Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno) Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214 Departamento de Bioquímica Instituto de Química 2009 Docentes: Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup. Sala 854 Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala 1013/1018

Monitores: Cecília Midori Ikegami (cikegami@usp.br) Mariana Lemos Duarte (mlduarte@gmail.com)

Programa Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise; gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons; fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos transgênicos. Bibliografia - Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999. - Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002. - Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996. - Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000. - Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004. - Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002. - Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc., 5th ed New York; 2001. - Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing Company; 1996. - Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G. Scrimgeour Prentice Hall; 1993. - Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995. - Nutritional Biochemistry: T. Brody – Academic Press; 1994. - Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996. Critério de Avaliação O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará 1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final deverá ser feito através da seguinte equação: NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5 10

2

Cronograma de Aulas 17/08 19/08 24/08 26/08 31/08 02/09 07/09 09/09 14/09 16/09 21/09 23/09 28/09 30/09 05/10 07/10 12/10 14/10 19/10 19/10 21/10 26/10 28/10 02/11 04/11 09/11 11/11 16/11 18/11 23/11 25/11 30/11 02/12 Aula 9 Aula 10 Aula 11 Aula 12 Aula 13 Aula 14 Aula 15 Aula 16 Aula 17 Aula 17 Aula 18 Aula 19 Aula 20 Aula 21 Aula 22 Aula 1 Aula 2 Aula 3 Aula 4 Aula 5 Aula 6 Aula 7 Aula 8 Enzima (funções e propriedades) Catabolismo/ Anabolismo (introdução) Glicolise (via das pentoses) Gliconeogênese – 1° Teste Oxidação de Triacilgliceróis Formação AcetilCoA (vitaminas e cofatores) – 2° Teste Feriado Ciclo de Krebs 1° Prova Fosforilação Oxidativa Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia de transporte de elétrons. Sala multimídia - Cadeia de transporte de elétrons e fosforilação oxidativa Metabolismo de Glicogênio – 3° Teste Controle Hormonal (insulina, glucagon e vitaminas) Controle Hormonal (insulina, glucagon e vitaminas) Síntese de Triacilglicerol – 4° Teste Feriado 2° Prova Metabolismo de aminoácidos Ciclo da uréia Fonte de Nutrição – 5° Teste Feriado Regulação Integrada Feriado Regulação Integrada Diabetes – 6° Teste Tradução e Código Genético Regulação da Expressão Gênica Biologia Molecular (testes diagnósticos) Técnicas de Biologia Molecular; Transgênicos – 7° Teste Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose Apresentação de Seminários (Alimentação e BioMol) 3° Prova

3

AULA 1: ENZIMAS I. Classifique as afirmações abaixo como verdadeiras ou falsas: 1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( ) 1.2. A velocidade da reação é proporcional ao tempo da reação. ( ) 1.3. A velocidade da reação é proporcional à concentração de substrato.( ) 1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração de substrato não seja limitante. ( ) 1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( ) 1.6. A quantidade de produto formado depende do tempo da reação. ( ) 1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( ) 2. Definir enzima, substrato e sítio ativo 3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da concentração de S. 4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade da enzima pelo seu substrato 5. Fazer o gráfico da velocidade de uma reação enzimática em função de: a. Concentração de enzima; b. Temperatura; c. pH. Justificar a forma dos gráficos 6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse procedimento. 7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de inibidor escolhido, competitivo ou não competitivo?

4

T. CASO 2 R. encontra-se pálido. precisou subir um lance de escada e sentiu-se muito cansado.Ler o relato dos três casos apresentados a seguir. saiu de casa sem comer nada e iniciou o trabalho. vindo a cair da própria altura.B. Relata que logo ao sair do aeroporto. após ter desmaiado no trabalho. Depois dos exames preliminares.P. CASO 3 5 . CASO 1 P. Insistindo com a atividade que fazia. nesta manhã. 27 anos. trabalhador da construção civil. No final do terceiro dia. Embora tenha feito refeições corretas. com a recomendação de que ingerisse chá ou outra bebida estimulante. Com o passar dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e sudorese fria. 32 anos. extremidades frias e referindo forte dor de cabeça. desmaiou. sudoreico. analisador de sistemas. Conta que nos últimos dias alimentou-se mal e.. Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas. Foi dispensado do hospital. tendo tido necessidade de um esforço intenso.Aula 2: Introdução ao Catabolismo e Anabolismo Obtenção de energia pelo Metabolismo MP I AA E q e ag ra d d g a a ã d n tr n s s u m e l a e r d ç o e u ie te A IM N O L ET S P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G oe lic s A in á id s m oc o Á id G x c o ra o C O ND A FD A + 2 ND AH FD AH 2 A P+P D O2 H2O i AP T A . vindo de Salvador. foi posto sob respiração em balão de oxigênio e rapidamente sentiu-se melhor. O paciente chegou no dia anterior a La Paz.. fumante. sendo conduzido ao Pronto Atendimento. No momento do exame. o cansado persistiu e agravava-se com atividades físicas que até a véspera fazia sem problemas. trazido por colegas. a tontura tornou-se muito forte e escureceu– lhe a vista. Deu entrada no serviço de emergência. masculino. por volta das 10:00 horas da manhã.

Que compostos são produzidos como conseqüência desta reação? Entre os compostos produzidos. A falta de que composto provocou os sintomas relatados nos três casos descritos? O que restringiu a síntese deste composto em cada um dos casos? Os sintomas dos casos 1 e 2 são claramente neurológicos. 42 anos. no máximo.J. o paciente sentiu forte dor no peito. HPO42-. Qual o primeiro composto comum à degradação de carboidratos. quais são excretados e qual é aproveitado pelas células? 6. de inicio abrupto. e. Que partes do Mapa I devem ser suprimidas quando referente exclusivamente ao cérebro? A síntese de ATP é obtida por oxidação ou redução dos alimentos? Discutir as seguintes afirmações: a.F. 1. Conta que o seu pai ficou pálido. Logo ao sair para o trabalho. As concentrações celulares de Na+ e K+ são. Os compostos característicos de um dado organismo devem ser supridos pela dieta. em aperto. 2. c. masculino. quer se processe in vitro. O paciente iniciou há seis meses um quadro de dor no peito. d. executivo. f. respectivamente 25 mmols/L e 150 mmols/L e as concentrações plasmáticas são 140 mmols/L e 5 mmols/L. B – Com base no Mapa I. quer ocorra in vivo. entre parênteses. b. Os processos celulares que requerem energia utilizam a energia térmica proveniente da oxidação dos alimentos. o número de átomos de carbono de alguns compostos.P. 5. 1. o paciente foi a óbito. A oxidação biológica consiste na retirada de hidrogênio do substrato. A quantidade de energia derivada da oxidação de nutrientes é a mesma. Com esse quadro foi trazido ao pronto socorro e embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca. fumante. relata o filho que o estava acompanhando. Fazendo exames de avaliação cardíaca. A manutenção destas concentrações é espontânea? Como o organismo consegue mantê-las? 8. Quais são os passos irreversíveis que aparecem no mapa? 2. 3. Alimentos + Processos que requerem energia VIAS METABÓLICAS DEGRADATIVAS No Mapa II (página seguinte) encontra-se. Acrescentar O2. sempre que fazia algum esforço físico. proteínas e lipídios? 6 . responder as questões seguintes. começou a suar frio e dentro de poucos minutos perdeu a consciência e caiu. foi constatada obstrução parcial de uma das artérias coronárias. A única função dos alimentos é fornecer energia. ou ao sentir emoções.. com duração de cinco a dez minutos. Resuma: por que é necessário comer e por que é necessário respirar? 7. ADP e ATP nos espaços do esquema abaixo. A dor melhorava com o repouso. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um composto rico em energia (ATP). como subir uma ladeira caminhando. 4. Desde então vinha fazendo uso de remédios que promovem dilatação das coronárias.

Não havendo outras restrições na dieta. verificando se é possível sintetizar: a. página 45 . glicose a partir de proteína f. 4. glicose a partir de ácido graxo d.3. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose. ácido graxo a partir de glicose b. Desidrogenases: Catalisam reações de óxido-redução. proteína a partir de glicose c. na mesma molécula.O SENTIDO DAS REAÇÕES 2 – ALGUNS TIPOS DE ENZIMAS: Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em geral ATP) para um aceptor. geralmente NAD+ ou FAD. na maior parte dos casos. Estas reações. Estes três tipos de compostos são essenciais para a sobrevivência. dando origem a diidroxiacetona fosfato e a outro açúcar. ou lipídios ou proteínas. Aldolases: Cindem açúcares fosforilados. proteína a partir de ácido graxo e. Isomerases: Catalisam reações de isomerização. são reversíveis. Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos. ácido graxo a partir de proteína Indicar no mapa a via utilizada para cada conversão. por transferência de hidrogênio do substrato para uma coenzima. Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma posição para outra. com três átomos de carbono a menos que o substrato original. 7 . Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato. prever que grupo de animais sobreviveria. Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se insuficientes para manter a glicemia? M P II AA P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G IC S L OE A sp F sfo o iru ato (3 o en lp v ) A IN Á ID S M OC O G ly A la S er Cs y L eu Ile Ls y Pe h G lu Á ID S G A O C O R X S L actato P v (3 iru ato ) C 2 O A cetil-C A(2 o ) C 2 O O alo x acetato (4 ) C 2 O M alato (4 ) Iso citrato (6) C 2 O Fm u arato (4 ) S ccin (4 u ato ) eto lu ) α C g tarato (5 C 2 O C itrato (6 ) 1 – Ler CAPÍTULO 4.

