Você está na página 1de 41

Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno)

Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214
Departamento de Bioquímica
Instituto de Química
2009

Docentes:
Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup.
Sala 854
Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala
1013/1018

Monitores:
Cecília Midori Ikegami (cikegami@usp.br)
Mariana Lemos Duarte (mlduarte@gmail.com)
Programa

Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise;


gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons;
fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de
triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos
transgênicos.

Bibliografia

- Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999.
- Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002.
- Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996.
- Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000.
- Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004.
- Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002.
- Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc.,
5th ed New York; 2001.
- Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing
Company; 1996.
- Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G.
Scrimgeour Prentice Hall; 1993.
- Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995.
- Nutritional Biochemistry: T. Brody – Academic Press; 1994.
- Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996.

Critério de Avaliação
O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao
longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da
Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará
1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final
deverá ser feito através da seguinte equação:

NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5


10

2
Cronograma de Aulas

17/08 Aula 1 Enzima (funções e propriedades)


19/08 Aula 2 Catabolismo/ Anabolismo (introdução)
24/08 Aula 3 Glicolise (via das pentoses)
26/08 Aula 4 Gliconeogênese – 1° Teste
31/08 Aula 5 Oxidação de Triacilgliceróis
02/09 Aula 6 Formação AcetilCoA (vitaminas e cofatores) – 2° Teste
07/09 Feriado
09/09 Aula 7 Ciclo de Krebs
14/09 1° Prova
16/09 Aula 8 Fosforilação Oxidativa
Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia
21/09
de transporte de elétrons.
Sala multimídia - Cadeia de transporte de elétrons e fosforilação
23/09 Aula 9
oxidativa
28/09 Aula 10 Metabolismo de Glicogênio – 3° Teste
30/09 Aula 11 Controle Hormonal (insulina, glucagon e vitaminas)
05/10 Aula 12 Controle Hormonal (insulina, glucagon e vitaminas)
07/10 Aula 13 Síntese de Triacilglicerol – 4° Teste
12/10 Feriado
14/10 2° Prova
19/10 Aula 14 Metabolismo de aminoácidos
19/10 Aula 15 Ciclo da uréia
21/10 Aula 16 Fonte de Nutrição – 5° Teste
26/10 Feriado
28/10 Aula 17 Regulação Integrada
02/11 Feriado
04/11 Aula 17 Regulação Integrada
09/11 Aula 18 Diabetes – 6° Teste
11/11 Aula 19 Tradução e Código Genético
16/11 Aula 20 Regulação da Expressão Gênica
18/11 Aula 21 Biologia Molecular (testes diagnósticos)
23/11 Aula 22 Técnicas de Biologia Molecular; Transgênicos – 7° Teste
Laboratório 2: Transformação de bactérias com DNA plasmidial e
25/11
eletroforese em gel de agarose
30/11 Apresentação de Seminários (Alimentação e BioMol)
02/12 3° Prova

3
AULA 1: ENZIMAS

I. Classifique as afirmações abaixo como verdadeiras ou falsas:


1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de
enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( )
1.2. A velocidade da reação é proporcional ao tempo da reação. ( )
1.3. A velocidade da reação é proporcional à concentração de substrato.( )
1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração
de substrato não seja limitante. ( )
1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( )
1.6. A quantidade de produto formado depende do tempo da reação. ( )
1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( )

2. Definir enzima, substrato e sítio ativo

3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da


concentração de S.

4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade
da enzima pelo seu substrato

5. Fazer o gráfico da velocidade de uma reação enzimática em função de:


a. Concentração de enzima;
b. Temperatura;
c. pH.
Justificar a forma dos gráficos

6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto
nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce
porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para
preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns
minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e
armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse
procedimento.

7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de
inibidor escolhido, competitivo ou não competitivo?

4
Aula 2: Introdução ao Catabolismo e Anabolismo

Obtenção de energia pelo Metabolismo

MAPA I
Esquemageral dadegradaçãodenutrientes

ALIMENTOS

POLISSACARÍDIOS PROTEÍNAS LIPÍDIOS

Glicose Aminoácidos ÁcidoGraxo

CO 2

NAD + NADH
FAD FADH 2

ADP+P i

O2

H2O

ATP

A - Ler o relato dos três casos apresentados a seguir.


CASO 1
P.B., 32 anos, trabalhador da construção civil. Deu entrada no serviço de emergência, trazido por
colegas, por volta das 10:00 horas da manhã, após ter desmaiado no trabalho. Conta que nos
últimos dias alimentou-se mal e, nesta manhã, saiu de casa sem comer nada e iniciou o trabalho.
Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas. Com o passar
dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e
sudorese fria. Insistindo com a atividade que fazia, a tontura tornou-se muito forte e escureceu–
lhe a vista, vindo a cair da própria altura.
No momento do exame, encontra-se pálido, sudoreico, extremidades frias e referindo forte dor
de cabeça.

CASO 2
R.T.P., 27 anos, masculino, analisador de sistemas, fumante. O paciente chegou no dia anterior a
La Paz, vindo de Salvador. Relata que logo ao sair do aeroporto, precisou subir um lance de
escada e sentiu-se muito cansado. Embora tenha feito refeições corretas, o cansado persistiu e
agravava-se com atividades físicas que até a véspera fazia sem problemas. No final do terceiro
dia, tendo tido necessidade de um esforço intenso, desmaiou, sendo conduzido ao Pronto
Atendimento. Depois dos exames preliminares, foi posto sob respiração em balão de oxigênio e
rapidamente sentiu-se melhor. Foi dispensado do hospital, com a recomendação de que ingerisse
chá ou outra bebida estimulante.

CASO 3

5
J.P.F., 42 anos, masculino, executivo, fumante. O paciente iniciou há seis meses um quadro de
dor no peito, em aperto, com duração de cinco a dez minutos, no máximo, sempre que fazia
algum esforço físico, como subir uma ladeira caminhando, ou ao sentir emoções. A dor
melhorava com o repouso. Fazendo exames de avaliação cardíaca, foi constatada obstrução
parcial de uma das artérias coronárias. Desde então vinha fazendo uso de remédios que
promovem dilatação das coronárias.
Logo ao sair para o trabalho, relata o filho que o estava acompanhando, o paciente sentiu forte
dor no peito, de inicio abrupto. Conta que o seu pai ficou pálido, começou a suar frio e dentro de
poucos minutos perdeu a consciência e caiu. Com esse quadro foi trazido ao pronto socorro e
embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca, o paciente
foi a óbito.

B – Com base no Mapa I, responder as questões seguintes.


1. A falta de que composto provocou os sintomas relatados nos três casos descritos?
O que restringiu a síntese deste composto em cada um dos casos?
2. Os sintomas dos casos 1 e 2 são claramente neurológicos. Que partes do Mapa I devem
ser suprimidas quando referente exclusivamente ao cérebro?
3. A síntese de ATP é obtida por oxidação ou redução dos alimentos?
4. Discutir as seguintes afirmações:
a. A oxidação biológica consiste na retirada de hidrogênio do substrato.
b. A quantidade de energia derivada da oxidação de nutrientes é a mesma, quer se processe
in vitro, quer ocorra in vivo.
c. Os processos celulares que requerem energia utilizam a energia térmica proveniente da
oxidação dos alimentos.
d. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um
composto rico em energia (ATP).
e. A única função dos alimentos é fornecer energia.
f. Os compostos característicos de um dado organismo devem ser supridos pela dieta.
5. Que compostos são produzidos como conseqüência desta reação? Entre os compostos
produzidos, quais são excretados e qual é aproveitado pelas células?
6. Resuma: por que é necessário comer e por que é necessário respirar?
7. As concentrações celulares de Na+ e K+ são, respectivamente 25 mmols/L e 150 mmols/L e as
concentrações plasmáticas são 140 mmols/L e 5 mmols/L. A manutenção destas
concentrações é espontânea? Como o organismo consegue mantê-las?
8. Acrescentar O2, HPO42-, ADP e ATP nos espaços do esquema abaixo.

Alimentos + Processos que


requerem energia

VIAS METABÓLICAS DEGRADATIVAS


No Mapa II (página seguinte) encontra-se, entre parênteses, o número de átomos de carbono de
alguns compostos.

1. Quais são os passos irreversíveis que aparecem no mapa?


2. Qual o primeiro composto comum à degradação de carboidratos, proteínas e lipídios?

6
3. Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos,
ou lipídios ou proteínas. Estes três tipos de compostos são essenciais para a sobrevivência. Não
havendo outras restrições na dieta, prever que grupo de animais sobreviveria, verificando se é
possível sintetizar:

a. ácido graxo a partir de glicose d. proteína a partir de ácido graxo


b. proteína a partir de glicose e. glicose a partir de proteína
c. glicose a partir de ácido graxo f. ácido graxo a partir de proteína

Indicar no mapa a via utilizada para cada conversão.

4. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose.
Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se
insuficientes para manter a glicemia?

