Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno) Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214 Departamento de Bioquímica Instituto de Química 2009 Docentes: Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup. Sala 854 Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala 1013/1018

Monitores: Cecília Midori Ikegami (cikegami@usp.br) Mariana Lemos Duarte (mlduarte@gmail.com)

Programa Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise; gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons; fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos transgênicos. Bibliografia - Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999. - Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002. - Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996. - Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000. - Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004. - Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002. - Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc., 5th ed New York; 2001. - Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing Company; 1996. - Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G. Scrimgeour Prentice Hall; 1993. - Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995. - Nutritional Biochemistry: T. Brody – Academic Press; 1994. - Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996. Critério de Avaliação O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará 1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final deverá ser feito através da seguinte equação: NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5 10

2

Cronograma de Aulas 17/08 19/08 24/08 26/08 31/08 02/09 07/09 09/09 14/09 16/09 21/09 23/09 28/09 30/09 05/10 07/10 12/10 14/10 19/10 19/10 21/10 26/10 28/10 02/11 04/11 09/11 11/11 16/11 18/11 23/11 25/11 30/11 02/12 Aula 9 Aula 10 Aula 11 Aula 12 Aula 13 Aula 14 Aula 15 Aula 16 Aula 17 Aula 17 Aula 18 Aula 19 Aula 20 Aula 21 Aula 22 Aula 1 Aula 2 Aula 3 Aula 4 Aula 5 Aula 6 Aula 7 Aula 8 Enzima (funções e propriedades) Catabolismo/ Anabolismo (introdução) Glicolise (via das pentoses) Gliconeogênese – 1° Teste Oxidação de Triacilgliceróis Formação AcetilCoA (vitaminas e cofatores) – 2° Teste Feriado Ciclo de Krebs 1° Prova Fosforilação Oxidativa Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia de transporte de elétrons. Sala multimídia - Cadeia de transporte de elétrons e fosforilação oxidativa Metabolismo de Glicogênio – 3° Teste Controle Hormonal (insulina, glucagon e vitaminas) Controle Hormonal (insulina, glucagon e vitaminas) Síntese de Triacilglicerol – 4° Teste Feriado 2° Prova Metabolismo de aminoácidos Ciclo da uréia Fonte de Nutrição – 5° Teste Feriado Regulação Integrada Feriado Regulação Integrada Diabetes – 6° Teste Tradução e Código Genético Regulação da Expressão Gênica Biologia Molecular (testes diagnósticos) Técnicas de Biologia Molecular; Transgênicos – 7° Teste Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose Apresentação de Seminários (Alimentação e BioMol) 3° Prova

3

AULA 1: ENZIMAS I. Classifique as afirmações abaixo como verdadeiras ou falsas: 1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( ) 1.2. A velocidade da reação é proporcional ao tempo da reação. ( ) 1.3. A velocidade da reação é proporcional à concentração de substrato.( ) 1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração de substrato não seja limitante. ( ) 1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( ) 1.6. A quantidade de produto formado depende do tempo da reação. ( ) 1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( ) 2. Definir enzima, substrato e sítio ativo 3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da concentração de S. 4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade da enzima pelo seu substrato 5. Fazer o gráfico da velocidade de uma reação enzimática em função de: a. Concentração de enzima; b. Temperatura; c. pH. Justificar a forma dos gráficos 6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse procedimento. 7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de inibidor escolhido, competitivo ou não competitivo?

4

encontra-se pálido. Deu entrada no serviço de emergência. 27 anos. precisou subir um lance de escada e sentiu-se muito cansado. Conta que nos últimos dias alimentou-se mal e. foi posto sob respiração em balão de oxigênio e rapidamente sentiu-se melhor. Insistindo com a atividade que fazia. extremidades frias e referindo forte dor de cabeça. vindo a cair da própria altura. No momento do exame. analisador de sistemas. Embora tenha feito refeições corretas. nesta manhã. Foi dispensado do hospital. com a recomendação de que ingerisse chá ou outra bebida estimulante. a tontura tornou-se muito forte e escureceu– lhe a vista. CASO 3 5 . vindo de Salvador. No final do terceiro dia. trazido por colegas.T. após ter desmaiado no trabalho. CASO 2 R. Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas.. sendo conduzido ao Pronto Atendimento.Ler o relato dos três casos apresentados a seguir.. Relata que logo ao sair do aeroporto. Depois dos exames preliminares. 32 anos. Com o passar dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e sudorese fria. trabalhador da construção civil. O paciente chegou no dia anterior a La Paz.P. fumante. desmaiou.B.Aula 2: Introdução ao Catabolismo e Anabolismo Obtenção de energia pelo Metabolismo MP I AA E q e ag ra d d g a a ã d n tr n s s u m e l a e r d ç o e u ie te A IM N O L ET S P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G oe lic s A in á id s m oc o Á id G x c o ra o C O ND A FD A + 2 ND AH FD AH 2 A P+P D O2 H2O i AP T A . masculino. tendo tido necessidade de um esforço intenso. CASO 1 P. saiu de casa sem comer nada e iniciou o trabalho. por volta das 10:00 horas da manhã. sudoreico. o cansado persistiu e agravava-se com atividades físicas que até a véspera fazia sem problemas.

Qual o primeiro composto comum à degradação de carboidratos. de inicio abrupto. d. A quantidade de energia derivada da oxidação de nutrientes é a mesma. b.P. masculino. 3. quais são excretados e qual é aproveitado pelas células? 6. Com esse quadro foi trazido ao pronto socorro e embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca. 2. Que compostos são produzidos como conseqüência desta reação? Entre os compostos produzidos. no máximo. entre parênteses. 42 anos. 1. A oxidação biológica consiste na retirada de hidrogênio do substrato. A manutenção destas concentrações é espontânea? Como o organismo consegue mantê-las? 8. com duração de cinco a dez minutos. Que partes do Mapa I devem ser suprimidas quando referente exclusivamente ao cérebro? A síntese de ATP é obtida por oxidação ou redução dos alimentos? Discutir as seguintes afirmações: a. f. A falta de que composto provocou os sintomas relatados nos três casos descritos? O que restringiu a síntese deste composto em cada um dos casos? Os sintomas dos casos 1 e 2 são claramente neurológicos. foi constatada obstrução parcial de uma das artérias coronárias. Resuma: por que é necessário comer e por que é necessário respirar? 7. proteínas e lipídios? 6 . Desde então vinha fazendo uso de remédios que promovem dilatação das coronárias.J. o paciente sentiu forte dor no peito. A dor melhorava com o repouso. Fazendo exames de avaliação cardíaca. Alimentos + Processos que requerem energia VIAS METABÓLICAS DEGRADATIVAS No Mapa II (página seguinte) encontra-se. Os processos celulares que requerem energia utilizam a energia térmica proveniente da oxidação dos alimentos. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um composto rico em energia (ATP). em aperto. Quais são os passos irreversíveis que aparecem no mapa? 2. respectivamente 25 mmols/L e 150 mmols/L e as concentrações plasmáticas são 140 mmols/L e 5 mmols/L. relata o filho que o estava acompanhando. começou a suar frio e dentro de poucos minutos perdeu a consciência e caiu. quer se processe in vitro. c. como subir uma ladeira caminhando.F.. Acrescentar O2. quer ocorra in vivo. O paciente iniciou há seis meses um quadro de dor no peito. e. 1. executivo. ou ao sentir emoções. ADP e ATP nos espaços do esquema abaixo. Os compostos característicos de um dado organismo devem ser supridos pela dieta. o número de átomos de carbono de alguns compostos. responder as questões seguintes. B – Com base no Mapa I. o paciente foi a óbito. fumante. As concentrações celulares de Na+ e K+ são. Conta que o seu pai ficou pálido. A única função dos alimentos é fornecer energia. 4. HPO42-. sempre que fazia algum esforço físico. 5. Logo ao sair para o trabalho.

4. Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma posição para outra. 7 . por transferência de hidrogênio do substrato para uma coenzima. dando origem a diidroxiacetona fosfato e a outro açúcar. Estas reações. ou lipídios ou proteínas. glicose a partir de ácido graxo d. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose. ácido graxo a partir de proteína Indicar no mapa a via utilizada para cada conversão. proteína a partir de ácido graxo e. Isomerases: Catalisam reações de isomerização. Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se insuficientes para manter a glicemia? M P II AA P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G IC S L OE A sp F sfo o iru ato (3 o en lp v ) A IN Á ID S M OC O G ly A la S er Cs y L eu Ile Ls y Pe h G lu Á ID S G A O C O R X S L actato P v (3 iru ato ) C 2 O A cetil-C A(2 o ) C 2 O O alo x acetato (4 ) C 2 O M alato (4 ) Iso citrato (6) C 2 O Fm u arato (4 ) S ccin (4 u ato ) eto lu ) α C g tarato (5 C 2 O C itrato (6 ) 1 – Ler CAPÍTULO 4. na maior parte dos casos. Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos. glicose a partir de proteína f. Não havendo outras restrições na dieta. página 45 . Desidrogenases: Catalisam reações de óxido-redução. na mesma molécula. prever que grupo de animais sobreviveria.O SENTIDO DAS REAÇÕES 2 – ALGUNS TIPOS DE ENZIMAS: Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em geral ATP) para um aceptor. Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato. Estes três tipos de compostos são essenciais para a sobrevivência. geralmente NAD+ ou FAD. com três átomos de carbono a menos que o substrato original. proteína a partir de glicose c. Aldolases: Cindem açúcares fosforilados. são reversíveis. ácido graxo a partir de glicose b. verificando se é possível sintetizar: a.3.

a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos alunos.3 Bisfosfoglicerato 3-Fosfoglicerato COO HC. Os parâmetros medidos estão apresentados nas figuras 1 e 2.P OH2COH H2O COO C.6 bisfosfato H2C-O.P HC-OH H2C-O P ADP ATP O =C-O HC-O H H2C-O. 8 .P Frutose 6-fosfato ATP ADP HO OH HO Frutose 1.AULA 3: GLICÓLISE H OCH 2 OH O OH OH ATP ADP H O GLICÓLISE Glicose ATP ADP P -OCH 2 O HO OH OH OH Glicose 6-fosfato PO-CH 2 O CH 2OH HO OH HO AT P A DP P -OCH 2 O CH 2O.P OCH 2 A DP A TP C OO HCOH CH 3 NAD + NADH CO O C= O CH 3 2-Fosfoglicerato Fosfoenolpiruvato AD P ATP Lactato NAD + NADH Piruvato Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas.P C=O H2C-OH HC=O HC-OH H2C-O P Pi NAD + N ADH O= C-O.P ADP AT P Diidroxiacetona fosfato Gliceraldeído 3-fosfato Pi NAD + NADH 1.

Examinando a via metabólica que converte glicose a lactato (a glicólise). 6. a hemácia poderia excretar piruvato? 11. Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante? 4.124). Quais são os produtos finais da via glicolítica? 8. Considerando o número de moléculas de ATP consumidas e formadas. utilizar apenas o mapa da glicólise (p. do aumento da freqüência cardíaca? Para responder as questões de 6 a 14. esta adaptação foi suficiente para manter a lactemia basal? 5. 7. é possível estimar a quantidade de glicose que pode ser convertida a lactato? 10. O esforço físico leva à produção de lactato? 2. estabelecer o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica. localize as reações que produzem ATP. Em lugar de excretar lactato. Qual a utilidade.170 Freqüência Cardíaca (bat/min) 160 150 140 130 120 110 100 90 80 0 0 2 4 B B (tiro de 30s) A (caminhada) Figura 1: freqüência cardíaca durante caminhada de 15 min (A) e tiro de 30 s (B) A 30s 6 8 10 14 15 min 16 tempo Figura 2: Níveis de lactato plasmático durante caminhada de 15 min (A) e tiro de 30 s (B) 9 8 7 B B (tiro de 30s) A (caminhada) Lactatemia (mmol/L) 6 5 4 3 2 1 0 0 0 2 4 30s A 6 8 10 14 15min 16 tempo Analisando os dados acima e com auxilio de livros responda as questões: 1. para a musculatura em exercício. Para cada molécula de glicose consumida qual é o número de moléculas de piruvato produzido? 9. Em caso afirmativo. Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M. 9 . O exercício é o único processo que leva à produção de lactato? 3.

7] c) Muitos aminoácidos podem ser convertidos a piruvato que. por sua vez. b) mantê-la em funcionamento 10 . b) Se a dieta contiver quantidades insuficientes de carboidratos. usando glicose como fonte de carbono e produzindo etanol. a partir de que tipo de macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as células que dependem deste açúcar? [Consulte o MAPA II.12. No entanto. a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via glicolítica. Explicar este aparente paradoxo. Citar o tecido responsável pela gliconeogênese. à p. 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a conversão de glicose a glicose 6-fosfato. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? 4. consultando o Mapa I. É possível converter lactato a glicose por um processo chamado gliconeogênese. Levar em consideração o fato de o nível de frutose 2. AULA 4: GLICONEOGÊNESE 1. 2. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase. Indicar a função da via glicolítica. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese.6 bisfosfato nos hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições. Citar as vitaminas necessárias para as seguintes conversões: a) glicose → lactato b) lactato → glicose 7. Citar os compostos que devem ser fornecidos à via glicolítica para: a) iniciá-la (haver formação de lactato). pode ser convertido a glicose por um processo chamado gliconeogênese. Explique. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise e da gliconeogênese? e) Explicar como é feito o controle das duas vias. 13. Seria possível excretar piruvato em lugar de etanol? Que semelhança tem este metabolismo com o do tecido muscular em condições de esforço extenuante? 3. 10) indicavam que o oxigênio é necessário para a produção de energia pelo organismo. a glicólise é anaeróbia e produz ATP. 6. 5. f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. usando as informações do quadro apresentado acima. Saccharomyces cerevisiae (levedo) cresce anaerobiamente. Os Casos clínicos 2 e 3 (p.

11 .

35 anos. 12 . casada. Após dois anos de casamento. Exames Laboratoriais: Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%) Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL) Soro lipêmico Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL) Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias. Além das enzimas. quando todos os carbonos do glicerol estiverem marcados ou em ambos os casos? 3.AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS 1. C. seu peso chegou a 105 kg. Em aerobiose. Quando o primeiro filho completava um ano e meio ano. Como é possível obter ATP a partir de etanol? Caso clínico Identificação: A. Explicar este aparente paradoxo. Apresenta boa função cardíaca e pulmonar. o levedo pode oxidar etanol. Queixa e Duração: Aumento de peso após as gestações História Pregressa da Moléstia Atual: A paciente relata. Citar a localização celular da beta-oxidação.. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior da mitocôndria se processe com eficiência. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo de Lynen: riboflavina. Encontra-se com leve edema dos membros inferiores. pantotenato. Altura de 1. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito pouco após o parto. É possível haver oxidação completa de um ácido graxo sem a presença de carnitina? 5. nasceu o primeiro filho. 4. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos dos radicais acila do triacilglicerol estiverem marcados com C14. a paciente engravidou novamente. Por esse motivo deu entrada em um spa. entretanto. O que provoca a degradação dos triacilgliceróis no tecido adiposo? 2.4 kg. Exame Físico: Peso na admissão 105. distribuída em cinco refeições. que compostos deveriam ser adicionados a um tubo de ensaio que contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA? 7. 9. Não apresenta problemas de saúde e não se queixa de nenhum mal estar.67 m. catalisa uma reação da qual os ácidos graxos não participam. na admissão a um centro de emagrecimento. Essa enzima. nicotinamida e/ou ácido lipóico? 8. O ciclo de Lynen pode ser feito em condições anaeróbias? 6. biotina. Por que hemácia e tecido nervoso não oxidam ácidos graxos? 10. que casou há cinco anos pesando 60 kg. e após esse segundo parto. Após passar por avaliação médica e de capacidade física.

A paciente sempre foi orientada a praticar exercícios físicos. 5. No 10o dia da estadia a paciente pesava 94. como jogos. Que composto o organismo armazenou. levando a 45 kg de aumento no peso da paciente? Citar o tecido de armazenamento corpóreo do composto. Ingerindo uma dieta de 600 kcalorias. 2. 6. Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação. 1. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar: a. relacionando sua função com atividade enzimática. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas). c. Por volta do 4o dia de estadia. com cerca de uma hora de cada vez). Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de piruvato. Definir vitaminas. tendo sido orientada quanto ao caráter reversível desses sintomas.8 kg. As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as dos macronutrientes (proteínas. Explicar a razão. 3. Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia. totalizando uma perda total de 19. a paciente tem um déficit energético. dispensando mais tempo para as caminhadas (duas vezes ao dia. com caminhadas de uma hora por dia e natação com aulas de 50 minutos.1 kg e prepara-se para submeter-se a uma cirurgia plástica. hidroginástica e natação (no mínimo uma hora por dia). feitos de maneira fracionada e diversificada.7%). e manutenção de prática de exercícios físicos. 7. as vitaminas envolvidas. Manutenção: Regime alimentar.7 kg (18. b. três vezes na semana. Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA? 4. De que forma isso contribui para o emagrecimento da paciente? 3. as 5 coenzimas necessárias. dando ênfase às caminhadas.7 kg. Por que a inibição da piruvato translocase provoca o acúmulo de lactato? 2. Após completar 30 dias de estadia a paciente retornou para casa pesando 85. dança (cerca de uma hora por dia) e atividades na piscina. Definir cofator. encontra-se com 71. verificando a estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina dinucleotídio (FAD) nas suas formas oxidada e reduzida.iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de exercícios. Após oito meses de tratamento. com uma dieta de aproximadamente 900 kcalorias. sensação de enjôo e gosto amargo na boca. carboidratos e lipídios). 8. a localização celular. AULA 7: CICLO DE KREBS 13 . a paciente sentiu-se com sonolência. Em que esses exercícios colaboram para a perda de peso? AULA 6: FORMAÇÃO DE ACETIL-COA 1. portanto com perda de cerca de 10% do peso inicial.

