Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno) Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214 Departamento de Bioquímica Instituto de Química 2009 Docentes: Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup. Sala 854 Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala 1013/1018

Monitores: Cecília Midori Ikegami (cikegami@usp.br) Mariana Lemos Duarte (mlduarte@gmail.com)

Programa Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise; gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons; fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos transgênicos. Bibliografia - Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999. - Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002. - Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996. - Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000. - Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004. - Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002. - Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc., 5th ed New York; 2001. - Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing Company; 1996. - Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G. Scrimgeour Prentice Hall; 1993. - Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995. - Nutritional Biochemistry: T. Brody – Academic Press; 1994. - Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996. Critério de Avaliação O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará 1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final deverá ser feito através da seguinte equação: NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5 10

2

Cronograma de Aulas 17/08 19/08 24/08 26/08 31/08 02/09 07/09 09/09 14/09 16/09 21/09 23/09 28/09 30/09 05/10 07/10 12/10 14/10 19/10 19/10 21/10 26/10 28/10 02/11 04/11 09/11 11/11 16/11 18/11 23/11 25/11 30/11 02/12 Aula 9 Aula 10 Aula 11 Aula 12 Aula 13 Aula 14 Aula 15 Aula 16 Aula 17 Aula 17 Aula 18 Aula 19 Aula 20 Aula 21 Aula 22 Aula 1 Aula 2 Aula 3 Aula 4 Aula 5 Aula 6 Aula 7 Aula 8 Enzima (funções e propriedades) Catabolismo/ Anabolismo (introdução) Glicolise (via das pentoses) Gliconeogênese – 1° Teste Oxidação de Triacilgliceróis Formação AcetilCoA (vitaminas e cofatores) – 2° Teste Feriado Ciclo de Krebs 1° Prova Fosforilação Oxidativa Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia de transporte de elétrons. Sala multimídia - Cadeia de transporte de elétrons e fosforilação oxidativa Metabolismo de Glicogênio – 3° Teste Controle Hormonal (insulina, glucagon e vitaminas) Controle Hormonal (insulina, glucagon e vitaminas) Síntese de Triacilglicerol – 4° Teste Feriado 2° Prova Metabolismo de aminoácidos Ciclo da uréia Fonte de Nutrição – 5° Teste Feriado Regulação Integrada Feriado Regulação Integrada Diabetes – 6° Teste Tradução e Código Genético Regulação da Expressão Gênica Biologia Molecular (testes diagnósticos) Técnicas de Biologia Molecular; Transgênicos – 7° Teste Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose Apresentação de Seminários (Alimentação e BioMol) 3° Prova

3

AULA 1: ENZIMAS I. Classifique as afirmações abaixo como verdadeiras ou falsas: 1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( ) 1.2. A velocidade da reação é proporcional ao tempo da reação. ( ) 1.3. A velocidade da reação é proporcional à concentração de substrato.( ) 1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração de substrato não seja limitante. ( ) 1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( ) 1.6. A quantidade de produto formado depende do tempo da reação. ( ) 1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( ) 2. Definir enzima, substrato e sítio ativo 3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da concentração de S. 4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade da enzima pelo seu substrato 5. Fazer o gráfico da velocidade de uma reação enzimática em função de: a. Concentração de enzima; b. Temperatura; c. pH. Justificar a forma dos gráficos 6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse procedimento. 7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de inibidor escolhido, competitivo ou não competitivo?

4

Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas. Com o passar dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e sudorese fria.. foi posto sob respiração em balão de oxigênio e rapidamente sentiu-se melhor. 27 anos. O paciente chegou no dia anterior a La Paz.Aula 2: Introdução ao Catabolismo e Anabolismo Obtenção de energia pelo Metabolismo MP I AA E q e ag ra d d g a a ã d n tr n s s u m e l a e r d ç o e u ie te A IM N O L ET S P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G oe lic s A in á id s m oc o Á id G x c o ra o C O ND A FD A + 2 ND AH FD AH 2 A P+P D O2 H2O i AP T A . No momento do exame. após ter desmaiado no trabalho. Conta que nos últimos dias alimentou-se mal e. sendo conduzido ao Pronto Atendimento.T.P.B. CASO 3 5 . Embora tenha feito refeições corretas. trabalhador da construção civil. trazido por colegas. o cansado persistiu e agravava-se com atividades físicas que até a véspera fazia sem problemas. 32 anos. por volta das 10:00 horas da manhã. tendo tido necessidade de um esforço intenso.Ler o relato dos três casos apresentados a seguir. sudoreico. com a recomendação de que ingerisse chá ou outra bebida estimulante. Foi dispensado do hospital. No final do terceiro dia.. analisador de sistemas. Relata que logo ao sair do aeroporto. a tontura tornou-se muito forte e escureceu– lhe a vista. CASO 1 P. vindo de Salvador. Insistindo com a atividade que fazia. encontra-se pálido. nesta manhã. CASO 2 R. vindo a cair da própria altura. saiu de casa sem comer nada e iniciou o trabalho. desmaiou. extremidades frias e referindo forte dor de cabeça. fumante. Deu entrada no serviço de emergência. precisou subir um lance de escada e sentiu-se muito cansado. Depois dos exames preliminares. masculino.

Os compostos característicos de um dado organismo devem ser supridos pela dieta. d.J. Que compostos são produzidos como conseqüência desta reação? Entre os compostos produzidos. 1. A manutenção destas concentrações é espontânea? Como o organismo consegue mantê-las? 8. fumante. O paciente iniciou há seis meses um quadro de dor no peito. Desde então vinha fazendo uso de remédios que promovem dilatação das coronárias. de inicio abrupto. quer ocorra in vivo. Resuma: por que é necessário comer e por que é necessário respirar? 7. 4. o número de átomos de carbono de alguns compostos. com duração de cinco a dez minutos. A oxidação biológica consiste na retirada de hidrogênio do substrato. foi constatada obstrução parcial de uma das artérias coronárias. respectivamente 25 mmols/L e 150 mmols/L e as concentrações plasmáticas são 140 mmols/L e 5 mmols/L. Logo ao sair para o trabalho. Que partes do Mapa I devem ser suprimidas quando referente exclusivamente ao cérebro? A síntese de ATP é obtida por oxidação ou redução dos alimentos? Discutir as seguintes afirmações: a. começou a suar frio e dentro de poucos minutos perdeu a consciência e caiu. Alimentos + Processos que requerem energia VIAS METABÓLICAS DEGRADATIVAS No Mapa II (página seguinte) encontra-se. B – Com base no Mapa I. A única função dos alimentos é fornecer energia. A dor melhorava com o repouso. entre parênteses. relata o filho que o estava acompanhando. Quais são os passos irreversíveis que aparecem no mapa? 2. no máximo. responder as questões seguintes. e. 1. Acrescentar O2. sempre que fazia algum esforço físico. HPO42-. c. f. Qual o primeiro composto comum à degradação de carboidratos. masculino. em aperto. A quantidade de energia derivada da oxidação de nutrientes é a mesma. executivo. o paciente sentiu forte dor no peito. 5.F. Com esse quadro foi trazido ao pronto socorro e embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca. 2. b. ADP e ATP nos espaços do esquema abaixo. Fazendo exames de avaliação cardíaca. Os processos celulares que requerem energia utilizam a energia térmica proveniente da oxidação dos alimentos. 42 anos. quais são excretados e qual é aproveitado pelas células? 6.. proteínas e lipídios? 6 . Conta que o seu pai ficou pálido. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um composto rico em energia (ATP). A falta de que composto provocou os sintomas relatados nos três casos descritos? O que restringiu a síntese deste composto em cada um dos casos? Os sintomas dos casos 1 e 2 são claramente neurológicos. como subir uma ladeira caminhando. ou ao sentir emoções. o paciente foi a óbito. As concentrações celulares de Na+ e K+ são. 3. quer se processe in vitro.P.

Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos. com três átomos de carbono a menos que o substrato original. são reversíveis. Estes três tipos de compostos são essenciais para a sobrevivência. proteína a partir de ácido graxo e. 4. 7 . Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma posição para outra. ou lipídios ou proteínas. ácido graxo a partir de proteína Indicar no mapa a via utilizada para cada conversão.3. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose. ácido graxo a partir de glicose b. na mesma molécula. glicose a partir de ácido graxo d. geralmente NAD+ ou FAD. Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se insuficientes para manter a glicemia? M P II AA P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G IC S L OE A sp F sfo o iru ato (3 o en lp v ) A IN Á ID S M OC O G ly A la S er Cs y L eu Ile Ls y Pe h G lu Á ID S G A O C O R X S L actato P v (3 iru ato ) C 2 O A cetil-C A(2 o ) C 2 O O alo x acetato (4 ) C 2 O M alato (4 ) Iso citrato (6) C 2 O Fm u arato (4 ) S ccin (4 u ato ) eto lu ) α C g tarato (5 C 2 O C itrato (6 ) 1 – Ler CAPÍTULO 4. na maior parte dos casos. dando origem a diidroxiacetona fosfato e a outro açúcar. Aldolases: Cindem açúcares fosforilados. proteína a partir de glicose c. glicose a partir de proteína f. verificando se é possível sintetizar: a.O SENTIDO DAS REAÇÕES 2 – ALGUNS TIPOS DE ENZIMAS: Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em geral ATP) para um aceptor. Estas reações. Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato. Desidrogenases: Catalisam reações de óxido-redução. Isomerases: Catalisam reações de isomerização. página 45 . por transferência de hidrogênio do substrato para uma coenzima. Não havendo outras restrições na dieta. prever que grupo de animais sobreviveria.

