Você está na página 1de 25

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

AMABIS
MARTHO

RESPOSTAS S QUESTES DAS ATIVIDADES


Unidade A
Captulo 1 Biologia e cincia
Questes para pensar e discutir
Questes objetivas
1. d

2. a

3. b

4. c

5. d

6. a

7. c

8. b

9. b

10. d

11. c

Questes discursivas
12. a) A hiptese testada por Jenner foi que a varola
bovina protege contra a varola humana, ou seja,
se uma pessoa contrair varola bovina ela se
torna imune varola humana.
b) Ele inoculou, em uma criana de oito anos, material retirado de erupes cutneas das mos
de uma ordenhadora atacada por varola bovina.
Aps dois meses, repetiu o procedimento com
material coletado de erupes cutneas de uma
pessoa atacada por varola humana. Como Jenner previra, a criana no desenvolveu a forma
grave da doena.
13. a) A provvel hiptese testada foi a de que alguns
aminocidos so essenciais sobrevivncia das
larvas.
b) O controle experimental era representado pelo
grupo de larvas alimentado com dieta completa
(com todos os 20 tipos de aminocidos naturais, alm de gua, sais, acares e vitaminas).
A importncia do grupo de controle que ele
permitiu verificar se possveis alteraes na
taxa de sobrevivncia das larvas realmente
deviam-se falta de certos aminocidos em sua
dieta e no a algum outro fator.
c) A varivel testada nos grupos experimentais
foi a ausncia de determinados aminocidos na
dieta das larvas.

d) As concluses so: 1. Nem todos os aminocidos


so fundamentais sobrevivncia, os grupos
que no receberam glutamina e glicina tiveram
comportamento semelhante ao do grupo de
controle; 2. Alguns aminocidos so essenciais,
isto , sem eles as larvas no sobrevivem ou a
sobrevivncia muito pequena (entre aminocidos testados: valina, leucina e isoleucina).
14. De acordo com o Dicionrio Aurlio Bsico da Lngua
Portuguesa, cincia refere-se a: 1. Conhecimento.
2. Saber que se adquire pela leitura e meditao; instruo, erudio, sabedoria. 3. Conjunto
organizado de conhecimentos relativos a um
determinado objeto, especialmente os obtidos
mediante a observao, a experincia dos fatos
e um mtodo prprio. 4. Soma de conhecimentos
prticos que servem a um determinado fim. 5.
A soma de conhecimentos humanos considerados
em conjunto. 6. Processo pelo qual o homem se
relaciona com a natureza visando denominao
dela em seu prprio benefcio. Tecnologia referese a: 1. Conjunto de conhecimentos, especialmente princpios cientficos, que se aplicam a um
determinado ramo de atividade. 2. A totalidade
desses conhecimentos.
As definies acima podero servir de referncia
para que a professora ou o professor estabeleam
comparaes com a lista obtida pelos estudantes
em sua pesquisa.
15. Chama-se Renascimento o movimento de revoluo
intelectual e artstica que surgiu na Europa, a partir
do sculo XIV. No pensamento renascentista, o ser
humano deixou de se ver apenas como criatura e
passou a desempenhar um papel criador, sentindose capaz de vencer diferentes obstculos. A natureza foi dessacralizada e a humanidade passou a
julgar que poderia domin-la e manipul-la como
bem entendesse. A inveno da imprensa, a divulgao de textos impressos e a descoberta de novas culturas pelos europeus tambm contriburam
para que se instaurasse uma nova viso de mundo.
A partir do Renascimento, surgiram novas formas
de pensar, como o racionalismo, segundo o qual
o conhecimento surge da atividade racional, e

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


o experimentalismo, que busca o conhecimento
por meio de experincias; essas ideias forneceram a base para o desenvolvimento do conhecimento cientfico. Coprnico (1473-1543), Kepler
(1571-1630) e Galileu (1564-1642), na Astronomia;
Vesalius (1514-1564), Miguel Servet (1509-1553)
e Ambroise Par (1509-1590), na Anatomia, so
alguns dos nomes de destaque na cincia do
Renascimento.
Vestibulares pelo Brasil
Questes objetivas
1. a

2. 004

3. e

4. d

5. b

6. a

7. b

Captulo 2 Origem da vida na Terra


Questes para pensar e discutir

AMABIS
MARTHO

condies (hiptese da gerao espontnea ou


abiognese).
b) Um exemplo de experimento para testar essa
hiptese : coloca-se, em duas caixas de sapato, uma mistura de papis picados, rao para
ces, serragem e pedriscos; uma das caixas
deve ser tampada e embrulhada com plstico
resistente, ou colocada em uma gaiola de tela
muito fina: ela ser o controle experimental;
a outra caixa deve ser mantida aberta. Essas
caixas devem ser colocadas em condies ambientais semelhantes, principalmente onde haja
ratos, camundongos, baratas etc., e observadas
durante 15 dias a um ms.
23. A hiptese testada por Miller foi a de que substncias orgnicas poderiam ter se formado nas
condies supostamente existentes na Terra
primitiva, sem a participao de seres vivos.
A deduo feita por ele foi que em um sistema que
simulasse as supostas condies da Terra primitiva deveria haver sntese abiolgica de compostos
orgnicos.

Questes objetivas
1. d

2. a

3. b

4. e

5. c

6. b

7. d

8. a

9. d

10. c

11. b

13. c

Vestibulares pelo Brasil


Questes objetivas
1. c, e

2. b

3. b

12. d

4. b

5. d

6. d

14. d

15. e

7. b

8. a

9. d

16. d

17. a

18. b

10. b

11. c

12. c

19. c

20. c

13. c

14. d

15. d

16. d

17. a

18. a

19. d

20. a

21. d

22. e

23. e

24. a

25. e

26. c

27. c

Questes discursivas
21. a) O processo UHT torna o leite estril, ou seja,
isento de microrganismos. Isso ocorre porque
a temperatura utilizada no processo chega a
150 C (durante 2 a 4 segundos), eliminando os
microrganismos indesejveis.
b) As baixas temperaturas no refrigerador retardam a proliferao de microrganismos que
invadem o leite (vindos do ar, por exemplo) e
que podem estrag-lo.
22. a) A hiptese de van Helmont era que a matria
inanimada pode gerar vida, em determinadas

Questes discursivas
28. a) Basicamente, seria necessria a existncia de
molculas orgnicas produzidas de modo abiognico.
b) A diminuio do tamanho das populaes de
hetertrofos.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


c) Os primeiros seres vivos deviam ser muito
simples e, portanto, ainda no teriam desenvolvido a capacidade de produzir substncias
alimentares.
29. a) Os primeiros eucariotos capazes de fazer respirao aerbia devem ter surgido em B, pois
eles dependiam da presena de gs oxignio
para respirar. Os organismos fotossintetizantes, que produzem gs oxignio no processo,
teriam surgido em A, num perodo anterior
origem dos organismos que faziam respirao
aerbia.
b) A mitocndria, no primeiro caso, pois a respirao aerbia nos organismos eucariotos ocorre
no interior dessa organela. O cloroplasto no segundo caso, pois a fotossntese nos organismos
eucariotos ocorre nessa organela.
c) Mitocndria e plastos surgiram por endossimbiose, segundo a teoria mais aceita, ou seja,
pelo englobamento de seres procariotos que
realizavam respirao aerbia e fotossntese.
Essas organelas citoplasmticas possuem
DNA, ribossomos semelhantes aos das
bactrias, e realizam sntese de protenas,
caractersticas que apoiam a teoria endossimbitica.
30. Poderiam existir em Io organismos semelhantes
a bactrias quimiolitoautotrficas, que produzem
substncias alimentares a partir da energia liberada por reaes qumicas entre componentes
inorgnicos.

AMABIS
MARTHO

Questes discursivas
18. Como resultado do trabalho os alunos podem
apresentar uma tabela como a seguir.
Informaes nutricionais de alguns alimentos
Alimento (100 g)
Queijo padro

Protenas Carboidratos Lipdios


24,0 g

1,0 g

23,0 g

Leite
pasteurizado
semidesnatado

3,2 g

4,9 g

0,2 g

Po natural de
trigo integral

10,0 g

48,0 g

2,5 g

Alimento
achocolatado
em p

4,8 g

84,2 g

2,9 g

Cereal matinal
de aveia, milho,
arroz e coco

8,0 g

75,0 g

5,0 g

Requeijo
cremoso light

13,0 g

2,5 g

13,7 g

Maionese de
baixo valor
lipdico

1,0 g

8,0 g

33,0 g

12,4 g

3,5 g

25,2 g

Queijo em
tabletes

19. (Promova a discusso em grupos das observaes


feitas).
20. a) Em ambos, a proporo entre H e O, na molcula,
2 : 1.

Captulo 3 Bases moleculares da vida

b) O da esquerda um monossacardio, pois tem


frmula geral Cn(H2O)n.
c) Eram duas trioses (C3H6O3), que se uniram em
uma sntese por desidratao, eliminando uma
molcula de gua.

Questes para pensar e discutir


Questes objetivas
1. b

2. c

3. c

4. a

5. e

6. d

7. c

8. b

9. b

10. a

11. a

12. b

13. d

14. d

15. d

16. b

17. c

21. a) Os nmeros correspondem a: 1) cido carboxlico ou carboxila (kCOOH); 2) amina (kNH2);


3) hidrognio (kH); 4) radical (kR).
b) O grupo 4 (radical).
22. a) A faixa de pH mais favorvel ao dessa enzima
est entre 1 e 3.
b) A pepsina deixa de atuar em pH igual ou maior
que 4.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


23.