Quando incubação semelhante foi feita substituindo o malato por succinato. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos que fazem parte da cadeia de transporte de elétrons? 2. 7). piruvato.NADH 7. separadamente. glutamato. Em anaerobiose. Explique estes dados. Em qual (quais) caso(s) aumentou a concentração de oxaloacetato? 5. há produção de CO2 marcado se for adicionado azul de metileno. 5 ) e II (p. além das enzimas e coenzimas: (a) acetil-CoA.Para responder às questões de 1 a 4 usar apenas os Mapas I (p. Uma suspensão de mitocôndrias. Que composto é oxidado no ciclo de Krebs? 2. nos dois casos. Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo de oxigênio. com acetil-CoA. A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação estequiométrica com a quantidade de NADH oxidado? 3. AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA 1. Uma suspensão de mitocôndrias foi incubada. observa-se também a descoloração do corante (azul de metileno reduzido é incolor). Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que contém. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve sofrer redução? 3. citrato e ácidos graxos. 1. (c) acetil-CoA + oxaloacetato. Que resultado haveria. se a rotenona fosse substituída por cianeto ou por antimicina A? LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA ATIVIDADE DA SUCCINATO DESIDROGENASE -Protocolo Experimental 14 . que porcentual do composto adicionado estará presente no final da reação? 6. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a regulação principal do ciclo de Krebs Enzima Isocitrato desidrogenase Efetuadores alostéricos Positivos Negativos ADP – NAD+ ATP . suplementada com acetil-CoA marcada com C14 só produz CO2 marcado em aerobiose. a. Em cada caso. Explicar este resultado. (b) oxaloacetato. 4. Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de citrato. ocorreu consumo de oxigênio. Por que? b. neste caso. (d) acetil-CoA + succinato.

Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no gelo. planejar o controle da experiência. Ressuspender o precipitado 2 obtido em 4ml de sacarose 0. escrever a reação que está sendo analisada. Novamente você obterá o precipitado2 e o sobrenadante 2. azul de metileno e óleo mineral. Seguir o protocolo 2. Você utilizará a redução do MTT via succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido. com exceção do reagente pfenilenodiamina. misturar. 3. Para verificar a oxidação do succinato.25M (previamente resfriada a 0 graus). Os aceptores e doadores são fornecidos na forma oxidada. Decantar e descartar o sobrenadante. PAR REDOX NADH/NAD+ 15 EO’ -0. tornar a decantar e descartar o sobrenadante.32 . picando-o bem com a tesoura. existe o fator cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS INTERVALOS DE TEMPO. Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores. homogeneizar o fígado e centrifugar a 4.000 rpm por 30 minutos. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE TRANSPORTE DE ELÉTRONS. as frações devem ser incubadas a 37°C. Antes de iniciar a experiência o grupo deve: 1. discutir as funções do succinato. Você obterá o precipitado 1 e um sobrenadante 1 . Adicionar outros 20 ml da solução de sacarose. INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO Sabendo em que fração celular se encontra a atividade da succinato desidrogenase. Separar o sobrenadante 1 e centrifugá-lo novamente a 10. sacarose. Adicionar novamente 20ml de sacarose 0. A.25M. um processo historicamente importante na elucidação das etapas de ciclo de Krebs. Sacrificar um rato em jejum por concussão cerebral.a) Fracionamento celular b) Verificação da atividade de succinato desidrogenase O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). Esta será a fração celular I.000 rpm por 10 minutos. mergulhá-lo em 20 ml de uma solução de sacarose 0. não sendo reoxidado pelo O2 do ar. Se a reação estiver lenta (isto dependerá da sua preparação mitocondrial). Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando as tabelas que se seguem. B. catalisada pela succinato desidrogenase. 2. Esta será a fração celular II. Seguir o protocolo 1. aqueça os tubos a 37°C por 5 minutos e os compare novamente. Remover o fígado. A redução do azul de metileno pode ser obtida a partir da oxidação do succinato.25M gelada. por 10 minutos. observe a inibição competitiva da enzima por malonato. NÃO ESQUEÇA a inibição é competitiva.

diclorofenolindofenol (DCPI) Benzilviológeno Ferricianeto Incolor Incolor Incolor Incolor 16 VOLUME UTILIZADO 0.6.2 Azul Azul Violeta Amarelo .1 0.6-diclorofenolindofenol (DCPI) red/ox Benzilviológeno red/ox Ferricianeto Fe(CN)64-/Fe(CN)63p-fenilenodiamino (p-FDA) red/ox EO’ -0.06 0.82 ACEPTORES E DOADORES ARTIFICIAIS Piocianina red/ox 2.34 0.25 0.3 0.36 0.36 0.27 COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E OXIDADA REDUZIDO OXIDADO Piocianina 2.22 0.40 0.00 0.3 0.3 0.Succinato/Fumarato FADH2/FAD Azul de metileno red/ox Cit b (Fe 2+)/ Cit b (Fe 3+) Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) Cit c (Fe 2+)/ Cit c (Fe 3+) Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) H2O / ½ O2 -0.20 -0.1 0.

2 ml 7 0.0 ml 0.2 ml 5 0.5 ml 0.2 ml 0.2 ml 6 0.4 ml 25µ l 0.1 (I) 0.2 ml 0.6 ml 0.3 ml 0.1 ml 25µ l 0.2 ml 0.3 ml 1.2 ml 25µ l 0. identificando as drogas A e B.5 ml 0.1 (II) 0.2 ml 0.1 (II) 0.1 ml 1.5 cm 2 0.5M MTT Água Destilada Fração Celular 1 0.1 ml 1.2 ml 0.1 ml 1.3 ml 1.2 ml 0.4 ml 0.2 ml 3 0.1 ml 1.2 ml 0.3 ml 0.2 ml 4 0.5 cm PROTOCOLO 2 TUBO Tampão A Malonato Succinato 0.2 ml 2 0.2 ml 25µ l 0.1 ml 25µ l 0.1 (I) 0.3 ml 1.Seguir o protocolo 3.4 ml 0.2 ml 0.5M Azul de Metileno Água Destilada Fração Celular Nujol 1 0.1 ml 0.3 ml 0.5 cm 3 0.1 ml 1.3 ml 1.2 ml 0.2 ml PROTOCOLO 3 17 .0 ml 0.3 ml 1.1 ml 0.0 ml 0.4 ml 0.5 cm 4 0.1 ml 25µ l 0.5 . PROTOCOLO 1 TUBO Tampão A Sacarose 0.1 ml 0.5 cm 5 0.7M Succinato 0.1 ml 0.p-fenilendiamino (p-FDA) Incolor Violeta 0.0 ml 0. Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas.0 ml 0.5 ml 0.2 ml 25µ l 0.5 ml 0.

2 0.5 0.9 0. c. d.2 0.4 1.0 0. Correto? 5.8 0.5 0.5 0.4 1.2 0.0 0. g.0 0.1 0.4 1.2 0.3 0.1 0.5 0.5 0.0 0.0 0. Hemácia e tecido nervoso fazem fosforilação oxidativa? 18 . b.7M Succinato 0.1 0. responder as questões seguintes: Sempre que há consumo de oxigênio há síntese de ATP? Sempre que há síntese de ATP há consumo de oxigênio? Sempre que há aumento do potencial de membrana há consumo de oxigênio? Sempre que há consumo de oxigênio há aumento do potencial de membrana? Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana? Pode haver síntese de ATP sem aumento do potencial de membrana? Pode haver consumo de oxigênio sem aumento do potencial de membrana? A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto? i.3 0.2 0.2 0.0 0.2 1.2 0.TUBO Volume (ml) Tampão A Sacarose 0.0 0. Com auxílio do software.5 0.2 0.5M Droga A ou B Ferricianeto DCPI p-FDA Água Destilada Fração Celular Nujol (cm) 1 2 3 4 5 6 7 8 9 0.5 0. h. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 3.5 0.4 1.4 1.4 1.2 0. j.5 AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA 1. Software Cadeia de Transporte de Elétrons.5 0. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele composto.9 0.8 0.2 1. f. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de controle fisiológico da velocidade da cadeia de transporte de elétrons? 4.0 0.3 0.9 0.0 0.4 1. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum composto? A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto? 2.1 0. e.0 0.2 0. a.4 1.4 1.1 0.3 1.5 0.0 0.5 1.

6. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 19 . Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de transporte de elétrons em presença de malato e de antimicina A? 7. 11. a) glicogênio fosforilase b) proteína quinase c) glicogênio fosforilase quinase 4. Apontar as que utilizam ATP e as que utilizam HPO42--. Escrever os substratos e os produtos das reações catalisadas por a) proteína quinase b) glicogênio fosforilase quinase c) fosfoproteína fosfatase 3. Correto? 2. A fosfodiesterase catalisa a conversão de cAMP a AMP. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas encontradas no glicogênio são do tipo α -1-4 ou α -1-6. A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH oxidado? 8. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem fornecimento de substrato oxidável? 10. A adição de dinitrofenol restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a inibição da síntese de ATP. Qual o efeito da ativação desta enzima sobre a degradação do glicogênio a glicose 1-fosfato? 5. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a grande utilização no citossol do ATP produzido na mitocôndria? 12. Hemácia e tecido nervoso fazem fosforilação oxidativa? 13. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do glicogênio. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 9. 7. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina inibe tanto o consumo de oxigênio quanto a síntese de ATP. Explicar estes resultados. Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e do glicerol-fosfato)? AULA 10: METABOLISMO DE GLICOGÊNIO 1. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 6.

permeabilidade da célula à glicose. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. síntese de glicogênio. 7. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a última refeição. fígado e ilhotas de Langerhans. libera glucagon. 6. síntese de glicogênio c. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no músculo. ocorre degradação de proteínas de músculo. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a) permeabilidade da célula à glicose b) síntese de glicogênio c) síntese de glicoquinase (fígado) 9. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. 4. permeabilidade da célula à glicose b. hemácia. quando cessa o efeito do glucagon? Se a célula contém proteína fosfatase. adrenalina e insulina no metabolismo de triacilgliceróis. 12. 5. Verificar os diferentes transportadores de glicose e sua dependência de insulina. b. 3. indicando o hormônio que atua em cada caso. O glucagon estimula a gliconeogênese? Como? 9.8. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de jejum noturno e após uma refeição rica em carboidratos. Verificar também se são independentes de insulina para a captação de glicose: cérebro. síntese de glicoquinase (fígado) Transportadores de glicose para o interior das células: 20 . 2. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 11. Mostrar a relação entre AMP cíclico e a síntese de glicogênio. como é possível manter proteínas fosforiladas? 10. c. AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação. 11. Descrever as ações de glucagon. 10. GLUCAGON) 1. rim. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 8. No jejum. síntese de glicoquinase (fígado). Como são desfosforiladas as enzimas. 13. Como a insulina leva a ativação da proteína quinase B? 12.

seria possível encontrar ácidos graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir de acetil-CoA marcada com C14. hemácia. Verificar os diferentes transportadores de glicose e sua dependência de insulina. testículo Adipócito.Transportador GLUT1 GLUT2 GLUT3 GLUT4 Distribuição Hemácias. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. Propriedades Baixo KM Alto KM Baixo KM Baixo KM Dependente de insulina Transporte ativo Co-transporte com Na+ GLUT5 Intestino. fígado e ilhotas de Langerhans. Analisar a regulação desta via. placenta. libera glucagon. Verificar também se são independentes de insulina para a captação de glicose: cérebro. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades apreciáveis de acetil-CoA no citossol? 2. outras células Fígado. 13. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato é elevada? 4. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6fosfato desidrogenase? 3. rim 13. Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato? 10. 5. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para gerar os equivalentes redutores necessários à síntese de palmitato? 7. placenta. O tecido muscular não sintetiza glicerol 3-fosfato.coração. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos? 8. células β do pâncreas Neurônio. Há conseqüências derivadas da produção excessiva de corpos cetônicos? 12. 14. rim. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de triacilgliceróis? AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA 21 .músculo esquelético. Que decorrência isto tem? 9. AULA 13 SÍNTESE DE TRIACILGLICEROL 1. O que impede a síntese e degradação simultânea de ácidos graxos? 11. rim. Se fosse fornecida a uma célula glicose marcada com H3. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A. quais carbonos apareceriam marcados? 6.

Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina hidroxilase? 8. tem necessidade de ingestão protéica. Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato sintetase. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. Definir balanço de nitrogênio. elimina uréia. Um adulto normal. Por quê? 2. 10. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos. Citar a coenzima que participa das reações e a vitamina presente na sua estrutura. Por que? 3. Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase (glutâmico-oxaloacético transaminase . Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio? QUESTÕES PARA DISCUSSÃO 1. 22 . 5. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 3.GTP). Um adulto normal. b) calcular o balanço de ATP c) qual o aminoácido proteico sintetizado? 14. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Por que? 2. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido? 15. com uma dieta rica em carboidratos e lipídios. 11. com uma dieta rica em carboidratos e lipídios. elimina uréia. com uma dieta desprovida de proteínas. 13 . Um adulto normal. tem necessidade de ingestão proteica. Por quê? AULAS 16 : FONTE DE NUTRIÇÃO 1. 4. com uma dieta desprovida de proteínas. 9. Um adulto normal. 6. 2. No ciclo da uréia (da ornitina): a) indicar a procedência dos átomos de nitrogênio da molécula de uréia. Exemplos destes compostos e seus precursores: Glicina purina porfirina glutationa Lisina carnitina Aspartato purina pirimidina Histidina histamina Tirosina adrenalina tiroxina melanina Triptofano nicotinamida 7.1. Citar as condições que levam a um balanço positivo ou negativo de nitrogênio. Esquematizar a reação catalisada pela glutamato desidrogenase. 12.GOT) e alanina aminotransferase (glutâmicopirúvico transaminase .

Segue-se uma lista de defeitos metabólicos hereditários hipotéticos: A. os processos que levam ao acúmulo de lipídios a partir de uma dieta rica em carboidratos. A concentração citossólica de citrato é maior em B do que em A. a. Descrever. 6. b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2. Caracterizar as síndromes de desnutrição mais comuns. Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em desenvolvimento. Fazer um resumo dos efeitos do glucagon. músculo e adiposo.100 kcal por dia. fosfoglicomutase 3. C. entre as enzimas alistadas a seguir. Incapacidade de sintetizar diidroxiacetona a partir de lactato. 8. Incapacidade de fazer gliconeogênese a partir de lactato. c. Escolher. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas). A concentração plasmática de HCO3. Os valores de ordenadas são diferentes para cada curva. B. e a de lipídios. D. fosfofrutoquinase 1. AULAS 17 : REGULAÇÃO INTEGRADA 1. verificar se a sentença é falsa ou verdadeira. hidroxiacil-CoA desidrogenase. e insulina no metabolismo de carboidratos. c) o metabolismo basal de um adulto consome cerca de 1. e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos. 5. d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos poliinsaturados. 23 . mas contendo proteínas de baixo valor biológico. tendo em vista que: a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g.800 kcal por dia. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de proteínas de origem vegetal.4. Planejar a distribuição entre carboidratos. aquela cuja perda de atividade seria responsável por cada um daqueles defeitos: a. com base em regulações hormonal e alostérica. O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à ingestão de uma refeição (tempo zero). b. 4.é maior em B do que em C. 7. 5. 6. 9 kcal/g). f) nove aminoácidos são essenciais para o organismo humano. Incapacidade de fazer a oxidação completa de glicose e lipídios. b. Descrever as conseqüências metabólicas de uma dieta com valor calórico normal. adrenalina. De a até j. lipídios e proteínas de uma dieta normal e de uma dieta para emagrecimento. Incapacidade de utilizar glicose para obtenção de energia. 9. glicose 6-fosfatase f. isocitrato desidrogenase d. lipídios e proteínas no fígado. fosfoenolpiruvato carboxiquinase e. 2. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de proteínas.

