Você está na página 1de 6

UNIVERSIDADE ESTADUAL DO PIAU

CAMPUS PROf. ALEXANDRE ALVES DE OLIVEIRA PARNABA


PRF. ANTNIO JOAQUIM DE SOUZA CASTRO

1. Quais as diferenas de composio e estrutura entre RNA e DNA. Como se
distingue entre uracila e timina, e entre ribose e desoxirribose?

2. Escreva a seqncia de bases da fita complementar do DNA dupla fita que
apresenta uma fita com a seqncia:
(5') ATGCCGTATGCATTGCATTC (3')
Exprima, em porcentagem, a composio de bases do DNA de fita dupla.

3. Uma molcula de cido nucleico tem a composio de bases abaixo. O que voc
pode afirmar sobre
esta molcula?
C = 24,1% G = 18,5% T = 24,6% A = 32,8%

4. Explique por que cidos nucleicos so desnaturados quando submetidos a alta
temperatura ou pHs extremos? Uma molcula de DNA desnaturada por aquecimento
pode ser renaturada? Como?

5. Descreva o experimento de Meselson-Stahl. Qual seria o resultado deste
experimento se a replicao do DNA fosse conservativa?

6. Combine as propriedades ou funes na coluna direita com a DNA polimerase na
coluna da esquerda:
(a) DNA polimerase I (1) envolvida na replicao
(b) DNA polimerase II (2) requer um iniciador e um molde
(c) DNA polimerase III (3) envolvida no reparo de DNA
(4) sintetiza a maior parte do DNA durante a replicao
(5) remove o iniciador e preenche as lacunas durante
a replicao

7. O fragmento de DNA no esquema abaixo de fita dupla em ambas as
extremidades, porm de fita simples no meio. As extremidades da fita superior esto
indicadas.
5'____________________________3'
__________P HO_________
a) O fosfato (P) indicado na fita inferior est na extremidade 5' ou 3' do fragmento ao
qual ele pertence ? (Indique no esquema).
b) Como voc esperaria que a lacuna fosse preenchida pelos processos de reparo do
DNA "in vivo" ?
c) Quantos fragmentos voc esperaria encontrar na fita inferior se o experimento fosse
realizado "in vitro", na presena de todos os desoxirribonucleotdeos-trifosfato e DNA
polimerase, mas na ausncia de DNA ligase?

8. Que propriedades do DNA e da DNA polimerase sugerem que a duas fitas no
podem ser replicadas pelo crescimento no mesmo sentido (como mostra a figura
abaixo)? Como a clula supera o problema? Esquematize a formao da ligao
fosfodiester durante a replicao a partir do nucleotdeo trifosfato livre, mostrando o
grupo fosfato que incorporado.

9. Genes de eucariotos so geralmente constitudos de introns e exons. Estas
seqncias so tanto transcritas como traduzidas? A remoo dos ntrons (splicing)
tem que ser um processo extremamente preciso. Por que?

10. As DNA polimerases necessitam de um iniciador, ao qual se liga um novo
nucleotdeo para o crescimento da cadeia polinucleotdica. necessrio um iniciador
para a ao da RNA polimerase?

11. A seguinte fita simples de DNA vai se transcrita in vitro:
5'- ATGTACCGAAGTGGTTT - 3'
Faa a transcrio deste filamento.

12. Defina "promotor", enumere as suas propriedades.

13. No desenho abaixo, da esquerda para a direita, indique as pontas 5' e 3' em cada
uma das fitas. Selecione uma das opes abaixo e explique o porqu de suas
escolhas:
a) fita codificadora de DNA
b) fita complementar ou fita molde de DNA
c) fita de mRNA
d) fita de tRNA (anticdon para Metionina)



14. Faa um x no cido nucleico (pode ser mais de um) que corresponde aos
conceitos abaixo:
cdigo gentico ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA
cdon ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA
anti-cdon ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA
moldura de leitura ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA

15. . Baseando-se na lista de cdons e amino cidos abaixo, discuta as afirmaes
abaixo.
AGU = serina
AGC = serina
AAG = lisina
AAA = lisina
AUG = metionina
AUA = isoleucina
a) O cdigo gentico degenerado.
b) A alterao de um nico nucleotdeo no DNA que dirige a sntese destes cdons
poderia levar substituio de uma isoleucina por uma lisina no polipeptdeo.
c) A alterao de um nico nucleotdeo no DNA que dirige a sntese destes cdons
necessariamente levaria substituio de um aminocido no polipeptdeo codificado.

16. Um tRNA com o anticdon ACU se ligaria a um ribossomo na presena de um dos
cdons da questo 15. Qual? Olhando a tabela ao final deste exerccio faa a previso
do anti-cdon para terminao da traduo e a seqncia das bases correspondentes
no DNA codificador .

17. Uma globina de 146 aminocidos sofreu uma mutao no cdon correspondente
ao sexto aminocido da cadeia (ver tabela ao final do exerccio). A anlise do DNA
indicou uma mudana de TTC para TAC na fita molde. Pergunta- se:
a) A mutao provocou a troca de um aminocido por outro? Em caso afirmativo,
quais so estes aminocidos?
b) Quais as implicaes para a estrutura da protena?

17. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte sequncia
5'...AGGTTACCTAGTTGC...3'
Qual a sequncia do polipeptdeo que seria codificado pelo mRNA sintetizado.
Assuma que o quadro de leitura comea com o primeiro nucleotdeo.

18. Abaixo est anotado o gene completo da insulina como se encontra no Banco de
dados NCBI. Para facilitar a leitura e a contagem, h um nmero que denota a
primeira base da fila e as bases esto separadas por um espao colocado a cada 10
bases. O cdon de iniciao e o cdon de terminao esto sublinhados e em negrito.
Qual o nmero de aminocidos na protena resultante da transcrio desta seqncia?
Explique porque.
1 gctgcatcag aagaggccat caagcacatc actgtccttc tgccatggcc ctgtggatgc
61 gcctcctgcc cctgctggcg ctgctggccc tctggggacc tgacccagcc gcagcctttg
121 tgaaccaaca cctgtgcggc tcacacctgg tggaagctct ctacctagtg tgcggggaac
181 gaggcttctt ctacacaccc aagacccgcc gggaggcaga ggacctgcag gtggggcagg
241 tggagctggg cgggggccct ggtgcaggca gcctgcagcc cttggccctg gaggggtccc
301 tgcagaagcg tggcattgtg gaacaatgct gtaccagcat ctgctccctc taccagctgg
361 agaactactg caactagacg cagcccgcag gcagcccccc acccgccgcc tcctgcaccg
421 agagagatgg aataaagccc ttgaaccagc

19. O gene de uma protena, cuja seqncia parcial est indicada abaixo, sofreu uma
srie de mutaes pontuais independentes, o que levar produo de diferentes
RNAs mensageiros, Indique a seqncia de aminocidos do peptdeo correspondente
(a tabela se encontra no fim dos exerccios) e explique a conseqncia do tipo de
mutao que ocorreu em cada um dos RNAs resultantes.
5'UUCACACAGGAAACAGCUAUGCGAAGCGUGGCUUGUAACU....3'
(a) 5'UUCACACAGGAAACAGCUAUGCGAAGCGGGGCUUGUAACU....3'
(b) 5'UUCACACAGGAAACAGCUAUGCGAAGCAUGGCUUGUAACU.....3'
(c) 5'UUCACACAGGAAACAGCUAUGCGAAGCGUCGCUGUAUACU......3'
(d) 5'UUCACACAGGAAACAGCUAUGCGAAGCGUUGGCUUGUAACU....3'



20. Considere a seguinte sequncia de um fragmento de DNA isolado de bactria:
5'CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTTC
3'
a) Assumindo que esta seqncia corresponde seqncia da fita codificadora, qual
seria a seqncia de aminocidos do polipeptdeo produzido quando um mRNA
transcrito deste gene for traduzido? Que caractersticas na seqncia do mRNA
determinam qual o cdon iniciador? Considere a primeira base como o incio da
transcrio.

b) De acordo com o princpio de oscilao no pareamento de bases ("wobble"), qual o
nmero mnimo de tRNAs necessrio para decodificar os seis cdons de leucina -
UUA, UUG, CUU, CUC, CUA e CUG ? Explique.

21. O cdon AUG funciona tanto para iniciar uma cadeia polipeptdica quanto para
dirigir a incorporao de uma metionina em posies internas de uma protena. Quais
os mecanismos de seleo do cdon AUG para a iniciao da traduo em
procariotos?

22. No que consiste a sequncia de Shine Dalgarno? Ela universal? Explique.

23. Compare a expresso gnica em procariotos e eucariotos quanto a:
a) grau de acoplamento da transcrio e da traduo.
b) nmero de produtos gnicos em um transcrito primrio.
c) nmero de protenas resultantes da traduo de um transcrito primrio.
d) proporo de seqncias codificadoras no DNA.
e) organizao de genes em operons.

24. Defina expresso gnica constitutiva. Compare expresso gnica induzida com
represso gnica. Use o esquema proposto por Jacob e Monod para o operon da
lactose e defina os termos operon, gene estrutural, gene regulador, operador,
promotor, indutor, repressor e co-repressor.

25. Numa cultura de E.coli em um meio contendo tanto lactose quanto glicose, qual
dos acares metabolizado preferencialmente? Qual o mecanismo que permite
esta seletividade? O que acontece quando a glicose se esgota durante o crescimento
da bactria?

26. Para o cultivo de E.coli utilizaram-se meios contendo alm dos sais necessrios,
os componentes:
a) lactose d) glicose + cAMP
b) lactose + glicose e) lactose + glicose + cAMP
c) glicose
Analise a produo de - galactosidase em cada caso, justificando a resposta
segundo o modelo de Jacob e Monod.

27. Qual o efeito da deleo do gene regulador do operon lac? Haveria outro tipo de
mutao resultando no mesmo efeito?