MAPAII
POLISSACARÍDIOS PROTEÍNAS LIPÍDIOS

GLICOSE AMINOÁCIDOS ÁCIDOS GRAXOS


Asp Gly Leu Glu
Ala Ile
Fosfoenolpiruvato (3) Ser Lys
Cys Phe

Lactato Piruvato (3)

CO 2
Acetil-CoA(2)

CO 2

Oxaloacetato (4) Citrato (6)

CO 2

Malato (4) Isocitrato (6)

CO 2
Fumarato (4) α Cetoglutarato (5)

CO 2
Succinato (4)

1 – Ler CAPÍTULO 4, página 45 - O SENTIDO DAS REAÇÕES


2 – ALGUNS TIPOS DE ENZIMAS:

Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em


geral ATP) para um aceptor.
Isomerases: Catalisam reações de isomerização.
Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma
posição para outra, na mesma molécula.
Desidrogenases: Catalisam reações de óxido-redução, por transferência de hidrogênio do
substrato para uma coenzima, geralmente NAD+ ou FAD. Estas reações, na maior parte dos
casos, são reversíveis.
Aldolases: Cindem açúcares fosforilados, dando origem a diidroxiacetona fosfato e a outro
açúcar, com três átomos de carbono a menos que o substrato original.
Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato.

7
AULA 3: GLICÓLISE

HOCH 2
O

HO
OH
OH
GLICÓLISE Glicose

OH
ATP ATP
ADP ADP

P -OCH 2
O
OH Glicose 6-fosfato
HO OH
OH

P -O-CH 2 O CH 2OH
HO Frutose 6-fosfato
OH
HO
ATP
ATP

ADP
ADP

P -O-CH 2 O CH 2O- P

HO OH
Frutose 1,6 bisfosfato
HO

H2C-O- P HC=O

C=O HC-OH Diidroxiacetona Gliceraldeído


fosfato 3-fosfato
H2C-OH H2C-O- P
Pi
Pi
NAD +
NAD +
NADH
NADH
O=C-O- P
HC-OH 1,3 Bisfosfoglicerato
H2C-O- P

ADP ADP
ATP ATP
O=C-O -

HC-OH 3-Fosfoglicerato
H2C-O- P

COO -

HC-O- P
2-Fosfoglicerato
H2C-OH

H2O

COO -

C-O- P
Fosfoenolpiruvato
CH 2
ADP
ADP
ATP
ATP
COO - COO -
HC-OH C=O
Lactato Piruvato
CH 3 NAD + NADH CH 3
NAD + NADH

Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas,


a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos
alunos. Os parâmetros medidos estão apresentados nas figuras 1 e 2.

8
170 B (tiro de 30s)
B A (caminhada)
160
Freqüência Cardíaca (bat/min)

150

140
Figura 1: freqüência cardíaca durante caminhada
130
de 15 min (A) e tiro de 30 s (B)
120

110 A
100

90

80

00 2 4 30s 6 8 10 14 15 min
16

tempo

Figura 2: Níveis de lactato plasmático durante


caminhada de 15 min (A) e tiro de 30 s (B)

8
B
7
B (tiro de 30s)
Lactatemia (mmol/L)

6 A (caminhada)
5

2
A
1

0
00 2 4 30s 6 8 10 14 15min
16
tempo

Analisando os dados acima e com auxilio de livros responda as questões:


1. O esforço físico leva à produção de lactato?
2. O exercício é o único processo que leva à produção de lactato?
3. Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante?
4. Em caso afirmativo, esta adaptação foi suficiente para manter a lactemia basal?
5. Qual a utilidade, para a musculatura em exercício, do aumento da freqüência cardíaca?
Para responder as questões de 6 a 14, utilizar apenas o mapa da glicólise (p.124).
6. Examinando a via metabólica que converte glicose a lactato (a glicólise),
localize as reações que produzem ATP.
7. Quais são os produtos finais da via glicolítica?
8. Para cada molécula de glicose consumida qual é o número de moléculas de
piruvato produzido?
9. Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M, é possível
estimar a quantidade de glicose que pode ser convertida a lactato?
10. Em lugar de excretar lactato, a hemácia poderia excretar piruvato?
11. Considerando o número de moléculas de ATP consumidas e formadas,
estabelecer o saldo final de ATP na degradação de uma molécula de glicose
pela via glicolítica.

9
12. Os Casos clínicos 2 e 3 (p. 10) indicavam que o oxigênio é necessário para a
produção de energia pelo organismo. No entanto, a glicólise é anaeróbia e
produz ATP. Explicar este aparente paradoxo, consultando o Mapa I.
13. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase.

AULA 4: GLICONEOGÊNESE

1. Indicar a função da via glicolítica.


a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via
glicolítica.
b) Se a dieta contiver quantidades insuficientes de carboidratos, a partir de que tipo de
macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as
células que dependem deste açúcar? [Consulte o MAPA II, à p. 7]
c) Muitos aminoácidos podem ser convertidos a piruvato que, por sua vez, pode ser
convertido a glicose por um processo chamado gliconeogênese. Como é possível esta
transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta
conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese?
d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise
e da gliconeogênese?
e) Explicar como é feito o controle das duas vias, usando as informações do quadro
apresentado acima. Levar em consideração o fato de o nível de frutose 2,6 bisfosfato nos
hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições.
f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Citar o tecido
responsável pela gliconeogênese.

2. Saccharomyces cerevisiae (levedo) cresce anaerobiamente, usando glicose como fonte de


carbono e produzindo etanol. Seria possível excretar piruvato em lugar de etanol? Que
semelhança tem este metabolismo com o do tecido muscular em condições de esforço
extenuante?
3. É possível converter lactato a glicose por um processo chamado gliconeogênese. Como é
possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam
esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese?
4. 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a
conversão de glicose a glicose 6-fosfato. Explique.
5. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese.
6. Citar as vitaminas necessárias para as seguintes conversões:

a) glicose → lactato b) lactato → glicose

7. Citar os compostos que devem ser fornecidos à via glicolítica para:


a) iniciá-la (haver formação de lactato).
b) mantê-la em funcionamento

10
11
AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS

1. O que provoca a degradação dos triacilgliceróis no tecido adiposo?


2. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos
dos radicais acila do triacilglicerol estiverem marcados com C14, quando todos os carbonos do
glicerol estiverem marcados ou em ambos os casos?
3. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior
da mitocôndria se processe com eficiência. Essa enzima, entretanto, catalisa uma reação da
qual os ácidos graxos não participam. Explicar este aparente paradoxo.
4. É possível haver oxidação completa de um ácido graxo sem a presença de carnitina?
5. O ciclo de Lynen pode ser feito em condições anaeróbias?
6. Além das enzimas, que compostos deveriam ser adicionados a um tubo de ensaio que
contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA?
7. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo
de Lynen: riboflavina, pantotenato, biotina, nicotinamida e/ou ácido lipóico?
8. Citar a localização celular da beta-oxidação.
9. Por que hemácia e tecido nervoso não oxidam ácidos graxos?
10. Em aerobiose, o levedo pode oxidar etanol. Como é possível obter ATP a partir de
etanol?

Caso clínico
Identificação: A. C., 35 anos, casada.
Queixa e Duração: Aumento de peso após as gestações
História Pregressa da Moléstia Atual: A paciente relata, na admissão a um centro de
emagrecimento, que casou há cinco anos pesando 60 kg. Após dois anos de casamento,
nasceu o primeiro filho. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito
pouco após o parto. Quando o primeiro filho completava um ano e meio ano, a paciente
engravidou novamente, e após esse segundo parto, seu peso chegou a 105 kg. Por esse motivo
deu entrada em um spa. Não apresenta problemas de saúde e não se queixa de nenhum mal
estar.
Exame Físico: Peso na admissão 105,4 kg. Altura de 1,67 m. Apresenta boa função cardíaca e
pulmonar. Encontra-se com leve edema dos membros inferiores.
Exames Laboratoriais:
Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%)
Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL)
Soro lipêmico
Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL)

Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias,
distribuída em cinco refeições. Após passar por avaliação médica e de capacidade física,
12
iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de
exercícios, feitos de maneira fracionada e diversificada, dando ênfase às caminhadas. Por
volta do 4o dia de estadia, a paciente sentiu-se com sonolência, sensação de enjôo e gosto
amargo na boca, tendo sido orientada quanto ao caráter reversível desses sintomas. No 10o
dia da estadia a paciente pesava 94,8 kg, portanto com perda de cerca de 10% do peso inicial.
Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia, dispensando mais
tempo para as caminhadas (duas vezes ao dia, com cerca de uma hora de cada vez), dança
(cerca de uma hora por dia) e atividades na piscina, como jogos, hidroginástica e natação (no
mínimo uma hora por dia). Após completar 30 dias de estadia a paciente retornou para casa
pesando 85,7 kg, totalizando uma perda total de 19,7 kg (18,7%).
Manutenção: Regime alimentar, com uma dieta de aproximadamente 900 kcalorias, e
manutenção de prática de exercícios físicos, com caminhadas de uma hora por dia e natação
com aulas de 50 minutos, três vezes na semana. Após oito meses de tratamento, encontra-se
com 71,1 kg e prepara-se para submeter-se a uma cirurgia plástica.

1. Que composto o organismo armazenou, levando a 45 kg de aumento no peso da paciente?


Citar o tecido de armazenamento corpóreo do composto.
2. Ingerindo uma dieta de 600 kcalorias, a paciente tem um déficit energético. De que forma
isso contribui para o emagrecimento da paciente?
3. A paciente sempre foi orientada a praticar exercícios físicos. Em que esses exercícios
colaboram para a perda de peso?