P HC-OH H2C-O P ADP ATP O =C-O HC-O H H2C-O.P C=O H2C-OH HC=O HC-OH H2C-O P Pi NAD + N ADH O= C-O.P ADP AT P Diidroxiacetona fosfato Gliceraldeído 3-fosfato Pi NAD + NADH 1. Os parâmetros medidos estão apresentados nas figuras 1 e 2. a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos alunos. 8 .P OCH 2 A DP A TP C OO HCOH CH 3 NAD + NADH CO O C= O CH 3 2-Fosfoglicerato Fosfoenolpiruvato AD P ATP Lactato NAD + NADH Piruvato Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas.P Frutose 6-fosfato ATP ADP HO OH HO Frutose 1.3 Bisfosfoglicerato 3-Fosfoglicerato COO HC.AULA 3: GLICÓLISE H OCH 2 OH O OH OH ATP ADP H O GLICÓLISE Glicose ATP ADP P -OCH 2 O HO OH OH OH Glicose 6-fosfato PO-CH 2 O CH 2OH HO OH HO AT P A DP P -OCH 2 O CH 2O.P OH2COH H2O COO C.6 bisfosfato H2C-O.

O exercício é o único processo que leva à produção de lactato? 3. Em lugar de excretar lactato. 7. Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M. 9 . Para cada molécula de glicose consumida qual é o número de moléculas de piruvato produzido? 9. Quais são os produtos finais da via glicolítica? 8. utilizar apenas o mapa da glicólise (p.124). a hemácia poderia excretar piruvato? 11. Qual a utilidade. Em caso afirmativo. Considerando o número de moléculas de ATP consumidas e formadas. estabelecer o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica. esta adaptação foi suficiente para manter a lactemia basal? 5.170 Freqüência Cardíaca (bat/min) 160 150 140 130 120 110 100 90 80 0 0 2 4 B B (tiro de 30s) A (caminhada) Figura 1: freqüência cardíaca durante caminhada de 15 min (A) e tiro de 30 s (B) A 30s 6 8 10 14 15 min 16 tempo Figura 2: Níveis de lactato plasmático durante caminhada de 15 min (A) e tiro de 30 s (B) 9 8 7 B B (tiro de 30s) A (caminhada) Lactatemia (mmol/L) 6 5 4 3 2 1 0 0 0 2 4 30s A 6 8 10 14 15min 16 tempo Analisando os dados acima e com auxilio de livros responda as questões: 1. é possível estimar a quantidade de glicose que pode ser convertida a lactato? 10. 6. do aumento da freqüência cardíaca? Para responder as questões de 6 a 14. Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante? 4. O esforço físico leva à produção de lactato? 2. para a musculatura em exercício. Examinando a via metabólica que converte glicose a lactato (a glicólise). localize as reações que produzem ATP.

Citar os compostos que devem ser fornecidos à via glicolítica para: a) iniciá-la (haver formação de lactato). 5. Levar em consideração o fato de o nível de frutose 2. Saccharomyces cerevisiae (levedo) cresce anaerobiamente. a glicólise é anaeróbia e produz ATP. usando as informações do quadro apresentado acima. a partir de que tipo de macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as células que dependem deste açúcar? [Consulte o MAPA II. É possível converter lactato a glicose por um processo chamado gliconeogênese. 10) indicavam que o oxigênio é necessário para a produção de energia pelo organismo. consultando o Mapa I. Citar o tecido responsável pela gliconeogênese. 6. Seria possível excretar piruvato em lugar de etanol? Que semelhança tem este metabolismo com o do tecido muscular em condições de esforço extenuante? 3. a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via glicolítica.12. 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a conversão de glicose a glicose 6-fosfato. b) Se a dieta contiver quantidades insuficientes de carboidratos. pode ser convertido a glicose por um processo chamado gliconeogênese. AULA 4: GLICONEOGÊNESE 1. Explicar este aparente paradoxo. Indicar a função da via glicolítica. Citar as vitaminas necessárias para as seguintes conversões: a) glicose → lactato b) lactato → glicose 7. f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase. à p. 7] c) Muitos aminoácidos podem ser convertidos a piruvato que. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise e da gliconeogênese? e) Explicar como é feito o controle das duas vias. 13. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? 4. b) mantê-la em funcionamento 10 . 2. Explique. por sua vez.6 bisfosfato nos hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições. usando glicose como fonte de carbono e produzindo etanol. No entanto. Os Casos clínicos 2 e 3 (p.

11 .

a paciente engravidou novamente. seu peso chegou a 105 kg. nasceu o primeiro filho. pantotenato. Altura de 1. O que provoca a degradação dos triacilgliceróis no tecido adiposo? 2. 4. Citar a localização celular da beta-oxidação. 9. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito pouco após o parto. entretanto. É possível haver oxidação completa de um ácido graxo sem a presença de carnitina? 5. 35 anos. Explicar este aparente paradoxo. distribuída em cinco refeições. Exames Laboratoriais: Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%) Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL) Soro lipêmico Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL) Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias. biotina. Em aerobiose. e após esse segundo parto. casada.67 m. Exame Físico: Peso na admissão 105..AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS 1. que casou há cinco anos pesando 60 kg. Apresenta boa função cardíaca e pulmonar. Como é possível obter ATP a partir de etanol? Caso clínico Identificação: A. Queixa e Duração: Aumento de peso após as gestações História Pregressa da Moléstia Atual: A paciente relata. 12 . Além das enzimas. nicotinamida e/ou ácido lipóico? 8. Após passar por avaliação médica e de capacidade física.4 kg. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior da mitocôndria se processe com eficiência. O ciclo de Lynen pode ser feito em condições anaeróbias? 6. na admissão a um centro de emagrecimento. que compostos deveriam ser adicionados a um tubo de ensaio que contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA? 7. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos dos radicais acila do triacilglicerol estiverem marcados com C14. C. Quando o primeiro filho completava um ano e meio ano. Encontra-se com leve edema dos membros inferiores. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo de Lynen: riboflavina. Após dois anos de casamento. Por que hemácia e tecido nervoso não oxidam ácidos graxos? 10. Essa enzima. o levedo pode oxidar etanol. quando todos os carbonos do glicerol estiverem marcados ou em ambos os casos? 3. Não apresenta problemas de saúde e não se queixa de nenhum mal estar. Por esse motivo deu entrada em um spa. catalisa uma reação da qual os ácidos graxos não participam.

7.1 kg e prepara-se para submeter-se a uma cirurgia plástica. Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA? 4. AULA 7: CICLO DE KREBS 13 . De que forma isso contribui para o emagrecimento da paciente? 3. dando ênfase às caminhadas.iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de exercícios. carboidratos e lipídios). Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de piruvato. relacionando sua função com atividade enzimática. as 5 coenzimas necessárias. Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação. e manutenção de prática de exercícios físicos. portanto com perda de cerca de 10% do peso inicial. Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia. b. como jogos. 2.7%). as vitaminas envolvidas. verificando a estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina dinucleotídio (FAD) nas suas formas oxidada e reduzida. dispensando mais tempo para as caminhadas (duas vezes ao dia. Ingerindo uma dieta de 600 kcalorias. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar: a. a localização celular. Após completar 30 dias de estadia a paciente retornou para casa pesando 85. No 10o dia da estadia a paciente pesava 94. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas). com caminhadas de uma hora por dia e natação com aulas de 50 minutos. levando a 45 kg de aumento no peso da paciente? Citar o tecido de armazenamento corpóreo do composto. Que composto o organismo armazenou. As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as dos macronutrientes (proteínas. encontra-se com 71.7 kg. tendo sido orientada quanto ao caráter reversível desses sintomas. A paciente sempre foi orientada a praticar exercícios físicos. totalizando uma perda total de 19. três vezes na semana.8 kg.7 kg (18. c. 3. a paciente tem um déficit energético. Por volta do 4o dia de estadia. 5. Definir cofator. Explicar a razão. dança (cerca de uma hora por dia) e atividades na piscina. com cerca de uma hora de cada vez). 8. Por que a inibição da piruvato translocase provoca o acúmulo de lactato? 2. feitos de maneira fracionada e diversificada. sensação de enjôo e gosto amargo na boca. Após oito meses de tratamento. 1. hidroginástica e natação (no mínimo uma hora por dia). 6. a paciente sentiu-se com sonolência. Em que esses exercícios colaboram para a perda de peso? AULA 6: FORMAÇÃO DE ACETIL-COA 1. Manutenção: Regime alimentar. com uma dieta de aproximadamente 900 kcalorias. Definir vitaminas.

