... 146 Calor especfico ............................................. 147 Quantidade de calor sensvel .................. 146 Calor latente de transformao (l) ....... 147 Balano trmico ............................................ 147 Calormetro ................................................. 148 Exerccios .................................................... 148 149 Conduo ...................................................... 149 Conveco ..................................................... 150 Irradiao ...................................................... 150 Energia refletida, absorvida e transmitida .............................. 151 Garrafa trmica Vaso de Dewar ............ 151 Forno de micro-ondas ................................... 151 Exerccios .................................................... 151

01 TERMOMETRIA

FSICA 3
pg pg

153 Fuso ............................................................. 153 Solidificao ................................................. 154 Vaporizao .................................................... 154 Liquefao e condensao ...................... 154 Sublimao .................................................. 155 Curva de aquecimento .................................. 155 Exerccios .................................................... 155

04

MUDANA DE ESTADO

pg

02

CALORIMETRIA

156 Dilatao dos slidos .................................. 156 Dilatao de corpo oco ou com furo ........ 158 dilatao dos lquidos, dilatao real e aparente ......................................................... 158 Exerccios .................................................... 159

05

DILATAO TRMICA

pg

03

PROPAGAO DE CALOR

pg

160 Equao geral dos gases ............................ 160 Transformaes fundamentais ................. 160 Equao de Clapeyron ................................... 161 Trabalho nas transformaes gasosas () ..................................................... 161 1 princpio da Termodinmica ............ 162 2 princpio da Termodinmica ............ 162 Exerccios .................................................... 162 Gabaritos ..................................................... 164

06

GASES E TERMODINMICA

pg

TERMOMETRIA

UNIDADE 1 TERMOMETRIA
comum, no inverno, sentirmos frio; no entanto, a soluo prtica: colocamos uma blusa, tomamos um banho bem quente, tomamos um chocolate quente bem gostoso. No vero exatamente o oposto: Procuramos uma piscina disponvel para nadarmos, usamos roupas mais leves e tomamos bebidas chamadas refrigerantes. H muito tempo, essa percepo de diferentes sensaes trmicas intrigou vrios cientistas pelo mundo, que comearam a desenvolver teorias e mtodos para tentar quantificar e qualificar essa grandeza que ns damos o nome de temperatura.

ESTADOS DA MATRIA
Podemos perceber que: Nos slidos a matria se encontra aglomerada, com baixa vibrao, e, geralmente, sem se deslocar no espao. E, aqui se comete um erro comum ao pensar que as molculas esto paradas, mas NO ESTO. Nos lquidos a matria est em contato ntimo, mas muito diferente dos slidos, ela est em constante deslocamento espacial. Nos gases a matria est em mnimo contato umas com as outras e tendem a escapar se no forem contidas dentro de um sistema fechado. A agitao molecular aqui a maior possvel A medio da temperatura feita de forma indireta. Experimentalmente, verifica-se que determinados corpos apresentam caractersticas fsicas que podem se alterar medida que a agitao trmica das partculas constituintes da matria se altera, por exemplo: O comprimento de uma barra. O volume de um lquido. A resistncia eltrica de um chuveiro. A presso de um gs. A termometria a parte da fsica, mais propriamente dito da termologia, que estuda a medio da temperatura atravs de processos indiretos, ou seja, tem por objetivo mensurar um nmero a cada estado trmico de um corpo e, consequentemente, permitir comparaes entre estados distintos. Se dois corpos esto com a mesma agitao trmica, esto com a mesma temperatura, e se estiverem com agitaes trmicas diferentes, esto com temperaturas diferentes.

GRANDEZAS MACRO X MICRO


Na fsica podemos efetuar a medida de dois tipos de grandezas: as macroscpicas e as microscpicas. Com uma boa aproximao, podemos afirmar que as grandezas macroscpicas podem ser percebidas pelo nossos sentidos, tais como o comprimento de uma barra, o volume de um lquido, a massa de um dado corpo. J as grandezas microscpicas exigem um estudo mais aprofundado a respeito da constituio da matria, devendo, portanto analisar sua estrutura molecular e, consequentemente, deve ser medida de forma indireta.

TEMPERATURA ()

Como vimos anteriormente, a temperatura no pode ser medida como uma grandeza macroscpica, pois assim recairamos na subjetividade do quente e frio. preciso, ento, analisar a constituio molecular, a menor arquitetura da matria.

EQUILBRIO TRMICO
Tomemos dois corpos, A e B, sendo que A est com a temperatura A e o corpo B com a temperatura B.

VIBRAO DAS MOLCULAS

Observando a Figura, ns podemos concluir que as molculas vibram em todas as direes, mesmo que estejam ligadas umas s outras. Quanto mais agitadas as molculas, maior ser a temperatura, e o inverso, quanto menos agitadas, menor ser a temperatura.

No incio do processo, os corpos tem diferentes temperaturas. Logo aps o contato os corpos comeam a trocar essa energia trmica, e o mais frio tende a ganhar energia do mais quente. Logo, os dois corpos entram no estado de equilbrio e ao invs de duas temperaturas diferentes, possuem uma s temperatura, C, diferente das duas iniciais: A B C. Pensando tambm no movimento molecular, podemos raciocinar sobre os trs estados da matria: slido, lquido e gasoso.

CALOR

Ao contrrio do que muitos pensam calor e temperatura no so grandezas equivalentes. Temperatura, como se sabe, uma medida de agitao das partculas, portanto um corpo possui

143

FSICA 3
uma determinada temperatura. Entretanto, um corpo no possui calor, pois calor uma forma de energia em trnsito que s existe quando dois corpos em diferentes temperaturas interagem de forma trmica. Calor energia trmica em trnsito que se desloca do corpo de maior temperatura para o corpo de menor temperatura. Podemos dizer que calor um fluxo de energia com sentido nico e obrigatrio. importante voc lembrar que mesmo que um corpo extenso esteja com suas extremidades em temperaturas diferentes, ele no possuir calor, mas sim existir um fluxo de calor entre suas extremidades, at que a diferena de temperatura desaparea e, consequentemente, nenhuma parte tenha maior ou menor temperatura em relao outra. Calor s existe enquanto o equilbrio trmico no estabelecido.

TERMOMETRIA
de se imaginar e a prpria cincia tem dificuldade de afirmar se h, realmente, um prprio limite. Entretanto, o limite inferior bvio, basta as partculas no se agitarem, isto , ficarem paradas. O ponto de zero absoluto um estado trmico de zero agitao molecular, isto , as partculas no possuem energia de vibrao. O fsico irlands, Willian Thomson, que recebeu o ttulo de nobreza lorde Kelvin, estabeleceu, em 1848, uma escala absoluta, a chamada Escala Kelvin. Kelvin verificou experimentalmente que a presso de um gs diminua 1/273 do valor inicial, quando resfriado a volume constante de 0 C para 1 C. Como a presso do gs est relacionada com o choque de suas partculas com as paredes do recipiente, quando a presso fosse nula, as molculas estariam em repouso, a agitao trmica seria nula e a sua temperatura tambm. Concluiu, ento, que isso aconteceria se transformssemos o gs at 273 C. Assim, Kelvin atribuiu o valor zero para este estado trmico e o valor de 1 kelvin a uma extenso igual do grau Celsius, de modo que o ponto de fuso do gelo corresponde a 273 K e o ponto de ebulio da gua corresponde a 373 K (o nome e o smbolo grau kelvin foram abolidos em conveno cientfica internacional e substitudos simplesmente por kelvin; portanto, ao invs de 10 K, escreve-se 10 K e l-se: dez kelvin). A escala de Rankine tambm uma escala absoluta como a de Kelvin, onde o zero o zero absoluto, mas diferentemente de Kelvin, ele admitiu variaes do tamanho das variaes em Fahrenheit. Posteriormente, descobriu-se impossvel atingir o estado de agitao molecular nulo; as molculas tm uma energia mnima denominada energia do ponto zero e o zero absoluto inatingvel na prtica. O zero absoluto obtido por extrapolao e no deve ser interpretado como o estado em que as partculas estariam em completo repouso, pois elas possuem uma energia mnima finita e apresentam movimento.

ESCALAS TERMOMTRICAS
O primeiro a montar uma escala termomtrica e definir pontos fundamentais foi Anders Celsius, sueco, em 1742. Ele definiu que, sob presso constante e normal os pontos fixos fundamentais so: Ponto de Gelo (PG): Gelo fundente, isto , gelo em equilbrio trmico com a gua lquida. Ponto de Vapor (PV): gua em ebulio, isto , vapor em equilbrio trmico com a gua liquida. Por esse motivo as escalas so denominadas RELATIVAS.

ESCALAS RELATIVAS
CELSIUS
A escala Celsius (C) foi montada a partir do PG da gua, 0C, e do PV da gua, 100C. Consequentemente existem cem divises inteiras entre o PV e o PG. Desta forma, o grau Celsius a variao de 1/100 do intervalo entre os pontos fixos.

COMPARAO ENTRE AS ESCALAS


Equao de transformao entre escalas Observe que as escalas, tanto relativas quanto absolutas, simplesmente so escalas que fornecem nmeros a estados termicamente definidos, portanto o que menos importa o nmero associado ao estado, mas sim o estado fsico em si. Note que as trs escalas tm relaes entre o PG e o PV. PG = 0C, 32F e 273K PV = 100C, 212F e 373K

FAHRENHEIT

Fahrenheit (F) tambm tinha o PG como zero, porm em uma de suas observaes notou que a temperatura mais fria em Amsterd, sua cidade, era -8. Portanto, ele postulou que a temperatura do dia mais frio deveria ser o zero e no o PG, que ficou com o valor +8. Porm, Fahrenheit percebeu que os valores eram muito quebrados e resolveu multiplicar seus valores por 4. Com essas adoes ns podemos colocar o PG e o PV nos valores 32F e 212F, respectivamente. Consequentemente, essa escala possui 180 intervalos inteiros. Essa escala, por ter mais espaos entre o PG e o PV mais precisa do que a escala Celsius.

ESCALA ABSOLUTA (Kelvin)


Uma escala absoluta de temperatura uma escala baseada no zero absoluto. Mas o que o zero absoluto? Pois bem, vamos falar sobre os limites, inferiores e superiores da agitao das partculas que constituem um dado corpo. O limite superior difcil

144

FSICA 3
A partir dessas escalas, podemos, com o Teorema de Tales, determinar segmentos proporcionais e montar equaes para transformar o valor de uma escala em um valor de outra escala. Para isso, fazemos a variao do PG at o ponto em comum (C, F e K) e dividimos pela variao do PG at o PV:

TERMOMETRIA

FUNCIONAMENTO DO TERMMETRO

Simplificando a equao, temos:

O termmetro um cilindro de vidro que contm uma poro de mercrio em um pequeno reservatrio. No cilindro, entre o reservatrio de mercrio e a haste que contm as marcaes com as temperaturas h um estrangulamento do vidro. Quando colocamos o termmetro em contato com o corpo, o mercrio se dilata e escapa pelo estrangulamento, assim, ele ocupa a haste marcada e indica a temperatura. Portanto, a temperatura medida com o termmetro graduada de acordo com a variao macroscpica do mercrio presente no tubo. Esse um timo mtodo de extrapolao da energia interna, microscpica, para a dilatao que condiz com a poro macroscpica. Para voltarmos o mercrio a posio inicial basta agitar o termmetro para que o lquido se acumule novamente no reservatrio.

Assim, se quisermos obter uma relao entre Celsius e Fahrenheit usamos somente as duas primeiras partes da equao; se quisermos obter a relao entre Celsius e Kelvin, usamos somente a primeira e a terceira parte da equao, e assim por diante. Dessa mesma forma, pelo Teorema de Tales podemos montar qualquer escala, desde que fixemos o PG e o PV e tracemos um ponto em comum entre a escala desejada e as escalas padres.

EXERCCIOS
1. Qual a temperatura em Celsius que corresponde a 122F? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. Qual a temperatura em Kelvin que corresponde a 97C? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 3. Que temperaturas em Celsius e Fahrenheit equivalem a 73K? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 4. Qual a temperatura em que as indicaes das escalas Celsius e Fahrenheit assumem valores iguais? _________________________________________________ 5. Qual a temperatura cuja indicao na escala Fahrenheit supera em 100 unidades a correspondente indicao da escala Celsius? _________________________________________________ 6. Quando um individuo est com febre nos EUA, ele possui a temperatura em F de: a) 40 c) 95 e) 105 b) 320 d) 100 7. Qualquer indicao na escala absoluta : a) Sempre inferior a zero b) Sempre igual a zero c) Nunca superior a zero d) Sempre superior a zero e) Sempre negativa

EXERCCIO RESOLVIDO
1. O ncleo externo terrestre formado principalmente por Nquel e Ferro, onde encontram-se fluidos em uma pasta em torno de 7232F. Determine a temperatura em graus Celsius e na escala absoluta do sistema internacional. Soluo: O ncleo terrestre est a temperatura de 7232F, vamos transformar para graus Celsius e depois para Kelvin.

Agora, basta transformar a temperatura encontrada para a escala Kelvin.

2. Na embalagem de um produto existe a seguinte recomendao: Manter a -4C. Num pas em que se usa a escala Fahrenheit, a temperatura correspondente recomendada : a) -39,2F c) 24,8F e) 40,2F b) -24,8F d) 39,2F Soluo:

A alternativa C est correta.

145

FSICA 3
8. Com respeito a temperatura, assinale a afirmativa mais correta: a) A escala Celsius utilizada em todos os pases do mundo e uma escala absoluta. A escala Kelvin s usada em alguns pases por isso relativa. b) A Kelvin uma escala absoluta, pois trata do estado de agitao das molculas, e usada em quase todos os pases do mundo. c) A escala Celsius uma escala relativa e representa, realmente a agitao molecular. d) As escalas Celsius e Kelvin referem-se ao mesmo tipo de medida e s diferem de um valor constante e igual a 373. e) A escala Celsius relativa ao ponto de fuso do gelo e de vapor de gua e o intervalo dividido em noventa e nove partes iguais. 9. Sob presso atmosfrica normal, um termmetro graduado na escala Celsius e outro graduado numa escala A se relacionam segundo o grfico a seguir:

UNIDADE 2 CALORIMETRIA
Como vimos na unidade anterior, quando corpos distintos com temperaturas distintas so postos unidos, h um fluxo de energia trmica do corpo com maior temperatura para o de menor temperatura, at que se atinja o equilbrio trmico. A esse fluxo damos o nome de calor. Salienta-se que o termo calor usado apenas para indicar a energia que est sendo transferida, no sendo empregado para indicar a energia que o corpo possui. A calorimetria tem por objetivo a anlise, do ponto de vista quantitativo, do problema das trocas de calor entre sistemas postos em presena, a diferentes temperaturas, no interior de recipientes termicamente isolados, ou no, do meio exterior. Se dois corpos A e B, cujas temperaturas so A e B, sendo A > B, forem postos no interior de um recipiente termicamente isolado do meio exterior, observaremos que decorrido um certo tempo, os corpos apresentaro a mesma temperatura de equilbrio E, sendo: A > E > B . Quando os corpos estiverem na E, diz-se que o calor cessou e h interrupo da transmisso de energia. A unidade de quantidade de calor Q no SI o joule (J), uma vez que o calor uma forma de energia. No entanto, a unidade mais utilizada a caloria (cal), cuja relao com a anterior :

CALOR SENSVEL E LATENTE


Quando observamos a troca de calor entre corpos temos que eles so de duas naturezas: O calor recebido ou cedido por um corpo tem uma nica consequncia: variao da temperatura . Nesse caso, a energia cintica de vibrao molecular alterada e age diretamente sobre a temperatura. O corpo que recebe ou cede calor, mantm seu estado de agregao, variando sua temperatura. Neste caso o calor trocado chamado de calor sensvel. O calor recebido ou cedido por um corpo tem como nica consequncia: variao de estado fsico. Nesse caso, a energia potencial de agregao que varia e atua diretamente sobre a mudana de estado fsico da matria. O corpo que recebe ou cede calor, mantm sua temperatura constante. Neste caso o calor trocado chamado de calor latente. Nota-se ento que a matria passa por perodos de calor sensvel e perodos de calor latente; primeiro para variar a temperatura e depois para mudar de estado fsico.

Na escala A, qual a temperatura de ebulio da gua? _________________________________________________ 10. Um fabricante de termmetros lanou no mercado um termmetro de mercrio graduado nas escalas Celsius e Fahrenheit. Na parte referente a Celsius, a distncia entre duas marcas consecutivas era de 1,08mm. Qual a distncia, na escala Fahrenheit, entre duas marcas consecutivas? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

CAPACIDADE TRMICA
Seja Q a quantidade de calor que um corpo troca com o exterior e a consequente variao da temperatura desse corpo, por definio, chama-se capacidade trmica do corpo razo entre a quantidade de calor trocada e a variao de temperatura sofrida.

146

FSICA 3
Podemos concluir que a capacidade trmica de um corpo numericamente igual quantidade de calor que o sistema troca com o meio quando a temperatura do sistema sofre uma variao. A capacidade trmica a robustez que o corpo oferece variao de temperatura, dada uma quantidade fixa de calor. A unidade usada cal/C.

CALORIMETRIA

EXERCCIO RESOLVIDO
1. Sabendo que o calor latente de vaporizao da gua de 540cal/g, determine o tempo que um fogo precisa para evaporar 50ml de gua, se ele emite calor uma taxa de 418W. Considere a densidade da gua de 1g/ml. Soluo: Primeiro vamos descobrir quanto de calor o fogo libera por segundo, lembrando que 1 cal = 4,18 J. Percebe-se, facilmente, que a potncia, em calorias por segundo, tem valor de P = 100cal/s. Agora vamos encontrar a quantidade de calor necessria para evaporar 50ml de gua.

CALOR ESPECFICO
Chama-se calor especfico de um corpo a capacidade trmica por unidade de massa desse corpo.

O calor especfico a robustez que o corpo oferece variao de temperatura por unidade de massa, dada uma quantidade fixa de calor. A unidade usada cal/gC. Esta grandeza uma caracterstica da substncia que compe o corpo, e no simplesmente do corpo. Ou seja, todas as regies do corpo so de mesma robustez oferecida troca de calor e ela depende da quantidade de substncia (massa). Quanto maior o calor especfico/capacidade trmica de uma substncia, menor ser a variao de temperatura sofrida. Portanto, ao aumentarmos a robustez do corpo, para uma mesma quantidade de calor, diminumos a variao de temperatura sofrida; ao diminuirmos a robustez, a variao de temperatura aumenta.

Lembrando que potncia pode ser calculada por meio da relao entre calor/energia e tempo e em seguida substituindo os valores na relao obtemos:

O tempo necessrio, portanto, para este volume de gua se vaporizar de 270 segundos.

QUANTIDADE DE CALOR SENSVEL


Combinando as equaes do calor especfico com a da capacidade trmica, encontra-se a equao:

BALANO TRMICO
No decorrer do seu estudo, voc ter que resolver problemas que envolvem trocas de calor, nos quais voc devera achar o valor de algum dos elementos do processo: temperatura inicial, temperatura final (equilbrio), massa ou calor especfico. Para resolver os problemas voc dever aplicar os seguintes princpios da calorimetria:

Essa equao nos fornece a quantidade de calor sensvel Q trocada por um corpo de massa m, constitudo de um material de calor especfico c, ao sofrer uma variao de temperatura . Sendo c uma constante caracterstica da substncia, podemos dizer que a quantidade de calor sensvel Q trocada por um corpo proporcional massa do corpo e variao da temperatura sofrida por ela.

IGUALDADE DAS TROCAS DE CALOR

CALOR LATENTE DE TRANSFORMAO (L)


Chama-se calor latente de transformao a quantidade de calor que a unidade de massa do sistema deve trocar com o exterior, na temperatura em que ocorre a transformao, para que o sistema sofra mudana de estado, sem variao da temperatura. Em tal situao toda energia est sendo utilizada para romper ligaes e alterar o estado da matria, portanto, no h variao de temperatura. Sendo m a massa da substncia que muda de estado e L o calor latente dessa mudana, a quantidade de calor Q envolvida no processo determinada pela frmula:

Quando dois ou mais corpos, em temperaturas diferentes so colocados no interior de um recipiente termicamente isolado do exterior, trocam calor entre si at atingir o equilbrio trmico. Portanto, a soma da quantidade de calor cedido, mais o calor recebido pelos corpos igual a zero. Simbolicamente temos:

TRANSFORMAES INVERSAS

Se um sistema recebe uma determinada quantidade de calor ao sofrer uma transformao, ento ceder a mesma quantidade de calor ao sofrer a transformao inversa.

147

FSICA 3

CALORIMETRIA
3. Uma atleta envolve sua perna com uma bolsa de gua quente, contendo 600g de gua temperatura inicial de 90C. Aps 4 horas ela observa que a temperatura da gua 42C. Responda: (cagua = 1,0 cal/gC) a) Qual foi a perda total de energia pela gua? _________________________________________________ b) Qual foi a perda mdia de energia em calorias por segundo? _________________________________________________ c) Qual a capacidade trmica da atleta? possvel obter esse dado sabendo que a perna da atleta estava em 36C no comeo do tratamento, e a 40C no final? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

EXERCCIO RESOLVIDO
2. Em um copo de gua (c=1,0g/C) de 200ml 22C, adicionado dois cubos de gelo -5C sendo que somados pesam 40g. Determine a temperatura de equilbrio. Considere o calor latente de fuso do gelo L = 80 cal/g e o calor especfico sensvel dessa mesma substncia igual a cg = 0,5 cal/gC.. Soluo: Como a gua inicialmente estava a maior temperatura, ela ceder calor, enquanto o gelo receber.

CALORMETRO
um recipiente onde usualmente so colocados os corpos com o objetivo de trocar calor. uma importante ferramenta experimental na medio do calor especifico dos corpos. Os calormetros so, teoricamente, isolados do meio exterior, para evitar trocas de calor entre o meio externo e o seu contedo, por serem essas quantidades de calor difceis de medir. Calormetros ideais so aqueles que no participam das trocas de calor em seu interior, isto , possui capacidade trmica nula ou desprezvel.

4. Dois blocos de cobre A e B, de massas iguais, e um recipiente R, contendo gua, inicialmente isolados, esto respectivamente s temperaturas Ta, Tb e Tr, tais que Tb > Tr > Ta. Os blocos A e B so lanados no recipiente R. A temperatura de equilbrio trmico do sistema T :

EXERCCIOS
1. Assinale a afirmativa falsa: a) A capacidade trmica de um corpo funo de sua massa. b) Quando recebido por um corpo, o calor sensvel produz apenas variao de temperatura. c) O calor especifico uma caracterstica da substncia, ou, corpo por unidade de massa. d) A capacidade trmica de um corpo indica a quantidade de calor que cada unidade de massa desse corpo necessita para sua temperatura variar uma unidade. e) O valor da capacidade trmica de um corpo depende do material que este feito. 2. Uma mesma quantidade de calor fornecida a massas iguais de gua e alumnio, inicialmente mesma temperatura. A temperatura final do corpo de alumnio : a) Maior que o da gua, pois tem maior calor especifico. b) Menor que o da gua, pois tem menor calor especifico. c) Mesma que a da gua, pois as massas so iguais. d) Maior que o da gua, pois tem menor calor especifico. e) No podemos comparar as variaes de temperatura por se tratarem de substancias diferentes. 5. Um bloco metlico tem capacidade trmica igual a 10 cal/C. Qual a quantidade de calor que devemos fornecer para que a temperatura do bloco varie de 20C para 25C? _________________________________________________ _________________________________________________ 6. Em um aqurio de 10L, completamente cheio de gua, encontrase um pequeno aquecedor de 60W. Sabendo que em 25 minutos a temperatura da gua aumentou de 2,0C, determine: Dados: cagua= 1,0 cal/gC; 1cal = 4J e 1W = 1J/s. a) A quantidade de energia que foi absorvida pela gua. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) A frao da energia fornecida pelo aquecedor que foi perdida para o exterior. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

148

FSICA 3
7 Qual a quantidade de gua, a 20C, que deve ser misturada em um calormetro ideal com 100g de gua a 80C, para que a temperatura final da mistura seja de 50C? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Num calormetro contendo 100g de gua a 0C coloca-se um pedao de ferro de 200g a 300C. Desprezando-se o calor absorvido pelo calormetro, qual a temperatura de equilbrio trmico? Dados: cagua= 1,0 cal/gC; cferro= 0,1 cal/gC _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 9. Um calormetro de alumnio de massa 200g contm 120g de gua a 96C. Quantos gramas de alumnio a 10C devem ser introduzidos no calormetro para resfriar a gua a 90C? Dados: cAl = 0,22 cal/gC a) 56g c) 5,6g e) 41g b) 28g d)112g 10. Na cozinha de um restaurante h dois caldeires com gua, um a 20 graus Celsius e outro a oitenta graus Celsius. Quantos litros devemos pegar de cada um, de modo a resultarem, aps mistura, 10L de gua a 26 graus Celsius? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

PROPAGAO DE CALOR

CONDUO
O calor se propaga por conduo quando passa de uma regio para outra de um corpo, ou de um corpo para outro com o qual est em contato, sem que haja deslocamento das molculas constituintes dos corpos. Portanto, nesse processo h transporte de energia sem transporte de matria. Uma experincia simples evidencia a conduo. Segure uma barra metlica por um de seus extremos e aproxime o outro extremo da chama de uma fonte de calor. Voc notar, decorrido um certo tempo, que o extremo no qual voc est segurando estar aumentando a temperatura. A temperatura de cada seo transversal da barra foi aumentando gradativamente at atingir a extremidade oposta colocada na fonte de calor.

Do ponto de vista microscpico, a conduo do calor pode ser explicada da seguinte maneira: numa determinada regio do corpo a energia posta em jogo provoca uma agitao maior das molculas dessa regio. Devido aos incessantes choques entre essas molculas e as molculas vizinhas, a energia transmitida para essas ltimas que assim se aquecem; esse fenmeno se repete ao longo do corpo, sem que as partculas constituintes do corpo tenham que se deslocar de suas posies de equilbrio. Bons e maus condutores: Sabe-se que nos slidos as molculas esto mais prximas do que nos lquidos e no gases, por isso os slidos conduzem o calor de forma melhor que os lquidos, sendo ainda, os gases so os piores condutores de calor. Entre os slidos os melhores condutores so os metais.

UNIDADE 3 PROPAGAO DE CALOR


Como voc j estudou nos captulos anteriores, calor energia em trnsito, que se desloca de um corpo para outro, ou mesmo dentro de um mesmo corpo, de uma regio para outra regio de temperaturas diferentes. Vale a pena observarmos que o calor entre corpos pode ocorrer, estando os corpos em contato ou no. Esse fenmeno recebe o nome de propagao do calor. O calor pode se propagar de trs maneiras, a saber: Conduo Conveco Irradiao Embora os processos tenham caractersticas diferentes, eles tm uma coisa em comum: O calor sempre se propaga de uma regio para outra de temperatura mais baixa, ou de um corpo para outro que esteja a temperatura mais baixa.

LEI DE FOURIER

A transmisso de calor por conduo entre dois pontos separados por um determinado meio regida pela Lei de Fourier, desde que as temperaturas dos dois pontos no variem no decorrer do tempo (regime permanente ou estacionrio de conduo). Consideremos uma barra metlica de comprimento L, seco transversal de rea A, isolada lateralmente, cujas extremidades estejam em contato com dois sistemas cujas temperaturas 1 e 2 permaneam constantes apesar de estar havendo a propagao de calor, veja figura abaixo.

149

FSICA 3
O fluxo de calor ao longo da barra, isto , a quantidade de calor Q que atravessa a barra num intervalo de tempo t, dado por:

PROPAGAO DE CALOR
As pores menos densas se deslocam para dar lugar s pores mais densas, ocorrendo a formao de correntes de partculas aquecidas de baixo para cima. Essas correntes so denominadas correntes de conveco. So favorecidas pela variao de densidade e levam o calor do fundo do recipiente para todas as partes do lquido. Perceba a sequncia lgica descrita acima: variao de temperatura acarreta variao de volume e leva a uma variao de densidade. De maneira anloga so formadas correntes de conveco nos gases. o que ocorre, por exemplo, no interior de um refrigerador. O ar na proximidade do congelador resfriado, ocorrendo uma diminuio do volume, aumentando sua densidade, e por isso o ar tende a descer, deslocando o ar mais quente, que ento se aproxima do congelador e , por sua vez, resfriado. Estabelecem-se assim as correntes de conveco dentro da geladeira.

geralmente expresso em cal/s, Nessas condies K expresso em cal/s.cm.C, e chamado de coeficiente de condutividade trmica do material que constitui a barra. Seu valor elevado para bons condutores e baixo para isolantes.

EXERCCIO RESOLVIDO
1. A temperatura externa de uma casa de madeira (K=0,5W/mC) de 12C, sendo que uma parede tem 12m2 de rea e tem 20cm de espessura. Sabendo que a temperatura dentro da casa de 24C, determine a quantidade de fluxo de calor. Soluo: Como a condutibilidade trmica foi dada em W/mC devemos usar a rea e espessura da parede em metros e a diferena de temperatura em C, assim obteremos o fluxo em watts.

CONVECO
O transporte do calor por conveco, em um meio, consiste essencialmente no deslocamento de pores de fluidos (lquidos, gases e vapores) de diferentes densidades, de uma regio para outra desse meio. Portanto, ao contrrio do que ocorre no processo de conduo, a conveco se caracteriza pelo arraste da matria. Devido a esse arraste, ou transporte, a conveco no pode ocorrer nos slidos, sendo caracterstica somente dos fluidos. Ao aquecermos um liquido contido num recipiente, as pores situadas no fundo recebem calor em primeiro lugar e, em consequncia, apresentam aumento do volume, do qual decorre uma diminuio da densidade.

Note que as prateleiras das geladeiras so sempre em forma de grade, exatamente para facilitar a circulao das correntes de conveco. Por esse motivo no recomendvel a obstruo total das prateleiras. O processo de resfriamento do ar de uma sala de aula baseado no mesmo processo, por isso que o ar condicionado colocado na poro superior das paredes. J na situao da lareira, melhor que a sua boca fique mais prxima possvel do cho, para maximizar as correntes de conveco que vo surgir em decorrncia do aquecimento do ar, diminuio da densidade e subida do ar quente, dando lugar ao ar frio que ser aquecido. Nas regies litorneas, durante o dia, a areia se aquece mais rapidamente que a gua do mar, pois a capacidade trmica da gua muito maior que a da areia, desta forma o ar aquecido sobe, e forma-se uma regio de baixa presso, permitindo o movimento do ar que se sobrepe ao mar para essa regio. Fala-se ento da brisa do mar. Durante a noite, a terra torna-se mais fria que a gua do mar, provocando a inverso do processo. Sopra ento vento da terra para o mar, brisa terrestre. importante perceber que quando um corpo esquenta com muita rapidez, ele tambm resfriar com muita rapidez (areia); assim como um corpo que demora a esquentar, demorar para resfriar-se (gua).

IRRADIAO
Na parte inicial deste captulo, mostramos que a conduo uma propagao de calor no corpo, sem arraste de matria, e que a conveco a propagao de calor com arraste de matria num corpo. Mas, como a energia emitida pelo Sol chega Terra?

150

FSICA 3
Neste caso, temos a irradiao, que a propagao de energia atravs do espao, mesmo quando no existe matria (corpo). O corpo que emite energia chamado de emissor ou radiador. O corpo que recebe energia chamado receptor, e atravs dele que constatamos a existncia dessa energia. A energia que se propaga do radiador para o receptor, atravs do espao, mesmo quando inexiste matria, chamada energia radiante. A energia radiante ficar mais bem caracterizada quando voc estudar Eletromagnetismo. Voc aprender, ento, que ela se propaga atravs de ondas eletromagnticas. Todos os corpos esto continuamente emitindo energia radiante. Quanto mais elevada a temperatura do corpo, maior ser a intensidade da emisso de energia. Experimentalmente comprava-se que a emisso de energia traz, em geral, uma diminuio da temperatura do corpo emissor. A absoro da energia se traduz pelo aumento da temperatura do receptor. A energia radiante no provoca alteraes na temperatura do meio atravs do qual ela se propaga.

PROPAGAO DE CALOR

GARRAFA TRMICA VASO DE DEWAR


A garrafa trmica um recipiente utilizado para conservar lquidos quentes ou frios, impedindo ou, pelo menos, reduzindo, ao mnimo as trocas de calor entre o contedo do recipiente e o meio externo. Desta maneira, a temperatura no interior do recipiente se mantm constante por longo tempo.

ENERGIA REFLETIDA, ABSORVIDA E TRANSMITIDA


Quando a energia radiante incide sobre um corpo, parte da energia refletida, parte transmitida e parte absorvida. O princpio de funcionamento da garrafa trmica o de impedir a transferncia de calor, seja por conduo, conveco ou irradiao. Para evitar a conduo e a conveco, o recipiente construdo com paredes duplas e faz-se o vcuo, ar rarefeito, entre as paredes; ento, tais processos no podem se realizar, devido ausncia de molculas. Para evitar a irradiao, as faces internas e externas do recipiente so espelhadas.

FORNO DE MICRO-ONDAS
Este forno construdo com um emissor de ondas de baixa frequncia e grande comprimento de onda, portanto so capazes de realizar grandes alteraes em energias cinticas moleculares, principalmente nas molculas de gua. Quando o emissor emite as ondas, elas atingem as molculas de gua e as pe a vibrar, assim, sua energia cintica aumentada, e, portanto sua temperatura aumenta. Nesse caso, as molculas de gua aumentam sua temperatura por irradiao, e por conduo e conveco elas aquecem o restante do alimento.

Somente a parcela absorvida transformada em calor, provocando aumento da temperatura do receptor.

CORPOS OPACOS, TRANSPARENTES E NEGROS

Se nenhuma parcela do fluxo incidente for transmitida o corpo dito opaco. Se alguma parcela de energia for transmitida o corpo dito transparente. Note que um dado corpo pode ser opaco para certas radiaes e, ao mesmo tempo, transparente para outras. O corpo humano, por exemplo, transparente para os raios X e opaco para a luz natural. Quando o corpo absorve totalmente a energia nele incidente, ele chamado corpo negro. Corpo negro aquele que emite apenas energia prpria. Sendo o corpo negro o melhor receptor de energia radiante, de acordo com a experincia anterior, ser tambm o melhor radiador. Na prtica consegue-se a realizao de um corpo negro fazendo-se um orifcio numa cavidade, cujas paredes so mantidas a temperatura fixa, a energia radiante penetra pelo orifcio, sofre mltiplas reflexes, permanecendo no interior da cavidade, sendo ento totalmente absorvida pelo receptor.

EXERCCIOS
1. A transmisso de calor de um ponto para outro, graas ao deslocamento do prprio material aquecido um fenmeno de: a) Irradiao d) Radiao b) Conveco e) Emisso c) Conduo 2. Uma pessoa caminhando descala no interior de uma casa, nota que o piso ladrilhado mais frio que o piso de madeira. Isto por causa de: a) Efeitos psicolgicos. b) As condutividades trmicas serem diferentes.

151

FSICA 3
c) Os calores especficos serem diferentes. d) A temperatura da madeira ser mais alta que a do ladrilho. e) Os equivalentes em gua dos materiais serem diferentes. 3. Para melhorar o isolamento trmico de um ambiente, mantendo o material de que so feitas as paredes, deve-se: a) Aumentar o volume das paredes. b) Aumentar a rea externa da parede e manter sua espessura. c) Diminuir a espessura das paredes. d) Aumentar a espessura e diminuir a rea das paredes. e) Nenhuma das respostas anteriores. 4. Se voc precisasse entrar num forno quente, preferiria ir: a) Nu. b) Envolto em roupa de seda. c) Envolto em roupa de l. d) Envolto em roupa de l e recoberta com alumnio. e) Envolto com roupa de linho preto. 5. O calor conduzido atravs de uma parede, na unidade de tempo : a) Inversamente proporcional rea da parede. b) Diretamente proporcional espessura da parede. c) Diretamente proporcional diferena de temperatura entre as duas superfcies da parede. d) Nenhuma das anteriores. 6. O calor do Sol chega Terra por um processo de: a) Condutibilidade, atravs das molculas. b) Conveco, por aquecimento do meio. c) Difuso de partculas no vcuo. d) Radiao, que pode ocorrer no vcuo. e) Transduo, ligada ao plasma (quarto estado da matria). 7. A radiao o nico processo possvel de transmisso de calor: a) Nos gases. b) Nos slidos que no apresentam eltrons livres. c) Nos slidos que no apresentam eltrons livres. d) Nos slidos em geral. e) Nos cristais. 8. Um cobertor de l tem por funo: a) Dar calor ao corpo b) Reduzir a transferncia de calor do corpo para o meio exterior. c) Impedir a entrada do frio. d) Comunicar sua temperatura ao corpo. e) Aquecer o ar entre ele e o corpo. 9. Sabe-se que a temperatura do caf se mantm razoavelmente constante no interior de uma garrafa trmica perfeitamente vedada. a) Qual o principal fator responsvel por esse bom isolamento trmico?

PROPAGAO DE CALOR
_________________________________________________ _________________________________________________ _________________________________________________ b) O que acontece com a temperatura do caf se a garrafa trmica for agitada vigorosamente? Explique. _________________________________________________ _________________________________________________ _________________________________________________ 10. Um corpo I colocado dentro de uma campnula de vidro transparente evacuada. Do lado externo, em ambiente presso atmosfrica, um corpo II colocado prximo campnula, mas no em contato com ela, como mostra a figura.

As temperaturas dos corpos so diferentes e os pinos que os sustentam so isolantes trmicos. Considere as formas de transferncia de calor entre esses corpos e aponte a alternativa correta. a) No h troca de calor entre os corpos I e II porque no esto em contato entre si. b) No h troca de calor entre os corpos I e II porque o ambiente no interior da campnula est evacuado. c) No h troca de calor entre os corpos I e II porque suas temperaturas so diferentes. d) H troca de calor entre os corpos I e II e a transferncia se d por conveco. e) H troca de calor entre os corpos I e II e a transferncia se d por meio de radiao eletromagntica. 11. Deseja-se isolar termicamente uma sala de modo que as paredes devem permitir uma transmisso mxima de calor, por unidade de rea, de 10 W/m2. Sabendo-se que o interior da sala mantido temperatura de 20C e o exterior atinge uma temperatura mxima de 35C, calcule a espessura mnima de l, em centmetros, que deve ser usada nas paredes. O coeficiente de condutividade trmica da l K=0,04 W/mK. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 12. Duas salas idnticas esto separadas por uma divisria de espessura L=5,0 cm, rea A=100m2 e condutividade trmica K=2,0W/mK. O ar contido em cada sala encontra-se, inicialmente, temperatura 1=47C e 2=27C, respectivamente.

152

FSICA 3
Considerando o ar como um gs ideal e o conjunto das duas salas um sistema isolado, calcule o fluxo de calor atravs da divisria relativo s temperaturas iniciais 1 e 2. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 13. Admita que o corpo humano transfira calor para o meio ambiente na razo de 2,0kcal/min. Se esse calor pudesse ser aproveitado para aquecer gua de 20C at 100C, a quantidade de calor transferido em 1,0 hora aqueceria uma quantidade de gua, em kg, igual a. Adote: Calor especfico da gua = 1,0 cal/gC a) 1,2 c) 1,8 e) 2,5 b) 1,5 d) 2,0 14. No interior de um recipiente adiabtico de capacidade trmica desprezvel, colocamos 500g de gelo (calor latente de fuso=80cal/g) a 0C e um corpo de ferro a 50C, como mostra a figura a seguir.

MUDANA DE ESTADO

Podemos perceber que a organizao molecular dos estados e a quantidade de energia deles bem diferente. Nos slidos temos uma menor energia cintica e uma maior organizao molecular, o que contribui para maior estabilidade de forma, portanto nos slidos forma e volume esto preservados. Nos lquidos, com a maior energia cintica, as molculas tendem a se afastarem, e assim, diminuem a coeso e a estabilidade intramolecular, portanto nos lquidos o volume est preservado, mas a sua forma no. No estado gasoso podemos verificar que as molculas esto em grande quantidade de movimentao, e assim a atrao entre uma molcula e outra mnima, disso decorre a menor coeso e estabilidade das ligaes entre as molculas, por isso os gases no mantm nem forma nem volume}, so totalmente dependentes do recipiente que os contem. Modificando-se as condies de presso e/ou temperatura, pode haver a passagem de um estado de agregao para outro. Podemos reconhecer as seguintes mudanas de estado:

Aps 10 minutos, o sistema atinge o equilbrio trmico e observase que 15g de gelo foram fundidos. O fluxo de calor que passou nesse tempo pela seco S foi de: a) 2 cal/s c) 5 cal/s e) 7 cal/s b) 4 cal/s d) 6 cal/s 15. Explique o que aconteceria se um congelador fosse deixado aberto em uma sala com as portas e as janelas fechadas. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

FUSO
A fuso a passagem de uma substncia do estado slido para o estado lquido atravs da absoro de calor (endotrmico). A uma dada presso, toda substncia cristalina pura sofre fuso a uma temperatura bem determinada, denominada temperatura de fuso da substncia. No havendo variao da presso, a temperatura permanecer constante durante a fuso.

UNIDADE 4 MUDANA DE ESTADO


Voc j conhece os estados de agregao da matria: solido, liquido e gasoso. Neste captulo, falaremos sobre as transies que acarretam a mudana de estado de agregao das substncias e descreveremos as propriedades dessas transies. Vimos tambm que as molculas tm Energias cinticas e Energias potenciais responsveis pela variao de temperatura e mudana de estado fsico, respectivamente.

153

FSICA 3
Observe na figura anterior que a temperatura de fuso f permanece constante durante toda a fuso. Durante o ganho de temperatura de -20C a 0C o calor do tipo sensvel, enquanto no processo de fuso do tipo latente.

MUDANA DE ESTADO
A gua no estado slido, devido a grande presena de pontes de hidrognio possui uma estrutura muito armada, ocupando um volume maior do que a mesma massa de gua no estado lquido.

CALOR LATENTE DE FUSO (Lf )

Chama-se calor latente de fuso de uma substncia, correspondente a uma dada presso, a quantidade de calor que deve ser fornecida unidade de massa da substncia, na temperatura de fuso, para que ocorra a mudana de estado, sem variao da temperatura. Se falarmos apenas calor latente de fuso da substncia, sem fazer meno presso, subentende-se que ela est sujeita a presso normal, ou seja, 1 atmosfera. Simbolicamente escrevemos: Lf = Q/m, portanto:

VAPORIZAO
Passagem do estado lquido para o vapor. Pode ocorrer de trs formas: evaporao, ebulio e calefao. Evaporao: o processo de vaporizao que ocorre na superfcie exposta do lquido ao ambiente de forma espontnea e contnua, que pode ocorrer a qualquer temperatura, de acordo com: natureza do lquido, rea da superfcie livre, presso externa, temperatura, saturao do meio. Por exemplo, a gua que evapora de um lago. O lquido entra em ebulio quando a tenso de vapor igual presso externa. Ebulio: o processo de vaporizao que envolve toda a massa lquida, e que ocorre em regime turbulento, devido formao de bolhas, compostas de vapor, que vm estourar na superfcie do lquido. O processo obedece a um conjunto de leis da ebulio: Sob determinada presso, todo lquido entra em ebulio, numa determinada temperatura que chamada temperatura de ebulio do lquido correspondente presso considerada. A temperatura de ebulio correspondente presso normal chamada de ponto de ebulio do lquido, e indicada por e . No havendo variao da presso, a temperatura permanecer constante durante toda a ebulio. O lquido entra em ebulio quando a tenso mxima de seu vapor saturante se torna igual presso exercida pela atmosfera sobreposta ao lquido. Calefao: o processo de vaporizao que envolve grande quantidade de energia. Gotas de gua entram em calefao quando submetidas, rapidamente, a temperaturas muito superiores que as de ebulio, para a presso considerada. Por exemplo, gotas de gua em uma panela muito quente; viram vapor assim que entram em contato com a superfcie da panela.

SOLIDIFICAO
a passagem do estado lquido para o estado slido. Ela a transformao inversa da fuso, e ocorre com liberao de calor por parte de substncia que se solidifica (exotrmico). Substncias cristalinas sofrem solidificao obedecendo a um conjunto de leis denominadas leis da solidificao: Sob determinada presso, toda substncia cristalina pura sofre solidificao a uma temperatura bem determinada, denominada temperatura de solidificao da substncia correspondente presso considerada. A temperatura de solidificao correspondente presso normal recebe o nome de ponto de solidificao da substncia. No havendo variao da presso, a temperatura permanecer constante durante a solidificao.

CALOR LATENTE DE SOLIDIFICAO (Ls )

Chama-se o calor latente de solidificao de uma substncia, correspondente a uma dada presso, a quantidade de calor que deve ser retirada da unidade de massa da substncia, na temperatura de solidificao, para que ocorra a mudana para o estado slido sem variao de temperatura. Se dissermos simplesmente calor latente de solidificao da substncia, sem fazer meno presso, subentende-se que ela seja a normal. Observa-se que para uma mesma substncia, em uma determinada presso, as temperaturas de fuso e solidificao so as mesmas em mdulo, assim como seus calores latentes.

CALOR LATENTE DE VAPORIZAO (Lv )

O calor latente de vaporizao Lv , correspondente a uma dada presso, a quantidade de calor que deve ser fornecida unidade de massa do lquido, na temperatura de ebulio, para que ocorra a mudana de estado, sem variao de temperatura. Simbolicamente Lv= Q/m , portanto:

VARIAO DO VOLUME NA FUSO E SOLIDIFICAO

Todas as substncias sofrem variao de volume ao sofrerem fuso. Umas se dilatam enquanto outras se contraem. Na grande maioria dos casos ocorre dilatao na fuso e, consequentemente, contrao na solidificao. Entretanto, algumas substncias comportam-se de maneira contrria, isto , se contraem na fuso e se expandem na solidificao. Entre estas substncias temos a gua, o antimnio, bismuto e o ferro fundido. Por isso, quando voc coloca no congelador uma garrafa tampada, completamente cheia de gua acontece o rompimento da garrafa.

LIQUEFAO E CONDENSAO
Chama-se liquefao a passagem do estado de vapor para o estado lquido. Essa transformao ocorre com a liberao de calor e tambm pode ser chamada condensao. Obedece as seguintes leis: Sob determinada presso, menor que sua tenso mxima, todo vapor sofre liquefao a uma temperatura bem determinada, chamada temperatura de liquefao do vapor correspondente

154

FSICA 3
presso considerada. A temperatura de liquefao, presso normal, recebe o nome de temperatura de condensao da substncia. Durante a liquefao, se a presso permanecer constante, a temperatura tambm permanecer constante.

MUDANA DE ESTADO
2. Descreva porque o alimento cozinha de forma diferente na panela de presso; mais rpido ou mais lento? _________________________________________________ _________________________________________________ 3. O fator do ter evaporar mais rapidamente que o lcool, quando nas mesmas condies, mostra que a rapidez de evaporao depende da: a) Temperatura. b) Presso em sua superfcie livre. c) Natureza do lquido. d) rea da superfcie livre. e) Densidade do lquido. 4. O calor especfico da gua da ordem de 1,0 cal/gC e seu calor latente de fuso igual a 80 cal/g. Para transformar 200 g de gelo a 0 C em gua a 30 C, a quantidade de energia necessria, em quilocalorias, equivale a: a) 8 b) 11 c) 22 d) 28 5. Quais afirmativas esto corretas? Justifique. a) Durante a transio de slido para lquido, a temperatura no muda, embora uma quantidade de calor tenha sido fornecida gua. b) O calor latente de condensao da gua tem um valor diferente do calor latente de vaporizao. c) Em determinadas condies, a gua pode coexistir na fase slida, lquida e gasosa. _________________________________________________ _________________________________________________ _________________________________________________ 6. Uma panela com um litro de gua colocada sobre a chama de um fogo. A temperatura de ebulio dessa gua ir depender da: a) Capacidade trmica da panela. b) Presso atmosfrica ambiente. c) Condutividade trmica da panela. d) Quantidade de calor cedida pela chama. 7. Na aula de Fsica, o professor entrega aos estudantes um grfico da variao da temperatura (em C) em funo do calor fornecido (em calorias).

CALOR LATENTE DE CONDENSAO (Lc )

Chama-se calor latente de condensao, correspondente a uma dada presso, quantidade de calor que deve ser retirada da unidade de massa do vapor, na temperatura de condensao, para que ocorra a liquefao sem mudana de temperatura. Simbolicamente, Lc = Q/m, portanto:

Observa-se que, para uma mesma substncia, a temperatura de ebulio igual temperatura de condensao, e o calor latente de vaporizao igual ao calor latente de condensao.

SUBLIMAO
a transformao que leva a substncia diretamente do slido para o estado de vapor, sem passar pelo estado lquido. O fenmeno inverso chamado de sublimao regressiva. Ocorre, entre outras substncias, com Iodo, dixido de carbono (gelo seco), naftalina, cnfora.

CURVA DE AQUECIMENTO
Todas as informaes ditas neste captulo at agora podem ser resumidas atravs de uma curva, chamada de curva de aquecimento. Tal grfico relaciona a temperatura de uma dada substncia pura em funo da quantidade de calor que lhe fornecida. Analise o diagrama e perceba que ele sintetiza tudo o que foi dito neste captulo!

EXERCCIOS
1. Se voc deseja que a gua ferva temperatura ambiente, o que deve ser feito? _________________________________________________ _________________________________________________

155

FSICA 3
Esse grfico referente a um experimento em que foram aquecidos 100 g de gelo, inicialmente a -20C, sob presso atmosfrica constante. Em seguida, o professor solicita que os alunos respondam algumas questes. Auxilie o professor na elaborao do gabarito correto, calculando, a partir das informaes dadas, a) O calor especfico do gelo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) O calor latente de fuso do gelo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ c) A capacidade trmica da quantidade de gua resultante da fuso do gelo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Uma pessoa solicita numa lanchonete um hambrguer e um copo de refrigerante com cubos de gelo. A temperatura dos cubos de gelo e o refrigerante so iguais. No existindo perdas de calor durante a fuso do gelo no refrigerante, o fenmeno fsico que se observa no sistema (refrigerante + gelo) indica que: a) A temperatura do sistema mantm-se constante durante a fuso do gelo. b) A temperatura do sistema aumenta. c) A temperatura do sistema diminui. d) A temperatura do gelo mantm-se constante e do refrigerante aumenta. e) A temperatura do sistema sempre aumenta. 9. Fraturas hidrotrmicas esto se abrindo no fundo do mar atravs das quais gua muito quente descarregada nos oceanos. A gua que emerge dessas fraturas a uma profundidade de 2400 m possui uma temperatura de 552 K. Apesar dessa temperatura, a gua no entra em ebulio por causa: a) Da baixa temperatura das guas profundas dos oceanos. b) Da alta presso no fundo do oceano. c) Do pequeno volume de gua quente. d) Da transferncia isotrmica de calor. 10. Na questo a seguir assinale a afirmativa INCORRETA. a) Todos os materiais expandem-se quando aquecidos. b) A temperatura de fuso de uma substncia depende da presso. c) Durante uma mudana de fase, a temperatura permanece constante. d) A temperatura em que a gua ferve depende da presso.

DILATAO TRMICA
11. Os ndios missioneiros utilizaram tecnologias trazidas pelos jesutas, entre elas, a fundio de metais para construo de ferramentas agrcolas, armas e utenslios em geral. Para construir um sino de ferro, foram fundidos 10 kg do metal que se encontrava inicialmente na temperatura ambiente de 16 C. Se a temperatura de fuso do ferro 1536 C, o calor especfico igual a 0,11 x 103 cal/kgC, e o calor latente de fuso do ferro igual a 65 x 103 cal/kg, a quantidade de energia na forma de calor utilizada, em quilocalorias (kcal), de a) 650 c) 2322 e) 6500 b) 1672 d) 4000

UNIDADE 5 DILATAO TRMICA


Nos captulos anteriores, estudamos o conceito de temperatura, calor e transformao de estado da matria. Lembre-se que a temperatura uma medida da agitao das partculas, portanto, quanto maior a temperatura, maior ser a agitao das partculas que constituem o corpo. Consequentemente, uma alterao da agitao molecular provoca alteraes mtricas nos corpos, e so essas alteraes que passaremos a estudar nesse captulo. D-se o nome de dilatao trmica variao das dimenses dos corpos como consequncia nica da variao da temperatura.

Analisando a figura podemos perceber que a distncia entre uma molcula e outra aumenta devido o aumento da temperatura, que o grau de agitao molecular. Note que as partculas direita esto vibrando muito mais, portanto elas precisam de uma maior distncia no espao para se acomodarem.

DILATAO DOS SLIDOS


As dilataes que acontecem nos slidos so analisadas em trs perspectivas: 1 dimenso (Linear), 2 dimenses (Superficial) e 3 dimenses (Volumtrica).

DILATAO LINEAR

Considere uma haste de comprimento L0 a uma temperatura i e de seco transversal desprezvel. Se aquecermos a barra at a temperatura f , notaremos que a barra ganhar algum comprimento, aumentando seu comprimento total para o valor L.

156

FSICA 3

DILATAO TRMICA

EXERCCIO RESOLVIDO
1. Determine a variao de comprimento de uma haste de metal com = 1,5.104, e 20m, quando ela varia 55C. Soluo:

A diferena L = L - L0 denominada alongamento, e corresponde ao intervalo trmico . Pois, conforme o intervalo de temperatura alterado, a dilatao da barra tambm muda. Experimentalmente, percebe-se que L e so diretamente proporcionais. Com isso, h a necessidade do uso de uma constante de proporcionalidade, que chamaremos de coeficiente de dilatao linear e a representaremos pela letra , cuja unidade C-1. A equao que relaciona a dilatao linear com a variao da temperatura :

DILATAO SUPERFICIAL

Agora, passaremos a adotar a dilatao em duas dimenses. Para isto, pensaremos em uma placa feita de um material istropo de espessura desprezvel, somente largura e profundidade interessam. Considere uma placa que tenha rea de superfcie S0 a uma temperatura 0. Se a temperatura passar para , a rea da superfcie passar ao valor S. A diferena S = S - S0 chamada dilatao superficial para a variao de temperatura = 0.

e o comprimeto final da barra dado por:

A experincia mostra que diferentes materiais, submetidos a mesmas variaes de temperaturas podem dilatar em valores diferentes. Desse modo, cada material dilata de acordo com suas caractersticas prprias. Isso se deve ao fato de que cada material possui um valor para o coeficiente de dilatao. Quanto maior o valor deste, maior ser a dilatao do corpo. O homem faz uso destas diferentes dilataes para mesmas variaes de temperaturas, como, por exemplo, na fabricao das lminas bimetlicas, muito usadas como termostatos em geladeiras. Estas lminas so formadas pela unio lateral de dois metais diferentes com coeficientes de dilatao diferentes. Desse modo, quando submetidas a variaes de temperatura, as lminas tero dilataes diferentes e se flexionam para baixo ou para cima.

A diferena V = V - V0 chamada dilatao volumtrica para a variao de temperatura = 0. O coeficiente de proporcionalidade , nesse caso, indicado por , sendo denominado coeficiente de dilatao volumtrica. A equao que relaciona a dilatao volumtrica com a variao da temperatura :

e o volume final do bloco dado por:

Relao entre e Como sabemos que a dilatao linear ocorre apenas em uma dimenso e a superficial em duas dimenses, podemos fazer a seguinte relao: o coeficiente de dilatao superficial o dobro do coeficiente de dilatao linear.

EXERCCIO RESOLVIDO
2. Um engenheiro encomenda uma laje pr-moldada quadrada de 15m de lado. A laje foi construda em Cuiab a 30C, ao ser transportada para Londrina, durante a viagem a temperatura chegou a 39C, mas na hora de executar a obra a temperatura era de 20C, determine o quanto de espao a laje chegou menor para a execuo da obra. Considere = 2.105 C1. Soluo: A variao da rea da depende da variao da temperatura. Utilizando a equao da dilatao superficial e lembrando que o coeficiente de dilatao superficial o dobro do linear .

Como evidencia a figura acima, na temperatura ambiente a lmina bimetlica estava totalmente horizontal. Com o aquecimento, a lmina do metal A, por ter maior , dilata mais que a lmina B, que tem menor . Com isso a lmina A tensiona a lmina B para baixo e o conjunto torna-se recurvo. Se, pelo contrrio, a lmina B tivesse maior coeficiente de dilatao que a A, o sistema se curvaria para cima.

157

FSICA 3

DILATAO TRMICA

DILATAO DE CORPO OCO OU COM FURO


Passaremos a analisar o que ocorre na dilatao de um corpo oco (uma panela, por exemplo) ou de um furo em uma chapa ou parede, quando submetido variao de temperatura. Todo corpo oco (ou dotado de furo, ou rachadura) ao se dilatar, comporta-se como se fosse macio. Lembre-se que o processo de dilatao ocorre devido ao fato das partculas estarem com maior energia de vibrao, necessitando, portanto de um maior espao fsico para se acomodar.

O sinal negativo indica que a laje teve sua superfcie diminuda.

DILATAO VOLUMTRICA

Vejamos agora a dilatao em trs dimenses, ou seja, a dilatao volumtrica. Para isto, consideremos um bloco feito de um material istropo e que tenha, temperatura 0, o volume V0. Se a temperatura aumentar para , o bloco aumenta seu volume para V.