P C=O H2C-OH HC=O HC-OH H2C-O P Pi NAD + N ADH O= C-O. Os parâmetros medidos estão apresentados nas figuras 1 e 2.P Frutose 6-fosfato ATP ADP HO OH HO Frutose 1.P HC-OH H2C-O P ADP ATP O =C-O HC-O H H2C-O.6 bisfosfato H2C-O.P OCH 2 A DP A TP C OO HCOH CH 3 NAD + NADH CO O C= O CH 3 2-Fosfoglicerato Fosfoenolpiruvato AD P ATP Lactato NAD + NADH Piruvato Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas.3 Bisfosfoglicerato 3-Fosfoglicerato COO HC.AULA 3: GLICÓLISE H OCH 2 OH O OH OH ATP ADP H O GLICÓLISE Glicose ATP ADP P -OCH 2 O HO OH OH OH Glicose 6-fosfato PO-CH 2 O CH 2OH HO OH HO AT P A DP P -OCH 2 O CH 2O. 8 .P OH2COH H2O COO C.P ADP AT P Diidroxiacetona fosfato Gliceraldeído 3-fosfato Pi NAD + NADH 1. a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos alunos.

Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M.124).170 Freqüência Cardíaca (bat/min) 160 150 140 130 120 110 100 90 80 0 0 2 4 B B (tiro de 30s) A (caminhada) Figura 1: freqüência cardíaca durante caminhada de 15 min (A) e tiro de 30 s (B) A 30s 6 8 10 14 15 min 16 tempo Figura 2: Níveis de lactato plasmático durante caminhada de 15 min (A) e tiro de 30 s (B) 9 8 7 B B (tiro de 30s) A (caminhada) Lactatemia (mmol/L) 6 5 4 3 2 1 0 0 0 2 4 30s A 6 8 10 14 15min 16 tempo Analisando os dados acima e com auxilio de livros responda as questões: 1. esta adaptação foi suficiente para manter a lactemia basal? 5. do aumento da freqüência cardíaca? Para responder as questões de 6 a 14. 7. para a musculatura em exercício. O esforço físico leva à produção de lactato? 2. Considerando o número de moléculas de ATP consumidas e formadas. Em lugar de excretar lactato. utilizar apenas o mapa da glicólise (p. Quais são os produtos finais da via glicolítica? 8. é possível estimar a quantidade de glicose que pode ser convertida a lactato? 10. Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante? 4. Examinando a via metabólica que converte glicose a lactato (a glicólise). estabelecer o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica. localize as reações que produzem ATP. 6. 9 . Em caso afirmativo. Qual a utilidade. O exercício é o único processo que leva à produção de lactato? 3. Para cada molécula de glicose consumida qual é o número de moléculas de piruvato produzido? 9. a hemácia poderia excretar piruvato? 11.

Os Casos clínicos 2 e 3 (p. 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a conversão de glicose a glicose 6-fosfato. AULA 4: GLICONEOGÊNESE 1. por sua vez. Seria possível excretar piruvato em lugar de etanol? Que semelhança tem este metabolismo com o do tecido muscular em condições de esforço extenuante? 3. 2. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? 4. usando glicose como fonte de carbono e produzindo etanol. No entanto. Saccharomyces cerevisiae (levedo) cresce anaerobiamente. 10) indicavam que o oxigênio é necessário para a produção de energia pelo organismo. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise e da gliconeogênese? e) Explicar como é feito o controle das duas vias. Citar o tecido responsável pela gliconeogênese. pode ser convertido a glicose por um processo chamado gliconeogênese. à p. Levar em consideração o fato de o nível de frutose 2. b) Se a dieta contiver quantidades insuficientes de carboidratos. Explicar este aparente paradoxo. 6. 7] c) Muitos aminoácidos podem ser convertidos a piruvato que. Citar os compostos que devem ser fornecidos à via glicolítica para: a) iniciá-la (haver formação de lactato). É possível converter lactato a glicose por um processo chamado gliconeogênese. 5. a glicólise é anaeróbia e produz ATP.12. a partir de que tipo de macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as células que dependem deste açúcar? [Consulte o MAPA II. Indicar a função da via glicolítica. b) mantê-la em funcionamento 10 . a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via glicolítica. Citar as vitaminas necessárias para as seguintes conversões: a) glicose → lactato b) lactato → glicose 7. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese.6 bisfosfato nos hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições. 13. consultando o Mapa I. f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Explique. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase. usando as informações do quadro apresentado acima.

11 .

12 . casada. 4. Exames Laboratoriais: Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%) Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL) Soro lipêmico Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL) Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias. O ciclo de Lynen pode ser feito em condições anaeróbias? 6. entretanto. Citar a localização celular da beta-oxidação. que casou há cinco anos pesando 60 kg. nicotinamida e/ou ácido lipóico? 8. que compostos deveriam ser adicionados a um tubo de ensaio que contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA? 7. pantotenato. catalisa uma reação da qual os ácidos graxos não participam. Como é possível obter ATP a partir de etanol? Caso clínico Identificação: A. Após dois anos de casamento.AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS 1. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo de Lynen: riboflavina. e após esse segundo parto. a paciente engravidou novamente. Exame Físico: Peso na admissão 105. Explicar este aparente paradoxo. nasceu o primeiro filho. É possível haver oxidação completa de um ácido graxo sem a presença de carnitina? 5. Queixa e Duração: Aumento de peso após as gestações História Pregressa da Moléstia Atual: A paciente relata. quando todos os carbonos do glicerol estiverem marcados ou em ambos os casos? 3.67 m. 35 anos. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior da mitocôndria se processe com eficiência.4 kg. Em aerobiose.. na admissão a um centro de emagrecimento. biotina. Além das enzimas. Por que hemácia e tecido nervoso não oxidam ácidos graxos? 10. 9. Após passar por avaliação médica e de capacidade física. Essa enzima. Altura de 1. C. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos dos radicais acila do triacilglicerol estiverem marcados com C14. O que provoca a degradação dos triacilgliceróis no tecido adiposo? 2. Encontra-se com leve edema dos membros inferiores. Por esse motivo deu entrada em um spa. Quando o primeiro filho completava um ano e meio ano. seu peso chegou a 105 kg. Apresenta boa função cardíaca e pulmonar. distribuída em cinco refeições. Não apresenta problemas de saúde e não se queixa de nenhum mal estar. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito pouco após o parto. o levedo pode oxidar etanol.

feitos de maneira fracionada e diversificada. sensação de enjôo e gosto amargo na boca. Após oito meses de tratamento. como jogos. c. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar: a. Por que a inibição da piruvato translocase provoca o acúmulo de lactato? 2. 6. Por volta do 4o dia de estadia. dando ênfase às caminhadas. De que forma isso contribui para o emagrecimento da paciente? 3. 5. Explicar a razão. a paciente tem um déficit energético. três vezes na semana. com uma dieta de aproximadamente 900 kcalorias. levando a 45 kg de aumento no peso da paciente? Citar o tecido de armazenamento corpóreo do composto. dança (cerca de uma hora por dia) e atividades na piscina. 8. encontra-se com 71.7%). 3. Manutenção: Regime alimentar. as vitaminas envolvidas.8 kg. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas). Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA? 4. A paciente sempre foi orientada a praticar exercícios físicos. com cerca de uma hora de cada vez). b. No 10o dia da estadia a paciente pesava 94. tendo sido orientada quanto ao caráter reversível desses sintomas. portanto com perda de cerca de 10% do peso inicial. Que composto o organismo armazenou.iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de exercícios. Definir vitaminas. hidroginástica e natação (no mínimo uma hora por dia). As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as dos macronutrientes (proteínas. AULA 7: CICLO DE KREBS 13 . as 5 coenzimas necessárias. Após completar 30 dias de estadia a paciente retornou para casa pesando 85. Ingerindo uma dieta de 600 kcalorias. totalizando uma perda total de 19.1 kg e prepara-se para submeter-se a uma cirurgia plástica. 7.7 kg. 2. Definir cofator. Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de piruvato. com caminhadas de uma hora por dia e natação com aulas de 50 minutos. Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação. a paciente sentiu-se com sonolência. verificando a estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina dinucleotídio (FAD) nas suas formas oxidada e reduzida. e manutenção de prática de exercícios físicos. dispensando mais tempo para as caminhadas (duas vezes ao dia. carboidratos e lipídios). Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia. Em que esses exercícios colaboram para a perda de peso? AULA 6: FORMAÇÃO DE ACETIL-COA 1.7 kg (18. 1. a localização celular. relacionando sua função com atividade enzimática.