Em cada caso. AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA 1. ocorreu consumo de oxigênio. (c) acetil-CoA + oxaloacetato. (d) acetil-CoA + succinato. que porcentual do composto adicionado estará presente no final da reação? 6. além das enzimas e coenzimas: (a) acetil-CoA. Uma suspensão de mitocôndrias. Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo de oxigênio. a. Explicar este resultado. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a regulação principal do ciclo de Krebs Enzima Isocitrato desidrogenase Efetuadores alostéricos Positivos Negativos ADP – NAD+ ATP . com acetil-CoA.Para responder às questões de 1 a 4 usar apenas os Mapas I (p. Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que contém. há produção de CO2 marcado se for adicionado azul de metileno. Uma suspensão de mitocôndrias foi incubada. Quando incubação semelhante foi feita substituindo o malato por succinato. 7). piruvato. citrato e ácidos graxos. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve sofrer redução? 3. nos dois casos. Que composto é oxidado no ciclo de Krebs? 2.NADH 7. suplementada com acetil-CoA marcada com C14 só produz CO2 marcado em aerobiose. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos que fazem parte da cadeia de transporte de elétrons? 2. A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação estequiométrica com a quantidade de NADH oxidado? 3. Em qual (quais) caso(s) aumentou a concentração de oxaloacetato? 5. Por que? b. neste caso. Que resultado haveria. Em anaerobiose. se a rotenona fosse substituída por cianeto ou por antimicina A? LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA ATIVIDADE DA SUCCINATO DESIDROGENASE -Protocolo Experimental 14 . 5 ) e II (p. 4. Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de citrato. observa-se também a descoloração do corante (azul de metileno reduzido é incolor). separadamente. (b) oxaloacetato. glutamato. 1. Explique estes dados.

discutir as funções do succinato.32 . Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no gelo. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE TRANSPORTE DE ELÉTRONS.a) Fracionamento celular b) Verificação da atividade de succinato desidrogenase O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). azul de metileno e óleo mineral. A. Antes de iniciar a experiência o grupo deve: 1.25M gelada. sacarose. com exceção do reagente pfenilenodiamina. um processo historicamente importante na elucidação das etapas de ciclo de Krebs. aqueça os tubos a 37°C por 5 minutos e os compare novamente. escrever a reação que está sendo analisada. NÃO ESQUEÇA a inibição é competitiva. Os aceptores e doadores são fornecidos na forma oxidada. catalisada pela succinato desidrogenase. 2. homogeneizar o fígado e centrifugar a 4.000 rpm por 10 minutos. A redução do azul de metileno pode ser obtida a partir da oxidação do succinato. INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO Sabendo em que fração celular se encontra a atividade da succinato desidrogenase. Você obterá o precipitado 1 e um sobrenadante 1 .000 rpm por 30 minutos. as frações devem ser incubadas a 37°C. Novamente você obterá o precipitado2 e o sobrenadante 2. planejar o controle da experiência. Esta será a fração celular I. existe o fator cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS INTERVALOS DE TEMPO. observe a inibição competitiva da enzima por malonato.25M. Seguir o protocolo 2. misturar. Sacrificar um rato em jejum por concussão cerebral. Para verificar a oxidação do succinato.25M (previamente resfriada a 0 graus). Remover o fígado. Ressuspender o precipitado 2 obtido em 4ml de sacarose 0. Adicionar novamente 20ml de sacarose 0. Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores. Decantar e descartar o sobrenadante. mergulhá-lo em 20 ml de uma solução de sacarose 0. picando-o bem com a tesoura. Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando as tabelas que se seguem. Se a reação estiver lenta (isto dependerá da sua preparação mitocondrial). 3. Separar o sobrenadante 1 e centrifugá-lo novamente a 10. Você utilizará a redução do MTT via succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido. Seguir o protocolo 1. por 10 minutos. B. PAR REDOX NADH/NAD+ 15 EO’ -0. não sendo reoxidado pelo O2 do ar. Adicionar outros 20 ml da solução de sacarose. Esta será a fração celular II. tornar a decantar e descartar o sobrenadante.

1 0.3 0.82 ACEPTORES E DOADORES ARTIFICIAIS Piocianina red/ox 2.25 0.20 -0.diclorofenolindofenol (DCPI) Benzilviológeno Ferricianeto Incolor Incolor Incolor Incolor 16 VOLUME UTILIZADO 0.00 0.27 COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E OXIDADA REDUZIDO OXIDADO Piocianina 2.Succinato/Fumarato FADH2/FAD Azul de metileno red/ox Cit b (Fe 2+)/ Cit b (Fe 3+) Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) Cit c (Fe 2+)/ Cit c (Fe 3+) Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) H2O / ½ O2 -0.6.2 Azul Azul Violeta Amarelo .36 0.22 0.1 0.40 0.36 0.34 0.3 0.6-diclorofenolindofenol (DCPI) red/ox Benzilviológeno red/ox Ferricianeto Fe(CN)64-/Fe(CN)63p-fenilenodiamino (p-FDA) red/ox EO’ -0.06 0.3 0.

1 ml 1.1 (I) 0.5 cm 3 0.1 ml 25µ l 0.2 ml 0.5 cm 4 0.2 ml PROTOCOLO 3 17 .2 ml 5 0.p-fenilendiamino (p-FDA) Incolor Violeta 0.2 ml 0.5M Azul de Metileno Água Destilada Fração Celular Nujol 1 0.5 ml 0.3 ml 1. identificando as drogas A e B.2 ml 25µ l 0.2 ml 0.5 ml 0.1 ml 1.0 ml 0.0 ml 0.1 ml 0. PROTOCOLO 1 TUBO Tampão A Sacarose 0.2 ml 0.3 ml 0.5 .5 ml 0.2 ml 25µ l 0.2 ml 0.1 (II) 0.3 ml 0.2 ml 7 0.3 ml 1.5 cm PROTOCOLO 2 TUBO Tampão A Malonato Succinato 0.4 ml 0.1 ml 0.Seguir o protocolo 3.4 ml 0.1 ml 1.0 ml 0.2 ml 0.2 ml 25µ l 0.0 ml 0.1 ml 25µ l 0.1 ml 0.2 ml 0.2 ml 4 0.3 ml 1.2 ml 6 0.1 (I) 0.5 ml 0.1 ml 25µ l 0.1 (II) 0.3 ml 0.0 ml 0. Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas.2 ml 0.2 ml 2 0.7M Succinato 0.3 ml 1.4 ml 25µ l 0.1 ml 0.6 ml 0.1 ml 1.2 ml 3 0.5 cm 2 0.2 ml 0.3 ml 1.5M MTT Água Destilada Fração Celular 1 0.4 ml 0.5 cm 5 0.1 ml 1.

5 AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA 1.5 0.5 0. responder as questões seguintes: Sempre que há consumo de oxigênio há síntese de ATP? Sempre que há síntese de ATP há consumo de oxigênio? Sempre que há aumento do potencial de membrana há consumo de oxigênio? Sempre que há consumo de oxigênio há aumento do potencial de membrana? Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana? Pode haver síntese de ATP sem aumento do potencial de membrana? Pode haver consumo de oxigênio sem aumento do potencial de membrana? A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto? i.5 0. h.1 0.5 0. j.3 0.4 1.2 0. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum composto? A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto? 2.5M Droga A ou B Ferricianeto DCPI p-FDA Água Destilada Fração Celular Nujol (cm) 1 2 3 4 5 6 7 8 9 0.5 0.2 0.0 0.0 0.3 1.4 1.0 0.5 0.2 0. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele composto.4 1. f.1 0. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de controle fisiológico da velocidade da cadeia de transporte de elétrons? 4. Hemácia e tecido nervoso fazem fosforilação oxidativa? 18 .9 0. c.2 0. g.9 0.0 0.0 0.1 0.4 1.4 1. a. Correto? 5.2 0.2 0.5 0. Com auxílio do software.2 0.0 0.8 0.8 0.TUBO Volume (ml) Tampão A Sacarose 0.0 0. e. Software Cadeia de Transporte de Elétrons.3 0.0 0. d.5 0.5 0.4 1.2 1.3 0.7M Succinato 0.9 0.2 0.1 0.4 1. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 3.0 0.2 0.1 0.5 1.0 0.4 1.5 0.0 0.2 1.2 0.4 1. b.