sexo. e. A curva I pode representar a concentração de glicogênio hepático e a curva III. lipídios e proteínas adequadas para seu peso. c. A curva II pode representar a atividade da via das pentoses. a gliconeogênese. Segundo as hipóteses formuladas. h. a maior parte da glicose. a. d. no fígado deste indivíduo. Em B ocorre oxidação de aminoácidos essenciais no fígado. Em B a lipogênese é mais intensa que a lipólise no tecido adiposo. Faça duas hipóteses explicativas deste quadro. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do que em B. Em C. Escolha uma das hipóteses e descreva como estão. o caso poderia ser normalizado aumentando a ingestão de carboidratos e diminuindo a de lipídios? AULAS 18 : DIABETES DIABETES MELITTUS 24 . Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase dependente de cAMP. durante várias semanas. aminoácidos e corpos cetônicos plasmáticos é originária do fígado. faixa etária e atividade física. a síntese de glicogênio. g. Para cada hipótese feita.c. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais. analise o balanço de nitrogênio e a produção de corpos cetônicos. a concentração de frutose 2. d. o ciclo de Krebs. o indivíduo apresentou perda lenta e contínua de peso. a utilização de corpos cetônicos pelo cérebro. b. uma dieta com quantidades de carboidratos. a concentração de acetil-CoA e a síntese de ácidos graxos.6-bisfosfato. Um indivíduo adulto recebeu. A B C II III I 0 5 10 15 20 25 Horas 12. A carnitina acil transferase de hepatócitos é mais ativa em A.

principalmente potássio. bem como da perda de água. Quando os níveis de glicose sobem. . A falta de insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do músculo e adipócito. • Aumenta o transporte de aminoácidos para os músculos e outros tecidos. usualmente devido à deficiência ou resistência à insulina. • Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase. devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza. oxidando-a para gerar energia ou usando-a para síntese de outros compostos. vamos lembrar os efeitos da insulina: . nervos e vasos sanguíneos. cujos aminoácidos são usados na gliconeogênese. inibindo a mobilização de ácidos graxos. 2) A tipo II. músculo e tecido adiposo e outras células.Por ação indireta: • Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase dependente de AMPc. 10 a 20% dos casos de diabetes são do tipo I. É uma doença que pode ser definida como um estado de tolerância diminuída à glicose. Ocorre cetoacidose. diluição dos eletrólitos extracelulares e maior concentração dos intracelulares. pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular. Evidências implicam a infecção viral e resposta auto-imune como maiores fatores contribuintes. por ação direta: • Aumenta o transporte de glicose para o fígado. qualquer incremento é acompanhado por perda de água. Assim. Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II. água intracelular é perdida para o interstício resultando em desidratação celular. Devido a isso. Como tudo que tem que ser excretado na urina deve estar solubilizado. • Aumenta a síntese de proteína.Esse hormônio. Ela tem início entre a infância e 35 anos e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de DMID adquirirá a doença). Antes de verificar as diferenças e semelhanças nas manifestações dessas duas diabetes. ou DM não dependente de insulina (DMNDI). • Diminui a atividade da triacilglicerol lipase no tecido adiposo. 25 . com conseqüente aumento da pressão osmótica. ele perde peso. caso não seja tratado. Há dois tipos mais comuns de diabetes melittus (DM): 1) A tipo I. Um indivíduo normal mantém os níveis plasmáticos normais de glicose convertendo-a em glicogênio. pela perda de eletrólitos. A perda de peso é decorrente de perda de tecido muscular e adiposo. também chamada de DM insulina dependente (DMID). o rim não consegue reabsorvê-la e ocorre glicosúria. A DMID é causada pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de hiperglicemia sustentada. • Diminui a quantidade de glucagon circulante por diminuição da expressão gênica. olhos. O desarranjo de todas essas reações é encontrado no diabético. Diabetis melittus insulino dependente (DMID) ou Tipo I. dependendo do tecido.Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e pode comprometer o funcionamento de rins. embora não só a genética possa explicá-la. ele desperdiça glicose eliminando-a na urina. lipídeo e glicogênio em proporções variadas.

Presente em 80 a 90 % dos diabéticos. ou tornar-se-á. Na tipo II. toda uma gama de variação das intensidades dos dois sintomas. Os pacientes apresentam normalmente níveis normais ou elevados de insulina. Atualmente. como sepsis. Diabetes tipo II é mais certamente diagnosticada por uma demonstração da tolerância diminuída à glicose. Alguns pacientes podem necessitar de injeções de insulina. Tratamento Depende do tipo de diabetes.DMNDI Em geral após 35 anos Lento. Deve haver reposição adequada de Na+ e água. atingindo 200mg/dL após 2h de ingestão da solução de glicose. a cetose pode aparecer em certas condições de estresse metabólico. sugerindo que não há a utilização correta do hormônio pelo organismo. Diagnóstico Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as observações clínicas como perda de peso. No período inicial da doença observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL. provavelmente por defeito nos receptores de insulina nas células. ocorrendo. na verdade. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de cetose. Assim. A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de diabetes. Agentes hipoglicemiantes orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou não. Não há relação necessária entre diabetes tipo I e obesidade. dependente de insulina por toda a vida. considera-se que não existem apenas duas situações extremas: cetoacidose diabética ou hiperglicemia não cetônica. silencioso Em geral obesidade 80 a 90% dos casos . perda de peso já pode influenciar na capacidade do corpo de controlar o nível de glicose. com alto fator genético (100% dos irmãos gêmeos idênticos de um diabético tipo II desenvolverão a doença). DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com obesidade e que tenham parentes diabéticos. Nesses pacientes dieta e exercícios físicos são um bom meio de alcançar o controle da glicemia. Tipo I –DMID Idade de início Início Estado nutricional no início Prevalência Em geral infância ou puberdade Em geral repentino Em geral desnutrido 10 a 20% dos casos 26 Tipo II . cetoacidose e glicosúria.Tipo I é. Nos diabéticos tipo II. baseado numa relativa mas não absoluta deficiência de glicose. O indivíduo ingere uma solução contendo 75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal. poliúria (aumento na quantidade de urina) e polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia. pacientes com DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de cetose.

Tanto a hiperglicemia como a hipernatremia afetam muito o cérebro. A retinopatia é quase universal entre os diabéticos. Vírus e toxinas Baixa a ausente Obesidade Normal a elevada Poliúria. A glicosilação de lipoproteínas plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença periférica vascular. β destruídas.Predisposição genética Defeito ou deficiência Outros fatores Insulina plasmática Sintomas iniciais Cetose Efeitos a longo prazo Complicações agudas Moderada Muito forte Cel. nefropatia.e neuropatia. a água move-se para fora das células cerebrais. Diabéticos podem desenvolver retinopatia (principal causa de cegueira). Uma explicação para isso é haver glicosilação de proteínas. a conseqüência mais provável é o coma. que causa a perda de sensibilidade nas extremidades inferiores. A neuropatia de nervos periféricos é comum em diabéticos. sem produção Cel. Aumentando a osmolaridade plasmática. neuropatia e doenças cardiovasculares. 27 . Complicações similares a surgimento após 5 anos tipo I. tornando os pacientes propensos a lesões nas pernas e pés. que ocorre principalmente no ε amino da Lys. Quando a osmolaridade alcança 340 a 350 mosmol/kg. causando desidratação celular. Complicações decorrentes do diabetes A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. Quando essa doença se desenvolve o paciente necessita de hemodiálise e transplante renal. com alta incidência de gangrena e amputação. polidipsia. principalmente a neuropatia simétrica. Essas proteínas ficam com conformação alterada e são mais resistentes ao ataque proteolítico. perda de Nenhum ou os mesmos do peso. enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 % dos portadores de DMID e em menos de 20% daqueles com DMNDI. fome. nefro. cetoacidose comum tipo I mais suaves Comum Rara Retino-. Faça hipóteses para explicar esse fato. mais tardias Cetoacidose Coma hiperosmolar Responde Em geral não necessário Resposta a hipoglicemiantes Não responde orais Administrar insulina Sempre necessário Coma diabético A glicose sanguínea em concentrações maiores que o limite de reabsorção renal provoca uma rápida diurese osmótica. A dosagem de Hb glicosilada plasmática é um teste mais sensível que a medida de glicemia. β produzem menos de insulina ou igual insulina. Há tendência a hipovolemia e deslocamentos de água intracelular para o espaço extracelular. que leva a perda de água e eletrólitos.