I. Trata-se de RNA, pois somente esse cido nucleico tem ribose em sua constituio.
II. Trata-se de DNA, pois somente esse cido nucleico tem timina em sua constituio.
III. Trata-se de RNA, pois somente esse cido nucleico tem uracila em sua constituio.
IV. Trata-se de DNA, pois somente esse cido
nucleico tem desoxirribose em sua constituio.

Vestibulares pelo Brasil


Questes objetivas
1. a

2. b

3. a

4. d

5. b

6. d

7. d

8. e

9. e

10. a

11. e

12. b

13. e

14. b

15. a

16. d

17. e

18. a

AMABIS
MARTHO

b) O glicognio pode ser armazenado no fgado


e nos msculos; o amido, nas sementes e em
certos tipos de caules e razes como a batata-inglesa e a mandioca.
53. a) Pela ingesto de vegetais. Porque o -caroteno
origina a vitamina A, a partir da qual produzido o pigmento (rodopsina), necessrio para a
viso.
b) Estrutura de membranas celulares e controle
hormonal.
Esteroides: colesterol, progesterona, testosterona.
c) Animais: tecido adiposo.
Plantas: sementes e frutos.

Unidade B
Captulo 4 A descoberta da clula viva
Questes para pensar e discutir
Questes objetivas

19. 002 004 016 022

20. e

1. c

2. b

3. a

21. e

22. c

23. d

4. b

5. d

6. a

24. b

25. c

26. d

7. c

8. c

9. b

27. c

28. c

29. d

10. d

11. b

12. c

30. c

31. a

32. b

13. b

14. d

15. c

33. d

34. d

35. b

36. b

37. e

38. b

39. c

40. a

41. c

42. 01 02 04 08 016 064 095


43. b

44. e

45. c

46. 04

47. V, V, F, V, F

48. b

49. e

50. 02 08 32 42

Questes discursivas
16. Alguns cientistas, poca em que viveram e principais aspectos de seus trabalhos.
Cientista

Sculo Principal trabalho

Antonie van
Leeuwenhoek

XVII

Descoberta dos
seres
microscpicos

Robert Hooke

XVII

Descoberta da
clula

Robert Brown

XIX

Descoberta do
ncleo celular

Mathias
Schleiden e
Theodor Schwann

XIX

Elaborao da
teoria celular

Questes discursivas
51. a) Vitamina C.
b) Atuam como cofatores em reaes enzimticas.
52. a) Polissacardio de origem animal: glicognio; de
origem vegetal: amido.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


17. Representao esquemtica de uma clula animal,
como era entendida antes de existir o microscpio
eletrnico.

Aspecto
comparado

Microscpio
ptico

Clula animal

ILUSTRAO: GILBERTO MARTHO

Ncleo

Citoplasma
Membrana
plasmtica

18. Com aumento de 2.000 vezes, os dimetros da


imagem da clula e de seu ncleo eram, respectivamente, 17,5 cm e 4,25 cm; portanto, seus dimetros
reais na clula sero 87,5 m e 21,25 m.
19. Procedimento 1 (fixao): a imerso em um lquido
fixador mata rapidamente as clulas, causando
um mnimo de alterao estrutural. Esse procedimento garante que as estruturas celulares se
preservem.
Procedimento 2 (incluso): necessrio embeber o
material em parafina quente que, ao se solidificar,
d consistncia ao tecido para que ele possa ser
cortado em fatias finas.
Procedimento 3 (corte histolgico): para ser observado ao microscpio ptico, o material biolgico
precisa ser cortado em fatias finas, de tal maneira
que permita a passagem de luz.
Procedimento 4 (colorao): os cortes (fatias)
do material biolgico precisam ser corados para
evidenciar suas diferentes estruturas celulares;
no caso, a hematoxilina cora o ncleo celular,
enquanto a eosina cora o citoplasma.
20. Comparao entre alguns aspectos de microscpios pticos e eletrnicos.

AMABIS
MARTHO

Microscpio
eletrnico

Tipo de lente
utilizada

Lentes
pticas de
vidro ou de
cristal

Lentes
eletromagnticas
(bobinas
eletromagnticas)

Aumentos
usuais

At 1.500 X

At 100.000 X
(ou mais)

Espessura
requerida
dos cortes
histolgicos

5 m

0,05 m

Limite de
resoluo

0,25 m

0,001 m (1 nm)

Possibilidade
de observar
material vivo

Sim

No

21. A diviso dos seres vivos em procariticos e eucariticos foi adotada apenas aps a utilizao
do microscpio eletrnico porque s ento foi
possvel visualizar estruturas citoplasmticas
membranosas (organelas) e a membrana do
ncleo (carioteca), caractersticas de clulas
eucariticas e que esto ausentes em clulas
procariticas.

Vestibulares pelo Brasil


Questes objetivas
1. d

2. a

3. e

4. c

5. c

6. b

7. b

8. b

9. c

Questo discursiva
10. Os procariontes no apresentam ncleo organizado
(ausncia de carioteca). A cromatina fica dispersa
pelo citoplasma. Nos eucariontes, existe ncleo
organizado, com carioteca e nuclolos.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

Captulo 5 Fronteiras da clula


Questes para pensar e discutir
Questes objetivas
1. d

2. a

3. b

4. c

5. e

6. d

7. b, a

8. c

9. a

10. c

11. a

12. b

13. b

14. c

15. b

16. c

17. a

18. d

19. d

20. a

21. d

22. b

23. b

24. d

25. b

26. a

AMABIS
MARTHO

b) Ocorrer osmose devido sacarose, ou seja,


ocorrer difuso de gua em maior quantidade
da soluo hipotnica para a hipertnica atravs
da membrana semipermevel.
c) O nvel de lquido no tubo A dever abaixar e no
tubo B dever subir, e a concentrao de sacarose nos dois tubos tender a se igualar.
Vestibulares pelo Brasil
Questes objetivas
1. c

2. 01 02 04 07

3. c

4. d

5. e

6. d

7. c

8. d

9. a

10. d

11. d

12. c

Questes discursivas

13. b

14. d

27. A difuso ocorrer mais depressa no recipiente


com gua quente, no qual o movimento das partculas da gua mais intenso (maior energia cintica)
e leva as partculas de tinta a se espalharem mais
rapidamente.

15. d

16. d

17. c

18. b

19. a

20. d

21. b

22. b

28. As concentraes das solues dos tubos e do


frasco tendero a se igualar. Assim, aps algum
tempo, no tubo 1 o nvel de lquido dever subir
(maior quantidade de solvente tende a atravessar
a membrana no sentido frasco # tubo); no tubo
2 no ocorre variao no nvel de lquido (mesma
quantidade de solvente tender a atravessar a
membrana em ambos os sentidos); no tubo 3 o
nvel de lquido dever abaixar (maior quantidade
de solvente tender a atravessar a membrana no
sentido tubo # frasco).
29. A manuteno da diferena de concentrao de
certa substncia dentro e fora da clula pode ser
explicada pelo seu bombeamento para o interior
da clula por transporte ativo, que ocorre contra
a tendncia natural da difuso e com gasto de
energia pela clula.
30. a) Espera-se que a concentrao de cloreto de
sdio diminua no tubo A e aumente no tubo
B, com tendncia a se igualar nos dois tubos.
Isso ocorre porque o sal capaz de atravessar
a membrana.

23. b
24. 002 004 016 032 054
25. d

26. e

27. 001 016 032 049


28. b

29. a

30. d

31. d

32. c

33. b

34. a

35. d

36. d

37. c

38. c

39. a

40. d

41. a

42. c

43. c

44. c

45. d

46. d

47. a

48. a

Moderna PLUS

BIOLOGIA
BIOLOGIA DAS CLULAS

AMABIS
MARTHO

Questes discursivas
49.

I.

Soluo de
sacarose
gotejada sobre
folhas de Elodea

Tonicidade da
soluo em
relao s
clulas

Identificao
da molaridade
da soluo (M)

Soluo A

Clulas com o mesmo


aspecto daquelas imersas
na soluo isotnica de
NaCL

Isotnica

0,4 M

Soluo B

Clulas apresentaram-se
mais trgidas que aquelas
da Elodea submetida
soluo A

Hipotnica

O,2 M

Soluo C

Clulas mais murchas


que aquelas da Elodea
submetida soluo A

Hipertnica

0,8 M

Soluo D

Clulas mais murchas


que aquelas da soluo A,
porm menos murchas que
aquelas da soluo C

Hipertnica

0,6 M

Resultado observado

II. As clulas vegetais em uma soluo hipotnica no estouram porque a parede celulsica impede a entrada de gua adicional a partir do ponto em que ela atinge o mximo
de distenso.
50. a) X: fosfolipdio; Y: protena.
b) A passagem de substncias do interior para o exterior das clulas pode ocorrer atravs
das protenas que compem a membrana plasmtica; pode ocorrer tambm pela fuso
das bolsas de secreo com a membrana.
51. a) As associaes corretas so: 1C; 2A; 3B. A realizao do transporte de substncias
realizado pelos processos indicados em A (difuso simples) e em B (transporte passivo
facilitado) no necessita de energia, enquanto que em C (transporte ativo) h a necessidade de consumo de energia para a realizao do transporte de substncia. Outra
diferena entre os processos a necessidade de protenas carreadoras no transporte de
substncias mostrado em B e C, enquanto em A essas protenas no so necessrias.
b) A folha de alface murchou rapidamente porque suas clulas perderam gua para o meio
salino (hipertnico) por osmose. Nesse processo o solvente (gua) passa da soluo de
menos concentrao, em soluto, para a de maior concentrao.
52. a) Os protozorios de gua salgada so isotnicos em relao ao meio em que vivem, no
necessitando de vacolos pulsteis. J os protozorios de gua doce so hipertnicos
em relao ao ambiente e, por isso, recebem gua continuamente por osmose, eliminando
o excesso de gua por meio dos vacolos pulsteis.
b) Intenso ganho de gua, por osmose, acarretando ruptura da clula.
53. a) Tubo 2. A soluo hipotnica e a clula ganha gua at sofrer lise.
b) Tubo 1. No ocorre alterao do volume da clula.