(c) acetil-CoA + oxaloacetato. A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação estequiométrica com a quantidade de NADH oxidado? 3. 7). há produção de CO2 marcado se for adicionado azul de metileno. a. ocorreu consumo de oxigênio. Em qual (quais) caso(s) aumentou a concentração de oxaloacetato? 5. AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA 1. Em anaerobiose. Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que contém. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve sofrer redução? 3. citrato e ácidos graxos. (b) oxaloacetato. separadamente. Por que? b. Que resultado haveria.NADH 7. 5 ) e II (p. 1. Uma suspensão de mitocôndrias.Para responder às questões de 1 a 4 usar apenas os Mapas I (p. se a rotenona fosse substituída por cianeto ou por antimicina A? LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA ATIVIDADE DA SUCCINATO DESIDROGENASE -Protocolo Experimental 14 . nos dois casos. piruvato. Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de citrato. Explicar este resultado. (d) acetil-CoA + succinato. Explique estes dados. Quando incubação semelhante foi feita substituindo o malato por succinato. com acetil-CoA. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos que fazem parte da cadeia de transporte de elétrons? 2. glutamato. que porcentual do composto adicionado estará presente no final da reação? 6. além das enzimas e coenzimas: (a) acetil-CoA. Uma suspensão de mitocôndrias foi incubada. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a regulação principal do ciclo de Krebs Enzima Isocitrato desidrogenase Efetuadores alostéricos Positivos Negativos ADP – NAD+ ATP . observa-se também a descoloração do corante (azul de metileno reduzido é incolor). 4. Em cada caso. suplementada com acetil-CoA marcada com C14 só produz CO2 marcado em aerobiose. Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo de oxigênio. Que composto é oxidado no ciclo de Krebs? 2. neste caso.

tornar a decantar e descartar o sobrenadante. as frações devem ser incubadas a 37°C. Esta será a fração celular II. por 10 minutos. Seguir o protocolo 2. planejar o controle da experiência. Para verificar a oxidação do succinato. INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO Sabendo em que fração celular se encontra a atividade da succinato desidrogenase. Separar o sobrenadante 1 e centrifugá-lo novamente a 10. 2. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE TRANSPORTE DE ELÉTRONS. azul de metileno e óleo mineral. Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores. Você utilizará a redução do MTT via succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido. discutir as funções do succinato. picando-o bem com a tesoura. aqueça os tubos a 37°C por 5 minutos e os compare novamente.32 . existe o fator cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS INTERVALOS DE TEMPO. Sacrificar um rato em jejum por concussão cerebral.a) Fracionamento celular b) Verificação da atividade de succinato desidrogenase O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). A. homogeneizar o fígado e centrifugar a 4.25M. misturar. Esta será a fração celular I. sacarose. Adicionar novamente 20ml de sacarose 0. Ressuspender o precipitado 2 obtido em 4ml de sacarose 0. um processo historicamente importante na elucidação das etapas de ciclo de Krebs. Remover o fígado. escrever a reação que está sendo analisada. Seguir o protocolo 1. com exceção do reagente pfenilenodiamina.25M (previamente resfriada a 0 graus). PAR REDOX NADH/NAD+ 15 EO’ -0.000 rpm por 10 minutos.000 rpm por 30 minutos. Você obterá o precipitado 1 e um sobrenadante 1 . B. Se a reação estiver lenta (isto dependerá da sua preparação mitocondrial). Novamente você obterá o precipitado2 e o sobrenadante 2. Decantar e descartar o sobrenadante. NÃO ESQUEÇA a inibição é competitiva.25M gelada. Os aceptores e doadores são fornecidos na forma oxidada. Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando as tabelas que se seguem. mergulhá-lo em 20 ml de uma solução de sacarose 0. 3. A redução do azul de metileno pode ser obtida a partir da oxidação do succinato. catalisada pela succinato desidrogenase. Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no gelo. não sendo reoxidado pelo O2 do ar. Adicionar outros 20 ml da solução de sacarose. Antes de iniciar a experiência o grupo deve: 1. observe a inibição competitiva da enzima por malonato.

Succinato/Fumarato FADH2/FAD Azul de metileno red/ox Cit b (Fe 2+)/ Cit b (Fe 3+) Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) Cit c (Fe 2+)/ Cit c (Fe 3+) Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) H2O / ½ O2 -0.diclorofenolindofenol (DCPI) Benzilviológeno Ferricianeto Incolor Incolor Incolor Incolor 16 VOLUME UTILIZADO 0.36 0.00 0.20 -0.3 0.36 0.82 ACEPTORES E DOADORES ARTIFICIAIS Piocianina red/ox 2.3 0.34 0.06 0.6-diclorofenolindofenol (DCPI) red/ox Benzilviológeno red/ox Ferricianeto Fe(CN)64-/Fe(CN)63p-fenilenodiamino (p-FDA) red/ox EO’ -0.22 0.40 0.6.1 0.1 0.3 0.25 0.2 Azul Azul Violeta Amarelo .27 COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E OXIDADA REDUZIDO OXIDADO Piocianina 2.

2 ml 0.0 ml 0.2 ml 0.6 ml 0.5 ml 0.1 ml 1.5 .5 cm PROTOCOLO 2 TUBO Tampão A Malonato Succinato 0.2 ml 0.2 ml 2 0.0 ml 0.1 ml 25µ l 0.2 ml 0. Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas.1 (I) 0.4 ml 0.2 ml 4 0.1 ml 25µ l 0.7M Succinato 0.3 ml 1.3 ml 0.2 ml 25µ l 0.5 cm 3 0.1 ml 0.0 ml 0.1 ml 0.5 ml 0.3 ml 1.1 ml 0. PROTOCOLO 1 TUBO Tampão A Sacarose 0.1 (I) 0.2 ml 25µ l 0.2 ml 25µ l 0.3 ml 1.1 ml 1.5 ml 0.2 ml 6 0.2 ml 5 0.5M Azul de Metileno Água Destilada Fração Celular Nujol 1 0.2 ml 0.4 ml 0.5 cm 5 0.1 ml 1.p-fenilendiamino (p-FDA) Incolor Violeta 0.3 ml 0.4 ml 25µ l 0.5 cm 2 0.1 (II) 0.1 ml 1.2 ml 0.5 ml 0.2 ml 0.5 cm 4 0.1 ml 1.0 ml 0.4 ml 0.3 ml 0.1 (II) 0.2 ml 0.Seguir o protocolo 3. identificando as drogas A e B.0 ml 0.5M MTT Água Destilada Fração Celular 1 0.3 ml 1.1 ml 25µ l 0.2 ml 7 0.2 ml 3 0.2 ml 0.3 ml 1.1 ml 0.2 ml PROTOCOLO 3 17 .

a.2 1.5 0. Correto? 5. d.0 0.4 1.4 1. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum composto? A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto? 2.TUBO Volume (ml) Tampão A Sacarose 0.1 0.2 0.0 0.0 0. c.2 0.4 1.1 0.2 1.2 0.2 0.5 0.3 1. Software Cadeia de Transporte de Elétrons. responder as questões seguintes: Sempre que há consumo de oxigênio há síntese de ATP? Sempre que há síntese de ATP há consumo de oxigênio? Sempre que há aumento do potencial de membrana há consumo de oxigênio? Sempre que há consumo de oxigênio há aumento do potencial de membrana? Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana? Pode haver síntese de ATP sem aumento do potencial de membrana? Pode haver consumo de oxigênio sem aumento do potencial de membrana? A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto? i.5 0.2 0.1 0.5 0. h.0 0.5M Droga A ou B Ferricianeto DCPI p-FDA Água Destilada Fração Celular Nujol (cm) 1 2 3 4 5 6 7 8 9 0.4 1. b. e.9 0.8 0.5 0.0 0.0 0. f. Hemácia e tecido nervoso fazem fosforilação oxidativa? 18 . Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 3.4 1.4 1.2 0.4 1.3 0.7M Succinato 0.0 0.4 1.2 0.2 0.3 0. Com auxílio do software.8 0.9 0.0 0.0 0.2 0.5 0.5 0.2 0.5 0. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele composto.5 0.0 0. g.4 1. j. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de controle fisiológico da velocidade da cadeia de transporte de elétrons? 4.5 AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA 1.5 0.3 0.9 0.5 1.1 0.1 0.0 0.