a paciente passou a sentir também fortes dores de cabeça.B. Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL) Cetonúria = +++/++++ (O normal é negativo). Exame Físico: Regular estado geral. Foi-lhe dito que. pulsos finos. História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de emagrecimento em um spa há três dias. 1. Relata que no entardecer do dia esteve em uma lanchonete com amigos. quando falava as pessoas sentiam cheiro de acetona. hálito cetônico bastante evidente. Exame Fïsico: Bom estado geral. principalmente nos acontecimentos sociais. hálito cetônico. a boca seca e. branca. bastaria uma refeição calórica que. aliadas à fraqueza. porém.P. segundo seus familiares. duas vezes ao dia. Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL) Cetonúria = +++ / ++++ Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de idade. há oito horas. Passadas quatro horas. Na seqüência sentiu um hálito amargo. Gosto amargo na boca e sensação de fraqueza. notou gosto ruim na boca e o apetite diminuiu. há uma hora. Dados de gasometria revelam acidose. comeu pizza e tomou sorvete. ritmos cardíaco e respiratório normal. Qual o sinal clínico comum aos dois casos relatados? 28 . por via muscular. levemente taquicárdico.. o gosto ruim na boca é muito intenso e acompanhado de um hálito próximo ao cheiro de acetona. para resolver seus sintomas. executiva do ramo de cosméticos. precisando levantar várias vezes da cama. começou a urinar intensamente. masculino. Como já passou por situações semelhantes. Respiração tendendo a ofegante. a fim de ser medicado antes do agravamento do quadro. mas que não é incomum a transgressão da dieta. Está submetida a uma dieta de 300 kcalorias/dia. Queixa e Duração:Aumento do volume urinário há 4 horas. ritmo cardíaco regular. Procurou o ambulatório médico para esclarecimentos. Após três horas de cuidados a glicemia já havia baixado para 185 mg/dL. de hora em hora. Queixa e Duração: Sensação de fraqueza há doze horas. Relata que no primeiro dia nada sentiu. procurou o serviço médico.L. palidez cutâneo-mucosa. bancário. Faz uso de insulina. Hálito amargo há um dia. Refere que procura seguir as recomendações dietéticas. a partir do segundo dia.CASO 1 Identificação: J. mas a cetonúria ainda se mantinha em + / +++. Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina. administrada por via subcutânea. Tudo seguido de uma intensa fraqueza e leve falta de ar. pressão arterial = 100 x 60 torr. 25 anos. de descompensação diabética.M. Sinais clínicos de desidratação. branco. não é lhe indicada já que está sob regime de emagrecimento. Hoje. 35 anos. CASO 2 Identificação: J. no terceiro dia de estadia. Indicou-se que aguardasse por mais alguns dias até que os sintomas regredissem. porém. onde ingeriu quatro ou cinco chopes. feminina. Dor de cabeça intermitente.

Por que o valor da glicemia difere tanto entre os casos 1 e 2? 3.2. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. 15. 14. Qual é a relação entre a glicemia e a presença plasmática de acetona? 4. desde que hidratado) como nos casos de greve de fome. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1 e 2? 7. hemácias. indicando o hormônio que atua em cada caso. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de frutose 2. Após alguns dias no spa. Nos dois casos apresentados. Citar a fonte de energia utilizada pelo cérebro. Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos casos 1 e 2? 9. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de um mRNA específico sem mudar o gene codificante da proteína os elementos controladores do gene. Qual a principal fonte de ATP para a contração muscular. que tipo de reserva a paciente do caso 2 deve estar utilizando para a obtenção de ATP? 6. Indicar as condições metabólicas que levam a uma aumento na produção de corpos cetônicos 18. manutenção ou ganho de peso? 10. Descrever as ações de glucagon. lipídios e proteínas provocadas por jejum prolongado e por diabetes. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65 mg/dL? Que via metabólica é utilizada para a síntese de glicose? 8. músculo e fígado neste jejum extremo. adrenalina e insulina no metabolismo de triacilgliceróis AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO 1. 16. Pela deficiência de insulina. nesse caso? 5. o paciente do Caso 1 fica impossibilitado de usar a glicose sangüínea em células como as do músculo. Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a quatro semanas. a tendência dos pacientes é de perda. Tabela de códons 29 .6 bisfosfato. Descrever as alterações do metabolismo de carboidratos. 17. pois a entrada de glicose nessas células é estimulada pela insulina.

c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente que o normal. Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma proteína chamada A.2. porém a enzima triptofano sintase é estável. coli são crescidas no meio com glicose como única fonte de carbono. coli são crescidas no meio contendo lactose. Além disso. Qual peptídeo é mais intensamente marcado? (B) Em t=3 minutos. você adiciona todos os 20 amino-ácidos. A2. A3. 4. Um transcrito para um gene contem a seqüência de bases abaixo: 5´ AACUGCACGAGGUAACACAAGAUGGCU 3´ Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes fases. O peptídeo A1. corta-a com tripsina e isola os cinco peptídeos. você isola a proteína A intacta do sistema. você sabe que a proteína A tem quatro pontos sensíveis à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1. (A) Em t=1 minuto. reduz ou não é 30 . 3. você sabe que seu sistema precisa de 4 minutos para produzir uma molécula de proteína A completa. cada um levando uma marcação com 14C . Explique. Aponte três mutações que não modificam a sequência da proteína. Tryptofano é adicionado. Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes condições: a) O trp mRNA é estável (degrada lentamente após algumas horas) b) O trp mRNA é degradado rapidamente. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de proteínas. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que decodificam o código genético.terminal e A5 é o carbpxi-terminal. Células de E. A4 e A5. Finalmente. 5. tRNA e rRNA? Aula 20: Regulação da Expressão Gênica 1. porém não glicose. Indique em cada uma das situações abaixo se a expressão do operon lac aumenta. 2. 7. Quais são as funções do mRNA. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações em: a) o gene lacI que inativa o repressor b) o promotor é eliminado na região próxima a posição -10 3. é o amino. As células continuam a crescer e dividem a cada 30 minutos. qual será a ordem de marcação dos peptídeos do mais para o menos marcado? (C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas? 6. Quais mecanismos são usados para garantir a fidelidade de cada um destes processos. Em t=0. Células de E.

Desenhe um modelo descrevendo o que acontece em cada uma destas situações. a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a seqüência 2. na sua opinião. os pontos favoráveis e desfavoráveis ao emprego da tecnologia para produção de alimentos transgênicos. coli pode ser afetada pelas seguintes manipulações da região promotora do mRNA trp. Esta RNA polimerase inicia somente a transcrição a partir de uma única região promotora altamente especializada. 31 . Para complementar seus estudos.alterada. monitores e colegas de grupo. d) Uma mutação que inativa completamente a permease galactosidase e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região do promotor lac. Como a transcrição do gene operon trp da E. acesse os sites recomendados ao final dos textos. c) Uma mutação que inativa completamente a β -galactosidase. 4. Esses termos deverão ser esclarecidos com o auxílio dos professores. Aula 22: Técnicas de Biologia Molecular. Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um fungo exótico. Façam uma lista contendo. e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador. a) Adição de alta concentração de glicose b) Uma mutação que impede a dissociação do repressor lac na região reguladora. A atividade desta RNA polimerase é reduzida quando a enzima é purificada. c) Removendo a seqüência 4 d) Trocando os dois códons trp no peptídeo iniciador para códons de His. Transgênicos – 7° Teste Questões para Estudo Leia os textos que se seguem a respeito de alimentos transgênicos. Sugira uma explicação para esta observação. 5. b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3. destacando os termos que você não compreenda ou de que nunca tenha ouvido falar.

A decifração do código genético e a manipulação do DNA neste último quarto de século. Nos primeiros ¾ deste século. pois.uma técnica para transformar células vegetais através da introdução do gene de interesse. . ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou Tecnologia do DNA Recombinante). Para a introdução do gene em outro organismo são utilizados vetores de clonagem (plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida. produção de proteínas humanas em microorganismos. Procedimentos para a obtenção de vegetais transgênicos: Para obter plantas transgênicas são necessários: .o gene de interesse. cuja característica adquirida passa a ser transmitida para as futuras gerações. O gene artificial ou intencionalmente inserido no genoma de um organismo é denominado transgene. O sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil cultivo e permitir a purificação e recuperação do produto do gene. na qual a transferência de genes se dava por meio de cruzamentos (reprodução sexuada). produzindo maiores safras de alimentos de origem vegetal. cientistas podem identificar e inserir no genoma de um determinado organismo um único gene responsável pela característica em particular. A clonagem molecular consiste no isolamento do gene de interesse. Surgiram técnicas biotecnológicas como a produção e pesquisa de plantas e animais transgênicos.uma técnica para gerar uma planta inteira a partir de uma só célula transformada. . plantas e animais. a partir de 1900 as Leis de Mendel foram redescobertas e começaram a ser aplicadas. abrindo novas perspectivas econômicas nos campos da saúde humana. aceleraram as descobertas científicas e suas aplicações biotecnológicas. aumentando a produtividade de animais e contribuindo para uma maior longevidade humana. O termo geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia do DNA recombinante para a alteração genética de animais.Definição de transgênicos: Os Transgênicos são organismos que adquiriram características de outro organismo. amplificação do número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. Histórico: A Genética é uma ciência característica do século XX. mapeamento do genoma humano. misturando todo o conjunto de genes dos dois organismos em combinações aleatórias. Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a transferência do material genético de um organismo para outro. A técnica exigia uma enorme demanda de tempo e não era precisa. Antes do desenvolvimento desta técnica. a mais utilizada era a do Melhoramento Clássico. pelo uso de técnicas modernas de Engenharia Genética. a genética mendeliana contribuiu significativamente para a sustentação do crescimento populacional de nosso planeta. clonagem de mamíferos. Ao invés de promover o cruzamento entre organismos relacionados para obter uma característica desejada. resultando em um organismo geneticamente modificado (OGM). plantas e microorganismos. sanidade animal e produção de alimentos. entretanto. 32 . O crescimento acelerado do campo da biotecnologia. técnicas de detecções e diagnósticos por PCR e Terapia Gênica.