Moderna PLUS

BIOLOGIA
BIOLOGIA DAS CLULAS

AMABIS
MARTHO

Questes discursivas
Captulo 6 Citoplasma e organelas
citoplasmticas
Questes para pensar e discutir
Questes objetivas
1. c
2. b
3. d

26. Espera-se encontrar maior quantidade de mitocndrias em uma clula de msculo porque este, para
se movimentar, consome muita energia, produzida
em reaes qumicas mitocondriais.
27. Espera-se encontrar cloroplastos apenas nas clulas das folhas de uma planta, pois, diferentemente
das razes, estas ficam expostas luz, a qual
necessria para a formao dos cloroplastos a
partir de leucoplastos ou de proplastos.

4. a
5. d
6. a
7. a
8. b
9. c
10. d
11. a
12. a
13. d
14. b
15. c
16. b
17. a
18. a
19. c
20. d
21. b
22. a
23. b
24. c
25. d

28. As enzimas das secrees so produzidas nos


ribossomos do retculo endoplasmtico granuloso
e, na sequncia, so armazenadas e secretadas
pelo complexo golgiense.
29. a) 1. Mitocndria: responsvel pela produo de
energia por meio da respirao celular, em
que o alimento degradado na presena de
gs oxignio. 2. Retculo endoplasmtico granuloso: responsvel pela sntese das protenas realizada nos ribossomos aderidos a suas
membranas. 3. Retculo endoplasmtico no
granuloso: responsvel pelo armazenamento
e transporte de substncias no interior da
clula. 4. Cloroplastos: sede da fotossntese,
em que ocorre a produo de matria orgnica a partir de CO2 e H2O e energia luminosa. 5.
Complexo golgiense: estrutura membranosa
cuja funo est relacionada com a secreo celular, que consiste na liberao das
substncias armazenadas em bolsas (gros
de secreo). O complexo golgiense tambm
responsvel pela produo de lisossomos,
organelas membranosas que contm enzimas
digestivas usadas em processos de digesto
intracelular. 6. Centrolos: originam os clios e
flagelos e participam do processo de diviso
celular.
b) A clula animal apresenta centrolo, que no
ocorre em clulas de plantas. A clula vegetal
apresenta cloroplastos e parede celulsica,
ausentes na clula animal.

Moderna PLUS

BIOLOGIA
BIOLOGIA DAS CLULAS

30.

Organela

Estrutura

Funo

AMABIS
MARTHO

Ocorre em

Retculo
endoplasmtico
no granuloso

Bolsas e tubos
membranosos sem
ribossomos aderidos

Sntese de
cidos graxos e
de fosfolipdios;
armazenamento
e transporte de
substncias

Retculo
endoplasmtico
granuloso

Bolsas achatadas
com ribossomos
aderidos

Produo de
protenas

Clulas eucariticas:
seres unicelulares
e pluricelulares
(vegetais e animais)

Complexo golgiense

Sacos membranosos
achatados e
empilhados

Armazenamento
e secreo de
substncias teis;
produo de
lisossomos

Clulas eucariticas:
seres unicelulares
e pluricelulares
(vegetais e animais)

Ribossomo

Estrutura granulosa
formada de duas
subunidades de
tamanhos diferentes

Produo de
protenas

Clulas eucariticas:
seres unicelulares
e pluricelulares
(vegetais e animais)

Lisossomo

Pequena bolsa
membranosa esfrica

Digesto intracelular

Clulas eucariticas:
seres unicelulares
e pluricelulares
(vegetais e animais)

Mitocndria

Estrutura
membranosa em
forma de bastonete
com extremidades
arredondadas

Produo de energia

Clulas eucariticas:
seres unicelulares
e pluricelulares
(vegetais e animais)

Cloroplasto

Estrutura
membranosa em
forma de lentilha
alongada

Produo de matria
orgnica

Clulas eucariticas
de seres unicelulares
fotossintetizantes e
de vegetais

Centrolo

Pequeno cilindro com


parede constituda
por nove conjuntos de
trs microtbulos

Organizao do fuso
mittico; formao de
clios e flagelos

Na maioria das
clulas eucariticas,
exceto em clulas
de angiospermas
e de algumas
gimnospermas

Clulas eucariticas:
seres unicelulares
e pluricelulares
(vegetais e animais)

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

Vestibulares pelo Brasil


Questes objetivas
1. d

2. a

3. d

4. b

5. e

6. e

7. c

8. d

9. b

10. c

11. b

12. d

13. d

14. b

15. 05

16. a

17. c

18. a

19. b

20. c

21. a

22. e

23. c

24. c

25. b

26. e

27. a

28. a

29. a

30. d

31. 002 004 008 014

32. d

33. a

34. e

35. e

36. a

37. a

38. c

39. d

40. b

41. b

42. c

43. a

44. b

45. a

46. d

47. d

48. a

49. b

50. c

51. d

52. d

53. b

54. c

55. d

56. e

57. a

58. a

59. b

60. e

61. F, V, F, F, F

62. 01 04 05 63. b

64. d

Questes discursivas
65. a) A funo dos ribossomos orientar a produo
das protenas.
b) Porque as protenas a produzidas so armazenadas e posteriormente encaminhadas para o
complexo golgiense.
c) Porque, segundo a hiptese endossimbitica,
as mitocndrias e os cloroplastos so organelas originadas de uma relao simbitica

AMABIS
MARTHO

10

entre seres procariticos e clulas eucariticas ocorrida h centenas de milhes de anos.


Esses seres procariticos deviam ter capacidade de sintetizar suas protenas e, para isso,
era essencial que tivessem ribossomos, como
ocorre nas mitocndrias das clulas eucariticas atuais.
66. a) O nuclolo o local de sntese do RNA ribossmico e da sua associao com protenas especficas para formar os ribossomos. Estes saem
do ncleo, amadurecem e podem se associar a
membranas do retculo endoplasmtico, constituindo o retculo endoplasmtico rugoso.
b) O complexo golgiense o local onde as protenas
a serem exportadas (secretadas) da clula so
modificadas e empacotadas.
67. Os lisossomos correspondem a bolsas membranosas repletas de enzimas digestivas. Essas enzimas
so produzidas no retculo endoplasmtico granuloso e empacotadas no complexo golgiense, dando
origem aos lisossomos. O alimento obtido pelo processo de fagocitose ser digerido pelas enzimas
presentes no lisossomo. Para isso, o lisossomo
dever unir-se ao fagossomo, formando o vacolo
digestivo. Terminada a digesto, as substncias
teis sero liberadas na clula e os resduos sero
eliminados.
68. a) Os lisossomos so responsveis pela digesto
intracelular.
b) Outro processo de internalizao celular de
substncias a fagocitose. A fagocitose difere
da pinocitose, pois implica a emisso de pseudpodes que envolvem a partcula a ser absorvida,
o que no ocorre na pinocitose. Nesta ocorre uma
microinvaginao na membrana na regio de
contato com a substncia a ser internalizada.
c) O colesterol utilizado em vrios processos celulares: estabilizao das membranas celulares,
sntese de hormnios esteroides etc.
69. A funo autofgica dos lisossomos est relacionada digesto de substncias presentes na prpria
clula, ao passo que na funo heterofgica as
substncias digeridas vm de fora, capturadas atravs de processos de fagocitose ou pinocitose.
70. A mitocndria tem papel imprescindvel no transporte ativo, que demanda o uso direto de energia

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


do ATP, produzido sobretudo na respirao celular
que ocorre nessa organela. Indiretamente ela
participa da digesto intracelular, uma vez que
para sntese das enzimas digestivas h necessidade de energia proveniente da respirao celular.
O processo de difuso no demanda gasto de
energia e, portanto, no est relacionado com as
mitocndrias.
71. a) A mitocndria libera a energia para o batimento
dos flagelos.
b) Porque as mitocndrias do espermatozoide no
penetram no vulo; ento, o zigoto tem apenas
as mitocndrias do gameta materno.
72. a) Cloroplasto.
b) Em clulas vegetais (de algas e plantas).
c) Realizao da fotossntese.

AMABIS
MARTHO

citoplasmticas, estando presentes apenas em


bactrias. Portanto, o fato de no terem ncleo
no implica que hemcias sejam procariticas.
14. A anlise do caritipo de um feto revela o nmero,
a forma e o tamanho dos cromossomos, possibilitando detectar certas alteraes cromossmicas
antes do nascimento da criana.
Vestibulares pelo Brasil
Questes objetivas
1. d

2. e

3. b

4. d

5. a

6. b

7. e

8. d

9. 004 008 032 044

73. A clula vegetal est representada na figura B, pois


ela apresenta cloroplasto e, alm disso, vacolo e
parede celular. O cloroplasto.