A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH oxidado? 8. Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e do glicerol-fosfato)? AULA 10: METABOLISMO DE GLICOGÊNIO 1. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 19 . Escrever os substratos e os produtos das reações catalisadas por a) proteína quinase b) glicogênio fosforilase quinase c) fosfoproteína fosfatase 3. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 9. 7. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem fornecimento de substrato oxidável? 10. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas encontradas no glicogênio são do tipo α -1-4 ou α -1-6. a) glicogênio fosforilase b) proteína quinase c) glicogênio fosforilase quinase 4. Correto? 2. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina inibe tanto o consumo de oxigênio quanto a síntese de ATP. A fosfodiesterase catalisa a conversão de cAMP a AMP. A adição de dinitrofenol restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a inibição da síntese de ATP. 11. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a grande utilização no citossol do ATP produzido na mitocôndria? 12. Qual o efeito da ativação desta enzima sobre a degradação do glicogênio a glicose 1-fosfato? 5. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 6. Apontar as que utilizam ATP e as que utilizam HPO42--. Hemácia e tecido nervoso fazem fosforilação oxidativa? 13.6. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do glicogênio. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. Explicar estes resultados. Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de transporte de elétrons em presença de malato e de antimicina A? 7.

GLUCAGON) 1. quando cessa o efeito do glucagon? Se a célula contém proteína fosfatase. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 8. permeabilidade da célula à glicose b. c. ocorre degradação de proteínas de músculo. 3. 2. No jejum. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação. hemácia. 12. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no músculo. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia.8. como é possível manter proteínas fosforiladas? 10. 7. libera glucagon. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de jejum noturno e após uma refeição rica em carboidratos. fígado e ilhotas de Langerhans. síntese de glicoquinase (fígado). 10. 13. AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA. 5. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a) permeabilidade da célula à glicose b) síntese de glicogênio c) síntese de glicoquinase (fígado) 9. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a última refeição. síntese de glicogênio c. 11. Descrever as ações de glucagon. Verificar também se são independentes de insulina para a captação de glicose: cérebro. 4. Mostrar a relação entre AMP cíclico e a síntese de glicogênio. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. síntese de glicoquinase (fígado) Transportadores de glicose para o interior das células: 20 . Há gasto de ATP para a síntese de glicogênio a partir de glicose? 11. rim. b. O glucagon estimula a gliconeogênese? Como? 9. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Como são desfosforiladas as enzimas. síntese de glicogênio. indicando o hormônio que atua em cada caso. adrenalina e insulina no metabolismo de triacilgliceróis. Verificar os diferentes transportadores de glicose e sua dependência de insulina. permeabilidade da célula à glicose. Como a insulina leva a ativação da proteína quinase B? 12. 6.

O tecido muscular não sintetiza glicerol 3-fosfato. O que impede a síntese e degradação simultânea de ácidos graxos? 11. testículo Adipócito. Verificar os diferentes transportadores de glicose e sua dependência de insulina. Se fosse fornecida a uma célula glicose marcada com H3. outras células Fígado. fígado e ilhotas de Langerhans. Analisar a regulação desta via. quais carbonos apareceriam marcados? 6. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato é elevada? 4. 5. hemácia. rim 13. Propriedades Baixo KM Alto KM Baixo KM Baixo KM Dependente de insulina Transporte ativo Co-transporte com Na+ GLUT5 Intestino. rim. placenta. 13. Há conseqüências derivadas da produção excessiva de corpos cetônicos? 12. rim. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia.coração. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6fosfato desidrogenase? 3. células β do pâncreas Neurônio. 14. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para gerar os equivalentes redutores necessários à síntese de palmitato? 7.músculo esquelético.Transportador GLUT1 GLUT2 GLUT3 GLUT4 Distribuição Hemácias. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de triacilgliceróis? AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA 21 . seria possível encontrar ácidos graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir de acetil-CoA marcada com C14. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades apreciáveis de acetil-CoA no citossol? 2. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos? 8. Que decorrência isto tem? 9. placenta. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. libera glucagon. Verificar também se são independentes de insulina para a captação de glicose: cérebro. AULA 13 SÍNTESE DE TRIACILGLICEROL 1. Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato? 10.

22 . Citar as condições que levam a um balanço positivo ou negativo de nitrogênio. Um adulto normal. Exemplos destes compostos e seus precursores: Glicina purina porfirina glutationa Lisina carnitina Aspartato purina pirimidina Histidina histamina Tirosina adrenalina tiroxina melanina Triptofano nicotinamida 7. com uma dieta desprovida de proteínas. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina hidroxilase? 8. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido? 15.1. Um adulto normal. Por que? 2. Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio? QUESTÕES PARA DISCUSSÃO 1. Por quê? 2. Por que? 3. 4. tem necessidade de ingestão proteica. Um adulto normal.GTP). com uma dieta rica em carboidratos e lipídios. b) calcular o balanço de ATP c) qual o aminoácido proteico sintetizado? 14. elimina uréia. 3. 13 . Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. com uma dieta desprovida de proteínas. 12. Esquematizar a reação catalisada pela glutamato desidrogenase. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Um adulto normal. 6. Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato sintetase. elimina uréia. Definir balanço de nitrogênio. No ciclo da uréia (da ornitina): a) indicar a procedência dos átomos de nitrogênio da molécula de uréia. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 2. Citar a coenzima que participa das reações e a vitamina presente na sua estrutura. 11. Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase (glutâmico-oxaloacético transaminase . com uma dieta rica em carboidratos e lipídios. 10. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos.GOT) e alanina aminotransferase (glutâmicopirúvico transaminase . Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 9. Por quê? AULAS 16 : FONTE DE NUTRIÇÃO 1. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. 5. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. tem necessidade de ingestão protéica.

9. Planejar a distribuição entre carboidratos. f) nove aminoácidos são essenciais para o organismo humano. 23 . O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à ingestão de uma refeição (tempo zero). entre as enzimas alistadas a seguir. De a até j. fosfofrutoquinase 1. B. c. Descrever. isocitrato desidrogenase d. adrenalina. tendo em vista que: a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g. D. fosfoenolpiruvato carboxiquinase e. músculo e adiposo. Descrever as conseqüências metabólicas de uma dieta com valor calórico normal.4. mas contendo proteínas de baixo valor biológico. 8. Os valores de ordenadas são diferentes para cada curva. fosfoglicomutase 3. e a de lipídios. 4. Fazer um resumo dos efeitos do glucagon. 5. C. b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2. AULAS 17 : REGULAÇÃO INTEGRADA 1. Segue-se uma lista de defeitos metabólicos hereditários hipotéticos: A. Incapacidade de fazer gliconeogênese a partir de lactato. b. A concentração citossólica de citrato é maior em B do que em A. glicose 6-fosfatase f. 5. hidroxiacil-CoA desidrogenase.100 kcal por dia. A concentração plasmática de HCO3. os processos que levam ao acúmulo de lipídios a partir de uma dieta rica em carboidratos. 6. aquela cuja perda de atividade seria responsável por cada um daqueles defeitos: a.800 kcal por dia. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos. lipídios e proteínas de uma dieta normal e de uma dieta para emagrecimento. Incapacidade de sintetizar diidroxiacetona a partir de lactato.é maior em B do que em C. com base em regulações hormonal e alostérica. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de proteínas. e insulina no metabolismo de carboidratos. Incapacidade de utilizar glicose para obtenção de energia. 7. Escolher. 6. e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas. Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em desenvolvimento. 2. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de proteínas de origem vegetal. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas). a. c) o metabolismo basal de um adulto consome cerca de 1. verificar se a sentença é falsa ou verdadeira. 9 kcal/g). lipídios e proteínas no fígado. Incapacidade de fazer a oxidação completa de glicose e lipídios. Caracterizar as síndromes de desnutrição mais comuns. d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos poliinsaturados. b.