além dos genes naturais. entretanto.  Genes bacterianos que codificam proteínas com propriedades tóxicas para insetos. onde este material é inserido e replicado por várias vezes. Os herbicidas são muito usados no controle de ervas daninhas. tem-se uma planta transgênica. 33 . Estes fragmentos são. Os genes são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta característica que permite que genes de um organismo sejam potencialmente funcionais em outro.000 e 60. um gene adicional proveniente de outro organismo. enquanto o genoma humano consiste de aproximadamente 30. para isso. Uma das possibilidades para isolamento de um gene é a construção de uma “biblioteca genômica” e. uma bactéria ou até um animal.Após esta última etapa.000. entre eles temos:  Gene que codifica proteína capaz de modificar herbicidas. Depois.000 genes. culturas contendo este gene poderiam tornar-se resistentes ao herbicida.000 genes. ligados a outros fragmentos de DNA. Deste modo. presente na castanha-do-pará. inativando-os. o DNA do organismo contendo o gene de interesse é extraído. entre 40. Este gene poderia ser usado para aumentar o valor nutricional de culturas importantes como feijão e soja. seleciona-se a colônia de bactérias que contém o fragmento de DNA correspondente ao gene de interesse. então. o de plantas. mas que podem se replicar em bactérias. Diversos genes de interesse agronômico já foram isolados. Genes de Interesse: O genoma de uma bactéria contém em média 5. levando ao seu controle na cultura.  Gene que codifica uma proteína de alto valor nutricional. Em seguida o DNA é cortado em fragmentos menores utilizando as enzimas de restrição. porque ela contém. facilitando assim o controle das ervas. algumas culturas não sobrevivem à aplicação deste produto. que pode ser uma planta. Os insetos que se alimentassem de plantas expressando este gene morreriam ou se desenvolveriam com menor eficiência.

em seguida. Parte do plasmídeo é um transposon (T DNA) que produz cópias de si mesmo nos cromossomos da planta infectada. A produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá resultar em um produto mais economicamente viável que o enriquecimento do trigo com a lisina obtida de microorganismos. como plantas e animais. um choque elétrico de alta voltagem é aplicado por curtíssimo tempo. Regeneração das plantas a partir das células transformadas: Uma vez inserido o gene na célula vegetal. Papel dos transgênicos na economia mundial: O século passado teve um grande desenvolvimento na biotecnologia microbiana. embora esta técnica já esteja estabelecida para inúmeras plantas de interesse econômico. em São Francisco. o domínio das técnicas de regeneração de plantas inteiras a partir de uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. 34 . O plasmídeo encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a transformação de plantas.especialmente para o caso de monocotiledôneas) ou através de agrobactérias. C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA extracromossomal que pode se replicar independentemente do cromossomo. Neste século. as mudanças obtidas no nível celular não são significativas. o que permite a penetração e eventual integração dos genes no genoma. Os microprojéteis são acelerados com pólvora ou gás em direção aos alvos (as células vegetais). Os genes entram nas células junto com o projétil de maneira não-letal. O choque causa uma alteração da membrana celular. há diferenças conceituais entre a situação com microrganismos e com plantas: nos primeiros. esta etapa ainda representa o maior gargalo na criação de plantas transgênicas. os objetivos finais são mudanças operadas no nível celular. introduziram o gene proveniente de uma rã em uma bactéria.Transferência dos genes de interesse em plantas: A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado . Ou seja. inserindo-se aleatoriamente nas organelas celulares. o DNA é dissociado das micropartículas pela ação do líquido celular. A transferência é alcançada por um dos métodos seguintes: A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais. estabelecido pela primeira vez em 1973. A transformação de uma célula vegetal é um tipo de manipulação genética que atende ao mesmo princípio da transformação de microrganismos. quando Stanley e Cohen. Os transposons são assim denominados (ou também chamados elementos de transposição) justamente porque são elementos genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se. desprovidas de parede celular. são incubados em soluções que contêm os genes a serem transferidos e. No entanto. a não ser que possam ser transferidas para todas as células do organismo. E. Para a transformação. nutricionais e ambientais para a regeneração. como cada espécie de planta tem diferentes exigências hormonais. esta célula ou grupos delas são estimuladas a gerar uma planta transformada. ocorrendo o processo de integração do gene exógeno no genoma do organismo a ser modificado. Em seguida. B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio cobertos com os genes de interesse. enquanto que em eucariotos superiores. é esperado um rápido desenvolvimento na biotecnologia animal e vegetal.

enquanto reduzimos os impactos ambientais. Vegetais geneticamente modificados: A maioria dos produtos já liberados para a comercialização contém transgenes que codificam características que visam minimizar estresses ambientais. muitos alimentos transgênicos importados já são comercializados e estima-se a importação de 3 milhões de toneladas de milho da Argentina e dos E. De acordo com uma pesquisa sobre a expectativa de comercialização de produtos obtidos de organismos geneticamente modificados nos E. dando resistência contra pragas de insetos ou viroses. No Brasil. estáveis quando armazenados e.A modificação genética de microrganismos continua sendo uma importante complementação para as modificações genéticas de plantas e animais. algumas tendo se tornado sucessos comerciais. Enquanto essas características têm trazido benefícios aos agricultores. em casos limitados. podem promover saúde trazendo benefícios para consumidores. Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30 milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. principalmente com características preferidas pelo mercado. um decréscimo no preço devido a custos reduzidos e aumento da facilidade de produção (University of Illinois. Esses esforços devem ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da agricultura.A. os consumidores dificilmente notaram qualquer benefício além de. onde as lavouras transgênicas são permitidas oficialmente. as características que visam aumentar a qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e deverão prevalecer nas próximas gerações de produtos transgênicos. Benefícios promovidos pelos transgênicos na agricultura: A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de plantas para alimentação. O ritmo atual de liberação de OGMs indica que na primeira década deste século já teremos uma centena de produtos geneticamente modificados nas prateleiras dos supermercados. É essencial melhorar a produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial crescente.A aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade apareceu no mercado europeu. e produzindo tolerância a determinados herbicidas. os E. seja em nações industrializadas ou em desenvolvimento.A.. que estejam atualmente em uso. Falck-Zepeda et al 1999). resistência a insetos e vírus. organizados.U. devem ser feitos para investigar os efeitos potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas.U. bioprocessamento. biorremediação e tratamento de águas.1999. Alimentos produzidos através de tecnologias de modificação genética podem ser mais nutritivos. biofertilizantes e biopesticidas. podendo-se chegar na casa dos milhares em algumas décadas. a agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em volume. No entanto. incluindo tolerância a herbicidas. em princípio.U. Esforços em conjunto. Para isso. especialmente para a produção de metabólitos secundários. Os desenvolvimentos resultantes em variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado no aumento de vida em prateleiras de frutas e vegetais. Na década de 90. é necessário utilizar de forma adequada e responsável as novas tecnologias e descobertas científicas. A seguir são apresentados alguns exemplos do uso da tecnologia da modificação genética de vegetais aplicada a alguns problemas específicos da agricultura: 35 .

mais forte e que aumenta o rendimento da safra diretamente. Como exemplo. graças à injeção de um único gene capaz de absorver um excedente de sal em plantações de tomate. Porém. temos um gene de tolerância em manguezais (Avicennia marina) que foi clonado e transferido para outras plantas que se mostraram mais tolerantes a altas concentrações de sal. Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e cultivado. Ele foi produzido usando-se genes envolvidos na produção de proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na dieta humana (Goto et al. Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual. deve-se considerar o fato de que populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta transgênica. e o desenvolvimento da sua parte reprodutiva (comestível) é aumentado. 1998).Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada no Hawai desde 1996 (Gonsalves. com conseqüente diminuição ou eliminação da necessidade do uso de pesticidas. É resultado do uso de modificação genética em vegetais visando obter maior resistência a uma praga específica. Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro. As plantas transgênicas contêm entre 2 e 4 vezes mais ferro do que normalmente encontrado no arroz convencional. como acontece com o uso de inseticidas. uma vez que o alongamento das células na parte vegetativa é reduzido. que devasta os arrozais africanos. por exemplo. O gene introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio excedente. temos o vírus Mottle Amarelo do arroz (RYMV). tomates perfeitamente comestíveis. Estes genes (NORIN 10) agem da mesma forma quando utilizados para transformar outras espécies de plantas importantes como alimento. Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto rendimento como. o trigo semi-anão que possui genes insensíveis à giberelina. os pesquisadores utilizaram uma técnica de imunização genética. Um exemplo de combate ao stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em solos ácidos (de La Fuente et al 1997). A introdução desses genes faz com que se obtenha uma planta mais baixa. através da criação de plantas de arroz transgênico resistentes ao RYMV. 1999). Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições. Segundo a revista Nature Biotechnology. Como exemplo. de forma a combater a anemia. cientistas conseguiram fazer crescer e desenvolver em água contendo forte teor de sódio. 36 .