10. e

11. d

12. c

13. d

14. c

15. d

74. a

16. c

17. a

18. c

19. a

20. b

21. b

22. b

23. c

24. a

25. e

26. d

27. a

28. c

29. b

30. b

31. a

32. b

Captulo 7 Ncleo e cromossomos


Questes para pensar e discutir
Questes objetivas
1. c

2. c

3. a

4. a

5. b

6. b

7. d

8. b

9. a

10. b

11. e

12. d

Questes discursivas
13. As clulas precursoras das hemcias (os eritroblastos) tm ncleo enquanto esto na medula
de certos ossos, onde se formam. O ncleo
eliminado da clula pouco antes de a hemcia
entrar no sangue. A eliminao do ncleo pode
ser explicada como uma adaptao para conter
mais hemoglobina, o que permite maior transporte
de gs oxignio. Hemcias, portanto, so clulas
eucariticas que perdem o ncleo por diferenciao. Clulas procariticas no apresentam ncleo
(carioteca ausente) nem organelas membranosas

11

33. V, F, V, F, F, F, V 34. c
Questes discursivas
35. a) Componentes: carioteca, cromatina, nuclolo e
nucleoplasma.
b) Composio qumica dos componentes: carioteca: lipdios e protenas; cromatina: DNA e protenas; nuclolo: RNA e protenas; nucleoplasma:
gua, sais, nucleotdios e protenas.
c) Funes dos componentes: carioteca: controle
da entrada e sada de substncias, proteo;
cromatina: guarda de informaes genticas
correspondentes a todas as caractersticas do
indivduo; nuclolo: produo de RNA ribossmico que entrar na constituio dos ribossomos;
nucleoplasma: meio para a ocorrncia de reaes
qumicas no ncleo.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


36. A clula que realiza intensa sntese de protenas
necessita de grande quantidade de ribossomos,
que so os corpsculos encontrados no citoplasma
(livres ou associados ao retculo endoplasmtico)
nos quais esse processo realizado. Nesse caso,
o nuclolo deve estar bem desenvolvido, pois ele
o responsvel pela fabricao desses ribossomos,
que nada mais so do que RNA ribossmico produzido nessa regio associado a protenas.
37. Teria as caractersticas da espcie A, porque herdou os mesmos genes, que esto localizados nos
ncleos.
38. 24 cromossomos, porque devem ser analisados:
um representante de cada par dos cromossomos
autossmicos e os cromossomos X e Y, que so
diferentes.
39. No. As hemcias dos mamferos so anucleadas
e, portanto, no possuem material gentico para
ser analisado.
40. Os cromossomos podem ser classificados em:
a) metacntricos, com o centrmero no meio, formando dois braos de mesmo tamanho;
b) submetacntricos, com o centrmero deslocado
da regio mediana, formando braos de tamanhos desiguais;
c) acrocntricos, com o centrmero bem prximo
de uma das pontas, formando um brao grande
e outro muito pequeno;
d) telocntricos, com o centrmero em uma das
extremidades, tendo apenas um brao.
41. Zero (0), uma vez que clulas haploides no tm
pares homlogos.

Captulo 8 Diviso celular: mitose e meiose


Questes para pensar e discutir
Questes objetivas
1. a

2. d

3. e

4. f

5. b

6. c

7. T4

8. T2

9. T3

10. T1

11. T2

12. T3

13. T4

14. c

15. g

16. a

17. c

18. f

AMABIS
MARTHO

19. d

20. e

21. h

22. b

23. c

24. d

25. b

26. a

27. c

28. e

29. d, e

30. b

31. a

32. d

33. d

34. b

35. c

36. b

37. d

38. c

39. b

40. a

41. d

42. b

43. c

44. c

12

Questes discursivas
45. No ser humano, em 5 litros de sangue h aproximadamente 2,5 1013 hemcias. Se o tempo mdio
de vida de uma hemcia cerca de 120 dias, ou
seja, 1,04 107 segundos, em 1 segundo cerca
de 2,40 106 (2.400.000) hemcias devem ser
produzidas para substituir as que so destrudas.
Veja o clculo:
2,5 1013
___________
2,40 106 2.400.000
1,04 107
46. a) O ndice mittico da populao de clulas estudada de 20%.
b) Sendo a durao do ciclo celular para o tipo de
clula estudada de cerca de 20 horas e sabendo
que 20% dessas clulas esto em mitose, pode-se inferir que a fase mittica do ciclo celular
dura cerca de 4 horas (20% das 20 horas). Os
80% restantes de clulas permanecem em interfase por um perodo aproximado de 16 horas
(80% das 20 horas). A metfase deve durar cerca
de 25% da fase mittica, ou seja, 1 hora. Essa
inferncia se baseia no fato de que 5 clulas, em
um total de 20, se encontram em metfase.
c) Aplicando o raciocnio usado no item anterior,
pode-se inferir que a durao aproximada dos
perodos G1, S e G2 ser de, respectivamente:
8,0 horas (50% das 16 horas); 4,8 horas (30%
das 16 horas); 3,2 horas (20% das 16 horas).
47. 1) Anfase II: os cromossomos esto migrando
para polos opostos; cada um deles constitudo
por uma nica cromtide. 2) Telfase I: os cromossomos, constitudos por duas cromtides,

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


descondensam-se nos polos da clula, sendo envolvidos por uma carioteca. 3) Prfase I (diplteno):
os cromossomos condensados emparelham-se
dois a dois; a carioteca ainda est presente e
podem ser vistos quiasmas. 4) Anfase I: os cromossomos esto migrando para os polos da clula;
cada um deles constitudo por duas cromtides.
5) Metfase II: nmero haploide de cromossomos
espalhados na regio mediana da clula.
Vestibulares pelo Brasil
Questes objetivas
1. a

2. b

3. c

4. c

5. d

6. c

7. e

8. b

9. d

10. b

11. c

12. c

13. a

14. e

15. d

16. d

17. a

18. b

19. 001 008 032 041


20. F

21. a

22. V

23. I. prfase I; II. metfase I; III. anfase I; IV. prfase


II; V. metfase II; VI. telfase II.
24. a

25. a

26. b

27. d

28. a

29. b

30. a

31. a

32. a

33. b

34. d

35. c

36. a

37. e

38. b

AMABIS
MARTHO

13

48. a) As clulas 4 e 5 esto em interfase, fase que se


caracteriza pela presena de cromossomos descondensados, de envelope nuclear e nuclolo.
b) A clula 7 encontra-se em metfase; os cromossomos, constitudos por duas cromtides
unidas pelo centrmero, prendem-se s fibras do
fuso por meio dos cinetcoros e se dispem na
regio mediana da clula, constituindo a placa
metafsica.
c) A citocinese ocorre na telfase (figura 9) pela
deposio de material constituinte da parede
celular, do centro para a periferia da clula;
trata-se de uma citocinese centrfuga, tpica de
clulas vegetais.
49. a) Na metfase. A colchicina liga-se s molculas
de tubulina impedindo que fiquem unidas entre
si e os microtbulos se desfazem.
b) Na prfase, porque o perodo S no se completaria.
50. a) Na mitose conserva-se o nmero de cromossomos das clulas. Na meiose, esse nmero se
reduz metade.
b) A meiose, ao reduzir o nmero cromossmico,
permite que ocorra a fecundao. Nesta, recompe-se o nmero tpico da espcie. A meiose
tambm permite que ocorra maior diversidade
gentica graas separao ao acaso dos cromossomos homlogos e permutao.
51. a) Apenas na meiose, porque nesse processo de
diviso celular que se separam os cromossomos
homlogos.
b) Na anfase da mitose e na anfase II da meiose,
porque nesses processos de diviso celular
que se separam as cromtides-irms.
52. a) No final da 1a diviso ser igual a 2x, ao final da 2a
diviso ser 4x e ao final da 3a diviso ser 8x.
b) igual a 2x.

39. 01, 02, 04, 08


40. 01 32 33
41. b

42. e

43. e

44. e

45. b

46. b

Questes discursivas
47. No. Nas clulas animais a diviso do citoplasma
ocorre por estrangulamento da regio mediana
(citocinese centrpeta); nas clulas vegetais, ela
ocorre por deposio de material do centro para
a periferia da clula (citocinese centrfuga).

53. a) A metfase mittica, pois temos os quatro cromossomos com cada uma de suas cromtides
presa a um dos polos da clula. B metfase
II da meiose, pois temos apenas dois cromossomos com cada uma de suas cromtides presa
a um dos polos da clula. C metfase I da
meiose, pois temos cromossomos emparelhados, formando bivalentes com cada membro do
par de homlogos, com suas duas cromtides,
preso a um dos polos da clula.