AULA 6: FORMAÇÃO DE ACETIL-COA

1. Por que a inibição da piruvato translocase provoca o acúmulo de lactato?


2. Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de
piruvato.
3. Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA?
4. Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação.
5. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar:
a. as 5 coenzimas necessárias;
b. as vitaminas envolvidas;
c. a localização celular.
6. Definir cofator. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos
(coenzimas).
7. Definir vitaminas, relacionando sua função com atividade enzimática.
8. As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as
dos macronutrientes (proteínas, carboidratos e lipídios). Explicar a razão, verificando a
estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina
dinucleotídio (FAD) nas suas formas oxidada e reduzida.

AULA 7: CICLO DE KREBS

13
Para responder às questões de 1 a 4 usar apenas os Mapas I (p. 5 ) e II (p. 7).

1. Que composto é oxidado no ciclo de Krebs?


2. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve
sofrer redução?
3. Uma suspensão de mitocôndrias, suplementada com acetil-CoA marcada com C14 só
produz CO2 marcado em aerobiose.
a. Por que?
b. Em anaerobiose, há produção de CO2 marcado se for adicionado azul de metileno; neste
caso, observa-se também a descoloração do corante (azul de metileno reduzido é
incolor). Explique estes dados.
4. Uma suspensão de mitocôndrias foi incubada, separadamente, com acetil-CoA, piruvato,
glutamato, citrato e ácidos graxos. Em qual (quais) caso(s) aumentou a concentração de
oxaloacetato?
5. Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que
contém, além das enzimas e coenzimas: (a) acetil-CoA; (b) oxaloacetato; (c) acetil-CoA +
oxaloacetato; (d) acetil-CoA + succinato. Em cada caso, que porcentual do composto
adicionado estará presente no final da reação?
6. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a
razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a
regulação principal do ciclo de Krebs

Enzima Efetuadores alostéricos


Positivos Negativos
Isocitrato desidrogenase ADP – NAD+ ATP - NADH

7. Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de
citrato.

AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO


OXIDATIVA

1. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos
que fazem parte da cadeia de transporte de elétrons?
2. A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação
estequiométrica com a quantidade de NADH oxidado?
3. Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo
de oxigênio. Quando incubação semelhante foi feita substituindo o malato por succinato,
ocorreu consumo de oxigênio. Explicar este resultado. Que resultado haveria, nos dois casos,
se a rotenona fosse substituída por cianeto ou por antimicina A?

LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA


ATIVIDADE DA SUCCINATO DESIDROGENASE

-Protocolo Experimental
14
a) Fracionamento celular
b) Verificação da atividade de succinato desidrogenase

O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). A


redução do azul de metileno pode ser obtida a partir da oxidação do succinato, catalisada pela
succinato desidrogenase. Seguir o protocolo 1. Para verificar a oxidação do succinato, as
frações devem ser incubadas a 37°C, por 10 minutos.
Sacrificar um rato em jejum por concussão cerebral. Remover o fígado, mergulhá-lo em
20 ml de uma solução de sacarose 0,25M (previamente resfriada a 0 graus), picando-o bem
com a tesoura. Decantar e descartar o sobrenadante. Adicionar outros 20 ml da solução de
sacarose, misturar, tornar a decantar e descartar o sobrenadante. Adicionar novamente 20ml
de sacarose 0,25M, homogeneizar o fígado e centrifugar a 4.000 rpm por 10 minutos. Você
obterá o precipitado 1 e um sobrenadante 1 .
Separar o sobrenadante 1 e centrifugá-lo novamente a 10.000 rpm por 30 minutos.
Novamente você obterá o precipitado2 e o sobrenadante 2.
Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no
gelo. Esta será a fração celular I.
Ressuspender o precipitado 2 obtido em 4ml de sacarose 0,25M gelada. Esta será a
fração celular II.
Antes de iniciar a experiência o grupo deve:
1. escrever a reação que está sendo analisada;
2. discutir as funções do succinato, sacarose, azul de metileno e óleo mineral;
3. planejar o controle da experiência.

A. INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO


Sabendo em que fração celular se encontra a atividade da succinato desidrogenase,
observe a inibição competitiva da enzima por malonato, um processo historicamente
importante na elucidação das etapas de ciclo de Krebs. Você utilizará a redução do MTT via
succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido, não
sendo reoxidado pelo O2 do ar. Seguir o protocolo 2.
Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores. Se a reação
estiver lenta (isto dependerá da sua preparação mitocondrial), aqueça os tubos a 37°C por 5
minutos e os compare novamente. NÃO ESQUEÇA a inibição é competitiva, existe o fator
cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS
INTERVALOS DE TEMPO.

B. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE


TRANSPORTE DE ELÉTRONS.
Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de
elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando
as tabelas que se seguem.
Os aceptores e doadores são fornecidos na forma oxidada, com exceção do reagente p-
fenilenodiamina.

PAR REDOX EO’

NADH/NAD+ -0.32

15
Succinato/Fumarato -0.3

FADH2/FAD 0.00

Azul de metileno red/ox 0.1

Cit b (Fe 2+)/ Cit b (Fe 3+) 0.06

Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) 0.22

Cit c (Fe 2+)/ Cit c (Fe 3+) 0.25

Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) 0.40

H2O / ½ O2 0.82

ACEPTORES E DOADORES ARTIFICIAIS EO’

Piocianina red/ox -0.34

2,6-diclorofenolindofenol (DCPI) red/ox 0.20

Benzilviológeno red/ox -0.36

Ferricianeto Fe(CN)64-/Fe(CN)63- 0.36

p-fenilenodiamino (p-FDA) red/ox 0.27

COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E


OXIDADA

REDUZIDO OXIDADO VOLUME UTILIZADO

Piocianina Incolor Azul 0.1

2,6- diclorofenolindofenol (DCPI) Incolor Azul 0.3

Benzilviológeno Incolor Violeta 0.3

Ferricianeto Incolor Amarelo 0.2

16
p-fenilendiamino (p-FDA) Incolor Violeta 0.5

- Seguir o protocolo 3.

Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas,


identificando as drogas A e B.

PROTOCOLO 1

TUBO 1 2 3 4 5

Tampão A 0.3 ml 0.3 ml 0.3 ml 0.3 ml 0.3 ml

Sacarose 0,7M 1.0 ml 1.0 ml 1.0 ml 1.0 ml 1.0 ml

Succinato 0,5M - - 0.2 ml 0.2 ml 0.2 ml

Azul de Metileno 0.1 ml 0.1 ml 0.1 ml 0.1 ml 0.1 ml

Água Destilada 1.5 ml 1.5 ml 1.3 ml 1.3 ml 1.4 ml

Fração Celular 0.1 (I) 0.1 (II) 0.1 (I) 0.1 (II) -

Nujol 0.5 cm 0.5 cm 0.5 cm 0.5 cm 0.5 cm

PROTOCOLO 2

TUBO 1 2 3 4 5 6 7

Tampão A 0.2 ml 0.2 ml 0.2 ml 0.2 ml 0.2 ml 0.2 ml 0.2 ml

Malonato - - - 0.1 ml 0.1 ml 0.1 ml 0.1 ml

Succinato 0,5M - 0.1 ml 0.2 ml - 0.1 ml 0.2 ml 0.4 ml

MTT 25µ l 25µ l 25µ l 25µ l 25µ l 25µ l 25µ l

Água Destilada 0.6 ml 0.5 ml 0.4 ml 0.5 ml 0.4 ml 0.3 ml 0.1 ml

Fração Celular 0.2 ml 0.2 ml 0.2 ml 0.2 ml 0.2 ml 0.2 ml 0.2 ml

PROTOCOLO 3

17
TUBO 1 2 3 4 5 6 7 8 9
Volume (ml)

Tampão A 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4

Sacarose 0,7M 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0

Succinato 0,5M - - - 0.2 0.2 - 0.2 0.2 -

Droga A ou B - - - - - - 0.1 0.1 0.1

Ferricianeto 0.2 - - 0.2 - - 0.2 - -

DCPI - 0.3 - - 0.3 - - 0.3 -

p-FDA - - 0.5 - - 0.5 - - 0.5

Água Destilada 1.3 1.2 1.0 1.0 0.9 0.9 0.9 0.8 0.8

Fração Celular - - - 0.2 0.2 0.2 0.2 0.1 0.1

Nujol (cm) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5

AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA

1. Software Cadeia de Transporte de Elétrons.

Com auxílio do software, responder as questões seguintes:


a. Sempre que há consumo de oxigênio há síntese de ATP?
b. Sempre que há síntese de ATP há consumo de oxigênio?
c. Sempre que há aumento do potencial de membrana há consumo de oxigênio?
d. Sempre que há consumo de oxigênio há aumento do potencial de membrana?
e. Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana?
f. Pode haver síntese de ATP sem aumento do potencial de membrana?
g. Pode haver consumo de oxigênio sem aumento do potencial de membrana?
h. A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto?
i. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum
composto?
j. A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto?

2. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a
fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a
oxaloacetato?
3. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de
controle fisiológico da velocidade da cadeia de transporte de elétrons?
4. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele
composto. Correto?
5. Hemácia e tecido nervoso fazem fosforilação oxidativa?

