P. 1
ApostilaNutricao_noturno_QBQ0214

ApostilaNutricao_noturno_QBQ0214

|Views: 4.971|Likes:
Publicado porRenan Reixach

More info:

Published by: Renan Reixach on Oct 07, 2010
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOC, PDF, TXT or read online from Scribd
See more
See less

06/02/2013

pdf

text

original

Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno) Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214 Departamento de Bioquímica Instituto de Química 2009 Docentes: Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup. Sala 854 Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala 1013/1018

Monitores: Cecília Midori Ikegami (cikegami@usp.br) Mariana Lemos Duarte (mlduarte@gmail.com)

Programa Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise; gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons; fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos transgênicos. Bibliografia - Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999. - Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002. - Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996. - Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000. - Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004. - Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002. - Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc., 5th ed New York; 2001. - Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing Company; 1996. - Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G. Scrimgeour Prentice Hall; 1993. - Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995. - Nutritional Biochemistry: T. Brody – Academic Press; 1994. - Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996. Critério de Avaliação O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará 1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final deverá ser feito através da seguinte equação: NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5 10

2

Cronograma de Aulas 17/08 19/08 24/08 26/08 31/08 02/09 07/09 09/09 14/09 16/09 21/09 23/09 28/09 30/09 05/10 07/10 12/10 14/10 19/10 19/10 21/10 26/10 28/10 02/11 04/11 09/11 11/11 16/11 18/11 23/11 25/11 30/11 02/12 Aula 9 Aula 10 Aula 11 Aula 12 Aula 13 Aula 14 Aula 15 Aula 16 Aula 17 Aula 17 Aula 18 Aula 19 Aula 20 Aula 21 Aula 22 Aula 1 Aula 2 Aula 3 Aula 4 Aula 5 Aula 6 Aula 7 Aula 8 Enzima (funções e propriedades) Catabolismo/ Anabolismo (introdução) Glicolise (via das pentoses) Gliconeogênese – 1° Teste Oxidação de Triacilgliceróis Formação AcetilCoA (vitaminas e cofatores) – 2° Teste Feriado Ciclo de Krebs 1° Prova Fosforilação Oxidativa Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia de transporte de elétrons. Sala multimídia - Cadeia de transporte de elétrons e fosforilação oxidativa Metabolismo de Glicogênio – 3° Teste Controle Hormonal (insulina, glucagon e vitaminas) Controle Hormonal (insulina, glucagon e vitaminas) Síntese de Triacilglicerol – 4° Teste Feriado 2° Prova Metabolismo de aminoácidos Ciclo da uréia Fonte de Nutrição – 5° Teste Feriado Regulação Integrada Feriado Regulação Integrada Diabetes – 6° Teste Tradução e Código Genético Regulação da Expressão Gênica Biologia Molecular (testes diagnósticos) Técnicas de Biologia Molecular; Transgênicos – 7° Teste Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose Apresentação de Seminários (Alimentação e BioMol) 3° Prova

3

AULA 1: ENZIMAS I. Classifique as afirmações abaixo como verdadeiras ou falsas: 1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( ) 1.2. A velocidade da reação é proporcional ao tempo da reação. ( ) 1.3. A velocidade da reação é proporcional à concentração de substrato.( ) 1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração de substrato não seja limitante. ( ) 1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( ) 1.6. A quantidade de produto formado depende do tempo da reação. ( ) 1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( ) 2. Definir enzima, substrato e sítio ativo 3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da concentração de S. 4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade da enzima pelo seu substrato 5. Fazer o gráfico da velocidade de uma reação enzimática em função de: a. Concentração de enzima; b. Temperatura; c. pH. Justificar a forma dos gráficos 6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse procedimento. 7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de inibidor escolhido, competitivo ou não competitivo?