Moderna PLUS

BIOLOGIA
BIOLOGIA DAS CLULAS

b) A seta indica o centrmero, que mantm as


cromtides-irms unidas at o incio da anfase e por meio do qual o cromossomo se liga s
fibras do fuso mittico.
54. a) Espermatognia e clula-me do gro de plen.
b) II. duplicao do DNA; IV. migrao dos cromossomos homlogos para polos opostos da clula
(anfase I); VI. migrao das cromtides-irms
para polos opostos da clula (anfase II).
c) Em uma etapa de III ocorre a permutao ou
crossing-over. Em IV ocorre recombinao de
cromossomos em decorrncia da segregao
independente dos pares de cromossomos homlogos.
55. a) Sero formados dois espermatozoides sem
cromossomo sexual e dois com ambos os cromossomos sexuais: um X e um Y.
b) Se um vulo fecundado por um espermatozoide
sem cromossomo sexual, forma-se um zigoto X0,
que se desenvolver em uma pessoa com sndrome de Turner. Se um vulo fecundado por um
espermatozoide portador de um cromossomo X
e um cromossomo Y, forma-se um zigoto XXY, que
se desenvolver em uma pessoa com sndrome
de Klinefelter.
56. A clula est em meiose (anfase II), uma vez que
se trata de uma clula haploide, pois os cromossomos no esto presentes aos pares, deduo feita
a partir do tamanho e da forma dos cromossomos,
definida pela posio do centrmero. O nmero
diploide de cromossomos nessa espcie 2n 6.
57. a) A meiose ocorre durante a formao de gametas
(ou gametognese). Podem ser citados como
eventos exclusivos da meiose: emparelhamento
dos cromossomos homlogos, crossing-over
(permutao), segregao independente dos
cromossomos homlogos e reduo do nmero
de cromossomos.
b) Os processos que levam formao de clulas
com trs cromossomos 21 so: a no disjuno
dos cromossomos homlogos, durante a anfase I, e a no disjuno de cromtides-irms,
durante a anfase II.
58. A no disjuno foi ps-zigtica, decorrente de uma
diviso mittica anmala. Se a no disjuno tivesse
ocorrido antes da fecundao, o caritipo anormal
seria detectado em todas as clulas pesquisadas.

AMABIS
MARTHO

14

Unidade C
Captulo 9 Metabolismo energtico (I):
respirao celular e fermentao
Questes objetivas
1. d

2. c

3. c

4. b

5. d

6. d

Questo discursiva
7. A morte de pacientes que usavam DNP para
fins de emagrecimento pode ser explicada pela
alterao provocada no metabolismo energtico
das clulas. O DNP torna a membrana interna da
mitocndria permevel passagem de ons H,
inativando o processo de produo de energia
realizado pela sintetase do ATP. Como consequncia, no h energia para fosforilar molculas
de ADP e produzir molculas de ATP. A ausncia
de produo de ATP inviabiliza praticamente
todos os processos metablicos celulares.
Vestibulares pelo Brasil
Questes objetivas
1. e

2. a

3. e

4. a

5. b

6. c

7. b

8. d

9. a

10. b

11. c

12. b

13. a

14. V

15. b

16. V

17. c

18. V

19. e

20. V

21. a

22. c

23. d

24. d

25. b

26. a

27. d

28. b

29. c

30. a

31. d

32. e

33. d

34. 01 02 04 08 15
35. b

36. c

Questes discursivas
37. a) A gliclise ocorre no citosol.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


b) Nessa fase so gastos 2 ATPs para ativar cada
molcula de glicose que, transformada em 2 cidos pirvicos, produz 4 ATPs, ou seja, um saldo
de 2 ATPs.
38. O ar contm oxignio e permite que o fungo realize
a respirao celular, produzindo gs carbnico e
gua e obtendo mais energia; assim, no produz o
lcool resultante da fermentao nem o vinho.
39. a) O acar representa a fonte de energia para o
levedo.
b) Na presena de oxignio, o levedo utiliza o processo de respirao aerbia, obtendo, a partir
da glicose, uma quantidade maior de energia do
que a obtida em condies anaerbias, o que
favorece seu crescimento.
40. a) As clulas que ficam na superfcie da massa
realizam a respirao celular e as que ficam no
seu interior, a fermentao.
b) Ambas as reaes produzem CO2. A liberao
desse gs faz a massa crescer.
41. a) Nos mamferos, a fermentao (lctica) pode
ocorrer nas clulas musculares em condies
de falta de gs oxignio.
b) Por meio da fermentao podemos obter po,
cerveja, queijo, iogurte etc.
42. a) A rota 1 e a rota 2.
b) Bactrias e fungos; po e iogurte.
43. O excesso de ATP inibe a gliclise, evitando desse
modo a produo desnecessria de mais ATP. Alm
disso, quando h consumo de ATP, os seus produtos de degradao levam reativao de gliclise,
restabelecendo os nveis de ATP.

Captulo 10 Metabolismo energtico (II):


fotossntese e quimiossntese
Questes para pensar e discutir
Questes objetivas
1. a

2. e

3. b

4. d

5. c

6. d

7. a

8. c

9. a

10. d

11. c

12. b

13. d

AMABIS
MARTHO

15

Questes discursivas
14. Essa equao simplificada da fotossntese no
permite identificar que todo o gs oxignio
(O 2 ) liberado provm de molculas de gua.
Para formar 6 O2, como mostrado na equao,
so necessrias 12 molculas de gua (H 2O),
e esse o nmero de molculas que deveria
constar nos reagentes. Sobrariam 6 tomos
de oxignio liberados pelo gs carbnico, os
quais, na fotossntese, originam gua. Assim,
se colocarmos o coeficiente 12 para as molculas de gua reagentes e 6 para as molculas
de gua produzidas, a equao mostraria que
12 molculas de gua foram consumidas no processo e 6 novas foram produzidas. A equao seria:
6 CO2 12 H2O # C6H12O6 6 O2 6 H2O.
15. A manuteno da vida despende energia continuamente, a qual se dissipa na forma de calor e no
pode ser reaproveitada pelos seres vivos. Assim,
estes precisam obter continuamente energia
para manter sua organizao e realizar trabalho.
A energia metablica retirada de molculas orgnicas dos alimentos, que se transformam em
substncias inorgnicas, gs carbnico (CO2) e
gua (H2O), liberando sua energia. A reposio das
molculas orgnicas a partir dessas substncias
inorgnicas se d por meio da fotossntese, em
que energia luminosa do Sol transformada em
energia qumica. a matria orgnica produzida
na fotossntese que serve de alimento a praticamente todos os seres heterotrficos, incapazes
de sintetizar o prprio alimento. Assim, todos os
seres heterotrficos, incluindo os seres humanos,
dependem da luz solar para viver.
16. O cloroplasto apresenta, em seu interior, um
conjunto de bolsas e tubos membranosos interligados mergulhados no estroma. Durante o
processo de fotossntese, ons H so forados
a passar do estroma para o interior do lmen do
tilacoide. Esses ons H acumulados fora no
lmen tendem a se difundir de volta ao estroma,
passando atravs das protenas que compem a
sintetase do ATP. Nessa passagem, h produo
de energia utilizada para fosforilar molculas de
ADP, transformando-as em molculas de ATP. O
ATP utilizado no ciclo das pentoses, fornecendo
energia para a produo de glicose.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

Vestibulares pelo Brasil

AMABIS
MARTHO

16

Captulo 11 O controle gnico das atividades


celulares

Questes objetivas
1. b

2. a

3. d

4. a

5. a

6. c

7. e

8. b

9. c

10. c

11. d

12. b

13. 001 004 032 037

14. F

15. b

16. b

17. a

18. e

19. b

20. a

21. e

22. b

23. d

24. b

25. b

26. a

27. d

28. 02 08 10

29. c

30. e

31. b

32. a
Questes discursivas
33. O aspecto inovador foi o uso da gua, uma substncia abundante no planeta, como fornecedora
de eltrons para a clorofila e de hidrognio para
o NADP, formando NADPH2, que ser utilizado na
produo de glicose.
34. A alga filamentosa realiza fotossntese de forma
mais eficiente nos comprimentos de onda na
faixa do vermelho (700 nm - 650 nm) e do azul
(450 nm), liberando gs oxignio (O2), que atrai as
bactrias.
35. a) I a fotossntese, que ocorre no cloroplasto.
II a respirao aerbia, que ocorre na mitocndria.
b) Por meio do processo I a energia da luz
transformada em energia qumica nos seres
fotossintetizantes e vai sustentar praticamente toda a atividade do mundo vivo. Por
meio do processo II a energia armazenada nas
molculas orgnicas, originalmente por meio
do processo I, liberada para a manuteno
da vida dos seres heterotrficos.