a) glicogênio fosforilase b) proteína quinase c) glicogênio fosforilase quinase 4. Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de transporte de elétrons em presença de malato e de antimicina A? 7. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a grande utilização no citossol do ATP produzido na mitocôndria? 12. Escrever os substratos e os produtos das reações catalisadas por a) proteína quinase b) glicogênio fosforilase quinase c) fosfoproteína fosfatase 3. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas encontradas no glicogênio são do tipo α -1-4 ou α -1-6. Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e do glicerol-fosfato)? AULA 10: METABOLISMO DE GLICOGÊNIO 1. Hemácia e tecido nervoso fazem fosforilação oxidativa? 13. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 9. 7.6. Qual o efeito da ativação desta enzima sobre a degradação do glicogênio a glicose 1-fosfato? 5. 11. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 19 . A fosfodiesterase catalisa a conversão de cAMP a AMP. A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH oxidado? 8. Explicar estes resultados. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do glicogênio. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. A adição de dinitrofenol restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a inibição da síntese de ATP. Apontar as que utilizam ATP e as que utilizam HPO42--. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina inibe tanto o consumo de oxigênio quanto a síntese de ATP. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 6. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem fornecimento de substrato oxidável? 10. Correto? 2.

2. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação. síntese de glicogênio c. indicando o hormônio que atua em cada caso. Como são desfosforiladas as enzimas. libera glucagon. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no músculo. 6. GLUCAGON) 1. O glucagon estimula a gliconeogênese? Como? 9. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a) permeabilidade da célula à glicose b) síntese de glicogênio c) síntese de glicoquinase (fígado) 9. rim. Descrever as ações de glucagon. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 8. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA. quando cessa o efeito do glucagon? Se a célula contém proteína fosfatase. 3. 4. 11. permeabilidade da célula à glicose. adrenalina e insulina no metabolismo de triacilgliceróis. síntese de glicogênio. como é possível manter proteínas fosforiladas? 10. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 11. permeabilidade da célula à glicose b. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a última refeição. 5. Verificar também se são independentes de insulina para a captação de glicose: cérebro. Verificar os diferentes transportadores de glicose e sua dependência de insulina.8. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. fígado e ilhotas de Langerhans. Como a insulina leva a ativação da proteína quinase B? 12. síntese de glicoquinase (fígado) Transportadores de glicose para o interior das células: 20 . 13. 10. c. síntese de glicoquinase (fígado). ocorre degradação de proteínas de músculo. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. hemácia. Mostrar a relação entre AMP cíclico e a síntese de glicogênio. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. 7. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de jejum noturno e após uma refeição rica em carboidratos. No jejum. b. 12.

placenta. O tecido muscular não sintetiza glicerol 3-fosfato. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos? 8. libera glucagon. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para gerar os equivalentes redutores necessários à síntese de palmitato? 7. 13. Se fosse fornecida a uma célula glicose marcada com H3. rim. AULA 13 SÍNTESE DE TRIACILGLICEROL 1.coração. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6fosfato desidrogenase? 3. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato é elevada? 4. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A. placenta. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. quais carbonos apareceriam marcados? 6. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. testículo Adipócito. Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato? 10.músculo esquelético. outras células Fígado.Transportador GLUT1 GLUT2 GLUT3 GLUT4 Distribuição Hemácias. células β do pâncreas Neurônio. Verificar os diferentes transportadores de glicose e sua dependência de insulina. Propriedades Baixo KM Alto KM Baixo KM Baixo KM Dependente de insulina Transporte ativo Co-transporte com Na+ GLUT5 Intestino. 5. Verificar também se são independentes de insulina para a captação de glicose: cérebro. hemácia. O que impede a síntese e degradação simultânea de ácidos graxos? 11. Analisar a regulação desta via. Há conseqüências derivadas da produção excessiva de corpos cetônicos? 12. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades apreciáveis de acetil-CoA no citossol? 2. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de triacilgliceróis? AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA 21 . seria possível encontrar ácidos graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir de acetil-CoA marcada com C14. fígado e ilhotas de Langerhans. rim. 14. rim 13. Que decorrência isto tem? 9.

GOT) e alanina aminotransferase (glutâmicopirúvico transaminase . 9. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. No ciclo da uréia (da ornitina): a) indicar a procedência dos átomos de nitrogênio da molécula de uréia. 6. 11. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. com uma dieta rica em carboidratos e lipídios. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido? 15. 3. 22 . 5. Um adulto normal. 13 . 2. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina hidroxilase? 8. 4. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos. Exemplos destes compostos e seus precursores: Glicina purina porfirina glutationa Lisina carnitina Aspartato purina pirimidina Histidina histamina Tirosina adrenalina tiroxina melanina Triptofano nicotinamida 7. b) calcular o balanço de ATP c) qual o aminoácido proteico sintetizado? 14. Citar as condições que levam a um balanço positivo ou negativo de nitrogênio. tem necessidade de ingestão proteica. Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase (glutâmico-oxaloacético transaminase . com uma dieta desprovida de proteínas. Por quê? AULAS 16 : FONTE DE NUTRIÇÃO 1. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. elimina uréia. com uma dieta rica em carboidratos e lipídios. elimina uréia. 12. Definir balanço de nitrogênio. Um adulto normal.GTP). 10. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. Por quê? 2. com uma dieta desprovida de proteínas. Um adulto normal. Citar a coenzima que participa das reações e a vitamina presente na sua estrutura. Por que? 3. Esquematizar a reação catalisada pela glutamato desidrogenase. Um adulto normal. Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio? QUESTÕES PARA DISCUSSÃO 1. tem necessidade de ingestão protéica. Por que? 2.1. Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato sintetase.

hidroxiacil-CoA desidrogenase. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de proteínas de origem vegetal. 2. 9. mas contendo proteínas de baixo valor biológico. lipídios e proteínas no fígado. Incapacidade de fazer gliconeogênese a partir de lactato. Planejar a distribuição entre carboidratos. Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em desenvolvimento. d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos poliinsaturados. fosfofrutoquinase 1. e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas.4. os processos que levam ao acúmulo de lipídios a partir de uma dieta rica em carboidratos. 23 . B. verificar se a sentença é falsa ou verdadeira. Incapacidade de fazer a oxidação completa de glicose e lipídios. A concentração citossólica de citrato é maior em B do que em A. Fazer um resumo dos efeitos do glucagon. aquela cuja perda de atividade seria responsável por cada um daqueles defeitos: a.100 kcal por dia. c) o metabolismo basal de um adulto consome cerca de 1. b. Segue-se uma lista de defeitos metabólicos hereditários hipotéticos: A. Descrever. isocitrato desidrogenase d. 6. D. lipídios e proteínas de uma dieta normal e de uma dieta para emagrecimento. Incapacidade de utilizar glicose para obtenção de energia. Caracterizar as síndromes de desnutrição mais comuns. adrenalina. c. De a até j. fosfoglicomutase 3. 7. b. tendo em vista que: a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g. Descrever as conseqüências metabólicas de uma dieta com valor calórico normal. b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2. O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à ingestão de uma refeição (tempo zero). A concentração plasmática de HCO3. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas). Os valores de ordenadas são diferentes para cada curva. glicose 6-fosfatase f. 8. entre as enzimas alistadas a seguir. músculo e adiposo. C.800 kcal por dia. com base em regulações hormonal e alostérica. 9 kcal/g). 5. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de proteínas. e a de lipídios. 5. AULAS 17 : REGULAÇÃO INTEGRADA 1. e insulina no metabolismo de carboidratos. 4. Incapacidade de sintetizar diidroxiacetona a partir de lactato. Escolher. a. f) nove aminoácidos são essenciais para o organismo humano.é maior em B do que em C. fosfoenolpiruvato carboxiquinase e. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos. 6.