4

. o cansado persistiu e agravava-se com atividades físicas que até a véspera fazia sem problemas. nesta manhã.Aula 2: Introdução ao Catabolismo e Anabolismo Obtenção de energia pelo Metabolismo MP I AA E q e ag ra d d g a a ã d n tr n s s u m e l a e r d ç o e u ie te A IM N O L ET S P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G oe lic s A in á id s m oc o Á id G x c o ra o C O ND A FD A + 2 ND AH FD AH 2 A P+P D O2 H2O i AP T A . 27 anos. extremidades frias e referindo forte dor de cabeça. saiu de casa sem comer nada e iniciou o trabalho. Deu entrada no serviço de emergência. com a recomendação de que ingerisse chá ou outra bebida estimulante. analisador de sistemas.T. sendo conduzido ao Pronto Atendimento. trabalhador da construção civil. foi posto sob respiração em balão de oxigênio e rapidamente sentiu-se melhor. masculino. No momento do exame. Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas. Relata que logo ao sair do aeroporto. Embora tenha feito refeições corretas. a tontura tornou-se muito forte e escureceu– lhe a vista. fumante. vindo de Salvador. por volta das 10:00 horas da manhã. Insistindo com a atividade que fazia. encontra-se pálido. CASO 3 5 . tendo tido necessidade de um esforço intenso. vindo a cair da própria altura. precisou subir um lance de escada e sentiu-se muito cansado. sudoreico. 32 anos. CASO 2 R. Com o passar dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e sudorese fria. desmaiou.B. Depois dos exames preliminares. após ter desmaiado no trabalho. Conta que nos últimos dias alimentou-se mal e. trazido por colegas. Foi dispensado do hospital. O paciente chegou no dia anterior a La Paz. No final do terceiro dia.. CASO 1 P.P.Ler o relato dos três casos apresentados a seguir.

Conta que o seu pai ficou pálido. Acrescentar O2. Alimentos + Processos que requerem energia VIAS METABÓLICAS DEGRADATIVAS No Mapa II (página seguinte) encontra-se. 1. com duração de cinco a dez minutos. respectivamente 25 mmols/L e 150 mmols/L e as concentrações plasmáticas são 140 mmols/L e 5 mmols/L. fumante.J. HPO42-. d. Quais são os passos irreversíveis que aparecem no mapa? 2. o paciente foi a óbito. 42 anos. ou ao sentir emoções. A manutenção destas concentrações é espontânea? Como o organismo consegue mantê-las? 8.. o número de átomos de carbono de alguns compostos. 4. começou a suar frio e dentro de poucos minutos perdeu a consciência e caiu. e. em aperto. Fazendo exames de avaliação cardíaca. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um composto rico em energia (ATP). Desde então vinha fazendo uso de remédios que promovem dilatação das coronárias. f. de inicio abrupto. A falta de que composto provocou os sintomas relatados nos três casos descritos? O que restringiu a síntese deste composto em cada um dos casos? Os sintomas dos casos 1 e 2 são claramente neurológicos. As concentrações celulares de Na+ e K+ são. quer ocorra in vivo. A dor melhorava com o repouso. A única função dos alimentos é fornecer energia. foi constatada obstrução parcial de uma das artérias coronárias. Qual o primeiro composto comum à degradação de carboidratos. entre parênteses. 3. como subir uma ladeira caminhando. A quantidade de energia derivada da oxidação de nutrientes é a mesma. Os processos celulares que requerem energia utilizam a energia térmica proveniente da oxidação dos alimentos.F. o paciente sentiu forte dor no peito. 2. Os compostos característicos de um dado organismo devem ser supridos pela dieta. masculino. ADP e ATP nos espaços do esquema abaixo.P. Que compostos são produzidos como conseqüência desta reação? Entre os compostos produzidos. O paciente iniciou há seis meses um quadro de dor no peito. no máximo. quais são excretados e qual é aproveitado pelas células? 6. sempre que fazia algum esforço físico. Resuma: por que é necessário comer e por que é necessário respirar? 7. proteínas e lipídios? 6 . relata o filho que o estava acompanhando. executivo. b. Com esse quadro foi trazido ao pronto socorro e embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca. 1. responder as questões seguintes. c. Logo ao sair para o trabalho. 5. B – Com base no Mapa I. A oxidação biológica consiste na retirada de hidrogênio do substrato. Que partes do Mapa I devem ser suprimidas quando referente exclusivamente ao cérebro? A síntese de ATP é obtida por oxidação ou redução dos alimentos? Discutir as seguintes afirmações: a. quer se processe in vitro.