Em C. a concentração de frutose 2. d. Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase dependente de cAMP. a síntese de glicogênio. h. o ciclo de Krebs. Em B a lipogênese é mais intensa que a lipólise no tecido adiposo.6-bisfosfato. aminoácidos e corpos cetônicos plasmáticos é originária do fígado. Segundo as hipóteses formuladas. a. Escolha uma das hipóteses e descreva como estão. d. o indivíduo apresentou perda lenta e contínua de peso. analise o balanço de nitrogênio e a produção de corpos cetônicos. Faça duas hipóteses explicativas deste quadro. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do que em B. a gliconeogênese. no fígado deste indivíduo. c. Para cada hipótese feita. A carnitina acil transferase de hepatócitos é mais ativa em A. uma dieta com quantidades de carboidratos. A B C II III I 0 5 10 15 20 25 Horas 12. durante várias semanas. sexo. a utilização de corpos cetônicos pelo cérebro.c. Um indivíduo adulto recebeu. A curva II pode representar a atividade da via das pentoses. g. Em B ocorre oxidação de aminoácidos essenciais no fígado. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais. lipídios e proteínas adequadas para seu peso. o caso poderia ser normalizado aumentando a ingestão de carboidratos e diminuindo a de lipídios? AULAS 18 : DIABETES DIABETES MELITTUS 24 . faixa etária e atividade física. A curva I pode representar a concentração de glicogênio hepático e a curva III. a concentração de acetil-CoA e a síntese de ácidos graxos. e. a maior parte da glicose. b.

Há dois tipos mais comuns de diabetes melittus (DM): 1) A tipo I. músculo e tecido adiposo e outras células. por ação direta: • Aumenta o transporte de glicose para o fígado. nervos e vasos sanguíneos. Ocorre cetoacidose. 2) A tipo II. diluição dos eletrólitos extracelulares e maior concentração dos intracelulares. . A DMID é causada pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de hiperglicemia sustentada. Como tudo que tem que ser excretado na urina deve estar solubilizado. qualquer incremento é acompanhado por perda de água. A falta de insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do músculo e adipócito. Evidências implicam a infecção viral e resposta auto-imune como maiores fatores contribuintes. Um indivíduo normal mantém os níveis plasmáticos normais de glicose convertendo-a em glicogênio. vamos lembrar os efeitos da insulina: . 25 . com conseqüente aumento da pressão osmótica. Quando os níveis de glicose sobem. ele perde peso. o rim não consegue reabsorvê-la e ocorre glicosúria. Assim. • Aumenta a síntese de proteína. • Aumenta o transporte de aminoácidos para os músculos e outros tecidos. Diabetis melittus insulino dependente (DMID) ou Tipo I. também chamada de DM insulina dependente (DMID).Esse hormônio. usualmente devido à deficiência ou resistência à insulina. • Diminui a quantidade de glucagon circulante por diminuição da expressão gênica. 10 a 20% dos casos de diabetes são do tipo I.Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e pode comprometer o funcionamento de rins. Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II. A perda de peso é decorrente de perda de tecido muscular e adiposo. pela perda de eletrólitos. oxidando-a para gerar energia ou usando-a para síntese de outros compostos. água intracelular é perdida para o interstício resultando em desidratação celular. principalmente potássio. caso não seja tratado. dependendo do tecido. cujos aminoácidos são usados na gliconeogênese. bem como da perda de água. devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza. embora não só a genética possa explicá-la. • Diminui a atividade da triacilglicerol lipase no tecido adiposo. pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular. Antes de verificar as diferenças e semelhanças nas manifestações dessas duas diabetes. lipídeo e glicogênio em proporções variadas. Devido a isso. olhos. ou DM não dependente de insulina (DMNDI). • Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase. É uma doença que pode ser definida como um estado de tolerância diminuída à glicose. O desarranjo de todas essas reações é encontrado no diabético.Por ação indireta: • Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase dependente de AMPc. inibindo a mobilização de ácidos graxos. ele desperdiça glicose eliminando-a na urina. Ela tem início entre a infância e 35 anos e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de DMID adquirirá a doença).

DMNDI Em geral após 35 anos Lento. Tratamento Depende do tipo de diabetes. perda de peso já pode influenciar na capacidade do corpo de controlar o nível de glicose. cetoacidose e glicosúria. baseado numa relativa mas não absoluta deficiência de glicose. ou tornar-se-á. Diabetes tipo II é mais certamente diagnosticada por uma demonstração da tolerância diminuída à glicose. O indivíduo ingere uma solução contendo 75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal. a cetose pode aparecer em certas condições de estresse metabólico. Assim. Tipo I –DMID Idade de início Início Estado nutricional no início Prevalência Em geral infância ou puberdade Em geral repentino Em geral desnutrido 10 a 20% dos casos 26 Tipo II . A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de diabetes. No período inicial da doença observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL. silencioso Em geral obesidade 80 a 90% dos casos . provavelmente por defeito nos receptores de insulina nas células.Tipo I é. ocorrendo. Nesses pacientes dieta e exercícios físicos são um bom meio de alcançar o controle da glicemia. Os pacientes apresentam normalmente níveis normais ou elevados de insulina. na verdade. toda uma gama de variação das intensidades dos dois sintomas. DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com obesidade e que tenham parentes diabéticos. com alto fator genético (100% dos irmãos gêmeos idênticos de um diabético tipo II desenvolverão a doença). sugerindo que não há a utilização correta do hormônio pelo organismo. considera-se que não existem apenas duas situações extremas: cetoacidose diabética ou hiperglicemia não cetônica. Nos diabéticos tipo II.Presente em 80 a 90 % dos diabéticos. Deve haver reposição adequada de Na+ e água. Agentes hipoglicemiantes orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou não. poliúria (aumento na quantidade de urina) e polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia. pacientes com DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de cetose. dependente de insulina por toda a vida. Não há relação necessária entre diabetes tipo I e obesidade. atingindo 200mg/dL após 2h de ingestão da solução de glicose. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de cetose. Alguns pacientes podem necessitar de injeções de insulina. Na tipo II. Diagnóstico Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as observações clínicas como perda de peso. como sepsis. Atualmente.

Diabéticos podem desenvolver retinopatia (principal causa de cegueira). β produzem menos de insulina ou igual insulina. tornando os pacientes propensos a lesões nas pernas e pés. Vírus e toxinas Baixa a ausente Obesidade Normal a elevada Poliúria. que causa a perda de sensibilidade nas extremidades inferiores. Complicações similares a surgimento após 5 anos tipo I. A retinopatia é quase universal entre os diabéticos. que ocorre principalmente no ε amino da Lys. nefro. Há tendência a hipovolemia e deslocamentos de água intracelular para o espaço extracelular. a conseqüência mais provável é o coma. Quando a osmolaridade alcança 340 a 350 mosmol/kg. com alta incidência de gangrena e amputação.Predisposição genética Defeito ou deficiência Outros fatores Insulina plasmática Sintomas iniciais Cetose Efeitos a longo prazo Complicações agudas Moderada Muito forte Cel. principalmente a neuropatia simétrica. Complicações decorrentes do diabetes A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. polidipsia. enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 % dos portadores de DMID e em menos de 20% daqueles com DMNDI. neuropatia e doenças cardiovasculares. causando desidratação celular. Uma explicação para isso é haver glicosilação de proteínas. nefropatia. Quando essa doença se desenvolve o paciente necessita de hemodiálise e transplante renal. A glicosilação de lipoproteínas plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença periférica vascular. sem produção Cel. β destruídas. mais tardias Cetoacidose Coma hiperosmolar Responde Em geral não necessário Resposta a hipoglicemiantes Não responde orais Administrar insulina Sempre necessário Coma diabético A glicose sanguínea em concentrações maiores que o limite de reabsorção renal provoca uma rápida diurese osmótica.e neuropatia. que leva a perda de água e eletrólitos. Tanto a hiperglicemia como a hipernatremia afetam muito o cérebro. a água move-se para fora das células cerebrais. 27 . perda de Nenhum ou os mesmos do peso. A neuropatia de nervos periféricos é comum em diabéticos. fome. Essas proteínas ficam com conformação alterada e são mais resistentes ao ataque proteolítico. Faça hipóteses para explicar esse fato. cetoacidose comum tipo I mais suaves Comum Rara Retino-. A dosagem de Hb glicosilada plasmática é um teste mais sensível que a medida de glicemia. Aumentando a osmolaridade plasmática.