Polêmica sobre os Alimentos Transgênicos . Foram inseridos genes de bactérias que fazem a conversão do precursor presente no arroz em beta-caroteno. que ajuda a combater diversas doenças. • Purves.arroz normal arroz transgênico Pesquisadores desenvolveram arroz com alto teor de beta-caroteno. Sinauer AssociaTES. Será iniciado um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o consumo de alimentos transgênicos. Mercado Aberto. W.br/start.cfn. ser limitado a aspectos nutricionais. R. • Zaha.Freeman and Company. agroeconomia. aumento da produtividade. & Heller. Em cada sala haverá um professor para mediar o debate e esclarecer as regras da atividade. • Okamuro.ctnbio. 37 . 1ed.C. Orians.Artigo da revista Ciência Hoje com link para arquivo pdf.br/cienciahoje/ch/ch146.org. (1989) The Biology of Plants.. precursor da vitamina A. Referências • Lewin. portanto. (1994) Genes. Utilize sua lista. Porto Alegre.G.php?id=port Questões para Discussão Cada sala deve ser organizada em dois grandes grupos – pró e contra. (2001) Life – the science of Biology. redigida nas “questões para estudo” para auxiliar o debate. ressecamento da córnea. o grupo contra deverá utilizar argumentos que condenem os transgênicos. Cerca de 300 g desse arroz cozido por dia suprem as necessidades de betacaroteno de um indivíduo.htm .com. 6th. como a cegueira noturna. diarréias e sarampo. O debate não deve.D. Ed.H. A.htm . H. Academic Press Inc. envolvendo tópicos como impacto ambiental.htm .: www.H..Posicionamento do Conselho Nacional de Nutricionistas: www. O resultado desse experimento foi a produção de grãos amarelados de arroz.org. devido à presença de beta-caroteno.B.gov.Posicionamento da SBBq: http://www.br/variavel/destaque/pgdestaque2. Oxford University Press. New Yourk.) (1996) Biologia Molecular Básica. Em ambos os casos os argumentos devem ser os mais variados possíveis.br/ctnbio/bio/artigos/004. (Coord. J.uol. redução do custo ou aumento do preço dos alimentos.Conselho Nacional de Biossegurança: www. & Goldberg. B.K. Inc & W.sbbq. Sadava. benefício para a saúde etc.K.

18. 6. Um dos métodos mais utilizados consiste na lise das bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio).8.Preparação do DNA plasmidialFundamento: Existem vários procedimentos para purificação em pequena escala de DNA plasmidial de células bacterianas.Solução de lise – SDS 1% em NaOH 0. Ribonuclease A 150µ g/ml em TrisHCl 25mM pH 8. EDTA 10mM. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro eppendorf contendo 300µ l de Isopropanol. Centrifugar a 12000xg por 10 min á temperatura ambiente . Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e delicadamente.Solução Neutralizadora – Acetato de potássio 3M pH 4.E .5 µ l/ml de Brometo de etídio e submeter a eletroforese a 100V em Tampão TBE. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no Vórtex. extrair e purificar o DNA plasmidial. 7. Aplicar a amostra em gel 0. Incubar o tubo em gelo por 20 min. 10. Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min.coli em meio LB-A (50µ g/ml ampicilina). Centrifugar a 12000xg por 5 min á temperatura ambiente. Utilizaremos cultura de E. 12. 17.0. Incubar a mistura por 5 min á temperatura ambiente. Soluções utilizadas: . Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente. Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência anterior. Neste procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo removidos por centrifugação. 3. 38 .7% de Agarose em TBE. 13. 16. 14. Centrifugar a 12000xg por 15 min á temperatura ambiente. Centrifugar a 12000xg por 5 min á temperatura ambiente. contendo 0. O DNA plasmidial purificado é em seguida concentrado por precipitação com etanol. 8.GET / Rnase – dextrose 50mM.2 N .Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose . separando-o do DNA cromossomal bacteriano. 1. Incubar por 5 min à 65 °C. . 15. Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra na proporção 1:10. 11. 4. 9. Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T. Tomar 1 ml da cultura e colocar em um tubo de eppendorf. 2. Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta. 5.

Questões 1. EDTA e Tris) ? 2. Qual a função do NaOH e do SDS presentes na solução de lise ? 4. Usaremos o plasmídeo pBR322 (ver mapa). genes que codificam para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). O que é lisozima e para que é usada na preparação de plasmídeos ? 3. Por que se dissolve a preparação de DNA em tampão Tris-EDTA ? 7. uma vez que este sítio está localizado na região amp r. leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido) contento estes antibióticos. O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de genes. Como age o isopropanol ? Este álcool poderia ser substituído por etanol.5 mg/ml tetraciclina. Transformação de bactérias que são sensíveis a um antibiótico. Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da resistência à ampicilina. em resistentes. Este plasmídeo pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas) que podem ter valor seletivo no meio.. por exemplo ? 6. clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina. Se o DNA cromosomal tiver sido muito quebrado durante as manipulações.Transformação de bactéria com plasmídeo contendo genes de resistência a antibióticos Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua manutenção como um elemento autônomo auto-replicativo. Que papel desempenha cada componente do tampão GET (glicose. ou seja. Na aula prática usaremos o método do CaCl2. 39 . Neste método as bactérias são submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes para a transformação pelo DNA do plasmídeo. será revelada através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LBtet. Da mesma forma. Contendo 50 mg/ml ampicilina ou 12. Portanto a introdução de pBR322 em E. onde espera encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de DNA plasmidial? 5. Várias técnicas são disponíveis para transformar uma bactéria.coli) o pBR322 apresenta duas marcas genéticas. Além da origem de replicação que permite sua propagação em bactérias (E. Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ? .coli que normalmente é sensível tanto à ampicilina como à tetraciclina.

1 M. Adicionar 0. Transferir a cultura para o gelo. 4.5 contendo CaCl2 0. distribuir 0. por uma hora. à 37°C até o dia seguinte sob agitação forte (200-250 rpm). Diluir a pré-cultura 1/10 em 10 ml de meio LB. incubar à 37°C sob agitação até OD600nm=0. 6.Procedimento experimental: O ideal é que a experiência seja realizada em ambiente asséptico (fluxo laminar).1 ml/tubo da suspensão de bactérias competentes para cada um de 2 tubos. Transferir os tubos para o gelo por 2 min. 5. 9. Espalhar as bactérias com o auxílio de uma alça de vidro. 7. 3. 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão (frio). 1. Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM pH6. 40 . 8. Incubar no gelo por 20 minutos. Para transformar. para evitar contaminação. As bactérias competentes assim preparadas podem ser armazenadas a –80°C. Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. 5 min). As bactérias competentes para transformação são preparadas a partir de uma cultura em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma solução de CaCl2. Coletar as bactérias (4000 rpm.5 contendo 1 mM EDTA) a um dos tubos. Incubar em gelo por 15 min. em banho-maria. para uso posterior. Adicionar o DNA transformante (0.9 ml/tubo de meio LB e incubar a 37°C sem agitação. previamente flambada e em seguida resfriada na própria tampa da placa de Petri. Manipule convenientemente o material estéril fornecido. Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E.3 (fase logarítmica de crescimento). NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO.coli) e incubar 2. No gelo estas BACTÉRIAS COMPETENTES podem ser transformadas. coletar as bactérias por centrifugação (4000 rpm.5 µ g DNA de pBR322 em 10µ l de tampão 10mM Tris pH7. Após pelo menos 30 min. Antes de dar o choque térmico (42°C por exatamente 90 segundos) . O outro tubo será usado como controle (bactéria apenas).

Qual a eficiência de transformação obtida. 41 .Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| ANÁLISE DOS RESULTADOS 1. Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes? 2. Qual o papel do choque térmico? 3. a 37°C antes de espalhá-las em placas de ágar? 4. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo. em termos de n° de colônias / µ g de DNA? Questões 1. Preencher a tabela com o número de colônias obtido em cada caso: Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| 2. Por que as bactérias devem ser incubadas por 60 min.

Sign up to vote on this title
UsefulNot useful