ou lipídios ou proteínas. geralmente NAD+ ou FAD. 4. proteína a partir de glicose c. Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos. glicose a partir de ácido graxo d. glicose a partir de proteína f. com três átomos de carbono a menos que o substrato original. Estes três tipos de compostos são essenciais para a sobrevivência. Não havendo outras restrições na dieta. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose. ácido graxo a partir de proteína Indicar no mapa a via utilizada para cada conversão.3. na mesma molécula. Aldolases: Cindem açúcares fosforilados. Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma posição para outra. Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato. na maior parte dos casos. proteína a partir de ácido graxo e. Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se insuficientes para manter a glicemia? M P II AA P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G IC S L OE A sp F sfo o iru ato (3 o en lp v ) A IN Á ID S M OC O G ly A la S er Cs y L eu Ile Ls y Pe h G lu Á ID S G A O C O R X S L actato P v (3 iru ato ) C 2 O A cetil-C A(2 o ) C 2 O O alo x acetato (4 ) C 2 O M alato (4 ) Iso citrato (6) C 2 O Fm u arato (4 ) S ccin (4 u ato ) eto lu ) α C g tarato (5 C 2 O C itrato (6 ) 1 – Ler CAPÍTULO 4. são reversíveis. prever que grupo de animais sobreviveria. Isomerases: Catalisam reações de isomerização. 7 . Estas reações. Desidrogenases: Catalisam reações de óxido-redução. ácido graxo a partir de glicose b. verificando se é possível sintetizar: a. dando origem a diidroxiacetona fosfato e a outro açúcar. página 45 .O SENTIDO DAS REAÇÕES 2 – ALGUNS TIPOS DE ENZIMAS: Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em geral ATP) para um aceptor. por transferência de hidrogênio do substrato para uma coenzima.

8 .P OH2COH H2O COO C.P HC-OH H2C-O P ADP ATP O =C-O HC-O H H2C-O. Os parâmetros medidos estão apresentados nas figuras 1 e 2.3 Bisfosfoglicerato 3-Fosfoglicerato COO HC.P OCH 2 A DP A TP C OO HCOH CH 3 NAD + NADH CO O C= O CH 3 2-Fosfoglicerato Fosfoenolpiruvato AD P ATP Lactato NAD + NADH Piruvato Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas.6 bisfosfato H2C-O.P Frutose 6-fosfato ATP ADP HO OH HO Frutose 1.AULA 3: GLICÓLISE H OCH 2 OH O OH OH ATP ADP H O GLICÓLISE Glicose ATP ADP P -OCH 2 O HO OH OH OH Glicose 6-fosfato PO-CH 2 O CH 2OH HO OH HO AT P A DP P -OCH 2 O CH 2O. a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos alunos.P ADP AT P Diidroxiacetona fosfato Gliceraldeído 3-fosfato Pi NAD + NADH 1.P C=O H2C-OH HC=O HC-OH H2C-O P Pi NAD + N ADH O= C-O.

Quais são os produtos finais da via glicolítica? 8. estabelecer o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica. Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M. a hemácia poderia excretar piruvato? 11. Qual a utilidade. 7. é possível estimar a quantidade de glicose que pode ser convertida a lactato? 10. O exercício é o único processo que leva à produção de lactato? 3. Considerando o número de moléculas de ATP consumidas e formadas. 6. utilizar apenas o mapa da glicólise (p. Para cada molécula de glicose consumida qual é o número de moléculas de piruvato produzido? 9.170 Freqüência Cardíaca (bat/min) 160 150 140 130 120 110 100 90 80 0 0 2 4 B B (tiro de 30s) A (caminhada) Figura 1: freqüência cardíaca durante caminhada de 15 min (A) e tiro de 30 s (B) A 30s 6 8 10 14 15 min 16 tempo Figura 2: Níveis de lactato plasmático durante caminhada de 15 min (A) e tiro de 30 s (B) 9 8 7 B B (tiro de 30s) A (caminhada) Lactatemia (mmol/L) 6 5 4 3 2 1 0 0 0 2 4 30s A 6 8 10 14 15min 16 tempo Analisando os dados acima e com auxilio de livros responda as questões: 1. para a musculatura em exercício. O esforço físico leva à produção de lactato? 2. do aumento da freqüência cardíaca? Para responder as questões de 6 a 14. Em lugar de excretar lactato. 9 . Em caso afirmativo.124). esta adaptação foi suficiente para manter a lactemia basal? 5. localize as reações que produzem ATP. Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante? 4. Examinando a via metabólica que converte glicose a lactato (a glicólise).

Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese. 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a conversão de glicose a glicose 6-fosfato. b) mantê-la em funcionamento 10 .12.6 bisfosfato nos hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições. b) Se a dieta contiver quantidades insuficientes de carboidratos. 2. consultando o Mapa I. f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise e da gliconeogênese? e) Explicar como é feito o controle das duas vias. Levar em consideração o fato de o nível de frutose 2. 13. por sua vez. 5. AULA 4: GLICONEOGÊNESE 1. Seria possível excretar piruvato em lugar de etanol? Que semelhança tem este metabolismo com o do tecido muscular em condições de esforço extenuante? 3. a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via glicolítica. Explique. Explicar este aparente paradoxo. 6. Citar o tecido responsável pela gliconeogênese. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase. Os Casos clínicos 2 e 3 (p. No entanto. à p. pode ser convertido a glicose por um processo chamado gliconeogênese. a glicólise é anaeróbia e produz ATP. usando glicose como fonte de carbono e produzindo etanol. Saccharomyces cerevisiae (levedo) cresce anaerobiamente. a partir de que tipo de macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as células que dependem deste açúcar? [Consulte o MAPA II. Citar os compostos que devem ser fornecidos à via glicolítica para: a) iniciá-la (haver formação de lactato). Indicar a função da via glicolítica. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? 4. 7] c) Muitos aminoácidos podem ser convertidos a piruvato que. usando as informações do quadro apresentado acima. É possível converter lactato a glicose por um processo chamado gliconeogênese. 10) indicavam que o oxigênio é necessário para a produção de energia pelo organismo. Citar as vitaminas necessárias para as seguintes conversões: a) glicose → lactato b) lactato → glicose 7.

11 .

É possível haver oxidação completa de um ácido graxo sem a presença de carnitina? 5. nasceu o primeiro filho. que compostos deveriam ser adicionados a um tubo de ensaio que contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA? 7. quando todos os carbonos do glicerol estiverem marcados ou em ambos os casos? 3. Quando o primeiro filho completava um ano e meio ano. catalisa uma reação da qual os ácidos graxos não participam.AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS 1. casada. Exames Laboratoriais: Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%) Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL) Soro lipêmico Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL) Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias. Por esse motivo deu entrada em um spa. Não apresenta problemas de saúde e não se queixa de nenhum mal estar. pantotenato. o levedo pode oxidar etanol. Apresenta boa função cardíaca e pulmonar. Altura de 1. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior da mitocôndria se processe com eficiência. Encontra-se com leve edema dos membros inferiores. 35 anos. Por que hemácia e tecido nervoso não oxidam ácidos graxos? 10. O que provoca a degradação dos triacilgliceróis no tecido adiposo? 2.67 m. que casou há cinco anos pesando 60 kg. Como é possível obter ATP a partir de etanol? Caso clínico Identificação: A. Explicar este aparente paradoxo. Além das enzimas. Queixa e Duração: Aumento de peso após as gestações História Pregressa da Moléstia Atual: A paciente relata. distribuída em cinco refeições. Essa enzima. biotina. na admissão a um centro de emagrecimento. 9. O ciclo de Lynen pode ser feito em condições anaeróbias? 6. seu peso chegou a 105 kg. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo de Lynen: riboflavina.. nicotinamida e/ou ácido lipóico? 8. a paciente engravidou novamente.4 kg. Após dois anos de casamento. entretanto. Em aerobiose. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos dos radicais acila do triacilglicerol estiverem marcados com C14. e após esse segundo parto. Citar a localização celular da beta-oxidação. C. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito pouco após o parto. Exame Físico: Peso na admissão 105. 4. 12 . Após passar por avaliação médica e de capacidade física.