não é lhe indicada já que está sob regime de emagrecimento. Queixa e Duração: Sensação de fraqueza há doze horas. Na seqüência sentiu um hálito amargo. executiva do ramo de cosméticos. Procurou o ambulatório médico para esclarecimentos. Hálito amargo há um dia. feminina. notou gosto ruim na boca e o apetite diminuiu. História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de idade. há uma hora. mas que não é incomum a transgressão da dieta. Foi-lhe dito que. porém.CASO 1 Identificação: J. hálito cetônico bastante evidente. Dor de cabeça intermitente. de hora em hora. 25 anos. por via muscular. masculino. pulsos finos. História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de emagrecimento em um spa há três dias. no terceiro dia de estadia. onde ingeriu quatro ou cinco chopes. mas a cetonúria ainda se mantinha em + / +++. para resolver seus sintomas. Faz uso de insulina. 35 anos. bastaria uma refeição calórica que. quando falava as pessoas sentiam cheiro de acetona. Relata que no primeiro dia nada sentiu. 1. aliadas à fraqueza. Hoje. Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL) Cetonúria = +++ / ++++ Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina. principalmente nos acontecimentos sociais. Queixa e Duração:Aumento do volume urinário há 4 horas. Qual o sinal clínico comum aos dois casos relatados? 28 . Após três horas de cuidados a glicemia já havia baixado para 185 mg/dL. a boca seca e. ritmos cardíaco e respiratório normal.. comeu pizza e tomou sorvete. Refere que procura seguir as recomendações dietéticas. palidez cutâneo-mucosa. branca. Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL) Cetonúria = +++/++++ (O normal é negativo). há oito horas. Como já passou por situações semelhantes. Respiração tendendo a ofegante. administrada por via subcutânea. Tudo seguido de uma intensa fraqueza e leve falta de ar.M. precisando levantar várias vezes da cama.B. Dados de gasometria revelam acidose. Exame Fïsico: Bom estado geral. Sinais clínicos de desidratação. começou a urinar intensamente.L. segundo seus familiares. bancário. a partir do segundo dia. o gosto ruim na boca é muito intenso e acompanhado de um hálito próximo ao cheiro de acetona. ritmo cardíaco regular. a paciente passou a sentir também fortes dores de cabeça. a fim de ser medicado antes do agravamento do quadro. duas vezes ao dia.P. porém. Indicou-se que aguardasse por mais alguns dias até que os sintomas regredissem. levemente taquicárdico. Está submetida a uma dieta de 300 kcalorias/dia. Exame Físico: Regular estado geral. de descompensação diabética. Passadas quatro horas. hálito cetônico. branco. Gosto amargo na boca e sensação de fraqueza. Relata que no entardecer do dia esteve em uma lanchonete com amigos. CASO 2 Identificação: J. procurou o serviço médico. pressão arterial = 100 x 60 torr.

a tendência dos pacientes é de perda. 14. músculo e fígado neste jejum extremo. o paciente do Caso 1 fica impossibilitado de usar a glicose sangüínea em células como as do músculo. Nos dois casos apresentados. manutenção ou ganho de peso? 10. Tabela de códons 29 . Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos casos 1 e 2? 9. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de um mRNA específico sem mudar o gene codificante da proteína os elementos controladores do gene. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1 e 2? 7.6 bisfosfato. Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a quatro semanas. indicando o hormônio que atua em cada caso. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de frutose 2. Por que o valor da glicemia difere tanto entre os casos 1 e 2? 3. 15. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65 mg/dL? Que via metabólica é utilizada para a síntese de glicose? 8. Indicar as condições metabólicas que levam a uma aumento na produção de corpos cetônicos 18. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. lipídios e proteínas provocadas por jejum prolongado e por diabetes. nesse caso? 5. Citar a fonte de energia utilizada pelo cérebro. 16. desde que hidratado) como nos casos de greve de fome. Descrever as ações de glucagon. Qual é a relação entre a glicemia e a presença plasmática de acetona? 4. pois a entrada de glicose nessas células é estimulada pela insulina. 17. Pela deficiência de insulina. adrenalina e insulina no metabolismo de triacilgliceróis AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO 1.2. hemácias. Descrever as alterações do metabolismo de carboidratos. Qual a principal fonte de ATP para a contração muscular. que tipo de reserva a paciente do caso 2 deve estar utilizando para a obtenção de ATP? 6. Após alguns dias no spa.

Um transcrito para um gene contem a seqüência de bases abaixo: 5´ AACUGCACGAGGUAACACAAGAUGGCU 3´ Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes fases. você sabe que seu sistema precisa de 4 minutos para produzir uma molécula de proteína A completa. você isola a proteína A intacta do sistema. você sabe que a proteína A tem quatro pontos sensíveis à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1. A3. Em t=0. reduz ou não é 30 . Quais são as funções do mRNA. Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes condições: a) O trp mRNA é estável (degrada lentamente após algumas horas) b) O trp mRNA é degradado rapidamente. (A) Em t=1 minuto. Além disso. Qual peptídeo é mais intensamente marcado? (B) Em t=3 minutos. você adiciona todos os 20 amino-ácidos. qual será a ordem de marcação dos peptídeos do mais para o menos marcado? (C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas? 6. 4. é o amino. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações em: a) o gene lacI que inativa o repressor b) o promotor é eliminado na região próxima a posição -10 3. Finalmente. corta-a com tripsina e isola os cinco peptídeos. Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma proteína chamada A. porém não glicose. 2. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que decodificam o código genético. A4 e A5. tRNA e rRNA? Aula 20: Regulação da Expressão Gênica 1. As células continuam a crescer e dividem a cada 30 minutos. Explique.2. Aponte três mutações que não modificam a sequência da proteína. porém a enzima triptofano sintase é estável. Células de E. c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente que o normal. Células de E. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de proteínas. Indique em cada uma das situações abaixo se a expressão do operon lac aumenta. coli são crescidas no meio com glicose como única fonte de carbono. coli são crescidas no meio contendo lactose. O peptídeo A1. 5. cada um levando uma marcação com 14C .terminal e A5 é o carbpxi-terminal. Tryptofano é adicionado. 3. A2. Quais mecanismos são usados para garantir a fidelidade de cada um destes processos. 7.

Esses termos deverão ser esclarecidos com o auxílio dos professores. A atividade desta RNA polimerase é reduzida quando a enzima é purificada. b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3. Façam uma lista contendo. na sua opinião. c) Uma mutação que inativa completamente a β -galactosidase. e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador. 4. monitores e colegas de grupo. Sugira uma explicação para esta observação. destacando os termos que você não compreenda ou de que nunca tenha ouvido falar. c) Removendo a seqüência 4 d) Trocando os dois códons trp no peptídeo iniciador para códons de His. 5. Desenhe um modelo descrevendo o que acontece em cada uma destas situações. Aula 22: Técnicas de Biologia Molecular. Como a transcrição do gene operon trp da E. Esta RNA polimerase inicia somente a transcrição a partir de uma única região promotora altamente especializada. d) Uma mutação que inativa completamente a permease galactosidase e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região do promotor lac. Transgênicos – 7° Teste Questões para Estudo Leia os textos que se seguem a respeito de alimentos transgênicos. acesse os sites recomendados ao final dos textos. a) Adição de alta concentração de glicose b) Uma mutação que impede a dissociação do repressor lac na região reguladora. coli pode ser afetada pelas seguintes manipulações da região promotora do mRNA trp. 31 . Para complementar seus estudos. Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um fungo exótico. os pontos favoráveis e desfavoráveis ao emprego da tecnologia para produção de alimentos transgênicos. a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a seqüência 2.alterada.

na qual a transferência de genes se dava por meio de cruzamentos (reprodução sexuada). O sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil cultivo e permitir a purificação e recuperação do produto do gene. Histórico: A Genética é uma ciência característica do século XX. pois.o gene de interesse. sanidade animal e produção de alimentos. O termo geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia do DNA recombinante para a alteração genética de animais. plantas e microorganismos. resultando em um organismo geneticamente modificado (OGM). O crescimento acelerado do campo da biotecnologia. a partir de 1900 as Leis de Mendel foram redescobertas e começaram a ser aplicadas.uma técnica para gerar uma planta inteira a partir de uma só célula transformada. Antes do desenvolvimento desta técnica. Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a transferência do material genético de um organismo para outro. O gene artificial ou intencionalmente inserido no genoma de um organismo é denominado transgene. Ao invés de promover o cruzamento entre organismos relacionados para obter uma característica desejada. misturando todo o conjunto de genes dos dois organismos em combinações aleatórias. ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou Tecnologia do DNA Recombinante). . . Procedimentos para a obtenção de vegetais transgênicos: Para obter plantas transgênicas são necessários: . 32 . plantas e animais. Surgiram técnicas biotecnológicas como a produção e pesquisa de plantas e animais transgênicos. Nos primeiros ¾ deste século. A técnica exigia uma enorme demanda de tempo e não era precisa. Para a introdução do gene em outro organismo são utilizados vetores de clonagem (plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida. cuja característica adquirida passa a ser transmitida para as futuras gerações. técnicas de detecções e diagnósticos por PCR e Terapia Gênica.uma técnica para transformar células vegetais através da introdução do gene de interesse. cientistas podem identificar e inserir no genoma de um determinado organismo um único gene responsável pela característica em particular. a genética mendeliana contribuiu significativamente para a sustentação do crescimento populacional de nosso planeta. aumentando a produtividade de animais e contribuindo para uma maior longevidade humana. clonagem de mamíferos. amplificação do número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. pelo uso de técnicas modernas de Engenharia Genética. produção de proteínas humanas em microorganismos. A decifração do código genético e a manipulação do DNA neste último quarto de século. mapeamento do genoma humano. produzindo maiores safras de alimentos de origem vegetal. entretanto. A clonagem molecular consiste no isolamento do gene de interesse.Definição de transgênicos: Os Transgênicos são organismos que adquiriram características de outro organismo. aceleraram as descobertas científicas e suas aplicações biotecnológicas. a mais utilizada era a do Melhoramento Clássico. abrindo novas perspectivas econômicas nos campos da saúde humana.