EXERCCIO RESOLVIDO
4. Joo chefe de uma oficina mecnica precisa encaixar um eixo de ao em um anel de lato. A temperatura ambiente, o dimetro do eixo maior que o do orifcio do anel. Sabe-se que o coeficiente de dilatao trmica do lato maior que o do ao. Diante disso, so sugeridos a Joo alguns procedimentos descritos nas alternativas a seguir para encaixar o eixo no anel. Assinale a alternativa que apresenta um procedimento que NO permite esse encaixe. a) Resfriar apenas o eixo. c) Resfriar o eixo e o anel. b) Aquecer apenas o anel. d) Aquecer o eixo e o anel. Soluo: Na alternativa a, resfriando o eixo, ele fica com menor dimetro que o anel, portanto funciona. Na alternativa b, se o anel for aquecido ele dilata e o eixo passa por ele. Na alternativa c, se resfriar o eixo e o anel, ambos vo contrair, mas o anel s contrai mais porque ele tem maior coeficiente de dilatao trmica, portanto o procedimento no permitido.

A diferena V = V - V0 chamada dilatao volumtrica para a variao de temperatura = 0. O coeficiente de proporcionalidade , nesse caso, indicado por , sendo denominado coeficiente de dilatao volumtrica. A equao que relaciona a dilatao volumtrica com a variao da temperatura :

e o volume final do bloco dado por:

Relao entre , e A relao entre os coeficientes de dilatao :

DILATAO DOS LQUIDOS, DILATAO REAL E APARENTE


Os lquidos so desprovidos de forma prpria, assumindo sempre o volume do recipiente que esto ocupando. Devido a esse fato, o estudo de dilatao dos lquidos fica um pouco mais complexo, pois devemos levar em considerao a dilatao do recipiente no qual esto colocados. Considere um balo de vidro comum com um certo lquido em seu interior. Inicialmente o nvel indicado 20. Suponha que num dado momento, o sistema seja levado presena de uma fonte trmica, como por exemplo, a chama de um fogo. Como o recipiente est mais prximo da fonte trmica do que o lquido, o recipiente se dilatar antes do lquido e em consequncia, o nvel do lquido abaixar at aproximadamente o nvel 0; posteriormente, quando todo conjunto estiver aquecido e dilatado, o nvel do lquido sobe, ultrapassando o nvel 20 e atingindo o nvel 60.

Lembrando que o coeficiente de dilatao tem a unidade C1, independentemente de ser linear, superficial ou volumtrico.

EXERCCIO RESOLVIDO
3. Um fabricante de sabo tem um caminho de 20m3 de capacidade e quer transportar o maior numero de pedras de sabo de 2.103m3, com = 2.102 C1, e sabendo que dentro do caminho a temperatura pode variar 35C, determine o maior numero de blocos de sabo que podem ser transportados. Soluo: Como a temperatura aumenta de 35C, cada barra de sabo dilatar, sendo assim vamos calcular o volume final de cada barra.

Desse modo, o nmero mximo de blocos de sabo que o caminho poder transportar de 20/0.0034 = 5882 blocos.

158

FSICA 3
Nesta experincia, o nvel do liquido desceu de 20 para 0, e depois sobe de 0 para 60. Entretanto, um observador que considerar apenas a situao inicial e a final, sem ter acompanhado o transcorrer do experimento, tem a impresso de que o nvel do lquido passou de 20 para 60. A sequncia de eventos que ocorreram De 20 at 60: corresponde dilatao aparente do lquido e leva em considerao a dilatao do recipiente. De 0 at 60: corresponde dilatao real do lquido, sem levar em conta a dilatao do recipiente. De 20 a 0: corresponde dilatao do recipiente. Assim, podemos definir dois tipos de dilatao e consequentemente dois coeficientes de dilatao: o coeficiente de dilatao real R e o coeficiente de dilatao aparente A. O coeficiente de dilatao real leva em conta s o lquido e caracterstico somente dele, enquanto o de dilatao aparente leva em conta lquido e frasco e relativo ao recipiente no qual o lquido est contido. Por exemplo, podemos ter quantidades iguais de gasolina em dois recipientes iguais, um recipiente de metal e outro de vidro. Se submetermos os dois recipientes, com gasolina, ao mesmo aquecimento, a dilatao real da gasolina em ambos os recipientes ser a mesma, enquanto que a dilatao aparente da gasolina ser diferente para cada um dos recipientes, pois a dilatao da gasolina depender da dilatao do recipiente, que no caso diferente no vidro e metal. No caso, o vidro vai se dilatar menos e o metal mais, fazendo com que a dilatao aparente da gasolina seja menor no metal e maior no vidro.

DILATAO TRMICA
_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 4. Voc convidado a projetar uma ponte metlica, cujo comprimento ser de 2,0 km. Considerando os efeitos de contrao e expanso trmica para temperaturas no intervalo de - 40 F a 110 F e que o coeficiente de dilatao linear do metal de 1,2.106 C1, qual a mxima variao esperada no comprimento da ponte? (O coeficiente de dilatao linear constante no intervalo de temperatura considerado). a) 9,3 m c) 3,0 m e) 6,5 m b) 2,0 m d) 0,93 m 5. Uma placa de alumnio tem um grande orifcio circular no qual foi colocado um pino, tambm de alumnio, com grande folga. O pino e a placa so aquecidos de 500 C, simultaneamente. Podemos afirmar que a) A folga ir aumentar, pois o pino ao ser aquecido ir contrair-se. b) A folga diminuir, pois ao aquecermos a chapa a rea do orifcio diminui. c) A folga diminuir, pois o pino se dilata muito mais que o orifcio. d) A folga ir aumentar, pois o dimetro do orifcio aumenta mais que o dimetro do pino. e) A folga diminuir, pois o pino se dilata, e a rea do orifcio no se altera. 6. Uma chapa de alumnio ( = 2,2.105 C1), inicialmente a 20 C, utilizada numa tarefa domstica no interior de um forno aquecido a 270 C. Aps o equilbrio trmico, sua dilatao superficial, em relao rea inicial, foi de: a) 0,55% c) 1,65% e) 4,4% b) 1,1% d) 2,2% 7. Uma chapa de zinco, cujo coeficiente de dilatao linear 25.106 C1, sofre elevao de 10C na sua temperatura. Verificase que a rea da chapa aumenta de 2,0 cm2. Nessas condies, a rea inicial da chapa mede, em cm2. a) 2,0.102 c) 4,0.103 e) 8,0.104 2 4 b) 8,0.10 d) 2,0.10 8. O coeficiente de dilatao trmica do alumnio (Al) , aproximadamente, duas vezes o coeficiente de dilatao trmica do ferro (Fe). Imagine duas peas onde um anel feito de um desses metais envolve um disco feito do outro. temperatura ambiente, os discos esto presos aos anis. Se as duas peas forem aquecidas uniformemente, correto afirmar que: a) Apenas o disco de Al se soltar do anel de Fe. b) Apenas o disco de Fe se soltar do anel de Al. c) Os dois discos se soltaro dos respectivos anis. d) Os discos no se soltaro dos anis.

EXERCCIOS
1. Na temperatura de 0C, um fio de cobre mede 100.000 m. Seu comprimento passa a ser de 100.068 m quando a temperatura atinge 40C. Qual o valor do coeficiente de dilatao linear do cobre? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. Duas barras de comprimentos L e 2L, a 0C, e coeficientes de dilatao linear 1 e 2, respectivamente, so emendadas, constituindo uma nica barra de comprimento 3L. Qual o coeficiente de dilatao linear mdio da barra resultante? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 3. O coeficiente de dilatao linear do alumnio 2,2.105 C-1. Um cubo de alumnio com volume de 5 litros aquecido de 40F at 76F. Qual a variao aproximada do volume desse cubo?

159

FSICA 3
9. O volume de um bloco metlico sofre um aumento de 0,6% quando sua temperatura varia de 200 C. O coeficiente de dilatao linear mdio desse metal, em C1, vale: a) 1,0.105 d) 3,0.104 5 b) 3,0.10 e) 3,0.103 4 c) 1,0.10 10. Uma barra metlica, ao variar sua temperatura de 80 C, aumenta seu comprimento de 0,16%. O coeficiente de dilatao volumtrico do material dessa barra, em C 1, : a) 6,0.105 d) 3,0.105 5 b) 5,0.10 e) 2,0.105 5 c) 4,0.10 11. Quando introduzimos um termmetro de mercrio em um recipiente contendo gua a uma temperatura significativamente superior temperatura inicial do termmetro, percebemos, de imediato, que ocorre uma diminuio da coluna de mercrio antes de seu esperado aumento. Explique este fato. _________________________________________________ _________________________________________________ _________________________________________________ 12. Um bloco macio de zinco tem forma de cubo, com aresta de 20cm a 50C. O coeficiente de dilatao linear mdio do zinco 25.106 C1. O valor, em cm3, que mais se aproxima do volume desse cubo a uma temperatura de -50C : a) 8060 c) 7980 e) 7700 b) 8000 d) 7940

GASES E TERMODINMICA
As partculas s interagem por ocasio das colises, supostas de curta durao. Para analisar o comportamento trmico dos gases do ponto de vista macroscpico consideramos, em geral, as seguintes variveis de estado: presso, temperatura e volume. Dizemos que a massa gasosa sofre uma transformao, passando de um estado inicial de equilbrio para um estado final de equilbrio, quando ocorre variao de pelo menos duas das variveis de estado acima apontadas. Contudo, se notarmos alterao em uma varivel de estado, j podemos concluir que houve transformao, apesar das variaes ocorrerem no mnimo, aos pares como citado anteriormente.

EQUAO GERAL DOS GASES


Imaginemos que uma certa massa de um gs esteja num estado caracterizado pelos valores de presso, volume e temperatura, respectivamente, p0 , V0 e T0. Ao sofrer um transformao, vamos admitir que as variveis de estado passem para os valores p, V e T. Verificamos que os valores iniciais e finais das variveis de estado se relacionam pela denominada Lei Geral dos Gases:

Nas equaes envolvendo gases a temperatura deve ser sempre usada em Kelvin.

TRANSFORMAES FUNDAMENTAIS
TRANSFORMAO ISOTRMICA
Uma transformao dita isotrmica quando ocorre a temperatura constante, isto , quando, ao passar do estado inicial de equilbrio para o estado final de equilbrio, a massa gasosa mantm a temperatura fixa. Assim, T = T0. Utilizando esta considerao e substituindo-a na equao geral dos gases, obtemos:

UNIDADE 6 GASES E TERMODINMICA


Gases so fluidos desprovidos de forma prpria, facilmente compressveis e dotados de expansibilidade, ocupando sempre a capacidade e volume total dos recipientes que os contm. O estudo de vrios gases concluiu que eles apresentam muitas propriedades fsicas em comum, independentemente de sua natureza qumica. Foi criado um modelo de gs perfeito ou gs ideal, cujo comportamento, teoricamente, se aproxima do observado na maioria dos gases reais. As partculas constituintes de um gs movem-se com muita liberdade, mantendo uma grande distncia mdia entre si. Isto significa que a quase totalidade do volume de um gs corresponde a vazios, e muito pequena a frao correspondente ao volume das molculas. O modelo de gs ideal segue o seguinte modelo: As partculas constituintes do gs so consideradas puntiformes, e obedecem s leis da dinmica do ponto material. Todas as colises entre as molculas do gs, ou entre as molculas do gs e as paredes do recipiente, so perfeitamente elsticas.

A equao acima constitui a denominada Lei de Boyle-Mariotte.

EXERCCIO RESOLVIDO
1. Um gs dentro de uma seringa est ocupando 5ml uma presso de 1 atm, determine qual o volume final se o gs for submetido uma presso de 4 atm. Considere que a temperatura tenha se mantido constante durante a transformao. Soluo:

TRANSFORMAO ISOBRICA

Uma transformao dita isobrica quando, ao passar de um ponto inicial de equilbrio para um ponto final, a presso do gs no se modifica, permanecendo constante. Assim p = p0.

160

FSICA 3
Utilizando esta considerao e substituindo-a na equao geral dos gases, obtemos:

GASES E TERMODINMICA
Nessa frmula, a constante de proporcionalidade R denominada constante universal dos gases perfeitos e seu valor s depende das unidades utilizadas para medir as variveis de estado p, V e T.

Esta equao constitui a Primeira lei de Gay-Lussac.

TRANSFORMAO ISOMTRICA OU ISOCRICA

Uma transformao dita isomtrica ou isocrica quando, ao passar de um estado de equilbrio inicial para um final, o volume do gs no se modifica. Assim V = V0. Utilizando esta considerao e substituindo-a na equao geral dos gases, obtemos:

TRABALHO NAS TRANSFORMAES GASOSAS ()


Certa massa de gs perfeito est no interior de um cilindro cujo mbolo se movimenta livremente sem atrito e sobre o qual mantido um peso, de modo que a presso sobre ele se mantenha constante. Ao colocar esse sistema na presena de uma fonte trmica, o gs recebe calor e desloca lentamente o mbolo para cima, conforme a figura abaixo.

Esta equao constitui a Segunda lei de Gay-Lussac.

EXERCCIO RESOLVIDO
2. Um balo cheio de Hlio sai da superfcie da terra 27C com uma presso de 1 atm, sabendo que a 150m de altura a presso de 0,5 atm determine a temperatura do gs. Considere que o volume do balo no se altera no processo. Soluo: Como j foi dito neste captulo, devemos trabalhar apenas com temperaturas na escala Kelvin. Lembrando que podemos fazer a converso atravs da equao K = C + 273. Quando o fenmeno observado ocorre dizemos que o gs realizou um trabalho sobre o meio, pois ocorreu expanso do volume de gs no interior de cilindro, e seu valor ser positivo ( > 0); se, pelo contrrio, o gs for comprimido, com diminuio do volume contido no interior do cilindro, dizemos que o meio realizou um trabalho sobre o gs e este tem valor negativo ( < 0). A equao para o clculo do valor do trabalho realizado ou recebido pelo gs presso constante tem a forma:

TRANSFORMAO ADIABTICA

A transformao dita adiabtica quando, ao passar de um ponto inicial de equilbrio a um ponto final de equilbrio, no existe troca de calor entre o sistema e o meio exterior. Uma transformao rpida pode ser considerada adiabtica. importante perceber que uma transformao sem troca de calor, isso no significa que a temperatura no pode alterar-se, ou seja, em uma transformao adiabtica a temperatura pode variar.

EQUAO DE CLAPEYRON
De acordo com a Lei Geral dos Gases, a relao pV/T constante para determinada massa de um gs ideal. O cientista frnces Clapeyron verificou que essa relao diretamente proporcional ao nmero de mols n do gs. Essa relao de proporcionalidade constitui a Equao de Clapeyron:

Em que representa o trabalho (dado sempre em joules), p a presso, que neste caso deve ter valor constante, e V a variao do volume do gs. Perceba que se no ocorrer variao de volume, tambm no h trabalho! O clculo do trabalho numa transformao qualquer, onde no necessariamente a presso seja mantida constante, possvel atravs do clculo da rea abaixo da curva no grfico p x V, que numericamente igual ao trabalho envolvido no processo.

161

FSICA 3

GASES E TERMODINMICA

1 PRINCPIO DA TERMODINMICA
Durante uma transformao, o gs pode trocar energia com o meio sob duas formas: calor e trabalho. Como resultado dessas trocas energticas, a energia interna do gs pode aumentar, diminuir ou permanecer constante. O primeiro princpio da termodinmica pode ser enunciado como: A variao da energia interna U de um sistema expressa por meio da diferena entre a quantidade de calor Q trocada com o ambiente e o trabalho realizado durante a transformao.

TRANSFORMAO ADIABTICA

A transformao dita adiabtica quando, ao passar de um ponto inicial de equilbrio a um ponto final de equilbrio, no existe troca de calor entre o sistema e o meio exterior Q = 0. Uma transformao rpida pode ser considerada adiabtica. Neste caso, a equao do primeiro princpio fica:

2 PRINCPIO DA TERMODINMICA
impossvel a construo de um dispositivo, que por si s, isto , sem a interveno do meio exterior, consiga transformar integralmente em trabalho o calor absorvido de uma fonte a uma dada temperatura uniforme, nem possvel a construo de outro dispositivo que transfira, sem a interveno do meio externo, calor de um corpo mais frio para outro corpo mais quente. Este enunciado foi proposto pelo fsico francs Carnot. Ele tambm demonstrou que o maior rendimento possvel para uma mquina trmica, operando entre as temperaturas T2 (fonte fria) e T1 (fonte quente), seria o de uma mquina que realizasse um ciclo terico constitudo por duas transformaes isotrmicas e duas adiabticas. Esse ciclo recebe o nome de ciclo de Carnot e o rendimento pode ser calculado atravs da equao:

Para a aplicao da equao acima, necessrio respeitar as convenes de sinais, expressas na tabela:

CICLO DE TRANSFORMAES

Suponha agora que o sistema gasoso sofra uma sequncia de transformaes, alcanando um estado final de equilbrio, coincidente com o estado inicial. Conforme a figura abaixo.

Observe que o rendimento de uma mquina que opera no ciclo de Carnot depende exclusivamente das temperaturas da fonte quente e fria.

Dizemos que o sistema percorre um ciclo de transformaes. Porm, lembrando que a energia interna inicial igual final (pois as temperaturas inicial e final so iguais), a variao de energia interna nula e o trabalho realizado igual quantidade de calor trocada. Ao realizar um ciclo em sentido horrio, no diagrama p x V, o gs converte calor em trabalho e ( > 0). Ao realizar um ciclo em sentido anti-horrio, no diagrama p x V, o gs converte trabalho em calor e ( < 0). Mquinas trmicas: so dispositivos que transformam calor em trabalho mecnico. O motor de exploso dos carros um exemplo de mquina trmica. Estas mquinas trabalham em ciclos, ou seja, retornam periodicamente s condies iniciais de cada ciclo. O rendimento de uma mquina trmica uma grandeza adimensional e calculado atravs da razo entre o trabalho til u e o calor total fornecido mquina Qt.

EXERCCIOS
1. O mbolo de um cilindro varia de 5,0 cm sua posio e o gs ideal no interior do cilindro sofre uma expanso isobrica, sob presso atmosfrica. O que ocorre com a temperatura do gs durante essa transformao termodinmica? Qual o valor do trabalho W realizado sobre o sistema pela atmosfera, durante a expanso? Dados: presso atmosfrica: 105 N/m2, rea da base do mbolo: 10 cm2. a) A temperatura aumenta; $W$ = - 5,0 J. b) A temperatura diminui; $W$ = 5,0 J. c) A temperatura aumenta; $W$ = - 5,0.10-2 J. d) A temperatura no muda; $W$ = 5,0.10-2 J. e) A temperatura diminui; $W$ = -0,5 J. 2. A primeira lei da termodinmica diz respeito : a) Dilatao trmica. b) Conservao da massa. c) Conservao da quantidade de movimento. d) Conservao da energia. e) Irreversibilidade do tempo.

162

FSICA 3
3. A Primeira Lei da Termodinmica estabelece que o aumento U da energia interna de um sistema dado por

GASES E TERMODINMICA
7.A figura a seguir representa o grfico presso versus volume da expanso isotrmica de um gs perfeito.

U = Q - , onde Q o calor recebido pelo sistema, e o trabalho que esse sistema realiza. Se um gs real sofre uma compresso adiabtica, ento, a) Q = U. b) Q = . c) = 0. d) Q = 0. e) U = 0. 4. Como consequncia da compresso adiabtica sofrida por um gs, pode-se afirmar que a) A densidade do gs aumenta, e sua temperatura diminui. b) A densidade do gs e sua temperatura diminuem. c) A densidade do gs aumenta, e sua temperatura permanece constante. d) A densidade do gs e sua temperatura aumentam. e) A densidade do gs e sua temperatura permanecem constantes. 5, Considere as proposies a seguir sobre transformaes gasosas. I.Numa expanso isotrmica de um gs perfeito, sua presso aumenta. II.Numa compresso isobrica de um gs perfeito, sua temperatura absoluta aumenta. III.Numa expanso adiabtica de um gs perfeito, sua temperatura absoluta diminui. Pode-se afirmar que apenas a) I correta. b) II correta. c) III correta. d) I e II so corretas. e) II e III so corretas. 6. Um corpo recebe 40 Joules de calor de um outro corpo e rejeita 10 Joules para um ambiente. Simultaneamente, o corpo realiza um trabalho de 200 Joules. Estabelea, baseado na primeira lei da termodinmica, o que acontece com a temperatura do corpo em estudo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

correto: a) A curva apresentada uma isobrica. b) A rea sombreada do grfico representa numericamente o trabalho realizado pelo gs ao se expandir. c) A rea sombreada numericamente igual ao trabalho realizado sobre o gs para sua expanso. d) A curva do grfico uma isocrica. 8. Qual dos ciclos a seguir representa as transformaes isobrica, isotrmica e isomtrica, respectivamente?

9. Um gs ideal, confinado no interior de um pisto com mbolo mvel, submetido a uma transformao na qual seu volume reduzido quarta parte do seu volume inicial, em um intervalo de tempo muito curto. Tratando-se de uma transformao muito rpida, no h tempo para a troca de calor entre o gs e o meio exterior. Pode-se afirmar que a transformao a) isobrica, e a temperatura final do gs maior que a inicial. b) isotrmica, e a presso final do gs maior que a inicial. c) adiabtica, e a temperatura final do gs maior que a inicial. d) isobrica, e a energia interna final do gs menor que a inicial. e) adiabtica, e a energia interna final do gs menor que a inicial.

163

GABARITOS

GABARITOS
UNIDADE 1
1. 50C 2. 370K 3. -328F 4. -40 5. 85C e 185F 6. d 7. d 8. e 9. 120A 10. 1,944mm

10. e 13. b

11. 0,22 14. a

12. 800

15. A temperatura da sala no ira se alterar pois o congelador tira calor do seu atrio e joga pra fora da sala, sendo assim a quantidade de calor que ele consegue retirar, ele mesmo recebe. 16. a) 10 b) 5

UNIDADE 4
1. Diminuir a presso sobre a gua, dessa forma as moleculas de gua precisariam de menos fora para se libertarem da condio lquida. 2. Ele cozinha mais rpido, visto que dentro da panela a presso maior que em uma panela comum, portanto, a probabilidade de colises entre as moleculas maior, logo, as reaes ocorrem mais rapidamente. 3. d 6. b 7. a) 0,5 8. a b) 80 c) 100 10. a 11. c 4. a 5. Todas so corretas.

UNIDADE 2
1. a 2. d 3. Q = 28800 cal; 2 cal / s; Sim; 1,152.105 cal / C. 4. e 5. 50 cal 6. Q =2 0.10 Kcal e 21,5 Kcal 7. 100g 8. 50C 9. Aproximadamente 56g 10. 9L e 1L

9. b

UNIDADE 5
1. 1,7.105 C1 3. 0,0066 7. b 4. b 8. b 2. (1 + 22)/3 5. d 9. b 6. a 10. a

11. E devido a dilatao da estrutura do termmetro, do bulbo do termmetro. 12. d

UNIDADE 6
1. a 3. d 5. c 6. O corpo esfria, Q < 0 7. b 9. e 8. e 2. d 4. a

UNIDADE 3
1. b 4. d 7. c 2. b 5. c 8. e 3. d 6. d

9. Pela impossibilidade de propagao de calor de qualquer maneira (irradiao, conduo e conveco).

164

GEOGRAFIA DO BRASIL
01
O TERRITRIO BRASILEIRO
pg

167

Brasil - posio geogrfica, limites e pontos ............................................. 167 Brasil - zonas de temperatura ................ 167 Fusos horrios ............................................ 168 Diviso poltica do Brasil ......................... 168 Regionalizao do Brasil ............................. 168 Exerccios ..................................................... 169

181 Disponibilidade de gua ........................... 181 Bacias hidrogrficas do Brasil ............... 182 Bacias secundrias do Brasil ................. 183 O litoral brasileiro ..................................... 183 Exerccios ..................................................... 183

04

HIDROGRAFIA

pg

171 A estrutura da terra ................................. 171 Ciclo das rochas ......................................... 172 Exerccios ..................................................... 173

02

GEOLOGIA

pg

03

ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA

pg

186 Tempo e clima ............................................. 186 Elementos do clima ................................... 187 Fatores do clima ......................................... 187 Conceitos importantes em climatologia ............................................. 188 Efeito estufa ................................................. 188 Ilhas de calor ................................................ 189 Exerccios ..................................................... 189

05

INTRODUO CLIMATOLOGIA

pg

176

Tipos de rochas e estrutura geolgica ................................... 176 Os agentes formadores do relevo terrestre ....................................... 176 O relevo do Brasil ................................... 178 Exerccios ..................................................... 179

191 Massas de ar .............................................. 191 Classificao climtica ............................. 192 Exerccios ..................................................... 192 Gabaritos ..................................................... 195

06

CLIMAS DO BRASIL

pg

O TERRITRIO BRASILEIRO

UNIDADE 1 O TERRITRIO BRASILEIRO


Com uma rea total de 8.514.876 km o Brasil coloca-se entre os maiores pases do mundo, sendo o quarto em terras continentais e o quinto em terras descontnuas.

OS MAIORES PASES DO MUNDO 1. Federao Russa 2. Canad 3. Repblica Popular da China 4. Estados Unidos da Amrica* 5. Repblica Federativa do Brasil 6. Comunidade da Austrlia 7. Repblica da ndia 8. Repblica Argentina 9. Repblica Democrtica do Sudo 10. Repblica Islmica da Arglia

REA EM KM2 17.075.400 9.970.610 9.552.900 9.372.614 8.514.876 7.662.300 3.287.782 2.780.092 2.505.813 2.381.741

Cerca de 93% do territrio brasileiro est inserido no hemisfrio Sul (austral/meridional) e apenas 7% no hemisfrio Norte (boreal/ setentrional). Em relao a Greenwich, todo o Pas pertence ao hemisfrio ocidental ou oeste. No aspecto continental, o Brasil est localizado na poro Centro-Oriental da Amrica do Sul, fazendo fronteira com quase todos os pases do continente, menos Equador e Chile. Apresenta extenso litoral, 7.408 km (9.198 km se contadas todas as salincias e reentrncias), banhado pelas guas do mais importante e navegado oceano, o Atlntico, desde o Cabo Orange, na foz do Rio Oiapoque, no Amap, at a foz do Arroio Chu no Rio Grande do Sul.

PONTOS EXTREMOS
Norte Nascente do rio Ail 516'19" N Na serra do Cabura, fronteira de RR com a Guiana. Sul Uma curva do Arroio Chu 3345'09" S Divisa do RS com o Uruguai. Leste Ponta Seixas no Cabo Branco 3445'54" L No litoral da PB. Oeste Nascente do Rio Mo 7359'32" O Serra da Contamana ou Divisor, na fronteira do AC com o Peru. Ao considerarmos as coordenadas geogrficas dos pontos extremos do pas, percebemos que as distncias norte-sul e leste-oeste se equivalem, sendo praticamente iguais. Distncia norte-sul 39 01' 28" 4.320 km. Provoca diferentes zonas climatobotnicas. Distncia leste-oeste 39 13' 38" 4.328 km. Provoca diferentes fusos horrios (3 fusos). O territrio brasileiro atravessado por dois importantes paralelos: O Equador e o Trpico de Capricrnio. O Equador corta o Norte do pas, cruzando terras de quatro Estados brasileiros: Amazonas, Par, Roraima e Amap. Assim, o Brasil possui terras nos dois hemisfrios, Norte e Sul, estando a maior parte, cerca de 93% do seu territrio, no Hemisfrio Sul.

*Nesta rea esto acrescentados Alasca e Hava.

BRASIL - POSIO GEOGRFICA, LIMITES E PONTOS

BRASIL - ZONAS DE TEMPERATURA


O Trpico de Capricrnio cruza o Sul do pas, atravessando terras dos Estados de So Paulo, Paran e Mato Grosso do Sul, fazendo com que o Brasil tenha terras na Zona Intertropical (92%) e a Zona Temperada (8%). Desta forma o Brasil se coloca como um pas tipicamente tropical, sendo o maior pas tropical do mundo.

167

GEOGRAFIA DO BRASIL

O TERRITRIO BRASILEIRO

DIVISO POLTICA DO BRASIL FUSOS HORRIOS


Devido grande extenso Leste-Oeste, o Brasil atravessado por quatro fusos horrios, porm, de acordo com a Lei N 11.662, de 24/04/2008 que modifica a quantidade de fusos horrios no Brasil, o 4 fuso (Oeste) brasileiro deixa de existir. Nesse sentido, o Brasil passa a ter somente 3 fusos horrios. Todos os fusos horrios do Brasil possuem horas atrasadas em relao a Greenwich, o que determinado pelo fato de estar o pas totalmente situado a Oeste de Greenwich ou Londres (Hemisfrio Ocidental). 1 Fuso Horrio Brasileiro: contm as ilhas ocenicas do pas (arquiplago de Fernando de Noronha, Atol das Rocas, Penedos de S. Pedro e S. Paulo, Trindade e Martim Vaz). o menos importante, por abranger uma diminuta rea e muito pequena populao. o segundo fuso a Oeste de Greenwich, estando, portanto, duas horas atrasado em relao ao meridiano principal. 2 Fuso Horrio Brasileiro: abrange todos os estados da regio Nordeste, Sudeste, Sul, alm do Distrito Federal, Gois, Tocantins, Amap e todo o estado do Par. 3 Fuso Horrio Brasileiro: compreende os estados de Roraima, Rondnia, Mato Grosso, Mato Grosso do Sul, Amazonas e todo o estado do Acre. O Brasil uma Repblica Federativa, composto por 26 estados e o Distrito Federal. Possui 17 estados litorneos e 9 interioranos. Dos estados litorneos o Piau possui o menor litoral e a Bahia, o maior. Entre os estados litorneos, possuem capitaisl interioranas: Piau Teresina, So Paulo So Paulo, Paran Curitiba e Rio Grande do Sul Porto Alegre. So Lus no Maranho, Vitria no Esprito Santo e Florianpolis em Santa Catarina e os demais estados litorneos possuem capitais estaduais insulares.

REGIONALIZAO DO BRASIL
DIVISO REGIONAL OFICIAL DO BRASIL
Essa regionalizao divide o territrio brasileiro em cinco macrorregies. Foi elaborada pelo Instituto Brasileiro de Geografia e Estatstica IBGE na dcada de 40, sofrendo algumas modificaes de critrios e, conseqentemente, limites, ao longo do tempo. Na ltima reviso feita pelo IBGE, em 1988, foram firmadas como critrios principais as condies econmicas, demogrficas e naturais, sempre respeitando os limites territoriais dos estados. As regies so compostas da seguinte forma: Regio Norte: formada por 7 estados: Amazonas, Par, Roraima, Amap, Rondnia, Tocantins e Acre. Regio Nordeste: formada por 9 estados: Maranho, Bahia, Piau, Cear, Rio Grande do Norte, Paraba, Pernambuco, Alagoas e Sergipe. O arquiplago de Fernando de Noronha pertence politicamente ao estado de Pernambuco. Regio Centro Oeste: formada pelo Distrito Federal, onde se encontra a capital Braslia e 3 estados: Gois, Mato Grosso e Mato Grosso do Sul.

168

GEOGRAFIA DO BRASIL
Regio Sudeste: formada por 4 estados: Minas Gerais, Esprito Santo, Rio de Janeiro e So Paulo. Regio Sul: formada por 3 estados: Paran, Santa Catarina e Rio Grande do Sul.

O TERRITRIO BRASILEIRO
Amaznia: abrange cerca de 5.000.000 km2 e coincide com a rea de atuao da SUDAM (Superintendncia para o Desenvolvimento da Amaznia). Pode ser caracterizada pelo predomnio do clima equatorial da floresta amaznica e da bacia Amaznica. Sua populao pequena e sua densidade muito baixa. A economia baseia-se em extrativismo vegetal e mineral e na agropecuria (setor primrio). Assim, a Amaznia representa a regio que durante sculos foi deixada de lado, embora nos dias de hoje sendo intensamente ocupada num processo de destruio de suas matas. Nordeste: abrange cerca de 1.500.000 km2 e de modo geral coincide com a rea de atuao da SUDENE (Superintendncia de Desenvolvimento do Nordeste), compreendendo toda a regio Nordeste (exceto o Oeste do Maranho) e mais o Norte de Minas Gerais. Pode ser caracterizada pela semiaridez, pela repulso populacional, pelo antigo povoamento e pelos contrastes naturais e scio-econmicos, apresentando a seguinte diviso: Meio-Norte ou Nordeste Ocidental (Maranho e Piau) e Nordeste Oriental, subdividido em Serto, Agreste e Zona da Mata. O Nordeste representa a poro territorial de ocupao econmica mais antiga do pas. No passado j contou com a maioria da populao nacional, mas a partir do sculo XIX vem fornecendo grande nmero de migrantes para as demais regies. Centro-Sul: com cerca de 2.000.000km2, dois teros da populao do pas, o Centro-Sul abrange Gois, Mato Grosso do Sul e mais as regies Sudeste e Sul. a poro mais rica, desenvolvida, dinmica e urbanizada do pas, embora apresente diversos contrastes scio-econmicos em seu interior. Sua economia predominantemente industrial e agropecuria, possuindo tambm destaque na minerao e no setor tercirio (o mais desenvolvido do pas). O Centro-Sul a regio que mais se desenvolveu aps a independncia e a abolio da escravatura. a parte mais industrializada e urbanizada do Brasil.

REGIES GEOECONMICAS OU COMPLEXOS REGIONAIS

Alm da diviso regional oficial do IBGE, que obedece aos limites das unidades polticas, h uma outra, que foi criada pelo gegrafo do IBGE Pedro Pinchas Geiger em 1967. Nessa diviso baseada na formao histrica do Brasil e em seus aspectos econmicos, so definidas trs vastas regies cujos limites no coincidem com as fronteiras estaduais. Essas trs regies (Amaznia, Nordeste e Centro-Sul) e, de certo modo, ainda refletem a realidade scio-econmica atual do pas.

EXERCCIOS
1. Com relao ao Brasil assinale a(s ativa(s)CORRETA(s): (01) O Brasil ocupa a posio centro-ocidental da Amrica do Sul, limitando-se com todos os pases sul-americanos, com exceo do Equador e do Chile. (02) O Brasil possui quatro fusos horrios, todos atrasados em relao a Greenwich. (04) O Brasil pode ser considerado um pas tropical, uma vez que todo o seu territrio fica na poro intertropical do planeta. (08) O Brasil uma republica Federativa, constituda por 26 estados e um Distrito Federal onde est localizada a capital, Braslia. (16) O Brasil um pas de dimenso continental, cortado pelo Equador e pelo Trpico de Capricrnio. 2. Analise as afirmativas sobre a posio geogrfica do Brasil e marque (V) para as verdadeiras e (F) para as falsas. a) O territrio brasileiro est totalmente ao sul da linha do Equador, portanto, o pas pertence somente ao Hemisfrio meridional.

169

GEOGRAFIA DO BRASIL
b) Os extremos do territrio do Brasil no sentido leste-oeste so: Monte Cabura (Roraima) e Arroio Chu (Rio Grande do Sul). c) O Brasil pertence ao Hemisfrio ocidental, visto que o pas est situado a oeste do meridiano de Greenwich. d) O Trpico de Capricrnio corta o territrio brasileiro na sua poro sul. e) Cortado ao norte pela linha do Equador, o Brasil possui 7% do seu territrio no Hemisfrio setentrional e 93% no Hemisfrio meridional. 3.Assinale a alternativa INCORRETA. a) O Brasil est localizado na Amrica do Sul e banhado somente pelo oceano Atlntico. b) Dos pases sul-americanos, somente Chile e Equador no possuem fronteira o Brasil. c) A poro sul do Brasil cortada pela linha do Equador, mais precisamente nos estados Amap, Par, Roraima e Amazonas. d) Bolvia e Peru esto localizados a oeste do territrio brasileiro. e) O Trpico de Capricrnio corta o territrio brasileiro na poro sul. 4.(UNESP-2003) Em maio de 1969, foi aprovada a diviso regional do Brasil em cinco grandes regies, para fins estatsticos e didticos. Mais modernamente, o espao geogrfico brasileiro foi dividido em trs grandes unidades territoriais. Para estas duas divises, os critrios utilizados foram, respectivamente: a) Poltico-administrativo e econmico-fiscal. b) Geoeconmico e poltico-administrativo. c) Econmico e poltico-administrativo. d) Poltico-administrativo e geoeconmico. e) Administrativo e econmico-fiscal. 5. (FUVEST) Os Estados do Esprito Santo, Maranho e Paran pertencem, respectivamente, s seguintes regies brasileiras: a) Sudeste, Norte, Sul. b) Nordeste, Norte, Sudeste. c) Leste, Nordeste, Sudeste. d) Sudeste, Nordeste, Sul. e) Leste, Sudeste, Centro-Oeste. 6. Considerando os dados apresentados, identificar a alternativa que contm, corretamente indicadas, as regies brasileiras que substituem os nmeros 1, 2 e 3 na ordem da tabela.

O TERRITRIO BRASILEIRO
7. (UFC-CE) A regionalizao do espao brasileiro tem sido trabalhada pelo Instituto Brasileiro de Geografia e estatstica (IBGE) e por especialistas gegrafos que tem apresentado, ao longo dos anos, diferentes propostas de diviso regional. Sobre o referido assunto, responda aos itens a seguir. a )Cite a atual diviso regional adotada pelo IBGE. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Cite a diviso das regies geoeconmicas (ou complexos regionais) no Brasil (proposta do gegrafo Pedro Pinchas Geiger). _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ c) Sobre as divises regionais relacionadas nos itens anteriores (diviso regional adotada pelo IBGE e complexos regionais), aponte as diferenas bsicas quanto aos critrios para a delimitao do espao. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

a) Centro-Oeste, Nordeste e Sul. b) Centro-Oeste, Sudeste e Sul. c) Norte, Nordeste e Sudeste. d) Sudeste, Sul e Nordeste. e) Norte, Sudeste e Sul.

_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

170

GEOLOGIA

UNIDADE 2 GEOLOGIA
Os gelogos comparam nosso planeta a um organismo vivo. Sabe-se que ao longo da evoluo geolgica da Terra, os continentes mudaram sua posio e configurao, o relevo e a hidrografia foram se estruturando e remodelando e os ecossistemas sofreram grandes transformaes, acompanhando as mudanas climticas ocorridas ao longo de milhes de anos. Desde que a humanidade iniciou sua aventura, h cerca de 2 milhes de anos, o planeta no passou por mudanas naturais significativas. A histria geolgica da Terra tem aproximadamente 4,6 bilhes de anos, sendo, portanto muito mais longa do que o tempo de existncia da espcie humana. Foi esse o tempo necessrio para a atual configurao do meio natural, ou seja, do conjunto das rochas, solos, relevo, hidrografia, clima e vegetao da superfcie, que at o surgimento da sociedade moderna, principalmente com o incio da Revoluo Industrial, mantinha-se em pleno equilbrio. Bastaram pequenos intervalos, de sculos ou at mesmo dcadas para que a humanidade deixasse sua marca ntida pela superfcie terrestre, atravs de lastimveis impactos ambientais provocados por um processo desenvolvimentista a qualquer custo. Casos como o da bomba de Hiroshima e Nagasaki (Japo), do acidente nuclear de Chernobyl (Ucrnia) e do vazamento do petroleiro Exxon Valdez (Alaska-EUA) so algumas das agresses humanas provocadas em escala planetria. Mesmo diante de tal interferncia, a natureza segue o seu caminho, firme em seu propsito de manter uma dinmica constante na transformao do relevo terrestre, sempre em conjunto com todos os elementos do meio, conforme esquema abaixo, onde o homem, aparentemente de fora, parte integrante do conjunto, sendo apenas simbolizada a parte para demonstrar a sua importncia atual na transformao do meio, imprimindo aes e sofrendo consequncias diretas das mesmas.

O prximo quadro descreve os principais eventos geolgicos do planeta Terra (anlise-o e entenda-o). Em todo esse processo evolutivo, a crosta terrestre modificou-se constantemente, tanto nas formas de relevo quanto na composio e nos tipos de rochas.

A ESTRUTURA DA TERRA
A estrutura do planeta Terra pode ser comparada a um ovo: a casca, extremamente fina, seria a crosta terrestre, com uma espessura mdia de 25 km (por volta de 6 km em algumas partes do assoalho ocenico e de 70 km nas regies de cadeias de montanhas). O manto, com 2870 km de espessura, formado por magma pastoso e denso, em estado de fuso, e pode ser comparado clara do ovo. Por fim, o ncleo, comparvel gema, a parte mais densa do planeta, formada predominantemente por nquel e ferro, por isso tambm chamada de nife, e subdividida em duas partes: ncleo externo, em estado de fuso, e ncleo interno, que, apesar das elevadas temperaturas, est em estado slido devido grande depresso. Imaginemos que esse ovo foi cozido e, logo em seguida, teve sua casca rachada. Essa casca rachada representa as placas tectnicas e as rachaduras os limites entre essas placas. Observe a figura que mostra as camadas da terra, a primeira (a casca do ovo) chamada de litosfera e compreende as placas rgidas e mveis. Logo abaixo da litosfera, h outra camada chamada de astenosfera, que faz parte do manto superior e constituda por rochas parcialmente fundidas. Essas caractersticas do mobilidade s placas da litosfera.

171

GEOGRAFIA DO BRASIL

GEOLOGIA

DERIVA CONTINENTAL

Em 1910, Alfred Wegener, um meteorologista alem, ao observar a coincidncia dos contornos da Amrica do Sul e da frica, comeou a pensar na possibilidade da unio pretrita desses continentes. A partir dessas hipteses Wegener comeou a pesquisar sistematicamente como o objetivo de levantar dados que sustentassem a idia dessa unio e encontrou trs indcios: Rochas iguais nos dois continentes. Fsseis de animais extintos, da mesma espcie, foram encontrados em reas correspondentes dos dois litorais. Possibilidade de explicao de fatos antes inexplicveis, como a ocorrncia de carvo mineral na Groenlndia (o carvo se forma apenas em ambientes de florestas equatoriais). De acordo com sua teoria, os continentes (menos densos que o restante do material) flutuam sobre o material mais denso. Essa teoria teve a incorporao de outros elementos e na dcada de 1960, chegou-se a complexa teoria da Tectnica de Placas (veja a figura que est nesta aula). A atual teoria entende que, alm do dito anteriormente, a superfcie passa por um constante processo de destruio e construo dessas placas. O contato entre as placas pode ser de trs formas: Convergentes (onde as placas se chocam e surgem as maiores altitudes do planeta, ex: Cordilheira dos Andes), essas reas so conhecidas como zonas orogenticas (formadoras de montanhas); Divergentes (onde as placas esto se afastando e h a construo da superfcie, ex: Dorsal Atlntica); e Transformante (onde uma placa se desloca paralelamente a outra, ex: falha de Santo Andr nos EUA). Esse contedo ser discutido mais detalhadamente abaixo.

CICLO DAS ROCHAS


importante que entendamos que as rochas da superfcie terrestre so criadas em um processo cclico (descrito abaixo), e que a todo o momento elas esto sendo criadas e destrudas. Quanto gnese, as rochas podem ser classificadas como magmticas, sedimentares e metamrficas.

172

GEOGRAFIA DO BRASIL
Rochas magmticas: So originadas pela solidificao do magma. Quando o resfriamento do material magmtico se d na superfcie, as rochas so classificadas como magmticas extrusivas ou vulcnicas, o caso do basalto. Quando o resfriamento se d abaixo da superfcie, as rochas originadas so classificadas como magmticas plutnicas ou intrusivas. Por exemplo: o granito. Rochas sedimentares: so formadas a partir do transporte, acmulo e consolidao de partculas sedimentares (areia e lama). O processo de transformao dos sedimentos em rocha recebe o nome de litificao. O grupo das rochas sedimentares o mais importa para os paleontlogos, visto que nele que h maior incidncia de fsseis. Um exemplo de rocha sedimentar o arenito. Rochas metamrficas: podem se originar de qualquer rocha preexiste. Para que ocorra a transformao, necessrio o aumento da temperatura e presso na rocha matriz, ocasionando a reorganizao dos minerais instveis em outros minerais estveis. O granito metamorfizado d origem ao gnaisse e o calcrio transforma-se em mrmore. Tanto as rochas magmticas quanto metamrficas, caso sejam muito antigas, podem ser consideradas como rochas cristalinas, onde comum a ocorrncia de minerais metlicos.

GEOLOGIA

Figura 2: Mapa de Zonas Ssmicas e Vulces. (SIMIELI, Maria Helena. Geoatlas. So Paulo: tica, 2000.)

Com base nas informaes contidas no texto, nos mapas e nos conhecimentos sobre placas tectnicas, considere as afirmativas a seguir. I. As placas tectnicas que dividem as Amricas da Europa e da frica so divergentes, comprovando a teoria de Wegener, segundo a qual os continentes esto se afastando. II. As reas de subduco so locais de encontro de placas tectnicas, resultando em formao de cadeias de montanhas, como os Andes e o Himalaia. III. As reas propensas a tsunamis, como Tailndia e Japo, coincidem com as faixas de incidncia de choques entre placas tectnicas. IV. O Brasil no sofre a influncia de tsunamis apesar de possuir um vasto litoral e de localizar-se em uma rea de instabilidade tectnica. Assinale a alternativa CORRETA. a) Somente as afirmativas I e IV so corretas. b) Somente as afirmativas II e III so corretas. c) Somente as afirmativas III e IV so corretas. d) Somente as afirmativas I, II e III so corretas. e) Somente as afirmativas I, II e IV so corretas. 2.(UEM) Sobre as rochas que compem a crosta terrestre, assinale a alternativa CORRETA. a) As rochas sedimentares formaram-se pelo resfriamento e pela solidificao de minerais da crosta terrestre, isto , o magma. b) As rochas metamrficas formaram-se a partir das transformaes sofridas pelas rochas magmticas e sedimentares quando submetidas ao calor e presso do interior da Terra. c) As rochas magmticas formaram-se a partir da compactao de sedimentos de outras rochas. d) O arenito e o calcrio so exemplos de rochas metamrficas.

EXERCCIOS
1.(UEL) At a segunda metade do sculo XIX, pensava-se que o mapa do mundo fosse praticamente uma constante. Alguns, porm, admitiam a possibilidade da existncia de grandes pontes terrestres, agora submersas, para explicar as semelhanas entre as floras e faunas da Amrica do Sul e da frica. De acordo com a teoria da tectnica de placas, toda a superfcie da Terra, inclusive o fundo dos vrios oceanos, consiste em uma srie de placas rochosas sobrepostas. Os continentes que vemos so espessamentos das placas que se erguem acima da superfcie do mar.
Adaptado de: DAWKINS, R. O Maior Espetculo da Terra. So Paulo: Companhia das Letras, 2009. p.257-258.

Figura 1: Mapa de Placas Tectnicas. (SIMIELI, Maria Helena. Geoatlas. So Paulo: tica, 2000.)

e) O gnaisse e o mrmore so exemplos de rochas sedimentares.

173

GEOGRAFIA DO BRASIL
3. (UEM) Sobre o planeta Terra, sua idade e evoluo, assinale o que for CORRETO. (01) A Terra se originou h, aproximadamente, 9,6 bilhes de anos, juntamente com o incio da formao do universo. As primeiras formas de vida na Terra surgiram na Era Mesozoica. Atualmente, nos encontramos na Era Paleozoica, no perodo Cretceo. (02) O mtodo de datao realizado a partir do carbono quatorze (C14), que um elemento radioativo absorvido pelos seres vivos, muito utilizado para a investigao da idade de achados arqueolgicos mais recentes, de origem orgnica, pois sua meia-vida de 5.700 anos. (04) O tempo geolgico dividido em ons, Eras, Perodos e pocas. A sua sistematizao cronolgica conhecida como escala de tempo geolgico. A partir dessa sistematizao, foi possvel estabelecer uma sucesso de eventos desde o presente at a formao da Terra. (08) A deriva dos continentes se iniciou na Era Cenozoica, por volta de 100 mil anos atrs, quando s existia um nico continente chamado de Gondwana. Posteriormente, no Holoceno, este continente se dividiu em cinco outros continentes, chegando configurao atual. (16) Geocronologia so as diferentes formas de investigao da escala de tempo das rochas, da evoluo da vida e da prpria Terra. O mtodo de datao mais utilizado na Geogronologia envolve a medio da quantidade de energia emitida pelos elementos radioativos presentes nas rochas e minerais 4. (UFV 2007) Observe a figura abaixo:

GEOLOGIA
nos conhecimentos sobre dinmica da crosta terrestre, assinale a afirmativa INCORRETA: a) As rochas gneas so formadas a partir do resfriamento do magma, levando formao de rochas como o granito. b) O intemperismo transforma as rochas gneas em metamrficas, como ocorreu com a formao do calcrio na regio de Sete Lagoas (MG). c) As rochas metamrficas so mais resistentes ao intemperismo do que as rochas sedimentares, permitindo o uso dessas na construo civil. d) As rochas sedimentares so formadas pelo processo de compactao do material oriundo do intemperismo e do transporte das rochas gneas ou metamrficas. e) As rochas metamrficas resultam da transformao de rochas antigas, que sofreram presso ou elevao de temperaturas, como caso do gnaisse. 5. (PUC-Minas-2007) A teoria da Tectnica de Placas explica como a dinmica interna da Terra responsvel pela estrutura da litosfera, sendo INCORRETO afirmar: a) A litosfera a parte rgida que compe a crosta terrestre; segmentada em placas que flutuam em vrias direes sobre o manto. b) O movimento das placas pode ser convergente ou divergente, aproximando-as ou afastando-as, ou ainda deslizando-as uma em relao outra. c) A tectnica responsvel por fenmenos como formao de cadeias montanhosas, deriva dos continentes, expanso do assoalho ocenico, erupes vulcnicas e terremotos. d) As placas continentais e ocenicas possuem semelhante composio mineralgica bsica, uma vez que essas placas compem a crosta terrestre. 6. (UEL-2013) Observe a gura abaixo e leia o texto a seguir.

(Fonte: VESENTINI, Jos William; VLACH, Vnia. Geografia Crtica, 1: O Espao Natural e a Ao Humana. So Paulo: tica. 2000. p. 90. Adaptado.)

No decorrer do tempo geolgico, as rochas sofrem diversas modificaes e se transformam. Com base na figura acima e

Molde de corpo petrificado. Pompeia

174

GEOGRAFIA DO BRASIL
Caam cinzas nos navios, quanto mais se aproximava, mais quentes e mais densas. Pedras-pomes e negras, queimadas e quebradas pelo fogo e a praia inacessvel pelo desmanchar do monte.
(Adaptado de: Carta de Plnio. Disponvel em: <http://www.culturaclasica. com>. Acesso em: 27 abr. 2012.)

GEOLOGIA
_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Quais so os trs tipos de limites entre as placas tectnicas? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Veja a figura abaixo:

A gura acima apresenta o molde de um corpo petricado pela ao do vulco Vesvio que atingiu Pompeia em 79 d.C. O fenmeno foi observado por Plnio, o Velho, de sua embarcao. Com base na gura, no texto e nos conhecimentos sobre fenmenos naturais, considere as armativas a seguir. I. A intensidade de fenmenos naturais, como a dos vulces, independe do nvel de desenvolvimento tcnico e econmico dos pases. II. Devido s transformaes tecnolgicas, fenmenos como terremotos, vulces e mesmo tsunmis so passveis de serem monitorados, minimizando possveis catstrofes. III. No caso de vulces de tipo pliniano, como o Vesvio, alguns fenmenos antecedem sua erupo, tais como abalos ssmicos, liberao de gases, cinzas e pedras-pomes. IV. Terremotos, vulces e tsunmis so fenmenos intensicados pela ao antrpica e mesmo com toda a tecnologia ainda so imprevisveis. Assinale a alternativa CORRETA. a) Somente as armativas I e II so corretas. b) Somente as armativas I e IV so corretas. c) Somente as armativas III e IV so corretas. d) Somente as armativas I, II e III so corretas. e) Somente as armativas II, III e IV so corretas. 7. (UNIFESP) Observe a imagem, leia o texto e responda.

a) Explique o processo de formao das rochas gneas e d pelo menos um exemplo de rochas plutnicas e extrusivas. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

(http://revistaescola.abril.com.br) De acordo com a teoria das placas tectnicas, a crosta terrestre est dividida em placas de espessura mdia de 150 km, que flutuam sobre o substrato pastoso, a astenosfera.
(Almeida e Rigolin, 2005. Adaptado.)

b) Explique o processo de formao das rochas metamrficas e exemplifique. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

a) Qual a relao existente entre a teoria da deriva dos continentes e a teoria das placas tectnicas?

175

ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA

UNIDADE 3 ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA


A estrutura geolgica a contraposio das foras internas e externas do planeta Terra que formam grandes corpos rochosos que sustentam as formas da superfcie. O conhecimento da estrutura geolgica do territrio brasileiro de suma importncia para podermos compreender o relevo de nosso Pas, e atuar de maneira coerente, explorando de maneira mais adequada possvel os recursos naturais, evitando desgastes, processos erosivos, ou seja, impactos que sejam prejudiciais economia e ao meio ambiente.

recursos minerais metlicos (ferro, mangans, bauxita, ouro entre outros). Como exemplo, citamos o Quadriltero Central ou Ferrfero em Minas Gerais. As rochas sedimentares, segundo a origem, classificamse em detrticas (resultantes de detritos de outras rochas, como arenito e argila); qumicas (sal gema) e as orgnicas / pseudorochas (carvo-mineral). Cerca de 64% da estrutura do Brasil composta por esse tipo de rocha. Tais estruturas ou provncias geolgicas so chamadas de Bacias Sedimentares. No territrio brasileiro, identificam-se oito bacias Sedimentares: Amaznica, Meio Norte, Recncavo, So-Franciscana, Pantanal, Paranica, Central e Litornea. Sua importncia econmica relaciona-se com a possibilidade de ocorrncias de combustveis fsseis, como o petrleo, gs natural e o carvo mineral. Os dobramentos modernos (uma estrutura geolgica que no aparece no Brasil em virtude da posio deste no interior da placa Sul americana) so formados pelos chamados dobramentos tercirios ou modernos (cintures orogenticos) originados do contato de grandes placas tectnicas. As altitudes so elevadas e os picos pouco desgastados pelos agentes erosivos externos. Por exemplo, o Himalaia e os Andes.

TIPOS DE ROCHAS E ESTRUTURA GEOLGICA


Na superfcie brasileira, identificamos os trs tipos de rochas encontrados na superfcie terrestre: metamrfica, magmtica e sedimentar, tambm podemos identificar trs estruturas geolgicas no Brasil: sedimentar, vulcnica e cristalina.

As rochas cristalinas, como o granito, originaram-se do lento resfriamento do magma1* (material em fuso no interior da crosta), durante o Pr-Cambriano e, juntamente com rochas metamrficas antigas, compem os chamados escudos cristalinos
A transformao de outros tipos de rochas, devido ao de elevadas temperaturas e grandes presses ao longo do tempo, acaba tambm dando origem a rochas cristalinas. Exemplo clssico o gnaisse, oriundo de alteraes ocorridas na estrutura do granito.
1*

No Brasil, as rochas cristalinas afloram em cerca de 36% da superfcie brasileira. Tais estruturas ou provncias geolgicas so chamadas de Escudos ou Ncleos (aglomerados rochosos menores). De forma genrica, identificam se dois grandes escudos no Brasil: o Guiano e o Brasileiro, sendo este ltimo dividido em uma srie de ncleos. Os escudos cristalinos so divididos em dois grupos: os terrenos da era Arqueozica que correspondem a 32% da estrutura geolgica brasileira e os da era Proterozicos que representam 4%. Nos terrenos Arqueozicos predominam as rochas magmticas (granito) e metamrficas (gnaisse). Nos terrenos da era Proterozica encontram-se, normalmente,

As rochas vulcnicas, originadas do rpido resfriamento do magma na superfcie, como o basalto e o diabsio, ocorrem, sobretudo, na poro meridional do pas explicada pela ocorrncia no Mesozico de intenso derrame de lavas vulcnicas na regio. As rochas vulcnicas, por vezes, sofrem intemperismo (desagregao fsico qumica das rochas), dando origem a um dos solos mais frteis do pas, a chamada terra-roxa.

OS AGENTES FORMADORES DO RELEVO TERRESTRE


O relevo formado pela atuao de foras oriundas do interior do planeta (endgenos) e, tambm, de fora (exgenos). Os fatores internos so responsveis pela elevao ou rebaixamento da superfcie da crosta terrestre; os fatores externos, por sua vez, causam modificaes nessa superfcie, atravs do desgaste das formas construdas.