Questes para pensar e discutir


Questes objetivas
1. d

2. b

3. c

4. a

5. b

6. b

7. d

8. c

9. b

10. d

11. c

12. c

13. b

14. d

15. a

16. c

17. b

18. c

19. a

20. d

21. a

22. b

23. a

24. c

25. b

26. c

27. d

28. c

29. d

30. c

31. c

32. d

33. a

34. a

35. a

36. d

37. b

38. b

39. a

40. b
Questes discursivas
41. a) AUG, que corresponde ao cdon de incio da
traduo e codifica o aminocido metionina.
b) UGA, que corresponde ao cdon de parada.
c) metionina leucina leucina treonina isoleucina.
42. As duas cadeias de DNA so:
TGACTGTACAATGAGTGATAAACTGTCATT
ACTGACATGTTACTCACTATTTGAGAGTAA
A cadeia transcrita a superior.
Questes objetivas
1. d

2. a

3. b

4. a

5. c

6. c

7. a

8. c

9. e

10. c

11. c

12. e

Moderna PLUS

BIOLOGIA
BIOLOGIA DAS CLULAS

13. b

14. F

15. d

16. a

17. d

18. b

19. a

20. d

21. b

22. b

23. b

24. d

25. b

26. c

27. d

28. a

29. e

30. b

31. a

32. b

33. c

34. c

35. c

36. e

37. d

38. a

39. a

40. c

41. a

42. b

43. e

44. 04 08 12

45. b

46. e

47. d

Questes discursivas
48. a) a correspondncia entre as trincas de bases dos
cdons e os aminocidos por eles codificados.
b) Porque um nico aminocido pode ser codificado
por mais de um cdon.
49. a) Arginina, pois o nico aminocido que foi traduzido por cdons diferentes (AGA e AGG).
b) No, pois o cdigo gentico degenerado. Alguns aminocidos podem ser codificados por
diferentes cdons e no seria possvel saber
qual dos cdons estava presente no mRNA que
foi traduzido.
50. a) Como C G e C G 58%, temos
C G 58% 2 29%. Da mesma forma,
como A T e A T 100% 58% 42%,
temos A T 21%.
b) Porque a proporo de bases apresentada
refere-se s duas cadeias da molcula de DNA,
no sendo possvel determinar a proporo de
citosina na cadeia que ser transcrita.
51. Trata-se de DNA devido presena da base nitrogenada timina. No entanto, essa molcula no
dupla porque, nesse caso, a quantidade de timina

AMABIS
MARTHO

17

encontrada deveria ser igual de adenina, uma vez


que essas bases nitrogenadas so encontradas
aos pares na dupla-hlice, unidas por pontes de
hidrognio. O mesmo deveria ser observado com
relao s bases citosina e guanina, que tambm
formam pares. Como essa relao no foi observada, o cientista concluiu que a molcula em questo
era formada por um nico filamento.
52. a) Como a duplicao do DNA semiconservativa,
todas as molculas da amostra B tero um
filamento com o istopo pesado (15N) e um com
nitrognio normal (14N).
b) Na faixa superior haver uma quantidade de DNA
igual da faixa inferior, isto , X.
53. a) Os corrimos correspondem s cadeias de nucleotdios, enquanto os degraus correspondem
aos pares de bases nitrogenadas unidas por
ligaes (pontes) de hidrognio.
b) Uma das propriedades do DNA a capacidade
de permitir, atravs de um segmento especfico (gene), a polimerizao de uma nova cadeia
de nucleotdios chamada RNA. Esse processo
recebe o nome de transcrio.
O RNA possui em sua cadeia uma sequncia
de informaes (bases nitrogenadas) que so
utilizadas por ribossomos na organizao de
aminocidos para a montagem de protena. Esse
processo recebe o nome de traduo ou sntese
proteica.
c) Protenas so macromolculas que podem ser
diferenciadas pelos tipos, nmeros e sequncia
de aminocidos.
54. Sim, pois o DNA indiretamente responsvel pela
produo de protenas, entre as quais se encontram as enzimas, que controlam todo o funcionamento celular. Uma alterao no DNA pode levar
produo de uma enzima alterada, o que pode
comprometer processos cujas reaes dependem
da atuao daquela enzima.
55. a) Esses processos ocorrem no ncleo (transcrio)
e no citoplasma (ribossomos [transcrio]).
b) No ocorrer a traduo porque, com a inativao da regio organizadora do nuclolo, no ser
produzido o RNA ribossmico que vai formar os
ribossomos.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

Unidade D

AMABIS
MARTHO

18

por perder o ncleo, tornando-se placas em forma de escama. Em outras palavras, a epiderme
dinmica, e as clulas geradas na camada basal
vo gradativamente se transformando nas camadas espinhosa, granulosa e crnea, finalmente se
desprendendo e sendo eliminadas.

Captulo 12 Tecidos epiteliais


Questes para pensar e discutir
Questes objetivas
1. d

2. c

3. a

4. b

5. b

6. d

7. c
Questes discursivas
8. a) Tecido epitelial de revestimento.
b) Apresentar clulas justapostas e bem unidas
entre si, com pouco material cimentante entre
elas.
c) O tecido A uniestratificado, mas as clulas
de diferentes alturas do a impresso de que
ele estratificado (pseudoestratificado); suas
clulas so prismticas e apresentam clios
(epitlio pseudoestratificado prismtico ciliado).
A funo desse epitlio revestir internamente
a traqueia e, graas ao muco produzido e aos
clios, filtrar e remover partculas que penetram
com o ar inalado.
d) O tecido B uniestratificado, suas clulas so
cbicas e apresentam microvilosidades (epitlio
uniestratificado cbico). A funo desse epitlio
revestir internamente o intestino e, graas s
microvilosidades, absorver eficientemente os
nutrientes contidos nos alimentos ingeridos.
e) O tecido C estratificado, as clulas da camada
mais externa so achatadas e ricas em queratina (trata-se da epiderme, um epitlio estratificado pavimentoso queratinizado). A funo desse
epitlio proteger a pele do atrito e outras
agresses mecnicas, qumicas e biolgicas,
impedir a dessecao, regular a temperatura
corporal e filtrar a radiao ultravioleta.
9. A epiderme renova-se continuamente devido
atividade das clulas da camada germinativa;
as novas clulas produzidas nessa camada vo
empurrando as clulas mais externas. medida
que so empurradas para a superfcie, as clulas
produzidas na camada germinativa sofrem diversas
transformaes: achatam-se, ancoram-se s vizinhas, secretam substncias impermeabilizantes
entre as clulas, produzem queratina e terminam

10. Tomar sol benfico sade, mas deve-se evitar a


exposio no perodo entre 10 e 16 horas, quando
maior a incidncia de radiao ultravioleta do
tipo A, que pode danificar a pele, causando-lhe
queimaduras e envelhecimento precoce. Pessoas
de pele clara e com muitas pintas devem sempre
usar um protetor solar que bloqueie tanto os raios
uvA como os uvB. Nunca se deve utilizar leos ou
produtos caseiros que, alm de no protegerem
a pele, podem produzir irritaes cutneas. Sabe-se que muitos tipos de cncer de pele surgem a
partir de pintas e manchas escuras, muitas delas
causadas pelo sol.
Vestibulares pelo Brasil
Questes objetivas
1. a

2. e

3. 1, 2, 3

4. e

5. c

6. d

7. e

8. c

9. e

10. c

11. c

12. c

13. d
Questes discursivas
14. O suor, ao evaporar, absorve grande quantidade de
calor do corpo, resfriando-o. Quando a temperatura
do corpo sobe, impulsos nervosos provocam dilataes dos vasos sanguneos drmicos, fazendo com
que maior quantidade de sangue passe a circular
na pele. Com isso, aumenta a irradiao de calor
para o meio e o corpo esfria.
15. Glndulas excrinas so aquelas que lanam suas
secrees para fora do corpo ou para a cavidade
dos rgos, como as glndulas salivares. Glndulas
endcrinas so aquelas que lanam suas secrees diretamente no sangue, como a glndula
tireidea.
16. a) A pele das pessoas claras tem pouca melanina
e menor proteo contra a radiao ultravioleta,
principalmente os raios uvA.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


b) Quando a pele exposta ao sol, o organismo produz vitamina D, importante para a absoro de
clcio, que interfere na formao e manuteno
dos ossos e dos dentes.
c) Tecido epitelial: ectoderme (constitui a epiderme). Tecido conjuntivo: mesoderme (constitui a
derme).

Vestibulares pelo Brasil


Questes objetivas

Questes para pensar e discutir


Questes objetivas
1. c

2. b

3. a

4. b

5. d

6. d

7. a

8. b

9. d

10. c

11. a

12. d

13. c

14. c

1. d

2. e

3. b

4. a

5. c

6. b

7. d

8. a

9. a

10. a

11. c

12. d

13. e

14. a

15. d

16. e

17. b

18. e

19. b

20. d

Questes discursivas
15. A mo que apresenta maior grau de ossificao
( direita) a do adulto. A mo esquerda, menos
ossificada e com mais cartilagens nas extremidades sseas (maior transparncia aos raios X), a
mo da criana. Depois dos 20 anos de idade, a
ossificao se completa e o crescimento cessa.
16. A: medula ssea; B: clulas sseas; C: clulas sanguneas; D: matriz extracelular; E: minerais.
17. A osteoporose pode ser causada por diversos fatores; um deles a produo excessiva do paratormnio, secretado pelas glndulas paratireideas.
Esse hormnio estimula o aumento do nmero
de osteoclastos, que digerem a matriz ssea,
causando sua degenerao, com consequente
fraqueza ssea. A osteoporose tambm pode
ser causada pela deficincia de vitamina A, pois
sabe-se atualmente que uma das funes dessa

19

vitamina equilibrar a atividade de osteoblastos e


osteoclastos, regulando assim a contnua reconstruo ssea. Assim, a ingesto dessa vitamina ou
de substncias ricas em betacaroteno (cenoura,
beterraba etc.) previne a osteoporose. O exerccio
fsico estimula a osteognese e pode ajudar a
prevenir e a combater os efeitos da osteoporose,
principalmente em pessoas de idade avanada.
Alm disso, a falta de clcio na alimentao durante a infncia, e tambm a falta de vitamina
D, pode levar ao raquitismo, com problemas no
crescimento e deformaes sseas. Nos adultos,
a deficincia de clcio ou de vitamina D pode levar
osteomalacia, que se caracteriza por fragilidade
dos ossos e maior suscetibilidade a fraturas.