A carnitina acil transferase de hepatócitos é mais ativa em A. Em B ocorre oxidação de aminoácidos essenciais no fígado. e. a concentração de frutose 2. Em C. a maior parte da glicose. no fígado deste indivíduo. aminoácidos e corpos cetônicos plasmáticos é originária do fígado. a síntese de glicogênio. Segundo as hipóteses formuladas. a utilização de corpos cetônicos pelo cérebro. d.c. a concentração de acetil-CoA e a síntese de ácidos graxos. b. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais. A curva I pode representar a concentração de glicogênio hepático e a curva III. d. o indivíduo apresentou perda lenta e contínua de peso. Para cada hipótese feita. uma dieta com quantidades de carboidratos. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do que em B. faixa etária e atividade física. Faça duas hipóteses explicativas deste quadro.6-bisfosfato. Escolha uma das hipóteses e descreva como estão. Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase dependente de cAMP. h. o ciclo de Krebs. a gliconeogênese. Em B a lipogênese é mais intensa que a lipólise no tecido adiposo. lipídios e proteínas adequadas para seu peso. A B C II III I 0 5 10 15 20 25 Horas 12. o caso poderia ser normalizado aumentando a ingestão de carboidratos e diminuindo a de lipídios? AULAS 18 : DIABETES DIABETES MELITTUS 24 . c. durante várias semanas. g. sexo. Um indivíduo adulto recebeu. a. A curva II pode representar a atividade da via das pentoses. analise o balanço de nitrogênio e a produção de corpos cetônicos.

O desarranjo de todas essas reações é encontrado no diabético. A DMID é causada pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de hiperglicemia sustentada. 10 a 20% dos casos de diabetes são do tipo I. Ela tem início entre a infância e 35 anos e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de DMID adquirirá a doença). • Aumenta o transporte de aminoácidos para os músculos e outros tecidos.Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e pode comprometer o funcionamento de rins. qualquer incremento é acompanhado por perda de água.Por ação indireta: • Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase dependente de AMPc. bem como da perda de água. Assim. • Diminui a quantidade de glucagon circulante por diminuição da expressão gênica. por ação direta: • Aumenta o transporte de glicose para o fígado. água intracelular é perdida para o interstício resultando em desidratação celular. devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza. Quando os níveis de glicose sobem. também chamada de DM insulina dependente (DMID). ou DM não dependente de insulina (DMNDI). . ele perde peso. dependendo do tecido. o rim não consegue reabsorvê-la e ocorre glicosúria. Há dois tipos mais comuns de diabetes melittus (DM): 1) A tipo I. oxidando-a para gerar energia ou usando-a para síntese de outros compostos. inibindo a mobilização de ácidos graxos. nervos e vasos sanguíneos. • Diminui a atividade da triacilglicerol lipase no tecido adiposo. pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular. Antes de verificar as diferenças e semelhanças nas manifestações dessas duas diabetes. Diabetis melittus insulino dependente (DMID) ou Tipo I. A falta de insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do músculo e adipócito. com conseqüente aumento da pressão osmótica. diluição dos eletrólitos extracelulares e maior concentração dos intracelulares. olhos. vamos lembrar os efeitos da insulina: . A perda de peso é decorrente de perda de tecido muscular e adiposo. usualmente devido à deficiência ou resistência à insulina. pela perda de eletrólitos. • Aumenta a síntese de proteína. 25 . ele desperdiça glicose eliminando-a na urina.Esse hormônio. cujos aminoácidos são usados na gliconeogênese. Como tudo que tem que ser excretado na urina deve estar solubilizado. músculo e tecido adiposo e outras células. caso não seja tratado. Devido a isso. • Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase. 2) A tipo II. Ocorre cetoacidose. Um indivíduo normal mantém os níveis plasmáticos normais de glicose convertendo-a em glicogênio. Evidências implicam a infecção viral e resposta auto-imune como maiores fatores contribuintes. embora não só a genética possa explicá-la. principalmente potássio. lipídeo e glicogênio em proporções variadas. É uma doença que pode ser definida como um estado de tolerância diminuída à glicose. Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II.

Assim. Não há relação necessária entre diabetes tipo I e obesidade. Diabetes tipo II é mais certamente diagnosticada por uma demonstração da tolerância diminuída à glicose. silencioso Em geral obesidade 80 a 90% dos casos . Tratamento Depende do tipo de diabetes. sugerindo que não há a utilização correta do hormônio pelo organismo. O indivíduo ingere uma solução contendo 75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal.DMNDI Em geral após 35 anos Lento. ocorrendo.Presente em 80 a 90 % dos diabéticos. Os pacientes apresentam normalmente níveis normais ou elevados de insulina. com alto fator genético (100% dos irmãos gêmeos idênticos de um diabético tipo II desenvolverão a doença). na verdade. Nos diabéticos tipo II. como sepsis. considera-se que não existem apenas duas situações extremas: cetoacidose diabética ou hiperglicemia não cetônica. poliúria (aumento na quantidade de urina) e polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia. dependente de insulina por toda a vida. Agentes hipoglicemiantes orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou não. DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com obesidade e que tenham parentes diabéticos. Nesses pacientes dieta e exercícios físicos são um bom meio de alcançar o controle da glicemia. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de cetose. Deve haver reposição adequada de Na+ e água. provavelmente por defeito nos receptores de insulina nas células. Tipo I –DMID Idade de início Início Estado nutricional no início Prevalência Em geral infância ou puberdade Em geral repentino Em geral desnutrido 10 a 20% dos casos 26 Tipo II . cetoacidose e glicosúria.Tipo I é. Na tipo II. pacientes com DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de cetose. perda de peso já pode influenciar na capacidade do corpo de controlar o nível de glicose. Atualmente. Alguns pacientes podem necessitar de injeções de insulina. a cetose pode aparecer em certas condições de estresse metabólico. Diagnóstico Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as observações clínicas como perda de peso. ou tornar-se-á. toda uma gama de variação das intensidades dos dois sintomas. A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de diabetes. atingindo 200mg/dL após 2h de ingestão da solução de glicose. baseado numa relativa mas não absoluta deficiência de glicose. No período inicial da doença observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL.

A dosagem de Hb glicosilada plasmática é um teste mais sensível que a medida de glicemia. 27 . que causa a perda de sensibilidade nas extremidades inferiores. neuropatia e doenças cardiovasculares. Quando a osmolaridade alcança 340 a 350 mosmol/kg. Quando essa doença se desenvolve o paciente necessita de hemodiálise e transplante renal. a água move-se para fora das células cerebrais. mais tardias Cetoacidose Coma hiperosmolar Responde Em geral não necessário Resposta a hipoglicemiantes Não responde orais Administrar insulina Sempre necessário Coma diabético A glicose sanguínea em concentrações maiores que o limite de reabsorção renal provoca uma rápida diurese osmótica.e neuropatia. Vírus e toxinas Baixa a ausente Obesidade Normal a elevada Poliúria. Essas proteínas ficam com conformação alterada e são mais resistentes ao ataque proteolítico. perda de Nenhum ou os mesmos do peso. que ocorre principalmente no ε amino da Lys. A neuropatia de nervos periféricos é comum em diabéticos. a conseqüência mais provável é o coma. cetoacidose comum tipo I mais suaves Comum Rara Retino-. A glicosilação de lipoproteínas plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença periférica vascular. que leva a perda de água e eletrólitos. nefropatia. nefro. principalmente a neuropatia simétrica. A retinopatia é quase universal entre os diabéticos. Tanto a hiperglicemia como a hipernatremia afetam muito o cérebro. fome. Complicações similares a surgimento após 5 anos tipo I. causando desidratação celular. polidipsia. Faça hipóteses para explicar esse fato. tornando os pacientes propensos a lesões nas pernas e pés. com alta incidência de gangrena e amputação. β destruídas. Uma explicação para isso é haver glicosilação de proteínas.Predisposição genética Defeito ou deficiência Outros fatores Insulina plasmática Sintomas iniciais Cetose Efeitos a longo prazo Complicações agudas Moderada Muito forte Cel. Diabéticos podem desenvolver retinopatia (principal causa de cegueira). Há tendência a hipovolemia e deslocamentos de água intracelular para o espaço extracelular. sem produção Cel. Complicações decorrentes do diabetes A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. β produzem menos de insulina ou igual insulina. Aumentando a osmolaridade plasmática. enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 % dos portadores de DMID e em menos de 20% daqueles com DMNDI.