176

GEOGRAFIA DO BRASIL

ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA

FATORES ENDGENOS (INTERNOS)

Os fatores internos de formao do relevo tm sua origem nas presses que o magma exerce sobre a crosta terrestre. Essas presses podem provocar vulcanismo, terremotos (sismos) e outros fenmenos chamados tectnicos (tectonismo), como a formao de dobras e fraturas e a criao de montanhas. O movimento do magma ocorre no manto, a parte do interior da Terra que fica entre a crosta e o ncleo, com aproximadamente 2 800 km de espessura. O magma age no manto superior, que vai at 670 km de profundidade. Veja a figura abaixo. A Cordilheira do Himalaia uma formao moderna, ainda em processo de soerguimento. Sua origem est associada coliso de duas placas continentais, e no ao choque entre uma placa continental e outra ocenica, como no caso da Cordilheira dos Andes. Tanto nas zonas de construo como nas zonas de destruio, alm da ocorrncia de terremotos e vulcanismos comum o aparecimento de dobras ou fraturas, conforme as figuras acima e abaixo. A diferena entre a temperatura do magma, uma substncia quentssima e por isso fluida, e a temperatura da crosta, que mais baixa, pode resultar em dois fenmenos: em algumas regies, o magma extravasa para a superfcie, pelos vulces, sob a forma de lavas; em outras, a crosta que se transforma novamente em magma, sugada para o interior do manto. Essa troca de calor denominada movimento de conveco, conforme indicao das setas na figura acima. Tais fenmenos ocorrem com maior intensidade nas zonas de contato das placas tectnicas, que formam a crosta terrestre. Essas placas, que compem a litosfera, so encontradas tanto nos continentes quanto sob o mar. a partir de rachaduras abertas na crosta terrestre pela fora da sua presso que o magma se movimenta e realiza seu trabalho de construo e destruio, ou seja, pratica a sua ao dinmica. As reas de construo so representadas principalmente pelas chamadas dorsais meso-ocenicas, grandes cadeias de montanhas submersas formadas por vazamentos e depsitos de magma. Ao atravessar a crosta e entrar em contato com a gua, o magma se consolida, formando aquelas que constituem as mais recentes rochas magmticas da crosta. O maior exemplo a zona da dorsal meso-atlntica, atravs da qual continuam surgindo novas rochas no solo ocenico. A expanso que ocorre no fundo do mar tensiona a crosta em cadeia, de tal forma que em outras reas ela pressionada e destruda. o que ocorre na regio do Pacfico Sul, em que a fina crosta ocenica est sendo lentamente empurrada contra o continente, retornando ao manto e voltando a fundirse, constituindo uma rea de destruio de placa tectnica. Em contrapartida, o continente, pressionado, sofre uma grande elevao. Esse lento soerguimento responsvel pela contnua elevao da cordilheira dos Andes. Em geral, as chamadas montanhas recentes, tambm conhecidas como dobramentos recentes apresentam intensa atividade ssmica e vulcanismos, justamente porque esto no limite de destruio das placas tectnicas.

A grande ocorrncia de dobras e falhas explica a formao de vrias cadeias de montanhas sobre a crosta antigas e recentes. Dizemos que as dobras e falhas so movimentos orogenticos, ou seja, criadores de montanhas.

OS FATORES EXGENOS (EXTERNOS)

Os agentes modeladores do relevo que atuam na superfcie terrestre recebem o nome de fatores exgenos (gua, temperatura, vento, gelo etc.). Sua ao principal intemperizar o modelado terrestre. O intemperismo (processo de destruio das rochas) e seus principais agentes: Intemperismo fsico (ambientes de pouca umidade e/ou temperaturas extremas): ocorre a fragmentao (desintegrao) da rocha de origem, sem, contudo, haver alterao qumica nos minerais constituintes. I. Periglacial: pequena ao erosiva pelo congelamento e descongelamento de guas. II. Semi-rido: sedimentos fluviais grosseiros, em funo do regime intermitente das guas, com o aparecimento de rios relmpagos. Intemperismo qumico (ambiente de maior umidade): ocorre a quebra da estrutura qumica (decomposio) das rochas gerando I. Tropical mido: formao de solos cidos e relevo mamelonar.

177

GEOGRAFIA DO BRASIL

ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA


A de Aziz Ab'Saber, elaborada na dcada de 50, tem como critrio o domnio do processo eroso/sedimentao, definindo planalto como a rea onde se verifica o domnio do processo erosivo sobre o sedimentar e plancie, como a rea onde a deposio supera a eroso. Recentemente foi divulgada uma nova proposta de diviso do relevo brasileiro, elaborada por Jurandyr Ross, que est calcada num extenso e detalhado levantamento por sistema de radar promovido pelo projeto Radambrasil, do Ministrio de Minas e Energia, realizado entre 1970 e 1985.

O RELEVO DO BRASIL
O relevo brasileiro caracterizado pelas baixas altitudes, pois apenas 3% do seu territrio est acima de 900m de altitude. A modstia desse relevo reflexo, entre outros fatores da: 1: antiguidade das formaes que datam de eras geolgicas distantes, o que determinou, ao longo do tempo, o desgaste e o aplainamento do relevo, por fora de intenso processo erosivo. Ou seja, os agentes externos atuam no relevo brasileiro com muito mais intensidade. 2: reduzida ao de foras tectnicas (agentes internos ou formadores do relevo) no Cenozico, ou seja, a no ocorrncia em nosso territrio dos Dobramentos Modernos (montanhas jovens).

Outro aspecto que se destaca no relevo brasileiro que ele formado por Planaltos, Depresses e Plancies e, o que frequentemente denominamos serras no Brasil so na verdade, em sua maior parte, bordas de planaltos, isto , escarpas (penhasco, encosta ngrime).

Relevo do Brasil Classificao de Aziz AbSaber

CLASSIFICAO DO RELEVO BRASILEIRO

Existem vrias classificaes do relevo brasileiro, mas duas delas so mais conhecidas e tiveram grande importncia em momentos diferentes: a de Aroldo Azevedo e de Aziz Ab'Saber. A de Aroldo de Azevedo, elaborada nos anos 40, utiliza o nvel altimtrico do relevo como critrio fundamental, definindo planaltos como reas de altitudes superiores a 200 metros e plancies, como reas inferiores a 200 metros de altitude.

Essa nova classificao se utiliza de um critrio que associa informaes sobre o processo de eroso e de sedimentao dominantes na atualidade com informaes da base geolgicoestrutural do terreno e com o nvel altimtrico.

Relevo do Brasil Classificao de Aroldo de Azevedo

178

GEOGRAFIA DO BRASIL
Segundo esse critrio, define-se Planalto como uma superfcie irregular, com altitudes superiores a 300 metros e originado a partir da eroso sobre rochas cristalinas ou sedimentares. De acordo com o tipo de rocha, as bordas dos planaltos podem assumir diferentes formas. No Brasil merecem destaque as Escarpas que so declividades acentuadas (como degraus) na borda dos planaltos e as chapadas elevaes com escarpas verticais e topo plano. Depresso uma superfcie geralmente mais plana que os planaltos, com inclinao suave com altitudes que variam entre 100 e 500 metros, resultante de prolongados processos erosivos, tambm sobre as superfcies cristalinas ou sedimentares, especialmente no limite das bacias sedimentares com os macios antigos. Plancie a superfcie mais ou menos plana, independente da altitude, e originada pelo acmulo recente de sedimentos fluviais, marinhos ou lacustres, ou seja, uma rea onde atualmente ocorre a deposio. A diviso se faz em 28 unidades, sendo 11 planaltos, 11 depresses, que ocupam a maior parte do territrio, e 6 plancies que tem uma participao percentual mnima no territrio. Logo abaixo, temos o perfil do relevo do estado do Paran com as diversas classificaes. importante lembrar que a diviso feita por Jurandir Ross no invlida as classificaes anteriores.

ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA


a) Apresentarem reas de intruses granticas, ricas em jazidas minerais (ferro, mangans). b) Corresponderem ao principal evento geolgico do Cenozoico no territrio brasileiro. c) Apresentarem reas arrasadas pela eroso, que originaram a maior plancie do pas. d) Possurem em sua extenso terrenos cristalinos ricos em reservas de petrleo e gs natural. e) Serem esculpidas pela ao do intemperismo fsico, decorrente da variao de temperatura. 2. (Enem 2010):

O esquema mostra depsitos em que aparecem fsseis de animais do Perodo Jurssico. As rochas em que se encontram esses fsseis so: a) Magmticas, pois a ao de vulces causou as maiores extines desses animais j conhecidas ao longo da histria terrestre. b) Sedimentares, pois os restos podem ter sido soterrados e litificados com o restante dos sedimentos. c) Magmticas, pois so as rochas mais facilmente erodidas, possibilitando a formao de tocas que foram posteriormente lacradas.

EXERCCIOS
1-(ENEM-2012) As plataformas ou crtons correspondem aos terrenos mais antigos e arrasados por muitas fases de eroso. Apresentam uma grande complexidade litolgica, prevalecendo as rochas metamrficas muito antigas (PrCambriano Mdio e Inferior). Tambm ocorrem rochas intrusivas antigas e resduos de rochas sedimentares. So trs as reas de plataforma de crtons no Brasil: a das Guianas, a Sul-Amaznica e a So Francisco.
ROSS, J. L. S. Geografia do Brasil. So Paulo: Edusp, 1998.

d) Sedimentares, j que cada uma das camadas encontradas na figura simboliza um evento de eroso dessa rea representada. e) Matamrficas, pois os animais representados precisavam estar perto de locais quentes. 3. No Brasil ocorreram extensos derrames vulcnicos na Era Mesozica. As rochas vulcnicas, pela sua alterao, deram origem aos solos ricos chamados terra roxa. Esses derrames vulcnicos situam-se, sobretudo, na: a) Bacia sedimentar do Paran . b) Bacia sedimentar do Amazonas. c) Bacia sedimentar do Parnaba. d) Bacia sedimentar do So Francisco. e) Bacia sedimentar de So Paulo.

As regies cratnicas das Guianas e a Sul-Amaznica tm como arcabouo geolgico vastas extenses de escudos cristalinos, ricos em minrios, que atraram a ao de empresas nacionais e estrangeiras do setor de minerao e destacam-se pela sua histria geolgica por:

179

GEOGRAFIA DO BRASIL
4. A origem do petrleo est associada a: a) Rochas cristalinas e detritos orgnicos depositados em mares profundos. b) Bacias sedimentares e detritos orgnicos marinhos depositados em mares rasos. c) Rochas metamrficas e restos vegetais alterados por temperatura e presso elevadas. d) Bacias sedimentares e detritos orgnicos continentais depositados em grandes pntanos. e) Rochas cristalinas e detritos orgnicos depositados em mares rasos. 5. Com relao estrutura geolgica do territrio brasileiro, assinale a afirmativa incorreta: a) As estruturas muito antigas do embasamento fundamental alternam-se com as estruturas sedimentares de diferentes perodos geolgicos. b) Aos terrenos sedimentares esto associadas s jazidas de combustveis fsseis, como petrleo e carvo mineral. c) Aos terrenos cristalinos esto associadas s jazidas minerais de grande importncia econmica, como minrio de ferro e bauxita. d) Os terrenos vulcnicos expandem-se pela maior parte do territrio, constituindo a base do relevo recente, ainda em processo de formao. e) As estruturas geolgicas dos dobramentos tercirios, formadores de grandes cadeias montanhosas, inexistem no territrio brasileiro. 6. (Mackenzie-2003) Os processos exgenos so movidos pelo calor solar que atua na superfcie da crosta continental atravs da atmosfera. Esses processos agem sobre o arranjo escultural das rochas e so responsveis pela esculturao do relevo. Geografia do Brasil Jurandyr Ross. A partir do texto podemos identificar como processos exgenos: a) As transgresses e regresses martimas. b) A ao do vulcanismo. c) A ao ao tectonismo. d) Os processos de intemperismo. e) Grandes atividades ssmicas. 7. Sobre a Geologia e o Relevo brasileiro, podemos afirmar que, EXCETO: a) Nas grandes bacias sedimentares predominam formas de plancies e planaltos sedimentares como chapadas e cuestas. b) O Brasil possui um embasamento constitudo de formaes antigas cristalinas, ricas em minerais metlicos. c) O relevo foi intensamente desgastado pela eroso, da a ocorrncia de vrios planaltos de modesta altitude. d) O relevo brasileiro apresenta altitudes modestas no interior, e no litoral bastante ngreme e elevado devido presena de dobramentos tercirios.

ESTRUTURA GEOLGICA DO BRASIL E GEOMORFOLOGIA


8. Sobre as caractersticas gerais do relevo brasileiro, CORRETO afirmar-se que: a) As superfcies onde os terrenos cristalinos esto aflorando, corresponde a cerca de 64% do territrio. b) Apenas 3% de todo o relevo brasileiro apresenta altitudes inferiores a 200 metros. c) Os picos mais elevados do Brasil abrangem uma rea que atinge cerca de 41% de todo o territrio. d) As reas onde o relevo formado por rochas sedimentares caracterizam-se por serem tambm as de maiores altitudes. e) Somando-se as superfcies entre 200 e 1200m de altitude, a rea ser superior das superfcies com menos de 200 m de altitude. 9. (UFBA / UFRB) [...] Levantamentos aerofotogramtricos, possibilitados pelo Radambrasil, forneceram informaes detalhadas que foram utilizadas para fundamentar uma nova classificao do relevo e de suas unidades. Essa classificao associa as informaes altimtricas com os processos de eroso, sedimentao e gnese origem e formao do modelado terrestre integrando-os, tambm, s estruturas geolgicas nas quais ocorrem. O relevo brasileiro passa a ser classificado [atravs] de trs formas: depresses, planaltos e plancies.
(LUCCI; BRANCO; MENDONA, 2003, p. 311).

A partir da leitura do texto e dos conhecimentos sobre o relevo brasileiro, caracterize os planaltos e as plancies, considerando os processos de sua formao, e cite um exemplo de cada forma, indicando sua respectiva localizao. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

180

GEOGRAFIA DO BRASIL
10 (UEL-2012) O relevo corresponde ao conjunto de formas apresentadas na superfcie terrestre. Essas formas so definidas pela estrutura geolgica combinada com as aes da dinmica interna e externa da Terra. Em 1985, o professor Jurandyr Ross elaborou uma classificao do relevo brasileiro com base em trs fatores geomorfolgicos: I. Morfoestrutura origem geolgica. II. Paleoclima ao de antigos agentes climticos. III. Morfoclima influncia dos atuais agentes climticos. Essa classificao associa a passado geolgico e o passado climtico com os atuais agentes escultores do relevo. Com base nesta associao, o professor Ross identificou trs tipos de relevo. a) Indique cada tipo de relevo e descreva suas caractersticas; _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) De que forma essas caractersticas influenciam a vida nas cidades? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ Mesmo sendo um valor proporcional pequeno, esta poro de gua doce pode suprir as necessidades dos seres humanos e do meio natural desde que utilizada adequadamente. Voltando primeira discusso, quase todos os recursos naturais so formados nos chamados ciclos do meio natural. Assim, enquanto utilizamos um recurso, ele est sendo novamente formado. O que torna um recurso no renovvel o fato do consumo ser mais rpido que a capacidade da natureza de criar tal recurso, como o caso dos minrios. Assim, preciso entender o ciclo natural da gua e sua utilizao pelo homem para respondermos a pergunta proposta no incio do desta unidade.

UNIDADE 4 HIDROGRAFIA
DISPONIBILIDADE DE GUA
gua um recurso natural indispensvel para a vida humana. Assim, antes de discutirmos sobre sua utilizao e manejo, nos perguntamos se ela um recurso renovvel ou no renovvel. Enquanto volume total, o planeta Terra possui cerca de 1,3 bilho de km de gua. Sob esta tica, os recursos hdricos no so considerados no-renovveis, uma vez que no se extinguem. Todavia, se falarmos em possibilidade de uso, a histria diferente, pois, 97,5% da gua invivel ao consumo (salgada), mas serve para a gerao de energia por meio do aproveitamento das onda, para o transporte martimo e, principalmente para a pesca. Dos 2,5% de gua doce (o que nos interessa no momento) 68,9% est presa em geleiras, 30,8% no subsolo (uma parte pode ser utilizada) e 0,3% em lagos e rios.

181

GEOGRAFIA DO BRASIL

HIDROGRAFIA

BACIAS HIDROGRFICAS DO BRASIL


O Brasil tem uma das maiores redes hidrogrficas (conjunto de rios) do mundo. Rios extensos e de grande volume de gua, como o caso do Amazonas, que despeja no Atlntico 120.000m3 por segundo. A maior parte dos rios de planalto, o que decorre das formas de relevo, como os rios So Francisco, Tiet e Paran, cujas quedas dgua so aproveitadas para construo de usinas hidreltricas. Os rios de plancie pertencem s bacias Amaznica e do Paraguai, e so os que podem ser aproveitados para a navegao. Os rios brasileiros tem regime pluvial, ou seja, so alimentados pelas chuvas, constituindo exceo apenas o Amazonas, que recebe parte de suas guas do degelo andino. Em consequncia do regime pluvial, quando a estao seca muito prolongada, os rios praticamente desaparecem. o que acontece com os rios do polgono das secas (serto semi-rido do Nordeste), que so rios temporrios ou intermitentes.

Principais problemas de uma bacia hidrogrfica: Desmatamento das matas ciliares. Assoreamentos. Despejo de resduos slidos e contaminao por agrotxicos. Lanamento de efluentes domsticos, industriais e pluviais. Usos desordenados das guas. Eutrofizao (acmulo de matria orgnica) e degradao da biodiversidade.

BACIA AMAZNICA
Quanto ao aproveitamento econmico dos rios brasileiros, o maior destaque para a produo de eletricidade (especialmente os da bacia do Paran) e para a navegao. Nesse particular, a dianteira cabe aos rios da bacia Amaznica, seguidos pelo rio So Francisco e rio Paraguai. importante lembrar que um rio de planalto perfeitamente navegvel com a construo de eclusas que permitem vencer obstculos representados pelas quedas dgua, como o caso da hidrovia Paran-Tiet. Mesmo assim, de maneira geral, os rios brasileiros tm um baixo aproveitamento energtico e tambm para a irrigao. Apenas as guas de rios do semi-rido so usadas para esse fim. Apesar de sua imensa rede hidrogrfica, o Brasil possui poucas e pequenas lagoas. H apenas algumas lagoas costeiras, como a Rodrigo de Freitas, Araruana, Saquarema (RJ), dos Patos, Mirim e Mangueira (RS).

a maior bacia fluvial do mundo. Seu principal rio, o Amazonas, percorre o territrio brasileiro em 3165 km e sofre um desnvel suave e progressivo (mdia de 20mm por km) sem ocorrncia de quedas dgua e corredeiras. Sua profundidade varia entre 20 e 200m, sendo de 3 a 15 km sua largura mdia; sofre um estreitamento em bitos, no Par, onde a distncia entre suas margens de apenas 2.600m; h tambm grandes alargamentos como nas confluncias com o Rio Negro e com o rio Madeira, onde sua largura supera os 90 km. O rio Amazonas um tpico rio de plancie, pois ao longo de seus 3.165 km em territrio brasileiro, tem um desnvel de apenas 60m, sendo em consequncia perfeitamente navegvel, inclusive por navios de grande calado. Tem grandes afluentes, destacando-se entre muitos outros, na margem direita: Juru, Purus, Madeira, Tapajs e Xingu, e na margem esquerda: Japur, Negro, Trombetas e Jari. No passado chegou-se a pensar que essa bacia era aproveitvel apenas na navegao sem grande utilidade para obteno de energia eltrica. O potencial dessa bacia hoje considerado como o mais elevado do pas, superior mesmo a bacia do Paran, no obstante o melhor aproveitamento desta, com a construo de muito mais usinas hidreltricas. Teso o nome dado s reas elevadas na Ilha de Maraj, que no so atingidas pelas inundaes e servem de refgio para o gado.

BACIA DO TOCANTINS-ARAGUAIA

Tanto o Tocantins quanto o Araguaia so rios que nascem no planalto Central. Ambos recolhem as guas de numerosos rios que drenam importantes reas agrcolas e pastoris, sobretudo do estado de Gois.

182

GEOGRAFIA DO BRASIL
No setor energtico, destaca-se a Usina de Tucuru: (Rio Tocantins, Par) fornecer energia para a minerao de Carajs, para siderurgia do porto de Itaqui (Maranho), para a eletrificao entre ambos e para usina eletrometalrgica, que, prxima a Belm, reduzir a alumnio o minrio proveniente do Vale do Rio Trombetas.

HIDROGRAFIA

BACIA DO LESTE

Rio Doce: drena a regio do quadriltero Ferrfero. Rio Paraba do Sul: regio de intensa industrializao entre Rio de Janeiro e So Paulo.

BACIA DO SUL

BACIA DO SO FRANCISCO

Rio Tubaro: passa por importante regio carbonfera.

Formado pelo rio So Francisco e seus afluentes, abrangendo 7.5% do territrio brasileiro. Nasce na Serra da Canastra (MG) com 3.160 km de extenso e atravessa o polgono das secas. Navegvel num longo trecho entre Pirapora (MG) e Juazeiro (BA). Devido ao seu papel na criao do gado, o Rio So Francisco recebe a denominao de Rio dos Currais; e tambm por unir vrios estados do Brasil, recebe o nome de Rio da Unidade Nacional. Possui grande potencial hidreltrico, e ao longo de seu curso existem vrias usinas: Trs Marias (MG) alm de produzir energia hidreltrica, controla o nvel das guas. Sobradinho um grande projeto para acelerar o desenvolvimento do nordeste, pois envolve mltiplos aspectos como: energia eltrica, irrigao, navegao e pesca. Paulo Afonso marca a transio do curso mdio do rio (rio de planalto) para o curso inferior (rio de plancie). Fornece energia para cerca de 700 municpios nordestinos.

O LITORAL BRASILEIRO
O litoral brasileiro estende-se desde o Cabo Orange, no Amap, at o Chu, no Rio Grande do Sul. Considerando-se as reentrncias e salincias do litoral brasileiro, como os golfos, as baas e as enseadas, a extenso real do litoral se eleva para 9.198 km. Quanto importncia econmica e estratgica do litoral brasileiro temos que: O sol, beneficiado pelas condies naturais favorveis (elevada salinidade do mar, temperaturas elevadas, intensa evaporao, etc.) abundante, principalmente no RN e RJ. Grande potencial para explorao turstica. A pesca, que era essencialmente artesanal at a Segunda Guerra Mundial, adquiriu carter empresarial e sofreu grande impulso aps a criao, em 1962, do SUDEPE (Superintendncia do Desenvolvimento da Pesca). O petrleo extrado na plataforma continental, com aproximadamente 60% da produo nacional, com destaque para a Bacia de Campos. Existncia em grande quantidade de portos naturais. As maiores reentrncias do nosso literal so: golfo Amaznico, (974 km de contorno), baa de Todos os Santos (291 km), baas de So Marcos e So Jos, no Maranho (237 km), baa de Paranagu, no Paran (183 km) e a baa de Guanabara (131 km). As maiores ilhas costeiras so: Maraj (48.000 km2), Caviana (4.900 km2), Maranho (1.100 km2), So Francisco (350 km2), Santa Isabel (312 km2) e So Sebastio (292 km2). Os tipos de costas mais comuns so as praias, as falsias e barreiras, os mangues e as dunas.

BACIA PLATINA

Compreende os rios Paran, Uruguai e Paraguai e a segunda bacia fluvial do mundo. Bacia do Paran: Rio Paran: formado pelo encontro das guas dos rios Paranaba e Grande. Drena a poro ocidental do Planalto Meridional, possui o maior potencial instalado, destacando-se em sua bacia, no rio Paran: Urubupung (Jupi e Ilha Solteira), Itaipu (binacional), no Rio Grande: Furnas; no Tiet: Promisso e Barra Bonita. Bacia do Paraguai: uma bacia formada por rios de plancie, destacando-se o rio Paraguai que o principal. Atravessa a grande depresso do Pantanal e, na poca das cheias, inunda uma vasta rea. navegvel e por ela so escoados muitos produtos, destacando-se o ponto de Corumb. A bacia possui pequeno potencial hidreltrico. Bacia do Uruguai: O rio Uruguai possui 1.500 km de extenso e serve de limite entre o Brasil, Argentina e Uruguai. Apresenta pequeno potencial hidreltrico.

EXERCCIOS
1. (ENEM-2003) Considerando a riqueza dos recursos hdricos brasileiros, uma grave crise de gua em nosso pas poderia ser motivada por: a) Reduzida rea de solos agricultveis. b) Ausncia de reservas de guas subterrneas. c) Escassez de rios e de grandes bacias hidrogrficas. d) Falta de tecnologia para retirar o sal da gua do mar. e) Degradao dos mananciais e desperdcio no consumo.

BACIAS SECUNDRIAS DO BRASIL


BACIA DO NORDESTE
Rio Parnaba: separa os estado do Piau e do Maranho, banhando a nica capital nordestina no martima, a cidade de Teresina, capital do Piau. Rio Jaguaribe: intermitente e de irrigao. Situa-se no Cear.

183

GEOGRAFIA DO BRASIL
2.(UFSM-RS-adaptado) Devido grande extenso territorial e aos tipos de rios o Brasil, a hidrografia brasileira apresenta as seguintes caractersticas: I. H rios temporrios, mas predominam os rios perenes, em funo dos regimes pluviomtricos. II. Quase todos os rios desguam no Oceano Atlntico possuindo foz em delta ou em esturio. III. A maior parte dos rios de planalto. Esto CORRETAS. a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III e) Todas as afirmativas. 3. As guas superficiais constituem parte da riqueza dos recursos hdricos de um pas. No caso brasileiro, pas de extenso continental, a rede fluvial importante recurso natural, contando em seu territrio com a maior bacia fluvial do mundo.
(CUNHA, S. B. Geomorfologia do Brasil. Rio de Janeiro: Bertrand Brasil, 1998. p. 229.)

HIDROGRAFIA
d) O nmero (5) assinala uma bacia hidrogrfica cujo rio mais importante o Uruguai. e) A maioria dos rios das bacias hidrogrficas da poro centro-sul do Brasil constituda de rios de plancie, que comeam a ser utilizados como meio de transporte de carga pesada. 4.(Ufsc) Observe o mapa do Aqfero Guarani abaixo.

Da observao da figura abaixo e com base no conhecimento de hidrografia do Brasil, correto afirmar:

Considerando o mapa e seus conhecimentos a respeito do assunto, assinale a(s) proposio (es) CORRETA(S). (01) A maior parte do Aqfero Guarani, importante reservatrio subterrneo de gua doce do mundo (parte hachurada do mapa), est localizada em territrio brasileiro. (02) O estado de Santa Catarina no apresenta problemas de abastecimento de gua devido preservao da cobertura vegetal em reas de mananciais e aos elevados ndices de precipitao pluviomtrica. (04) As reservas subterrneas representam uma alternativa estratgica ao problema da gua, recurso cada vez mais disputado porque a quantidade disponvel nos rios, lagos e atmosfera insuficiente para atender as crescentes necessidades globais. a) O nmero (2) assinala a bacia hidrogrfica do rio Paran, que se destaca pela explorao do seu potencial hidrulico e abriga as hidreltricas de Itaipu Binacional e Salto Segredo, no estado do Paran. b) Os rios da bacia Amaznica (1), cujas nascentes encontram-se no Planalto Central Brasileiro, so pouco extensos e de pequena vazo porque se localizam no domnio do Cerrado, em rea de baixa pluviosidade. c) O rio So Francisco, na rea (4), tem pouca importncia econmica porque atravessa o semi-rido do Nordeste. (08) O grande potencial de gua representado pelo Aqfero Guarani assegura o abastecimento de energia eltrica para o Centro-Sul do Brasil e demais pases da Amrica do Sul. (16) As formaes vegetais e a rica rede hidrogrfica, que caracterizam a regio demarcada pelo crculo no mapa, asseguraram um desenvolvimento econmico sem afetar os recursos hdricos regionais. Soma_______

184

GEOGRAFIA DO BRASIL
5. (PUC-SP) A gua encontra-se neste incio de sculo em condies que exigem srios cuidados. Alm do volume existente desse recurso, importante considerar sua distribuio geogrfica e suas formas de uso para preserv-lo. Tendo como referncia o planeta, pode-se afirmar que: a) O consumo mundial de gua doce maior na agricultura (mais de 70%), mas esse ndice tende a cair, pois a agricultura est se concentrando cada vez mais em reas midas. b) O maior estoque de gua doce subterrnea, superando o volume de guas em estado slido (calotas polares, geleiras e neves permanentes), em razo do derretimento provocado pelo efeito estufa. c) Apenas das guas do planeta no de gua salgada, e esse volume insuficiente para as necessidades humanas, o que obriga aes de dessanilizao das guas ocenicas. d) Existe notria desigualdade na distribuio das guas continentais e, nesse aspecto, a Amrica do Sul um dos continentes mais abastecidos com esse recurso natural, em especial nas reas tropicais. e) Embora na rea intertropical do planeta haja uma dominncia de climas chuvosos, os estoques de gua doce no so expressivos nessa rea, pois essa tambm uma rea de grande evaporao. 6. O Aqfero Guarani se estende por 1,2 milho de km2 e um dos maiores reservatrios de guas subterrneas do mundo. O aqfero como uma esponja gigante de arenito, uma rocha porosa e absorvente, quase totalmente confinada sob centenas de metros de rochas impermeveis, Ele recarregado nas reas em que o arenito aflora superfcie, absorvendo gua da chuva. Uma pesquisa realizada em 2002 pela Embrapa apontou cinco pontos de contaminao do aqfero por agrotxico, conforme a figura:

HIDROGRAFIA
Considerando as consequncias socioambientais e respeitando as necessidades econmicas, pode-se afirmar que, diante do problema apresentado, polticas pblicas adequadas deveriam: a) Proibir o uso das guas do aqfero para irrigao. b) Impedir a atividade agrcola em toda a regio do aqfero. d) Impermeabilizar as reas onde o arenito aflora. d) Construir novos reservatrios para a captao da gua na regio. e) Controlar a atividade agrcola e agroindustrial nas reas de recarga. 7. (UEL/2013) Analise o mapa, a foto e leia os textos a seguir.

a) O Brasil apresenta um cenrio hdrico privilegiado. Dispe de um dos maiores complexos hidrogrcos superciais, com aproximadamente 8% de toda gua doce que est na superfcie do planeta, e subterrneos, como os aquferos Guarani e Alter do Cho, conforme o mapa ao lado. Possui a maior bacia uvial do mundo, a Amaznica. Somente o rio Amazonas desgua no mar um quinto de toda a gua doce que despejada nos oceanos; apesar da abundncia desse recurso natural no cenrio hdrico brasileiro, os rgos governamentais e no governamentais tm intensicado sua preocupao com relao sua qualidade e quantidade. Aponte trs motivos dessa preocupao e enumere trs aes que poderiam ser implantadas para assegurar a qualidade e a quantidade da gua destinada ao abastecimento da sociedade e dos ecossistemas naturais. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

185

GEOGRAFIA DO BRASIL
b) A foto e a manchete do jornal, a seguir, apresentam a ocorrncia de enchentes nos ltimos anos em Londrina.

INTRODUO CLIMATOLOGIA
b) Indique um impacto positivo e outro negativo esperados no projeto de transposio do So Francisco. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

Cite trs alteraes ambientais causadas pelo processo de urbanizao sobre o solo de uma bacia hidrogrca. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. (UNICAMP) O mapa abaixo representa a rea abrangida pelo projeto de transposio do rio So Francisco.

UNIDADE 5 INTRODUO CLIMATOLOGIA


TEMPO E CLIMA
O estudo da atmosfera, de maneira geral, chama-se climatologia, e examina a temperatura, as precipitaes, as presses atmosfricas e o regime dos ventos, elementos que, por sua vez, dependem de muitos fatores, como a latitude, aspectos topogrficos do relevo, as correntes martimas, a distribuio de guas e terras, a vegetao e muitos outros.

TEMPO

Situao da atmosfera em um certo lugar da superfcie terrestre, em um determinado momento.

CLIMA

Conjunto de fenmenos meteorolgicos que caracterizam o Estado Mdio da atmosfera em um ponto da superfcie terrestre.

(J. Hann)

a) Qual o principal bioma a ser atingido pela transposio do So Francisco? D duas caractersticas desse bioma. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

O clima do planeta influenciado por inmeros fatores da superfcie terrestre. Assim, nunca podemos afirmar, por exemplo, que todas as reas que esto na linha do Equador so quentes, pois caso o local apresente uma elevada altitude, como o caso das Cordilheiras dos Andes no Peru, o seu clima ser muito frio, podendo at nevar. Assim, para compreendermos todos os climas e por consequncia suas respectivas vegetaes, estudaremos os fatores que podem exercer alguma influncia climtica. Vale salientar que fator climtico diferente de elemento do clima. Os fatores so externos ao clima, exercendo influncia direta no seu comportamento, como a latitude, altitude, relevo, etc. J os elementos correspondem a temperatura, umidade, presso, ou seja, internos ao clima. Os principais fatores climticos so: latitude, altitude, maritimidade/continentalidade, correntes martimas, relevo e a dinmica das massas de ar. Detalharemos todos a seguir:

186

GEOGRAFIA DO BRASIL
No caso especfico do Brasil, a posio geogrfica ou as latitudes condicionam temperaturas geralmente altas devido transferncia da energia solar para a superfcie terrestre, mas essas temperaturas so abrandadas em lugares mais altos, em latitudes mais distantes do Equador, e, em escala menor, em ambientes de maior ventilao, menor presso urbana e outros.

INTRODUO CLIMATOLOGIA

PRESSO

ELEMENTOS DO CLIMA
A TEMPERATURA
A temperatura atmosfrica o estado trmico do ar atmosfrico. Varia conforme a altitude e a latitude do lugar. Voc deve saber que a temperatura de um lugar de baixa altitude mais elevada que a temperatura de um lugar de alta altitude. Voc sabe tambm que a temperatura se eleva medida que nos aproximamos do Equador (baixa latitude) e diminui medida que nos aproximamos dos plos (alta latitude). Essa variao decorre da forma esfrica da Terra e da incidncia dos raios solares sobre a superfcie terrestre.

Corresponde fora provocada pelo peso do ar. medida que a altitude cresce a coluna de ar torna-se menor e, consequentemente, a presso diminui. A temperatura tambm influencia na presso atmosfrica; quanto a temperatura aumenta, o volume dos gases expande, assim, a presso atmosfrica diminui. Quando ocorre o resfriamento, h maior nmero de molculas por metro cbico e o ar torna-se mais pesado e com maior presso. A circulao atmosfrica ocasionada por diferena de presso (conforme a figura abaixo), seja em escala local ou planetria. A nica circulao que no depende de diferenas de presso a corrente dos alsios que so criados pelo movimento de rotao da Terra (fora de Corilis).

UMIDADE

O termo umidade corresponde quantidade de vapor de gua encontrado na atmosfera em determinado momento e pode ser expressa em nmeros absolutos (g/m3) e relativos (%). A umidade relativa expressa, em porcentagem, o quanto da capacidade mxima de vapor de gua h em um determinado volume de ar determinada temperatura. Quando h excesso de vapor de gua (acima do ponto de saturao) ocorrem as precipitaes. Chuva Orogrfica ou de relevo: Ao tentar ultrapassar obstculos naturais (barreiras de relevo), as massas de so obrigadas a ascenderem. Com o aumento da altitude, a temperatura diminui, o que gera a condensao do vapor de gua e a consequente precipitao. A vertente que recebe as massas de ar chama de Barlavento e possui vegetao mais densa; j a vertente menos mida denominada Sotavento. A chuva originada por este processo costuma ser intermitente e fina, sendo muito comum nas regies Sudeste e Nordeste do Brasil, onde h chapadas e serras que dificultam a penetrao das massas de ar midas. Chuva Frontal: Ocorre do encontro de duas massas de ar (frente) com caractersticas diferentes (uma quente e outra fria). A variao na precipitao e a abrangncia (em quilmetros quadrados) decorre da intensidade das massas, o que pode variar durante o ano. Chuva Convectiva: Tambm conhecida como chuva de vero. Nos dias de vero, o ar prximo superfcie aquecido e ascende. Ao atingir grandes altitudes, o vapor de gua se condensa e forma gotculas to pequenas que permanecem em suspenso. Com o resfriamento, o ar torna-se mais pesado e desce frio e seco, o que reinicia o ciclo. No final da tarde, o resultado uma nuvem enorme que causa chuvas torrenciais e rpidas.

Ventos: So movimentos de massas atmosfricas ocasionadas por diferenas de presso. Os ventos circulam das reas de alta presso para as de baixa presso.

FATORES DO CLIMA
ALTITUDE
O impacto da altitude no clima se faz segundo o seguinte esquema:

ALTITUDE MENOR MAIOR

TEMPERATURA MAIOR MENOR

187

GEOGRAFIA DO BRASIL
Alm disso, orientando o deslocamento das massas de ar de acordo com a disposio e altitude, o relevo pode agir como barreira para o deslocamento das massas de ar (como o caso das cordilheiras montanhosas) ou, se ele for baixo (plancies), facilitar esse deslocamento, formando verdadeiros corredores.

INTRODUO CLIMATOLOGIA

LATITUDE

A latitude caracteriza-se por ser o mais importante dos fatores climticos. Sem considerarmos os demais fatores que influem no clima, podemos afirmar que a temperatura do ar diminui com o aumento da latitude, uma vez que a fonte de calor, isto , a radiao solar, mais intensa na linha do equador, diminuindo no sentido dos plos. Sintetizando, quanto maior for a latitude de um lugar, menor ser a temperatura.

CONCEITOS IMPORTANTES EM CLIMATOLOGIA


Mdia Trmica a aritmtica das temperaturas em um determinado tempo. Amplitude Trmica a diferena entre a mxima e a mnima temperatura. Se em um determinado dia foi registrada a temperatura mxima de 25C e a mnima de 15C, a amplitude trmica desse dia ser 10C. Isotermas so linhas que traamos nos mapas para unir os pontos que tm as mesmas temperaturas ou as mesmas mdias trmicas.

CONTINENTALIDADE / MARITIMIDADE

Nas regies interioranas dos continentes, a distncia dos oceanos propicia a existncia dos efeitos da continentalidade, que acarreta na diminuio das chuvas e no aumento da amplitude trmica (diferena entre a maior e a menor temperatura), pois no sofre influncia direta das massas de ar vindas do oceano ou das correntes martimas. Em contra partida, nas regies mais prximas do mar ocorre uma influncia direta destes fatores. Como nas guas dos oceanos ocorre uma menor variao da temperatura (menor amplitude trmica), as reas continentais prximas sofrero esta influncia. Assim, via de regra, e excetuando-se os demais fatores que exercem influncia direta no clima, podemos afirmar que: Quanto maior a proximidade com o mar, menor ser a amplitude trmica da regio, ocorrendo o oposto nas reas interiores dos continentes.

EFEITO ESTUFA
Ao contrrio do que popularmente se acredita, a gnese do efeito estufa no causada pela poluio. Esse fenmeno atmosfrico acompanha a vida do planeta desde seus primrdios e decorre da ao bloqueadora, atravs dos gases da atmosfera, do calor refletido da irradiao solar pela superfcie terrestre. Esse efeito possibilita a manuteno das temperaturas da Terra em nveis que permitam a existncia da vida. Ocorre que, a partir do sculo XIX, esse efeito tem-se acentuado/acelerado. A queima de florestas tropicais e a utilizao cada vez maior de combustveis fsseis (petrleo, gs natural e carvo mineral), lanam na atmosfera grandes quantidades de gs carbnico (CO2). Esse gs um dos principais responsveis pelo efeito estufa, e no permite que a radiao solar, depois de refletida na Terra, volte para o espao, bloqueando o calor.

CORRENTES MARTIMAS

As correntes martimas so massas lquidas quentes ou frias que se deslocam como rios dentro dos oceanos, influindo na temperatura do ar atmosfrico por onde passam e por consequncia no clima. Vrias correntes martimas deslocam-se pelas guas que banham os continentes. Vamos destacar a corrente de Humboldt ou do Peru que se desloca dos mares da Antrtica em direo a linha do Equador, atravs do Oceano Pacfico. Sendo uma corrente fria (com temperaturas abaixo de 10C) resfria a regio por onde passa, trazendo grandes quantidades de peixes para o litoral oeste da Amrica do Sul. As massas de ar quente e midas vindas da parte Oeste do Oceano Pacifico (da Oceania), quando passam sobre a corrente martima fria se condensam, provocando chuvas no oceano. Quando esses ventos se dirigem ao continente j esto secos, formando o deserto mais seco do mundo, chamado de Atacama, localizado no litoral norte do Chile e sul do Peru. O mesmo ocorre na Amrica do Norte, com a corrente da Califrnia, provocando o aparecimento do deserto Mexicano e do deserto do Colorado, no oeste dos EUA.

188

GEOGRAFIA DO BRASIL

INTRODUO CLIMATOLOGIA
( ) As brisas terrestres e martimas so sistemas de ventos constantes causados pelas diferenas de umidade entre a superfcie terrestre e a aqutica. ( ) Durante o dia, a terra se aquece mais rapidamente do que a su perfcie aqutica, provocando uma baixa presso local em superfcie, sobre o continente, com ventos soprando do mar para a Terra. ( ) A brisa martima comea poucas horas depois do nascer do sol e a mais intensa durante o incio da tarde. ( ) noite, a terra se esfria lentamente, enquanto o mar permanece menos aquecido; o gradiente de presso , assim, invertido, e o vento sopra do mar para a terra. ( ) A brisa martima raramente traz chuva, porm oferece agradvel alvio ao calor intenso que durante o dia castiga muitas reas tropicais. 3. Responda a questo com base nas figuras abaixo.

ILHAS DE CALOR
Em uma cidade grande, como o caso de So Paulo, devido a enorme quantidade de gases txicos, lanados por automveis e industrias, somados aos edifcios que barram ou dificultam a penetrao dos ventos e canalizao das guas fato que diminui o resfriamento provocado pela evaporao -, conduzem comumente a ocorrncia de fenmenos como ilhas de calor, representado no esquema abaixo.

Ilha de calor: alterao do microclima urbano)

Observe que o pico de temperatura ocorre na rea central da cidade, sendo que s suas vizinhanas as temperaturas so normalmente menores. medida que samos da rea central, h diminuio na densidade de construes, aumento da ocorrncia de vegetao e, consequentemente, reduo das temperaturas.

EXERCCIOS
1.Assinale (V) verdadeiro ou (F) falso nas afirmativas a seguir: ( ) A presso atmosfrica varia com a altitude e com a temperatura ambiente. Em geral, a presso mais alta em lugares de maior altitude. ( ) O vento existe devido diferena de presso entre duas regies. O ar deslocasse de uma zona de baixa presso para uma zona de alta presso. ( ) Podemos afirmar que tempo o estado momentneo do ar e que clima uma sucesso habitual de muitos estados de tempo. ( ) O ciclo da gua ocorre devido aos fenmenos da evaporao, condensao e precipitao. ( ) As massas polares ocenicas apresentam baixa temperatura e podem provocar mudanas repentinas no tempo. 2. Observe a figura e analise as proposies colocando (V) verdadeiro ou (F) falso:

As afirmativas a seguir relacionam-se aos movimentos da atmosfera assinalados nos desenhos. I. So ventos sazonais, responsveis por perodos distintos de chuvas no vero e secas no inverno, regulando a cultura do arroz. II. So ventos monnicos, direcionados pela diferena de presso atmosfrica existente entre o oceano e o continente. III. No inverno, as chuvas so reduzidas em funo do deslocamento do centro de alta presso, direcionando os ventos de uma zona ciclonal para zonas de alta presso. IV. Alm de soprar no sul e sudeste asitico, esses ventos so comuns na costa oeste do sul da frica, contribuindo para a formao do Deserto da Nambia. (PUC/RS - 2002) Pela anlise das afirmativas, conclui-se que esto CORRETAS as alternativas: a) I e II d) II e IV b) I, II e III e) III e IV c) I, III e IV

189

GEOGRAFIA DO BRASIL
4. Relacione as colunas indicando os tipos de chuvas: a) De relevo b) Convectiva c) Frontal ( ) o encontro com barreiras de montanhas provocam chuvas nas encostas. ( ) provocada pelo encontro de uma massa de ar quente com uma massa fria. ( ) provocada pela intensa evapo-transpirao principalmente em regies tropicais. 5. Relacione as colunas indicando os fenmenos descritos: a) Quanto mais longe do Equador mais inclinados so os raios solares. b) O ar mais rarefeito provoca a diminuio da atmosfera. c) A terra se resfria e se aquece mais rapidamente que a gua. ( ) altitude ( ) continentalidade ( ) latitude

INTRODUO CLIMATOLOGIA
O texto exemplifica uma importante alterao socioambiental, comum aos centros urbanos. A maximizao desse fenmeno ocorre a) Pela reconstruo dos leitos originais dos cursos dgua antes canalizados. b) Pela recomposio de reas verdes nas reas centrais dos centros urbanos. c) Pelo uso de materiais com alta capacidade de reflexo no topo dos edifcios. d) Pelo processo de impermeabilizao do solo nas reas centrais das cidades. e) Pela construo de vias expressas e gerenciamento de trfego terrestre. 9. (PUCRJ) DESERTOS: Domnios que cobrem 2/9 da superfcie continental da Terra

6. (UEL) Considere as seguintes afirmativas: I. A temperatura aumenta dos plos em direo ao Equador. II. A temperatura diminui a medida que a altitude aumenta. III. A temperatura do litoral regularizada pela proximidade das guas ocenicas (maritimidades). IV. A temperatura do litoral sempre mais alta que o interior. V. Cidades localizadas em latitudes diferentes nunca apresentam temperaturas semelhantes. So CORRETAS apenas as afirmativas a) I, II e III d) II, IV e V b) II, II e IV e) III, IV e V c) I, III e IV 7. A atmosfera a camada de ar que envolve o nosso planeta. Considerando essa camada importante, assinale a proposio que esteja correta. a) As partculas que compem a atmosfera no se distribuem de forma homognea nos diversos ambientes da superfcie terrestre. b) A atmosfera composta de vrios gases cujas propores no variam em funo da altitude. c) A estratosfera a camada em que ocorre a maior parte dos fenmenos metereolgicos, como as chuvas e os ventos. d) A troposfera, primeira camada da atmosfera, apresenta ar bastante rarefeito e temperatura estvel. e) A maior quantidade de oznio encontrada na troposfera, e ele importante porque reflete as ondas de rdio. 8. O fenmeno de ilha de calor o exemplo mais marcante da modificao das condies iniciais do clima pelo processo de urbanizao, caracterizado pela modificao do solo e pelo calor antropognico, o qual inclui todas as atividades humanas inerentes sua vida na cidade.
BARBOSA, R. V. R. reas verdes e qualidade trmica em ambientes urbanos: estudo em microclimas em Macei. So Paulo: EdUSP, 2005.

Fonte: google.imagens.com.br

Compreende-se hoje que os desertos so domnios morfoclimticos fundamentais para o equilbrio ecolgico do planeta. a) Explique a tendncia s altas amplitudes trmicas dirias nesses ambientes. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Justifique como a baixa pluviosidade mdia nos desertos impede que os seus solos sejam bem desenvolvidos para a agricultura. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

190

GEOGRAFIA DO BRASIL
10. O mapa abaixo indica a ocorrncia de queda de neve na Amrica do Sul. Observe o mapa e responda s questes.

UNIDADE 6 CLIMAS DO BRASIL


Os elementos climticos que estudamos at aqui ocorrem simultaneamente num mesmo lugar e percebemos que se alteram com o passar do tempo. Em cada lugar temos uma sucesso de estados atmosfricos durante o ano, que se repete com maior ou menor variao a cada ano, caracterizando assim o clima de cada lugar. No Brasil atuam 5 massas de ar, cujos movimentos iro caracterizar as variedades climticas, j que elas so portadoras de uma determinada combinao de elementos climticos (temperatura-umidade-presso).

MASSAS DE AR
Podemos considerar que massas de ar so pores de atmosfera onde predominam caractersticas fsicas homogneas (temperatura, presso, umidade, densidade). Como o planeta aquecido diferentemente em suas vrias latitudes, temos a formao, basicamente de trs tipos de massas de ar: Equatoriais, Tropicais e Polares. Estas massas esto em constante movimento, normalmente as Equatoriais, mais quentes, se deslocam para as reas polares e as Polares mais frias vo, por cima, para as regies equatoriais, o que leva a um equilbrio trmico da atmosfera como um todo. Ao se deslocarem as massas de ar vo alterando suas dimenses e caractersticas fsicas, at se dissiparem. Conforme as reas de origem das massas de ar, ainda podemos diferenci-las em Ocenicas e Continentais. mEa: Massa Equatorial Atlntica quente e mida provoca chuvas, principalmente, nas zonas litorneas do Norte e Nordeste Ocidental. mEc: - Massa Equatorial Continental quente e mida tem seu centro na Amaznia, sendo responsvel pelas chuvas intensas na regio. No vero, sua atuao atinge o Nordeste e Centro-Oeste. mTc: Massa Tropical Continental (Massa do Chaco) quente e seca atua principalmente no inverno, na poro oeste do Mato Grosso e Mato Grosso do Sul. mTa: Massa Tropical Atlntica quente e mida tem grande atuao em toda a fachada Atlntica Oriental, onde ocasiona as chuvas de relevo. mPa: Massa Polar Atlntica fria e mida origina-se no sul do continente. durante o inverno sua ao expande-se, provocando chuvas no litoral do Nordeste, a friagem no sul da Amaznia e as baixas temperaturas do Centro Sul do pas.

a) Que fatores climticos determinam a distribuio geogrfica da ocorrncia de queda de neve na Amrica do Sul? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Quais so as condies momentneas de estado de tempo necessrias para a ocorrncia de precipitao em forma de neve? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

191

GEOGRAFIA DO BRASIL

CLIMAS DO BRASIL
I. Equatorial: quente e mido, com temperaturas mdias entre 24 e 26C, amplitudes trmicas pequenas at 3C e chuvas abundantes superiores a 2000 mm/ano. II. Tropical: quente e caracterizado pela existncia de duas estaes no ano, vero chuvoso e inverno seco, exceto para o litoral Nordestino, entre Salvador e o Rio Grande do Norte, onde chove no inverno. As mdias trmicas variam de 22 a 27C e a amplitude trmica pode chegar a 5C; as chuvas sero superiores a 1000 mm, mas variaro de regio para regio. III. Semi-rido: quente com mdias trmicas superiores a 24C e pequenas amplitudes trmicas (menores que 3C). As chuvas so irregulares e mal distribudas, fazendo surgir o polgono das secas. IV. Tropical de Altitude: predomina nas partes mais elevadas do Planalto Atlntico, chegando at o Mato Grosso do Sul. Apresenta mdias trmicas menores (18 a 22C) e amplitudes trmicas maiores (at 7C). No inverno pode apresentar geadas. As precipitaes situar-se-o entre 1000 e 1500 mm/ano.

Massas de ar que atuam sobre a Amrica do Sul

CLASSIFICAO CLIMTICA
A quantidade de chuvas , em geral, boa. O pas recebe em mdia 1000 mm/ano. Porm sua distribuio, durante o ano e pelas regies, no uniforme, permitindo-nos reconhecer trs tipos de reas: reas com precipitaes abundantes: mais de 2000 mm/ ano. - Serra do Mar (SP), Amaznia Ocidental e litoral sul da Bahia. reas com precipitaes satisfatrias: entre 1000 e 2000 mm/ano atinge o Centro-Oeste, a maior parte do Sudeste e o sul do pas. reas com chuvas escassas: menores que 1000 mm/ ano compreendem Serto Nordestino e vale mdio do R. So Francisco, chegando at o norte de Minas Gerais. Existem vrias classificaes climticas para o Brasil. Aqui trabalharemos com a de Lisia Bernardes:

V. Subtropical: predomina na regio Sul no norte do Paran e no extremo sul do Mato Grosso do Sul. um clima menos quente, com mdias trmicas inferiores a 20C, chuvas abundantes e bem distribudas entre 1500 e 2000 mm/ano. No inverno pode chegar a apresentar nevascas. VI. Tropical mido: tpico do litoral oriental, temperaturas elevadas e chuvas de inverno (NE) e de vero (SE). Sugesto de vdeo: O poder da Terra: Atmosfera, BBC.

EXERCCIOS
1. (UEPB) Observe os pluviogramas abaixo. Neles os ndices pluviomtricos esto representados pelas colunas, enquanto que a variao de temperatura representada pela linha. Com base na leitura dos grficos, identifique as respectivas descries feitas dos mesmos.

192

GEOGRAFIA DO BRASIL
( ) Clima semirido com chuvas de vero e outono. Apresenta baixo ndice pluviomtrico e baixa amplitude trmica com temperaturas elevadas durante todo o ano. ( ) Clima subtropical, com chuvas bem distribudas durante todo o ano e alta amplitude trmica, com veres quentes e invernos frios. ( ) Clima equatorial, com chuvas abundantes e temperaturas elevadas durante todo o ano, no apresenta estao seca. ( ) Clima tropical litorneo sob a influncia dos alsios, com chuvas abundantes no inverno, estao na qual as temperaturas elevadas declinam. A alternativa que apresenta a sequncia CORRETA : a) 4 3 2 1 b) 3 4 2 1 c) 3 1 2 4 d) 3 4 1 2 e) 1 2 4 3 2. (Puc-RS) No Brasil, a variedade de climas existentes est relacionada a diferentes fatores. Entre aqueles considerados dinmicos, temos as massas de ar. Em virtude da grande extenso territorial que o Brasil possui, nosso pas apresenta cinco massas de ar agindo sobre o territrio, cada uma delas apresentando caractersticas relativas temperatura e umidade. Por exemplo: a Massa ________ caracteriza-se como ________. a) Equatorial Atlntica - quente e mida b) Equatorial Continental - fria e mida c) Tropical Atlntica - fria e seca d) Tropical Continental - quente e mida e) Polar Atlntica - fria e seca 3. (UFPE) Um grupo de cinco vestibulandos estava discutindo a seguinte matria publicada no jornal Folha de So Paulo. Mudana de clima provoca chuvas Em apenas um dia, a cidade de Ribeiro Preto registrou mais chuvas do que em todo ms de agosto. De acordo com o coordenador do Lab- Geo, as oscilaes climticas registradas no fim de semana clima frio no sbado, ameno anteontem e um pouco mais frio ontem foram consequncias de duas massas de ar frio.
Folha de S. Paulo 03/09/2002

CLIMAS DO BRASIL
c) O ttulo da matria est correto, pois as mudana climticas provocam sempre chuvas fortes. d) No se pode falar em oscilaes climticas semanais; tais oscilaes verificam-se em outra escala temporal, bem superior a semanas ou meses. 4. De acordo com o mapa climtico do Brasil, assinale a alternativa CORRETA:

a) Na rea l, verifica-se uma estao seca prolongada. b) Na rea 2, registram-se as menores temperaturas mdias do pas. c) Na rea 3, a ao da massa equatorial continental responsvel pela intensa precipitao. d) Na rea 4, a influncia da altitude ameniza a temperatura. e) Na rea 5, a ao da massa equatorial atlntica responsvel pela aridez do interior. 5. Observe o mapa abaixo e identifique os tipos climticos do Brasil.

Houve quatro opinies diferentes sobre esta matria. Est INCORRETA apenas a afirmativa. a) O ttulo da matria est errado, pois, na escala considerada, as chuvas foram acarretadas por mudanas no tempo meteorolgico. b) A matria est equivocada, uma vez que confunde o clima com o tempo, que so dois aspectos da baixa atmosfera distintos.

193

GEOGRAFIA DO BRASIL
Faa a associao CORRETA: Climas I. Tropical Continental. II. Equatorial. III. Semi-rido. IV. Subtropical. Caractersticas ( ) Chuvas bem distribudas durante o ano, mdias trmicas entre 17C e 19C, chuvas entre 1.250 e 2.000 mm anuais. ( ) Chuvas escassas e mal distribudas, mdias trmicas acima de 25C, baixos ndices pluviomtricos. ( ) Duas estaes bem definidas, com mdias trmicas entre 19C e 27C e pluviosidade mdia anual de 1.500 mm. ( ) Mdias trmicas entre 25 e 27C, pequena amplitude trmica, elevados ndices pluviomtricos(superiores a 2.000mm anuais) e chuvas o ano todo. 6. (UFF-RJ) O ecossistema amaznico abriga cerca de 80 mil espcies vegetais e 30 milhes de espcies animais. Toda essa riqueza em biodiversidade resulta de integrao de diversos fatores ecolgicos, dentre os quais destaca-se a dinmica das massas de ar que regulam as condies climticas da regio. Pode-se afirmar que, na Amaznia, ocorre: a) o domnio das massas de ar Equatorial Atlntica e Equatorial Continental, que contribuem para a alta pluviosidade e para as elevadas temperaturas mdias na regio. b) O predomnio da massa da massa Tropical Atlntica no inverno, que desloca a Massa Equatorial Pacifica e provoca elevadas pluviosidade e temperatura, no vero. c) O permanente deslocamento de massa Tropical Pacfica carregada de umidade para o centro da regio, promovendo fortes chuvas ao longo do outono e da primavera. d) O controle das massas Tropical Continental e Equatorial Atlntica, dividindo a regio em duas estaes bem definidas - quente e seca no vero, chuvosa e fria no inverno. 7. (UNICAMP) Os climogramas abaixo representam dois tipos climticos que ocorrem em territrio brasileiro. Observe-os e responda:

CLIMAS DO BRASIL
a) A que tipos climticos se referem as figuras 1 e 2, respectivamente? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Qual a vegetao caracterstica das respectivas regies? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. (UEL-2012) Analise a figura a seguir.