17. O pncreas considerado uma glndula de secreo mista ou anfcrina. A parte excrina lana
sua secreo no duodeno. Essa secreo o suco
pancretico, que contm bicarbonatos e enzimas
digestivas. A parte endcrina secreta hormnios,
entre os quais a insulina, responsvel pelo controle
do teor de acar no sangue.

Captulo 13 Tecidos conjuntivos

AMABIS
MARTHO

Questo discursiva
21.

I. Tecido sseo.
II. Frouxo ou denso.
III. Hematopoitico.

Captulo 14 Tecido sanguneo


Questes para pensar e discutir
Questes objetivas
1. e

2. f

3. a

4. b

5. c

6. d

7. e

8. f

9. b

10. d

11. a

12. c

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

AMABIS
MARTHO

Questes discursivas
13.

Plaquetas
Plaquetas

Tromboplastina
Protrombina
Tromboplastina

Protrombina
Ca2
2

Ca
Ca2

Trombina 2
Ca
Trombina

14.

Fibrina
Fibrina

Fibrinognio

Fibrinognio

Tipos de
leuccito

Caractersticas
gerais

Funes

Locais
de
formao

Quantidade
por mm3
de sangue

Neutrfilos

Granulosos,
ncleo
trilobado

Fagocitam
agentes
invasores

Medula
ssea

6.000 a
7.000

Eosinfilos

Granulosos,
ncleo
bilobado

Atuam no
combate a
vermes
parasitas

Medula
ssea

100 a 300

Basfilos

Granulosos,
ncleo irregular,
granulaes
grandes

Participam
de reaes
alrgicas

Medula
ssea

50 a 100

Moncitos

Granulosos,
ncleo em
forma de
ferradura

Originam
macrfagos
e
osteoclastos

Medula
ssea

300 a 800

Linfcitos

Granulosos,
divididos em
B ou T

Participam
das defesas
do corpo

Medula
ssea e
rgos
linfoides

2.000 a
3.000

Vestibulares pelo Brasil


Questes objetivas
1. e

2. e

3. c

4. d

5. b

6. c

7. d

8. a

9. b

10. e

11. d

12. e

13. c

14. d

15. a

16. a

17. a

18. b

19. b

20. b

21. d

22. d

23. b

24. d

20

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS

AMABIS
MARTHO

21

Questes discursivas

Questes discursivas

25. Uma das funes do sangue levar oxignio e


nutrientes a todas as clulas. Estas, realizando
a respirao celular, obtm energia para realizar
todas as funes.

14. a) O cido lctico produto da fermentao lctica


que ocorre no msculo esqueltico em situao
de oxigenao insuficiente.

26. Se o sangue no chega ao local do tumor, as clulas no recebem oxignio nem nutrientes e no se
multiplicam.
27. Paciente X. A quantidade de plaquetas menor
que a normal, e essas clulas so essenciais para
a coagulao sangunea.

Captulo 15 Tecidos musculares


Questes para pensar e discutir

15. a) O grupo C corresponde ao dos maratonistas e o


grupo A, ao dos velocistas.

Questes objetivas
1. d

2. a

3. b

Questes discursivas
4. a) Um atleta especialista em corrida de 100 metros
rasos, para obter o mximo desempenho nessa
especialidade, precisa desenvolver em seus
msculos miosina do tipo II (rpida), uma vez
que esse tipo de miosina contrai cerca de dez
vezes mais rapidamente que a do tipo I.
b) O atleta dever iniciar o treinamento at trs
meses antes da competio prevista para setembro, ou seja, at julho. Seria melhor treinar
at o dia da competio, pois a inatividade acarreta a reduo da miosina que foi desenvolvida
no perodo de treinamento.
5. A) miosina; B) ons Ca2; C) ATP; D) mimeros; E)
respirao celular; F) fermentao lctica; G) gs
oxignio.
Vestibulares pelo Brasil
Questes objetivas
1. c

2. a

3. a

4. a

5. c

6. c

7. a

8. e

9. c

10. a

11. d

12. a

13. e

b) As responsveis pela contrao dos msculos


so as miofibrilas, constitudas pelas protenas
actina e miosina. O estmulo para a contrao
dado por um impulso nervoso. Com o estmulo,
ons Ca2 so bombeados para o citoplasma e
reagem com as molculas de miosina, permitindo que as fibras de actina deslizem sobre
a miosina. Gasta-se ATP. Ao cessar o estmulo
nervoso, os ons Ca2 so rebombeados para o
retculo; a ligao entre as molculas de miosina
e actina se desfaz e as miofibrilas relaxam.

b) A dor causada pelo acmulo de cido lctico


produzido pela fermentao lctica nas fibras
musculares. A razo que, na ausncia de exerccio fsico adequado, a irrigao sangunea
dos msculos no se desenvolve o suficiente
e, quando h um esforo muscular acentuado,
a quantidade de gs oxignio que chega ao
msculo no suficiente para suprir toda a
respirao celular que est sendo necessria
e as clulas passam a produzir energia por fermentao lctica.
16. a) Velocista: IIB; maratonista: I.
b) Na fibra do tipo I, h um maior nmero de mitocndrias, onde ocorrem o ciclo de Krebs e a
cadeia transportadora de eltrons, que fornecem o ATP (energia) para uma atividade fsica de
longa durao e de pequena intensidade, como
a maratona.
17. Quando h um esforo muscular acentuado e a
quantidade de gs oxignio que chega ao msculo
no suficiente para suprir toda a respirao celular que est sendo necessria, as clulas passam
a produzir energia por fermentao lctica, em que
gerado cido lctico. Uma maneira de se evitar
a produo excessiva de cido lctico estimular
uma maior irrigao sangunea dos msculos,
o que pode ser obtido por meio de treinamento
adequado.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


18. a) O aumento no nmero de capilares permite maior
irrigao e, portanto, maior aporte de oxignio
e nutrientes para as fibras musculares.
b) O glicognio uma reserva de glicose que pode
ser utilizada na produo de ATP durante o exerccio.

AMABIS
MARTHO

22

Vestibulares pelo Brasil


Questes objetivas
1. d

2. a

3. a

4. e

5. b

6. a

7. 001 004 016 021


Captulo 16 Tecido nervoso

8. a) V; b) V; c) F; d) F

Questes para pensar e discutir

9. a) V; b) F; c) F; d) F
10. a) V; b) V; c) F

Questes objetivas
1. c

2. d

3. d

4. a

5. a

6. b

7. c

8. a

9. a

10. c
Questes discursivas

Instante A

+
+

+
+

+
+

+
+

+
+

12. e

13. c

14. c

15. c

16. d

17. e

18. c

19. c

20. c

21. c

22. e

23. V, F, V, F, F

24. a

25. 02 32 34

11. a) No instante A, o primeiro voltmetro marca


40 mV: est ocorrendo o potencial de ao,
com despolarizao da membrana. O segundo
voltmetro marca 70 mV: o potencial de repouso, indicando que o impulso nervoso ainda
no atingiu essa regio do axnio. No instante
B, o primeiro voltmetro marca 70 mV, que
corresponde ao potencial de repouso, indicando que houve a repolarizao da membrana
aps a passagem do impulso nervoso. O valor
de 40 mV indicado pelo segundo voltmetro
mostra que o potencial de ao chegou a essa
regio do axnio.
b) Esquema a seguir:

+
+

11. a

26. b

27. b

Questes discursivas
28. A bainha de mielina permite uma propagao
rpida porque a conduo do impulso descontnua, isto , salta de um n neurofibroso para o
seguinte. Acima de 1 m de dimetro, a diferena
de propagao do impulso nas fibras mielinizadas
e desmielinizadas torna-se muito acentuada.
29. O bilogo referiu-se ao tecido nervoso, pois nele
que se encontram os neurnios, cujas extremidades axnicas liberam neurotransmissores que
geram novos impulsos em neurnios adjacentes.

Instante B

+
+

+
+

+
+

+
+

+
+

+
+

c) A velocidade de propagao do impulso nervoso


nesse neurnio da ordem de 40 km/h.
12. Ao se combinar aos receptores de acetilcolina, o
curare impede a transmisso do impulso nervoso,
causando paralisia muscular. Os movimentos respiratrios cessam e ocorre a morte do animal.

30. Neurnio a clula nervosa. Nervo um conjunto


de neurofibras (axnio, dendritos ou ambos) envolvidas por tecidos conjuntivos protetores.
31. a) Por meio de inverses bruscas no potencial eltrico de reas da membrana da clula nervosa, a
inverso do potencial, denominada potencial de
ao, transmite-se como uma onda que percorre
as clulas, dos dendritos para o axnio.
b) O impulso nervoso transmite-se de uma clula
para outra pela sinapse nervosa. As sinapses
podem ser qumicas ou eltricas.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


32. a) Y Dendritos Corpo celular Axnio (II)
Dendritos Corpo celular Axnio (I)
X.
b) A liberao de neurotransmissores que estimulam eletricamente os dendritos do neurnio I.
c) As extremidades dos axnios so dilatadas e
seu citoplasma apresenta bolsas membranosas
repletas de neurotransmissores; essas bolsas
se fundem membrana plasmtica e liberam
seu contedo no espao sinptico. Os neurotransmissores ligam-se a protenas receptoras
da membrana dos dendritos seguintes gerando
o potencial de ao. Os neurotransmissores so,
ento, destrudos por enzimas.