18
6. Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de
transporte de elétrons em presença de malato e de antimicina A?
7. A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH
oxidado?
8. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a
fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a
oxaloacetato?
9. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem
fornecimento de substrato oxidável?
10. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina
inibe tanto o consumo de oxigênio quanto a síntese de ATP. A adição de dinitrofenol
restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a
inibição da síntese de ATP. Explicar estes resultados.
11. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a
grande utilização no citossol do ATP produzido na mitocôndria?
12. Hemácia e tecido nervoso fazem fosforilação oxidativa?
13. Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória
(lançadeiras do malato e do glicerol-fosfato)?

AULA 10: METABOLISMO DE GLICOGÊNIO

1. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas


encontradas no glicogênio são do tipo α -1-4 ou α -1-6. Correto?

2. Escrever os substratos e os produtos das reações catalisadas por


a) proteína quinase
b) glicogênio fosforilase quinase
c) fosfoproteína fosfatase

3. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do
glicogênio. Apontar as que utilizam ATP e as que utilizam HPO42--.

a) glicogênio fosforilase
b) proteína quinase
c) glicogênio fosforilase quinase

4. A fosfodiesterase catalisa a conversão de cAMP a AMP. Qual o efeito da ativação desta


enzima sobre a degradação do glicogênio a glicose 1-fosfato?
5. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a
exportação do hepatócito?
6. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a
conseqüência deste efeito sobre a atividade da via glicolítica.
7. Há gasto de ATP para a síntese de glicogênio a partir de glicose?

19
8. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à:
a) permeabilidade da célula à glicose
b) síntese de glicogênio
c) síntese de glicoquinase (fígado)

9. Verificar os diferentes transportadores de glicose e sua dependência de insulina. Verificar


também se são independentes de insulina para a captação de glicose: cérebro, hemácia,
rim, fígado e ilhotas de Langerhans.
10. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no
músculo. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a
última refeição.
11. No jejum, ocorre degradação de proteínas de músculo.
12. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia, libera
glucagon.
13. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de
jejum noturno e após uma refeição rica em carboidratos.

AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA, GLUCAGON)

1. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por
ação hormonal, indicando o hormônio que atua em cada caso.
2. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e
mostrar seu modo de ação.
3. Mostrar a relação entre AMP cíclico e a síntese de glicogênio.
4. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à:
a. permeabilidade da célula à glicose;
b. síntese de glicogênio;
c. síntese de glicoquinase (fígado).
5. Descrever as ações de glucagon, adrenalina e insulina no metabolismo de triacilgliceróis.
6. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a
conseqüência deste efeito sobre a atividade da via glicolítica.
7. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para
a exportação do hepatócito?
8. O glucagon estimula a gliconeogênese? Como?
9. Como são desfosforiladas as enzimas, quando cessa o efeito do glucagon? Se a célula
contém proteína fosfatase, como é possível manter proteínas fosforiladas?
10. Há gasto de ATP para a síntese de glicogênio a partir de glicose?
11. Como a insulina leva a ativação da proteína quinase B?
12. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à:
a. permeabilidade da célula à glicose
b. síntese de glicogênio
c. síntese de glicoquinase (fígado)

Transportadores de glicose para o interior das células:


20
Transportador Distribuição Propriedades

GLUT1 Hemácias, rim, placenta, outras células Baixo KM

GLUT2 Fígado, células β do pâncreas Alto KM

GLUT3 Neurônio, placenta, testículo Baixo KM

Baixo KM
GLUT4 Adipócito,coração,músculo esquelético,
Dependente de insulina

Transporte ativo
GLUT5 Intestino, rim
Co-transporte com Na+

13. Verificar os diferentes transportadores de glicose e sua dependência de insulina. Verificar


também se são independentes de insulina para a captação de glicose: cérebro, hemácia,
rim, fígado e ilhotas de Langerhans.
14. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia, libera
glucagon.

AULA 13 SÍNTESE DE TRIACILGLICEROL

1. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades


apreciáveis de acetil-CoA no citossol?
2. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6-
fosfato desidrogenase?
3. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato
é elevada?
4. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A.
5. Se fosse fornecida a uma célula glicose marcada com H3, seria possível encontrar ácidos
graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir
de acetil-CoA marcada com C14, quais carbonos apareceriam marcados?
6. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para
gerar os equivalentes redutores necessários à síntese de palmitato?
7. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos?
8. O tecido muscular não sintetiza glicerol 3-fosfato. Que decorrência isto tem?
9. Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato?
10. O que impede a síntese e degradação simultânea de ácidos graxos?
11. Há conseqüências derivadas da produção excessiva de corpos cetônicos?
12. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. Analisar
a regulação desta via.
13. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de
triacilgliceróis?

AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA

21
1. Um adulto normal, com uma dieta desprovida de proteínas, elimina uréia. Por que?
2. Um adulto normal, com uma dieta rica em carboidratos e lipídios, tem necessidade de
ingestão proteica. Por que?
3. Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase
(glutâmico-oxaloacético transaminase - GOT) e alanina aminotransferase (glutâmico-
pirúvico transaminase - GTP). Citar a coenzima que participa das reações e a vitamina
presente na sua estrutura.
4. Esquematizar a reação catalisada pela glutamato desidrogenase.
5. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e
indicar aqueles que podem originar glicose.
6. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos.
Exemplos destes compostos e seus precursores:

Glicina Aspartato Tirosina


purina purina adrenalina
porfirina pirimidina tiroxina
glutationa melanina
Lisina Histidina Triptofano
carnitina histamina nicotinamida

7. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina


hidroxilase?
8. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz.
9. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e
indicar aqueles que podem originar glicose.
10. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem.
11. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz.
12. Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato
sintetase.
13 . No ciclo da uréia (da ornitina):
a) indicar a procedência dos átomos de nitrogênio da molécula de uréia.
b) calcular o balanço de ATP
c) qual o aminoácido proteico sintetizado?
14. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido?
15. Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio?

QUESTÕES PARA DISCUSSÃO


1. Um adulto normal, com uma dieta desprovida de proteínas, elimina uréia. Por quê?
2. Um adulto normal, com uma dieta rica em carboidratos e lipídios, tem necessidade de
ingestão protéica. Por quê?

AULAS 16 : FONTE DE NUTRIÇÃO

1. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem.


2. Definir balanço de nitrogênio.
3. Citar as condições que levam a um balanço positivo ou negativo de nitrogênio.

22
4. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de
proteínas.
5. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas).
6. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de
proteínas de origem vegetal.
7. Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em
desenvolvimento.
8. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos.
9. Caracterizar as síndromes de desnutrição mais comuns.

AULAS 17 : REGULAÇÃO INTEGRADA

1. Fazer um resumo dos efeitos do glucagon, adrenalina, e insulina no metabolismo de


carboidratos, lipídios e proteínas no fígado, músculo e adiposo.
2. Segue-se uma lista de defeitos metabólicos hereditários hipotéticos:
A. Incapacidade de fazer a oxidação completa de glicose e lipídios.
B. Incapacidade de fazer gliconeogênese a partir de lactato.
C. Incapacidade de utilizar glicose para obtenção de energia.
D. Incapacidade de sintetizar diidroxiacetona a partir de lactato.
Escolher, entre as enzimas alistadas a seguir, aquela cuja perda de atividade seria responsável
por cada um daqueles defeitos:
a. fosfofrutoquinase 1.
b. hidroxiacil-CoA desidrogenase.
c. isocitrato desidrogenase
d. fosfoenolpiruvato carboxiquinase
e. glicose 6-fosfatase
f. fosfoglicomutase

3. Descrever, com base em regulações hormonal e alostérica, os processos que levam ao


acúmulo de lipídios a partir de uma dieta rica em carboidratos.
4. Planejar a distribuição entre carboidratos, lipídios e proteínas de uma dieta normal e de
uma dieta para emagrecimento, tendo em vista que:
a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g, e a de lipídios, 9 kcal/g);
b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2.100
kcal por dia;
c) o metabolismo basal de um adulto consome cerca de 1.800 kcal por dia;
d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos
poliinsaturados.
e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas;
f) nove aminoácidos são essenciais para o organismo humano.
5. Descrever as conseqüências metabólicas de uma dieta com valor calórico normal, mas
contendo proteínas de baixo valor biológico.
6. O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à
ingestão de uma refeição (tempo zero). Os valores de ordenadas são diferentes para cada
curva. De a até j, verificar se a sentença é falsa ou verdadeira.

a. A concentração citossólica de citrato é maior em B do que em A.


b. A concentração plasmática de HCO3- é maior em B do que em C.
23
c. Em C, a maior parte da glicose, aminoácidos e corpos cetônicos plasmáticos é originária
do fígado.
d. A curva I pode representar a concentração de glicogênio hepático e a curva III, a
utilização de corpos cetônicos pelo cérebro.
e. Em B ocorre oxidação de aminoácidos essenciais no fígado.
Em B a lipogênese é mais intensa que a lipólise no tecido adiposo.
g. Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase
dependente de cAMP.
h. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do
que em B.
A carnitina acil transferase de hepatócitos é mais ativa em A.
A curva II pode representar a atividade da via das pentoses.