A figura ilustra as massas de ar que atuam na dinmica atmosfrica do Brasil: equatoriais, tropicais e polares que resultam em diferentes tipos climticos. a) Quais as massas que atuam na regio Sul do Brasil? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Como denominado o tipo climtico predominante e quais so as caractersticas do clima que atua nessa regio? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

194

GABARITOS

GABARITOS
UNIDADE 1
1. 24 3. C 2. F,F,V,V,V. 4. D 5. D 6. E

afastam uma da outra; Convergentes ou destrutivos: so os que acontecem quando duas placas se movem uma em direo outra, podendo ocorrer uma subduco (quando uma das placas mergulha sob a outra) ou uma formao de montanhas (quando as placas colidem, se comprimem e se erguem). 8. Ver unidade

7. a) O IBGE dividiu o Brasil em cinco macrorregies geogrficas, a saber: Norte, Nordeste, Centro-Oeste, Sudeste e Sul (diviso oficial). b) As regies geoeconmicas (ou complexos regionais) do Brasil so: Amaznia, CentroSul e Nordeste. N a delimitao das regies geoeconmicas (ou complexos regionais), o critrio bsico foi a diviso regional do trabalho, ou seja, a estrutura produtiva dominante em cada regio, sem levar em conta os limites polticos territoriais dos estados. c) A diviso oficial adotada pelo IBGE, composta de cinco macrorregies, est fundamentada na combinao das caractersticas econmicas, naturais e demogrficas, mantendo na diviso regional o limite poltico-administrativo dos estados.

UNIDADE 3
1. a 5. d 2. b 6. d 3. a 7. d 4. b 8. e

UNIDADE 2
1. d 2. b 3. 02 + 04 + 16 = 22 4. b 5. d 6. d

9. Os planaltos so superfcies irregulares (planas ou acidentadas) de estruturas cristalinas ou sedimentares, nos quais predominam os processos erosivos. Localizam-se, geralmente, acima de 300m de altitude e apresentam bordas em declive. Exemplos: Planaltos Norte-Amaznicos (Regio Norte); Planalto da Borborema (Regio Nordeste); Planalto Central (Regio Centro-Oeste), Planalto Meridional (Regio Sul), entre outros. As plancies so reas essencialmente planas geradas pela deposio de sedimentos recentes de origem marinha, lacustre ou fluvial. Predominam, portanto, os processos de sedimentao. As altitudes mdias variam, geralmente, entre 0 e 100 metros, podendo ocorrer tambm em nveis mais elevados nas regies interplanlticas e/ou intermontanas, podendo aparecer em vrios nveis topogrficos do pas. Exemplos: Plancie do Rio Amazonas (Regio Norte); Plancie do Pantanal Matogrossense (Regio Centro-Oeste), Plancie Costeira (Litornea), entre outras. 10. a) Ver unidade b) O relevo influencia a vida nas cidades, pois se estas esto em fundos de vale, por exemplo, correm o risco de inundaes; se esto em declives, desmoronamentos. Deve-se ter uma gesto municipal levando em conta a dinmica do relevo

7. a) A teoria da deriva continental, criada pelo alemo Alfred Wegener no comeo do sculo XX, propunha a hiptese de que uma nica massa continental, chamada Pangeia, teria comeado a se dividir h 200 milhes de anos, formando os continentes. Isso teria sido possvel pelo fato de a camada mais exterior da Terra estar composta pela litosfera, que inclui a zona solidificada (continentes), e pela astenosfera, que inclui a parte mais interior, o substrato viscoso citado no texto do enunciado. Segundo o cientista, os continentes se moviam sobre o assoalho ocenico devido ao das foras gravitacionais o que se provou errado. Mais tarde, outros cientistas defenderam que o movimento determinado pela ao das foras geradas pelas correntes de conveco do manto terrestre. Portanto os continentes so a parte visvel das placas tectnicas que flutuam e derivam ao longo de milhes de anos o que justifica a expresso deriva continental , seguindo a direo indicada no mapa do enunciado. b) As placas tectnicas apresentam na sua periferia as zonas de contato, formando trs tipos de limites: Transformantes ou conservativos: so os que acontecem quando as placas deslizam ao longo das falhas e se atritam com as suas vizinhas. Ocorrem com o movimento vertical ou epirogentico; Divergentes ou construtivos: so os que acontecem quando duas placas se

UNIDADE 4
1.e 2.e 3.a 4. 1+8= 9 5.d 6.e

7. a) Entre os motivos da preocupao em relao qualidade e quantidade da gua esto: a sua contaminao pelo uso de agrotxicos, a contaminao por esgotos no tratados e por produtos qumicos industriais. Dentre as aes que poderiam ser implantadas destacam-se o efetivo controle e scalizao do uso de agrotxicos e dos produtos qumicos utilizados pela indstria, consumidos e no consumidos pela sociedade; a ampliao de medidas e da infraestrutura de saneamento visando melhorar o processo de descontaminao do tratamento de esgoto domiciliar e industrial (poluio); e a utilizao racional da gua dos aquferos, visando sua preservao; alm da reconstituio das matas ciliares dos cursos hdricos.

195

GEOGRAFIA DO BRASIL
b) Entre as alteraes ambientais causadas pela sociedade no solo urbano esto o desmatamento, o aumento das reas impermeabilizadas e o assoreamento dos cursos hdricos. 8. a) O bioma que ocorre na rea da transposio do So Francisco a Caatinga. Esse bioma apresenta clima tropical semi-rido, vegetao de arbustos de porte mdio, normalmente com espinhos (vegetao xerfita), solos rasos e rios intermitentes. b)Impactos positivos: possibilidade de irrigao e aumento da rea agrcola; perenizao de rios; maior disponibilidade de gua para o abastecimento urbano. Impactos negativos: risco de salinizao dos solos; eventual alterao de flora e fauna da regio atingida; possibilidade de concentrao de terras; reduo da vazo do So Francisco a jusante da rea de captao em anos muito secos.

GABARITOS

UNIDADE 6
1. d 3. c 2. a 4. d 6.a

5. IV, III, I, II

7. a) O climograma 1 refere-se ao clima subtropical e o 2 ao clima semirido. b) No clima subtropical (climograma 1), a vegetao caracterstica a mata de araucria e os campos; no semirido (climograma 2), a caatinga. 8. a) So as massas de ar tropicais e polares. b) O tipo de cima predominante o subtropical mido e as caractersticas do clima so: veres quentes, queda sensvel de temperatura durante o inverno, maiores amplitudes trmicas anuais do pas e chuvas regulares durante o ano.

UNIDADE 5
1. F,F,V,V,V 3. a 6. a 2. F,V,V,F,V 5. B,C,A 4.a,c,b 7. a 8. d

9. a) Como so ambientes que conservam baixa umidade no ar devido escassez de guas superficiais e cobertura vegetal, os desertos perdem a maior parte da energia que entra no sistema durante o dia (atravs da insolao) durante a noite, quando no h mais radiao solar. A sada sem retenes da energia provoca uma queda acentuada de temperatura, afetando a amplitude mdia diria do ambiente. b) A baixa pluviosidade mdia reduz a decomposio qumica das rochas, tornando os solos do deserto arenosos e pedregosos (j que sofrem mais decomposio fsica), o que afetar a formao dos seus horizontes e sua qualidade para o desenvolvimento da agricultura. 10) a) A ocorrncia de precipitao de neve na Amrica do Sul est associada especialmente s elevadas altitude e latitude, o que explica a sua ocorrncia na poro mais sul da Amrica do Sul e mais a oeste, associada Cordilheira dos Andes. b) As condies momentneas de estados de tempo para a ocorrncia de precipitao de neve so as temperaturas baixas (prximas de zero) e elevada umidade do ar.

196

GEOGRAFIA GERAL
199 Seus principais pontos de anlise ........... 199 A terra e seus movimentos .......................... 199 As estaes do ano ...................................... 200 Zonas climticas .......................................... 200 Hemisfrios ................................................. 200 Orientao ..................................................... 200 Exerccios ..................................................... 201

BSICAS 01 NOES E GEOGRAFIA

pg

210 Industrializao .......................................... 210 As trs revolues industriais ..................... 211 Tipos de indstrias e localizao ................. 211 Ordens internacionais ................................. 211 Movimentos de trabalhadores ................... 212 Exerccios ..................................................... 212

04

A INDUSTRIALIZAO MUNDIAL

pg

202 Fuso horrio ................................................ 202 Exerccios ..................................................... 203

02 03

COORDENADAS GEOGRFICAS

pg

205 Projees cartogrficas ............................... 205 Classificao das projees ................... 205 Projeo de Mercator .............................. 206 Projeo de Peters ...................................... 206 Escala ........................................................... 206 Perfil topogrfico ...................................... 207 Exerccios ..................................................... 208

CARTOGRAFIA

pg

214 Origem da Dit .............................................. 214 Consolidao da Dit ..................................... 214 Mundializao do capital ......................... 214 A mais nova Dit ............................................. 215 Exerccios ..................................................... 215

05

EVOLUES NO MUNDO DO TRABALHO

pg

217 As fases ou etapas do capitalismo .............. 217 Exerccios ..................................................... 219 Gabaritos ...................................................... 220

06

CAPITALISMO

pg

NOES BSICAS E GEOGRAFIA

UNIDADE 1 NOES BSICAS E GEOGRAFIA


SEUS PRINCIPAIS PONTOS DE ANLISE
Estudar Geografia uma forma de entendermos o mundo em que vivemos. Por meio deste estudo podemos entender melhor tanto o nosso local de moradia, quanto o nosso pas ou o mundo contemporneo. Neste contexto, o objetivo principal desta cincia o estudo do espao geogrfico (o espao da sociedade humana), sobre o qual os homens constroem, destroem e reconstroem permanentemente, atravs das indstrias, agricultura, das cidades, etc. As modificaes que as sociedades produzem em seus respectivos espaos so hoje muito mais intensas que no passado, fato este que tem acarretado em srias conseqncias ambientais que pe em risco a perpetuao da espcie humana. Costuma-se dizer que nos dias atuais o mundo cabe na palma de nossas mos, veja o caso do advento da Internet, do avano nos meios de comunicaes e dos transportes. claro que estas novas tecnologias esto acessveis apenas para alguns, conforme o nvel de riqueza de cada um. Este mundo cada vez mais complexo e intrigante, carregado de desigualdades sociais e injustias e ao mesmo tempo cheio de esperana no que se refere as necessrias mudanas, o principal motor de nosso estudo. Para tanto iniciaremos este captulo com o estudo dos aspectos gerais de nosso planeta: a TERRA.

O movimento de rotao da Terra traz como consequncias: Sucesso dos dias e das noites. Dilatao da regio do Equador e achatamento dos plos. Desvio de ventos e correntes martimas para Oeste (fora de Corilis). Movimento de Translao: o movimento que a Terra executa em torno do sol em rbitas elpticas, ou seja, apresentando uma variao da sua distncia em relao ao sol: Aflio (perodo em que a Terra est mais afastada em relao ao sol 152.000.000 Km) e Perilio (perodo em que a Terra est mais prxima do sol 147.000.000 Km). Este movimento apresenta as seguintes caractersticas: Durao do movimento: 365d 5h e 48m (as 6 horas aproximadas que sobram de cada ano, so contabilizadas de 4 em 4 anos, quando temos o ano com 366 dias); Velocidade: 107.000 Km/h. O movimento de translao da Terra traz como consequncias: Sucesso dos anos. Em conjunto com o eixo de inclinao da Terra, d origem s estaes do ano. Inclinao da Terra (obliqidade da eclptica): a inclinao do plano da linha do Equador em relao ao plano de translao, na medida de 23o 2730. Esta inclinao influencia diretamente da distribuio da iluminao na superfcie terrestre, conforme o perodo do ano. O planeta Terra no uma esfera perfeita. Aps a utilizao de novas tecnologias, os cientistas chegaram a concluso de que h um achatamento nos plos e um maior dimetro na linha equatorial. Isto ocorre devido ao movimento de rotao da Terra. Confira suas medidas: Dimetro polar: 12.713 Km Dimetro equatorial: 12.756 Km Circunferncia polar: 40.009 Km Circunferncia equatorial: 40.076 Km Devido a estas caractersticas especficas, nosso planeta no possui uma forma definida, sendo conhecida como um geide ou elipside de rotao.

A TERRA E SEUS MOVIMENTOS


A partir do sol, a Terra o terceiro planeta do sistema solar, a uma distncia aproximada de 150.000.000 Km, posio esta que conferiu ao planeta as condies ideais para a existncia da vida animal e vegetal. Movimento de Rotao: o movimento que a Terra faz em torno do seu prprio eixo imaginrio, apresentando as seguintes caractersticas: Sentido do movimento: de OESTE (W) para LESTE (E). Durao do movimento: 23h 56m e 4 s (aproximado 24h). Velocidade na linha do Equador: 1.669 Km/h (aproximado).

199

GEOGRAFIA GERAL

NOES BSICAS E GEOGRAFIA


Zonas Temperadas: Tanto no hemisfrio Sul quanto no Norte, a faixa temperada localiza-se entre os trpicos e os crculos polares. Localiza-se assim nas mdias latitudes, onde os raios solares incidem inclinados, diminuindo a insolao e as temperaturas. Zonas Polares: Na regio dos plos, rea das altas latitudes, entre os crculos polares e os plos, os raios solares incidem de maneira muito inclinada, diminuindo drasticamente a insolao e por conseqncia apresentando temperaturas muito baixas (a menor registrada foi no Plo Sul Geogrfico, onde localiza-se a Estao Antrtica da Rssia : -89.2 oC)

AS ESTAES DO ANO
Considerando-se a esfericidade da Terra em conjunto com a inclinao do seu eixo, os hemisfrios Norte e Sul, durante o movimento de Translao, no recebem a mesma quantidade de luz solar, o que resulta nas estaes do ano, apontando dois extremos: Solstcios: A circunferncia equatorial est a 23o2730 da eclptica, sendo este, o momento de maior afastamento entre o Plano da rbita e o Plano do Equador. Ocorre em 21 de junho e 21 de dezembro. Os hemisfrios recebem iluminao desigual. Um dos plos encontra-se iluminado e outro na escurido total. Solstcio de Vero: Maior perodo de dia do ano. Solstcio de inverno: Maior perodo de noite do ano. Equincios: A circunferncia equatorial coincide com a eclptica. Isto , o Plano da rbita coincide com o Plano do Equador. Ocorre em 21 de maro e 23 de setembro. Os dois hemisfrios recebem a mesma quantidade de luz. Nesse caso os perodos de dia e de noite possuem a mesma durao. Ou seja, nos equincios os dias e as noites so iguais em durao.

HEMISFRIOS
A palavra hemisfrio significa metade da esfera. Assim, a Terra dividida em quatro hemisfrios, recebendo cada um trs tipos de nomes, conforme esquema abaixo:

ORIENTAO ZONAS CLIMTICAS


Os paralelos principais que cortam a superfcie terrestre de Leste para Oeste so importantes porque servem de limite para as Zonas Climticas da Terra. Assim, temos as seguintes zonas:

Zona Tropical: a regio das baixas latitudes, entre os trpicos (tambm conhecida como Zona Intertropical). a faixa de terras que recebe a maior quantidade de insolao, pois prximo a Linha do Equador os raios solares incidem verticalmente.

No mundo contemporneo, a necessidade de localizar-se no espao geogrfico cada vez maior em vrias profisses. Neste contexto, um dos instrumentos mais antigos para localizao a rosa dos ventos, que trs os pontos cardeais, colaterais e ainda quando necessrio, os subcolaterais, dando as direes na superfcie terrestre. Com o auxlio do professor, complete a rosa dos ventos ao lado com as direes corretas (lembre-se que na padronizao internacional colocamos apenas as iniciais dos nomes que indicam as direes, que no caso so em ingls):

200

GEOGRAFIA GERAL

NOES BSICAS E GEOGRAFIA


IV. A longitude o afastamento, medido em graus, de um meridiano em relao a outro, chamado meridiano de Greenwich. V. Quando se projeta a rede de paralelos e meridianos sobre o papel, tem-se uma projeo cartogrfica. Assinale: a) Se todas so corretas: b) Se apenas I, II e III so corretas. c) Se apenas I, IV e V so corretas. d) Se apenas II, III e V so corretas. e) Se apenas II, IV e V so corretas. 5. (UFRN) Analise a figura abaixo e assinale a opo que corresponde, respectivamente, s coordenadas geogrficas dos pontos X e Z.

EXERCCIOS
1. (UFRJ) Observe com ateno o desenho a seguir.

De acordo com o desenho, considerando que so 18 horas, se a bola for chutada do centro em direo aos pontos A, B e C respectivamente, as direes percorridas sero: a) Leste, norte, noroeste b) Oeste, sul, sudeste c) Leste, sul, sudoeste d) Oeste, norte, noroeste e) Sul, leste, noroeste

X
2. (MACKENZIE-SP) Preencha o espao em branco com a alternativa que convm: O Brasil localiza-se a oeste do meridiano inicial ou de Greenwich, situando-se, portanto, inteiramente no hemisfrio ocidental. Sendo cortado ao norte , pela linha .................., apresenta 7% de suas terras no hemisfrio ................. e 93% no hemisfrio................., ao sul cortado pelo trpico de....................... . a) Do equador - setentrional - meridional - capricrnio b) Do meridiano de Greenwich - meridional - setentrional - Cncer c) Inicial - oriental - ocidental Cncer d) Do equador - ocidental - oriental - Cncer e) Do meridiano de Greenwich - setentrional - meridional - Cncer 3. Quando os raios solares atingem perpendicularmente ao trpico de Capricrnio, ocorre: a) Solstcio de vero no hemisfrio sul b) Solstcio de inverno no hemisfrio sul c) Solstcio de vero no hemisfrio norte d) Equincio 4 (FESP) Examine atentamente as sentenas a seguir e assinale o grupo das que lhe parecerem corretas. I. Paralelamente ao Equador ficam dispostos crculos que diminuem de tamanho proporo que esto mais prximos dos plos. II. A latitude de um lugar medida em km e representa a distncia entre dois pontos na superfcie do planeta. III. As coordenadas geogrficas compreendem a latitude, a longitude, a distncia em metros em relao ao nvel do mar e as isoietas.

Z 30o de Latitude Sul 90o de Longitude Leste 90o de Latitude Norte 30o de Longitude Oeste 30o de Latitude Norte 90o de Longitude Oeste 90o de Latitude Sul 30o de Longitude Leste

a) b) c) d)

60o de Latitude Sul 15o de Longitude Oeste 15o de Latitude Norte 60o de Longitude Leste 60o de Latitude Norte 15o de Longitude Leste 15o de Latitude Sul 60o de Longitude Oeste

6. Marque V (verdadeiro) ou F(falso). a) ( ) O movimento de rotao da Terra gera o dia e a noite, e diferenas no horrio dos diversos pontos longitudinais da Terra. b) ( ) O meridiano de Greenwich, referencia para a latitude.

c) ( ) Latitude a medida, em graus, de qualquer lugar at o Equador. d) ( ) A escala expressa o quanto a realidade foi reduzida para se caber em um mapa. Ela pode ser numrica ou grfica. 7. Quais so as consequncias geradas pelos movimentos de rotao e translao e suas influncias no cotidiano da sociedade? 8. Quais concepes foram criadas pelo homem para auxiliar sua orientao no espao terrestre?

201

COORDENADAS GEOGRFICAS

UNIDADE 2 COORDENADAS GEOGRFICAS


As coordenadas geogrficas so linhas imaginrias traadas na superfcie terrestre de Leste (E) para Oeste (W) paralelo e de Norte (N) para Sul (S) meridiano. O cruzamento de um paralelo com um meridiano localiza precisamente qualquer ponto na superfcie terrestre. Paralelos: Crculos imaginrios a partir da Linha do Equador 0o, variando at os plos 90. As medidas em graus entre os paralelos so chamadas de latitude.

Em resumo, teremos:

Latitude: distncia em graus de qualquer ponto do planeta at o Equador. Longitude: distncia em graus de qualquer ponto do planeta at o Meridiano de Greenwich.

FUSO HORRIO
Enquanto os paulistanos esto tomando caf da manh (9 horas), os franceses almoam (13 horas), os indianos tomam o ch da tarde (17 horas), os tailandeses jantam (19 horas) e os australianos de Sydney se preparam para dormir (22 horas).
Marcelo Duarte, O guia dos curiosos, Companhia das Letras, p. 405.

Meridianos: Linhas imaginrias perpendiculares a linha do Equador, passando pelos plos. A partir do meridiano de Greenwich 0o, teremos 180o de longitude tanto para o hemisfrio Oriental quanto para o Ocidental, at a Linha Internacional de Mudana de Data, oposta ao Meridiano de Greenwich. As coordenadas geogrficas (paralelos e meridianos) O movimento de rotao da Terra responsvel direto pela ocorrncia dos dias e das noites e por consequncia das diferenciaes de horas na superfcie terrestre. Quando o relgio marca meio-dia em Braslia, os japoneses de Tquio esto do lado oposto iluminao solar, iniciando as 0:00 horas de um novo dia. Como a Terra gira de Oeste (W) para Leste (E) e convencionouse que o meridiano de 0o passaria sobre a cidade de Londres, todas as terras do LADO ORIENTAL sempre estaro com suas horas adiantadas em relao ao hemisfrio ocidental. Para entendermos como foram convencionados os fusos-horrios, observe o esquema abaixo: TERRA: circunferncia na linha do Equador 360 ROTAO: movimento em torno de si mesma 24h RESULTADO: a partir da diviso de 360 / 24h = 15 (espao de um fuso)

202

GEOGRAFIA GERAL
Assim: FUSO HORRIO: so faixas imaginrias entre meridianos, na medida de 15, que equivale ao tempo de 1 hora. O primeiro fuso tem no seu centro o meridiano de Greenwich, assim, a partir de 7 o 30 para o Ocidente e 7 o 30 para o Oriente, teremos os demais fusos de 15 o em 15 o.

COORDENADAS GEOGRFICAS
corretamente seus movimentos. Desse modo, a aterrissagem torna-se possvel mesmo durante a noite e sob mau tempo (nevoeiro, por exemplo), quando o piloto no tem boa visibilidade da pista onde dever pousar. O radar um complexo aparelho eletrnico, muito utilizado para orientar a navegao area e martima. O radar possui uma antena, que emite ondas de rdio. Ao se chocarem contra um avio ou um navio, essas ondas retornam a seu ponto de origem, onde so captadas por um aparelho receptor, que as transforma em impulsos eltricos. Esses impulsos so transmitidos a uma tela, semelhante de um televisor, onde aparecem sob a forma de sinais luminosos. Ento, pela tela do radar possvel acompanhar o movimento do avio ou do navio e, atravs do rdio orientar as aes do piloto. Os meios mais modernos de orientao utilizam o sistema GPS (Global Positioning System), que funciona com base em uma rede de 24 satlites artificiais, circulando a 20 mil metros de altitude e enviando sinais Terra permanentemente. Entre esses meios, o mais notvel o GPS IPS 360 Pyxis, um pequeno e sofisticado apare-lho dotado de uma antena para receber os sinais dos satlites. Medindo o tempo que uma onda de rdio emitida por cada satlite leva para chegar at ele, o Pyxis calcula automaticamente a latitude, a longitude e, se for o caso, a velocidade do veculo em que estiver instalado.

Diviso da Terra em fusos

EXERCCIOS
1. Analise as questes abaixo: I. ( ) Os paralelos so linhas imaginrias traadas paralelamente Linha do Equador. II.( ) A Linha do equador divide a Terra em dois hemisfrios, norte e sul. III. ( ) Os meridianos so linhas imaginrias traadas de um plo ao outro. Fusos horrios (hora legal) IV. ( ) A latitude a distncia em graus de qualquer ponto da superfcie terrestre linha do equador. V. ( ) A longitude a distncia em graus de qualquer ponto da superfcie terrestre ao Meridiano de Greenwich. VI. ( ) Por meio das coordenadas geogrficas, no possvel a localizao exata de qualquer ponto na superfcie terrestre. Coloque a ordem correta das proposies acima consideradas, colocando V (verdadeiro) e F (falso). a) V, V, V, V, V, F d) V, V, F, V, V, F b) F, F, V, V, V,F e) V, F, V, F, F, V c) F, V, F, F, F, V 2. O globo terrestre cortado por linhas imaginrias criadas para possibilitar a localizao de qualquer ponto em sua superfcie. Para localizar um certo ponto no globo, determinam-se as coordenadas geogrficas (latitude e longitude) com base nos princpios do crculo trigonomtrico.

TEXTO COMPLEMENTAR Como funcionam os modernos meios de orientao?


Atualmente, os pilotos de avies e de navios dispem de meios modernos e eficientes, que lhes permitem orientar seus movimentos com grande preciso. Entre esses meios, os mais comuns so o rdio, o radar e os satlites artificiais. O rdio emite sinais atravs de ondas que se propagam no ar. Nos aeroportos, por exemplo, existem estaes de rdio, que transmitem sinais dirigidos, destinados a orientar a descida das aeronaves. Por sua vez, os avies so equipados com um aparelho receptor chamado radiogonimetro. Conforme a direo, a intensidade e o volume dos sinais recebidos, o piloto fica sabendo a posio exata de seu avio, podendo ento orientar

203

GEOGRAFIA GERAL

COORDENADAS GEOGRFICAS
5. Em Londres, capital da Inglaterra, situada a 0 de longitude meio dia (12 horas). Em So Paulo que est a 45 de longitude ocidental so: a) 3 horas da manh b) 3 horas da tarde c) 9 horas da manh d) 9 horas da noite. 6. (UFV-MG) Um avio sai do Rio de Janeiro - 45W, s 14 horas, com destino a Fernando de Noronha - 30W. O Vo de 3 horas. Que horas sero na ilha quando esse avio aterrissar: a) 16 horas c) 18 horas e) 20 horas b) 17 horas d) 19 horas 7. (UEL 2006 - conhec. Gerais) Os primeiros relgios baseavam-se no aparente movimento do Sol na abboda celeste e no deslocamento da sombra projetada sobre a superfcie de um corpo iluminado pelo astro. Considere que: a Terra esfrica e seu perodo de rotao de 24 horas no sentido oeste-leste; o tempo gasto a cada 15 de rotao de 1 hora; o tringulo Braslia/Centro da Terra/Luzaka (Zmbia) forma, em seu vrtice central, um ngulo de 75.

Suponha que um navio tenha lanado um S.O.S. nas seguintes coordenadas geogrficas: 30 latitude Sul e 60 longitude Leste. Com base nas informaes e no mapa, correto afirmar que o navio encontra-se: a) Nas proximidades do litoral brasileiro. b) No setor ocidental do Oceano Atlntico. c) Nas proximidades da costa oriental da frica. d) No setor oriental da Amrica do Norte. e) Na costa oriental da Oceania. 3. (UFCE) Entre os elementos bsicos das representaes cartogrficas esto as coordenadas geogrficas. Sobre algumas de suas aplicaes na cartografia est CORRETO afirmar que: a) So smbolos utilizados exclusivamente na confeco de mapas e cartas climticas. b) So sinais aplicados na delimitao de cotas altimtricas e batimtricas do relevo. c) So referncias grficas que indicam reas de mesma temperatura no globo terrestre. d) Servem para identificar zonas climticas diferentes e constituem um sistema de orientao. e) Servem para relacionar a distncia real com a distncia grfica expressa nos mapas. 4. (UFPE) Observe as proposies abaixo: I.Crculo de iluminao o crculo mximo que limita a parte da Terra iluminada pelo Sol da parte no iluminada. II.Equincios so os dois momentos em que, durante o ano, o crculo de iluminao atinge a mxima distncia dos plos. III.Latitude de um lugar a distncia, em graus, entre o Equador, tomado como origem, e o paralelo do lugar considerado. IV.Altitude de um lugar a distncia vertical entre o lugar considerado e o nvel mdio do mar. V.Solstcios so os dois momentos em que o crculo de iluminao passa, durante o ano, pelos plos. Esto corretas: a) I, II e III b) II, III e IV c) III, IV e V d) II e V e) I, III e IV

A hora marcada em Luzaka, num relgio solar, quando o sol est a pino em Braslia : a) 5 horas. d) 17 horas. b) 9 horas. e) 21 horas. c) 12 horas. 8. (UEL-2006/espec.) Considere que um avio supersnico sai da cidade de Tquio a 1 h da manh de um domingo com direo cidade de Manaus AM. A durao do vo de nove horas e a diferena de fuso horrio de uma cidade a outra de onze horas. Assinale a alternativa que apresenta corretamente a hora e o dia da semana da chegada desse avio na cidade de Manaus. a) 22 h do sbado. d) 10 h do domingo. b) 23 h do sbado. e) 12 h do domingo. c) 01 h do domingo.

204

CARTOGRAFIA

UNIDADE 3 CARTOGRAFIA
PROJEES CARTOGRFICAS

CLASSIFICAO DAS PROJEES


Embora existam diversos tipos, as projees costumam ser agrupadas em trs tipos bsicos: cilndricas, cnicas e azimutais. As projees cilndricas baseiam-se na projeo dos paralelos e dos meridianos em um cilindro envolvente, posteriormente planificado. Tm as seguintes caractersticas: Os paralelos e os meridianos so linhas retas que se cruzam em ngulos retos. O intervalo entre os meridianos constante, e a escala verdadeira sobre o Equador. As regies de elevadas latitudes aparecem bastante exageradas ( na latitude de 60 chega a ser de 100). A mais conhecida projeo cilndrica de Mercator (1569), a preferida pelos navegantes.

Projeo cartogrfica a representao de uma superfcie esfrica num plano (o mapa) ou, ainda, um sistema plano de paralelos e meridianos sobre os quais pode-se desenhar um mapa. Como a esfera no um slido desenvolvvel, obrigatoriamente sofrer deformaes quando projetada sobre um plano. As deformaes podem ser em relao s distncias, s reas ou os ngulos; por isso cabe ao cartgrafo escolher o tipo de projeo que melhor atenda aos objetivos do mapa. As opes so de trs tipos: Equidistncia: so as projees que mantm as distncias corretas: Equivalncia: so as projees que mantm a proporo entre rea real e sua representao no mapa; Conformidade: so as projees que mantm a igualdade dos ngulos na Terra no mapa. O globo terrestre artificial, guardada as propores, constitui a mais perfeita representao da Terra, pois, sendo igualmente esfrico, nos d uma idia bastante aproximada da realidade, apresentando ainda as seguintes vantagens ou caractersticas: mostra-nos todos os continentes, os oceanos, as principais cadeias montanhosas; possibilita a simulao dos movimentos da Terra; apresenta as distncias em latitude e longitude. Por outro lado, o globo artificial apresenta alguns inconvenientes, tais como; sua dimenso, geralmente reduzida, no permite um grande nmero de informaes. se construdo em tamanho muito grande, torna-se de elevado custo e de difcil manuseio. mais utilizado para informaes generalizadas da superfcie terrestre. As projees cnicas baseiam-se na projeo do globo terrestre sobre um cone que o tangencia, sendo depois planifico. A projeo cnica simples apresenta as seguintes caractersticas: Os meridianos so linhas retas e convergentes, e os paralelos so crculos concntricos. Os paralelos e os meridianos esto separados por distncias iguais. mais utilizada para representar regies de latitudes mdias.

205

GEOGRAFIA GERAL
As projees azimutais baseiam-se na projeo da superfcie terrestre num plano. Tm as seguintes caractersticas: os meridianos so linhas retas divergentes, e os paralelos so crculos concntricos. As distores aumentam a partir do centro (ponto de tangncia). So as preferidas para representar as regies polares.

CARTOGRAFIA

PROJEO DE PETERS
tambm uma projeo cilndrica, com os paralelos e meridianos representados ortogonalmente. A rea dos continentes so reproduzidos fielmente, porm deforma o formato dos mesmos. As regies de baixa latitude aparentam se alongar, enquanto as de alta latitude parecem que esto achatadas. Dessa caracterstica, a denominao de um mapa para um mundo mais solidrio, na qual os pases subdesenvolvidos so destacados.

Projeo de Peters

ESCALA
Os mapas nada mais so do que uma representao bastante reduzida da superfcie total ou parcial da Terra, sendo que essa representao deve estar numa proporo definida. A funo da escala , portanto, informar a quantidade de vezes que uma determinada rea ou distncia foi reduzida em relao sua representao no mapa. Exemplificando: num mapa de escala 1: 200 0000 devemos entender que a dimenso real sofreu reduo de 200 000 vezes unidades (no caso, 200 000 cm) no lugar real. Quanto menor for o segundo nmero, no caso o denominador da frao ordinria, maior ser a escala; e vice-versa. Assim as escalas inferiores a 100.000 so consideradas grandes; quanto superiores a 500.000, so pequenas. Quanto maior a escala mais detalhada a carta geogrfica. Assim, as plantas (ou cartas cadastrais) se fazem com escalas entre 1/500 e 1/20.000. Os mapas topogrficos tm escalas entre 1/25.000 e 1/250.000, que so escalas mdias; estes mapas so conceituados como informao oficial.

PROJEO DE MERCATOR
A projeo de Mercator uma projeo cilndrica conforme que distorce a proporo do tamanho dos continentes, mas mantm correta a forma. Essa projeo refora a viso eurocntrica a Europa como o centro do mundo e expressa a dominao econmica e cultural dos pases do hemisfrio norte sobre os pases do hemisfrio sul.

TIPOS DE ESCALA
A escala costuma ser apresentada sob uma das trs formas seguintes:

NUMRICA

Projeo de Mercator 1569

Representada sob a forma de uma razo (1: 200 000) ou de uma forma proporo (1/200 000). Em ambos os casos, significa que cada unidade no mapa corresponde a 200 000 unidades no lugar real.

206

GEOGRAFIA GERAL

CARTOGRAFIA
Quanto grandeza, as escalas podem ser assim classificadas: Grande escala: at 1 : 250 000 Mdia escala: at 1 : 250 000 a 1 : 1 000 000 Pequena escala: acima de 1 : 1 1000 000

CURVAS DE NVEL
o mtodo mais comum de representar as elevaes do relevo. A curvas de nvel so linhas que ligam pontos ou cotas de igual altitude em intervalos iguais. A escolha do espaamento ou equidistncia das linhas depende de vrios fatores, como escala do mapa, tipo de relevo etc. A equidistncia entre as curvas pode ser, de acordo com o caso, de 10, 20. 50 ou 100m. As curvas mostram tanto a altitude como o formato do relevo. Quando o relevo muito abrupto, as curvas aparecem no mapa muito prximas umas das outras; quando o relevo suave, aparecem mais distanciadas.

d: distncia medida na carta D: distncia real As escalas numricas mais comuns so da forma

E=d/D

E = 1 / 10x ou E = 1:10x

GRFICA

Representada atravs de uma linha reta graduada. Exemplo:

Nestes casos, a reta foi seccionada em quatro pedaos iguais, cada um medindo 1 cm. Isso quer dizer que 1 cm no mapa corresponde a 2 km no lugar real.Nos permite realizar as transformaes de dimenses grficas em dimenses reais sem efetuarmos clculos. Para sua construo, entretanto, torna-se necessrio o emprego da escala numrica.

GRANDE ESCALA E PEQUENA ESCALA


De modo prtico, podemos dizer que, quanto maior for o denominado da frao, menor ser a escala e, inversamente, quanto menor for o denominador, maior ser a escala. Exemplos:

Escala A: 1/1000 000

Escala B: 1/100 000

Neste caso, podemos dizer que a escala A menor que a Escala B. Podemos dizer tambm que quanto maior for a escala, maior ser a riqueza de detalhes, ao passo que, quanto menor for a escala, menor ser a riqueza de detalhes. Exemplo: um mapa do Brasil na escala de 1: 50 0000 000 comporta muito menos informaes (detalhes) do que um mapa na escala de 1: 25 000 000. que, no primeiro caso, o Brasil foi reduzido 50 000 000 de vezes, ao passo que , no segundo caso, a reduo foi de apenas 25 0000 000 de vezes.

PERFIL TOPOGRFICO
Com base nas curvas de nvel podemos construir perfis topogrficos do relevo. O perfil topogrfico uma representao grfica de um corte vertical do terreno segundo uma direo previamente escolhida.Um dos processos para construir um perfil topogrfico o seguinte: Sobre o mapa topogrfico traa uma reta, que corresponde seco transversal l, cujo perfil pretendemos construir.

207

GEOGRAFIA GERAL
Orienta sobre o mapa uma folha de papel milimtrico ou quadriculado de maneira que o eixo horizontal sobre o qual se vai construir o perfil seja paralelo linha reta que traaste no mapa. Projeta-se sobre o eixo horizontal a interseco de cada curva de nvel com a linha reta, tendo em conta a cota de altitude correspondente. Traa um eixo vertical, que representa a altitude ou cotas. Recorrendo ao eixo vertical localiza e marca o valor de cada curva de nvel projetada. Depois de marcados todos os pontos correspondentes s curvas de nvel projetadas, unem-se dando origem a um perfil topogrfico.

CARTOGRAFIA

EXERCCIOS
1. (PUC-MG) Analisando o planisfrio abaixo, todas as afirmativas podem ser constatadas nele, EXCETO:

CONSTRUO DE UM PERFIL TOPOGRFICO

a) Apresenta os paralelos retos e horizontais e o meridiano reto e vertical. b) O planisfrio resultou de uma projeo cnica. c) As reas de altas latitudes esto incorretas quanto a reas e distncias. d) As latitudes extremas do hemisfrio meridional deixaram de ser mostradas. e) A Antrtida foi parcialmente cortada. 2. (UFPE) Observe as proposies abaixo:

O exemplo em cima mostra um perfil topogrfico mais complexo. Temos duas montanhas com formas muito distintas. A da esquerda tem maiores altitudes, tem um cume mais pontiagudo, maiores declives e alguma assimetria. A sua vertente direita tem maiores declives que a vertente da esquerda, como se pode ver no perfil e nas curvas de nvel que esto mais juntas. O cume da esquerda tem uma forma mais arredondada, menores altitudes, mas continuamos na presena de um relevo assimtrico: h uma diferena de declives entre as duas montanhas.

I. Em relao ao Meridiano de Greenwich, o Nordeste est situado no Hemisfrio Oriental. II. As coordenadas geogrficas do ponto A, situado na parte central da Bahia, so: Lat. 12o S e Long. 42o W. III. De acordo com a escala apresentada, podemos concluir que cada centmetro do mapa corresponde a 150 Km no terreno.

208

GEOGRAFIA GERAL
IV. No mapa, a distncia em linha reta entre Salvador e Teresina de 3,5 cm, que equivale a uma distncia real de 1.050 Km. V. So Lus a capital mais setentrional do Nordeste. So CORRETAS: a) II, IV, V b) I, IV, V c) II, III, V d) II, III e) I, II, III

CARTOGRAFIA
5. (PUC-RS) Responder questo com base no mapa e nas afirmativas abaixo.

3. (PUC-RS) Responda questo com base no mapa e afirmativas abaixo, relacionadas percepo cartogrfica.

I. uma projeo cilndrica, caracterizando uma viso de mundo eurocntrica, privilegiando a forma dos continentes. II. Publicada pela primeira vez em 1973, pelo historiador alemo Arno Peters, indica uma projeo cilndrica equivalente. III. Pretende demonstrar uma viso geopoltica dos pases subdesenvolvidos, pois enfatiza o ponto de vista do Sul, apesar de comprometer a forma dos continentes. IV. um mapa equivocado, pois o Norte est "embaixo" e o Sul "em cima". V. Foi idealizada no sculo XVI, pelo belga Mercator, e se caracteriza por ser uma projeo conforme, sendo muito utilizada nas Grandes Navegaes. A anlise das afirmativas, relacionadas ao mapa, permite concluir que est CORRETA a alternativa: a) I, II e III c) I e V e) II e III b) I, III e V d) II, III e IV 6. (PUC-RS) Com Base no mapa abaixo:

I. Neste mapa aparece a poro meridional do Brasil e o Trpico de Cncer, localizado ao Sul do Equador. II. A rea menos deformada deste mapa o Plo Sul, pois uma Projeo Azimutal Polar. III. O mapa apresenta como ponto central o Plo Norte, ficando em evidncia o Crculo Polar rtico. IV. Todos os continentes nessa projeo esto ao norte do seu centro. V. Entre os meridianos apresentados existem dois fusos horrios. A anlise das afirmativas permite concluir que est CORRETA a alternativa: a) I, II e III d) II e IV b) I, III e V e) III e V c) II, IV e V 4. (PUC-PR) A distncia de 7 cm, medida em um mapa de escala numrica 1:2 500 000, corresponde em quilmetros na superfcie da Terra a um comprimento real de: a) 225 d) 175 b) 17 500 e) 185 c) 1 750

209

GEOGRAFIA GERAL
A distncia grfica entre as cidades de So Paulo e Porto Alegre, em linha reta, de 2cm. A distncia grfica entre esses mesmos locais, em uma escala de 1 : 20.000.000, de: a) 2,2 cm c) 0,22 cm e) 4,2 cm b) 4,4 cm d) 0,44 cm 7. (UFPE) Projeo cartogrfica a representao de uma superfcie esfrica num plano (mapa), podendo ser definida como um sistema plano de paralelos e meridianos, sobre os quais desenhamos um mapa. H vrios tipos de projees que so classificadas em trs grupos bsicos: cilndricas, cnicas e azimutais, como mostram as ilustraes.

UNIDADE 4 A INDUSTRIALIZAO MUNDIAL


Desde a Revoluo Industrial, iniciada na Inglaterra a partir do final de sculo XVIII e depois disseminada para outros pases de industrializao clssica, em muito o processo industrial evoluiu. Ao compararmos os processos produtivos anteriores e posteriores a este marco histrico, podemos dividi-los em trs fases: Artesanato: tcnica conhecida h milhares de anos, onde utiliza-se apenas a capacidade braal do ser humano, que individualmente, elabora o produto do comeo ao fim, apenas com o uso de ferramentas simples. Manufatura: estgio de transio entre o artesanato e a maquinofatura, perdurando na Europa do sc. XVI ao XVIII e ainda existindo em pases de economia atrasada. Neste mtodo so utilizados mquinas simples com a diviso do trabalho, ou seja, cada funcionrio trabalha em uma parte do processo. Todas as tarefas so complementares para a obteno do produto final. Indstria moderna ou maquinofatura: surge com a Revoluo Industrial. Neste processo h uma especializao do trabalhador em determinadas atividades, apresentando uma grande diviso do trabalho, com o funcionrio perdendo a idia de como se faz o produto final. O uso de maquinrios movidos modernas tecnologias torna-se comum, para que haja uma elevada produtividade de objetos iguais, aumentando o volume, diminuindo os custos e ampliando-se os lucros.

Quais so as principais caractersticas das projees apresentadas acima: _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Imagine: voc est no inicio de uma avenida, e quer chegar at um cinema nesta avenida. Voc quer saber o quanto dever caminhar, por isso olha num mapa da cidade. Este mapa tem escala 1:8000, e de onde voc se encontra at o cinema mede-se 20cm, portanto quanto dever caminhar? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

INDUSTRIALIZAO
A Europa Ocidental foi o bero da Revoluo Industrial que se apoiou na explorao de carvo e ferro na Gr-Bretanha e no Vale do Reno e posteriormente na Frana, a partir do que se desenvolveram as siderrgicas e as indstrias de mecnica pesada. Com o desenvolvimento da indstria e consequentemente do comrcio, o litoral da Europa Ocidental se tomou o mais ativo centro de atividades porturias do mundo. As principais regies industriais so: o Vale do Reno/Rhur na Alemanha, o Vale do P no norte da Itlia, o Vale do Sena (Bacia de Paris) e do Rdano(Lyon) na Frana. Atualmente, o parque industrial europeu um dos mais importantes do mundo. A consolidao da Unio Europia(UE), a integrao dos mercados e o estabelecimento da moeda, o euro, fortaleceram ainda mais a economia dos pases europeus.As empresas europias iniciaram, por meio de fuses, um processo de concentrao que fez crescer uma unio empresarial mais europia e menos apegada aos Estados nacionais. O espao de economia mais dinmica da Europa do qual fazem parte pases altamente industrializados, como a Alemanha, a Frana o Reino Unido, a Itlia, a Holanda, a Blgica e Luxemburgo, conta com importantes centros tecnolgicos e indstrias de ponta (informtica, engenharia gentica, aeroespacial, nuclear etc.) ao lado de indstrias clssicas (siderrgicas, qumica, automobilstica, txtil, alimentcia, etc).

210

GEOGRAFIA GERAL
Pode-se afirmar que a Europa Ocidental o atelier, o banqueiro e o rbitro do mundo. Tal afirmao se baseia na poderosa indstria do vesturio da Frana e da Itlia, na importncia dos bancos suos para o mundo e na sede da Corte Internacional de Justia, localizada na cidade de Haia, nos Pases Baixos.

A INDUSTRIALIZAO MUNDIAL

ORDENS INTERNACIONAIS
A periodizao usada para explicar aspectos geogrficos e geopolticos diferente daquela usada pela Histria que coloca os grandes perodos: Antiguidade, Idade mdia, Idade moderna e Idade Contempornea. A geopoltica mundial pode ser organizada, analisando em conjuntura aspectos naturais, econmicos, sociais, culturais, tcnicos e polticos, em Ordens Internacionais, correspondentes a um menor espao de tempo, focalizando em caractersticas mais especficas que a primeira classificao. As Ordens Internacionais se referem ao conjunto de caractersticas polticas e econmicas mundiais reveladoras das relaes de poder, na histria. O perodo correspondente Ordem da Revoluo Industrial fica didaticamente posicionada entre s Ordem do Colonialismo e a Ordem da Guerra fria. Seus limites de datas no so estreitamente rgidos. As transformaes geopolticas e econmicas passavam por transformaes e as datas so marcos referencial. Seu incio datado em 1815, do Congresso de Viena j sentia mudanas desde a Revoluo Francesa, no final do sc. XVIII. No entanto, a partir de tal data, as caractersticas se tornaram mais evidentes e facilmente reconhecveis. O mesmo raciocnio vale para o que estabelece o fim da ORI. Seu trmino j estava pronunciado desde o fim da Primeira Guerra mundial em 1914, porm de fato, s ocorreu com o fim da Segunda Guerra, quando a sim, as mudanas foram mais expressivas. Dentre as principais causas da RI, podemos citar: Expanso do comrcio: acumulao de capital nas mos da burguesia. Crescimento do mercado consumidor: exigncias de novos produtos. Abolio das restries impostas pelo mercantilismo e abandono das prticas absolutistas de governo. Novas descobertas.

AS TRS REVOLUES INDUSTRIAIS


1 REV. INDUSTRIAL INCIO PAS IRRADIADOR MEIOS DE PRODUO +/- 1780 Inglaterra Braal + mecnica 2 REV. INDUSTRIAL +/- 1870 EUA Fordista Petrleo e eletricidade 3 REV. INDUSTRIAL +/- 1970 Japo, Europa e EUA Just-in-time Fontes diversas

COMBUSTVEL Carvo mineral

TIPOS DE INDSTRIAS E LOCALIZAO


As indstrias de bens de produo, tambm chamadas de indstrias de base ou pesadas, por transformarem grandes quantidades de matriasprimas ou de energia, como o caso das siderrgicas, metalrgicas, petroqumicas, tendem a se localizar perto de fontes fornecedoras ou de portos e ferrovias, o que facilita a recepo de matriasprimas e o escoamento da produo. A indstria de bens de capital, como as de mquinas e equipamentos, tem um papel fundamental: equipar outras indstrias, leves ou pesadas, sem o que seria impossvel a produo de bens para um amplo mercado consumidor. Essas indstrias tendem a se localizar perto de empresas consumidoras de seus produtos, ou seja, em grandes regies industriais. As indstrias mais espalhadas espacialmente, no plano nacional e internacional, que se instalam preferencialmente nos lugares onde h maior disponibilidade de mo-de-obra e maior facilidade de acesso ao mercado consumidor, so as indstrias de bens de consumo ou leves. Graas s melhorias dos sistemas de transporte, elas encontram-se localizadas em grandes, mdios e pequenos centros urbanos ou mesmo na zona rural de diversos pases. Podem ser classificadas como durveis (mveis, eletrodomsticos, automveis) e no durveis (bebidas, alimentos). A produo, portanto, destina-se a um mercado consumidor mais amplo: ao abastecimento da populao em geral.

ASPECTOS FUNDAMENTAIS DA RI

REVOLUO INDUSTRIAL Conjunto de transformaes tcnicas, econmicas e sociais que assinalaram a plena configurao do sistema capitalista (ou modo de produo capitalista).

Na geopoltica, verificou-se a consolidao de uma multipolaridade de poder na Europa. O pioneirismo britnico na RI, consequente da acumulao de capital, mo-de-obra abundante, liberalismo poltico e econmico, inovaes tcnicas e poder naval, contribuiu para seu desenvolvimento econmico e expanso colonial. Se tornou a nao mais rica do perodo. Entretanto, ao seu fim, novos imprios como EUA e Japo, cresceram rpido e acentuadamente, ameaando o deixo de poder hegemnico da Europa ocidental. Entre as relaes internacionais constatou-se um duplo movimento: ampliao das formas de explorao e dominao capitalista e nova forma de organizao poltico econmico, que o Sistema Socialista (critica o sistema vigente). A primeira materializada pelo Imperialismo, essencialmente atuante nos continentes africano e asitico. Um marco para a segunda a Revoluo Russa de 1917. No campo poltico, especificamente na forma de organizao do poder, percebe-se a generalizao do Estado. Desde o sc. XVIII observa-se o surgimento do Estado moderno europeu, que veio a se consolidar no sc XIX. Sinteticamente pode ser entendido como uma forma de organizao que progressivamente

211

GEOGRAFIA GERAL
centraliza o poder e consolida o princpio de territorialidade. O poder passa a abranger todas as relaes polticas. Tambm o espao precisa ser demarcado por fronteiras e tratados. Esse Estado gerenciado pela burguesia (classe dominante) sob os princpios de liberdade poltica e igualdade de participao. O Estado burgus acelerou o acmulo de capital favorecendo o imperialismo, expandindo seus plos de poder. O processo de produo industrial foi, conseqentemente, difundido pelo mundo. O capital foi transferido do comrcio para a indstria, baseada na mecanizao da produo, caminhando conjuntamente com o desenvolvimento de novas tecnologias. Desta forma, as estruturas sociais e relaes geopolticas passaram por mudanas.

A INDUSTRIALIZAO MUNDIAL

EXERCCIOS
1.(IBMECRJ-2009) "A expresso Revoluo Industrial tem sido utilizada para designar um conjunto de transformaes econmicas, sociais e tecnolgicas que teve incio na Inglaterra, na segunda metade do sculo XVIII. Em pouco tempo, essas mudanas afetariam outros pases da Europa e outros continentes, alterando definitivamente as relaes entre as sociedades humanas."
FIGUEIRA, D. G. "Histria". So Paulo: tica, 2005. p. 193.

Sobre esse tema so feitas as seguintes afirmativas: I. A produo de tecidos foi um dos primeiros setores a desenvolver o processo industrializador. II. Ao aumentar a produtividade de cada trabalhador, aumentou a oferta de mercadoria e, por consequncia, possibilitou uma reduo nos preos dos produtos. III. O sucesso da Revoluo Industrial foi to significativo que originou um apoio utilizao de mquinas, processo que ficou conhecido como ludismo. Assinale: a) Se apenas a afirmativa I for correta. b) Se apenas a afirmativa II for correta. c) Se apenas a afirmativa III for correta. d) Se as afirmativas I e II forem corretas. e) Se as afirmativas II e III forem corretas. 2. (UFMS-2010) A partir do estabelecimento da indstria como novo ramo de atividade econmica, nveis diferenciados de tecnologia foram empregados no processo fabril. De acordo com o nvel tecnolgico e a funo que cada segmento fabril desempenha na economia das atuais sociedades capitalistas, a indstria pode assumir diferentes classificaes. Em relao classificao das indstrias, CORRETO afirmar: (01) Indstrias de tecnologia de ponta so aquelas que produzem recursos tecnolgicos altamente sofisticados, resultantes da aplicao imediata das descobertas cientficas no processo de produo. So exemplos de indstrias de tecnologia de ponta: as de informtica, de produtos eletrnicos, a aeroespacial e as de biotecnologia. (02) Indstrias tradicionais so aquelas que primeiro se instalaram em uma regio. Servem de base para outras indstrias, fornecendo-lhes matrias-primas j processadas. Utilizam equipamentos pesados e pouca mo-de-obra, considerando o elevado grau de automao dos equipamentos. So exemplos de indstrias tradicionais: as siderrgicas, as cimenteiras, as metalrgicas e as cermicas. (04) Indstrias de bens de produo so aquelas que produzem mercadorias para o consumo da populao. Empregam muita mo-de-obra e pouca tecnologia e atuam em mercados altamente competitivos em nvel regional. So exemplos de indstrias de bens de produo: indstrias alimentcias, indstrias moveleiras e indstrias farmacuticas.

1 REVOLUO INDUSTRIAL (1780 1850)

Revoluo do carvo e ferro. Desenvolvimento do capitalismo industrial/ liberal. Liberdade de comrcio e produo. Livre concorrncia e livre iniciativa.

2 REVOLUO INDUSTRIAL (1850 1914)


Revoluo do ao e da eletricidade Capitalismo monopolista. Grandes monoplios.

CONSEQUNCIAS DA REVOLUO INDUSTRIAL:

A Revoluo industrial implicou em mudanas substanciais na evoluo dos processo de produo e o rumo econmicopoltico e social em escala internacional. Dentre as consequncias produtivas esto a utilizao constante de mquinas e o aumento de produo. Os meios de transportes e comunicaes evoluram. A runa dos arteso, com dificuldades de competir com a produtividade da mquina, e a diviso do trabalho (internamente dentro das fbricas e no processo como um todo) envolvendo produes particionadas em locais distantes. A crescente urbanizao e despovoamento do campo, compondo novas classes sociais nesse palco de ao: os burgueses industriais e o proletariado. Em escala externa, o colonialismo foi ampliado, combinado ao imperialismo e expandindo o capitalismo pela Europa e suas colnias.

MOVIMENTOS DE TRABALHADORES
Ludismo: destruio das mquinas, pelos trabalhadores, introduzidas na indstria fabril. Os trabalhadores acreditavam que as mquinas eram responsveis pela sua misria, explorao e desemprego. Cartismo: movimento derivado da Carta do Povo, documento onde os trabalhadores reivindicavam, dentre outras coisas, reduo de jornada de trabalho, sufrgio universal masculino, voto secreto e eleies anuais. Uma das principiais consequncias desse movimento foi o surgimento das associaes de trabalhadores que deram origem aos sindicatos modernos.

212

GEOGRAFIA GERAL
(08) Indstrias de bens ntermedirios so aquelas que produzem mquinas e equipamentos que sero utilizados em outros segmentos da indstria e em diversos setores da economia. So exemplos de indstrias de bens intermedirios: indstria mecnica e indstria de autopeas. (16) Indstrias de bens de consumo so aquelas que fabricam bens que so consumidos pela populao em geral. Esto divididas em bens de consumo durveis e bens de consumo no durveis. Entre as indstrias de bens de consumo durveis, esto: as indstrias de produo de eletrodomsticos e a indstria automobilstica. Entre as indstrias de bens de consumo no durveis, esto: as tecelagens, as de confeces, as de produtos alimentares, as de perfumaria e medicamentos. 3. (PUCCAMP) "O produto da atividade humana separado de seu produtor e aambarcado por uma minoria: a substncia humana absorvida pelas coisas produzidas, em lugar de pertencer ao homem." A partir do texto, pode-se afirmar que a Revoluo Industrial: a) Produziu a hegemonia do capitalista na produo social; b) Tornou a manufatura uma alternativa para o artesanato; c) Introduziu mtodos manuais de trabalho na produo; d) Tornou o homem mais importante que a mquina; e) Valorizou o produtor autnomo. 4. Entre os fatores que fizeram da Inglaterra o bero propcio ecloso da Revoluo Industrial, podemos citar os seguintes: a) As condies sociais e polticas da poca eram favorveis. b) Com a criao do Banco da Inglaterra, essa nao tornou-se o maior centro capitalista da poca. c) O sistema corporativo no chegara a se enraizar desde a Idade Mdia. d) A supremacia naval inglesa assegurava o controle das rotas de distribuio de mercadorias. e) Todas as anteriores. 5. As questes abaixo referem-se aos movimentos operrios, no contexto da Revoluo Industrial do sculo XIX. I. Ao longo do sculo XIX a consolidao do capitalismo tornaria as condies de vida e de trabalho do nascente proletariado extremamente precrias. II. O ludismo traduz as primeiras manifestaes de resistncia da nascente classe operria que ocupou os ltimos anos do sculo XVIII e os primeiros do sculo XIX. III. Em meados do sculo XIX a greve geral dos trabalhadores na Europa, organizada pelo sindicato que representava a classe operria, provocou importantes mudanas na legislao trabalhista da poca. IV. O movimento cartista, movimento operrio que surgiu na primeira metade do sculo XIX, no se constituiu um fato isolado, pois foi precedido de greves, motins, insurreies e outras manifestaes da classe operria.