Unidade E
Captulo 17 Reproduo e ciclos de vida
Questes para pensar e discutir
Questes objetivas
1. b

2. c

3. a

4. d, e

5. d

6. d

7. d

8. b

9. c

10. d

11. b

12. a

13. d

14. d

15. a

16. c

17. b

Questes discursivas
18. Como orientao aos estudantes na pesquisa
que iro desenvolver, a professora ou o professor
poder:
a) Recomendar que o entrevistado seja devidamente identificado; dados dos entrevistados comparados s respostas fornecidas por eles podem
originar interpretaes significativas. Podem
ser solicitados, por exemplo, o nome; a idade; o
sexo; a nacionalidade (e o estado do Brasil em
que a pessoa nasceu); o grau de escolaridade;
a religio; a renda familiar.
b) Sugerir algumas perguntas objetivas. Por exemplo: a favor do aborto? (sim, no, por qu?);
Deve-se continuar gerando bebs de proveta?
(sim, no, por qu?); a favor ou contra o comrcio de gametas e embries? (por qu?); a favor
ou contra a realizao de clonagens em seres
humanos? (por qu?).

AMABIS
MARTHO

23

c) Ajudar os estudantes na tabulao dos dados


obtidos e na comparao dos dados dos entrevistados e suas respostas.
19. Na espcie humana, denominam-se gmeas as
crianas nascidas em um mesmo parto. Gmeos
monozigticos (idnticos) originam-se de um mesmo zigoto (um nico vulo fecundado), cujo embrio
se separou em dois. Portanto, as crianas tm
o mesmo sexo e a mesma constituio cromossmica e gnica. Gmeos dizigticos (fraternos)
originam-se de dois zigotos, resultantes de fecundaes independentes (dois vulos fecundados).
As crianas apresentam constituies cromossmicas e gnicas to distintas quanto dois irmos
nascidos em partos diferentes. Portanto, crianas
originadas de um mesmo grupo de embries fecundados in vitro, mas nascidas em pocas diferentes,
no podem ser consideradas gmeas, pois no
nasceram em um mesmo parto.
20. a) As relaes sexuais (sem outros cuidados) devem ser evitadas entre o 7o e o 19o dia (inclusive)
aps o incio do ciclo menstrual.
b) As relaes sexuais (sem outros cuidados) devem ser evitadas entre o 9o e o 14 o dia (inclusive)
aps o incio do ciclo menstrual.
Vestibulares pelo Brasil
Questes objetivas
1. c

2. d

3. e

4. a

5. a

6. b

7. V, F, V, V

8. e

9. b

10. e

11. b

12. e

13. F, F

14. b

15. d

16. b

17. c

18. b

19. b

20. d

21. a

22. c

23. c

24. c

25. c

26. d

27. a

28. b

29. e

30. d

31. d

32. c

33. c

34. b

35. a

36. 04 64 68

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


Questes discursivas
37. a) Est representada a reproduo da ameba por
diviso binria.
b) Nesse processo os cromossomos duplicam-se
e ocorre diviso do ncleo, seguida de diviso
do citoplasma.
38. a) Clula I: zigoto (2n); veio da fecundao. Clula
II: esporos (n); vieram da meiose do indivduo
(X). Clula III: gametas (n).
b) X 2n 24; Y n 12; Z n 12.
39. 1. Acrossomo: digesto das membranas do vulo
para permitir a fecundao.
2. Ncleo: material cromossmico (gentico).
3. Mitocndrias: fornecimento de energia para o
batimento flagelar.
4. Flagelo: locomoo do espermatozoide.
40. a) Ocorre nos ovidutos.
b) Flagelo.
c) Membrana pelcida.
41. Porque o ncleo contm as informaes genticas
de um organismo; para ser um clone do camundongo macho necessrio receber ncleo de suas
clulas diploides, no caso extradas da cauda.

Captulo 18 Noes de embriologia


animal
Questes para pensar e discutir
Questes objetivas
1. c

2. d

4. d

5. b

3. b

Questes discursivas
6. Em A, as oito clulas que se formam aps a terceira
clivagem no diferem muito em tamanho; em B, as
clulas que se formam no polo animal so muito
menores que as do polo vegetativo. Essa diferena decorre do fato de o ovo de anfioxo ter pouco
vitelo (ovo oligolcito), apresentando clivagens
completas, com a formao de blastmeros quase
de mesmo tamanho, enquanto o ovo de anfbio
tem vitelo concentrado em um dos polos (ovo
heterolcito) e as clivagens, apesar de completas,
do origem a blastmeros grandes, ricos em vitelo
(macrmeros), e blastmeros pequenos, quase
sem vitelo (micrmeros).

AMABIS
MARTHO

24

7. Com relao ao esquema 1:


a) o embrio representado encontra-se em fase de
gstrula jovem.
b) a1: ectoderma; b1: endoderma; c1: arquntero;
d1: blastporo.
Com relao ao esquema 2:
a) o estgio de desenvolvimento que est se iniciando o de nurula.
b) a2: ectoderma; b2: mesoderma (futuro somito);
c2: arquntero; d2: celoma (incio de formao);
e2: placa neural; f2: notocorda em formao.
c) Ver desenho da figura 18.16, no quadro sobre o
desenvolvimento do anfioxo.
Vestibulares pelo Brasil
Questes objetivas
1. b

2. 04

3. e

4. d

5. b

6. F, V, V, F

7. 0, 3, 4

8. b

9. a

10. a, b, d, e

11. b

12. b

13. e

14. c

15. 001 004 016 021

16. b

17. V

18. a

19. d

20. c

21. d

22. d

23. a

24. e

25. c

26. d

27. d

28. a

29. a

30. d

31. e

32. a
Questes discursivas
33. a) A; zigoto ou clula-ovo. B: mrula. C: blstula. D:
gstrula. E: nurula.
b) A: clula-ovo ou zigoto. B: mrula, com blastmeros indiferenciados. C: blstula, com blastoderma e cavidade chamada blastocela. D: gstrula,
com dois tecidos embrionrios, o ectoderma e
o mesentoderma; cavidade digestria primitiva,
o arquntero. E: nurula, com tubo neural, notocorda e celoma.
34. a) Ectoderma, mesoderma e endoderma.
b) Os ossos originam-se do mesoderma; o encfalo
do ectoderma e os pulmes do endoderma.

BIOLOGIA

Moderna PLUS

BIOLOGIA DAS CLULAS


35. a) Tubo nervoso, ou neural, com encfalo e medula
no decorrer do desenvolvimento (I). Coluna vertebral (II).
b) Mrula, blstula e gstrula.
36. a) O mnio um anexo embrionrio composto por
uma bolsa cheia de lquido; sua funo impedir a desidratao do embrio e proteg-lo de
impactos mecnicos.
b) Rpteis, aves e mamferos.
37. a) a saco vitelnico; b crio; c mnio;
d embrio; e alantoide.
b) A fecundao interna; isso garante proteo
aos gametas e aumenta as chances de fecundao.

AMABIS
MARTHO

25

Vestibulares pelo Brasil


Questes objetivas
1. c

2. c

3. c

4. d

5. c

6. c

7. a

8. c

9. a

10. e

11. e

12. c

13. e

14. d

15. 002, 008, 032

16. d

17. d

18. b

20. b

21. d

19. a

22. 01 02 04 07

Captulo 19 Desenvolvimento embrionrio


de mamferos

23. a

24. b

Questes para pensar e discutir

26. c

27 a

25. F, V, F, F, V
28. b

Questes objetivas
1. c

2. b

3. a

4. c

5. b

6. d

7. e

8. c

9. b

10. d
Questes discursivas
11. A) Ovrio. B) Tuba uterina. C) tero. D) Endomtrio.
12. 1) Ovulao. 2) Fecundao. 3) Primeira segmentao (mitose). 4) Embrio no estgio de dois blastmeros. 5) Mrula. 6) Blastocisto. 7) Implantao
do blastocisto no endomtrio (nidao).
13. O embrio permanece no interior da membrana
pelcida (capa gelatinosa que envolvia o gameta
feminino) at chegar ao tero, portanto, entre os
estgios 5 e 6 indicados na figura. A membrana
pelcida impede a implantao do embrio na tuba
uterina.
14. 1) Crio. 2) mnio. 3) Alantoide. 4) Saco vitelnico.
15. 5.
16. A regio do crio, que compe a parte embrionria
da placenta.

Questes discursivas
29. Os gmeos ditos univitelinos so originrios da
fecundao de um mesmo vulo por um mesmo
espermatozoide, o que os torna geneticamente
idnticos e no identificveis pelo sequenciamento do DNA, no sendo portanto possvel definir a
paternidade do recm-nascido em questo.
30. Atravs da placenta e do cordo umbilical.
31. a) Sobre a paternidade de Alfredo, porque seus
supostos pais so geneticamente diferentes
(os pais formaram-se de dois vulos e de dois
espermatozoides diferentes).
b) A outra criana (Renato) no pde ter a paternidade identificada porque seus supostos pais
so geneticamente iguais (os pais formaram-se
do mesmo zigoto).
32. a) A separao de clulas originadas de um nico zigoto, produzindo gmeos idnticos, ou
monozigticos. A fecundao de dois ou mais
vulos por um nmero correspondente de espermatozoides, produzindo gmeos fraternos,
ou dizigticos.
b) No caso acima, os gmeos so dizigticos, originados pela fecundao de dois vulos por dois
espermatozoides.