Dor de cabeça intermitente.B. de descompensação diabética. a boca seca e. Respiração tendendo a ofegante. para resolver seus sintomas. Hálito amargo há um dia. Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina. Hoje. pressão arterial = 100 x 60 torr. bastaria uma refeição calórica que. Queixa e Duração: Sensação de fraqueza há doze horas. porém. Qual o sinal clínico comum aos dois casos relatados? 28 . por via muscular. Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL) Cetonúria = +++/++++ (O normal é negativo). feminina. há uma hora. Como já passou por situações semelhantes. porém. procurou o serviço médico.P. duas vezes ao dia. ritmo cardíaco regular. bancário. Na seqüência sentiu um hálito amargo. Procurou o ambulatório médico para esclarecimentos. administrada por via subcutânea. branco. CASO 2 Identificação: J. Após três horas de cuidados a glicemia já havia baixado para 185 mg/dL.L.M. não é lhe indicada já que está sob regime de emagrecimento. mas a cetonúria ainda se mantinha em + / +++. a paciente passou a sentir também fortes dores de cabeça. hálito cetônico bastante evidente. notou gosto ruim na boca e o apetite diminuiu. masculino. começou a urinar intensamente. principalmente nos acontecimentos sociais. História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de idade. ritmos cardíaco e respiratório normal. o gosto ruim na boca é muito intenso e acompanhado de um hálito próximo ao cheiro de acetona. Gosto amargo na boca e sensação de fraqueza. palidez cutâneo-mucosa. 25 anos. hálito cetônico. a partir do segundo dia. de hora em hora. levemente taquicárdico. Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL) Cetonúria = +++ / ++++ Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. executiva do ramo de cosméticos. branca. a fim de ser medicado antes do agravamento do quadro. Foi-lhe dito que. onde ingeriu quatro ou cinco chopes. Relata que no entardecer do dia esteve em uma lanchonete com amigos. Faz uso de insulina. Indicou-se que aguardasse por mais alguns dias até que os sintomas regredissem. Queixa e Duração:Aumento do volume urinário há 4 horas. 35 anos. no terceiro dia de estadia. há oito horas.CASO 1 Identificação: J. pulsos finos. segundo seus familiares. Dados de gasometria revelam acidose. Refere que procura seguir as recomendações dietéticas.. 1. Relata que no primeiro dia nada sentiu. Está submetida a uma dieta de 300 kcalorias/dia. Tudo seguido de uma intensa fraqueza e leve falta de ar. mas que não é incomum a transgressão da dieta. precisando levantar várias vezes da cama. Exame Fïsico: Bom estado geral. comeu pizza e tomou sorvete. aliadas à fraqueza. História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de emagrecimento em um spa há três dias. Passadas quatro horas. quando falava as pessoas sentiam cheiro de acetona. Exame Físico: Regular estado geral. Sinais clínicos de desidratação.

nesse caso? 5. Qual a principal fonte de ATP para a contração muscular. Tabela de códons 29 . indicando o hormônio que atua em cada caso. Por que o valor da glicemia difere tanto entre os casos 1 e 2? 3. o paciente do Caso 1 fica impossibilitado de usar a glicose sangüínea em células como as do músculo. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos casos 1 e 2? 9. adrenalina e insulina no metabolismo de triacilgliceróis AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO 1. Citar a fonte de energia utilizada pelo cérebro. músculo e fígado neste jejum extremo. a tendência dos pacientes é de perda.6 bisfosfato. Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a quatro semanas. 16. Qual é a relação entre a glicemia e a presença plasmática de acetona? 4. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1 e 2? 7.2. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de frutose 2. Descrever as alterações do metabolismo de carboidratos. 14. Indicar as condições metabólicas que levam a uma aumento na produção de corpos cetônicos 18. Após alguns dias no spa. Descrever as ações de glucagon. Nos dois casos apresentados. pois a entrada de glicose nessas células é estimulada pela insulina. desde que hidratado) como nos casos de greve de fome. lipídios e proteínas provocadas por jejum prolongado e por diabetes. 15. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65 mg/dL? Que via metabólica é utilizada para a síntese de glicose? 8. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de um mRNA específico sem mudar o gene codificante da proteína os elementos controladores do gene. Pela deficiência de insulina. 17. que tipo de reserva a paciente do caso 2 deve estar utilizando para a obtenção de ATP? 6. hemácias. manutenção ou ganho de peso? 10.

porém a enzima triptofano sintase é estável. Em t=0. corta-a com tripsina e isola os cinco peptídeos. qual será a ordem de marcação dos peptídeos do mais para o menos marcado? (C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas? 6. Aponte três mutações que não modificam a sequência da proteína. Qual peptídeo é mais intensamente marcado? (B) Em t=3 minutos. Quais são as funções do mRNA. você adiciona todos os 20 amino-ácidos. porém não glicose. Quais mecanismos são usados para garantir a fidelidade de cada um destes processos. As células continuam a crescer e dividem a cada 30 minutos. é o amino.2. O peptídeo A1. A3. 7. 4. Células de E. Indique em cada uma das situações abaixo se a expressão do operon lac aumenta. coli são crescidas no meio contendo lactose. você sabe que a proteína A tem quatro pontos sensíveis à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1. 2. Finalmente. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de proteínas. c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente que o normal. Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes condições: a) O trp mRNA é estável (degrada lentamente após algumas horas) b) O trp mRNA é degradado rapidamente.terminal e A5 é o carbpxi-terminal. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações em: a) o gene lacI que inativa o repressor b) o promotor é eliminado na região próxima a posição -10 3. você isola a proteína A intacta do sistema. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que decodificam o código genético. coli são crescidas no meio com glicose como única fonte de carbono. Além disso. Células de E. reduz ou não é 30 . (A) Em t=1 minuto. Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma proteína chamada A. Tryptofano é adicionado. você sabe que seu sistema precisa de 4 minutos para produzir uma molécula de proteína A completa. cada um levando uma marcação com 14C . Um transcrito para um gene contem a seqüência de bases abaixo: 5´ AACUGCACGAGGUAACACAAGAUGGCU 3´ Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes fases. A2. tRNA e rRNA? Aula 20: Regulação da Expressão Gênica 1. 5. A4 e A5. Explique. 3.

Façam uma lista contendo. A atividade desta RNA polimerase é reduzida quando a enzima é purificada. acesse os sites recomendados ao final dos textos. 5. Aula 22: Técnicas de Biologia Molecular. a) Adição de alta concentração de glicose b) Uma mutação que impede a dissociação do repressor lac na região reguladora. a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a seqüência 2. Como a transcrição do gene operon trp da E. Desenhe um modelo descrevendo o que acontece em cada uma destas situações. d) Uma mutação que inativa completamente a permease galactosidase e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região do promotor lac. Esses termos deverão ser esclarecidos com o auxílio dos professores. destacando os termos que você não compreenda ou de que nunca tenha ouvido falar. monitores e colegas de grupo. c) Removendo a seqüência 4 d) Trocando os dois códons trp no peptídeo iniciador para códons de His. Para complementar seus estudos.alterada. coli pode ser afetada pelas seguintes manipulações da região promotora do mRNA trp. b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3. Esta RNA polimerase inicia somente a transcrição a partir de uma única região promotora altamente especializada. os pontos favoráveis e desfavoráveis ao emprego da tecnologia para produção de alimentos transgênicos. 4. Sugira uma explicação para esta observação. c) Uma mutação que inativa completamente a β -galactosidase. e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador. Transgênicos – 7° Teste Questões para Estudo Leia os textos que se seguem a respeito de alimentos transgênicos. 31 . Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um fungo exótico. na sua opinião.

uma técnica para transformar células vegetais através da introdução do gene de interesse. 32 . ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou Tecnologia do DNA Recombinante). clonagem de mamíferos. mapeamento do genoma humano. técnicas de detecções e diagnósticos por PCR e Terapia Gênica. a partir de 1900 as Leis de Mendel foram redescobertas e começaram a ser aplicadas. produção de proteínas humanas em microorganismos. O crescimento acelerado do campo da biotecnologia. Ao invés de promover o cruzamento entre organismos relacionados para obter uma característica desejada. O gene artificial ou intencionalmente inserido no genoma de um organismo é denominado transgene. Procedimentos para a obtenção de vegetais transgênicos: Para obter plantas transgênicas são necessários: . . aceleraram as descobertas científicas e suas aplicações biotecnológicas. Histórico: A Genética é uma ciência característica do século XX. cuja característica adquirida passa a ser transmitida para as futuras gerações. misturando todo o conjunto de genes dos dois organismos em combinações aleatórias. resultando em um organismo geneticamente modificado (OGM). A técnica exigia uma enorme demanda de tempo e não era precisa. plantas e animais. amplificação do número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. entretanto.uma técnica para gerar uma planta inteira a partir de uma só célula transformada. Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a transferência do material genético de um organismo para outro.o gene de interesse. Para a introdução do gene em outro organismo são utilizados vetores de clonagem (plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida. O termo geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia do DNA recombinante para a alteração genética de animais. sanidade animal e produção de alimentos. produzindo maiores safras de alimentos de origem vegetal. A clonagem molecular consiste no isolamento do gene de interesse. pelo uso de técnicas modernas de Engenharia Genética.Definição de transgênicos: Os Transgênicos são organismos que adquiriram características de outro organismo. pois. O sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil cultivo e permitir a purificação e recuperação do produto do gene. a genética mendeliana contribuiu significativamente para a sustentação do crescimento populacional de nosso planeta. Antes do desenvolvimento desta técnica. . plantas e microorganismos. cientistas podem identificar e inserir no genoma de um determinado organismo um único gene responsável pela característica em particular. a mais utilizada era a do Melhoramento Clássico. aumentando a produtividade de animais e contribuindo para uma maior longevidade humana. A decifração do código genético e a manipulação do DNA neste último quarto de século. Surgiram técnicas biotecnológicas como a produção e pesquisa de plantas e animais transgênicos. abrindo novas perspectivas econômicas nos campos da saúde humana. Nos primeiros ¾ deste século. na qual a transferência de genes se dava por meio de cruzamentos (reprodução sexuada).