A INDUSTRIALIZAO MUNDIAL
V. Na segunda metade do sculo XIX, e principalmente com a formao das associaes internacionais dos trabalhadores, percebeu-se uma estreita relao entre o marxismo e o movimento operrio europeu. Assinale a alternativa CORRETA. a) Somente as afirmativas I, II, III e IV so verdadeiras. b) Somente as afirmativas I, II, IV e V so verdadeiras. c) Somente as afirmativas IV e V so verdadeiras. d) Somente as afirmativas II e III so verdadeiras. e) Todas as afirmativas so verdadeiras. 6. As afirmaes a seguir apontam algumas tendncias da nova lgica de localizao industrial. I. Distribuio dos estabelecimentos industriais das empresas em diferentes localidades de tradio manufatureira. II. Separao territorial entre processo produtivo e gerenciamento empresarial com a reintegrao de ambos por intermdio de redes informacionais. III. Desconcentrao da atividade industrial e emergncia de novos espaos industriais, estruturando redes globalizadas. IV Concentrao territorial da indstria dependente de fontes de energia e matria-prima. Est correto apenas o que se afirma em a) I e II. c) II e III. b) I e III. d) II e IV e) III e IV

7. Quais so algumas condies favorveis para o surgimento de industrias, em uma determinada rea? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. O que so guerras fiscais e quais so suas implicantes para o posicionamento das industrias? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

213

EVOLUES NO MUNDO DO TRABALHO

UNIDADE 5 EVOLUES NO MUNDO DO TRABALHO


O modelo atual de organizao social e econmica conhecido como capitalismo, conseqncia de uma srie de fenmenos e acontecimentos desencadeados h sculos atrs. A evoluo do trabalho nesse mbito sempre esteve merc das modificaes desse fenmeno, alterando-se em vrios aspectos, sejam eles tcnicos, sociais, espaciais ou econmicos. A histria do sistema capitalista revela que houveram determinadas divises do trabalho em perodos histricos que dinamizaram esse modelo e foram primordiais para a atual distino entre naes desenvolvidas e subdesenvolvidas. A partir dessas divises internacionais do trabalho ou DIT, como so mais conhecidas, esta unidade pretende abordar a evoluo e as modificaes no mundo do trabalho e suas conseqncias na organizao global.

ORIGEM DA DIT
No final do sculo XV, o capital estava presente em grande intensidade na distribuio e circulao das mercadorias entre as metrpoles e suas colnias. As diversas regies do mundo passaram a desenvolver diferentes funes com a crescente colonizao, pois cada uma passou a especializar-se principalmente no fornecimento de matria-prima, metais preciosos, produtos manufaturados entre outros. Dessa maneira, as metrpoles detinham a funo de exportar manufaturas e as colnias de exportarem matrias-primas para as metrpoles.

CONSOLIDAO DA DIT
Graas consolidao do sistema capitalista no sculo XVIII, houve uma intensa transformao no processo produtivo, que ficou conhecida como Revoluo Industrial. Nesse perodo, a diviso internacional do trabalho sofreu mudanas, por causa do novo modelo de produo em que as fbricas tomam o lugar da produo artesanal. Nesse momento, o mundo estava dividido entre pases especializados em fornecer matria-prima e pases que utilizavam dessas matrias-primas para faturar produtos industrializados. Os que forneciam matria-prima estavam atrelados ao subdesenvolvimento e os que produziam produtos industrializados se tornariam lderes do sistema capitalista.

MUNDIALIZAO DO CAPITAL
Aps a Segunda Guerra Mundial muitos pases subdesenvolvidos iniciaram um processo de industrializao calcados no trip capital nacional, capital estatal e capital multinacional. Com isso, muitos conglomerados se instalaram em pases da periferia. O que havia nesses pases que atraiu as grandes empresas? A possibilidade de maiores lucros, pois eles ofereciam mo-de-obra abundante, politicamente desmobilizada e, portanto, barata; fontes de energia e matrias-primas a baixo custo; mercado interno em crescimento; facilidades de exportao e de remessa de lucros para as sedes dessas empresas; incentivos fiscais e subsdios governamentais e, mais recentemente, ausncia de legislao de proteo ao meio ambiente ou a possibilidade de burlar essa norma, caso ela exista. No perodo imediatamente aps a Segunda Guerra, esses fatores, com destaque para a mo-de-obra barata, constituam vantagens comparativas importantssimas para a alocao dos investimentos no exterior. Evidentemente, nem todos os pases subdesenvolvidos apresentavam essas vantagens. Por isso apenas alguns se industrializaram e se reposicionaram na tradicional diviso internacional do trabalho. Muitos deles passaram gradativamente de exportadores de matrias-primas para exportadores de produtos industrializados. No entanto, no possvel situ-los, pelo menos por enquanto, no mundo desenvolvido. Eles fazem parte de uma nova diviso internacional do trabalho. O processo de industrializao ocorrido nos pases subdesenvolvidos foi, em grande parte, decorrente da implantao de um modelo que dependia de capitais e de tecnologias do exterior. Trata-se de um processo desigual e complementar ao dos pases desenvolvidos, uma vez que comandado por interesses

As divises internacionais do trabalho podem ser resumidas de forma sinttica em quatro fases: Origem: Colonialismo Consolidao: RI e Imperialismo Mundializao do Capital: Ps 2 GM Globalizao: Ps Modernidade

214

GEOGRAFIA GERAL
externos, embora muitas vezes em associao aos capitais nacionais (privados ou estatais). O processo foi desigual porque em geral os tipos de indstria e a tecnologia empregada no so os mesmos das matrizes. Esse modelo de industrializao complementar ao mundo desenvolvido porque garante a manuteno da produo, circulao, consumo e portanto, o acmulo de capitais em grande escala nos pases desenvolvidos. As noes que se industrializaram seguindo este modelo so conhecidas como pases recentemente industrializados.

EVOLUES NO MUNDO DO TRABALHO


A atual diviso internacional do trabalho refora as desigualdades internacionais que j existem em suas formas precedentes, gerando uma nova categoria do ponto de vista scio-espacial: a das regies e pases excludos. A emergncia desta nova diviso no suprime as anteriores, pois a maioria dos pases da frica, Amrica Latina e sia continuam exportando produtos primrios, inserindo-se na diviso antiga.

TEXTO COMPLEMENTAR Participao da mulher no mercado de trabalho brasileiro


A partir da dcada de 1970, intensificou-se a participao das mulheres na atividade econmica em um contexto de expanso da economia com acelerado processo de industrializao e urbanizao. Prosseguiu na dcada de 1980, apesar da estagnao da atividade econmica e da deteriorao das oportunidades de ocupao. A dcada de 1990, foi cauterizada pela intensa abertura econmica, pelos baixos investimentos e pela terceirizao da economia, continuou a tendncia de crescente incorporao da mulher na fora de trabalho. Contudo, incrementa-se no sculo XXI o desemprego feminino, indicando que o aumento de postos de trabalho para mulheres no foi suficiente para absorver a totalidade do crescimento da PEA feminina. Veja a seguir algumas informaes e dados sobre a mulher no mercado de trabalho. 1940 a 1990: a fora de trabalho feminina passou de 2,8 milhes para 22,8 milhes. Participao pequena: 35,5%. A maioria exerce atividades de mdia e baixa qualificao profissional. Salrios mais baixos. Jornada dupla de trabalho (emprego e lar). Vtimas de preconceito e de abusos que revelam tratamento desigual.

Montadora da Ford em Camaari - BA

A MAIS NOVA DIT


Com o desenvolvimento da economia informacional e da globalizao, estruturou-se uma nova organizao da produo no mundo. O socilogo espanhol Manuel Castells denominou-a a mais nova diviso internacional do trabalho, que est disposta em quatro posies diferentes no capitalismo informacionalglobal: os produtores de alto valor com base no trabalho informacional, os produtores de grande volume baseado no trabalho de baixo custo, os produtores de mat-rias-primas que se baseiam em recursos naturais e, finalmente, os produtores redundantes, limitados ao trabalho desvalorizado. A posio privilegiada dos lugares dentro dessa nova especializao produtiva em escala mundial deve-se ao domnio tecnolgico, sobretudo da tecnologia da informao, ao nvel educacional da populao e, consequentemente, a qualidade da mo-de-obra. A grande diferena da atual diviso internacional do trabalho em relao as anteriores que ela no ocorre entre pases, portanto no coincide com seus limites territoriais. Essa nova diviso se estabelece entre agentes econmicos localizados nas quatro posies mencionadas por Castells ao longo de uma estrutura global de redes e fluxos. Esses agentes podem aparecer em posies diferentes de um mesmo pas (desenvolvido ou no). A posio mais importante, a dos produtores de alto valor com base no trabalho informacional, que compreende as industrias de alta tecnologia informtica, telecomunicaes, robtica, biotecnologia e os trabalhadores mais qualificados, concentra-se predominantemente nos pases desenvolvidos, sobretudo nos tecnopolos, como o do Vale do Silcio na Califrnia. Mas aparece tambm em pases emergente como Brasil, Coria do Sul e ndia.

EXERCCIOS
1. Leia com ateno as afirmaes: I. A diviso do espao geogrfico de nossos dias se baseia na produo para o lucro (espao capitalista) e na produo para o suprimento da sociedade (espao socialista). II. A especializao dos pases na produo de determinadas mercadorias destinadas ao mercado internacional denominada Diviso Internacional do Trabalho. III. At a dcada de 50, os pases mais avanados importavam produtos primrios e exportavam produtos manufaturados e capital.

215

GEOGRAFIA GERAL
IV. Atualmente, pases de industrializao recente (Brasil. Mxico, China, Coria, Formosa) no so apenas exportadores de produtos primrios, mas incluem produtos manufaturados em suas exportaes. Estes pases dependem da importao de equipamento e da tecnologia sofisticada (de ponta), na eletrnica, na qumica fina, na biotecnologia etc. Que textos esto CORRETOS? a) Apenas I b) Apenas II e III c) Apenas III e IV d) Apenas IV e V e) II, III e IV. 2. Cortando fronteiras com capital e tecnologia, as multinacionais otimizam mercados, recursos naturais e polticos em escala mundial. Uma nova forma de acumular lucros, uma nova diviso internacional do trabalho.
KUCINSKI, Bernardo. O que so multinacionais

EVOLUES NO MUNDO DO TRABALHO


d) As quatro posies descritas podem ocorrer simultaneamente num mesmo pas, visto que a nova diviso internacional do trabalho no ocorre entre pases, mas entre agentes econmicos organizados em sistemas de redes e fluxos. e) Esto excludos da nova diviso internacional do trabalho os pases de economia dependente, porque no so capazes de produzir tecnologia de ponta, o que os impede de participar. 4. O colonialismo e a diviso internacional da produo ditada pelo capitalismo desestruturam as formas originais de produo agrcola na sia, frica e Amrica Latina. A agricultura de produtos alimentares de subsistncia foi substituda pela agricultura comercial de exportao. Isso para atender, fundamentalmente, aos interesses das metrpoles. Para as colnias delineou-se, entre outras coisas, o espectro da fome. Com base no que diz o texto sobre desestruturao das formas originais de produo agrcola na sia, frica e Amrica Latina e com base nos seus conhecimentos sobre a dinmica da produo do espao agrrio mundial hoje, correto afirmar: a) Essa desestruturao est relacionada ao fato de que os colonizadores europeus se apropriaram das terras e dos recursos naturais dos colonizados, impondo-lhes, nos moldes do capitalismo comercial, uma estrutura produtiva agrria marcada pela Diviso Internacional do Trabalho DIT, como colnias agrcolas voltadas produo de alimentos destinados s metrpoles. b) As razes desta desestruturao esto relacionadas aos fatores tnicos e religiosos locais de cada pas ou regio, que marcam, at hoje, uma dinmica agrria fortemente fragilizada e improdutiva no combate fome, decorrentes dos constantes conflitos tribais. c) Hoje, so visveis as contradies socioeconmicas nesses continentes, decorrentes dessa desestruturao. E elas esto relacionadas no s a fatores externos, como o neo- colonialismo, mas tambm a fatores internos, como as grandes oligarquias rurais de origem tnica e religiosa, que controlam o comrcio dos produtos agrcolas. d) Essa desestruturao foi necessria em virtude da baixa produtividade desse modelo agrcola caracterizado pelo uso de tcnicas rudimentares no plantio, o que tornou necessria sua substituio por um modelo implantado pelo colonizador europeu, mais eficaz no combate fome. e) A causa principal dessa desestruturao est na antiga insero desses continentes no capitalismo industrial, que, dentro da Diviso Internacional do Trabalho DIT, os coloca como grandes exportadores de produtos agrcolas, que usam novas tecnologias para o mercado mundial e local, visando, acima de tudo, ao combate fome. 5. So indstrias de ponta na terceira Revoluo Industrial: a) Metalrgica construo civil naval. b) Petroqumica automobilstica siderrgica.

A nova diviso internacional do trabalho apresentada no texto tem como causa a seguinte atuao das multinacionais: a) Aplicao de capitais em atividades agropastoris nos pases perifricos. b) Implantao de filiais em pases de mo-de-obra barata. c) Participao em mais de um ramo de atividade. d) Importao de matrias-primas do 3 mundo. e) Explorao de novas fontes de energia. 3. O que chamo de a mais nova diviso internacional do trabalho est disposta em quatro posies diferentes na economia informacional/global: produtores de alto valor com base no trabalho informacional; produtores de grande volume baseado no trabalho de mais baixo custo; produtores de matrias-primas que se baseiam em recursos naturais; e os produtores redundantes, reduzido so trabalho desvalorizado (...) A questo crucial que estas posies diferentes no coincidem com os pases.So organizadas em redes e fluxos, utilizando a infra-estrutura tecnolgica da economia informacional (...)
(Manuel Castells, A sociedade em rede.)

Considerando as informaes contidas no trecho e as alteraes no espao geogrfico a partir da Revoluo Informacional, CORRETO afirmar que: a) A nova diviso internacional do trabalho uma reproduo da clssica diviso, pois h espaos geogrficos de alto valor informacional (pases centrais) e outros de trabalho desvalorizado (pases da periferia). b) O desenvolvimento tecnolgico na rea de informao, ao reorganizar os fluxos de capital e de pessoas, criou uma rede hierarquizada e cristalizada de novos pases informatizados. c) As cidades globais Nova Iorque, Otawa e Rio de Janeiro so espaos geogrficos exclusivos dos produtores de alto valor do trabalho informacional, representando, portanto, os cones da nova diviso internacional do trabalho.

216

GEOGRAFIA GERAL
c) Eltrica eletrnica txtil. d) Informtica microeletrnica biotecnolgica. e) Alimentcia de bebidas finas de cosmtico 6. A respeito da indstria moderna, CORRETO afirmar: a) Com as inovaes tecnolgicas atuais, eliminou-se a diviso tcnica do trabalho. b) Seus trabalhadores, chamados de artesos, possuem uma clara idia de como ocorre todo o processo de produo, trocando freqentemente de funo dentro da empresa. c) No mais se baseia no assalariamento, mas no regime de parceria. d) Tende a absorver maior capacidade tcnica e cientfica, deslocando tarefas para a terceirizao. e) No se preocupa com a produtividade, passando a intensificar a competitividade. 7. Qual a atual situao de alguns pases emergentes na sia e nas Amricas perante as novas mudanas na Diviso Internacional do Trabalho e quais mudanas ocorreram nessa segmentao mundial? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Como se caracterizou a primeira diviso internacional do trabalho nos pases desenvolvidos? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

UNIDADE 6 CAPITALISMO
O capitalismo, que surge no final da Idade Mdia em substituio ao modo de produo feudal, est associado s atividades comerciais e expanso europia para outros locais do planeta (frica, sia Amrica e Oceania). Os mecanismos polticos, sociais e econmicos existentes nessas reas sofreram adaptaes de forma bastante desigual no espao e no tempo, mas as disparidades so observadas principalmente entre os pases desenvolvidos e subdesenvolvidos. Mesmo com profundos contrastes entre os pases capitalistas, algumas caractersticas so comuns a todos eles, pois elas fazem parte da estrutura central do sistema capitalista, como: Propriedade dos meios de produo: setor privado. Objetivo: obteno de lucros. Mecanismo de funcionamento da economia: lei da oferta e da procura. Relao de trabalho: assalariado. Meios de troca e instrumento de crdito: moeda metlica ou papel moeda. Relao social: proprietrios x proletrios. Para compreender melhor o capitalismo possvel distinguir quatro fases: capitalismo comercial (pr-capitalismo), capitalismo industrial, capitalismo financeiro ou monopolista e o capitalismo informacional. Cada fase mercada por caractersticas particulares com relao s formas de produo, trabalho, circulao e consumo de mercadorias.

AS FASES OU ETAPAS DO CAPITALISMO

217

GEOGRAFIA GERAL
Capitalismo Comercial Capitalismo Industrial Capitalismo Financeiro Capitalismo Informacional

CAPITALISMO
Na sia tambm em fins do sculo XIX, o Japo emergiu como potncia, sobretudo aps a ascenso do Imperador Mitsuhito, que deu incio a chamada Era Meiji.

CAPITALISMO COMERCIAL

A partir do sc. XV, as relaes mercantis ampliaram-se geograficamente com as grandes navegaes e a insero de novas terras no sistema capitalista de produo. Desenvolveu-se ento a fase do chamado capitalismo comercial; o ciclo de reproduo do capital estava alicerado principalmente na circulao e distribuio de mercadorias realizadas entre as metrpoles e as colnias (Pacto Colonial). Nesse perodo inaugurou-se a Diviso Internacional do Trabalho (DIT), caracterizada pela produo de matrias-primas nas colnias em troca de manufaturas das metrpoles. O mercantilismo, doutrina econmica e poltica do capitalismo comercial, criou as bases de uma nova geografia europia e mundial. Fortaleceu a unificao territorial a partir de um governo centralizado, dando origem aos Estados nacionais modernos europeus. Tais Estados fortaleceram-se e acumularam riquezas com o protecionismo de seus mercados internos e com o comrcio. Com isso, amplia-ram-se as relaes espaciais, baseadas na escravizao e comercializao dos escravos e na explorao colonial. Nessa poca, a riqueza e o poder de um pas eram medidos pela quantidade de metais preciosos (ouro e prata) que possuam. Esse princpio ficou conhecido como metalismo. O mercantilismo foi fundamental para o desenvolvimento do capitalismo, pois permitiu, como resultado do comrcio altamente lucrativo e pela explorao das colnias, grande acmulo de capitais (acumulao primitiva do capital).

O CAPITALISMO MONOPOLISTA:

CAPITALISMO INDUSTRIAL

O sistema capitalista s iria se consolidar no sculo XVIII, com a substituio da manufatura pelas mquinas a vapor, iniciada nas indstrias txteis da Inglaterra. A mecanizao imprimiu um novo ritmo produo de mercadorias. 1 Revoluo Industrial. Lder: Reino Unido. Fonte de Energia: Carvo mineral. Tipos de Indstria: txtil, siderrgica, naval e carbonfera. 2 Revoluo Industrial. Lderes: EUA e Alemanha. Fontes de Energia: Petrleo e Eletricidade. Tipos de Indstria: Petrolfera, eltrica, qumica e de motores. Aumento do potencial de transformar a natureza. Acelerao na circulao de pessoas e mercadorias. Doutrina econmica: Liberalismo. Expanso imperialista na frica e sia. Partilha da frica (1885 Conferncia de Berlim). Marxismo.

Durante a Segunda fase da Revoluo Industrial, o desenvolvimento da industrializao em outros pases e a aplicao de novas tecnologias produo e ao transporte modificaram profundamente a orientao liberal. As novas tecnologias foram empregadas nas indstrias metalrgica, siderrgica, no transporte ferrovirio, entre outros. Esses setores industriais dependiam de investimentos maiores que aqueles realizados na primeira fase da Revoluo Industrial. Era necessrio a unio de vrios empreendedores para a produo das novas mercadorias. Boa parte da indstria passou a contar com o capital bancrio ou financeiro. No final do sc. XIX, a fuso entre o capital industrial e o financeiro e, mesmo a fuso entre indstrias, levou ao aparecimento de empresas gigantescas, os monoplios e oligoplios (empresas de grande porte que se associam para controlar o mercado), ocorrendo, com isso, um enfraquecimento da livre concorrncia. Pela baixa competitividade, as pequenas empresas, que no acompanharam essa nova tendncia do desenvolvimento econmico capitalista, faliram ou foram absorvidas pelas grandes. Nesse perodo, o estrondoso aumento da produo atravs da tecnologia, no encontrou mercado consumidor correspondente, o que ocasionou uma queda brutal nos preos, abalando a bolsa de valores de Nova York. Esse perodo ficou conhecido como a Crise de 1929. Essa crise gerou uma acumulao maior de capital pelos monoplios e oligoplios remanescentes. Para contornar a crise, o Estado passou a interferir diretamente na economia (Keynesianismo), elaborando planos econmicos, construindo grandes obras pblicas, controlando preos, definindo regras para o mercado, etc. O impacto da crise obrigou o Estado a definir polticas especficas para a satisfao das necessidades sociais da populao. Estrutura-se o chamado Estado do bem-estar Social (Wellfare State). Segundo essas novas determinaes, o Estado nacional assumiu o papel de mediador nas relaes estabelecidas entre a sociedade e as empresas, defendendo os interesses dos trabalhadores, consumidores e apoiando as atividades sindicais. Em cada setor da economia - petrolfero, eltrico, siderrgico, txtil, etc-passam a dominar alguns grandes grupos. So os trustes. Quando esses trustes fazem acordos entre si, estabelecendo um preo comum, dividindo o mercados potenciais e portanto

218

GEOGRAFIA GERAL
inviabilizando a livre concorrncia criam uma cartel. Muitos trustes surgidos no final do sculo XIX e incio do sculo XX, transformaram-se em conglomerados, resultantes de um processo mais amplo de concentrao e centralizao de capitais, de uma brutal ampliao e diversificao nos negcios, visando dominar a oferta de determinados produtos ou servios no mercado, os conglomerados, so o exemplo mais perfeito de empresas que atuam no capitalismo monopolista. Dentro da Segunda Revoluo Indstria dois aspectos ou processos se destacam, ambos tpicos do sculo XX: o Taylorismo e, em especial, o Fordismo.

CAPITALISMO
c) A experincia socialista de pases como Angola, Moambique e Guin-Bissau propiciou condies de vida semelhantes s de pases do Primeiro Mundo. d) Fronteiras polticas estabelecidas no perodo de colonizao, reunindo povos inimigos com idiomas e costumes diferentes, continuam sendo um dos maiores problemas africanos. e) Com a retirada dos colonizadores europeus, cessaram as guerras e guerrilhas no continente africano. 2. (UESPI) O perodo subseqente grande crise de 1929, ocasionada, sobretudo, pela superproduo desordenada, levou os Estados Unidos a um abrangente projeto de obras pblicas implantado pelo Governo Roosevelt, conhecido como New Deal. Sobre esse programa, CORRETO afirmar que: I. foi inspirado na teoria do economista J. Mainard Keynes, que defendia uma ampla participao do Estado nas questes de ordem socioeconmica e poltica. II. o mercado que deveria se sobrepor ao Estado Nacional com relao ao planejamento e s diretrizes socioeconmicas e polticas. III. foi inspirado no Plano Marshall, que objetivava expandir os ideais de consumo e de liberdade de mercado. Est (o) CORRETA(s): a) I apenas b) II apenas c) I e III apenas d) II e III apenas e) I, II e III. 3. O Capitalismo apresenta algumas caractersticas gerais, e esto presentes desde a fase inicial at a fase atual. Indique a opo em que essas caractersticas esto presentes. a) Lucro, trabalho assalariado e propriedade particular b) Uso do carvo mineral, trabalho na indstria e globalizao. c) Lei da Oferta e da Procura, trabalho assalariado e propriedade particular. d) Revolues Industriais, Fuso do capital e os bancos. 4. Em decorrncia da estrutura desigual que o capitalismo acarreta, o espao global marcado por relaes assimtricas e de dependncia entre regies e pases. Essa assimetria NO pode ser observada pelo seguinte fator: a) Grande poder de comando exercido pela trade: Estados Unidos, Unio Europia e Japo. b) Intensa rede de fluxos comerciais e produtivos mantida entre os pases que compem os principais blocos econmicos. c) Ritmo de crescimento econmico elevado em vrios pases do globo, principalmente nos da Amrica Latina. d) Excluso, na medida em que h pases que nem sequer participam da produo ou das trocas internacionais.

O CAPITALISMO INFORMACIONAL:
3 Revoluo Industrial - Tcnico cientifica (1970): Lderes: Japo e EUA. Tipo de Indstrias: Informtica, Robtica, Biotecnologia e Telecomunicaes. Doutrina econmica: Neoliberalismo. Globalizao da economia e dos problemas mundiais. Conhecimento em tecnoplos. Acelerao da produtividade econmica, fluxo de capitais e mercadorias.

EXERCCIOS
1. (UEL Janeiro / 2001) Apesar da resistncia, que teve momentos brilhantes, a colonizao destruiu as formas autnticas de vida desses pases, fraturou seu equilbrio cultural e material e instalou uma relao de dependncia na qual o capitalismo europeu, integrado a uma economia e comrcio mundiais, saqueou, atravs de suas companhias de minerao, mercantis e financeiras, os recursos da frica e obrigou seus povos a trabalhar, no para si prprios, mas para o desenvolvimento europeu.
(Enciclopdia do mundo contemporneo. So Paulo: Publifolha; Rio de Janeiro: Editora Terceiro Milnio, 1999. p. 100.)

A histria das antigas colnias europias trouxe conseqncias diversas para os pases hoje considerados de Terceiro Mundo, em especial no continente africano. Sobre o tema, correto afirmar: a) A colonizao europia implementou polticas de recuperao ambiental para o continente africano. b) Com a independncia das antigas colnias africanas, as economias locais tornaram-se autnomas e bem-sucedidas.

219

GEOGRAFIA GERAL
5. Durante grande parte do Breve Sculo XX, o comunismo sovitico proclamou-se um sistema alternativo e superior ao capitalismo, e destinado pela histria a triunfar sobre ele. E durante grande parte desse perodo, at mesmo muitos daqueles que rejeitavam suas pretenses de superioridade estavam longe de convencidos de que ele no pudesse triunfar.
HOBSBAWM, Eric. Era dos Extremos: o breve sculo XX. 1914-1991. So Paulo: Cia das Letras, 1995. Citado por VICENTINO, Cludio. Histria Geral. So Paulo: Scipione, 1997, p. 371.

GABARITOS
8. A partir da segunda metade do sculo XX novas transformaes no sistema econmico internacional ocorreram alterando a dinmica financeira entre os pases. Caracterize esse perodo e cite algumas mudanas desse momento. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

O texto acima a) Defende que o sistema socialista sovitico foi superior ao sistema capitalista, ao longo do sculo XX, fato reconhecido pelos prprios ocidentais. b) Refere-se ao prestgio do regime sovitico e disseminao da tese de que o advento do socialismo era historicamente inevitvel. c) Afirma que as potncias capitalistas, embora temessem a expanso socialista, tinham convico de que o capitalismo era superior e no seria suplantado por outro sistema. d) Contrape-se a Marx, ao apontar a presena do comunismo, na Unio Sovitica, sem a fase transitria do socialismo. 6. Algumas empresas de pases capitalistas buscam acordo entre si visando a controlar a produo e, principalmente, os preos no mercado. A esse tipo de integrao denominamos: a) Holding d) Pool b) Conglomerados e)Truste c) Cartel 7. Quais so as fases do capitalismo e quais suas principais caractersticas? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

GABARITOS
UNIDADE 1
1. a 2. a 3.a 4. c 5. a 6. v, f, v, v

UNIDADE 2
1.a 5.e 2.b 6.b 3.b 7.d 4.b 8.a

UNIDADE 3
1.b 2.b 3.c 4.d 5.e 6.b

UNIDADE 4
1.d 2. 25 3.a 4.e 5.b 6.a

UNIDADE 5
1.e 2.b 3.d 4.a 5.d 6.e

UNIDADE 6
1.d 2.a 3.a 4.c 5.c 6.c

220

GRAMTICA
223 Classes De Palavras .................................. 223 Substantivo .................................................. 223 Exerccios ..................................................... 224

DE PALAVRAS: 01 CLASSES SUBSTANTIVO

pg

225 Artigo ............................................................ 225 Adjetivo ......................................................... 225 Numeral ........................................................ 225 Exerccios ..................................................... 227

02

CLASSES DE PALAVRAS:
ARTIGO, ADJETIVO E NUMERAL

pg

231 Flexes Verbais ........................................... 231 Modo Imperativo ........................................ 231 Subclassificao do verbo ....................... 231 Como usar o particpio ............................. 232 Quando flexionar o infinitivo? ................. 232 Verbos Ter e Haver .................................... 232 Gerundismo ................................................. 232 Exerccios ..................................................... 234

04

CLASSES DE PALAVRAS: VERBO

pg

227 Pronome Pessoal ....................................... 228 Pronome de Tratamento .......................... 228 Pronome Possessivo ................................. 228 Pronome Demonstrativo .......................... 228 Pronome Indefinido ................................... 228 Pronome Relativo ....................................... 228 Pronome Interrogativo ............................. 229 Exerccios ..................................................... 230

03

CLASSES DE PALAVRAS: PRONOME

pg

CLASSES DE PALAVRAS: pg ADVRBIO, PREPOSIO, 234 CONJUNO E INTERJEIO Advrbio ....................................................... 234 Preposio ................................................... 234 Conjuno .................................................... 235 Interjeio .................................................... 235 Exerccios ..................................................... 236 Gabaritos ..................................................... 238

05

CLASSES DE PALAVRAS: SUBSTANTIVO

UNIDADE 1 CLASSES DE PALAVRAS: SUBSTANTIVO


CLASSES DE PALAVRAS
A lngua constituda por um nmero imenso de palavras. Essas palavras, que constituem o lxico (conjunto de palavras de uma lngua), possuem semelhanas e diferenas entre si. Repare como gato e mesa, por exemplo, podem ser colocadas em um mesmo grupo (coisas que existem); ao passo que gato e portanto so palavras de grupos distintos. Existem na lngua portuguesa dez grupos, chamados de classes de palavras, que compreendem quase todas as palavras do lxico. Assim, gato, cachorro, mesa, relgio, amor e saudade fazem parte da classe dos substantivos, porque indicam uma mesma idia de ser existente; enquanto porm, portanto, entretanto e contudo participam da classe das conjunes, porque ligam idias. Certas classes tm a propriedade de sofrer alteraes no final de sua forma. Essa propriedade, chamada flexo, encontra-se apenas no primeiro dos dois grupos abaixo, em que se dividem as classes de palavras: Variveis (ou flexveis): substantivo, artigo, adjetivo, numeral, pronome e verbo. Invariveis (ou inflexveis): advrbio, preposio, conjuno e interjeio. Por exemplo: o adjetivo belo pode se flexionar em belos, bela, belas, belssimo, belssimas etc.; j a preposio aps possui sempre essa forma.

FLEXO DO SUBSTANTIVO

Plural dos Substantivos Compostos A formao do plural dos nomes compostos, em portugus, no obedece a uma regularidade que nos permite uma sistematizao precisa e rigorosa. H, entretanto, a possibilidade de explicitar tendncias bem definidas. Para pluralizar os substantivos compostos, podemos pautarnos pelas seguintes normas: Dentro do substantivo composto, as palavras adjetivas e substantivas vo para o plural, as demais (verbos, advrbios) no. Exemplos: - Couve-flor (substantivo + substantivo): couves-flores; - Guarda-roupa (verbo + substantivo): guarda-roupas; - Bota-fora (verbo + advrbio): os bota-fora; Nos compostos de substantivo + substantivo, se o segundo no se relaciona com o primeiro de maneira aditiva, mas indicando tipo ou finalidade do primeiro, normalmente s varia o primeiro elemento (embora muitas vezes possam variar os dois). Exemplos: - Tquete-refeio tquetes-refeio - Salrio-famlia salrios-famlia Observao 1: Se, no mesmo caso, a relao entre os substantivos de soma, ambos vo para o plural. Exemplo: - Cirurgio-dentista cirurgies-dentistas (= cirurgies e dentistas) Nos compostos ligados por preposio, s varia o primeiro elemento. Exemplos: - mula-sem-cabea mulas-sem-cabea - p-de-moleque ps-de-moleque Nos compostos formados de palavras repetidas (ou muito semelhantes) constituindo uma onomatopia, s varia o segundo elemento. Exemplos: - tico-tico tico-ticos - pingue-pongue pingue-pongues

SUBSTANTIVO
Como voc percebeu, o texto 1 composto quase exclusivamente por substantivos. Isso possvel porque o autor reduziu a narrao ao mnimo, essncia. Repare que os nomes so de seres ou objetos. Assim, podemos conceituar o que so substantivos: So usados para nomear os seres em geral, tais como lugares, pessoas, coisas, aes, sentimentos, estados tomados como seres: xcara (coisa), amor (sentimento), Chico Buarque (pessoa), vida (estado), beijo (ao). Sempre funcionam com ncleo (palavra mais importante) do sujeito, dos objetos e do agente da passiva. Aparecem tambm em locues adjetivas (duas palavras com valor de um nico adjetivo) e adverbiais: sorriso (objeto direto), horas (locuo adverbial); pavor (locuo adjetiva). Flexiona-se em gnero, nmero e grau: menino, meninas, menininhos.

trabalhando com textos


TEXTO 1

VIDINHA REDONDA

Esperma, vulo, embrio, parto. Beb, choro, sobressalto, coc, xixi, fralda, leite, colo, sono. Doena, vmito, pavor, pediatra, remdio, preo. Murmrio, passos, fala. Escola, lancheira, material, professora. Curiosidade, descoberta. Crescimento, desenvolvimento, plos pubianos, seios, curvas, menstruao, modess, clica, atroveran, adolescncia. Primeiro beijo, paixo, shopping Center. Batom, esmalte, rinsagem, depilao. Namorado, presso, intimidade, culpa. Festa, pai, cime, relgio, motel, desculpa, dissimulao.

223

GRAMTICA
Faculdade, trabalho, conscincia, cansao, sossego, idade. Noivado, loja, fogo, geladeira, cama, mesa, banho, aliana, ch-de-panela. Cartrio, igreja, npcias. Sexo, trabalho, sexo, trabalho, sexo, esperma, vulo, licena, parto. (Ktia da Costa Aguiar)

CLASSES DE PALAVRAS: SUBSTANTIVO


2. Que sentido podemos tirar do fato de a crnica ser escrita apenas em substantivo concretos? _________________________________________________ _________________________________________________ _________________________________________________ 3. Na msica, no ltimo verso de cada estrofe, ocorrem quatro atribuies diferentes boca da mulher. Analise a mudana de significado a partir dos usos de substantivos concretos e abstratos. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 4. Assinale a alternativa INCORRETA: a) Se o substantivo manh estivesse no diminutivo manhzinha, demonstraria que a mulher acorda o eu lrico muito cedo. b) Se o substantivo sorriso estivesse no diminutivo sorrisinho, poderia demonstrar desconfiana quanto sinceridade do sorriso. c) Se o substantivo boca estivesse no diminutivo boquinha, aumentaria o carter sensual da boca. d) Se o substantivo caf estivesse no diminutivo cafezinho, estaria demonstrando que o caf pequeno. 5. Numa das seguintes frases, h uma flexo de plural grafada erradamente: a) Os escrives sero beneficiados por esta lei. b) O nmero mais importante o dos anezinhos. c) Faltam os hifens nesta relao de palavras. d) Fulano e Beltrano so dois grandes carteres. e) Os rpteis so animais ovparos. 6. Assinale o par de vocbulos que fazem o plural da mesma forma que balo e caneta-tinteiro: a) Vulco, abaixo-assinado d) Bno, papel-moeda b) Irmo, salrio-famlia e) Razo, guarda-chuva c) Questo, manga-rosa 7. Assinale a alternativa em que est correta a formao do plural: a) Cadver cadveis d) Mal maus b) Gavio gavies e) Atlas os atlas c) Fuzil fuzveis 8. Indique a alternativa em que todos os substantivos so abstratos: a) Tempoangstiasaudadeausnciaesperanaimagem b) Angstia sorriso luz ausncia esperana inimizade c) Inimigo luz esperana espao tempo d) Angstia saudade ausncia esperana inimizade e) Espao olhos luz lbios ausncia esperana

TEXTO 2
(Chico Buarque) *Todo dia ela faz tudo sempre igual Me sacode s seis horas da manh Me sorri um sorriso pontual E me beija com a boca de hortel Todo dia ela diz que pra eu me cuidar E essas coisas que diz toda mulher Diz que est me esperando pro jantar E me beija com a boca de caf Todo dia eu s penso em poder parar Meio-dia eu s penso em dizer no Depois penso na vida pra levar E me calo com a boca de feijo Seis da tarde como era de se esperar Ela pega e me espera no porto Diz que est muito louca pra beijar E me beija com a boca de paixo Toda noite ela diz pra eu no me afastar Meia-noite ela jura eterno amor E me aperta pra eu quase sufocar E me morde com a boca de pavor * Repete

COTIDIANO

EXERCCIOS
1. Na expresso Sorri um sorriso, encontramos uma figura de linguagem . Nomeie e explique essa figura. _________________________________________________ _________________________________________________ _________________________________________________ Leia a diferenciao de substantivo concreto e abstrato e responda s questes 2 e 3: Concreto: designa o ser existindo independentemente de outros, real ou imaginariamente, isto , nomes de pessoas, lugares, instituies, gneros, espcies: casa, mesa, sof, Brasil, sereia, vento, mamferos; Abstrato: designa qualidade, aes, sentimentos ou atribuies dos seres como se existissem em si mesmo: beleza, crueldade, demolio, largura, limpeza.

PROPOSTA DE REDAO

Produza um texto, usando de base o texto 1. Para isso, utilize-se apenas de substantivos.

224

CLASSES DE PALAVRAS: ARTIGO, ADJETIVO E NUMERAL

UNIDADE 2 CLASSES DE PALAVRAS: ARTIGO, ADJETIVO E NUMERAL


Os substantivos geralmente vm acompanhados. Peguemos do primeiro verso da msica a seguinte construo: a estupidez humana. Temos, no ncleo, o substantivo, que vem acompanhado esquerda por um artigo e, direita, por um adjetivo.

No primeiro caso, preta substantivo, e no segundo faz-se adjetivo. O oposto ocorre com velha. Os adjetivos podem ser substitudos por locues adjetivas, ou seja, conjunto de palavras com funo de adjetivo: - Corao de anjo (prep. + subst.) - Jornal de hoje (prep. + advrbio) OBRIGADO: Para agradecer, mulheres devem usar SEMPRE obrigada (e homens, sempre obrigado), pois o adjetivo deve concordar com quem est falando. E como resposta, evite as formas obrigado(a) eu ou obrigado(a) voc. So mais agradveis as formas: eu que agradeo, por nada, de nada e no h de qu.

ARTIGO
Demonstram se o substantivo ou no conhecido pelo leitor ou ouvinte, seja por ter sido mencionado antes, seja por ser objeto de um conhecimento de experincia. Sempre indicam o gnero e nmero dos substantivos. E servem exclusivamente a esta classe de palavras. Desta forma, qualquer palavra associada a um artigo ou um substantivo, ou uma palavra substantivada. Flexiona-se em gnero e nmero, sempre concordando com o substantivo a que se associa.

FLEXO DO ADJETIVO

Plural dos Adjetivos Compostos Regra-geral: Os adjetivos compostos s variam no segundo elemento tanto em gnero quanto em nmero. Exemplos: - Produto norte-americano - Produo norte-coreana - Espelhos cncavo-convexos Os adjetivos compostos de nome de cor mais substantivo ficam invariveis: fardas verde-oliva. Tambm as cores com nome cor-de mais substantivo so invariveis: camisas cor-de rosa (ou camisas rosa); prdios cor-de-cinza (ou prdios cinza). O adjetivo azul-marinho invarivel: tecidos azul-marinho.

DEFINIDOS O a os as

INDEFINIDOS um uma Uns Umas

Como j dito, os artigos demonstram se o substantivo j conhecido ou no pelo receptor. Usa-se o artigo definido quando o substantivo for j conhecido. Repare no exemplo abaixo o uso dos artigos: Os veteranos promoveram uma festa na semana passada. Disseram-me que a festa foi um fiasco. Alm disso, pode ter valor depreciativo: Ele era um jogadorzinho...

NUMERAL
Indicam quantidade exata de seres, ou a posio que estes ocupam numa determinada srie. Associam-se ao substantivo, tendo funo semelhante de adjetivo. Podem ser variveis (trezentas pessoas) ou invariveis (mil pessoas).

ADJETIVO
Indicam qualidade, defeito, estado, modo de ser ou aspecto de um substantivo. So essencialmente modificadores de substantivos, concordando com estes em gnero e nmero. Podem flexionar-se em gnero nmero e grau. muito estreita a relao entre substantivo (essncia) e adjetivo (caracterstica). No raro h uma nica forma para as duas classes de palavras. Para saber se o adjetivo se transformara em substantivo, basta notar se caberia um artigo palavra. Se o artigo for aceito, trata-se ento de substantivo: Uma preta velha vendia laranjas. Uma velha preta vendia laranjas.

CLASSIFICAO DOS NUMERAIS

Cardinais: indicam quantidade determinada. Ex.: um, dois, treze, oitenta. Ordinais: indicam ordem de sucesso. Ex: primeiro, octogsimo, milsimo quadragsimo stimo. Multiplicativos: indicam multiplicao. Ex: dobro, triplo, qudruplo. Fracionrios: indicam diviso, frao. Ex: meio, metade, um stimo.

225

GRAMTICA
Designao de reis, papas, imperadores, sculos, captulos festas, feiras etc.: Utilizam-se algarismos romanos. Na leitura, deve-se ler como ORDINAL at 10, e a partir da como cardinal. Se o numeral vier antes do substantivo, ser sempre ordinal. Nunca se inicia frase com algarismos Deve-se escrever por extenso. No meio da frase, aconselha-se escrever em algarismos nmeros longos.

CLASSES DE PALAVRAS: ARTIGO, ADJETIVO E NUMERAL

TEXTO 3

(Legio Urbana) Vamos celebrar a estupidez humana A estupidez de todas as naes O meu pas e sua corja de assassinos Covardes, estupradores e ladres Vamos celebrar a estupidez do povo Nossa polcia e televiso Vamos celebrar nosso governo E nosso estado que no nao Celebrar a juventude sem escola As crianas mortas Celebrar nossa desunio Vamos celebrar Eros e Thanatos Persephone e Hades Vamos celebrar nossa tristeza Vamos celebrar nossa vaidade Vamos comemorar como idiotas A cada fevereiro e feriado Todos os mortos nas estradas Os mortos por falta de hospitais Vamos celebrar nossa justia A ganncia e a difamao Vamos celebrar os preconceitos O voto dos analfabetos Comemorar a gua podre E todos os impostos Queimadas, mentiras e sequestros Nosso castelo de cartas marcadas O trabalho escravo Nosso pequeno universo Toda a hipocrisia e toda a afetao Todo roubo e toda a indiferena Vamos celebrar epidemias: a festa da torcida campe Vamos celebrar a fome No ter a quem ouvir No se ter a quem amar Vamos alimentar o que maldade Vamos machucar um corao Vamos celebrar nossa bandeira Nosso passado de absurdos gloriosos Tudo que gratuito e feio Tudo o que normal Vamos cantar juntos o hino nacional A lgrima verdadeira Vamos celebrar nossa saudade E comemorar a nossa solido Vamos festejar a inveja A intolerncia e a incompreenso Vamos festejar a violncia E esquecer da nossa gente Que trabalhou honestamente a vida inteira E agora no tem mais direito a nada Vamos celebrar a aberrao De toda a nossa falta de bom senso Nosso descaso por educao Vamos celebrar o horror de tudo isso Com festa, velrio e caixo

PERFEIO

trabalhando com textos


TEXTO 1

POEMA BRASILEIRO
(Ferreira Gullar) *No Piau de cada 100 crianas que nascem 78 morrem antes de completar 8 anos de idade No Piau de cada 100 crianas que nascem 78 morrem antes de completar 8 anos de idade No Piau de cada 100 crianas que nascem 78 morrem antes de completar 8 anos de idade antes de completar 8 anos de idade antes de completar 8 anos de idade antes de completar 8 anos de idade antes de completar 8 anos de idade

TEXTO 2

POEMA TIRADO DE UMA NOTICIA DE JORNAL


(Manuel Bandeira)

Joo Gostoso era carregador de feira-livre e morava no morro da Babilnia num barraco sem nmero Uma noite ele chegou no bar Vinte de Novembro Bebeu Cantou Danou Depois se atirou na Lagoa Rodrigo de Freitas e morreu afogado.

226

GRAMTICA
Est tudo morto e enterrado agora J que tambm podemos celebrar A estupidez de quem cantou esta cano Venha, meu corao est com pressa Quando a esperana est dispersa S a verdade me liberta Chega de maldade e iluso Venha, o amor tem sempre a porta aberta E vem chegando a primavera Nosso futuro recomea: Venha que o que vem perfeio...

CLASSES DE PALAVRAS: PRONOME


_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 7. O uso de numeral comum em textos de carter cientfico, pois os dados estatsticos do mais veracidade ao texto. Que sentido traz o uso dos numerais 100, 78 e 8 no poema? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Assinale a alternativa em que o adjetivo que qualifica o substantivo seja explicativo: a) Aia chuvoso b) gua morna c) Moa bonita d) Fogo quente e) Lua cheia 9. Assinale a alternativa que contm o grupo de adjetivos gentlicos, relativos a Japo, Trs Coraes e Moscou: a) Oriental, Tricardaco, Moscovita b) Nipnico,Tricordiano, Sovitico c) Japons, Trscoraoense, Moscovita d) Nipnico, Tricordiano, Moscovita e) Oriental, Tricardaco, Sovitico

EXERCCIOS
1. Leia as definies de dicionrio: * banal adj.2g. Sem originalidade; comum, trivial, vulgar. * -izar Forma verbos com idia de converter, tornar, assemelhar. De acordo com as leituras e com a definio, escreva o que banalizao. _________________________________________________ _________________________________________________ _________________________________________________ 2. No texto 1, como voc justifica o recurso de repeties? _________________________________________________ _________________________________________________ _________________________________________________ 3. Que figura de linguagem traz a msica para expressar a mensagem? a) Ironia: expressar o contrrio do que as palavras apresentam b) Pleonasmo: redundncia de idias c) Elipse: omisso de palavras d) aliterao: repetio de um som consonantal 4. Na msica, percebemos a existncia de apenas um artigo indefinido. Explique por que a grande maioria dos artigos so definidos. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 5. Que sentido traz o uso do nico artigo indefinido da msica? _________________________________________________ _________________________________________________ _________________________________________________ 6. Compare os seguintes versos: As crianas mortas e Todos os mortos nas estradas. Em cada caso, a que classe de palavras pertence o termo sublinhado? Como podemos perceber a mudana?

PROPOSTA DE REDAO

Utilize como modelo o texto redigido da Unidade 1, mas, agora, voc poder utilizar artigos, adjetivos e numerais.

UNIDADE 3 CLASSES DE PALAVRAS: PRONOME


Representam ou acompanham um substantivo. Quando acompanham um substantivo, tm funo adjetiva, quando substituem o substantivo, possuem funo substantiva. Dividem-se em variveis (flexveis) e invariveis (inflexveis). Podem ser flexionados em gnero, nmero e pessoa. Subdividem-se em pessoais, possessivos, demonstrativos, indefinidos, interrogativos e relativos. So trs as pessoas do discurso (ou de um ato de fala): 1 a pessoa que fala 2 a pessoa com quem se fala 3 a pessoa de quem se fala

227

GRAMTICA

CLASSES DE PALAVRAS: PRONOME

PRONOME PESSOAL
aquele que se designa uma das trs pessoas do discurso. Os do caso reto funcionam sempre como sujeito; os do caso oblquo, como complementos.

PRONOME POSSESSIVO
Transmitem a idia de posse.

NMERO

PESSOA 1

PRONOMES Meu, minha, meus, minhas Teu, tua, teus, tuas Seu, sua, seus, suas Nosso, nossa, nossos, nossas Vosso, vossa, vossos, vossas Seu, sua, seus, suas

NMERO

PESSOA 1

PRONOMES RETOS Eu Tu Ele Ns Vs Eles

PRONOMES OBLQUOS Me, mim, comigo Te, ti, contigo Se, si, consigo, o, a, lhe, ele Nos, ns conosco Vos, vs, convosco Se, si, consigo, os, as, lhes, eles.

Singular

2 3 1

Singular

2 3 1

Plural

2 3

Plural

2 3

PRONOME DEMONSTRATIVO
Indicam a posio do ser no tempo e no espao.

Obs: Os pronomes oblquos em itlico so tnicos e aparecem sempre precedidos de preposio (com exceo de comigo, contigo e consigo, pois j trazem em si a preposio com). Exemplo: No h nada entre mim e voc. Enganaram a ns. Fez tudo por eles.

1 2 3

este, esta, estes, estas; isto esse, essa, esses, essas; isso aquele, aquela, aqueles, aquelas; aquilo

PRONOME DE TRATAMENTO
Vossa Santidade (V.S.), para o papa. Vossa Majestade (V.M.), Vossas Majesta-des (VV.MM.), para reis ou rainhas. Vossa Alteza (V.A.), Vossas Altezas (VV.AA.), para prncipes ou princesas. Vossa Magnificncia, Vossas Magnificncias, para reitores de universidades. Vossa Reverendssima (V.Revma), Vossas Reverendssimas (V.Revmas.), para sacerdotes e outras autoridades religiosas do mesmo nvel. Vossa Excelncia (V.Exa.), Vossas Excelncias (V.Exas.), para altas autoridades. Vossa Senhoria (V.Sa.), Vossas Senhorias (V.Sas.), para oficiais, funcionrios graduados, e principalmente na linguagem comercial. Acrescenta-se o pronome voc, derivado de vossa merc. Embora os pronomes de tratamento se dirijam segunda pessoa, concordam sempre em terceira. Ex: Tu amas teu pai; voc ama seu pai. Quando se dirigir diretamente pessoa, usa-se vossa; quando no, usa-se sua. Ex: Vossa excelncia me acompanhe at a sala. (falando com a pessoa). Sua excelncia foi embora ontem.(falando sobre a pessoa)

Este, esta, isto indicam o ser que est no mbito da pessoa que fala (1 pessoa); esse, essa, isso referem-se ao ser que se acha no campo de ao da pessoa com que se fala (2 pessoa); aquele, aquela, aquilo relacionam-se ao ser de que se fala, ou seja, o assunto (3 pessoa). Tambm pronome demonstrativo: O (e as variaes a, os, as, equivalendo a isto, isso, aquilo, aquele, aquela, aqueles, aquelas). Ex: No compreendo o que dizes. Eu j estudei: e tu, j o fizeste tambm?

PRONOME INDEFINIDO
Referem-se sempre terceira pessoa.

VARIVEIS Algum, nenhum, todo, outro, muito, pouco, certo, bastante, qualquer, tanto.

INVARIVEIS Algo, tudo, nada, algum, ningum, cada, outrem, menos

No existe menas! Sempre menos: hoje vieram menos mulheres.

PRONOME RELATIVO
Retomam um nome da orao anterior e o projetam em outra orao.

VARIVEIS O qual, a qual, os quais, as quais. Cujo, cuja, cujos, cujas. Quanto, quanta, quantos, e quantas.

INVARIVEIS Que, quem e onde.

228

CLASSES DE PALAVRAS: PRONOME

PRONOME INTERROGATIVO
So os pronomes que, quem, qual(is), quanto(as) usados em perguntas diretas ou indiretas. Ex: Quem aquele menino (direta) Perguntaram quem era aquele menino (indireta).

TEXTO 3

AQUELES DOIS (fragmento)


(Caio Fernando Abreu) Afastaram-se, ento. Raul disse qualquer coisa como eu no tenho mais ningum no mundo, e Saul outra coisa qualquer como voc tem a mim agora, e para sempre. Usavam palavras grandes - ningum, mundo, sempre - e apertavam-se as duas mos ao mesmo tempo, olhando-se nos olhos injetados de fumo e lcool. Embora fosse sexta e no precisassem ir repartio na manh seguinte, Saul despediu-se. Caminhou durante horas pelas ruas desertas, cheias apenas de gatos e putas. Em casa; acariciou Carlos Gardel at que os dois dormissem. Mas um pouco antes, sem saber por qu, comeou a chorar sentindo-se s e pobre e feio e infeliz e confuso e abandonado e bbado e triste, triste, triste. Pensou em ligar para Raul, mas no tinha fichas e era muito tarde.

trabalhando com textos


TEXTO 1

PANORAMA SOBRE A HOMOSSEXUALIDADE


Os cientistas ainda no tm resposta definitiva de como a orientao sexual se desenvolve em qualquer indivduo. No entanto, muitos compartilham a viso de que ela seja moldada, na maioria das pessoas, nos primeiros anos de vida, atravs de complexas interaes de fatores biolgicos, psicolgicos e sociais. Os profissionais de sade mental concordam que a homossexualidade no enfermidade, doena mental ou problema emocional. Ela tambm no uma escolha; ningum escolhe sofrer discriminao e injustia social. Algumas pessoas relatam terem tentado, durante muitos anos, mudar a sua orientao sexual de homossexual para heterossexual, sem sucesso. Por isso que, em 1999, o Conselho Federal de Psicologia, emitiu uma resoluo proibindo expressamente qualquer psiclogo de fornecer tratamento a qualquer sujeito autodenominado homossexual no sentido de promover sua cura, j que irreversvel. A sexualidade tambm no influencivel. Se assim fosse, todas as pessoas seriam heterossexuais. No Brasil, a situao vergonhosa. Nosso pas ocupa o primeiro lugar de assassinatos a homossexuais, com mais de cem crimes homofbicos por ano. Ou seja, em pases como Ir, Sudo e Iraque, onde existe a pena de morte para homossexuais, acontecem menos execues do que os assassinatos no Brasil. O antroplogo Luiz Mott, fundador do GGB (Grupo Gay da Bahia), acredita que a situao seja ainda pior, pois as informaes nem sempre chegam aos militantes.

TEXTO 4
(Legio Urbana) Quero me encontrar, mas no sei onde estou Vem comigo procurar algum lugar mais calmo Longe dessa confuso E dessa gente que no se respeita Tenho quase certeza que eu no sou daqui. Acho que gosto de So Paulo, Gosto de So Joo, Gosto de So Francisco e So Sebastio, E eu gosto de meninos e meninas. Vai ver que assim mesmo E vai ser assim pra sempre Vai ficando complicado E ao mesmo tempo diferente Estou cansado de bater e ningum abrir Voc me deixou sentindo tanto frio No sei mais o que dizer Te fiz comida, velei teu sono Fui teu amigo, te levei comigo E me diz: pra mim o que que ficou? Me deixa ver como viver bom No a vida como est, E sim as coisas como so Voc no quis tentar me ajudar Ento, a culpa de quem? A culpa de quem? Eu canto em portugus errado Acho que o imperfeito no participa do passado Troco as pessoas, troco os pronomes Preciso de oxignio, preciso ter amigos Preciso ter dinheiro, preciso de carinho Acho que te amava, agora acho que te odeio So tudo pequenas coisas e tudo deve passar Acho que gosto de So Paulo Gosto de So Joo Gosto de So Francisco e So Sebastio E eu gosto de meninos e meninas.

MENINOS E MENINAS

TEXTO 2

Garotos de 17 e 15 anos sendo enforcados no Ir.

229

GRAMTICA

CLASSES DE PALAVRAS: PRONOME


c) Em Tenho quase certeza, o pronome limita o sentido do substantivo, e sentindo tanto frio, o pronome intensifica. d) Em A culpa de quem?, h um pronome interrogativo. e) No refro, o pronome demonstrativo eu aparece apenas no ltimo verso. 7. Sobre o trecho em pases como Ir, Sudo e Iraque (...), acontecem menos execues do que os assassinatos no Brasil, CORRETO afirmar que: a) Execues uma palavra feminina, ento deveria ser menas execues. b) Menos um pronome com funo de comparar, e sempre concorda com a palavra a que se refere. c) Menos um pronome invarivel. d) o oposto a menos...do que maior...do que. 8. (IBGE) Assinale a opo que apresenta o emprego CORRETO do pronome, de acordo com a norma culta: a) O diretor mandou eu entrar na sala. b) Preciso falar consigo o mais rpido possvel. c) Cumprimentei-lhe assim que cheguei. d) Ele s sabe elogiar a si mesmo. e) Aps a prova, os candidatos conversaram entre eles. 9. (IBGE) Assinale a opo em que houve erro no emprego do pronome pessoal em relao ao uso culto da lngua: a) Ele entregou um texto para mim corrigir. b) Para mim, a leitura est fcil. c) Isto para eu fazer agora. d) No saia sem mim. e) Entre mim e ele h uma grande diferena. 10. (U-UBERLNDIA) Assinale o tratamento dado ao reitor de uma Universidade: a) Vossa Senhoria b) Vossa Santidade c) Vossa Excelncia d) Vossa Magnificncia e) Vossa Paternidade 11. (BB) Colocao INCORRETA: a) Preciso que venhas verme. b) Procure no desapont-lo. c) O certo faz-los sair. d) Sempre negaram-me tudo. e) As espcies se atraem

EXERCCIOS
1. As expresses cura e crimes sexuais do Texto 1 esto entre aspas. Isso demonstra que: a) Essas palavras pertencem a uma personagem. b) Essas palavras so de outra lngua. c) O autor criou neologismos. d) O autor no concorda com essas terminologias. e) O autor quis enfatizar uma verdade. 2. O pronome ela grifado no incio do Texto 1 remete palavra: a) Homossexualidade d) Indivduo b) Resposta e) Viso c) Orientao sexual 3. O ttulo do conto (Texto 3) contm um pronome demonstrativo. Analise os comentrios acerca da expresso aqueles dois e some as alternativas corretas: (01) O pronome demonstrativo geralmente usado para apontar pessoas ou coisas que se encontram longe dos interlocutores. (02) A expresso que d ttulo ao conto demonstra que os dois rapazes eram constantemente assunto de fofocas. (04) O pronome aqueles reitera a distncia que separava os dois rapazes. (08) Pelo ttulo, podemos notar que o narrador menospreza a histria que conta. (16) O ttulo Aqueles dois remete a Raul e Saul, dois rapazes que trabalhavam juntos. 4. Raul e Saul Usavam palavras grandes - ningum, mundo, sempre. Qual a figura de linguagem em que se exagera uma ideia? a) Metfora d) Ironia b) Hiprbole e) Prosopopia c) Pleonasmo 5. No refro, que elementos indicam a tentativa do filho de amenizar o choque da confisso aos pais? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 6. Quanto aos pronomes do Texto 4, assinale a alternativa inCORRETA: a) Em gente que no se respeita o pronome demonstra que as pessoas, da mesma forma como no respeitam os outros, tambm no so respeitadas. b) A construo Te fiz comida prpria da linguagem coloquial.