A B C

II
III

0 5 10 15 20 25

Horas

12. Um indivíduo adulto recebeu, durante várias semanas, uma dieta com quantidades de
carboidratos, lipídios e proteínas adequadas para seu peso, sexo, faixa etária e atividade
física. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais, o
indivíduo apresentou perda lenta e contínua de peso.

a. Faça duas hipóteses explicativas deste quadro.


b. Escolha uma das hipóteses e descreva como estão, no fígado deste indivíduo, o ciclo de
Krebs, a concentração de frutose 2,6-bisfosfato, a gliconeogênese, a síntese de
glicogênio, a concentração de acetil-CoA e a síntese de ácidos graxos.
c. Para cada hipótese feita, analise o balanço de nitrogênio e a produção de corpos
cetônicos.
d. Segundo as hipóteses formuladas, o caso poderia ser normalizado aumentando a ingestão
de carboidratos e diminuindo a de lipídios?

AULAS 18 : DIABETES

DIABETES MELITTUS

24
Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e
pode comprometer o funcionamento de rins, olhos, nervos e vasos sanguíneos. É uma doença
que pode ser definida como um estado de tolerância diminuída à glicose, usualmente devido à
deficiência ou resistência à insulina. Há dois tipos mais comuns de diabetes melittus (DM):
1) A tipo I, também chamada de DM insulina dependente (DMID), 2) A tipo II, ou DM não
dependente de insulina (DMNDI). Antes de verificar as diferenças e semelhanças nas
manifestações dessas duas diabetes, vamos lembrar os efeitos da insulina:
- Esse hormônio, por ação direta:

• Aumenta o transporte de glicose para o fígado, músculo e tecido adiposo e outras


células.
• Aumenta o transporte de aminoácidos para os músculos e outros tecidos.
• Diminui a atividade da triacilglicerol lipase no tecido adiposo, inibindo a mobilização
de ácidos graxos.
• Aumenta a síntese de proteína, lipídeo e glicogênio em proporções variadas,
dependendo do tecido.

- Por ação indireta:


• Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase
dependente de AMPc.
• Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase.
• Diminui a quantidade de glucagon circulante por diminuição da expressão gênica.

Diabetis melittus insulino dependente (DMID) ou Tipo I.


10 a 20% dos casos de diabetes são do tipo I. Ela tem início entre a infância e 35 anos
e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de
DMID adquirirá a doença), embora não só a genética possa explicá-la. Evidências implicam a
infecção viral e resposta auto-imune como maiores fatores contribuintes. A DMID é causada
pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de
hiperglicemia sustentada, caso não seja tratado. Um indivíduo normal mantém os níveis
plasmáticos normais de glicose convertendo-a em glicogênio, oxidando-a para gerar energia
ou usando-a para síntese de outros compostos. O desarranjo de todas essas reações é
encontrado no diabético. Assim, ele desperdiça glicose eliminando-a na urina; ele perde peso,
pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular, cujos
aminoácidos são usados na gliconeogênese. Quando os níveis de glicose sobem, o rim não
consegue reabsorvê-la e ocorre glicosúria. Como tudo que tem que ser excretado na urina
deve estar solubilizado, qualquer incremento é acompanhado por perda de água. A falta de
insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do
músculo e adipócito, com conseqüente aumento da pressão osmótica. Devido a isso, água
intracelular é perdida para o interstício resultando em desidratação celular, diluição dos
eletrólitos extracelulares e maior concentração dos intracelulares. A perda de peso é
decorrente de perda de tecido muscular e adiposo, bem como da perda de água. Ocorre
cetoacidose, devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza,
pela perda de eletrólitos, principalmente potássio.

Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II.

25
Presente em 80 a 90 % dos diabéticos, com alto fator genético (100% dos irmãos
gêmeos idênticos de um diabético tipo II desenvolverão a doença). Os pacientes apresentam
normalmente níveis normais ou elevados de insulina, sugerindo que não há a utilização
correta do hormônio pelo organismo, provavelmente por defeito nos receptores de insulina
nas células. DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com
obesidade e que tenham parentes diabéticos. Não há relação necessária entre diabetes tipo I e
obesidade. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de
cetose, baseado numa relativa mas não absoluta deficiência de glicose. Assim, pacientes com
DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de
cetose. Nos diabéticos tipo II, a cetose pode aparecer em certas condições de estresse
metabólico, como sepsis. Atualmente, considera-se que não existem apenas duas situações
extremas: cetoacidose diabética ou hiperglicemia não cetônica, ocorrendo, na verdade, toda
uma gama de variação das intensidades dos dois sintomas.

Diagnóstico
Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as
observações clínicas como perda de peso, poliúria (aumento na quantidade de urina) e
polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia,
cetoacidose e glicosúria. Diabetes tipo II é mais certamente diagnosticada por uma
demonstração da tolerância diminuída à glicose. O indivíduo ingere uma solução contendo
75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O
nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal,
atingindo 200mg/dL após 2h de ingestão da solução de glicose. No período inicial da doença
observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL.
A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de
diabetes.

Tratamento
Depende do tipo de diabetes.Tipo I é, ou tornar-se-á, dependente de insulina por toda
a vida. Deve haver reposição adequada de Na+ e água. Na tipo II, perda de peso já pode
influenciar na capacidade do corpo de controlar o nível de glicose. Agentes hipoglicemiantes
orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou
não. Alguns pacientes podem necessitar de injeções de insulina. Nesses pacientes dieta e
exercícios físicos são um bom meio de alcançar o controle da glicemia.

Tipo I –DMID Tipo II - DMNDI

Idade de início Em geral infância ou puberdade Em geral após 35 anos

Início Em geral repentino Lento, silencioso

Estado nutricional no início Em geral desnutrido Em geral obesidade

Prevalência 10 a 20% dos casos 80 a 90% dos casos

26
Predisposição genética Moderada Muito forte

Defeito ou deficiência Cel. β destruídas, sem produção Cel. β produzem menos


de insulina ou igual insulina.

Outros fatores Vírus e toxinas Obesidade

Insulina plasmática Baixa a ausente Normal a elevada

Sintomas iniciais Poliúria, polidipsia, perda de Nenhum ou os mesmos do


peso, fome, cetoacidose comum tipo I mais suaves

Cetose Comum Rara

Efeitos a longo prazo Retino-, nefro- e neuropatia; Complicações similares a


surgimento após 5 anos tipo I, mais tardias

Complicações agudas Cetoacidose Coma hiperosmolar

Resposta a hipoglicemiantes Não responde Responde


orais

Administrar insulina Sempre necessário Em geral não necessário

Coma diabético
A glicose sanguínea em concentrações maiores que o limite de reabsorção renal
provoca uma rápida diurese osmótica, que leva a perda de água e eletrólitos. Há tendência a
hipovolemia e deslocamentos de água intracelular para o espaço extracelular. Tanto a
hiperglicemia como a hipernatremia afetam muito o cérebro. Aumentando a osmolaridade
plasmática, a água move-se para fora das células cerebrais, causando desidratação celular.
Quando a osmolaridade alcança 340 a 350 mosmol/kg, a conseqüência mais provável é o
coma.

Complicações decorrentes do diabetes


A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum
apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. Uma
explicação para isso é haver glicosilação de proteínas, que ocorre principalmente no ε -
amino da Lys. Essas proteínas ficam com conformação alterada e são mais resistentes ao
ataque proteolítico. Diabéticos podem desenvolver retinopatia (principal causa de cegueira),
nefropatia, neuropatia e doenças cardiovasculares. A retinopatia é quase universal entre os
diabéticos, enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 %
dos portadores de DMID e em menos de 20% daqueles com DMNDI. Quando essa doença se
desenvolve o paciente necessita de hemodiálise e transplante renal. A neuropatia de nervos
periféricos é comum em diabéticos, principalmente a neuropatia simétrica, que causa a perda
de sensibilidade nas extremidades inferiores, tornando os pacientes propensos a lesões nas
pernas e pés, com alta incidência de gangrena e amputação. A glicosilação de lipoproteínas
plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença
periférica vascular. A dosagem de Hb glicosilada plasmática é um teste mais sensível que a
medida de glicemia. Faça hipóteses para explicar esse fato.
27
CASO 1
Identificação: J.B.M, 25 anos, masculino, branco, bancário.
Queixa e Duração:Aumento do volume urinário há 4 horas. Gosto amargo na boca e sensação
de fraqueza, há uma hora.
História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de
idade. Faz uso de insulina, administrada por via subcutânea, duas vezes ao dia. Refere que
procura seguir as recomendações dietéticas, mas que não é incomum a transgressão da dieta,
principalmente nos acontecimentos sociais. Relata que no entardecer do dia esteve em uma
lanchonete com amigos, onde ingeriu quatro ou cinco chopes, comeu pizza e tomou sorvete.
Passadas quatro horas, começou a urinar intensamente, precisando levantar várias vezes da
cama. Na seqüência sentiu um hálito amargo, a boca seca e, segundo seus familiares, quando
falava as pessoas sentiam cheiro de acetona. Tudo seguido de uma intensa fraqueza e leve
falta de ar. Como já passou por situações semelhantes, de descompensação diabética,
procurou o serviço médico, a fim de ser medicado antes do agravamento do quadro.

Exame Físico: Regular estado geral, palidez cutâneo-mucosa. Sinais clínicos de desidratação,
ritmo cardíaco regular, levemente taquicárdico. Respiração tendendo a ofegante, pulsos finos,
hálito cetônico bastante evidente.

Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL)
Cetonúria = +++/++++ (O normal é negativo).
Dados de gasometria revelam acidose.
Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina, por
via muscular, de hora em hora. Após três horas de cuidados a glicemia já havia baixado para
185 mg/dL, mas a cetonúria ainda se mantinha em + / +++.

CASO 2
Identificação: J.L.P., 35 anos, feminina, branca, executiva do ramo de cosméticos.
Queixa e Duração: Sensação de fraqueza há doze horas. Dor de cabeça intermitente, há oito
horas. Hálito amargo há um dia.
História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de
emagrecimento em um spa há três dias. Está submetida a uma dieta de 300 kcalorias/dia.
Relata que no primeiro dia nada sentiu, porém, a partir do segundo dia, notou gosto ruim na
boca e o apetite diminuiu. Hoje, no terceiro dia de estadia, o gosto ruim na boca é muito
intenso e acompanhado de um hálito próximo ao cheiro de acetona; a paciente passou a sentir
também fortes dores de cabeça, aliadas à fraqueza. Procurou o ambulatório médico para
esclarecimentos.
Exame Fïsico: Bom estado geral, hálito cetônico, ritmos cardíaco e respiratório normal,
pressão arterial = 100 x 60 torr.
Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL)
Cetonúria = +++ / ++++
Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de
ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. Foi-lhe
dito que, para resolver seus sintomas, bastaria uma refeição calórica que, porém, não é lhe
indicada já que está sob regime de emagrecimento. Indicou-se que aguardasse por mais
alguns dias até que os sintomas regredissem.

1. Qual o sinal clínico comum aos dois casos relatados?


28
2. Por que o valor da glicemia difere tanto entre os casos 1 e 2?
3. Qual é a relação entre a glicemia e a presença plasmática de acetona?
4. Pela deficiência de insulina, o paciente do Caso 1 fica impossibilitado de usar a glicose
sangüínea em células como as do músculo, pois a entrada de glicose nessas células é
estimulada pela insulina. Qual a principal fonte de ATP para a contração muscular, nesse
caso?
5. Após alguns dias no spa, que tipo de reserva a paciente do caso 2 deve estar utilizando
para a obtenção de ATP?
6. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1
e 2?
7. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65
mg/dL? Que via metabólica é utilizada para a síntese de glicose?
8. Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos
casos 1 e 2?
9. Nos dois casos apresentados, a tendência dos pacientes é de perda, manutenção ou ganho
de peso?
10. Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a
quatro semanas, desde que hidratado) como nos casos de greve de fome. Citar a fonte de
energia utilizada pelo cérebro, hemácias, músculo e fígado neste jejum extremo.
14. Descrever as alterações do metabolismo de carboidratos, lipídios e proteínas provocadas
por jejum prolongado e por diabetes.
15. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de
frutose 2,6 bisfosfato.
16. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por
ação hormonal, indicando o hormônio que atua em cada caso.
17. Indicar as condições metabólicas que levam a uma aumento na produção de corpos
cetônicos
18. Descrever as ações de glucagon, adrenalina e insulina no metabolismo de triacilgliceróis

AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO

1. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de


um mRNA específico sem mudar o gene codificante da proteína os elementos
controladores do gene.
Tabela de códons

29
2. Um transcrito para um gene contem a seqüência de bases abaixo:
5´ AACUGCACGAGGUAACACAAGAUGGCU 3´
Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes
fases.
3. Aponte três mutações que não modificam a sequência da proteína.
4. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de
proteínas. Quais mecanismos são usados para garantir a fidelidade de cada um destes
processos.
5. Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma
proteína chamada A. Além disso, você sabe que a proteína A tem quatro pontos sensíveis
à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1,
A2, A3, A4 e A5. O peptídeo A1. é o amino- terminal e A5 é o carbpxi-terminal.
Finalmente, você sabe que seu sistema precisa de 4 minutos para produzir uma molécula
de proteína A completa. Em t=0, você adiciona todos os 20 amino-ácidos, cada um
levando uma marcação com 14C .
(A) Em t=1 minuto, você isola a proteína A intacta do sistema, corta-a com tripsina e isola
os cinco peptídeos. Qual peptídeo é mais intensamente marcado?
(B) Em t=3 minutos, qual será a ordem de marcação dos peptídeos do mais para o menos
marcado?
(C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas?
6. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que
decodificam o código genético. Explique.
7. Quais são as funções do mRNA. tRNA e rRNA?

Aula 20: Regulação da Expressão Gênica

1. Células de E. coli são crescidas no meio com glicose como única fonte de carbono.
Tryptofano é adicionado. As células continuam a crescer e dividem a cada 30 minutos.
Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes
condições:
a) O trp mRNA é estável (degrada lentamente após algumas horas)
b) O trp mRNA é degradado rapidamente, porém a enzima triptofano sintase é estável.
c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente
que o normal.

2. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações
em:
a) o gene lacI que inativa o repressor
b) o promotor é eliminado na região próxima a posição -10

3. Células de E. coli são crescidas no meio contendo lactose, porém não glicose. Indique
em cada uma das situações abaixo se a expressão do operon lac aumenta, reduz ou não é
30
alterada. Desenhe um modelo descrevendo o que acontece em cada uma destas
situações.
a) Adição de alta concentração de glicose
b) Uma mutação que impede a dissociação do repressor lac na região reguladora.
c) Uma mutação que inativa completamente a β -galactosidase.
d) Uma mutação que inativa completamente a permease galactosidase
e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região
do promotor lac.

4. Como a transcrição do gene operon trp da E. coli pode ser afetada pelas seguintes
manipulações da região promotora do mRNA trp.
a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a
seqüência 2.
b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3.
c) Removendo a seqüência 4
d) Trocando os dois códons trp no peptídeo iniciador para códons de His.
e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador.

5. Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um
fungo exótico. Esta RNA polimerase inicia somente a transcrição a partir de uma única região
promotora altamente especializada. A atividade desta RNA polimerase é reduzida quando a
enzima é purificada. Sugira uma explicação para esta observação.

Aula 22: Técnicas de Biologia Molecular; Transgênicos – 7° Teste

Questões para Estudo


Leia os textos que se seguem a respeito de alimentos transgênicos, destacando os
termos que você não compreenda ou de que nunca tenha ouvido falar. Esses termos deverão
ser esclarecidos com o auxílio dos professores, monitores e colegas de grupo. Façam uma
lista contendo, na sua opinião, os pontos favoráveis e desfavoráveis ao emprego da tecnologia
para produção de alimentos transgênicos. Para complementar seus estudos, acesse os sites
recomendados ao final dos textos.

31
Definição de transgênicos: Os Transgênicos são organismos que adquiriram características
de outro organismo, pelo uso de técnicas modernas de Engenharia Genética. O termo
geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia
do DNA recombinante para a alteração genética de animais, plantas e
microorganismos.
Histórico: A Genética é uma ciência característica do século XX, pois, a partir de 1900 as
Leis de Mendel foram redescobertas e começaram a ser aplicadas. Nos primeiros ¾
deste século, a genética mendeliana contribuiu significativamente para a sustentação do
crescimento populacional de nosso planeta, produzindo maiores safras de alimentos de
origem vegetal, aumentando a produtividade de animais e contribuindo para uma maior
longevidade humana. O crescimento acelerado do campo da biotecnologia, entretanto,
ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou
Tecnologia do DNA Recombinante). A decifração do código genético e a manipulação
do DNA neste último quarto de século, aceleraram as descobertas científicas e suas
aplicações biotecnológicas, abrindo novas perspectivas econômicas nos campos da
saúde humana, sanidade animal e produção de alimentos. Surgiram técnicas
biotecnológicas como a produção e pesquisa de plantas e animais transgênicos,
clonagem de mamíferos, produção de proteínas humanas em microorganismos, plantas
e animais, mapeamento do genoma humano, técnicas de detecções e diagnósticos por
PCR e Terapia Gênica.

Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a


transferência do material genético de um organismo para outro. Ao invés de promover
o cruzamento entre organismos relacionados para obter uma característica desejada,
cientistas podem identificar e inserir no genoma de um determinado organismo um
único gene responsável pela característica em particular. O gene artificial ou
intencionalmente inserido no genoma de um organismo é denominado transgene.
Antes do desenvolvimento desta técnica, a mais utilizada era a do Melhoramento
Clássico, na qual a transferência de genes se dava por meio de cruzamentos (reprodução
sexuada), misturando todo o conjunto de genes dos dois organismos em combinações
aleatórias. A técnica exigia uma enorme demanda de tempo e não era precisa.
A clonagem molecular consiste no isolamento do gene de interesse, amplificação do
número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. O
sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil
cultivo e permitir a purificação e recuperação do produto do gene.
Para a introdução do gene em outro organismo são utilizados vetores de clonagem
(plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida, resultando em
um organismo geneticamente modificado (OGM), cuja característica adquirida passa a ser
transmitida para as futuras gerações.

Procedimentos para a obtenção de vegetais transgênicos:


Para obter plantas transgênicas são necessários:
- o gene de interesse;
- uma técnica para transformar células vegetais através da introdução do gene de interesse.
- uma técnica para gerar uma planta inteira a partir de uma só célula transformada.