Deste modo. que pode ser uma planta.000. Depois. presente na castanha-do-pará. Uma das possibilidades para isolamento de um gene é a construção de uma “biblioteca genômica” e. levando ao seu controle na cultura.000 genes.000 genes. enquanto o genoma humano consiste de aproximadamente 30.  Genes bacterianos que codificam proteínas com propriedades tóxicas para insetos. Os insetos que se alimentassem de plantas expressando este gene morreriam ou se desenvolveriam com menor eficiência. inativando-os. facilitando assim o controle das ervas. para isso. Estes fragmentos são. ligados a outros fragmentos de DNA. Diversos genes de interesse agronômico já foram isolados. culturas contendo este gene poderiam tornar-se resistentes ao herbicida. tem-se uma planta transgênica. onde este material é inserido e replicado por várias vezes. entre eles temos:  Gene que codifica proteína capaz de modificar herbicidas. 33 . porque ela contém. Em seguida o DNA é cortado em fragmentos menores utilizando as enzimas de restrição. seleciona-se a colônia de bactérias que contém o fragmento de DNA correspondente ao gene de interesse.000 e 60. Os herbicidas são muito usados no controle de ervas daninhas. uma bactéria ou até um animal. entretanto. algumas culturas não sobrevivem à aplicação deste produto. então. mas que podem se replicar em bactérias. um gene adicional proveniente de outro organismo. Genes de Interesse: O genoma de uma bactéria contém em média 5. o de plantas.Após esta última etapa. além dos genes naturais. Este gene poderia ser usado para aumentar o valor nutricional de culturas importantes como feijão e soja. Os genes são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta característica que permite que genes de um organismo sejam potencialmente funcionais em outro. entre 40. o DNA do organismo contendo o gene de interesse é extraído.  Gene que codifica uma proteína de alto valor nutricional.

estabelecido pela primeira vez em 1973. Ou seja. Em seguida. as mudanças obtidas no nível celular não são significativas. nutricionais e ambientais para a regeneração. quando Stanley e Cohen.Transferência dos genes de interesse em plantas: A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado . introduziram o gene proveniente de uma rã em uma bactéria. o que permite a penetração e eventual integração dos genes no genoma. Papel dos transgênicos na economia mundial: O século passado teve um grande desenvolvimento na biotecnologia microbiana. esta célula ou grupos delas são estimuladas a gerar uma planta transformada. No entanto. B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio cobertos com os genes de interesse. Os transposons são assim denominados (ou também chamados elementos de transposição) justamente porque são elementos genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se. há diferenças conceituais entre a situação com microrganismos e com plantas: nos primeiros. A transferência é alcançada por um dos métodos seguintes: A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais. em São Francisco. a não ser que possam ser transferidas para todas as células do organismo. A transformação de uma célula vegetal é um tipo de manipulação genética que atende ao mesmo princípio da transformação de microrganismos. Parte do plasmídeo é um transposon (T DNA) que produz cópias de si mesmo nos cromossomos da planta infectada. esta etapa ainda representa o maior gargalo na criação de plantas transgênicas. inserindo-se aleatoriamente nas organelas celulares. são incubados em soluções que contêm os genes a serem transferidos e. O choque causa uma alteração da membrana celular. como cada espécie de planta tem diferentes exigências hormonais. E. Os genes entram nas células junto com o projétil de maneira não-letal. o DNA é dissociado das micropartículas pela ação do líquido celular. o domínio das técnicas de regeneração de plantas inteiras a partir de uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. é esperado um rápido desenvolvimento na biotecnologia animal e vegetal. embora esta técnica já esteja estabelecida para inúmeras plantas de interesse econômico. Para a transformação. 34 . O plasmídeo encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a transformação de plantas. Regeneração das plantas a partir das células transformadas: Uma vez inserido o gene na célula vegetal. como plantas e animais. A produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá resultar em um produto mais economicamente viável que o enriquecimento do trigo com a lisina obtida de microorganismos. desprovidas de parede celular. Neste século. Os microprojéteis são acelerados com pólvora ou gás em direção aos alvos (as células vegetais). enquanto que em eucariotos superiores. ocorrendo o processo de integração do gene exógeno no genoma do organismo a ser modificado. um choque elétrico de alta voltagem é aplicado por curtíssimo tempo. os objetivos finais são mudanças operadas no nível celular. C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA extracromossomal que pode se replicar independentemente do cromossomo. em seguida.especialmente para o caso de monocotiledôneas) ou através de agrobactérias.

Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30 milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões.A aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade apareceu no mercado europeu. é necessário utilizar de forma adequada e responsável as novas tecnologias e descobertas científicas. Para isso. em casos limitados. bioprocessamento. onde as lavouras transgênicas são permitidas oficialmente. resistência a insetos e vírus. Vegetais geneticamente modificados: A maioria dos produtos já liberados para a comercialização contém transgenes que codificam características que visam minimizar estresses ambientais.A modificação genética de microrganismos continua sendo uma importante complementação para as modificações genéticas de plantas e animais.U. Benefícios promovidos pelos transgênicos na agricultura: A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de plantas para alimentação. em princípio. devem ser feitos para investigar os efeitos potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas. Os desenvolvimentos resultantes em variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado no aumento de vida em prateleiras de frutas e vegetais. No entanto. organizados. incluindo tolerância a herbicidas.U. os consumidores dificilmente notaram qualquer benefício além de. estáveis quando armazenados e. que estejam atualmente em uso. podem promover saúde trazendo benefícios para consumidores.. as características que visam aumentar a qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e deverão prevalecer nas próximas gerações de produtos transgênicos. seja em nações industrializadas ou em desenvolvimento. podendo-se chegar na casa dos milhares em algumas décadas. enquanto reduzimos os impactos ambientais. um decréscimo no preço devido a custos reduzidos e aumento da facilidade de produção (University of Illinois. algumas tendo se tornado sucessos comerciais. Enquanto essas características têm trazido benefícios aos agricultores. biorremediação e tratamento de águas. Falck-Zepeda et al 1999). Alimentos produzidos através de tecnologias de modificação genética podem ser mais nutritivos. principalmente com características preferidas pelo mercado. biofertilizantes e biopesticidas. Esses esforços devem ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da agricultura. A seguir são apresentados alguns exemplos do uso da tecnologia da modificação genética de vegetais aplicada a alguns problemas específicos da agricultura: 35 . O ritmo atual de liberação de OGMs indica que na primeira década deste século já teremos uma centena de produtos geneticamente modificados nas prateleiras dos supermercados. É essencial melhorar a produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial crescente.1999. os E. muitos alimentos transgênicos importados já são comercializados e estima-se a importação de 3 milhões de toneladas de milho da Argentina e dos E.A. No Brasil. a agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em volume. Esforços em conjunto.A. Na década de 90.U. De acordo com uma pesquisa sobre a expectativa de comercialização de produtos obtidos de organismos geneticamente modificados nos E. e produzindo tolerância a determinados herbicidas. dando resistência contra pragas de insetos ou viroses. especialmente para a produção de metabólitos secundários.