PROPOSTA DE REDAO

Escreva uma carta pedindo um aumento ao seu chefe.

230

CLASSES DE PALAVRAS: VERBO

UNIDADE 4 CLASSES DE PALAVRAS: VERBO


Indicam aes (encontrar, saber, vir), estado (so, ) e fenmenos da natureza (chover). Sempre concordam com o sujeito em nmero e pessoa: quero (1 pessoa do singular), sujeito: eu (1 pessoa do singular); As crianas correm (3 pessoa do plural). Alm disso, tem funo obrigatria no predicado. Flexionam-se em pessoa, nmero, tempo, modo e voz. Ex: correm: 3 pessoa, plural, tempo presente, modo indicativo e voz ativa. Tambm se encaixam em uma das trs conjugaes verbais: 1 conjugao: infinitivo terminado em -ar: ficar, estar, olhar, maltratar, quebrar; 2 conjugao: infinitivo terminado em -er ou -or: morrer, haver, poder, pr; 3 conjugao: infinitivo terminado em -ir: ir, conseguir, falir.

Alm desses, existem ainda os tempos nominais do verbo: Infinitivo: andar, fazer, partir; Gerndio: andando, fazendo, partindo; Particpio: andado, feito, partido. Voz: I. Ativa o sujeito executor da ao verbal. (Juliana estudou a matria) II. Reflexiva o sujeito pratica e recebe a ao. (Marcos se sujou de giz) III. Passiva o sujeito paciente, ou seja, sofre a ao verbal. (O rato foi pego pelo gato). O estudo da voz passiva se far ainda quando se estudar a sintaxe.

IMPORTANTE
Pessoas Indicativo Imperativo afirmativo
tu voc ns vs vocs left lent let lay lost dizeis dizes

Subjuntivo
digas diga digamos digais digam

Imperativo negativo
no digas no diga no digamos no digais no digam

FLEXES VERBAIS
Nmero: o verbo pode estar no singular (ando, andas, anda) ou no plural (andamos, andais, andam). A primeira forma se usa quando o sujeito uma s pessoa ou coisa; e o plural, quando mais de uma. Pessoa: existem trs pessoas verbais, so as mesmas apresentadas nos pronomes. Obs: Atualmente, principalmente no Brasil, as formas tu e vs foram substitudas pelo pronome de tratamento voc(s). Embora a funo desse termo seja de 2 pessoa, j que remete pessoa a quem se fala, sua estrutura idntica aos pronomes de 3 (tu andas; voc/ele anda). Modo: categoria prpria do verbo que exprime nossa atitude psquica, perante o processo que enunciamos. Pode ser: I. Indicativo simplesmente narra um processo, expe um acontecimento: certeza. (A chuva cai mansa). II. Subjuntivo geralmente exprime um processo possvel, condicionado: dvida. ( possvel que eu chegue antes). III. Imperativo exprime comando, solicitao: ordem. (Deixe tudo e faa a lio). Obs: to importantes quanto essas definies de sentido, as funes sintticas de cada modo sero vistas adiante. Tempo: indica o momento em que se d o fato. Divide-se basicamente em presente, pretrito (ou passado) e futuro. O presente indivisvel, mas o pretrito pode ser imperfeito, perfeito ou mais-que-perfeito, e o futuro pode ser do presente ou do pretrito. As gramticas trazem as subdivises e estudo detalhado de cada uma.

O tempo pretrito mais-que-perfeito (eu amara, tu correras, ela partira) atualmente mais usado na forma composta (eu tinha/havia amado, tu tinhas corrido, ele havia partido). Existem tambm as locues verbais, isto , mais de um verbo para indicar apenas uma idia: est fazendo; comeou a andar.

MODO IMPERATIVO
O imperativo afirmativo se forma da seguinte forma: a segunda pessoa do singular (tu) e a segunda pessoa do plural (vs) derivam das pessoas correspondentes do presente do indicativo, suprimindo-se o s do final; as demais pessoas (voc, ns, vocs) vm do presente do subjuntivo sem alteraes. O imperativo negativo no possui formas especiais. Suas pessoas so idnticas s correspondentes do presente do subjuntivo.

SUBCLASSIFICAO DO VERBO
VERBO REGULAR
Suas terminaes seguem o modelo geral da conjugao a que pertence; Seu radical se mantm inalterado em todas as formas da conjugao. Como exemplo, podemos citar o verbo partir, pertencente 3 conjugao.

231

GRAMTICA PRESENTE DO INDICATIVO part part part part part part o es e imos is em PRETRITO PERFEITO DO INDICATIVO part part part part part part i iste iu imos istes iram Terminaes tpicas da 3 conjugao

CLASSES DE PALAVRAS: VERBO

COMO USAR O PARTICPIO


Existem verbos, em portugus, que possuem dois particpios: um regular com as terminaes -ado e -ido e outro chamado irregular, porque se forma de modo contrado, sem as terminaes, como solto, findo, salvo, seco etc. O particpio regular usado com os auxiliares ter e haver, ou seja, na voz ativa: tem prendido, havia soltado, tem entregado. O particpio irregular usado na voz passiva, com ser, estar, ficar, e neste caso flexiona no feminino e no plural: ser preso, foi solta, foram entregues. Obs: quando o verbo s possui um particpio, essa forma usada em todos os casos: foi/tem escrito, /tinha chegado.

Terminaes seguem o Radical (part): Radical (part): modelo geral constante constante dos verbos da 3 conjugao

Obs: Para saber se um verbo regular basta verificar se a regularidade se revela no presente e no perfeito do indicativo.

QUANDO FLEXIONAR O INFINITIVO?


De regra geral, usa-se o infinitivo flexionado quando o sujeito do verbo no infinitivo for diferente do sujeito do verbo da outra orao. Por exemplo: (eu) Mencionei a inteno de (ns) vendermos a casa. Quando o sujeito o mesmo, a flexo do infinitivo no necessria. No , porm, proibida. Por exemplo: Deveremos reunirnos para discutir/discutirmos os problemas da empresa Nunca se flexiona o verbo principal de uma locuo: os alunos querem sair.

VERBO IRREGULAR

O radical se altera em algumas das formas de conjugao, ou;

As terminaes no seguem o modelo geral da conjugao a que pertence. Como exemplo, podemos citar o verbo estar (1 conjugao) e o verbo medir (3 conjugao).

PRESENTE DO INDICATIVO Est Est Est Est Est Est Ou s amos ais o

PRETRITO PERFEITO DO INDICATIVO me med med med med med o es e imos is em

VERBOS TER E HAVER


Com sentido de existir, ocorrer, e verbo FAZER com ideia de tempo decorrido. Sempre na terceira pessoa do singular: teve/houve dias difceis (e no tiveram/houveram) ter/haver festas (e no tero/ havero), faz 10 anos que no volto (e no fazem). Obs: o uso do ter com sentido de existir no da norma culta.

Terminaes: como se v, as Terminaes: terminaes no caso, as Radical: Na no seguem terminaes primeira Radical (est): (ao menos seguem o pessoa, houve constante integralmente) modelo da 3 alterao o modelo da conjugao: -o radical. 1 conjugao: -es -e -imos -is -o -as -a -amos em. -ais -am.

GERUNDISMO
O uso repetitivo do gerndio chama-se endorria ou gerundismo. Mas a vtima do gerundismo no o gerndio em si, mas a estrutura vou estar + gerndio, uma locuo. Em si, a locuo vou estar + gerndio correta quando comunica a idia de uma ao que ocorre no momento de outra. A sentena vou estar dormindo na hora da novela adequada, assim como quando h verbos que indiquem ao ou processo duradouros e contnuos: amanh vai estar chovendo ou amanh vou estar trabalhando o dia todo, por exemplo. Gerundismo se d quando ns no queremos comunicar essa idia de eventos ou aes simultneas, mas antes falar de uma ao especfica, pontual, em que a durao no a preocupao dominante. A coisa piora mesmo quando a idia de continuidade nem deveria existir na frase. Vou falar narra algo que vai ocorrer a partir de agora. Vou estar falando se refere a um futuro em andamento estar d idia de permanncia no tempo.

VERBO DEFECTIVO

aquele que apresenta deficincia ou falta de uma ou mais formas de conjugao. Como exemplo, podemos apontar o verbo reaver que, no presente do indicativo, s possui primeira e segunda pessoa do plural:

Eu Tu Ele 232

Ns Vs Eles

reavemos reaveis

GRAMTICA

CLASSES DE PALAVRAS: VERBO

trabalhando com textos


TEXTO 1

TEXTO 2

(Gabriel o Pensador) No coma de boca aberta, no fale de boca cheia; no beba de barriga vazia no fale da vida alheia, no julgue sem ter certeza e no apie os cotovelos sobre a mesa no pare no acostamento, no passe pela direita, no passe embaixo de escada que d azar no cuspa no cho da rua, no cuspa pro alto, no deixe de dar descarga depois de usar no use o nome de Deus em vo, irmo no use remdios sem orientao. *SORRIA! Voc t sendo filmado SORRIA! Voc t sendo observado SORRIA! Voc t sendo controlado c t sendo filmado! c t sendo filmado! (2x) No coma de boca aberta, no fale de boca cheia, no toque nos produtos se no for comprar no pise na grama, no faa xixi na cama; no ame quem no te ama; no ame quem no te ama No chame os elevadores em caso de incndio no entre no elevador sem antes verificar se o mesmo encontra-se neste andar no chupe balas oferecidas por estranhos no recuse um convite sem dizer obrigado no diga palavras chulas na frente dos seus avs no fale com o motorista; apenas o necessrio no se deixe levar pelos instintos carnais no desobedea a seus pais no d esmola aos mendigos, no d comida aos animais no d comida aos animais, no d esmola aos mendigos no coma de boca aberta, no fale de boca cheia, no d na primeira noite, no coma a mulher do amigo. * repete No use o nome de Deus em vo, irmo no use remdios sem orientao no se deixe levar! (4x) Coma de boca aberta, coma de boca fechada coma nos elevadores em caso de incndio coma nas escadas coma no cho da rua, coma na grama, coma na cama ame quem no te ama, no recuse balas oferecidas por estranhos no d esmola aos mendigos sem dizer obrigado no chupe os animais, no desobedea aos seus instintos carnais no d na primeira noite na frente dos seus avs no use o nome de Deus se no for comprar no coma a mulher do amigo sem antes verificar se o mesmo encontra-se neste andar.

SORRIA

UM DIA AINDA VOU ME VINGAR DESTE JEITO!


Toca o celular: Al? Al, Senhor Guilherme? Sim. Sr. Guilherme, aqui da Operadora X, estamos ligando para oferecer a promoo X 1382 minutos, com a qual o senhor tem direito... Desculpe interrompo mas quem est falando? Aqui Rosicleide Judite, da X, e estamos ligando... Rosicleide, me desculpe, mas para nossa segurana, esta conversa estar sendo gravada a partir de agora. Eu gostaria de estar conferindo alguns dados antes de estar continuando a conversa, pode ser? Bem, pode... Voc trabalha em que rea, na X? Telemarketing Pr Ativo. Voc pode estar me passando o nmero de matrcula na X? Senhor, desculpe, mas no creio que essa informao seja necessria. Ento terei de estar desligando, pois no posso ter segurana de que estarei falando com uma funcionria da X. Mas posso garantir... Alm do mais, sempre sou obrigado a estar fornecendo meus dados a uma legio de atendentes sempre que tento estar falando com a X. Minha matrcula 39452964. S um momento, estarei verificando... (Dois minutos). S mais um momento... (Cinco minutos). Senhor? S mais um momento, por favor, nossos sistemas esto lentos hoje. Mas senhor... Pronto, Rosicleide, obrigado por haver aguardado. Em que posso estar ajudando? Aqui da X, estamos ligando para oferecer a promoo X 1382 minutos, com a qual o senhor tem direito a falar 1.300 minutos e ganha 82 minutos grtis, alm de poder enviar 372 X Torpedos totalmente grtis. O senhor est interessado, Sr. Guilherme? Rosicleide, vou ter que estar transferindo voc para a minha esposa, porque ela que estar decidindo sobre alterao de planos de telefones celulares. Por favor, no desligue, pois esta ligao muito importante para mim. Coloco o celular em frente ao aparelho de som, deixo a msica Festa no Ap do Latino tocando no repeat e vou para o bar tomar uma cervejinha.

233

GRAMTICA

EXERCCIOS
1. D exemplos de gerundismos no Texto 1. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. Sem entrar na ltima parte da msica, encontramos apenas um verbo no imperativo afirmativo. Que sentido se percebe nesse verbo e nos versos em que aparece. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 3. Todos os verbos no imperativo esto na: a) Primeira pessoa do singular; b) Primeira pessoa do plural; c) Segunda pessoa do singular; d) Terceira pessoa do singular; e) Terceira pessoa do plural. 4. Podemos considerar gerundismo a frase: voc est sendo filmado? Por qu? _________________________________________________ _________________________________________________ _________________________________________________ 5. (UEPG) Na orao: a passagem do cometa fizera a vida mais bonita. A forma verbal pode ser substituda, sem prejuzo do significado, por: a) Havia feito b) Fez c) Fazia d) Fizesse e) Faria 6. (UEL 2008) Analise o perodo: Antes de embrenhar-se na terceira reforma ortogrfica em menos de um sculo (j houve outras em 1943 e 1971), preciso ao menos ter certeza de que Portugal ir segui-la, (...). Assinale a alternativa que substitui corretamente a forma verbal sublinhada. a) Existiu. d) Haveriam. b) Houveram. e) Existiria. c) Existiram. 7. Assinale a alternativa com uso adequado do particpio: a) Voc tem salvo os arquivos? b) A encomenda foi entregue ontem. c) J havamos escrivido todo o texto. d) Tenho pagado minhas contas em dia. e) Os garotos no tm mais solto bales?

UNIDADE 5 CLASSES DE PALAVRAS: ADVRBIO, PREPOSIO, CONJUNO E INTERJEIO


ADVRBIO
Indicam circunstncias, podendo ser lugar, tempo, modo etc. Sempre acompanham um verbo, um adjetivo ou um outro advrbio. Nunca um substantivo. Como nunca acompanha um substantivo, no recebe deste as flexes, sendo, ento, sempre inflexveis.

CLASSIFICAO DOS ADVRBIOS

De dvida: Provavelmente, talvez. De lugar: perto, aqui, ali, l. De modo: apressadamente, calmamente, dissimuladamente. De tempo: Cedo, tarde, antes, nunca, agora. De intensidade: to, muito, bastante, pouco. De afirmao: sim, certamente, realmente. De negao: No, absolutamente.

LOCUO ADVERBIAL

uma expresso formada de preposio mais substantivo, ligada ao verbo com funo equivalente do advrbio. Trata-se de um sintagma nominal. Exemplo:

Olhou-nos

com desconfiana. (Locuo adverbial)

Numa sequncia de advrbios terminados em -mente, s o ltimo ganha o sufixo: Falou sbia e calmamente. H palavras que podem assumir tanto valor adverbial quanto valor adjetivo, dependendo do contexto em que ocorrem. Quando funcionam como advrbios, ficam invariveis; como adjetivos, concordam com a palavra a que se referem. Exemplos: Elas esto meio atrapalhadas. (meio = advrbio). Meias palavras no bastam. (meias = numeral fracionrio: comporta-se como adjetivo).

PREPOSIO
Completam o sentido de alguma palavra, indicando posse, conformidade, direo etc.

234

GRAMTICA
Ligando palavras, estabelecem relao entre elas. So invariveis.

CLASSES DE PALAVRAS: ADVRBIO, PREPOSIO, CONJUNO E INTERJEIO


s vezes no simples diferenciar as preposies das conjunes. Adiante, na anlise sinttica, as discrepncias sero mais visveis. Por hora, a melhor forma de diferenciar ainda decorando as preposies.

Eis as principais preposies: A, ante, at, aps, com, contra, de, desde, em, entre, para, perante, por (per), sem, sob, sobre, trs. A preposio classifica-se em: Essencial: sempre funciona como preposio. Exemplo: a, ante, de, por, com, em, etc. Acidental: provm de outras classes morfolgicas. Exemplos: consoante, segundo, mediante, etc.

INTERJEIO
So palavras que se aproximam aos sons emitidos quando exprimimos sentimentos ou emoes sbitas. Encontram-se sempre isoladas por sinais de pontuao (Excetua-se a intejeio , utilizada em poesias: mundo cruel!) So invariveis. As interjeies, alm de outras funes, podem ser de: F alegria: ah!, oh!, oba!, Viva!; F alvio: ufa!, arre!; F chamamento: !, Ol!, Ei!, E a!, Oi!; F dor: ai!, ui!; F advertncia: cuidado!, ateno!; F despedida: Thau!, At!, Falou!. Se a emoo expressa por um grupo de palavras, estas recebem o nome de LOCUO INTERJETIVA: Cruz credo! Puxa vida! Se Deus quiser! Minha Virgem Santssima Consoladora dos Desamparados! LTIMA OBSERVAO QUANTO S CLASSES DE PALAVRAS Como foi dito na introduo deste assunto, as dez classes de palavras abrangem quase todas as palavras do lxico. Alguns vocbulos fogem a qualquer classificao, aparecendo, porm, como advrbios em alguns autores. Eis alguns casos: Eu tambm quero/ At o Antonio foi festa/ S a rica me agrada/ Eu que te amo.

LOCUO PREPOSITIVA

Quando duas ou mais palavras funcionam com o valor de uma nica preposio, classificam-se como locuo prepositiva (por causa de, ao lado de, em virtude de, apesar de, etc). Exemplo: Apesar do atraso, a cerimnia foi elogiada por todos.

COMBINAES

As preposies podem combinar-se com outras classes gramaticais: do = de + artigo o no = em + artigo o daqui = de + advrbio aqui

CONJUNO
Estabelece relao de sentidos. Juntam duas oraes ou termos coordenados. So invariveis.

CLASSIFICAO DA CONJUNO

Conjuno Coordenativa: Aditiva: estabelece relao de soma (e, nem, mas tambm) Adversativa: relao de oposio, de adversidade (mas, porm, contudo etc) Alternativa: relao de alternncia (ou...ou, ora...ora etc) Conclusiva: relao de concluso (logo, portanto etc) Explicativa: relao de confirmao ou de justificao (pois, porque, que etc) Conjuno Subordinativa: Integrante: introduz orao subordinada substantiva (que, se) Causal: estabelece relao de causa (porque, visto que etc) Comparativa: relao de comparao (como, assim como, que etc) Condicional: relao de condio (se, caso etc) Conformativa: relao de conformidade, adequao (segundo, conforme etc) Consecutiva: relao de consequncia (que precedido de tal, tanto, to etc) Final: relao de finalidade (a fim de que, para que, que etc) Proporcional: relao de proporcionalidade ( medida que, proporo que, quanto mais etc) Temporal: relao de tempo (quando, enquanto, logo que etc)

trabalhando com textos


TEXTO 1
Aqui bandido: Plnio Marcos. Ateno, malandrage! Eu num v pedir nada, v te d um al! Te liga a: Aids uma praga que ri at os mais fortes, e ri devagarinho. Deixa o corpo sem defesa contra a doena. Quem peg essa praga est ralado de verde e amarelo, de primeiro ao quinto, e sem vaselina. Num tem dot que d jeito, nem reza brava, nem choro, nem vela, nem ai, Jesus. Pegou Aids, foi pro brejo! Agora sente o aroma da perptua: Aids pega pelo esperma e pelo sangue, entendeu? pelo esperma e pelo sangue! Eu num t te dando esse al pra te assombr, ento se toca! No porque tu ta na tranca que virou anjo. Muito pelo contrrio,

235

GRAMTICA

CLASSES DE PALAVRAS: ADVRBIO, PREPOSIO, CONJUNO E INTERJEIO


(04) No Texto 2, a argumentao construda por uma afirmao, que enaltece as pessoas que usam preservativo. (08) Na embalagem do preservativo est escrito Vista-se. Trata-se de uma figura de linguagem chamada metonmia, que neste caso est representando a parte pelo todo. (16) Ao ler a pergunta do anncio, pode-se inferir que o uso da camisinha previne contra a AIDS. 3. Assinale o trecho que no apresenta linguagem conotativa: a) Aids uma praga que ri at os mais fortes. b) Quem peg essa praga est ralado de verde e amarelo. c) Pegou Aids, foi pro brejo. d) cana dura deixa o cara ruim!. e) Quem gosta de tu tu mesmo. 4. No primeiro pargrafo, aparecem dois advrbios (um de lugar e um de tempo) que fogem sua funo original e adquirem outras. Apresente esses advrbios e indique a funo deles. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 5. Assinale a alternativa que classifica corretamente o advrbio devagarinho e as locues adverbiais pro brejo e s vezes, respectivamente: a) Lugar, lugar, tempo. d) Tempo, modo, tempo. b) Modo, lugar, intensidade. e) Tempo, lugar, dvida. c) Modo, lugar, tempo. 6. Explique a repetio da conjuno nem (1 pargrafo) e (3 pargrafo). _________________________________________________ _________________________________________________ _________________________________________________

cana dura deixa o cara ruim! Mas preciso que cada um se cuide, ningum pode val pra ningum nesse negcio de aids. Ento, j viu: trans, s de acordo com o parceiro, e de camisinha! Quanto a tu, mais chegado ao pico, eu to sabendo que ningum corta o vcio s por ordem da chefia. Mas escuta bem, vago mestre, num qu nem sab que, s vezes, a seringa vem at com um pingo de sangue, e tu mete ela direto em ti. s vezes, ela parece que vem limpona, e vem com a praga. E tu, na afobao, mete ela direto na veia. A tu dana. Tu, que se diz mais tu, mas que diz que num pode aguent a tranca sem pico, se cuida. Quem gosta de tu tu mesmo. E a farinha que tu cheira, e a erva que tu barrufa enfraquece o corpo e deixa tu chu da cabea e dos peitos. E a tu fica moleza pro Aids! Mas o pico o canal direto pra essa praga que est a. Ento, malandro, se cobre. Quem gosta de tu tu mesmo. A sade como a liberdade. A gente d valor pra ela quando j era!
(Extrado de um vdeo exibido na casa de Deteno de So Paulo)

TEXTO 2

EXERCCIOS
1. Comente a linguagem utilizada pelo enunciador do Texto 1. Qual foi o objetivo em usar essa linguagem? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. Some as alternativas corretas: (01) As duas ltimas frases do Texto 1 usam da comparao como argumentao. Ao fazer a comparao, o valor da liberdade se estende ao da sade. (02) O uso do pronome tu distancia dos presidirios o autor, o que enfraquece o objetivo do texto.

7. Some as alternativas corretas: (01) A palavra "al" originalmente interjeio, mas na frase aparece como um substantivo. Pode-se comprovar esse fato pela presena do artigo "um", pois s os substantivos podem vir acompanhados de artigo. (02) Em "Eu num v pedir nada, v te d um al!", poderamos acrescentar a conjuno "mas" logo aps a vrgula, sem alterar o sentido do texto. (04) Se o texto fosse uma reportagem sobre a Aids, as interjeies no apareceriam, pois elas so tpicas da linguagem oral e no so usadas em textos cientficos. (08) Em Deixa o corpo sem defesa contra a doena, h as preposies sem e contra. A primeira indica oposio, e a segunda, ausncia.

236

CLASSES DE PALAVRAS: ADVRBIO, PREPOSIO, CONJUNO E INTERJEIO


8. Alm de al, no primeiro pargrafo existe outra interjeio. Qual? _________________________________________________ _________________________________________________ 9. (Anglo 2004) Comprove que Dove realmente tudo o que dizem. Faa o teste Dove dos 5 dias. Suponha esta outra redao para o anncio: Comprove se Dove realmente tudo o que dizem. Confrontando os dois textos, correto afirmar: a) A troca do que pelo se no altera em nada o sentido do texto, b) A troca do que pelo se enfraquece o poder argumentativo da mensagem publicitria. c) Ao permutar o que pelo se, o sentido se altera levemente, mas no afeta o efeito argumentativo da mensagem. d) O que produz um efeito persuasivo mais forte, pois o se, no caso, introduz uma orao de contedo falso. e) Tanto o que quanto o se esto introduzindo oraes substantivas com o mesmo sentido. 10. Assinale a frase onde o que aparece como interjeio: a) Tenho que sair mais cedo hoje. b) O qu!? Ainda no est pronta? No acredito! c) Este o caminho que eu sugeri a ele. d) Venha logo que j estamos atrasados. e) Voc saiu. Por qu? 11. (UFG-MG) Em todas as alternativas h dois advrbios, exceto em: a) Ele permaneceu muito calado. b) Amanh, no iremos ao cinema. c) O menino, ontem, cantou desafinadamente. d) Tranquilamente, realizou-se, hoje, o jogo e) Ela falou calma e sabiamente. 12. (UFC-CE) A opo em que h um advrbio exprimindo circunstncia de tempo : a) Possivelmente viajarei para So Paulo. b) Maria tinha aproximadamente quinze anos. c) As tarefas foram executadas concomitantemente. d) Os resultados chegaram demasiadamente atrasados. 13. (Unicamp) De todas as garotas da classe, Paula foi a que mais me impressionou. Gostaria de ter ido a sua festa com ela. Eu a convidei, mas ela no aceitou. As palavras destacadas so respectivamente: a) Pronome oblquo artigo preposio. b) Pronome demonstrativo preposio pronome oblquo. c) Pronome oblquo preposio pronome oblquo. d) Pronome demonstrativo preposio artigo. e) Preposio artigo pronome demonstrativo. 14. (Fuvest-SP) Ao ligar dois termos de uma orao, a preposio pode expressar, entre outros aspectos, uma relao temporal, espacial ou nocional. Nos versos: Amor total e falho... Puro e impuro... Amor de velho adolescente... A preposio de estabelece uma relao nocional. Essa mesma relao ocorre em: a) Este fundo de hotel um fim de mundo. b) A quem sonha de dia e sonha de noite, sabendo todo sonho vo. c) Depois fui pirata mouro, flagelo da Tripolitnia. d) Chegarei de madrugada, quando cantar a seriema. e) S os roados da morte compensam aqui cultivar. 15. (Cesgranrio-RJ) Assinale a opo que a preposio com traduz uma relao de instrumento: a)Teria sorte nos outros lugares, com gente estranha b) Com o meu av cada vez mais peto do fim, o Santa Rosa seria um inferno. c)No fumava, e nenhum livro com fora de me prender. d)Trancava-me no quarto fugindo do apareio, matando-as com jornais. e)Andavam por cima do papel estendido com outras ja pregadas no breu. 16. (FGV-SP) Foi um tcnico de sucesso, mas nunca conseguiu uma reputao no campo altura de sua reputao de vestirio. Comeando a frase por Nunca conseguiu uma reputao no campo altura de sua reputao de vestirio. Para manter a mesma relao lgica expressa na frase Inicialmente deve-se continuar com: a) Enquanto foi... b) Na medida em que era. c) Ainda que tenha sido. d) Desde que fosse. e) Porquanto era. 17. (Mack-SP) No perodo Minha me hesitou um pouco, mas acabou cedendo, depois que o padre Cabral, tendo consultado o bispo, voltou a dizer-lhe que sim, que poderia ser. A expresso depois que, morfologicamente, a) Locuo verbal d) Advrbio de modo b) Advrbio de tempo e) Explicativo c) Locuo conjuntiva 18. (PUC-SP) ...ouviram-se amplos bocejos, fortes como o marulhar das ondas..., a partcula como expressa uma ideia de: a) Causa d) Proporo b) Explicao e) Comparao c) Concluso 19. (Unimep-SP) Havendo tempo, irei sua casa. Comece com: Irei sua casa, ... a) Se houvesse b) Embora haja c) Exceto se houver d) Desde que houvesse e) Caso haja

237

GABARITOS

GABARITOS
UNIDADE 1
1. Pleonasmo - uma redundncia (proposital ou no) numa expresso, enfatizando-a. 2. Que podemos construir textos mesmo sem os verbos, pronomes, conjunes, adjetivos e etc. 3. A diferena est na evoluo temporal. Escova os dentes, toma caf, almoa, janta, na cama com o amante sente pavor da solido. 4. c 5. d 6. c 7. e 8. d

UNIDADE 4
1. Estar continuando a conversa; estar me passando; estar desligando; estar falando com a ....: estar ajudando. 2. O verbo "sorria". Totalmente irnico, pois a nica coisa que no se probe fazer sorrir, sendo que, pela construo da msica, no notamos sentido algum em achar graaa de alguma coisa. Alm disso, na plaquetas das lojas, a ltima coisa que se espera dos clientes que eles riam para a cmera. O 'sorria', na verdade um "te cuida seu trouxa'. 3. d 4. No, pois um verbo que est indicando o desenrolar de um processo. o uso normal do gerndio. 5. a 6. c 7. b

UNIDADE 2
1. Tornar algo ou algum sem originalidade, vulgar, trivial, sem importncia. 2. polissndeto: consiste na repetio de conectivos ligando termos da orao ou elementos do perodo. 3. a 4. Porque indica que o substantivo j conhecido do leitor ou do ouvinte. E a sua ausncia generaliza o substantivo. 5. Indiferena 6. 1. Adjetivo; 2. Substantivo pela colocao do artigo. 7. Dados concretos que revelam a frieza dos fatos. 8. d 9. d

UNIDADE 5
1. A linguagem carregada de grias e marcas de oral-idade. Tem o objetivo de se aproximar dos detentos. 2. 21 3. e 4. Aqui, lugar - indicador de quem fala; agora, tempo chama ateno 5. c 6. Adio - refora a ideia, insistncia/frustrao 7. 7 8. "Ai Jesus" 9. b 13. b 17. c 10. b 14. e 18. e 11. a 15. c 19. e 12. c 16. c

UNIDADE 3
1. d 3. 19 2. c 4. b

5. Gosto de meninos e meninas - verbo achar - mostra religiosidade ao falar dos santos 6. e 9. a 7. c 10. d 8. d 11. d

238

HISTRIA DO BRASIL
241 O pioneirismo portugus ......................... 241 As consequncias da expanso martima na europa ..................................... 241 Os tratados Ibricos .................................. 242 A Bula Inter Coetera (1493) ..................... 242 O tratado de Tordesilhas (1494) ............ 242 Exerccios ..................................................... 242

01

A EXPANSO COMERCIAL E MARTIMA DE PORTUGAL

pg

251 Unio Ibrica ............................................... 251 As invases estrangeiras ......................... 251 Exerccios ..................................................... 252

04

UNIO IBRICA E INVASES ESTRANGEIRAS

pg

244 O perodo pr-colonial (1500-1530) .............. 244 Perodo colonial (1530 1822) ............... 245 Exerccios ..................................................... 246

02

A CHEGADA DOS PORTUGUESES

pg

253 Entradas ...................................................... 253 Bandeiras ..................................................... 254 A minerao ................................................ 254 Exerccios ..................................................... 254

05

EXPANSO TERRITORIAL

pg

03

A ECONOMIA AUCAREIRA

pg

247

06

TRATADOS TERRITORIAIS

pg

256

Outras atividades econmicas No brasil colonial .......................................... 248 Exerccios ..................................................... 249

A crise do sistema colonial movimentos nativistas ................................. 256 Exerccios ..................................................... 257

A EXPANSO COMERCIAL E MARTIMA DE PORTUGAL NO SCULO XV

UNIDADE 1 A EXPANSO COMERCIAL E MARTIMA DE PORTUGAL NO SCULO XV


No principio do sculo XV, a Europa passa por uma fase de profundas modificaes polticas, econmicas e sociais. A retomada da atividade comercial, faz com que a oferta de moeda, metais preciosos, se torne cada vez mais limitada na Europa, conseqncia do intenso comrcio realizado com o Oriente, em troca de especiarias e outros artigos de luxo, isso soma-se o esgotamento das minas de ouro e prata do continente Europeu, prejudicando ainda mais o comrcio. As naes europias esbarravam ainda em outro empecilho, o monoplio comercial sobre as rotas do mar Mediterrneo, exercido pelas cidades italianas, principalmente Gnova e Veneza, o que encarecia o preo das especiarias, tornando restritas as possibilidades de lucro das outras cidades europias. Essas dificuldades foraram a burguesia europia a buscar rotas alternativas para expandir o comrcio. O Atlntico foi sada encontrada, dando inicio ao processo de expanso martima europia. Para que essa empreitada fosse possvel eram necessrios muitos investimentos, muito alm do que qualquer cidade isolada da Europa pudesse realizar. por isso que a expanso martima apenas se tornou possvel em onde havia uma populao unificada por uma centralizao monrquica, sendo Portugal a primeira nao europia a se aventurar pelo Atlntico.

Interesse em descobrir nova rota para o Oriente, a fim de participar do lucrativo comrcio de especiarias; Apoio da Igreja Catlica atravs de bnos especiais. Em 1415 Portugal conquista Ceuta, rico porto comercial no atual Marrocos na frica. A seguir vai contornando o litoral africano, e criando feitorias (entrepostos comerciais, ou ainda pequenas colnias, que podem estar ligadas defesa da regio, ao reabastecimento de navios, ou ao comrcio de escravos). Entre 1415 e 1460 os navegadores portugueses descobriram Aores, Madeira, cabo Verde, So Tom e Guin. Em 1488, Bartolomeu Dias cruzou o cabo das Tormentas, mais tarde sendo rebatizado pelo rei de Portugal como cabo da Boa Esperana, localizado no extremo sul da frica. Em 1498, dez anos depois, Vasco da Gama ultrapassou o cabo da Boa Esperana, alcanando finalmente a cidade de Calicute, nas ndias. Dois anos depois, partiu de Portugal rumo ao Oriente, uma grande frota para comercializar com o Oriente, comandada por Pedro lvares Cabral, que chegou no litoral do novo continente, a Amrica.

AS CONSEQUNCIAS DA EXPANSO MARTIMA NA EUROPA


As grandes navegaes representam um dos mais significativos acontecimentos da Idade Moderna. Seus resultados foram decisivos para a Histria da maioria dos povos do planeta. Seguem as suas principais consequncias: Mudana do eixo econmico europeu do mar Mediterrneo para os oceanos Atlntico e ndico: com isso as cidades italianas declinaram e duas novas potncias ascenderam, Portugal e Espanha; Europeizao do mundo; Domnio e colonizao de terras alcanadas: isso ocasionou explorao e escravizao de povos no europeus; Revoluo Comercial: houve acentuado crescimento quantitativo e qualitativo do comrcio, interligando o mundo; Afirmao econmica da burguesia e fortalecimento do poder dos reis europeus; "Revoluo dos Preos" na Europa: a entrada macia de metais na Europa sem o correspondente crescimento da produo provocou a alta generalizada dos preos; Acmulo de capitais, possibilitando mais tarde a Revoluo Industrial. Em 1492, antes de Vasco da Gama alcanar o Oriente, a Espanha iniciou sua expanso martima. Os reis espanhis, Fernando II e Isabel I, financiaram o projeto do navegador genovs Cristvo Colombo, que pretendia chegar s ndias navegando para o Ocidente, acreditando nas teorias renascentistas da esfericidade da Terra. Colombo chega Amrica em outubro de 1492, pensando ter chegado s ndias. Isso desencadeou uma grande disputa entre Portugal e Espanha pela posse das novas terras.

O PIONEIRISMO PORTUGUS
Eram muitos os problemas enfrentados pelos pioneiros. Alm do pouco conhecimento at ento adquirido sobre a arte de navegar, havia outras dificuldades, como o fato de que os europeus acreditavam ser a terra quadrada e a crena de que o sul do oceano Atlntico era habitado por animais fantsticos, por sereias, que atraam os homens para a morte com seus cantos e por demnios. Apesar de todas as dificuldades, Portugal reunia as condies necessrias grande empreitada, como: Posio geogrfica estratgica (pennsula Ibrica - sudeste europeu); Tradio naval: os portugueses tinham grande experincia de navegao (economia pesqueira) e acmulo de conhecimentos nuticos e de tcnicas de navegao; Precoce centralizao poltica: o primeiro Estado Nacional a se formar na Europa foi Portugal (sculo XII), com a Revoluo de Avis; Aliana entre o rei e a burguesia: o desejo de expanso da burguesia mercantil coincidia com o sonho de engrandecimento do Estado Nacional Portugus;

241

HISTRIA DO BRASIL

A EXPANSO COMERCIAL E MARTIMA DE PORTUGAL NO SCULO XV


_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 2. (UFPE) Sobre a Expanso Martima, analise as afirmativas: I. Para a realizao da grande aventura martima, foram fundamentais as descobertas tcnicas da poca, no tendo influncia a experincia do navegador. II. A busca de riqueza foi importante para o envolvimento das pessoas com a navegao e para a valorizao de novos produtos comerciais. III. O descobrimento do Brasil foi resultado de uma estratgia do grande navegador Vasco da Gama com a ajuda de Pedro Alvarez Cabral. IV. A Expanso Martima trouxe grandes renovaes para a cultura da poca e teve, portanto, claras ligaes com as mudanas histricas que levaram construo dos tempos modernos. V. A importncia das viagens de Colombo se restringe aos parmetros de uma aventura herica de um grande e idealista navegador. Esto CORRETAS apenas: a) I, II e V. c) I, III e V. b) III e IV. d) II e IV. e) I, II, IV e V.

OS TRATADOS IBRICOS
Portugueses e espanhis detinham agora o monoplio das expedies sobre o Atlntico, sendo seguidos a partir do inicio do sculo XVI, por Frana e Inglaterra. Mas a partilha do mundo j havia sido realizada pelas duas naes pioneiras. Ambos os documentos dividiam as terras descobertas e a descobrir. Os outros Estado Europeus ignoraram as divises, invadindo durante quase todo o perodo da Idade Moderna os territrios recm-conquistados por Portugal e Espanha.

A BULA INTER COETERA (1493)


Esse documento, editado pelo Papa Alexandre VI criava uma linha demarcatria a cem lguas a oeste de cabo Verde. As terras localizadas a leste da linha, isto , direita, pertenceriam a Portugal. As terras localizadas a oeste da linha, isto , esquerda, pertenceriam Espanha. O acordo no foi aceito por Portugal, pois a linha demarcatria passaria no Atlntico e Portugal ficaria sem terras na Amrica. E, desse modo, o problema no foi resolvido.

O TRATADO DE TORDESILHAS (1494)


O novo documento, denominado Tratado de Tordesilhas, estabelecia que o meridiano passaria a 370 lguas a oeste de cabo Verde, com as terras a leste pertencendo a Portugal e as terras a oeste pertencendo Espanha. As duas partes chegaram, ento, a um acordo diplomtico. Segundo o Tratado de Tordesilhas, uma grande extenso de terras brasileiras j pertencia a Portugal, seis anos antes do descobrimento do Brasil.

EXERCCIOS
1. (UERJ) As grandes navegaes dos sculos XV e XVI possibilitaram a explorao do Oceano Atlntico, conhecido, poca, como Mar Tenebroso. Como resultado, um novo movimento penetrava nesse mundo de universos separados, dando incio a um processo que foi considerado por alguns historiadores uma primeira globalizao e no qual coube aos portugueses e espanhis um papel de vanguarda. a) Apresente o motivo que levou historiadores a considerarem as grandes navegaes uma primeira globalizao. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Aponte dois fatores que contriburam para o pioneirismo de Portugal e Espanha nas grandes navegaes.

3. (UFSC) Sobre o contato entre os europeus e os indgenas no Brasil, no sculo XVI, correto afirmar que: I. No perodo inicial do contato entre europeus e indgenas a idias que se tinha do Brasil correspondia ao Paraso Perdido, o que se verificava pelas relaes pacficas em que viviam as naes indgenas no Brasil. II. Uma nica nao habitava o territrio brasileiro no momento do contato: os tupis-guaranis. III. o conhecimento da arte de curar era um dos saberes dos indgenas mais cobiados pelos europeus, que procuraram aprender com eles como utilizar as plantas nativas em beneficio prprio. IV. As sociedades indgenas brasileiras no possuam riquezas em metais preciosos, ao contrrio dos povos do Mxico e dos Andes, cujas riquezas foram espoliadas pelos espanhis. V. Os indgenas brasileiros se organizavam em cidades complexas, com grande concentrao populacional e construes monumentais.

242

HISTRIA DO BRASIL

A EXPANSO COMERCIAL E MARTIMA DE PORTUGAL NO SCULO XV


_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 6. (UFSM) O ano de 1998 marca os quinhentos anos do Descobrimento do Brasil, pois, Em 1498, D. Manuel ordenava que Duarte Pacheco Pereira navegasse pelo Mar Oceano, a partir das Ilhas de Cabo Verde at o limite de 370 lguas [ estipuladas pelo Tratado de Tordesilhas]. esta a primeira viagem, efetivamente conhecida pelos portugueses, s costas do litoral norte do Brasil.
(Franzen, Beatriz. A presena portuguesa no Brasil antes de 1500. In: Estudos Leopoldenses. So Leopoldo: Unisinos, 1997. P. 95.).

Esto CORRETAS as alternativas: a) I e IV. d) Todas esto corretas. b) I, III e V. e) Apenas a III esta correta. c) III e IV. 4. (MACK) No sculo XV, as Coroas Ibricas iniciaram o processo de expanso martima da Europa. Assinale a alternativa que apresenta um motivo que impulsionou essa expanso. a) A procura do caminho martimo para se alcanar o Oriente e, assim, ter acesso s valiosas especiarias. b) A rpida decadncia do ciclo de explorao das riquezas provenientes do continente americano. c) A busca de ouro e outros metais preciosos para financiar as expedies militares de reconquista da Pennsula Ibrica. d) Os acordos com as cidades italianas, que permitiram um melhor aproveitamento dos recursos financeiros e trocas de informaes geogrficas. e) A preocupao em encontrar uma nova rota martima para a China, aps a tomada de Constantinopla pelos exrcitos mongis de Gengis-Khan. 5. (Unicamp) O termo feitor foi utilizado em Portugal e no Brasil colonial para designar diversas ocupaes. Na poca da expanso martima portuguesa, as feitorias espalhadas pela costa africana e, depois, pelas ndias e pelo Brasil tinham feitores na direo dos entrepostos com funo mercantil, militar e diplomtica. No Brasil, porm, o sistema de feitorias teve menor significado do que nas outras conquistas, ficando o termo feitor muito associado administrao de empresas agrcolas.
(Adaptado de Ronaldo Vainfas (org.), Dicionrio do Brasil Colonial. Rio de Janeiro: Ed. Objetiva, 2000, p.222).

Esse fato faz parte: a) Da expanso martimo-comercial europia, que deslocou o eixo econmico do Mediterrneo para o Atlntico. b) Da expanso capitalista portuguesa, em sua fase mercantilcolonial, plenamente consolidada no Brasil. c) Do avano martimo portugus, tendo Duarte Pacheco Pereira papel relevante na espionagem e pirataria no Atlntico. d) Do processo de instalao de feitorias no Brasil, pois Duarte Pacheco Pereira instalou a primeira feitoria, ou seja, So Luiz do Maranho. e) Das expedies de explorao do litoral brasileiro, cujo papel de reconhecimento econmico e geogrfico coube a Duarte Pacheco Pereira. 7. (UFMG) Sabe-se que Cristvo Colombo no descobre a Amrica, pois imagina estar chegando sia, ilha de Cipango [ o Japo ], perto da costa da China e da corte do Gro-C. O que procurava? As Ilhas Douradas, Tarsis e Ofir, de onde saram as fabulosas riquezas que o rei Salomo explorara [...]. Alis, o Almirante era um homem obstinado. Convencido de ter chegado ao Continente Asitico quando desembarcou em Cuba, ele obrigou seus partidrios a partilharem de sua idia fixa.
(GRUZINSKI, Serge. A passagem do sculo. 1480-1520: as origens da globalizao. So Paulo: Companhia das Letras, 1999. p.21.)

a) Indique caractersticas do sistema de feitorias empreendido por Portugal. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Qual a produo agrcola predominante no Brasil entre os sculos XVI e XVII? Quais as funes desempenhadas pelo feitor nessas empresas agrcolas?

Considerando-se as informaes desse texto, correto AFIRMAR que: a) A obstinao de Colombo o levou a atingir as remotas regies do Japo e da China, onde estariam as riquezas que dizia-se haviam sido exploradas pelo rei Salomo e pelo Grande C.

243

HISTRIA DO BRASIL
b) A busca das maravilhas relatadas em livros de viagens, desde os tempos medievais, se constitui em um dos fatores que incentivaram as grandes navegaes no incio dos tempos modernos. c) O desembarque de Coombo em Cuba, na sua segunda viagem, acabou por convenc-lo e a sua frota de que eles haviam chegado a uma terra ainda por descobrir possivelmente as famosas Ilhas Douradas. d) A descoberta da Amrica foi feita por Amrico Vespcio, uma vez que Colombo, de acordo com os novos estudos, atingiu, na sua primeira viagem, o Continente Asitico, onde foram fundadas feitorias. 8. (PUC-Camp) Erro de portugs Quando o portugus chegou Debaixo duma bruta chuva Vestiu o ndio Que pena! Fosse uma manh de sol O ndio tinha despido O portugus

A CHEGADA DOS PORTUGUESES


se por ele. Era, porm, necessrio ocupar a terra e defend-la contra invases estrangeiras, por isso o governo portugus enviou expedies a sua Colnia na Amrica.

AS EXPEDIES

Sentindo a necessidade de defender as terras americanas de possveis invases das demais naes europias, o governo portugus enviou vrias expedies ao Brasil, mas que at 1530 no tinham a finalidade de colonizar o territrio. Expedies Exploradoras: as que tinham o objetivo de explorar o litoral. A primeira foi em 1501, comandada por Gaspar de Lemos. Percorreu o litoral do Rio Grande do Norte regio do Prata, dando nome a vrios acidentes geogrficos, como: a baa de Todos os Santos, o rio So Francisco, o Rio de Janeiro, e Angra dos Reis. Durante essa expedio, os portugueses tomaram conhecimento da grande extenso do litoral brasileiro e da enorme quantidade que havia de pau-brasil. Em 1503 chegou outra expedio, comandada por Gonalo Coelho, que fundou a feitoria de Cabo Frio e procurou ouro. Expedies Guarda-Costas: as que tinham o objetivo de patrulhar o litoral, expulsando os contrabandistas. Em 1516 e em 1526 chegaram duas expedies guarda-costas, ambas comandadas por Cristvo Jacques. Apesar de ter destrudo navios e feitorias dos corsrios, Cristvo Jacques no conseguiu expulsar os franceses, devido extenso do litoral. A explorao do pau-brasil Apesar de no proporcionar os mesmos lucros que as especiarias, e nem gerar a ocupao territorial, a extrao do PauBrasil, encontrado em enorme quantidade nas florestas litorneas, tornou-se a nica atividade econmica sistemtica exercida no Brasil durante o perodo pr-colonial. O trabalho era, em sua maioria, realizado pelos indgenas, que se encarregavam de cortar e transportar a madeira para as feitorias, ou para os navios. A mo-de-obra indgena era recompensada com quinquilharias, sistema denominado de escambo: troca de mercadorias (trabalho por quinquilharias), sem a interveno do fator monetrio (dinheiro).

( Oswald de Andrade. Poesias reunidas. 2. Ed. Rio de Janeiro: Civilizao Brasileira, 1972)

Os versos descrevem um momento histrico ligado : a) Expanso Martima Europia. b) Revoluo Industrial Inglesa. c) Crise do Antigo Regime. d) Guerra dos Cem Anos. e) Partilha Afro-Asitica.

UNIDADE 2 A CHEGADA DOS PORTUGUESES


A colonizao efetiva da Amrica pelos portugueses no ocorreu imediatamente aps a chegada da esquadra de Pedro lvares Cabral, em 1500. Pois, no fora encontrado os to desejados metais preciosos,e nem produtos similares s lucrativas especiarias do Oriente. Assim Portugal mantinha o territrio americano em segundo plano, preocupando-se apenas em garantir a sua posse, mantendo seu foco no comrcio com o Oriente.

A NECESSIDADE DE COLONIZAR O BRASIL

O PERODO PR-COLONIAL (1500-1530)


Nos primeiros trinta anos aps o descobrimento, Portugal no demonstrou interesse pelo Brasil, limitando-se a explorar o paubrasil, madeira da qual era extrada uma tinta vermelha, empregada no tingimento de tecidos. A madeira que chegava do Brasil j era bastante conhecida pelos europeus, sendo usada nas tinturarias, porm no era grande o lucro que advinha do comrcio com o paubrasil. Esse o motivo por que poucos portugueses interessaram-

Como vemos, somente trinta anos aps o descobrimento, teve incio a colonizao do Brasil. Portugal atravessava um perodo de grave crise econmica. O comrcio de especiarias estava em declnio e as terras brasileiras sofriam frequentes ataques de estrangeiros. No era mais possvel adiar a colonizao. Colonizar, porm, significava empregar muito capital, uma vez que se fazia necessrio no s povoar a terra, mas desenvolver meios para defend-la e, ainda, organiz-la. E com a inteno de colonizar, somente ento, que Portugal envia expedies colonizadoras, e busca solues econmicas e administrativas para que a colnia desse certo. A primeira expedio colonizadora, comandada por Martim Afonso de Souza, chegou em 1530 e trazia cerca de quatrocentas pessoas, entre elas trabalhadores, padres e soldados. Martim Afonso de Souza veio de Portugal com a misso de expulsar os estrangeiros que contrabandeavam pau-brasil, de procurar ouro e de iniciar a colonizao. Tem incio o povoamento portugus em terras brasileiras. Em 1532 foi fundada a vila de So

244

HISTRIA DO BRASIL
Vicente, primeiro ncleo de povoamento do Brasil. L se fixaram quatrocentos colonos, que se dedicavam ao plantio da cana. E l surgiu o primeiro engenho produtor de acar.

A CHEGADA DOS PORTUGUESES

OS PRIMEIROS GOVERNADORES GERAIS

PERODO COLONIAL (1530 1822)


O SISTEMA DE CAPITANIAS HEREDITRIAS
O sistema de Capitanias Hereditrias criado em 1534 por D. Joo III, que dividia o territrio colonial em 15 capitanias no exigia grande investimento do governo portugus, pois transferia as despesas da colonizao para os donatrios, atravs de doaes. Os donatrios deveriam fundar vilas, cobrar impostos, doar sesmarias, desenvolver o plantio da cana-de-acar e proteger o territrio. O sistema de capitanias era um sistema poltico descentralizado, visto que o poder achava-se distribudo entre os doze donatrios. As capitanias eram denominadas hereditrias porque passavam de pai para filho, isto , com a morte do pai, o filho mais velho herdava o direito sobre a terra. Devemos nos lembrar, contudo, de que os donatrios no eram donos das terras. Eles tinham o direito de administr-las e explor-las, mas elas na verdade pertenciam ao governo portugus. O sistema de capitanias hereditrias era regulamentado pela Carta de Doao e pelo Foral. A Carta de Doao era o documento atravs do qual o rei de Portugal concedia uma capitania a um donatrio. O Foral era o documento que determinava os direitos e deveres do donatrio e os direitos do rei. Ao rei de Portugal cabia o monoplio sobre o comrcio da capitania, a cunhagem das moedas que circulavam na colnia, a cobrana o quinto (20%) sobre os metais encontrados e a dzima (1/10) sobre os produtos explorados. O sistema de capitanias hereditrias fracassou, uma vez que apenas duas delas prosperaram: a de So Vicente, e a de Pernambuco. Muitas foram as causas do fracasso do sistema de capitanias, sendo as mais importantes: a falta de capital de alguns donatrios; a imensa distncia entre a colnia e a metrpole, o que dificultava o transporte de equipamentos; a extenso das capitanias, tornando difcil sua explorao e a defesa do litoral; e os constantes ataques dos ndios, que resistiam invaso de suas terras pelo portugus.

Tom de Souza (1549-1553) foi o primeiro governador geral, responsvel por grande incentivo agricultura e pela introduo, na colnia, de escravos negros e de gado bovino. Com ele chegaram centenas de colonos e seis jesutas, padres liderados por Manoel da Nbrega, que vinham com a misso de catequizar os ndios, ou seja, ensinar-lhes a religio catlica. O primeiro governador geral vistoriou pessoalmente as capitanias mais distantes do sul, desenvolveu a pecuria e mandou que viessem de Portugal moas rfs. A administrao de Tom de Souza teve incio na Bahia de Todos os Santos, sede do Governo Geral, onde ele fundou a primeira cidade brasileira, Salvador, o primeiro colgio e o primeiro bispado. Duarte da Costa (1553-1558), segundo governador geral, trouxe com ele mais colonos e mais jesutas, entre eles Jos de Anchieta, que representaria papel importante na catequese e na pacificao dos ndios. O governo de Duarte da Costa foi marcado por conflitos relacionados aos indgenas. Os jesutas pretendiam catequiz-los e os colonos queriam que eles trabalhassem nas lavouras. Para agravar a situao da colnia, houve a invaso francesa, em 1555, no Rio de Janeiro, onde os franceses, aliados aos tamoios, na chamada Confederao dos Tamoios, fundaram uma colnia, que denominaram Frana Antrtica. Jos de Anchieta e Manoel da Nbrega criaram, em 25 de janeiro de 1554, o Colgio de So Paulo, que daria origem cidade de So Paulo. Mem de S (1558-1572), o terceiro governador, foi considerado grande administrador. Durante seu governo ele incentivou a agricultura e a pecuria, apoiou os jesutas na catequese e no combate escravido indgena e reuniu os ndios em misses. Durante o governo de Mem de S, Jos de Anchieta e Manoel da Nbrega controlaram os ndios unidos na Confederao dos Tamoios. Em 1565, Estcio de S, sobrinho do governador geral, fundou a cidade de So Sebastio do Rio de Janeiro. Em 1567, o governador, auxiliado por Estcio de S, expulsou do Rio de Janeiro os franceses. Mem de S morreu em 1572.

DOIS GOVERNOS: UM NO NORTE E OUTRO NO SUL

O SISTEMA DE GOVERNO GERAL (1548-1808)

O governo portugus criou, atravs do Regimento de 1548, o sistema de Governo-geral, reafirmando a autoridade e a soberania da Coroa, fortalecendo os instrumentos colonizadores, e que durou at 1808. Esse sistema no acabou com as capitanias. Ele foi criado com o objetivo de centralizar o poder poltico, auxiliar as capitanias no que fosse necessrio, intensificar o povoamento, defender melhor o litoral contra ataques estrangeiros, enfim, desenvolver a colnia. As principais funes do governador geral eram: procurar ouro no interior, estimular a catequese, combater as tribos rebeldes e determinar com quanto cada colono deveriam contribuir para a defesa da terra. Pelo fato de o governador geral ser o representante do rei na colnia, ele era a autoridade mxima aqui, e contava com trs auxiliares diretos: o provedormor (encarregado das finanas); o ouvidor-mor (encarregado da justia); e o capito-mor da costa (encarregado da defesa do litoral).

Com a morte de Mem de S, o rei nomeou D. Lus de Vasconcelos para ser o quarto governador geral da colnia. Ele foi, porm, atacado por piratas franceses e morreu antes de chegar ao Brasil. Com o objetivo de administrar melhor o vasto territrio brasileiro, Portugal decidiu, ento, dividir a colnia em dois governos distintos: o governo do norte, com capital em Salvador, foi dado a D. Lus de Brito, e o governo do sul, com capital no Rio de Janeiro, foi dado a D. Antnio de Salema. A tentativa no teve xito e, em 1578, Loureno da Veiga unificou os dois governos, tornando-se o quinto governador geral.

AS CMARAS MUNICIPAIS

As Cmaras Municipais eram compostas por Vereadores, escolhidos pelos "homens bons". Chamavam-se homens-bons aqueles que tinham projeo social e no exerciam profisso manual, ou seja, os grandes proprietrios de terras. Sendo assim, as Cmaras Municipais sempre defendiam seus interesses, excluindo a maioria da populao da administrao colonial. Como se v, a classe que dominava econmica, social e politicamente no Brasil colonial era a dos grandes proprietrios de terras, chamada a aristocracia rural.