Uma das possibilidades para isolamento de um gene é a construção de uma “biblioteca genômica” e. Os insetos que se alimentassem de plantas expressando este gene morreriam ou se desenvolveriam com menor eficiência. algumas culturas não sobrevivem à aplicação deste produto. Deste modo.  Gene que codifica uma proteína de alto valor nutricional. uma bactéria ou até um animal.000 genes. para isso.000 e 60. 33 . o de plantas. porque ela contém. que pode ser uma planta. Em seguida o DNA é cortado em fragmentos menores utilizando as enzimas de restrição.  Genes bacterianos que codificam proteínas com propriedades tóxicas para insetos. facilitando assim o controle das ervas. ligados a outros fragmentos de DNA. seleciona-se a colônia de bactérias que contém o fragmento de DNA correspondente ao gene de interesse. entretanto.000. Os herbicidas são muito usados no controle de ervas daninhas. Depois. presente na castanha-do-pará. além dos genes naturais. entre 40. Estes fragmentos são. enquanto o genoma humano consiste de aproximadamente 30. culturas contendo este gene poderiam tornar-se resistentes ao herbicida. Os genes são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta característica que permite que genes de um organismo sejam potencialmente funcionais em outro. levando ao seu controle na cultura. tem-se uma planta transgênica. um gene adicional proveniente de outro organismo. Genes de Interesse: O genoma de uma bactéria contém em média 5. inativando-os. então.Após esta última etapa. onde este material é inserido e replicado por várias vezes. Diversos genes de interesse agronômico já foram isolados.000 genes. o DNA do organismo contendo o gene de interesse é extraído. entre eles temos:  Gene que codifica proteína capaz de modificar herbicidas. Este gene poderia ser usado para aumentar o valor nutricional de culturas importantes como feijão e soja. mas que podem se replicar em bactérias.

34 . há diferenças conceituais entre a situação com microrganismos e com plantas: nos primeiros.especialmente para o caso de monocotiledôneas) ou através de agrobactérias. o que permite a penetração e eventual integração dos genes no genoma. ocorrendo o processo de integração do gene exógeno no genoma do organismo a ser modificado. estabelecido pela primeira vez em 1973. Os microprojéteis são acelerados com pólvora ou gás em direção aos alvos (as células vegetais). como cada espécie de planta tem diferentes exigências hormonais. esta etapa ainda representa o maior gargalo na criação de plantas transgênicas. o DNA é dissociado das micropartículas pela ação do líquido celular. introduziram o gene proveniente de uma rã em uma bactéria. Ou seja. em São Francisco. Regeneração das plantas a partir das células transformadas: Uma vez inserido o gene na célula vegetal. O plasmídeo encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a transformação de plantas. O choque causa uma alteração da membrana celular. Parte do plasmídeo é um transposon (T DNA) que produz cópias de si mesmo nos cromossomos da planta infectada. A transformação de uma célula vegetal é um tipo de manipulação genética que atende ao mesmo princípio da transformação de microrganismos. No entanto. C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA extracromossomal que pode se replicar independentemente do cromossomo. as mudanças obtidas no nível celular não são significativas. os objetivos finais são mudanças operadas no nível celular. são incubados em soluções que contêm os genes a serem transferidos e. Neste século. o domínio das técnicas de regeneração de plantas inteiras a partir de uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. nutricionais e ambientais para a regeneração.Transferência dos genes de interesse em plantas: A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado . E. como plantas e animais. desprovidas de parede celular. um choque elétrico de alta voltagem é aplicado por curtíssimo tempo. Para a transformação. A transferência é alcançada por um dos métodos seguintes: A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais. em seguida. quando Stanley e Cohen. B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio cobertos com os genes de interesse. enquanto que em eucariotos superiores. Em seguida. é esperado um rápido desenvolvimento na biotecnologia animal e vegetal. a não ser que possam ser transferidas para todas as células do organismo. inserindo-se aleatoriamente nas organelas celulares. Os transposons são assim denominados (ou também chamados elementos de transposição) justamente porque são elementos genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se. A produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá resultar em um produto mais economicamente viável que o enriquecimento do trigo com a lisina obtida de microorganismos. Papel dos transgênicos na economia mundial: O século passado teve um grande desenvolvimento na biotecnologia microbiana. esta célula ou grupos delas são estimuladas a gerar uma planta transformada. Os genes entram nas células junto com o projétil de maneira não-letal. embora esta técnica já esteja estabelecida para inúmeras plantas de interesse econômico.

No Brasil. O ritmo atual de liberação de OGMs indica que na primeira década deste século já teremos uma centena de produtos geneticamente modificados nas prateleiras dos supermercados. e produzindo tolerância a determinados herbicidas. seja em nações industrializadas ou em desenvolvimento. os consumidores dificilmente notaram qualquer benefício além de. No entanto. algumas tendo se tornado sucessos comerciais. em princípio.U. A seguir são apresentados alguns exemplos do uso da tecnologia da modificação genética de vegetais aplicada a alguns problemas específicos da agricultura: 35 . especialmente para a produção de metabólitos secundários. é necessário utilizar de forma adequada e responsável as novas tecnologias e descobertas científicas. a agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em volume.A modificação genética de microrganismos continua sendo uma importante complementação para as modificações genéticas de plantas e animais.U. biorremediação e tratamento de águas. bioprocessamento. principalmente com características preferidas pelo mercado.A. Esses esforços devem ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da agricultura. muitos alimentos transgênicos importados já são comercializados e estima-se a importação de 3 milhões de toneladas de milho da Argentina e dos E. Para isso.A aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade apareceu no mercado europeu. Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30 milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. dando resistência contra pragas de insetos ou viroses.. os E.1999. Alimentos produzidos através de tecnologias de modificação genética podem ser mais nutritivos. em casos limitados. De acordo com uma pesquisa sobre a expectativa de comercialização de produtos obtidos de organismos geneticamente modificados nos E. resistência a insetos e vírus.A. É essencial melhorar a produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial crescente. Os desenvolvimentos resultantes em variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado no aumento de vida em prateleiras de frutas e vegetais. Na década de 90. organizados. podendo-se chegar na casa dos milhares em algumas décadas. Vegetais geneticamente modificados: A maioria dos produtos já liberados para a comercialização contém transgenes que codificam características que visam minimizar estresses ambientais. um decréscimo no preço devido a custos reduzidos e aumento da facilidade de produção (University of Illinois. devem ser feitos para investigar os efeitos potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas.U. Benefícios promovidos pelos transgênicos na agricultura: A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de plantas para alimentação. as características que visam aumentar a qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e deverão prevalecer nas próximas gerações de produtos transgênicos. onde as lavouras transgênicas são permitidas oficialmente. Esforços em conjunto. incluindo tolerância a herbicidas. enquanto reduzimos os impactos ambientais. que estejam atualmente em uso. estáveis quando armazenados e. biofertilizantes e biopesticidas. Enquanto essas características têm trazido benefícios aos agricultores. Falck-Zepeda et al 1999). podem promover saúde trazendo benefícios para consumidores.

1999). que devasta os arrozais africanos. deve-se considerar o fato de que populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta transgênica. cientistas conseguiram fazer crescer e desenvolver em água contendo forte teor de sódio. graças à injeção de um único gene capaz de absorver um excedente de sal em plantações de tomate. os pesquisadores utilizaram uma técnica de imunização genética. Ele foi produzido usando-se genes envolvidos na produção de proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na dieta humana (Goto et al. e o desenvolvimento da sua parte reprodutiva (comestível) é aumentado. Como exemplo. temos o vírus Mottle Amarelo do arroz (RYMV). mais forte e que aumenta o rendimento da safra diretamente. Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições. Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e cultivado.Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada no Hawai desde 1996 (Gonsalves. Estes genes (NORIN 10) agem da mesma forma quando utilizados para transformar outras espécies de plantas importantes como alimento. Segundo a revista Nature Biotechnology. Como exemplo. As plantas transgênicas contêm entre 2 e 4 vezes mais ferro do que normalmente encontrado no arroz convencional. 36 . A introdução desses genes faz com que se obtenha uma planta mais baixa. através da criação de plantas de arroz transgênico resistentes ao RYMV. por exemplo. tomates perfeitamente comestíveis. de forma a combater a anemia. temos um gene de tolerância em manguezais (Avicennia marina) que foi clonado e transferido para outras plantas que se mostraram mais tolerantes a altas concentrações de sal. Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto rendimento como. 1998). Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro. com conseqüente diminuição ou eliminação da necessidade do uso de pesticidas. Porém. Um exemplo de combate ao stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em solos ácidos (de La Fuente et al 1997). É resultado do uso de modificação genética em vegetais visando obter maior resistência a uma praga específica. O gene introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio excedente. Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual. o trigo semi-anão que possui genes insensíveis à giberelina. uma vez que o alongamento das células na parte vegetativa é reduzido. como acontece com o uso de inseticidas.