É resultado do uso de modificação genética em vegetais visando obter maior resistência a uma praga específica. Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e cultivado. Como exemplo.Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada no Hawai desde 1996 (Gonsalves. que devasta os arrozais africanos. temos um gene de tolerância em manguezais (Avicennia marina) que foi clonado e transferido para outras plantas que se mostraram mais tolerantes a altas concentrações de sal. Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições. e o desenvolvimento da sua parte reprodutiva (comestível) é aumentado. As plantas transgênicas contêm entre 2 e 4 vezes mais ferro do que normalmente encontrado no arroz convencional. uma vez que o alongamento das células na parte vegetativa é reduzido. Estes genes (NORIN 10) agem da mesma forma quando utilizados para transformar outras espécies de plantas importantes como alimento. o trigo semi-anão que possui genes insensíveis à giberelina. cientistas conseguiram fazer crescer e desenvolver em água contendo forte teor de sódio. Porém. temos o vírus Mottle Amarelo do arroz (RYMV). 36 . deve-se considerar o fato de que populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta transgênica. os pesquisadores utilizaram uma técnica de imunização genética. Um exemplo de combate ao stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em solos ácidos (de La Fuente et al 1997). A introdução desses genes faz com que se obtenha uma planta mais baixa. graças à injeção de um único gene capaz de absorver um excedente de sal em plantações de tomate. Ele foi produzido usando-se genes envolvidos na produção de proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na dieta humana (Goto et al. por exemplo. Como exemplo. com conseqüente diminuição ou eliminação da necessidade do uso de pesticidas. 1999). Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual. de forma a combater a anemia. como acontece com o uso de inseticidas. Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto rendimento como. 1998). através da criação de plantas de arroz transgênico resistentes ao RYMV. Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro. Segundo a revista Nature Biotechnology. mais forte e que aumenta o rendimento da safra diretamente. O gene introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio excedente. tomates perfeitamente comestíveis.

benefício para a saúde etc. aumento da produtividade. (Coord. O debate não deve.Posicionamento da SBBq: http://www.gov. Será iniciado um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o consumo de alimentos transgênicos. & Heller. Inc & W. 1ed. • Zaha. Em cada sala haverá um professor para mediar o debate e esclarecer as regras da atividade.G.org.C. & Goldberg.Artigo da revista Ciência Hoje com link para arquivo pdf. • Okamuro.br/start. R.htm . Utilize sua lista.uol. Cerca de 300 g desse arroz cozido por dia suprem as necessidades de betacaroteno de um indivíduo. (1994) Genes. Referências • Lewin. Foram inseridos genes de bactérias que fazem a conversão do precursor presente no arroz em beta-caroteno. • Purves.H.br/cienciahoje/ch/ch146. Sadava. que ajuda a combater diversas doenças. redução do custo ou aumento do preço dos alimentos.ctnbio. ressecamento da córnea. J. (2001) Life – the science of Biology. Mercado Aberto.br/ctnbio/bio/artigos/004. Em ambos os casos os argumentos devem ser os mais variados possíveis. O resultado desse experimento foi a produção de grãos amarelados de arroz.: www. envolvendo tópicos como impacto ambiental. portanto.Conselho Nacional de Biossegurança: www. B. (1989) The Biology of Plants.. Orians. agroeconomia. Academic Press Inc. Sinauer AssociaTES. o grupo contra deverá utilizar argumentos que condenem os transgênicos. Oxford University Press.cfn.) (1996) Biologia Molecular Básica.htm ..com.br/variavel/destaque/pgdestaque2. New Yourk. H. W. diarréias e sarampo. 6th.B.Freeman and Company. Ed. Porto Alegre. como a cegueira noturna.sbbq. precursor da vitamina A.arroz normal arroz transgênico Pesquisadores desenvolveram arroz com alto teor de beta-caroteno.K. A.K. redigida nas “questões para estudo” para auxiliar o debate.htm .org.Posicionamento do Conselho Nacional de Nutricionistas: www. 37 .php?id=port Questões para Discussão Cada sala deve ser organizada em dois grandes grupos – pró e contra. ser limitado a aspectos nutricionais. Polêmica sobre os Alimentos Transgênicos .D. devido à presença de beta-caroteno.H.

E . Incubar a mistura por 5 min á temperatura ambiente. Ribonuclease A 150µ g/ml em TrisHCl 25mM pH 8. 17.Preparação do DNA plasmidialFundamento: Existem vários procedimentos para purificação em pequena escala de DNA plasmidial de células bacterianas. Incubar o tubo em gelo por 20 min. Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T. 16. EDTA 10mM. 8. Centrifugar a 12000xg por 15 min á temperatura ambiente. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e delicadamente. Incubar por 5 min à 65 °C. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro eppendorf contendo 300µ l de Isopropanol. 9. Soluções utilizadas: .Solução Neutralizadora – Acetato de potássio 3M pH 4.Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose . 13. 4. Centrifugar a 12000xg por 5 min á temperatura ambiente. 1. Neste procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo removidos por centrifugação. Tomar 1 ml da cultura e colocar em um tubo de eppendorf. O DNA plasmidial purificado é em seguida concentrado por precipitação com etanol. 7.2 N . Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min. separando-o do DNA cromossomal bacteriano. Centrifugar a 12000xg por 10 min á temperatura ambiente . 12.Solução de lise – SDS 1% em NaOH 0. 18. 5.coli em meio LB-A (50µ g/ml ampicilina). Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%.0. 2. 38 . Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência anterior.5 µ l/ml de Brometo de etídio e submeter a eletroforese a 100V em Tampão TBE. 6. 15. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no Vórtex. Utilizaremos cultura de E. 14. extrair e purificar o DNA plasmidial. 3.GET / Rnase – dextrose 50mM. 10. Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente. . Um dos métodos mais utilizados consiste na lise das bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio). 11. contendo 0. Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta. Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra na proporção 1:10.7% de Agarose em TBE. Aplicar a amostra em gel 0.8. Centrifugar a 12000xg por 5 min á temperatura ambiente.

onde espera encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de DNA plasmidial? 5. 39 . Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da resistência à ampicilina. O que é lisozima e para que é usada na preparação de plasmídeos ? 3. Da mesma forma.coli) o pBR322 apresenta duas marcas genéticas. leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido) contento estes antibióticos. em resistentes. clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina.coli que normalmente é sensível tanto à ampicilina como à tetraciclina..Transformação de bactéria com plasmídeo contendo genes de resistência a antibióticos Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua manutenção como um elemento autônomo auto-replicativo. Contendo 50 mg/ml ampicilina ou 12. ou seja. Por que se dissolve a preparação de DNA em tampão Tris-EDTA ? 7. Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ? . O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de genes. EDTA e Tris) ? 2. Várias técnicas são disponíveis para transformar uma bactéria. Este plasmídeo pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas) que podem ter valor seletivo no meio. Transformação de bactérias que são sensíveis a um antibiótico. será revelada através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LBtet. Como age o isopropanol ? Este álcool poderia ser substituído por etanol. Que papel desempenha cada componente do tampão GET (glicose. Neste método as bactérias são submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes para a transformação pelo DNA do plasmídeo. Na aula prática usaremos o método do CaCl2. Além da origem de replicação que permite sua propagação em bactérias (E. uma vez que este sítio está localizado na região amp r.Questões 1. Qual a função do NaOH e do SDS presentes na solução de lise ? 4.5 mg/ml tetraciclina. genes que codificam para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). por exemplo ? 6. Portanto a introdução de pBR322 em E. Usaremos o plasmídeo pBR322 (ver mapa). Se o DNA cromosomal tiver sido muito quebrado durante as manipulações.

Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. As bactérias competentes assim preparadas podem ser armazenadas a –80°C.3 (fase logarítmica de crescimento). Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E. As bactérias competentes para transformação são preparadas a partir de uma cultura em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma solução de CaCl2. Antes de dar o choque térmico (42°C por exatamente 90 segundos) . Incubar no gelo por 20 minutos. NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO. Incubar em gelo por 15 min. Diluir a pré-cultura 1/10 em 10 ml de meio LB. Manipule convenientemente o material estéril fornecido. Após pelo menos 30 min.1 ml/tubo da suspensão de bactérias competentes para cada um de 2 tubos. Coletar as bactérias (4000 rpm. previamente flambada e em seguida resfriada na própria tampa da placa de Petri.5 contendo 1 mM EDTA) a um dos tubos. 4.Procedimento experimental: O ideal é que a experiência seja realizada em ambiente asséptico (fluxo laminar).1 M. No gelo estas BACTÉRIAS COMPETENTES podem ser transformadas. para evitar contaminação. para uso posterior. por uma hora. Adicionar 0. Adicionar o DNA transformante (0. O outro tubo será usado como controle (bactéria apenas). distribuir 0. coletar as bactérias por centrifugação (4000 rpm.coli) e incubar 2.5 µ g DNA de pBR322 em 10µ l de tampão 10mM Tris pH7. 5. 8. Transferir os tubos para o gelo por 2 min.9 ml/tubo de meio LB e incubar a 37°C sem agitação. 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão (frio). 6. à 37°C até o dia seguinte sob agitação forte (200-250 rpm). em banho-maria. Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM pH6. 5 min). incubar à 37°C sob agitação até OD600nm=0. Espalhar as bactérias com o auxílio de uma alça de vidro. 3. 40 . Para transformar. 7. 1. Transferir a cultura para o gelo. 9.5 contendo CaCl2 0.

Por que as bactérias devem ser incubadas por 60 min. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo. Preencher a tabela com o número de colônias obtido em cada caso: Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| 2. Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes? 2. a 37°C antes de espalhá-las em placas de ágar? 4.Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| ANÁLISE DOS RESULTADOS 1. 41 . Qual o papel do choque térmico? 3. Qual a eficiência de transformação obtida. em termos de n° de colônias / µ g de DNA? Questões 1.

Sign up to vote on this title
UsefulNot useful