245

HISTRIA DO BRASIL
As Cmaras Municipais eram presididas por um juiz ordinrio, tambm escolhido pelos "homens bons", e acumulavam vrios poderes: abastecimento de mo-de-obra escrava de acordo com as necessidades da regio, cobrana de impostos, catequese, guerras contra os ndios, etc. Embora o sistema de Governo Geral tenha sido criado para centralizar o poder poltico, dando aos governadores gerais amplos poderes, eles no conseguiam, porm, impor totalmente sua autoridade aos senhores de engenho. Os senhores de engenho possuam escravos e terras, concedidas pelo governo portugus. Adquiriram poder em suas fazendas e no aceitavam a autoridade do governador geral. Devido extenso do territrio brasileiro, predominava, na colnia, a fora local das Cmaras Municipais, encarregadas da administrao dos municpios e instaladas nas principais vilas e cidades. Ou seja, as autoridades municipais no se submetiam facilmente ao governador geral, demonstrando forte tendncia autonomista. Mas, a partir da Restaurao Portuguesa (1640), foram perdendo parte de suas atribuies e autonomia. J no sculo XVIII seu papel era quase simblico.

A CHEGADA DOS PORTUGUESES


d) O sistema era regulamentado por dois documentos: a Carta de Doao e o Foral, sendo que na Carta de Doao vinham detalhados os direitos e deveres dos donatrios, alm dos impostos e tributos a serem pagos. e) A administrao poltica da colnia tornou-se centralizada, assim como a da Metrpole. 3. (Unifesp) Convm ter muita advertncia nas prises que fizer nas pessoas que ho de sair ao auto pblico, que se faa tudo com muita justificao pelo muito que importa reputao e crdito do Santo Oficio e a honra e fazenda das ditas pessoas, as quais depois de presas e sentenciadas no se lhes pode restituir o dano que se lhe der.
(Do Inquisitor-Geral ao primeiro Visitador na colnia, em 1591.) Essa afirmao indica que, na Colnia, a Inquisio:

EXERCCIOS
1. (Fuvest) Os portugueses chegaram ao territrio, depois denominado Brasil, em 1500, mas a administrao da terra s foi organizada em 1549. Isso ocorreu porque, at ento: a) Os ndios ferozes trucidavam os portugueses que se aventurassem a desembarcar no litoral, impedindo assim a criao de ncleos de povoamento. b) A Espanha, com base no Tratado de Tordesilhas, impedia a presena portuguesa nas Amricas, policiando a costa com expedies blicas. c) As foras e atenes dos portugueses convergiam para o Oriente, onde vitrias militares garantiam relaes comerciais lucrativas. d) Os franceses, aliados dos espanhis, controlavam as tribos indgenas ao longo do litoral bem como as feitorias da costa sul-atlntica. e) A populao de Portugal era pouco numerosa, impossibilitando o recrutamento de funcionrios administrativos. 2. (Fatec) No tendo capital necessrio para realizar a colonizao do Brasil, pois atravessava um srie crise econmica, Portugal decidiu adotar o sistema de capitanias hereditrias. CORRETO afirmar que: a) As capitanias foram entregues a capites donatrios, com o compromisso de promoverem seu povoamento e explorao; contudo, poucos eram os direitos e os privilgios que recebiam em troca. b) O sistema foi adotado devido presena de estrangeiros no litoral, pssima situao econmica-financeira de Portugal e a seu sucessos nas ilhas do Atlntico. c) As capitanias eram pessoais, transferveis, inalienveis e no podiam ser passadas para seus herdeiros.

a) Testou mtodos de tortura que depois passou a utilizar na Metrpole. b) Cuidou de no se entregar aos excessos repressivos a que se habituara na Metrpole. c) Relaxou seu controle, conformando-se ao no existe pecado abaixo do equador. d) Utilizou procedimentos que pouco diferiam dos empregados na Metrpole. e) Trabalhou em conjunto com a sua congnere espanhola, visando maior eficcia.

4. (UNESP) Leia os textos seguintes: Texto 1: Etnocentrismo: tendncia para considerar a cultura de seu prprio povo como a medida para todas as outras.
(Novo Dicionrio Aurlio.)

Texto 2: [Os ndios] no tem f, nem lei, nem rei (...) so mui desumanos e cruis, (...) so mui desonestos e dados sensualidade (...). Todos comem carne humana e tm-na pela melhor iguaria de quantas pode haver (...) Vivem mui descansados, no tm cuidados de cousa alguma se no de comer e beber e matar gente.
(Pero Magalhes Gandavo. Tratado da Terra do Brasil, suclo XVI)

a) O texto 2 pode ser considerado etnocntrico? Justifique a sua resposta. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Comente algumas das conseqncias, para as populaes indgenas, da chegada dos portugueses Amrica.

246

HISTRIA DO BRASIL
_________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 5. (UNAERP) Em1534, o governo portugus concluiu que a nica forma de ocupao do Brasil seria atravs da colonizao. Era necessrio colonizar, simultaneamente, todo o extenso territrio brasileiro. Essa colonizao dirigida pelo governo portugus se deu atravs da: a) Criao da Companhia Geral do Comrcio do Estado do Brasil. b) Criao do sistema de governo geral e cmaras municipais. c) Criao das Capitanias Hereditrias. d) Montagem do Sistema Colonial. e) Criao e distribuio de sesmarias. 6. (UFPR) O Brasil Colnia teve como base uma economia e uma sociedade centradas no trabalho escravo e na grande lavoura para a exportao. Comente essa afirmao. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 7. (Fatec) Dentre as caractersticas gerais do perodo prcolonizador destaca-se: a) O grande interesse pela terra, pois as comunidades primitivas do nosso litoral produziam excedentes comercializados pela burguesia mercantil portuguesa. b) O extermnio de tribos e a escravizao dos nativos, efeitos diretos da ocupao com base na grande lavoura. c) A montagem de estabelecimentos provisrios em diferentes pontos da costa, onde eram amontoadas as toras de paubrasil, para serem enviadas Europa. d) A distribuio de lotes de terras a fidalgos e funcionrios do Estado portugus, copiando-se a experincia realizada em ilhas do Atlntico. e) A implantao da agro manufatura aucareira, iniciada com a construo do Engenho do Senhor Governador, em 1553, em So Vicente.

A ECONOMIA AUCAREIRA
8 (MACK) No seu conjunto, e vista no plano mundial e internacional, a colonizao dos trpicos toma o aspecto de uma vasta empresa comercial, mais completa que a antiga feitoria, mas sempre com o mesmo carter que ela, destinada a explorar os recursos naturais de um territrio virgem em proveito do comrcio europeu. este o verdadeiro sentido da colonizao tropical, de que o Brasil uma das resultantes.
(Caio Prado Jnior, Formao do Brasil Contemporneo)

Este sentido da colonizao tropical permite explicar elementos fundamentais da evoluo econmica, poltica e social do Brasil Colnia. Entre as alternativas abaixo, assinale a que NO apresenta elementos que se ajustem a essa explicao. a) Predomnio do povoamento litorneo, seguido de disperso populacional para o interior, determinada por atividades de preao de ndios e procura de metais preciosos. b) Preponderncia das necessidades do mercado internacional na determinao dos gneros agrcolas cultivados, provocando uma sucesso de ciclos econmicos. c) Incorporao de grupos nativos e estrangeiros como mode-obra cativa nas lavouras e minas, resultando num notvel e prolongado fenmeno de mestiagem. d) Tolerncia religiosa irrestrita como prtica fundamental do Estado para o incremento das relaes comercias com pases estrangeiros. e) Centralizao da administrao metropolitana, marcada pela intensa preocupao quanto ao fisco, ou seja, quanto tributao dos produtos coloniais.

UNIDADE 3 A ECONOMIA AUCAREIRA


Como j vimos, os declnios do comrcio com o Oriente e as ameaas de invaso no Brasil foraram o governo portugus a se decidir pela ocupao efetiva das terras brasileiras. Entretanto, para incorporar a colnia aos interesses do capital mercantil era necessrio organizar aqui um sistema de produo de algum gnero agrcola que garantisse alta lucratividade para a metrpole. A produo de acar se adequou ao projeto colonizador portugus, por preencher algumas condies bsicas, como: Adaptao s condies do clima e solo (massap) do nordeste brasileiro; Grande aceitao no mercado consumidor europeu, alcanando bons preos; A experincia portuguesa na produo aucareira, atividade j praticada pelos portugueses nas ilhas da Madeira e de Cabo Verde; somado a abundncia de terras disponveis.

247

HISTRIA DO BRASIL
O Brasil se constituiu em colnia de explorao nos moldes mercantilistas, baseado nos princpios do monoplio e da complementaridade. Para isso foi necessrio o estabelecimento de um conjunto de regras, regulamentando a submisso da colnia metrpole. Desse sistema fazia parte o Pacto Colonial, pelo qual a metrpole controlava todo o comrcio da colnia (importao e exportao), garantindo sua margem de lucro (monoplio). O comrcio com a colnia era feito por empresas privilegiadas, que recebiam do governo portugus a concesso para comprar e vender nos mercados coloniais. Estando a produo brasileira vinculada diretamente demanda do mercado externo e aos interesses mercantis de Portugal, era preciso produzir a maior quantidade possvel pelo menor custo possvel. Por isso, a produo colonial se estruturou com base em trs elementos principais: A monocultura: garantia da produo em larga escala de um produto que tivesse grande valor comercial; Latifndio: necessrio para a produo monocultora, o latifndio foi possvel graas grande disponibilidade de territrios; A escravido: instrumento essencial para garantir a mode-obra necessria produo monocultora nos latifndios, e grande fonte de acumulao capitalista, uma vez que os lucros do trfico negreiro enriqueciam os cofres portugueses. Esses trs elementos compem o sistema de plantation, aplicado tambm em grande parte das colnias de toda a Amrica, principalmente Amrica Central e do Sul. A monocultura, o latifndio e a escravido eram os pilares dessa produo que servia ao mercado externo. A instalao da empresa aucareira no Brasil exigiu a aplicao de imensos capitais: compra de escravos, plantio da cana, instalao dos engenhos, transporte e distribuio. Portugal no dispunha dos recursos necessrios para essa gigantesca tarefa. Por isso, associou-se a capitais estrangeiros (principalmente holandeses). Os holandeses participaram da empresa aucareira brasileira, financiando a instalao dos engenhos em troca do direito de comercializar o produto final (acar) nos mercados europeus. Dessa maneira, a parte maior do lucro do acar brasileiro acabava nas mos dos holandeses, responsveis pelo refino do produto. A produo aucareira se constituiu em principal atividade econmica do Brasil nos sculos XVI e XVII. Geograficamente ela ficou circunscrita ao litoral brasileiro, principalmente no nordeste. O sudeste (Rio de Janeiro e So Vicente) tambm teve seus engenhos, mas foi prejudicado pela distncia maior em relao ao mercado consumidor europeu. O engenho era a unidade produtora do complexo aucareiro. O termo se refere a toda a propriedade, desde as terras cultivadas at as instalaes (moenda, caldeira, casa-grande, senzala, oficinas, capela, etc.). Nele viviam o senhor de engenho e sua famlia, os escravos e alguns poucos trabalhadores livres (feitores, mestres, purgadores, etc.). A economia aucareira entrou em declnio a partir da segunda metade do sculo XVIII. Dentre os fatores que explicam sua decadncia, podemos citar: A retirada dos capitais holandeses do Brasil, devido sua expulso de Pernambuco, em 1654; A concorrncia do acar antilhano no mercado europeu; A economia mineradora, que canalizou para o centro-sul do pas grandes contingentes da mo-de-obra.

A ECONOMIA AUCAREIRA
No final do sculo XVIII e incio do sculo XIX a atividade aucareira voltou a ter importncia no quadro econmico brasileiro, tanto no nordeste quanto no sudeste, graas aos incentivos da administrao pombalina, s dificuldades vividas pelas colnias francesas (diminuio da concorrncia no mercado externo) e ao crescimento do prprio mercado interno.

OUTRAS ATIVIDADES ECONMICAS NO BRASIL COLONIAL


A economia do perodo colonial tinha sempre um produto que canalizava os investimentos, interesses e atividades, mas havia algumas atividades secundrias, na maioria das vezes complementares s necessidades da sociedade: Pecuria: introduzida no Brasil como atividade complementar ao engenho (fora motriz, transporte e alimentao), acabou constituindo-se em atividade independente. Com o crescimento dos rebanhos, surgiram as fazendas da criao, expandindose para o serto (interior), possibilitando o desbravamento e ocupao dessa parte da colnia que at ento era mal levada em conta. No sculo XVIII os campos meridionais foram extremamente importantes para abastecer a economia mineradora (alimentao e transporte). considerada a nica atividade colonial que esteve voltada para o mercado interno. O declnio da atividade no nordeste teve incio em meados do sculo XVIII, devido concorrncia da produo de Minas Gerais, que passou a abastecer as zonas mineradoras. Nos vastos campos do atual Rio Grande do Sul, a pecuria encontrou condies favorveis ao seu desenvolvimento. Alm do gado, foi significativa a criao de cavalos e mulas. Exportadas para a regio de Minas Gerais, as mulas tornaram-se importante meio de transporte nos terrenos acidentados e montanhosos das reas mineradoras. Tabaco: Comeou a ser cultivado no sculo XVII, e boa parte de sua produo era usada na troca por escravos. A principal rea produtora era a Bahia, tambm era cultivado em So Paulo, Esprito Santo e Sergipe. Drogas do Serto: Explorao de plantas medicinais que alcanavam altos preos no mercado europeu. Teve incio no sculo XVII, com a entrada das ordens religiosas na Amaznia (jesutas e outros). A coleta era feita pelos ndios das misses religiosas. Vale lembrar que o rio Amazonas era uma regio onde se praticava intenso contrabando. Ingleses, franceses e holandeses vinham procura de cacau, baunilha, guaran, ou seja, especiarias que atingiam excelentes preos na Europa. A coroa portuguesa com o auxlio dos jesutas reagiu s invases e incorporou a regio ao domnio portugus. Algodo: A exportao comea em 1760 e o Rio de Janeiro, Bahia, Pernambuco e o Maranho so os principais produtores. Predominou no Maranho, na segunda metade do sculo XVIII, voltado para o abastecimento da nascente indstria txtil inglesa. Era uma atividade monocultora, latifundiria e escravista, tal qual o acar. Seus momentos de apogeu estiveram vinculados ao declnio da concorrncia norte-americana, por problemas internos (guerra de independncia, no sculo XVIII; e guerra de secesso, no sculo XIX).

248

HISTRIA DO BRASIL
Agricultura de Subsistncia: cada engenho possua uma pequena rea destinada produo de alimentos (mandioca, milho, feijo, etc.) para a alimentao dos escravos. Ostentando opulncia, muitas vezes os senhores importavam o prprio alimento da Europa.

A ECONOMIA AUCAREIRA
Sobre a escravido no Brasil, CORRETO afirmar que: (01) A escravido de africanos destinou-se a fornecer mo-deobra para a indstria, em crescente expanso no Brasil do sculo XVII. (02) O mercado de escravos provocou a desagregao social dos grupos africanos que foram transportados para o Brasil. (04) Algumas tribos africanas exerciam papel ativo no trfico, facilitando o comrcio de escravos pelos europeus e trocando prisioneiros de naes rivais por mercadorias. (08) Os quilombos, como Palmares, foram locais de refgio e socializao dos escravos que conseguiam escapar de seu cativeiro. (16) A Igreja no sculo XVII e, posteriormente, a Medicina no sculo XIX exerceram importante papel no rompimento com o preconceito racial que os afros descendentes foram alvo no Brasil. (32) No Brasil Colnia imperava o patriarcalismo, definido como a autoridade exercida pelas mulheres sobre os homens naquela sociedade. (64) A explorao do escravo em atividades manuais fez com que estas fossem consideradas imprprias para um homem livre, preconceito que perdurou durante muito tempo no Brasil. Soma:_______ 3. (UNESP) A cana-de-acar comeou a ser cultivada igualmente em So Vicente e em Pernambuco, estendendose depois Bahia e ao Maranho a sua cultura, que onde logrou xito medocre como em So Vicente ou mximo como em Pernambuco, no Recncavo e no Maranho trouxe em consequncia uma sociedade e um gnero de vida de tendncias mais ou menos aristocrticas e escravocratas. (Gilberto Freyre, Casa Grande e Senzala.) Tendo por base as informaes do autor, a) Cite um motivo de maior sucesso da explorao da cana de acar em Pernambuco do que em So Vicente. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Explique por que o autor definiu o gnero de vida da sociedade constituda pela cultura da cana de acar como apresentando tendncias mais ou menos aristocrticas. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

EXERCCIOS
1. (UEM) Leia o fragmento a seguir: Toda a organizao administrativa e burocrtica criada pela metrpole objetivava sobretudo criar a base necessria para valorizar economicamente suas terras americanas, incentivando o desenvolvimento da agro manufatura do acar. Dessa forma, o incio da colonizao propriamente dita esteve ligado ao cultivo da cana e ao preparo do acar.
(Nadai, Elza e Neves, Joana. Histria do Brasil da Colnia a Republica. So Paulo: Saraiva, 1987, p.44.)

A respeito da colonizao do Brasil , assinale a(s) alternativa(s) CORRETAS. (01) Para a colonizao efetiva dos territrios, com a organizao dos engenhos, a Coroa portuguesa recorreu aos recursos particulares, por meio das concesses das capitanias e das sesmarias. (02) Inicialmente, a mo-de-obra utilizada nos engenhos foi a do ndio escravizado. No entanto, medida que a produo aucareira foi crescendo, recorreu-se importao do africano e sua utilizao como escravo. (04) A produo do acar no Brasil colonial visava, em primeiro lugar, atender as necessidades de consumo dos produtores. Isso no impedia que eventuais excedentes fossem vendidos no mercado externo. (08) Os escravos viviam nas senzalas, habitaes coletivas, trabalhavam sem descanso e eram responsveis pela imensa maioria das atividades na Casa Grande, nas oficinas e nos canaviais. Soma:_______ 2. (UFSC) MARIA DIAMBA Para no apanhar mais Falou que sabia fazer bolos Virou cozinha. Foi outras coisas para que tinha jeito. No falou mais. Viram que sabia fazer tudo, At mulecas para a Casa-Grande. Depois falou s, S diante da ventania Que ainda vem do Sudo; Falou que queria fugir Dos senhores e das judiarias deste mundo Para o sumidouro.

(LIMA, Jorge de. Poemas Negros. In: Os melhores poemas. So Paulo: Global, 1994. P. 60)

249

HISTRIA DO BRASIL
4. Assinale a alternativa que apresenta as caractersticas predominantes da economia colonial brasileira e cujas marcas se fazem sentir, ainda hoje, em nossa sociedade: a) Produo monocultora, grande propriedade (latifndio) e trabalho escravo. b) Monoplio comercial, pequena propriedade rural e trabalho servil. c) Produo para o mercado interno, propriedades diversificadas e trabalho assalariado. d) Monocultura de exportao, propriedade minifundiria e trabalho escravo. e) Importao de matria-prima, latifndio e trabalho escravo de negros e ndios. 5. (PUCRS) Considere as afirmativas a seguir sobre a sociedade brasileira no perodo colonial. I. A oposio senhor escravo uma das formas de explicar a ordenao social no perodo colonial, embora tenha existido o trabalho livre (assalariado ou no) mesmo nas grandes propriedades aucareiras e fazendas de gado. II. Os escravos trazidos da frica pelos traficantes pertenciam a diferentes etnias e foram transformados em trabalhadores cativos empregados tanto nas atividades econmicas mais rentveis ( cana de acar e minerao) quanto nas atividades domsticas e urbanas. III. Os primeiros escravos foram os Tupis e os Guaranis do litoral, porm, medida que se desenvolveu a colonizao e se criaram misses jesuticas, no final do sculo XVI, a escravizao indgena extinguiu-se. IV. Os homens livres pobres ( lavradores, vaqueiros, pequenos comerciantes, artesos) podiam concorrer s Cmaras Municipais, pois no havia no Brasil critrios de nobreza ou de propriedade como os que vigoravam na metrpole portuguesa. Esto CORRETAS as alternativas: a) I e II. c) I e IV. b) I, II e IV. d) II e III. e) III e IV.

A ECONOMIA AUCAREIRA
b) Caracterize o comrcio triangular entre Europa, frica e Amrica neste perodo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ c) Quais as conseqncias, para a frica, do trfico negreiro? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 7. (UEG GO) Seja qual for o termo utilizado para descrever o encontro de indgenas e europeus no continente americano no findar do sculo XV, consenso que seu resultado foi, ao mesmo tempo, lucrativo para os europeus e desastrosos para as populaes indgenas. Sobre as conseqncias de tal encontro, analise as seguintes proposies: I. A colonizao da Amrica do Norte foi empreendida por famlias inglesas em fuga da Inglaterra por causa das perseguies religiosas. Ao implement-la, os colonos dizimaram grande parte da populao nativa, considerada um empecilho para os seus interesses. II. A estrutura bsica da economia colonial na Amrica do Norte foi a pequena propriedade fundamentada no trabalho familiar, no policultura e em uma industria rudimentar, principalmente na reas txtil. III. A partir da descoberta da Amrica, pode-se notar o interesse da Igreja em cristianizar os nativos, preservando as culturas locais, ao mesmo tempo em que se introduzia pacificamente a nova religio. IV. Nas possesses portuguesas, houve pouco interesse na efetiva ocupao do territrio, devido prioridade dada pelo reino lusitano ao comrcio com as ndias e ao fato de no terem sido encontrados metais preciosos nos primeiros contatos. Assinale a alternativa CORRETA: a) I, II e III. d) I e III. b) II, III e IV. e) Todas so verdadeiras. c) I, II e IV. 8. (PUC Camp) As caractersticas dos primeiros ncleos de ocupao no Brasil, dos quais emergiram os mencionados grupos sociais nascentes, revelam o tipo de colonizao empreendida por Portugal e predominante na Amrica Latina, denominado pela historiografia de: a) Colonizao Estatal. b) Colonialismo Religioso. c) Colonizao de Explorao. d) Neo colonialismo. e) Colonizao de Povoamento.

6. (Unicamp) Os primeiros escravos negros chegaram ao Novo Mundo bem no inicio do sculo XVI. Por trs sculos e meio as principais potncias martimas competiram entre si em torno do lucrativo trfico de escravos, que levou aproximadamente dez milhes de africanos para as Amricas. a) Cite uma das principais potncias europias que traficava escravos no sculo XVII e XVIII. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

250

UNIO IBRICA E INVASES ESTRANGEIRAS

UNIDADE 4 UNIO IBRICA E INVASES ESTRANGEIRAS


UNIO IBRICA
Em 1578 morreu o jovem rei de Portugal, D. Sebastio, lutando contra os rabes no norte da frica, na batalha de Alccer-Quibir. Como D. Sebastio no deixou herdeiro (descendente direto), o trono foi ocupado por seu tio, o cardeal D. Henrique, que morreu dois anos depois, em 1580, tambm sem deixar descendentes. Dentre os principais pretendentes ao trono portugus, D. Antnio, prior do Crato, contava com a simpatia de poucos setores influentes. Diante das dificuldades de manter o imprio do Oriente e da carncia de metais preciosos, a maior parte da nobreza e dos comerciantes de grande porte preferiu apoiar as pretenses do rei de Espanha, Felipe II (1527-1598). Aps subornos e a invaso do reino pelas tropas espanholas, desmantelando a resistncia de D. Antnio, aquele foi aclamado rei de Portugal, nas cortes de Tomar (1581), com o nome Felipe I. Com a unificao das coroas portuguesa e espanhola ocorre a Unio Peninsular, ou seja, a unio entre as duas naes da pennsula Ibrica. Desse modo, o Brasil e as demais colnias portuguesas ficaram sob o domnio da Espanha e foi suspenso o Tratado de Tordesilhas. A unificao da Espanha pouco alterou a situao do Brasil, mas possibilitou a ultrapassagem do meridiano de Tordesilhas, facilitando o avano de colonizadores portugueses para o interior brasileiro e para reas do territrio sul-americano, pertencentes originalmente Espanha. Em 1640 houve a Restaurao Portuguesa, isto , Portugal recuperou sua independncia.

AS INVASES HOLANDESAS

Os holandeses tinham grande interesse na indstria aucareira do Brasil. Participavam da refinao e distribuio do acar na Europa. Quando Portugal e suas colnias ficaram sob o domnio espanhol, a Espanha catlica estava em guerra com a Holanda protestante. Os espanhis, ento, fecharam os portos da Espanha, de Portugal e das colnias aos navios holandeses. Para defender seus interesses comerciais, os holandeses criaram, em 1602, a Companhia das ndias Orientais, para comercializar com o Oriente. Para comerciar com a frica e com as Amricas, criaram a Companhia das ndias Ocidentais, em 1621. Foram os capitalistas da Companhia das ndias Ocidentais que planejaram a invaso do Nordeste, uma vez que no queriam perder os grandes lucros obtidos com a empresa aucareira brasileira. A primeira invaso holandesa ocorreu na Bahia, em 1624. Uma esquadra atacou a cidade de Salvador, sede do Governo Geral e porto exportador de acar. Os senhores de engenho e a populao refugiaram-se no interior e organizaram a resistncia, sob a liderana do bispo D. Marcos Teixeira. Em 1625 chegou ao Brasil uma esquadra chamada Jornada dos Vassalos, formada por navios portugueses e espanhis. A populao com a ajuda dessa esquadra expulsou os invasores. A segunda invaso holandesa ocorreu em Pernambuco, em 1630, quando os holandeses atacaram Olinda que, na poca, era capital de Pernambuco, a principal regio produtora de acar no Brasil. Logo depois, conquistaram tambm Recife. O governador de Pernambuco, Matias de Albuquerque, foi para o interior, organizou guerrilhas e fundou o maior centro de resistncia aos holandeses: o arraial do Bom Jesus. A luta prosseguiu at 1632 quando Domingos Fernandes Calabar, conhecedor da regio, levou os holandeses aos centros de guerrilhas. Foram muitas, ento, as vitrias holandesas, As lutas freqentes no agradavam nem aos senhores nem aos donos da Companhia das ndias Ocidentais, pois os dois lados eram prejudicados, sofrendo prejuzos constantes. Por esse motivo foi enviado ao Brasil o conde Joo Maurcio de Nassau, para promover a paz e governar o Nordeste brasileiro.

AS INVASES ESTRANGEIRAS
AS INVASES FRANCESAS
A primeira invaso francesa, comandada por Nicolau Durand de Villegaignon, ocorreu em 1555, quando os franceses invadiram o Rio de Janeiro, fundando uma colnia chamada Frana Antrtica. Construram um forte e aliaram-se aos Tamoios, ndios da regio revoltados contra os portugueses, que estavam unidos na Confederao dos Tamoios. Os padres Manoel da Nbrega e Jos de Anchieta conseguiam pacificar os ndios rebeldes e uniram-se contra os franceses aos ndios Termimins, chefiados pelo cacique Araribia. Em 1567, durante a administrao do governador geral Mem de S, aps doze anos de luta, os franceses foram expulsos, com a ajuda de Estcio de S, sobrinho do governador. Em 1612 os franceses voltaram a invadir o Brasil e fundaram, no Maranho, uma colnia, que chamaram de Frana Equinocial. Os franceses permaneceram por trs anos no Maranho e fundaram a cidade de So Lus, cujo nome uma homenagem ao rei francs Lus XIII.Em 1615 foram expulsos por Jernimo de Albuquerque e Alexandre de Moura.

O GOVERNO DE MAURICIO DE NASSAU (1637-1644)

Nassau governou o Brasil holands a partir de 1637. Apesar de ser protestante, concedeu liberdade religiosa aos catlicos e aos judeus. Fez coisas importantes, como: o aumento da produo aucareira, conseguindo emprstimos para os senhores de engenho; a conquista de Sergipe e do Maranho; a urbanizao de Recife, com a construo de jardins, pontes, palcios, hospitais e o primeiro observatrio astronmico do Brasil; a vinda de cientistas e artistas europeus (arquitetos, botnicos, mdicos, matemticos e pintores, entre eles o pintor Frans Post, que estudou e retratou a flora e a fauna brasileira). A Holanda precisava de dinheiro, pois estava em guerra. A Companhia das ndias Ocidentais reclamava dos excessivos gastos de Nassau e comeou a pression-lo para que cobrasse aos senhores de engenho os emprstimos atrasados, alm de ter aumentado os impostos. Nassau no concordava com isso e acabou por demitir-se, voltando Holanda em 1644. Com o aumento dos impostos, o confisco de engenhos como forma de pagamento das dvidas e a restrio liberdade religiosa, foi reiniciada em Pernambuco, a luta contra os holandeses, que se chamou Insurreio Pernambucana. Na liderana dessa luta estavam representantes de vrias etnias: os brancos Andr Vidal de

251

HISTRIA DO BRASIL
Negreiros e Joo Fernandes Vieira, o negro Henrique Dias e o ndio Poty, mais tarde batizado com o nome de Filipe Camaro. Depois de dez anos de luta, houve a vitria na Batalha de Guararapes e a rendio dos holandeses na Campina da Taborda, em 1654. A expulso dos holandeses desencadeou uma crise na empresa aucareira, pois os holandeses haviam levado mudas e plantado cana-de-acar em seus domnios nas Antilhas, comeando, assim, a ter produo prpria. O acar brasileiro no podia concorrer com aquele produzido nas Antilhas, porque os holandeses continuavam a dominar os mercados consumidores. O Brasil viveu, ento, na metade do sculo XVII, sua primeira grande crise econmica.

UNIO IBRICA E INVASES ESTRANGEIRAS


III. As medidas econmicas de Nassau garantiam os lucros da Companhia das ndias Ocidentais e os lucros dos senhores de engenho, j que aumentaram a produo do acar. IV. A poltica adotada por Nassau para assentar os holandeses na Bahia acabou por deflagrar sua derrota no fim da ocupao holandesa, graas a resistncia dos ndios e portugueses expulsos das terras que ocupava. So verdadeiras as proposies: a) I e II. c) II, III e IV. b) I, II e III. d) I, III e IV. e) II e IV.

NOVA DIVISO DA COLNIA

Durante o domnio espanhol houve outra tentativa de melhorar a administrao do Brasil e defender o litoral contra a invaso dos franceses. Em 1621, o territrio brasileiro foi outra vez dividido, desta vez em dois grandes estados. As diversas capitanias passaram a ser administrados em dois blocos: Estado do Maranho (da Amaznia ao Cear), com a capital em So Lus, que mais tarde transformou-se em Estado do Gro Par, com capital em Belm; e Estado do Brasil (do Rio Grande do Norte ao Rio Grande do Sul) com a capital em Salvador. A partir de 1763 a capital passou a ser o Rio de Janeiro. Essa diviso durou at 1774.

3. (UFG-GO) No perodo da Unio Ibrica (1580-1640), o domnio espanhol sobre Portugal provocou tambm mudanas polticoeconmicas importantes no imprio colonial portugus. Explique uma das mudanas ocorridas na Amrica portuguesa, resultante da dominao espanhola. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 4. (UNESP) Foi assim possvel dispor um segundo ataque ao Brasil, desta vez contra uma capitania mal aparelhada na sua defesa, mas a principal e a mais rica regio produtora do acar do mundo de ento. Existiam a e nas capitanias vizinhas mais de 130 engenhos que, nas melhor safras, davam mais de mil toneladas de produto. (J.A. Gonalves de Mello) O texto refere-se : a) Guerra dos Mascates. b) Invaso francesa. c) Invaso holandesa. d) Revolta de Beckman. e) Invaso inglesa.

EXERCCIOS
1.(FGV) A administrao de Maurcio de Nassau sobre parte do Nordeste do Brasil, no sculo XVII, caracterizou-se: a) Por uma forte intolerncia religiosa, representada, principalmente, por meio do confisco das propriedades dos judeus e dos catlicos. b) Pela proteo s pequenas e mdias propriedades rurais, o que contribuiu para o aumento da produo de acar e tabaco em Pernambuco. c) Por uma ocupao territorial limitada a Pernambuco, em funo da proteo militar efetuada por Portugal nas suas colnias africanas. d) Por inmeras vantagens econmicas aos colonos e pela ausncia de tolerncia religiosa, representada pela imposio do calvinismo. e) Pela ateno aos proprietrios luso-brasileiros, que foram beneficiados com crditos para a recuperao dos engenhos e a compra de escravos. 2. Em relao ao perodo da ocupao holandesa no Nordeste brasileiro, afirma-se: I. A invaso deveu-se aos interesse dos comerciantes holandeses pelo acar produzido na regio, interesses esses que foram prejudicados devido Unio Ibrica (1580-1640). II. Foi, tambm, uma conseqncia dos conflitos econmicos e polticos que envolviam as relaes entre os chamados Pases Baixos e o Imprio espanhol.

5. (UEM-PR) Quando os historiadores fazem meno ao Brasil holands, eles se referem ao perodo em que a Holanda, uma das principais potncias europias, ocupou e colonizou o Nordeste brasileiro no sculo XVII. Sobre esse assunto, assinale a alternativa INCORRETA: a) Mauricio de Nassau, governador holands da regio ocupada, incentivou financeiramente a modernizao da produo aucareira nordestina e realizou grandes obras urbansticas e de saneamento em Recife. b) A poltica colonial holandesa se distinguiu da poltica colonial portuguesa em vrios aspectos, permitindo, por exemplo, a liberdade religiosa e a coexistncia entre catlicos, judeus e protestantes calvinistas. c) A ocupao holandesa no Brasil se insere no quadro de disputa entre as potncias mercantilistas europias por territrios e por mercados coloniais.

252

HISTRIA DO BRASIL
d) A memria histrica da poca da colonizao holandesa no Brasil ficou registrada na arquitetura de muitas cidades nordestinas e nos quadros pintados por artistas holandeses que retrataram as paisagens da regio. e) A ocupao holandesa do Nordeste brasileiro terminou em 1700, com a retirada pacifica do exrcito holands, aps a intermediao diplomtica do rei Luis VXI da Frana. 6. (UFV-MG) Durante a segunda metade do sculo XVII, os portugueses perderiam grande parte do controle do comrcio do Oriente e das rotas do Oceano ndico para os holandeses, que, por sua vez, logo se veriam superados pelos ingleses. Holandeses e ingleses deviam seu sucesso capacidade de organizar e financiar seus empreendimento simultaneamente militares e comerciais. a) Qual o principal instrumento de poltica colonial dos holandeses e ingleses? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Aponte um evento que indique os desdobramentos da concorrncia entre as grandes potncias na Amrica Portuguesa. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 7. Sobre as invases holandesas no Nordeste brasileiro, na primeira metade do sculo XVII, assinale as alternativas CORRETAS. (01) Uma vez expulsos do nordeste, os holandeses organizaram a produo de acar nas Antilhas. A concorrncia do acar antilhano contribuiu decisivamente para uma crise na economia aucareira da Amrica portuguesa. (02) Os holandeses permaneceram no nordeste do Brasil por mais de vinte anos. Por serem protestantes, aboliram a escravido do negro, que foi restaurada quando os portugueses retomaram o controle sob a regio. (04) Holandeses tiveram uma participao significativa na economia aucareira no nordeste do Brasil. Com a unio Ibrica (1580-1640), a Coroa da Espanha passou a dificultar a participao dos holandeses no comrcio do acar produzido no

EXPANSO TERRITORIAL
nordeste. Tal fato contribuiu para que os holandeses invadissem o Nordeste brasileiro. (08) A Companhia das ndias Ocidentais, criada pelos holandeses, alm de promover a invaso do nordeste brasileiro, foi responsvel pela administrao da rea invadida. (16) Em 1673, o Conde Maurcio de Nassau foi nomeado governador das terras ocupadas pelos holandeses no nordeste do Brasil. Alm de administradores, Nassau trouxe, para o Brasil, artistas e cientistas. Soma:_______ 8. A ocupao portuguesa do litoral Norte e Nordeste do Brasil, em fins do sculo XVI e incio do sculo XVII, deu-se em virtude dos ataques ingleses, franceses e holandeses a esse territrio. Sobre estas invases e ocupaes, identifique as proposies VERDADEIRAS e FALSAS: ( ) Os franceses invadiram Sergipe d El Rei, a Paraba, o Rio Grande do Norte, o Cear, o Maranho e o Gro-Par. ( ) Os holandeses ocuparam, por longo tempo, os territrios da Bahia, Pernambuco, Paraba e Rio Grande do Norte. ( ) Os franceses, holandeses e ingleses conquistaram todo o Norte e Nordeste, restando aos portugueses, no sculo XVI, o domnio do territrio abaixo da Bahia. ( ) De todas as invases do sculo XVII, a holandesa foi a mais duradoura, no sentido da permanncia da ocupao. Em Pernambuco, o domnio holands se estendeu de 1630 a 1654. ( ) A conquista do Gro-Par, pelos portugueses, em 1616, beneficiou o monoplio do comrcio dessa regio para Portugal e obrigou os franceses a se instalarem nas Guianas.

UNIDADE 5 EXPANSO TERRITORIAL


A ocupao do territrio que hoje forma o Brasil resultou de elementos da colonizao europia, conflitos com povos indgenas e questes econmicas. Entre os sculos XVI e XVII o que houve foi o deslocamento populacional do litoral para o interior, numa espcie de marcha para o oeste.

ENTRADAS
As Entradas eram expedies oficiais, formadas apenas por homens, que saam geralmente do litoral. Com a proibio da criao de gado no litoral, a sada foi levar a criao para o interior. Mas por serem expedies oficiais, feitas pelo governo, no ultrapassavam Tordesilhas de 1492.

253

HISTRIA DO BRASIL

EXPANSO TERRITORIAL

BANDEIRAS
Expedies organizadas por particulares, as bandeiras nasceram na capitania de So Vicente, mais especificamente, na vila de So Paulo, cujo o objetivo era procurar riquezas no interior da Colnia, capturar escravos fugitivos e aprisionar nativos para serem vendidos como escravos. Considerando o bero do movimento bandeirante, foi da que partiu a maioria das expedies que penetraram serto adentro e atingiram as mais distantes regies da colnia. O principal motivo das bandeiras terem sido organizadas na capitania de So Vicente foi o desenraizamento de sua populao, causado pela extrema pobreza de seus habitantes, uma vez que a lavoura aucareira havia fracassado na regio em razo da m qualidade do solo e a longa distncia que separava a capitania da Europa.

EXERCCIOS
1. As expedies destinadas ao apresamento de indgenas constituram, como se pode observar no mapa abaixo, a principal atividade realizada pelos bandeirantes paulistas entre os sculos XVI e XVIII.

A MINERAO
As primeiras descobertas de ouro na Amrica portuguesa esto ligadas expanso bandeirante, quando a comercializao do acar e sua produo esto em declnio. A descoberta das minas atraiu milhares de portugueses e colonos para a regio mineradora, desenvolvendo o surgimento de cidades e vilas.Houve tambm uma transferncia do eixo econmico para a regio centro-sul, incluindo a transferncia da capital de Salvador para o Rio de Janeiro, em 1763. As minas pertenciam coroa portuguesa, que concedia lotes aos mineradores para a explorao do ouro. O trabalho nesses lotes era realizado por escravos em locais denominados lavras. Vendo no ouro a possibilidade de revigorar sua economia, o governo portugus organizou um rgido esquema administrativo para controlar a regio mineradora.

INTENDNCIA DAS MINAS

Criado em 1702, o rgo era responsvel por distribuir terras para a explorao do ouro, fiscalizar a atividade mineradora, julgar questes referente minerao e cobrar impostos pela explorao das jazidas: os mineradores deviam ao governo portugus um quinto de qualquer quantidade de metal extrado.

CASAS DE FUNDIO

Para facilitar o controle, o governo portugus proibiu a circulao do ouro em p. Criou as casas de fundio, onde todo o ouro era obrigatoriamente fundido e transformado em barras. Ao receber o ouro, As casas de fundio j retiravam a parte que correspondia ao imposto devido Fazenda Real (Coroa). O restante recebia um selo que comprovava o pagamento do quinto, podendo ser legalmente negociado: era o ouro quintado.

Estabelea a relao existente entre as expedies de apresamento e as atividades econmicas desenvolvidas pelos habitantes da Capitania de So Vicente. Em seguida, identifique um efeito dessas expedies para a colnia portuguesa na Amrica. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

CRISE DA MINERAO

Ao longo do sculo XVIII, com a intensa explorao, at mesmo as maiores jazidas foram se esgotando. NA segunda metade do sculo, a produo do ouro caiu brutalmente. O governo portugus continuou aumentando as formas de controle e as presses sobre os mineradores. Em 1765, foi decretada a derrama, cobrana de todos os impostos atrasados. As autoridades no pouparam nem mesmo os mineradores empobrecidos, que acabaram perdendo os poucos bens que lhes restavam.

254

HISTRIA DO BRASIL
2. Leia as seguintes afirmaes sobre as bandeiras: I. Os bandeirantes criaram muitos atritos com os jesutas, pois no respeitavam as redues, aldeias de ndios catequizados. II. Expedies para o interior brasileiro foram organizadas desde o sculo XVI. Mas s no sculo XVII o movimento bandeirista assumiu maior importncia, e o Rio Grande do Sul foi o principal ncleo irradiador. III. Na primeira metade do sculo XVII, prevaleceu o apresamento de ndios, mais baratos que os africanos, o que fazia com que os bandeirantes estabelecessem um intenso comrcio de escravos com os senhores de engenho de acar. IV. Na segunda metade do sculo XVII, predominaram bandeiras que procuravam metais preciosos. Pode-se afirmar que esto CORRETAS somente: a) II, III e IV. c) I, II e III. b) I, III e IV. d) I e IV. e) I e II.

EXPANSO TERRITORIAL
6. (PUC-RS) Entre os fatores que contriburam, a partir do sculo XVII, para a expanso territorial da colonizao portuguesa no Brasil, ultrapassando os limites de Tordesilhas, correto apontar: a) pecuria, a extrao das drogas do serto e as expedies bandeirantes. b) As capitanias hereditrias, as expedies bandeirantes e a invaso holandesa. c) Os engenhos de acar, a extrao das drogas do serto e a fundao da Frana Antrtica. d) A pecuria, a Insurreio Pernambucana e a criao dos Governos Gerais. e) Os governos gerais, a unio Ibrica e os engenhos de acar. 7. (UFC) Os bandeirantes paulistas foram responsveis pela interiorizao e expanso do projeto colonial portugus. Suas expedies visavam ao aprisionamento de ndios, com a finalidade de transform-los em mo-de-obra escrava, e a procura por metais preciosos para seu enriquecimento pessoal ou da Coroa Portuguesa. a) Diga como eram chamadas as expedies conduzidas pelos bandeirantes. _________________________________________________ _________________________________________________ b) Apresente pontos de divergncia, presentes na Historiografia Brasileira, a respeito da ao dos Bandeirantes. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

3. (FUVEST) Qual destas definies expressa melhor o que foram as Bandeiras? a) Expedies financiadas pela Coroa que se propunham exclusivamente a descobrir metais e pedras preciosas. b) Movimento de fundo catequtico, liderados pelos jesutas para a formao de uma nao indgena crist. c) Expedies particulares que apresavam os ndios e procuravam metais e pedras preciosas. d) Empresas organizadas como objetivo de conquistar as reas litorneas e ribeirinhas. e) Incurses de portugueses para atrair tribos indgenas para serem catequizadas pelos jesutas. 4. (FUVEST) No sculo XVIII a produo do ouro provocou muitas transformaes na colnia. Entre elas podemos destacar: a) A urbanizao da Amaznia, o incio da produo do tabaco, a introduo do trabalho livre com os imigrantes. b) A introduo do trafico africano, a integrao do ndio, a desarticulao das relaes com a Inglaterra. c) A industrializao de So Paulo, a produo de caf no Vale do Paraba, a expanso da criao de ovinos em Minas Gerais. d) A preservao da populao indgena, a decadncia da produo algodoeira, a introduo de operrios europeus. e) O aumento da produo de alimentos, a integrao de novas reas por meio da pecuria e do comrcio, a mudana do eixo econmico para o Sul. 5. A expanso territorial do sculo XVII foi motivada principalmente por: a) A busca de novas terras para o cultivo da cana - de acar. b) Necessidade de defesa das fronteiras brasileiras. c) Fim da unio Ibrica e restaurao da monarquia portuguesa. d) Procura de riquezas minerais e o aprisionamento de ndios. e) Necessidade de se encontrar quilombos que abrigavam escravos fugitivos.

8. Em fevereiro de 1748, diante do padre visitador do bispado, a preta forra Catarina de Sousa foi acusada de obrigar com castigo as suas escravas a que lhe dem jornal todos os dias de servio, e domingos e dias santos, jornal dobrado, ainda que sejam em ofensas de Deus, porquanto no h vendagem equivalente ao jornal que lhe pedido (...)
(FIGUEIREDO, Luciano. O acesso da memria: cotidiano e trabalho da mulher em Minas Gerais no sculo XVIII. R.J.:Jos Olympio, Braslia:Edunb, 1993. P. 63)

Glossrio: Jornais = rendimento, ganhos dirios; Ofensas de Deus = atividades de prostituio e/ou correlatas. O relato acima remete-nos a um captulo fundamental da nossa histria, o da escravido. Ento, a partir da leitura do mesmo e dos estudos histricos sobre a organizao do trabalho escravo CORRETO afirmar que : a) De acordo com a legislao do sculo XVIII, era vedada aos forros a posse de escravos, razo pela qual Catarina de Sousa foi acusada perante o visitador.

255

HISTRIA DO BRASIL
b) A prtica de prostituio por escravas, na regio de Minas, era regulamentada tanto pelo Igreja quanto pelo Estado, como forma de complementar os jornais perdidos pelos proprietrios de escravos. c) Na regio das Minas, a administrao do trabalho escravo era subordinado Igreja e, devido a essa relao, foram realizadas devassas eclesiais no sentido de coibir os castigos impingidos aos escravos. d) Nas Minas, o comrcio ambulante no raramente misturava-se com as atividades de prostituio, o que se depende da expresso ainda que sejam ofensas de Deus, referida no relato.

TRATADOS TERRITORIAIS
Diante da explorao e monoplio da Companhia de Comrcio do Maranho por parte do governo portugus, os colonos reagiram. Este episdio ficou conhecido como revolta de Beckman, lembrando o sobrenome dos lderes, os irmos Toms e Emanuel Beckman. O governo portugus reprimiu violentamente a revolta, no entanto, a Companhia de Comrcio do Maranho foi extinta, depois de confirmada as queixas dos revoltosos.

A GUERRA DOS EMBOABAS (1708-1709 - Minas Gerais)


Foi um conflito entre paulistas e forasteiros (emboabas) e teve como principal causa, a disputa pelas regies ricas em ouro nas Minas Gerais. Os paulistas, por serem pioneiros, no aceitavam a presena dos forasteiros na regio. Mas a guerra foi vencida pelos emboabas e os paulistas foram expulsos da regio, penetrando mais ainda no interior do territrio brasileiro. Episdio marcante: Capo da Traio, onde muitos paulistas foram cercados pelos emboabas. Diante da promessa de que ningum seria morto, os paulistas se renderam e entregaram as armas. Entretanto, o comandante emboaba, Bento do Amaral Coutinho ordenou o ataque e massacrou os rivais.

UNIDADE 6 TRATADOS TERRITORIAIS


TRATADO DE MADRI-1750
O grande acordo que limitava as fronteiras entre os imprios coloniais ibricos na Amrica. Atravs dele, a Coroa de Portugal se assenhoreava do norte, centro-oeste e sul do Brasil (em especial o Territrio dos Sete Povos das Misses). Princpio do uti possidets, isto , a posse da terra garantia a propriedade desta. o que aconteceu com a Amaznia, que pertencia a Espanha e passou a ser de Portugal. Contudo, este tratado no foi respeitado por ambos os lados.

A GUERRA DOS MASCATES (1710 Pernambuco)

TRATADO DE SANTO ILDEFONSO-1777

Este tratado entregava a propriedade do Territrio dos Sete Povos das Misses e da Colnia de Sacramento (atual Uruguai), ao domnio da Espanha. J a Amaznia e parte do atual CentroOeste, foi entregue Portugal.

Os fazendeiros de Olinda detinham o poder poltico, pois a Cmara Municipal ficava nesta cidade, enquanto que os comerciantes de Recife detinham o poder econmico. Diante desta situao, os comerciantes (mascates) de Recife exigiram participao poltica. Imediatamente, os fazendeiros de Olinda reagiram iniciando o conflito. O governo portugus interveio e no ano seguinte Recife foi elevada a condio de Vila, tornando-se assim a sede administrativa de Pernambuco.

A CRISE DO SISTEMA COLONIAL MOVIMENTOS NATIVISTAS


A partir do sculo XVII, o Brasil conheceu vrias revoltas internas que foram denominadas Revoltas Nativistas. Estas revoltas no objetivavam a independncia do pas, mas sim buscavam resolver os entraves polticos e econmicos locais.

REBELIO DE VILA RICA OU REVOLTA DE FELIPE DOS SANTOS (1720 Vila Rica, MG)
A populao de Vila Rica estava insatisfeita com a alta cobrana de impostos. A situao agravou-se quando o governo portugus anunciou a instalao da Casa de Fundio, onde o ouro seria transformado em barras e quintado, proibindo sua circulao em p ou em pepitas, o que dificultaria o contrabando. Felipe dos Santos organizou um movimento e exigiu mudanas. Portugal, estrategicamente, prometeu atenderlhes as exigncias. Mas assim que conseguiu reunir tropas suficientes, os Drages da Cavalaria, para conter a revolta, o governo portugus lanou-se contra os revoltosos de Vila Rica. Numa ao muito violenta, na qual vrios rebeldes foram presos e mortos, suas casas queimadas, Felipe dos Santos foi executado e esquartejado, num claro objetivo de inibir qualquer movimento contra a coroa portuguesa.

A REVOLTA DE BECKMAN (1684 MARANHO)

Teve como causa principal o uso da mo-de-obra indgena. Devido a uma grande crise econmica na regio os fazendeiros, sem condies de importar mo-de-obra escrava africana, usavam o ndio. Os jesutas, no concordando com a explorao do ndio, exigiram a proibio da escravido indgena junto ao governo portugus. O rei de Portugal, ento, proibiu o uso da mode-obra indgena e criou uma companhia de comrcio para trazer escravos africanos e, em troca, receberiam o monoplio comercial na regio.

256

HISTRIA DO BRASIL

TRATADOS TERRITORIAIS
b) Aprofundou-se a crise econmica dos reinos ibricos com a Guerra da Restaurao. c) Intensificou-se a crise do regime absolutista, culminando com a Revoluo Francesa. d) Incentivou-se a luta pela participao popular, culminando com a Revoluo Gloriosa. e) Estimularam-se os ideais nacionalistas radicais, provocando a Independncia da Amrica. 4. A Guerra dos Emboabas, a dos Mascates e a Revolta de Vila Rica, verificadas nas primeiras dcadas do sculo XVIII, podem ser caracterizadas como: a) Movimentos isolados em defesa de idias liberais, nas diversas capitanias, com a inteno de se criarem governos republicanos. b) Movimentos de defesa das terras brasileiras, que resultaram num sentimento nacionalista, visando independncia poltica. c) Manifestaes de rebeldia localizadas, que contestavam aspectos da poltica econmica de dominao do governo portugus. d) Manifestaes das camadas populares das regies envolvidas, contra as elites locais, negando a autoridade do governo metropolitano. 5. No sculo XVIII, a colnia Brasil passou por vrios conflitos internos. Entre eles temos a: a) Guerra dos Emboabas, luta entre paulistas e gachos pelo controle da regio das Minas Gerais. Essa guerra impediu a entrada dos forasteiros nas terras paulistas e manteve o controle da capitania de So Paulo sobre a minerao. b) Revolta Liberal, tentativa de reagir ao avano conservador da monarquia portuguesa, que usava de seus smbolos monrquicos e das baionetas do Exrcito da Guarda Nacional, como forma de cooptar e intimidar os colonos portugueses. c) Revolta de Filipe dos Santos, levante ocorrido em Vila Rica e liderado pelo tropeiro Filipe dos Santos. O motivo foi a cobrana do quinto, a quinta parte do ouro fundido pelas Casas de Fundio controladas pelo poder imperial. d) Farroupilha, revolta que defendia a proclamao da Repblica Rio-Grandense (Repblica dos Farrapos) como forma de obter liberdades polticas, fim dos tributos coloniais e proibio da importao do charque argentino. e) Cabanagem,movimento de elite dirigido por padres, militares e proprietrios rurais, que propunham a proclamao da repblica como forma de combater o controle econmico exercido pelos comerciantes portugueses. 6. A colonizao brasileira foi sempre marcada por confrontos que refletiam a diversidade de interesses presentes na sociedade colonial como pode ser observado nos(as): a) Conflitos internos, sem contedo emancipacionista, como as Guerras dos Emboabas e dos Mascates. b) Ideais monrquicos e democrticos defendidos pelos mineradores e agricultores na Conjurao Mineira.

EXERCCIOS
1. (UFPE) Portugal enfrentou resistncias para manter sua dominao sobre o Brasil. Algumas rebelies revelaram a insatisfao da populao diante das cobranas dos tributos e das formas de dominao existentes. Na regio das Minas Gerais, em 1720, houve a Revolta de Vila Rica, a qual: ( ) Formulou um manifesto baseados nas idias iluministas, conseguindo a adeso do clero e dos comerciantes, insatisfeitos com as cobranas de impostos. ( ) Conseguiu fortalecer a idia de abolio da escravatura, com apoio dos grandes comerciantes da regio. ( ) Foi um movimento dirigido contra a cobrana de tributos, sem as propostas libertrias presentes em outras rebelies do sculo XVIII. ( ) Teve amplas repercusses na colnia e ameaou o governo portugus com suas estratgias militares. ( ) Ficou limitada aos protestos feitos na regio de Minas, sendo liderada por Felipe dos Santos, que, afinal, foi puindo por Portugal. 2. Sobre a Guerra dos Emboabas, possvel AFIRMAR que ela se constituiu: a) Em um conflito opondo paulistas e forasteiros pelo controle das reas de minerao e tenses relacionadas com o comrcio e a especulao de artigos de consumo como a carne de gado, controlada pelos forasteiros. b) Em uma rebelio envolvendo senhores de minas de regies distantes dos maiores centros como Vila Rica que no aceitavam a legislao portuguesa referente distribuio das datas e a cobrana do dzimo, c) No primeiro movimento colonial organizado que tinha como principal objetivo separar a regio das Minas Gerais do domnio do Rio de Janeiro, assim como da metrpole portuguesa, e que teve a participao de escravos, d) No mais importante movimento nativista da segunda metade do sculo XVIII, que envolveu ndios cativos, escravos africanos e pequenos mineradores e faiscadores contra a criao das Casas de Fundio. e) Na primeira rebelio ligada aos princpios do liberalismo, pois defendia reformas nas prticas coloniais e exigia que qualquer aumento nos tributos tivesse a garantia de representao poltica para os colonos. 3. (PUC SP) O declnio da economia mineradora brasileira, no final do sculo a que o texto se refere, coincidiu com profundas mudanas ocorridas na sociedade europia e nas relaes entre metrpoles e suas colnias. No plano poltico, a) Caracterizou-se isso pela tentativa de restaurao do Antigo Regime pela Santa Aliana.

257

HISTRIA DO BRASIL
c) Projetos imperiais adotados pela Revoluo Pernambucana de 1817 por influncia da burocracia lusitana. d) Reaes contrrias aos monoplios, como na Conjurao Baiana, organizada pelos comerciantes locais. e) Caractersticas nacionalistas de todos os movimentos ocorridos no perodo colonial, como nas Revoltas do Rio de Janeiro e de Beckman. 7. Sobre as rebelies ocorridas no Brasil, durante o perodo colonial, CORRETO afirmar: (01) A Revolta de Beckmann (1684), no Maranho, pode ser considerada a primeira rebelio de cunho social no pas, pois, com o apoio dos jesutas, uniu brancos, escravos negros e ndios contra os desmandos da Coroa Lusitana. (02) A Guerra dos Emboabas (1707-1709), em Minas Gerais, considerada precursora dos ideais da Inconfidncia Mineira, pois sua liderana tentava unir mineradores paulistas e portugueses na luta contra a espoliao da riqueza aurfera pela Metrpole. (04) A Guerra dos Mascates (1710-1712), ocorrida em Pernambuco, no pode ser entendida como uma revolta contra o jugo colonial, pois ela foi motivada, principalmente, por causa da disputa pelo controle econmico e poltico local entre comerciantes do Recife e senhores de engenho de Olinda. (08) A Inconfidncia Mineira (1789) teve maior conotao colonial do que social, porque foi movimento de reao dos colonos contra as presses exercidas pela Metrpole, e porque o objetivo principal de sua liderana era obter a separao poltica do Brasil de Portugal. (16) A Conjurao Baiana (1798) teve maior conotao social do que colonial, porque sua liderana no propunha a separao poltica, alm de defender a Monarquia Portuguesa. Soma:_______ 8. O termo Nativismo utilizado pelos historiadores para designar revoltas ou movimentos de resistncia contra a dominao portuguesa. So movimentos nativistas ocorridos no Brasil: a) Mascates, Emboabas, Revolta de Beckman. b) Guerra dos Brbaros, Mascates. c) Revoluo de 1817, Confederao do Equador. d) Revoluo Praieira, Canudos, Quilombo dos Palmares. e) Confederao dos Tamoios, Guerra dos Brbaros.