32
Após esta última etapa, tem-se uma planta transgênica, porque ela contém, além dos
genes naturais, um gene adicional proveniente de outro organismo, que pode ser uma planta,
uma bactéria ou até um animal.

Genes de Interesse:
O genoma de uma bactéria contém em média 5.000 genes, o de plantas, entre 40.000 e
60.000, enquanto o genoma humano consiste de aproximadamente 30.000 genes. Os genes
são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta
característica que permite que genes de um organismo sejam potencialmente funcionais em
outro.
Uma das possibilidades para isolamento de um
gene é a construção de uma “biblioteca genômica”
e, para isso, o DNA do organismo contendo o gene
de interesse é extraído. Em seguida o DNA é
cortado em fragmentos menores utilizando as
enzimas de restrição. Estes fragmentos são, então,
ligados a outros fragmentos de DNA, mas que
podem se replicar em bactérias, onde este material
é inserido e replicado por várias vezes. Depois,
seleciona-se a colônia de bactérias que contém o
fragmento de DNA correspondente ao gene de
interesse. Diversos genes de interesse agronômico
já foram isolados, entre eles temos:

 Gene que codifica proteína capaz de modificar


herbicidas, inativando-os. Os herbicidas são
muito usados no controle de ervas daninhas,
entretanto, algumas culturas não sobrevivem à
aplicação deste produto. Deste modo, culturas
contendo este gene poderiam tornar-se
resistentes ao herbicida, facilitando assim o
controle das ervas.
 Gene que codifica uma proteína de alto valor
nutricional, presente na castanha-do-pará. Este
gene poderia ser usado para aumentar o valor
nutricional de culturas importantes como
feijão e soja.
 Genes bacterianos que codificam proteínas
com propriedades tóxicas para insetos. Os
insetos que se alimentassem de plantas
expressando este gene morreriam ou se
desenvolveriam com menor eficiência,
levando ao seu controle na cultura.

33
Transferência dos genes de interesse em plantas:
A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado
- especialmente para o caso de monocotiledôneas) ou através de agrobactérias. A
transferência é alcançada por um dos métodos seguintes:
A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais,
desprovidas de parede celular. Para a transformação, são incubados em soluções que contêm
os genes a serem transferidos e, em seguida, um choque elétrico de alta voltagem é aplicado
por curtíssimo tempo. O choque causa uma alteração da membrana celular, o que permite a
penetração e eventual integração dos genes no genoma.
B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio
cobertos com os genes de interesse. Os microprojéteis são acelerados com pólvora ou gás em
direção aos alvos (as células vegetais). Os genes entram nas células junto com o projétil de
maneira não-letal, inserindo-se aleatoriamente nas organelas celulares. Em seguida, o DNA é
dissociado das micropartículas pela ação do líquido celular, ocorrendo o processo de
integração do gene exógeno no genoma do organismo a ser modificado.
C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA
extracromossomal que pode se replicar independentemente do cromossomo. O plasmídeo
encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a
transformação de plantas. Parte do plasmídeo é um transposon (T DNA) que produz cópias
de si mesmo nos cromossomos da planta infectada. Os transposons são assim denominados
(ou também chamados elementos de transposição) justamente porque são elementos
genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se.

Regeneração das plantas a partir das células transformadas:


Uma vez inserido o gene na célula vegetal, esta célula ou grupos delas são
estimuladas a gerar uma planta transformada.
A transformação de uma célula vegetal é um tipo de manipulação genética que atende
ao mesmo princípio da transformação de microrganismos, estabelecido pela primeira vez em
1973, quando Stanley e Cohen, em São Francisco, introduziram o gene proveniente de uma rã
em uma bactéria. No entanto, há diferenças conceituais entre a situação com microrganismos
e com plantas: nos primeiros, os objetivos finais são mudanças operadas no nível celular,
enquanto que em eucariotos superiores, como plantas e animais, as mudanças obtidas no
nível celular não são significativas, a não ser que possam ser transferidas para todas as células
do organismo. Ou seja, o domínio das técnicas de regeneração de plantas inteiras a partir de
uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. E,
como cada espécie de planta tem diferentes exigências hormonais, nutricionais e ambientais
para a regeneração, esta etapa ainda representa o maior gargalo na criação de plantas
transgênicas, embora esta técnica já esteja estabelecida para inúmeras plantas de interesse
econômico.

Papel dos transgênicos na economia mundial:


O século passado teve um grande desenvolvimento na biotecnologia microbiana.
Neste século, é esperado um rápido desenvolvimento na biotecnologia animal e vegetal. A
produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá
resultar em um produto mais economicamente viável que o enriquecimento do trigo com a
lisina obtida de microorganismos.

34
A modificação genética de microrganismos continua sendo uma importante
complementação para as modificações genéticas de plantas e animais, especialmente para a
produção de metabólitos secundários, biofertilizantes e biopesticidas, bioprocessamento,
biorremediação e tratamento de águas. De acordo com uma pesquisa sobre a expectativa de
comercialização de produtos obtidos de organismos geneticamente modificados nos E.U.A., a
agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em
volume.
Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30
milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. No Brasil,
muitos alimentos transgênicos importados já são comercializados e estima-se a importação de
3 milhões de toneladas de milho da Argentina e dos E.U.A, onde as lavouras transgênicas são
permitidas oficialmente.
Na década de 90, os E.U.A aprovaram dezenas de produtos geneticamente
modificados e outra grande quantidade apareceu no mercado europeu. O ritmo atual de
liberação de OGMs indica que na primeira década deste século já teremos uma centena de
produtos geneticamente modificados nas prateleiras dos supermercados, podendo-se chegar
na casa dos milhares em algumas décadas.

Vegetais geneticamente modificados:


A maioria dos produtos já liberados para a comercialização contém transgenes que
codificam características que visam minimizar estresses ambientais, incluindo tolerância a
herbicidas, resistência a insetos e vírus. No entanto, as características que visam aumentar a
qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e
deverão prevalecer nas próximas gerações de produtos transgênicos. É essencial melhorar a
produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial
crescente, enquanto reduzimos os impactos ambientais. Para isso, é necessário utilizar de
forma adequada e responsável as novas tecnologias e descobertas científicas.
Alimentos produzidos através de tecnologias de modificação genética podem ser mais
nutritivos, estáveis quando armazenados e, em princípio, podem promover saúde trazendo
benefícios para consumidores, seja em nações industrializadas ou em desenvolvimento.
Esforços em conjunto, organizados, devem ser feitos para investigar os efeitos
potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas
aplicações específicas. Esses esforços devem ser avaliados tomando-se como referência os
efeitos de tecnologias convencionais da agricultura, que estejam atualmente em uso.

Benefícios promovidos pelos transgênicos na agricultura:


A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de
plantas para alimentação, principalmente com características preferidas pelo mercado,
algumas tendo se tornado sucessos comerciais. Os desenvolvimentos resultantes em
variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado
no aumento de vida em prateleiras de frutas e vegetais, dando resistência contra pragas de
insetos ou viroses, e produzindo tolerância a determinados herbicidas. Enquanto essas
características têm trazido benefícios aos agricultores, os consumidores dificilmente notaram
qualquer benefício além de, em casos limitados, um decréscimo no preço devido a custos
reduzidos e aumento da facilidade de produção (University of Illinois,1999; Falck-Zepeda et
al 1999).
A seguir são apresentados alguns exemplos do uso da tecnologia da modificação
genética de vegetais aplicada a alguns problemas específicos da agricultura:
35
Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada
no Hawai desde 1996 (Gonsalves, 1998). É resultado do uso de modificação genética em
vegetais visando obter maior resistência a uma praga específica, com conseqüente diminuição
ou eliminação da necessidade do uso de pesticidas. Porém, deve-se considerar o fato de que
populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta
transgênica, como acontece com o uso de inseticidas.

Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto


rendimento como, por exemplo, o trigo semi-anão que possui genes insensíveis à giberelina.
A introdução desses genes faz com que se obtenha uma planta mais baixa, mais forte e que
aumenta o rendimento da safra diretamente, uma vez que o alongamento das células na parte
vegetativa é reduzido, e o desenvolvimento da sua parte reprodutiva (comestível) é
aumentado. Estes genes (NORIN 10) agem da mesma forma quando utilizados para
transformar outras espécies de plantas importantes como alimento.

Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma


resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual. Como
exemplo, temos o vírus Mottle Amarelo do arroz (RYMV), que devasta os arrozais africanos.
Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e
cultivado, os pesquisadores utilizaram uma técnica de imunização genética, através da
criação de plantas de arroz transgênico resistentes ao RYMV. Um exemplo de combate ao
stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em
solos ácidos (de La Fuente et al 1997).

Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem
ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições.
Como exemplo, temos um gene de tolerância em manguezais (Avicennia marina) que foi
clonado e transferido para outras plantas que se mostraram mais tolerantes a altas
concentrações de sal.
Segundo a revista Nature Biotechnology, graças à injeção de um único gene capaz de
absorver um excedente de sal em plantações de tomate, cientistas conseguiram fazer crescer e
desenvolver em água contendo forte teor de sódio, tomates perfeitamente comestíveis. O gene
introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio
excedente.

Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro,
de forma a combater a anemia. Ele foi produzido usando-se genes envolvidos na produção de
proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na
dieta humana (Goto et al, 1999). As plantas transgênicas contêm entre 2 e 4 vezes mais ferro
do que normalmente encontrado no arroz convencional.

36
Pesquisadores desenvolveram arroz
com alto teor de beta-caroteno,
precursor da vitamina A, que ajuda a
combater diversas doenças, como a
cegueira noturna, ressecamento da
córnea, diarréias e sarampo. Foram
inseridos genes de bactérias que fazem
a conversão do precursor presente no
arroz em beta-caroteno. O resultado
desse experimento foi a produção de
grãos amarelados de arroz, devido à
presença de beta-caroteno. Cerca de
300 g desse arroz cozido por dia
arroz normal arroz transgênico suprem as necessidades de beta-
caroteno de um indivíduo.

Referências
• Lewin, B. (1994) Genes. 1ed. New Yourk, Oxford University Press.
• Okamuro, J.K. & Goldberg, R.B. (1989) The Biology of Plants. Academic Press Inc.
• Purves, W.K.; Sadava,D.; Orians,G.H. & Heller, H.C. (2001) Life – the science of
Biology. 6th. Ed. Sinauer AssociaTES, Inc & W.H.Freeman and Company.
• Zaha, A. (Coord.) (1996) Biologia Molecular Básica, Porto Alegre, Mercado Aberto.

Polêmica sobre os Alimentos Transgênicos


- Posicionamento do Conselho Nacional de Nutricionistas:
www.cfn.org.br/variavel/destaque/pgdestaque2.htm
- Conselho Nacional de Biossegurança:
www.ctnbio.gov.br/ctnbio/bio/artigos/004.htm
- Artigo da revista Ciência Hoje com link para arquivo pdf.:
www.uol.com.br/cienciahoje/ch/ch146.htm
- Posicionamento da SBBq: http://www.sbbq.org.br/start.php?id=port

Questões para Discussão


Cada sala deve ser organizada em dois grandes grupos – pró e contra. Será iniciado
um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o
consumo de alimentos transgênicos; o grupo contra deverá utilizar argumentos que condenem
os transgênicos. Em ambos os casos os argumentos devem ser os mais variados possíveis,
envolvendo tópicos como impacto ambiental, aumento da produtividade, agroeconomia,
redução do custo ou aumento do preço dos alimentos, benefício para a saúde etc. O debate
não deve, portanto, ser limitado a aspectos nutricionais. Utilize sua lista, redigida nas
“questões para estudo” para auxiliar o debate. Em cada sala haverá um professor para mediar
o debate e esclarecer as regras da atividade.

37
Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel
de agarose

- Preparação do DNA plasmidial-


Fundamento: Existem vários procedimentos para purificação em pequena escala de DNA
plasmidial de células bacterianas. Um dos métodos mais utilizados consiste na lise das
bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio). Neste
procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo
removidos por centrifugação. O DNA plasmidial purificado é em seguida concentrado por
precipitação com etanol.
Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência
anterior, extrair e purificar o DNA plasmidial, separando-o do DNA cromossomal bacteriano.
Utilizaremos cultura de E.coli em meio LB-A (50µ g/ml ampicilina).
Soluções utilizadas:
- GET / Rnase – dextrose 50mM, EDTA 10mM, Ribonuclease A 150µ g/ml em
Tris- HCl 25mM pH 8,0;
- Solução de lise – SDS 1% em NaOH 0,2 N
- Solução Neutralizadora – Acetato de potássio 3M pH 4,8.

1. Tomar 1 ml da cultura e colocar em um tubo de eppendorf.


2. Centrifugar a 12000xg por 5 min á temperatura ambiente.
3. Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente
por 1 min.
4. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no
Vórtex.
5. Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente.
6. Incubar a mistura por 5 min á temperatura ambiente.
7. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e
delicadamente.
8. Incubar o tubo em gelo por 20 min.
9. Centrifugar a 12000xg por 15 min á temperatura ambiente.
10. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro
eppendorf contendo 300µ l de Isopropanol.
11. Centrifugar a 12000xg por 10 min á temperatura ambiente .
12. Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%.
13. Centrifugar a 12000xg por 5 min á temperatura ambiente.
14. Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T.E .
15. Incubar por 5 min à 65 °C.
16. Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra
na proporção 1:10.
17. Aplicar a amostra em gel 0,7% de Agarose em TBE, contendo 0,5 µ l/ml de Brometo de
etídio e submeter a eletroforese a 100V em Tampão TBE.
18. Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta.

38
Questões
1. Que papel desempenha cada componente do tampão GET (glicose, EDTA e Tris) ?
2. O que é lisozima e para que é usada na preparação de plasmídeos ?
3. Qual a função do NaOH e do SDS presentes na solução de lise ?
4. Se o DNA cromosomal tiver sido muito quebrado durante as manipulações, onde espera
encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de
DNA plasmidial?
5. Como age o isopropanol ? Este álcool poderia ser substituído por etanol, por exemplo ?
6. Por que se dissolve a preparação de DNA em tampão Tris-EDTA ?
7. Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas
bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ?

- Transformação de bactéria com plasmídeo contendo genes de resistência a


antibióticos

Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma


bactéria e sua manutenção como um elemento autônomo auto-replicativo. Este plasmídeo
pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas)
que podem ter valor seletivo no meio. Várias técnicas são disponíveis para transformar uma
bactéria. Na aula prática usaremos o método do CaCl2. Neste método as bactérias são
submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes
para a transformação pelo DNA do plasmídeo. Usaremos o plasmídeo pBR322 (ver mapa).
O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de
fragmentos de genes.. Além da origem de replicação que permite sua propagação em
bactérias (E.coli) o pBR322 apresenta duas marcas genéticas, ou seja, genes que codificam
para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). Portanto a
introdução de pBR322 em E.coli que normalmente é sensível tanto à ampicilina como à
tetraciclina, leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido)
contento estes antibióticos.
Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à
perda da resistência à ampicilina, uma vez que este sítio está localizado na região amp r. Da
mesma forma, clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina.
Transformação de bactérias que são sensíveis a um antibiótico, em resistentes, será revelada
através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB
(meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LB-
tet. Contendo 50 mg/ml ampicilina ou 12,5 mg/ml tetraciclina.

39
Procedimento experimental: O ideal é que a experiência seja realizada em ambiente
asséptico (fluxo laminar), para evitar contaminação. Manipule convenientemente o material
estéril fornecido. NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO.
As bactérias competentes para transformação são preparadas a partir de uma cultura
em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de
bactérias com uma solução de CaCl2. As bactérias competentes assim preparadas podem ser
armazenadas a –80°C, para uso posterior.
1. Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E.coli) e incubar
à 37°C até o dia seguinte sob agitação forte (200-250 rpm).
2. Diluir a pré-cultura 1/10 em 10 ml de meio LB, incubar à 37°C sob agitação até
OD600nm=0,3 (fase logarítmica de crescimento).
3. Transferir a cultura para o gelo, coletar as bactérias por centrifugação (4000 rpm, 5 min).
Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM
pH6,5 contendo CaCl2 0,1 M. Incubar no gelo por 20 minutos.
4. Coletar as bactérias (4000 rpm, 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão
(frio).
5. Após pelo menos 30 min. No gelo estas BACTÉRIAS COMPETENTES podem ser
transformadas.
6. Para transformar, distribuir 0,1 ml/tubo da suspensão de bactérias competentes para cada
um de 2 tubos. Adicionar o DNA transformante (0,5 µ g DNA de pBR322 em 10µ l de
tampão 10mM Tris pH7,5 contendo 1 mM EDTA) a um dos tubos. O outro tubo será
usado como controle (bactéria apenas).
7. Incubar em gelo por 15 min. Antes de dar o choque térmico (42°C por exatamente 90
segundos) . Transferir os tubos para o gelo por 2 min.
8. Adicionar 0,9 ml/tubo de meio LB e incubar a 37°C sem agitação, em banho-maria, por
uma hora.
9. Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo
ampicilina) previamente identificadas conforme a tabela abaixo. Espalhar as bactérias
com o auxílio de uma alça de vidro, previamente flambada e em seguida resfriada na
própria tampa da placa de Petri.

40
Número de Colônias / Placas

Placa LB Placa LB-A

# 1 Bactérias controle 25µ l |||||||||||||

# 2 Bactérias controle 250µ l |||||||||||||

# 3 Bactérias transformadas 25µ l |||||||||||||

# 4 Bactérias transformadas 250µ l |||||||||||||

ANÁLISE DOS RESULTADOS


1. Preencher a tabela com o número de colônias obtido em cada caso:
Número de Colônias / Placas

Placa LB Placa LB-A

# 1 Bactérias controle 25µ l |||||||||||||

# 2 Bactérias controle 250µ l |||||||||||||

# 3 Bactérias transformadas 25µ l |||||||||||||

# 4 Bactérias transformadas 250µ l |||||||||||||

2. Qual a eficiência de transformação obtida, em termos de n° de colônias / µ g de DNA?

Questões
1. Por que se usa cultura em fase exponencial de crescimento para obter bactérias
competentes?
2. Qual o papel do choque térmico?
3. Por que as bactérias devem ser incubadas por 60 min. a 37°C antes de espalhá-las em
placas de ágar?
4. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo.

41