O resultado desse experimento foi a produção de grãos amarelados de arroz.K. & Heller. Referências • Lewin. redigida nas “questões para estudo” para auxiliar o debate.Conselho Nacional de Biossegurança: www. Em cada sala haverá um professor para mediar o debate e esclarecer as regras da atividade. (1989) The Biology of Plants.D. Ed.gov.Freeman and Company.) (1996) Biologia Molecular Básica. diarréias e sarampo. Academic Press Inc. Polêmica sobre os Alimentos Transgênicos . Cerca de 300 g desse arroz cozido por dia suprem as necessidades de betacaroteno de um indivíduo. benefício para a saúde etc. R.sbbq.Artigo da revista Ciência Hoje com link para arquivo pdf.Posicionamento do Conselho Nacional de Nutricionistas: www.B. redução do custo ou aumento do preço dos alimentos. portanto. H. Sadava.: www. (2001) Life – the science of Biology. Porto Alegre. (Coord.G. 37 . • Okamuro. O debate não deve. Oxford University Press.htm . Mercado Aberto. W.br/variavel/destaque/pgdestaque2.htm . envolvendo tópicos como impacto ambiental. (1994) Genes.ctnbio.arroz normal arroz transgênico Pesquisadores desenvolveram arroz com alto teor de beta-caroteno. • Purves. Orians. J. Foram inseridos genes de bactérias que fazem a conversão do precursor presente no arroz em beta-caroteno.org.org.H. Utilize sua lista. Inc & W. ressecamento da córnea.C.K. New Yourk.Posicionamento da SBBq: http://www. 6th. Em ambos os casos os argumentos devem ser os mais variados possíveis. que ajuda a combater diversas doenças. Será iniciado um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o consumo de alimentos transgênicos. B. A.br/cienciahoje/ch/ch146.H. agroeconomia. como a cegueira noturna.htm . 1ed. & Goldberg.br/start.br/ctnbio/bio/artigos/004. aumento da produtividade.. ser limitado a aspectos nutricionais.cfn.uol. Sinauer AssociaTES. o grupo contra deverá utilizar argumentos que condenem os transgênicos. • Zaha.. precursor da vitamina A. devido à presença de beta-caroteno.php?id=port Questões para Discussão Cada sala deve ser organizada em dois grandes grupos – pró e contra.com.

Centrifugar a 12000xg por 5 min á temperatura ambiente.2 N . Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta. Centrifugar a 12000xg por 5 min á temperatura ambiente. 4.Solução Neutralizadora – Acetato de potássio 3M pH 4. Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%. Tomar 1 ml da cultura e colocar em um tubo de eppendorf.E .GET / Rnase – dextrose 50mM. Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência anterior. 6. extrair e purificar o DNA plasmidial. 3. 16. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no Vórtex. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro eppendorf contendo 300µ l de Isopropanol. 12. O DNA plasmidial purificado é em seguida concentrado por precipitação com etanol. Um dos métodos mais utilizados consiste na lise das bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio). . 11. 1. 18. Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra na proporção 1:10. Incubar por 5 min à 65 °C. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e delicadamente. Neste procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo removidos por centrifugação. Ribonuclease A 150µ g/ml em TrisHCl 25mM pH 8. 15.0. 9. Incubar o tubo em gelo por 20 min. 2.Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose .7% de Agarose em TBE. 5. 7. 13. Incubar a mistura por 5 min á temperatura ambiente. EDTA 10mM. Centrifugar a 12000xg por 15 min á temperatura ambiente.8. Aplicar a amostra em gel 0. Soluções utilizadas: . 17. separando-o do DNA cromossomal bacteriano.Solução de lise – SDS 1% em NaOH 0. 38 . Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente. Utilizaremos cultura de E.Preparação do DNA plasmidialFundamento: Existem vários procedimentos para purificação em pequena escala de DNA plasmidial de células bacterianas. Centrifugar a 12000xg por 10 min á temperatura ambiente . 8. 10. 14.5 µ l/ml de Brometo de etídio e submeter a eletroforese a 100V em Tampão TBE. Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T. contendo 0.coli em meio LB-A (50µ g/ml ampicilina). Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min.

Que papel desempenha cada componente do tampão GET (glicose. Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da resistência à ampicilina. Por que se dissolve a preparação de DNA em tampão Tris-EDTA ? 7.Questões 1. leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido) contento estes antibióticos. por exemplo ? 6. Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ? . clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina.. O que é lisozima e para que é usada na preparação de plasmídeos ? 3.coli) o pBR322 apresenta duas marcas genéticas. Portanto a introdução de pBR322 em E. O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de genes. Se o DNA cromosomal tiver sido muito quebrado durante as manipulações.5 mg/ml tetraciclina. EDTA e Tris) ? 2. 39 . genes que codificam para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). Várias técnicas são disponíveis para transformar uma bactéria. uma vez que este sítio está localizado na região amp r. Da mesma forma. onde espera encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de DNA plasmidial? 5. Este plasmídeo pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas) que podem ter valor seletivo no meio. ou seja. Além da origem de replicação que permite sua propagação em bactérias (E. será revelada através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LBtet. Neste método as bactérias são submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes para a transformação pelo DNA do plasmídeo. Transformação de bactérias que são sensíveis a um antibiótico. em resistentes.Transformação de bactéria com plasmídeo contendo genes de resistência a antibióticos Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua manutenção como um elemento autônomo auto-replicativo. Como age o isopropanol ? Este álcool poderia ser substituído por etanol. Qual a função do NaOH e do SDS presentes na solução de lise ? 4.coli que normalmente é sensível tanto à ampicilina como à tetraciclina. Na aula prática usaremos o método do CaCl2. Contendo 50 mg/ml ampicilina ou 12. Usaremos o plasmídeo pBR322 (ver mapa).

8. Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. Para transformar.5 µ g DNA de pBR322 em 10µ l de tampão 10mM Tris pH7. distribuir 0. 7. coletar as bactérias por centrifugação (4000 rpm.1 M.coli) e incubar 2. Incubar em gelo por 15 min.3 (fase logarítmica de crescimento). Manipule convenientemente o material estéril fornecido. 4. 3. 1. para evitar contaminação. As bactérias competentes para transformação são preparadas a partir de uma cultura em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma solução de CaCl2. Transferir os tubos para o gelo por 2 min. 5 min). previamente flambada e em seguida resfriada na própria tampa da placa de Petri.5 contendo 1 mM EDTA) a um dos tubos. 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão (frio). No gelo estas BACTÉRIAS COMPETENTES podem ser transformadas. por uma hora.Procedimento experimental: O ideal é que a experiência seja realizada em ambiente asséptico (fluxo laminar). Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E. As bactérias competentes assim preparadas podem ser armazenadas a –80°C. Coletar as bactérias (4000 rpm.5 contendo CaCl2 0. à 37°C até o dia seguinte sob agitação forte (200-250 rpm). 40 .9 ml/tubo de meio LB e incubar a 37°C sem agitação. NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO. em banho-maria. Diluir a pré-cultura 1/10 em 10 ml de meio LB. Transferir a cultura para o gelo. para uso posterior. incubar à 37°C sob agitação até OD600nm=0. Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM pH6. Após pelo menos 30 min. 6.1 ml/tubo da suspensão de bactérias competentes para cada um de 2 tubos. Antes de dar o choque térmico (42°C por exatamente 90 segundos) . Espalhar as bactérias com o auxílio de uma alça de vidro. Adicionar o DNA transformante (0. O outro tubo será usado como controle (bactéria apenas). Adicionar 0. Incubar no gelo por 20 minutos. 9. 5.

Qual a eficiência de transformação obtida. Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes? 2. em termos de n° de colônias / µ g de DNA? Questões 1. a 37°C antes de espalhá-las em placas de ágar? 4. Qual o papel do choque térmico? 3. 41 . Por que as bactérias devem ser incubadas por 60 min.Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| ANÁLISE DOS RESULTADOS 1. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo. Preencher a tabela com o número de colônias obtido em cada caso: Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| 2.

Sign up to vote on this title
UsefulNot useful