258

HISTRIA GERAL
261 Egito e Mesopotmia ................................. 261 Egito - aspectos econmicos e sociais ............ 261 Aspectos polticos ...................................... 261 Exerccios ..................................................... 262

01

INTODUO A HISTRIA

pg

263 Aspectos econmicos e sociais .............. 263 Aspectos polticos ...................................... 263 Exerccios ..................................................... 264 267 Atenas ........................................................... 267 Reformadores ................................................ 267 Perodo clssico ......................................... 267 Perodo helenstico .................................... 268 Aspectos culturais da grcia antiga ............................................ 268 Exerccios ..................................................... 268 272 Os Triunviratos ........................................... 272 Imprio ........................................................... 273 Cristianismo ............................................... 273 A crise do imprio romano ..................... 273 Aspectos culturais ..................................... 273 Exerccios ..................................................... 273 Gabaritos ..................................................... 275

02 04

MESOPOTMIA

pg

GRCIA II

pg

265 Aspectos geogrficos ................................ 265 Esparta ........................................................... 265 Exerccios ..................................................... 265

03

GRCIA I

pg

270 Realeza ......................................................... 270 Repblica ........................................................ 270 Lutas Sociais ............................................... 270 Expanso territorial .................................. 270 As crises da repblica .............................. 270 Exerccios ..................................................... 270

05

ROMA I

pg

06

ROMA II

pg

INTODUO A HISTRIA

UNIDADE 1 INTODUO A HISTRIA


Antiguidade Oriental - Egito e Mesopotmia

INTRODUO
Assim como na matemtica, determinados conhecimentos bsicos so necessrios para a melhor compreenso dos eventos histricos. Apresentaremos de maneira sinttica alguns desses conhecimentos: A linha do tempo e suas divises (a.C, d.C, idade antiga, medieval, moderna e contempornea). Datao dos sculos em algarismos romanos (I, V, X um, cinco e dez, respectivamente). Conhecimentos geogrficos bsicos (localizao dos continentes, tal como dos oceanos e do mar mediterrneo). Conhecimento de determinados conceitos polticos e econmicos (sero trabalhados no decorrer do curso). Devido s mudanas do vestibular da UEL, comearemos nossos estudos a partir da antiguidade oriental, em que tentaremos compreender os aspectos essenciais de duas civilizaes, a saber, a egpcia e a mesopotmica.

EGITO - ASPECTOS ECONMICOS E SOCIAIS


Essa civilizao se desenvolveu ao longo do rio Nilo e foi totalmente dependente deste, e de suas cheias regulares que permitiram que a agricultura se tornasse sua principal atividade. A comodidade que a regio proporcionava devido facilidade de plantio e colheita facilitaram a formao dos Nomos comunidades autnomas que com o decorrer do tempo ocasionou o crescimento da populao. Com isso surgiu a necessidade de melhorar as tcnicas de irrigao com as construes de grandes obras hidrulicas. Sua economia foi praticamente auto-suficiente, no havendo crescimento da produo artesanal para trocas nem a monetarizao da economia. A sociedade esteve dividida em camadas estratificadas, marcadas pelo imobilismo. No topo estavam o fara e sua famlia, abaixo vinham os sacerdotes, altos burocratas e aristocratas, em seguida ficavam os militares e escribas, depois os artesos e comerciantes e na base os camponeses e escravos. Sua religio era politesta e antropozoomfica. Criam na vida aps a morte e desenvolveram a tcnica de mumificao de cadveres.

EGITO E MESOPOTMIA
Tanto a sociedade egpcia como a mesopotmica, foram civilizaes do mdio oriente e desenvolveram-se na regio do Crescente frtil. Constituram-se em civilizaes hidrulicas, ou seja, dependentes das guas dos rios s suas voltas. Ambas constituram Estados despticos e burocratizados, de carter teocrtico e impuseram s suas populaes o trabalho compulsrio e coletivo. O modo de produo predominante foi o asitico.

ASPECTOS POLTICOS
Para efeitos didticos a histria poltica do antigo Egito est dividida em trs perodos: Antigo Imprio (3200 2300 a.C) Mdio Imprio (2000 1750 a.C) Novo Imprio (1580 662 a.C) O Antigo Imprio foi o perodo de consolidao de um Estado monrquico, desptico, altamente burocratizado de carter teocrtico. O poder central se fortaleceu possibilitando uma estabilidade poltica. Por volta de 2300 a.C essa estabilidade foi abalada pelo fortalecimento dos Nomarcas (chefes dos nomos) que passaram a lutar por autonomia frente ao governo. O Mdio Imprio tem incio com a recuperao do poder pelo fara em 2000 a.C e a volta da centralizao poltica que s a ser abalada novamente por volta de 1800 a.C com a invaso

261

HISTRIA GERAL
do territrio por parte dos hebreus e hicsos, que assumiram o controle da regio por aproximadamente dois sculos. O Novo Imprio comea em 1580 a.C quando acontece a expulso dos hicsos do territrio e a escravizao dos hebreus. Foi o apogeu da civilizao egpcia.

INTODUO A HISTRIA
4. Os Estados Teocrticos da Mesopotmia e do Egito evoluram acumulando caractersticas comuns e peculiaridades culturais. Os Egpcios desenvolveram a prtica de embalsamar o corpo humano porque: a) Se opunham ao politesmo dominante na poca. b) Os seus deuses, sempre prontos para castigar os pecadores, desencadearam o dilvio. c) Depois da morte a alma podia voltar ao corpo mumificado; d) Construram tmulos, em forma de pirmides truncadas, erigidos para a eternidade. e) Os camponeses constituam categoria social inferior. 5. (FAC. MED. AMIN) "Salve, Nilo (...) regas a terra em toda parte, deus dos gros, senhor dos peixes, produtor do trigo e da cevada (...) Logo tuas guas se erguem (...) todo ventre se agita, o dorso sacudido de alegria e os dentes rangem." O trecho acima celebra: a) O Egito, regio quente e seca como o Saara; b) A crena numa vida de alm-tmulo e as dores do parto; c) O relativo isolamento do vale, limitado pelos desertos da Arbia e da Lbia; d) As nascentes desconhecidas do Rio Nilo; e) O poder criador do regime das cheias e das vazantes do rio Nilo, que deixaram no solo um logo de grande fertilidade. 6. (Ufrs) A chamada Revoluo Urbana foi antecedida pelos avanos verificados no perodo neoltico, a saber, a sedentarizao das comunidades humanas, a domesticao de animais e o surgimento da agricultura. Porm, h cerca de cinco mil anos ocorreram novos avanos, quase simultaneamente, em pelo menos duas regies do Oriente Prximo: na Mesopotmia e no Egito. Assinale a nica alternativa que NO corresponde a transformaes ocorridas nesse perodo. a) Diversificao social: ocorreu o surgimento de uma elite social composta por sacerdotes, prncipes e escribas, diretamente ligada ao poder poltico e afastada da tarefa primria de produzir alimentos. b) Expanso populacional: verificou-se o surgimento de grandes cidades, densamente povoadas, especialmente na regio mesopotmica. c) Desenvolvimento econmico: a economia deixou de estar baseada somente na produo auto-suficiente de alimentos para basear-se na manufatura especializada e no comrcio externo de matrias-primas ou de manufaturados. d) Descentralizao poltico-econmica: o controle econmico passou a ser feito pelos poderes locais, sediados nas comunidades aldes, que funcionavam como centros de redistribuio da produo. e) Surgimento da escrita: foi uma decorrncia do aumento da complexidade contbil. Serviu inicialmente para controlar as atividades econmicas dos templos e palcios, mas depois teve profundas implicaes culturais, como o surgimento da literatura.

EXERCCIOS
1. (UCS-RS) Assinale a alternativa que completa CORRETAMENTE as lacunas. As antigas civilizaes orientais caracterizavam-se pelo predomnio das concepes polticas _______________ e pelo carter majoritariamente ___________ de suas crenas religiosas. a) Teocrticas monotesta. b) Democrticas politesta. c) Teocrticas politesta. d) Democrticas monotesta. e) Coletivistas racionalista. 2. A respeito da civilizao egpcia, considere as seguintes afirmaes: I. O grande nmero de escravos originou-se das conquistas militares, pois os cativos eram, geralmente, os prisioneiros de guerra. II. A principal atividade econmica era a agricultura, que necessitava da aplicao de sistemas de irrigao e drenagem do solo. III. O excedente de produo obtido pela arrecadao de impostos concentrou-se nas mos da classe dirigente. IV. No havia relao entre poltica e religio, sendo que as atividades do governo eram distintas das atividades religiosas. Pode-se considerar que: a) As afirmaes I, II e III so corretas. b) Somente a afirmao II correta. c) As afirmaes I, II e IV so corretas. d) Somente a afirmao III correta. e) Todas as afirmaes so corretas. 3. A respeito das sociedades que, na Antiguidade, habitavam os vales dos rios Nilo, Tigre e Eufrates, incorreto afirmar que elas: a) Desenvolveram uma estrutura poltica fortemente baseada na religio. b) Eram povos que formaram diversas cidades, as quais organizavam e controlavam a produo de cereais. c) Possibilitaram a formao do Estado a partir da produo de excedentes, da necessidade de controle hidrulico e da diferenciao social. d) Possuam exrcitos que viabilizaram a formao de grandes imprios. e) Desenvolveram um intenso comrcio martimo, que favoreceu a constituio de grandes civilizaes hidrulicas.

262

HISTRIA GERAL
7. (FAAP) A Astronomia e a Matemtica foram os primeiros ramos da cincia que ocuparam a ateno dos egpcios. Ambas se desenvolveram com fins prticos. Cite dois resultados para os quais essas cincias deram sua contribuio. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Explique por que as cheias que ocorriam de junho a setembro no Egito, eram esperadas com ansiedade pelos egpcios. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

MESOPOTMIA
a adotarem o conceito de moeda. No acreditavam na vida aps a morte. Em contrapartida, muitas so as semelhanas dessa sociedade com a egpcia. Seu modo de produo foi o asitico baseado na agricultura de regadio e na servido coletiva. O Estado era o controlador dos meios de produo bem como das construes das obras hidrulicas. A sociedade era estratificada e sem mobilidade estando os reis, nobres e sacerdotes no topo, seguidos dos militares e altos funcionrios, em seguida estavam os comerciantes e arteso, aps estes vinham os camponeses e na base encontravam-se os escravos (quase sempre prisioneiros de guerra; nunca foram a base da economia).

ASPECTOS POLTICOS
Para efeitos didticos a histria poltica da mesopotmia est dividida em quatro perodos de dominao: Sumrios e Acdios (antes de 2000 a.C) Primeiro Imprio Babilnico (1800 1600 a.C) Imprio Assrio (1300 612 a.C) Imprio Caldeu ou 2 Imprio Babilnico (612 539 a.C) Os sumrios foram os primeiros a ocuparem a regio. Constituram uma forma de governo baseada na religio. Seu governante era a representao dos deuses na terra diferente do Egito, em que o fara era considerado como deus. Desenvolveram a primeira forma de escrita que se tem conhecimento, a escrita cuneiforme. As lutas entre suas cidades-estado causaram o enfraquecimento do poder central permitindo a penetrao e dominao acdia que estabeleceu o primeiro imprio na regio. Porm no conseguiu estabelecer uma estabilidade poltica vindo a desaparecer por volta de 2100 a.C. Por volta de 1800 a.C o rei da Babilnia, Hamurbi, conseguiu impor seu domnio por toda a regio dando origem ao primeiro Imprio Babilnico. O perodo foi marcado por uma forte estrutura militar e por um complexo aparato jurdico, que tem como elemento mais conhecido, o cdigo de Hamurbi olho por olho, dente por dente. Com a morte de Hamurbi, acontece a desestruturao do imprio dando origem a uma srie de rebelies internas deixando a regio vulnervel invases. Em 1300 a.C um povo que j habitava a regio, os assrios, estabeleceram seu domnio sobre ela. Criaram uma forte estrutura militarista e investiram na expanso territorial. Procurando uma sada para o Golfo Prsico e para o mar Mediterrneo conquistaram: A Mesopotmia; a Sria-Palestina e o Egito. A decadncia do Imprio Assrio acontece aps a morte do rei Assurbanipal que deu origem a uma generalizada rebelio dos povos submetidos. Com o colapso do Imprio assrio, os caldeus povo de origem semita tomaram o poder, fazendo da Babilnia a capital do Imprio. Foi um perodo marcado por grandes realizaes, como Os jardins suspensos da Babilnia, com o objetivo de expanso das terras agrcolas. Seu principal soberano foi o rei Nabucodonosor. Quando da sua morte, o imprio foi destrudo e a regio dominada pelos persas.

UNIDADE 2 MESOPOTMIA
ASPECTOS ECONMICOS E SOCIAIS
Localizada entre os rios Tigre e Eufrates na regio do atual Iraque, a Mesopotmia necessitou de tcnicas de irrigao bem antes que o Egito, pois as cheias desses rios no so regulares, como as cheias do rio Nilo. Isso explica o motivo de seu desenvolvimento ter ocorrido de forma acentuada com relao ao Egito. Suas obras hidrulicas tiveram que ser complexas, o que exigiu grande controle sobre a mo-de-obra explorada. Diferentemente do Egito, a Mesopotmia estava em uma localidade vulnervel penetrao externa, o que levou a sociedade a investir na produo de armas no intuito de se defenderam das invases. Isso possibilitou a formao de exrcitos profissionais e uma sociedade mais belicista que a egpcia. Foi sempre dependente do comrcio externo, pois em todo territrio havia poucos minrios, pedras e madeiras. Teve um forte investimento na produo artesanal j que necessitavam de algo que servisse como moeda de troca. Houve a monetarizao da economia, foram os primeiros

263

HISTRIA GERAL

MESOPOTMIA
e) O Direito Romano, sujeito a novas interpretaes, tornou-se parte importante do Cdigo de Justiniano, influenciou juristas da Idade Mdia e at das fases histricas subsequentes. 5. (Fuvest-SP) A escrita cuneiforme dos mesopotmicos, utilizada principalmente em seus documentos religiosos e civis, era a) Semelhante em seu desenho escrita dos egpcios. b) Composta exclusivamente de sinais lineares e traos verticais. c) Uma representao figurada evocando a coisa ou o ser. d) Baseada em grupamentos de letras formando slabas. e) Uma tentativa de representar os fonemas por meio de sinais. 6. (EFCA-MG) A mais antiga coleo de normas penais econmicas e civis passou Histria da Mesopotmia com o nome de: a) Cdigo de Hamurbi. b) Alcoro. c) Cdigo de Drkon. d) Lei das Doze Tbuas. e) Cdigo de Justiniano. 7. (UEG) O primeiro cdigo de leis que se tem conhecimento foi estabelecido pelos babilnicos por volta de XVIII a.C. Quais os princpios fundamentais do chamado Cdigo de Hamurbi? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Explique a importncia dos rios Tigre e Eufrates para o desenvolvimento econmico-social das civilizaes mesopotmicas. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

EXERCCIOS
1. Em relao a civilizao egpcia, correto fazer a seguinte afirmao: a) A economia foi, durante toda a antiguidade, baseada na coleta e na caa. b) Os trabalhadores, na sua maioria, eram homens livres que cultivavam a prpria terra. c) A existncia do monotesmo facilitava o controle do Fara pelos sacerdotes. d) A escrita cuneiforme nasceu em funo das necessidades prticas da contabilidade dos templos. e) O poder manifestava-se pelo exerccio de uma administrao centralizada que controlava todos os aspectos da vida egpcia. 2. A agricultura na mesopotmia, das mais importantes da antiguidade, caracterizava-se: a) Pelo ritmo da produo em funo das cheias do Rio Nilo. b) Pelo emprego do trabalho animal, especialmente do cavalo e do camelo. c) Pelo uso de uma tecnologia mais sofisticada, com emprego de adubos minerais. d) Pelo alto ndice pluviomtrico, que favorecia constantemente as colheitas. e) Pela fertilidade do solo associada qualidade da mo de obra. 3. A regio da Mesopotmia ocupa lugar central na histria da humanidade. Na Antiguidade, foi bero da civilizao sumeriana devido ao fato de: a) Ser ponto de confluncia de rotas comerciais de povos de diversas culturas. b) Ter um subsolo rico em minrios, possibilitando o salto tecnolgico da idade da pedra para a idade dos metais. c) Apresentar um relevo peculiar e favorvel ao isolamento necessrio para o crescimento socioeconmico. d) Possuir uma rea agriculturvel extensa, favorecida pelos rios Tigre e Eufrates. e) Abrigar um sistema hidrogrfico ideal para locomoo de pessoas e apropriado para desenvolvimento comercial. 4. (Unesp) certo que as civilizaes da Antiguidade legaram posteridade um respeitvel acervo cultural. No entanto, para superar equvoco, assinale a alternativa INCORRETA: a) A pintura egpcia revela belos exemplos de descrio de movimento, sendo a figura humana representada com a cabea e os ps de perfil. b) Entre as Civilizaes Mesopotmicas que se desenvolveram no vale dos rios Tigre e Eufrates, predominou, durante certo tempo, a forma asitica de produo. c) No perodo denominado Homrico, houve a dissoluo das comunidades gentlicas e a formao gradativa das Cidades-Estado da Grcia. d) A escrita egpcia era em caracteres cuneiformes.

264

ANTIGUIDADE CLSSICA: O MUNDO GRECO-ROMANO GRCIA I

UNIDADE 3 ANTIGUIDADE CLSSICA: O MUNDO GRECO-ROMANO GRCIA I


Em Antiguidade clssica estudaremos duas civilizaes que se desenvolveram na Europa antiga: os gregos e romanos. Esses dois povos desempenharam um papel fundamental na Antiguidade, e sua influncia foi profunda na formao dos valores da civilizao ocidental.

PERODO ARCAICO (sculos VIII a.C a VI a.C)

O perodo arcaico marcado pelo desenvolvimento da vida urbana na Grcia. Sabe-se que existiam mais de trezentas delas, mas para o nosso estudo ser importante apenas duas: Esparta e Atenas. Elas correspondem a dois modelos distintos de organizao poltica, o que mostra a descentralizao do poder na Grcia.

ESPARTA
Esparta, ou Lacedemnia, estava localizada na regio do Peloponeso, na plancie da Lacnia. Foi fundada pelos drios, tribo de carter essencialmente guerreira, o que solidificou em Esparta uma estrutura essencialmente militarista. Devido ao seu militarismo, Esparta veio a se desenvolver de forma peculiar e distinta das demais plis gregas. A poltica espartana era oligrquica, ou seja, apenas a elite (minoria da populao) tinha acesso ao poder. Essa organizao baseava-se num cdigo atribudo a Licurgo, sendo o smbolo da tradio e preservado pela elite. A estrutura social de Esparta estava dividida em: Espartanos: elite que possua acesso ao poder e que possua terras - aristocracia; Periecos: nativos / pobres que viviam do artesanato e do comrcio, atividades pouco valorizadas; Hilotas: servos pertencentes ao Estado. Trabalhavam nas terras da elite). importante destacar que a educao espartana era voltada para a formao de soldados, visando sempre o aprimoramento fsico e militar. Desde pequenos, os meninos eram submetidos a uma srie de situaes de perigo, para que assim se acostumassem com o estilo de vida militar que enfrentariam posteriormente.

ASPECTOS GEOGRFICOS
A Grcia antiga abrangia o Sul da Pennsula Balcnica, dividindo-se em: Grcia Continental (norte); Grcia Peninsular (sul); Grcia Insular (ilhas do mar Egeu e mar Jnio) e a Magna Grcia (territrio colonial). A histria da Grcia encontra-se dividida em cinco perodos:

PERODO PR-HOMRICO (cerca de 2000 a 1200 a.C)

Tambm chamado de Grcia Primitiva, parte do perodo anterior formao do povo grego. o perodo em que ocorre o contato entre a cultura cretense, que possua um grande desenvolvimento comercial, e os povos que habitavam a Grcia continental. Este contanto foi muito importante na formao da cultura grega. Com a chegada de povos nmades indo-europeus (aqueus, jnios, elios e drios), que vinham do norte e ocupavam a Grcia paulatinamente, temos o incio da formao do povo grego.

Por volta de 1200 a.C a Grcia continental sofre a invaso dos drios, tribo nmade indo-europia, que ocupou a regio de maneira violenta. Devido a essa ocupao, muitos fugiram para outras regies, esse acontecimento ficou conhecido como a primeira dispora grega. A populao apresentava um modo primitivo de vida. A organizao se dava em pequenas comunidades: os genos, que eram compostos por indivduos descendentes de um mesmo antepassado. A base econmica era a produo agrria domstica, as terras eram coletivas e os membros desta organizao, que moravam juntos, obedeciam a um chefe, denominado pter. Devido ao crescimento da populao, as melhores terras foram doadas aos parentes mais prximos do pter. Assim, houve a formao de uma aristocracia fundiria: a elite proprietria de terras. Essa diviso desigual das terras deu origem a lutas que visavam a posse das terras, culminando na desintegrao dos genos, que formaram as frtrias, as tribos e, por fim, as cidadesestado. Muitos abandonaram a Grcia, colonizando outras regies do Mediterrneo: foi a segunda dispora grega. Cada cidade-estado ou plis apresentava autonomia e governo prprio. Tinham certos elementos caractersticos: a Acrpole (parte alta onde localizava-se o templo religioso); gora (parte central, onde ocorriam discusses polticas). Neste perodo ocorre a estruturao da vida urbana.

PERODO HOMRICO (sculos XII a.C a VIII a.C)

EXERCCIOS
1. A navegao e o comrcio martimo foram desenvolvidos pelos gregos. Dentre os vrios fatores que os levaram a isso, podemos citar, como causa inicial: a) A pobreza do solo grego e a necessidade de novas terras para suprir suas necessidades. b) O desejo de difundir a cultura grega. c) O fato de serem constantemente molestados por povos brbaros. d) O seu amplo conhecimento geogrfico e martimo que despertava em seu povo a busca do desconhecido. e) O fato de os mercadores gregos precisarem de novos mercados consumidores. 2. (FATEC) "A cidade-estado era um objeto mais digno de devoo do que os deuses do Olimpo, feitos imagem de brbaros humanos. A personalidade humana, quando emancipada, sofre se no encontra um objeto mais ou menos digno de sua devoo, fora de si mesma." Na antiguidade clssica, as cidades-estados representavam:

265

HISTRIA GERAL
a) Uma forma de garantir territorialmente a participao ampla da populao na vida poltica grega. b) Um recurso de expanso das colnias gregas. c) Uma forma de assegurar a independncia poltica das cidades gregas entre si. d) Uma caracterstica da civilizao helenstica no sistema poltico grego. e) Uma instituio poltica helenstica no sistema poltico grego. 3. "Toda a educao tendia a fazer do menino um soldado. Passava o tempo sob as ordens de um monitor, fazendo ginstica e correndo no campo, dormia no cho e era obrigado a roubar uma parte do que necessitava para viver. Cidado aos trinta anos, permanecia arregimentado. noite jantava com os que deviam ser, na guerra, os seus companheiros de tenda." O texto refere-se aos a) Fencios. b) Espartanos. c) Romanos. d) Atenienses. e) Macednios.

ANTIGUIDADE CLSSICA: O MUNDO GRECO-ROMANO GRCIA I


Esta ideologia foi produzida na(o): a) Perodo Homrico e manifesta o pensamento burgus em relao a todas as classes sociais. b) Imprio Romano e apresenta resqucios nas discriminaes tnicas vigentes nos Estados Unidos da Amrica. c) Antiga Grcia e reflete o preconceito - em relao s atividades manuais - tambm presente ao longo da histria da sociedade brasileira. d) Perodo Arcaico, em Atenas, quando era necessrio estabelecer legitimaes para as expanses colonialistas modernas. e) Idade Antiga, mas foi eliminada, aps a Revoluo Francesa, pela filosofia liberal. 6. FATEC 2008 "Vivemos sob uma forma de governo que no se baseia nas instituies de nossos vizinhos; ao contrrio, servimos de modelo a alguns ao invs de imitar outros. Seu nome democracia, pois a administrao serve aos interesses da maioria e no de uma minoria."
(Tucdides, "Histria da Guerra do Peloponeso". Texto adaptado.)

4. As afirmativas a seguir esto relacionadas com os povos gregos na antiguidade. I. Os atenienses criaram a democracia como forma de governo. Dessa prtica poltica, estavam excludos de participao as mulheres, os estrangeiros e os escravos. II. Os atenienses construram no sculo V a.C. um vasto imprio que controlava a Grcia, o Egito, a Palestina e a Babilnia. III. A cidade de Esparta tinha uma estrutura social rgida e dividia-se em: espartanos, classe privilegiada; os periecos, que se dedicavam ao comrcio e os hilotas, pessoas que assumiam a funo de servos. IV. Os atenienses, durante as Guerras Mdicas, venceram os espartanos e, em seguida, fizeram a unificao de todas as cidades-estado gregas. Esto corretas as afirmativas da alternativa: a) I e III d) II e III b) I, III e IV e) I e II c) III e IV 5. "A natureza faz o corpo do escravo e do homem livre diferentes. O escravo tem corpo forte, adaptado para a atividade servil, o homem livre tem corpo ereto, inadequado para tais trabalhos, porm apto para a vida do cidado. Na cidade bem constituda, os cidados devem viver executando trabalhos braais (artesos) ou fazendo negcios (comerciantes). Estes tipos de vida so ignbeis e incompatveis com as qualidades morais. Tampouco devem ser agricultores os aspirantes cidadania. Isso porque o cio indispensvel ao desenvolvimento das qualidades morais e prtica das atividades polticas."
(ARISTTELES (384-322 a. C.). "Poltica" [Adapt.].)

O trecho acima faz parte do discurso feito por Pricles em homenagem aos atenienses mortos na guerra do Peloponeso. Por esse discurso CORRETO afirmar que: a) A guerra do Peloponeso foi injusta e trouxe muitas mortes tanto para os atenienses como para os espartanos, que lutavam em lados opostos pela hegemonia da Grcia. b) Pricles se orgulhava da cidade de Atenas por ser ela uma cidade democrtica, que no imitava o sistema poltico de outras cidades-Estado, mas era imitada por elas. c) Atenas e Esparta possuam o mesmo sistema poltico descrito por Pricles, a democracia, mas divergiam sobre como implant-lo nas demais cidades- Estado gregas. d) Atenas, por no partilhar do sistema poltico democrtico de Esparta, criou a Liga de Delos e declarou Guerra Liga do Peloponeso. e) Esparta era a nica cidade-Estado democrtica em toda a Grcia antiga e desejava implantar esse sistema nas cidadesEstado gregas. 7. (Unicamp) A poca Arcaica (sculos VIII-VI a.C.) talvez o perodo mais importante da histria grega. O perodo arcaico trouxe consigo inovaes capitais em todos os domnios. A novidade maior o desenvolvimento da polis (cidade-estado grega) cuja caracterstica essencial a unificao entre cidade e campo. Outras conquistas da poca arcaica foram o aparecimento da noo de cidado e a codificao das leis, que limitavam os poderes arbitrrios dos poderosos, a justia torna-se, portanto, um negcio pblico.
(Adaptado de M. Austin e R. Vidal-Naquet, Economia e sociedade na Grcia antiga.)

266

HISTRIA GERAL
a) Cite trs caractersticas da polis grega. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Por que a codificao das leis foi uma etapa importante na formao da polis? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Comente a especificidade da estrutura social espartana, no contexto da cidade-estado grega clssica. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

GRCIA-II
Quando os aristocratas acabaram com a autoridade do basileus, Atenas conheceu o regime oligrquico. Na Oligarquia, o Arepago, se fortalece substituindo o poder do rei. Assim os euptridas se consolidam no poder, passando a governar em benefcio de sua classe social. Neste perodo, devido ao avano comercial e o consequente enriquecimento pelo comrcio, Atenas sofre transformaes em seu governo e na sua sociedade. As lutas entre as classes sociais, a instabilidade, o crescimento da polis juntamente com o desenvolvimento do comrcio so apontados como os principais fatores que desencadearam estas reformas.

REFORMADORES
Drcon: estabeleceu as primeiras leis escritas, organizando as antigas leis orais, transferindo a justia para o Estado. Slon: proporciona o fim da escravido por dvidas. Implanta uma plutocracia (diviso do poder baseada na riqueza dos cidados). Com a continuidade dos descontentamentos polticos, bem como as conturbaes sociais, Atenas conhece o regime da Tirania , quando os tiranos Psstrato, Hipias e Hiparco tomaram o poder pela fora. Mas, com Clstenes, no ano de 510 a.C. que Atenas finalmente conhece a Democracia, pondo fim ditadura. Clstenes, o pai da democracia, dividiu a tica em 100 demos, dando origem h 10 tribos. Estas, por sua vez forneciam membros para formar o Conselho dos 500 (Bul). Este Conselho, juntamente com a Assemblia Popular (Eclsia) tinham em mos o poder legislativo. A Eclsia tinha tambm o poder de votar o ostracismo (exlio de 10 anos) contra todos aqueles que pusessem a democracia ateniense em perigo. Somente participavam da democracia os cidados (homens, maiores de 18 anos, filhos de pais atenienses). Mulheres, crianas, metecos e escravos no eram considerados cidados.

UNIDADE 4 GRCIA II
ATENAS
Atenas, localizada na regio da tica, teve como habitantes primitivos os jnios e aqueus. Devido a uma grande atividade scio-cultural, a poltica ateniense foi marcada por perodos de evoluo estrutural e institucional. Atenas conservou a Monarquia por muito tempo. O poder era exercido pelo Basileus (rei), havia ainda um conselho de nobres (Arepago) que, de certa maneira, servia para limitar o poder do rei. Foi neste perodo que ocorreu a clssica diviso social desta cidade-estado: Euptridas (aristocratas) Demos (povo) Metecos (estrangeiros) Escravos (dvidas)

PERODO CLSSICO
Este perodo foi marcado pelo imperialismo, cultura e democracia ateniense. Mas enquanto Atenas estava fortalecendo suas estruturas democrticas, o Imprio Persa expandia-se pelo oriente e tambm para o oeste. A disputa poltico-econmica pelo controle do comrcio martimo no mar Egeu entre gregos e persas desencadearam as Guerras Mdicas (490 479 a.C.). Em meio guerra, Atenas forjou uma unio militar jamais vista, at ento, dentro da Grcia: a Confederao de Delos. Cada cidade-estado deveria enviar navios ou dinheiro para a ilha de Delos. Com a participao de quase todas as cidades (polis) gregas, esta aliana militar, sob o comando de Atenas, tomou definitivamente a ofensiva contra os persas. Aps as Guerras Mdicas, com a vitria grega, Atenas passou a ser a cidade-estado mais importante exercendo grande domnio e influncia sobre as demais. Este perodo passou a ser considerado sculo de ouro de Atenas. Governada por Pricles, que consolidou a democracia ateniense, graas s reformas implantadas, a cidade de Atenas conheceu o seu auge poltico, econmico e cultural.

267

HISTRIA GERAL
Mas como a democracia ateniense dependia do imperialismo, do intenso comrcio e dos tributos cobrados das outras plis, muitas cidades, que haviam permanecido oligrquicas, representada principalmente por Esparta, opunham-se ao expansionismo de Atenas dentro da Grcia. Assim, logo Esparta organizou sua prpria confederao: a Liga do Peloponeso. Diante desse quadro, ficou inevitvel o choque das duas principais plis gregas. Devido rivalidade existente entre as duas cidades-estado, Esparta liderando a Liga do Peloponeso declara guerra ao imperialismo ateniense. Iniciase, ento, a Guerra do Peloponeso (431 404 a.C.). Motivos polticos e econmicos causaram esta guerra, resultando na vitria militar de Esparta.

GRCIA-II
Mas o conhecimento dos gregos no se limitou a filosofia: na medicina, Hipcrates, o pai da Medicina, apresentou um comportamento cientfico, admitindo causas naturais para as doenas. Os gregos tambm foram os primeiros a tratar a Histria com esprito cientfico, separando as lendas dos fatos. Destaque para Herdoto, o Pai da Histria, que foi o historiador das Guerras Mdicas, e Tucdides, que escreveu a Histria da Guerra do Peloponeso. Na arquitetura destacam-se os trs estilos: o drico (mais simples e antigo); jnico: (adornos em espiral no capitel); corntio (capitel mais rebuscado). Na escultura grega, as grandes caractersticas eram a naturalidade, a harmonia das formas e a viso idealista do homem. Fdias trabalhou na decorao do Prtenon, o mais famoso templo grego.

PERODO HELENSTICO
Enquanto as cidades gregas entravam em decadncia, provocada pelas contnuas guerras e disputas entre si, os macednios estavam se fortalecendo, iniciando uma rpida expanso atravs de guerras de conquista. Aproveitando-se desse enfraquecimento, gerado pela disputa interna entre as cidadesestado, Felipe II, rei da Macednia, estabelece seu domnio sobre os gregos vencendo-os na Batalha de Queronia (388 a.C.). Mas seu filho, Alexandre Magno (o Grande), que inicia as conquistas rumo ao Oriente, ampliando as fronteiras do Imprio Macednio. Do contato entre as culturas grega e oriental surge a Civilizao Helenstica.

EXERCCIOS
1. (UEL) "Foi na Grcia de Homero que surgiu uma maneira at ento desconhecida de fazer poltica: o rei deixou de ser onipotente e seu poder foi paulatinamente partilhado e disputado entre os cidados. Era o incio de um fenmeno que se consolidaria a partir do sculo 6 a.C., na Atenas de Slon e Clstenes, e que se tornaria um dos fundamentos da civilizao ocidental: a democracia." (Entrevista com Jean Pierre
Vernant. Folha de S. Paulo, 31 out. 1999. Caderno Mais!, p. 4.)

Com base no trecho da entrevista e nos conhecimentos sobre o tema, assinale a alternativa CORRETA. a) A afirmao de que o "poder foi paulatinamente partilhado e disputado entre os cidados" considera que na democracia grega todos os habitantes podiam eleger e ser eleitos para cargos polticos. b) A democracia grega foi um fenmeno isolado e, por isso, no teve influncia significativa nos rumos da poltica na civilizao ocidental. c) Os gregos desconheciam, at o governo de Slon e Clstenes, no sculo 6 a.C., qualquer forma de fazer poltica. d) A "maneira at ento desconhecida de fazer poltica", a que o texto se refere, a democracia grega, que permitiu aos cidados participarem das questes relativas coletividade. e) Na democracia grega, que se consolidou a partir do sculo 6 a.C., o rei detinha o poder absoluto, decidindo sobre todas as questes pblicas. 2. Sobre o perodo clssico e helenstico, analise as proposies a seguir: I. O perodo clssico foi marcado pela absoluta paz, j que a democracia ateniense tinha alcanado seu auge. II. As guerras mdicas e principalmente a do Peloponeso fragilizaram as plis gregas, que acabara sendo conquistadas pelos macednios.

Toynbee, Arnold J. HELENISMO, HISTRIA DE UMA CIVILIZAO)

ASPECTOS CULTURAIS DA GRCIA ANTIGA


A religio grega era politesta e antropomrfica, uma vez que, os deuses possuam formas e caractersticas humanas (fraquezas, paixes, virtudes, etc...). As principais divindades eram: Zeus, deus dos deuses; Hera, deusa do matrimnio; Atena, deusa da sabedoria; Afrodite, deusa do amor e da beleza; Poseidon, deus do mar; Ares, deus da guerra; entre outros. O teatro grego era dividido em tragdia e comdia. Acessvel praticamente a toda populao, foi de grande importncia na educao dos jovens. Na busca de respostas racionais recheadas de um esprito crtico, os pensadores da poca, chamados de filsofos (amantes da sabedoria), construram teoria diversas, destruindo crenas e mitos. A Filosofia uma criao grega que deixou para o Ocidente um universo de leis e princpios regulando a natureza e o pensamento humano.

268

HISTRIA GERAL
III. Alexandre Magno promoveu a fuso entre a cultura grega e oriental, formando a chamada cultura helenstica. IV. As conquistas territoriais de Alexandre foram duradouras, j que aps sua morte o imprio permaneceu unificado. Em relao cultura, os resultados foram efmeros, no tendo influncia nos demais perodos histricos. As alternativas corretas so: a) I e II c) II e IV b) II e III d) I e IV e) III e IV

IGREJA E CULTURA MEDIEVAL


b) A concepo criada pelos gregos do exrcito como uma fora permanente, composta de soldados profissionais. c) As representaes teatrais (tragdias e comdias) surgidas na Grcia no contexto das festividades dionisacas. d) O regime democrtico nascido a partir da experincia poltica caracterstica da cidade grega de Atenas. e) O desenvolvimento, na Grcia, do pensamento filosfico atravs do qual se poderia compreender de forma diferenciada o universo. 6. Leia a frase a seguir. " bom deixar claro que o regime democrtico ateniense tinha os seus limites".
(Pedro Paulo Funari. "Grcia e Roma". So Paulo: Contexto, 2001, p. 36)

3. (UFPE) Na construo da sociedade ocidental, h um destaque, dado por muitos historiadores, aos feitos da civilizao grega, nos setores mais diversos da sua vida. Muitos feitos culturais dos gregos: a) Permanecem atuantes na contemporaneidade, contribuindo para o pensamento ocidental, inclusive na formulao de seus valores estticos e polticos. b) Distanciam-se totalmente dos princpios dos nossos tempos, no sendo retomados pelos pensadores do mundo atual. c) Esto restritos aos tempos da Antigidade clssica, onde predominavam os interesses da aristocracia comercial de Atenas. d) Permanecem na contemporaneidade principalmente no que tange a religio, pois o cristianismo surgiu em Atenas. e) Ficaram restritos s conquistas estticas da arquitetura e dos jogos olmpicos, que se tornaram mundiais. 4. A partir do sculo VIII a.C. as cidades-Estado gregas conheceram um rpido processo de consolidao de suas estruturas internas, e dadas as condies locais, iniciaram o estabelecimento de domnios territoriais em vrias regies do Mediterrneo. O fator determinante para o estabelecimento dessas reas coloniais foi: I. A derrota para os troianos, seguido de um acentuado declnio econmico. II. A busca de recursos minerais e o desenvolvimento de novas tcnicas nuticas. III. A escassez de terras cultivveis e um crescimento populacional significativo. Est(o) correta(s) somente: a) I. c) III. b) II. d) I e II. e) II e III.

Assinale a alternativa que apresenta um grupo que tinha direitos polticos durante a democracia ateniense na Grcia Antiga. a) Crianas. b) Escravos. c) Mulheres. d) Estrangeiros. e) Camponeses. 7. Quais acontecimentos desencadearam as Guerras Mdicas (470-479 a.C.)? E como as cidades-estado gregas se organizaram para esse conflito? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8. Explique as principais diferenas polticas, econmicas e sociais entre Atenas e Esparta durante o Perodo Clssico. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

5. A civilizao grega da Antigidade deixou para outras sociedades um amplo legado que se expressa em vrios campos, como o cultural e o poltico. Das alternativas a seguir assinale aquela que NO corresponde a um legado da Grcia Antiga. a) Os primeiros relatos tidos como histricos foram atribudos a autores gregos como Herdoto e Tucdides.

269

ROMA I

UNIDADE 5 ROMA I
Roma, fundada pelos etruscos, desenvolveu-se na Pennsula Itlica. Sua histria est dividida em trs perodos: Realeza, Repblica e Imprio. A sua origem tambm est vinculada a uma verso lendria, relatada por Tito Lvio em sua Histria de Roma, e reforada na obra Eneida, do poeta romano Virglio. Os primitivos habitantes da regio estavam divididos em tribos: os Italiotas (latinos, sabinos, samnitas); os Etruscos; e tambm os Gregos.

LUTAS SOCIAIS
Os plebeus encontravam-se margem da poltica romana. Como no possuam uma vida ativa na poltica, com frequncia sofriam uma srie de discriminaes. Devido a esta realidade, os plebeus, em sinal de protesto, iniciam uma srie de lutas e reivindicaes sociais. Um dos principais movimentos dos plebeus foi a Revolta do Monte Sagrado (494 a.C.). Os plebeus retiraram-se de Roma, e somente retornaram aps os patrcios atenderem suas reivindicaes, como por exemplo: a libertao de escravos por dvidas; e o direito de eleger representantes (Tribunos da Plebe). Aps outras revoltas e reivindicaes, os plebeus alcanaram novas conquistas, como exemplo, a Lei das XII Tbuas, em 450 a.C. (foi a primeira lei escrita, pblica e comum, garantindo uma uniformizao jurdica ao povo romano);

REALEZA (753 509 a.C)


O poder, durante esta primeira fase, est centrado nas mos do rei. Foi neste perodo em que ocorreu a estratificao social romana. A sociedade estava dividida em: patrcios (aristocracia); clientes (prestavam servios aos patrcios); plebeus (comerciantes, artesos e camponeses).

EXPANSO TERRITORIAL
A expanso de Roma, motivados por uma necessidade de defesa e expanso, deu uma dinmica prpria s estruturas da sociedade romana. Neste contexto ocorreu a Conquista da Pennsula Itlica, em que os romanos dominaram as tribos itlicas. Para ampliar seus domnios territoriais, Roma teve que travar guerras com Cartago (norte da frica) na conquista do Mediterrneo. Foram as famosas Guerras Pnicas. Cartago foi destruda, passando condio de Provncia Romana. Aps a vitria definitiva sobre Cartago, Roma foi anexando vrias regies aos seus domnios e transformou o Mar Mediterrneo no mare nostrum.

REPBLICA (509 27 a.C)


Mais importante perodo histrico de Roma. Esta fase foi marcada pela expanso, transformaes e lutas sociais dentro da sociedade romana. O poder poltico-administrativo durante este perodo estava centrado no Senado, que se tornou o rgo mais importante da Repblica. O Senado controlava toda a administrao, dirigindo a poltica externa e legislativa. Havia tambm as Magistraturas, que auxiliavam o Senado na conduo da vida pblica e administrativa dentro de Roma. Dentre as principais magistraturas destacam-se o Consulado (formado por dois cnsules, eleitos anualmente, que tinham funes administrativas e militares); Ditador (em casos de calamidades, um Ditador era escolhido para administrar com poder ilimitado durante seis meses); Pretores: (ministravam a justia); Questores (encarregados da administrao dos impostos e das finanas); Edis (encarregados da conservao pblica, das festas e dos jogos); Assemblias (Curiata aspectos/assuntos religiosos e Centuriata com a participao de todos os cidados, elegiam os magistrados).

AS CRISES DA REPBLICA
Os irmos Graco (Tibrio e Caio Graco), eleitos Tribunos da Plebe, empenharam-se em realizar reformas para amenizar a dura realidade social dos plebeus. Tibrio aprovou uma lei para realizar a Reforma Agrria, mas sofreu forte oposio e acabou sendo assassinado e com isto, sua lei no foi cumprida. Caio props a Lei Frumentria, que reduzia o preo do trigo populao pobre. Assim como seu irmo, ele tambm sofre oposio, que o leva a cometer suicdio (121 a.C.). Com o agravamento das crises sociais, surgem grandes desentendimentos na poltica, com um perodo de guerra civil, na disputa pelo poder entre os generais Mrio e Sila. Neste contexto inicia-se a decadncia poltica da repblica romana.

EXERCCIOS
1. Leia as afirmativas sobre a Repblica Romana (509-27 a.C.). I. Nos primeiros tempos da Repblica, a sociedade era composta por apenas dois setores: os patrcios e os escravos. II. Os escravos, pouco numerosos no incio da Repblica, cresceram numericamente com as guerras de conquista. III. Entre as funes pblicas em Roma, havia os cnsules, os pretores e os tribunos da plebe.

270

HISTRIA GERAL
IV. Em 494 a.C., plebeus rebelados se retiram para o Monte Sagrado, ameaando fundar outra cidade se no tivessem, entre outras reivindicaes, o direito de eleger seus prprios magistrados. V. Com o expansionismo romano e as suas conquistas territoriais, houve um grupo especialmente beneficiado: os plebeus, que passaram a vender trigo para os povos dominados. So corretas as afirmativas a) I, II e III, apenas. b) II, III e IV, apenas. c) II, III, IV e V, apenas. d) III, IV e V, apenas. e) I, II, III, IV, V.

ROMA I
Com base no texto e nos conhecimentos sobre o tema, pode-se AFIRMAR que a Lei da Reforma Agrria na Roma Antiga a) Proposta pelos irmos Graco, Tibrio e Caio, era uma tentativa de ganhar apoio popular para uma nova eleio de Tribunos da Plebe, pois pretendiam reeleger-se para aqueles cargos. b) Proposta por Tibrio Graco, tinha como verdadeiro objetivo beneficiar os patrcios, ocupantes das terras pblicas que haviam sido conquistadas com a expanso do Imprio. c) Tinha o objetivo de criar uma guerra civil, visto que seria a nica forma de colocar os plebeus numa situao de igualdade com os patrcios, grandes latifundirios. d) Era vista pelos generais do exrcito romano como uma possibilidade de enriquecer, apropriando-se das terras conquistadas e, por isto, tinham um acordo firmado com Tibrio. e) Foi proposta pelos irmos Graco, que viam na distribuio de terras uma forma de superar a crise provocada pelas conquistas do perodo republicano, satisfazendo as necessidades de uma plebe numerosa e empobrecida. 5. Leia atentamente os textos: "Arrio dizia 'rbrica' em vez de rubrica / e por pudico 'pdico' dizia / e achava que falava to incrivelmente / que se podia 'pdico' dizia. / Creio que assim a me, assim o tio liberto, / assim o av materno e a av falavam. / Foi Hispnia e os ouvidos descansaram todos; / as palavras soavam leves, lindas / e tais palavras nunca mais ningum temeu. / Sbito chega a hrrida notcia: / os iberos, depois que Arrio foi para l, / Iberos j no eram, eram 'beros'."
(Gaius Valerius Catullus. Poema 84 (Texto do sculo I a.C.). Traduo potica de Joo ngelo Oliva Neto. In: FUNARI, P.P.A. "Antigidade clssica: a histria e a cultura a partir de documentos". Campinas: Editora da Unicamp, 1995. p.1.)

2. Podemos dizer que antes as coisas do Mediterrneo eram dispersas... Mas como resultado das conquistas romanas como se a histria passasse a ter uma unidade orgnica, pois, as coisas da Itlia e da frica passaram a ser entretecidas com as coisas da sia e da Grcia e o resultado disso tudo aponta para um nico fim. (Polbio, Histria, I.3.) No texto, a conquista romana de todo o Mediterrneo : a) Criticada, por impor aos povos uma nica histria, a ditada pelos vencedores. b) Desqualificada, por suprimir as independncias polticas regionais. c) Defendida, por estabelecer uma nica cultura, a do poder imperial. d) Exaltada, por integrar as histrias particulares em uma nica histria geral. e) Lamentada, por sufocar a autonomia e identidade das culturas. 3. (UEL) A interpretao do valor do trabalho recebeu diferentes respostas ao longo da histria da humanidade. Sobre a concepo de trabalho manual na Antigidade Clssica, correto afirmar: a) Era glorificado, por ser a maneira como o homem se apropria da natureza e a transforma em benefcio prprio. b) Tinha o mesmo valor que a atividade intelectual, por ser expresso de diferentes, mas complementares, aptides do homem. c) Era visto como causador de sofrimento, mas essencial para a garantia do ingresso no reino dos cus. d) Era considerado uma atividade inferior e degradante em comparao atividade contemplativa. e) Era compreendido como o instrumento de libertao do homem, permitindo a ele superar a determinao da natureza. 4. "Os animais da Itlia possuem cada um sua toca, seu abrigo, seu refgio. No entanto, os homens que combatem e morrem pela Itlia esto merc do ar e da luz e nada mais: sem lar, sem casa, erram com suas mulheres e crianas. Os generais mentem aos soldados quando, na hora do combate, os exortam a defender contra o inimigo suas tumbas e seus lugares de culto, pois nenhum destes romanos possui nem altar de famlia, nem sepultura de ancestral. para o luxo e enriquecimento de outrem que combatem e morrem tais pretensos senhores do mundo, que no possuem sequer um torro de terra."
(Plutarco, Tibrio Graco, IX, 4. In: PINSKY, J. "100 Textos de Histria Antiga". So Paulo: Contexto, 1991. p. 20.)

"Mais ou menos na mesma poca, o Senado discutiu o comportamento ofensivo dos ex-escravos. Houve uma argumentao geral no sentido de que os proprietrios tivessem o direito de retirar a liberdade de ex-escravos que no a merecessem. [...] Nero duvidava sobre a deciso [...]. H ex-escravos por toda parte. A maioria dos eleitores est formada por ex-escravos, como tambm ocorre com os assistentes dos magistrados, os auxiliares dos sacerdotes, a patrulha noturna e os bombeiros; a maioria dos eqestres e muitos dos senadores so descendentes de ex-escravos [...]".
(Publius Cornelius Tacitus. Anais (XIII, 26-7) (texto do sculo I d.C.). In: CARDOSO, C. F. "Trabalho compulsrio na Antiguidade". Rio de Janeiro: Graal, 1984. p.140-1.)

De acordo com os textos e com os conhecimentos sobre o tema CORRETO afirmar: a) Iniciou-se neste perodo, de acordo com o dito de Nero, um processo de reformas no latim erudito, visando torn-lo mais acessvel s classes populares em ascenso na sociedade romana, devido ao desenvolvimento comercial.

271

HISTRIA GERAL
b) A ausncia de transformaes sociais em Roma fez com que o Senado desejasse retirar a liberdade de ex-escravos, pois estes, sendo to numerosos, impediam o desenvolvimento comercial e fabril. c) Embora os ex-escravos fossem motivo de chacota para muitos membros da elite romana, Nero deveria promover uma reforma poltica, ampliando os direitos econmicos das classes pobres que se agitavam em razo da escassez de gneros alimentcios. d) As transformaes sociais expressas pela linguagem dos referidos autores demonstram que o latim perdeu a fora unificadora do Imprio, dando lugar s lnguas locais como o portugus, o espanhol, o italiano e o francs. e) Processava-se uma ruptura na sociedade romana, pois os ex-escravos, motivo de zombaria das elites, com o passar do tempo tornaram-se numerosos, tendo ascendido at as mais elevadas categorias sociais. 6. As lutas sociais, na Roma Republicana (509 a.C. a 27 a.C.), foram protagonizadas entre Patrcios e Plebeus, nas quais os ltimos buscavam seus direitos sociais e polticos. Foi fato que marcou estas lutas: a) As Guerras Mdicas b) A Guerra do Peloponeso c) A Criao do Colonato d) A Guerra Pnica e) A retirada para o monte sagrado 7. "Augusto conquistou os soldados com presentes, o povo com po barato, e todos os homens com os frutos da paz. Assim tornou-se progressivamente mais poderoso, congregando em si as funes do Senado, dos magistrados e das leis."
(Tcito, Anais 1.2, MOSES HADAS, ED., THE COMPLETE WORKS OF TACITUS, NEW YORK, RANDOM HOUSE, 1942, p. 3).

ROMA II
a) Compare a escravido na Roma Antiga e na Amrica Colonial, identificando suas diferenas. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ b) Quais foram as formas de resistncia escrava nesses dois perodos? _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________

UNIDADE 6 ROMA II
OS TRIUNVIRATOS
No ano 60 a.C., o Senado elegeu trs fortes lderes polticos ao Consulado, para administrarem juntos os domnios romanos. Foi o primeiro Triunvirato, formado por Jlio Csar, Pompeu e Crasso, que para governar o mundo romano fazem um acordo e dividem o poder em Roma. Csar, aps duras campanhas, conquista a vitria nas Glias. Usa, ento, seu prestgio militar e isola-se no poder com as mortes de Crasso (Oriente) e Pompeu (assassinado no Egito). Jlio Csar proclamado Ditador Perptuo, anulando o poder do Senado, que logo organizou uma conspirao contra ele. Csar, ento, foi assassinado numa conspirao senatorial, em que participaram Brutos e Cssio. A morte de Jlio Csar gerou grande revolta na populao, fato que foi muito bem explorado por Marco Antnio, um dos principais generais de Csar. Marco Antnio, juntamente com Otvio, sobrinho de Jlio Csar, e Lpido, formam o segundo Triunvirato. Os partidrios de Csar derrotam os seus assassinos, e a partir da, inicia-se uma nova disputa pelo poder. Saindo vitorioso nesta disputa, Otvio centraliza o poder e inaugura o Imprio Romano. A vitria no Egito sobre marco Antnio e Clepatra deu a Otvio os ttulos de Pontfice Mximo, Prnceps, Impertor e Augusto.

a) Identifique o perodo da histria de Roma tratado nesse texto.

_________________________________________________ _________________________________________________ b) A partir dos elementos indicados no texto, caracterize o Estado romano durante esse perodo. _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ 8.(Unicamp) No ano de 73 a. C., um grande nmero de escravos e camponeses pobres se rebelaram contra as autoridades romanas no sul da Itlia. Os escravos buscavam retornar s suas ptrias. Depois de resistirem aos exrcitos romanos durante dois anos, a maioria foi massacrada.
(Traduzido e adaptado de P. Brunt, Social Conflicts in the Roman Republic).

272

HISTRIA GERAL

ROMA II

IMPRIO (27 a.C 476 d.C)


Com a implantao do Imprio, Otvio Augusto reorganizou a estrutura poltica romana, concentrando toda a autoridade em suas mos. Promoveu um grande desenvolvimento cultural e seu governo caracteriza-se pela paz, progresso e austeridade (Pax Romana). Neste perodo ocorre a famosa poltica do po e circo, em que o imprio concedia gratuitamente comida e diverso ao povo para que a multido de plebeus no se revoltassem contra o governo. A partir deste momento ocorre a sucesso de vrios imperadores romanos.

ASPECTOS CULTURAIS
Os romanos deixaram grandes contribuies no campo militar, na administrao pblica. Sua lngua, o latim, deu origem ao portugus, espanhol, francs e ao italiano. O grande destaque, sem dvida, est na cincia jurdica. O Direito, dividido em jus civile (direito civil), jus gentium (direito dos povos / estrangeiros) e jus naturale (direito natural). Na Arquitetura, destacam-se os templos, aquedutos, circos, arcos de triunfo.

EXERCCIOS
1. "A histria da Antigidade Clssica a histria das cidades, porm, de cidades baseadas na propriedade da terra e na agricultura."
(K. Marx. "Formaes econmicas pr-capitalistas.")

CRISTIANISMO
Jesus Cristo nasceu na poca de Otvio Augusto e foi crucificado na poca de Tibrio. Neste perodo, o imprio romano desfrutava de certa estabilidade poltica. O cristianismo era um incmodo neste contexto, pois negava a divindade do imperador, o que era considerado uma afronta ao estado romano. Diversos cristos serviram de espetculo ao povo romano ao serem lanados aos lees. Outro fator agravante era a oposio dos cristos em relao ao militarismo e ao escravismo, que eram as bases da civilizao romana. Esta perseguio acabou colaborando com o aumento do nmero de fiis. Nos sculos seguintes, o cristianismo ganhou liberdade de culto atravs do Edito de Milo (313) e posteriormente, tornou-se a religio oficial do Imprio atravs do Edito de Tessalnica (380).

Em decorrncia da frase de Marx, CORRETO afirmar que: a) Os comerciantes eram o setor urbano com maior poder na Antigidade, mas dependiam da produo agrcola. b) O comrcio e as manufaturas eram atividades desconhecidas nas cidades em torno do Mediterrneo. c) As populaes das cidades greco-romanas dependiam da agricultura para a acumulao de riqueza monetria. d) A sociedade urbana greco-romana se caracterizava pela ausncia de diferenas sociais. e) Os privilgios dos cidados das cidades gregas e romanas se originavam da condio de proprietrios rurais. 2. Considere os fatores a seguir: I. Declnio da capacidade de conquista, o que comprometia o abastecimento de escravos para o Imprio. II. Fracasso da reforma agrria que limitou o uso da terra pelos comandantes militares. III. Oposio dos cristos escravido. IV. Aumento dos latifndios na Pennsula ltlica. V. Concorrncia comercial das provncias conquistadas. A partir do sculo III inicia-se uma crise econmica, social e poltica no Imprio Romano. Os fatores responsveis por essa crise foram APENAS. a) I, II e V c) I, IV e V e) II, III e V b) I, III e IV d) II, III e IV 3. Vrias razes explicam as perseguies sofridas pelos cristos no Imprio Romano, entre elas: a) A organizao dos Conclios Ecumnicos, que visavam a definio da doutrina crist b) A publicao do Edito de Milo, que impediu a legalizao do cristianismo e alimentou a represso c) A formao de heresias, como a do arianismo, de autoria do bispo rio, que negava a natureza divina de Cristo d) A oposio religio do Estado Romano e a negao da origem divina do imperador pelos cristos e) O fortalecimento do paganismo, com o imperador Teodsio, que mandou martirizar milhares de cristos

A CRISE DO IMPRIO ROMANO


O colapso das Instituies poltico-administrativas foi causado por vrios fatores, entre eles pode-se destacar: a diminuio do nmero de escravos; A sobrecarga da estrutura administrativa; A corrupo poltica; a fragmentao territorial; ameaas externas, como as invases brbaras. A diviso do Imprio Romano em duas partes, no ano de 395, pelo imperador Teodsio: Imprio Romano do Ocidente (Roma) e Imprio Romano do Oriente (Constantinopla) foi decisiva para a fragilizao das fronteiras, acelerando a queda de Roma. A