Manutenção: Regime alimentar. As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as dos macronutrientes (proteínas. Por que a inibição da piruvato translocase provoca o acúmulo de lactato? 2.8 kg. Ingerindo uma dieta de 600 kcalorias. encontra-se com 71. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas). Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação. 8. como jogos. três vezes na semana. 3. AULA 7: CICLO DE KREBS 13 . as vitaminas envolvidas.7 kg. dança (cerca de uma hora por dia) e atividades na piscina. 6. De que forma isso contribui para o emagrecimento da paciente? 3. tendo sido orientada quanto ao caráter reversível desses sintomas. 1. totalizando uma perda total de 19. verificando a estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina dinucleotídio (FAD) nas suas formas oxidada e reduzida. a paciente tem um déficit energético. Explicar a razão. 7. portanto com perda de cerca de 10% do peso inicial. Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia. 2. sensação de enjôo e gosto amargo na boca. Após oito meses de tratamento.1 kg e prepara-se para submeter-se a uma cirurgia plástica. dando ênfase às caminhadas. Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA? 4. c. No 10o dia da estadia a paciente pesava 94. Que composto o organismo armazenou.7 kg (18. Definir vitaminas. com cerca de uma hora de cada vez). com caminhadas de uma hora por dia e natação com aulas de 50 minutos. a localização celular. b. as 5 coenzimas necessárias. a paciente sentiu-se com sonolência. levando a 45 kg de aumento no peso da paciente? Citar o tecido de armazenamento corpóreo do composto. com uma dieta de aproximadamente 900 kcalorias.7%). feitos de maneira fracionada e diversificada. 5. Por volta do 4o dia de estadia. carboidratos e lipídios). dispensando mais tempo para as caminhadas (duas vezes ao dia. hidroginástica e natação (no mínimo uma hora por dia). relacionando sua função com atividade enzimática. Em que esses exercícios colaboram para a perda de peso? AULA 6: FORMAÇÃO DE ACETIL-COA 1. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar: a.iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de exercícios. A paciente sempre foi orientada a praticar exercícios físicos. Após completar 30 dias de estadia a paciente retornou para casa pesando 85. e manutenção de prática de exercícios físicos. Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de piruvato. Definir cofator.

1. Uma suspensão de mitocôndrias. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a regulação principal do ciclo de Krebs Enzima Isocitrato desidrogenase Efetuadores alostéricos Positivos Negativos ADP – NAD+ ATP . neste caso. Em cada caso.Para responder às questões de 1 a 4 usar apenas os Mapas I (p. Uma suspensão de mitocôndrias foi incubada. Em anaerobiose. Em qual (quais) caso(s) aumentou a concentração de oxaloacetato? 5. Por que? b. a. se a rotenona fosse substituída por cianeto ou por antimicina A? LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA ATIVIDADE DA SUCCINATO DESIDROGENASE -Protocolo Experimental 14 . AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA 1. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos que fazem parte da cadeia de transporte de elétrons? 2. ocorreu consumo de oxigênio. (c) acetil-CoA + oxaloacetato. que porcentual do composto adicionado estará presente no final da reação? 6. 5 ) e II (p. há produção de CO2 marcado se for adicionado azul de metileno. Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que contém.NADH 7. Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo de oxigênio. (d) acetil-CoA + succinato. 7). Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de citrato. Explique estes dados. piruvato. (b) oxaloacetato. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve sofrer redução? 3. glutamato. Que composto é oxidado no ciclo de Krebs? 2. citrato e ácidos graxos. observa-se também a descoloração do corante (azul de metileno reduzido é incolor). nos dois casos. suplementada com acetil-CoA marcada com C14 só produz CO2 marcado em aerobiose. com acetil-CoA. Explicar este resultado. separadamente. Quando incubação semelhante foi feita substituindo o malato por succinato. 4. A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação estequiométrica com a quantidade de NADH oxidado? 3. além das enzimas e coenzimas: (a) acetil-CoA. Que resultado haveria.

Você obterá o precipitado 1 e um sobrenadante 1 . Você utilizará a redução do MTT via succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido. um processo historicamente importante na elucidação das etapas de ciclo de Krebs. tornar a decantar e descartar o sobrenadante.25M gelada. catalisada pela succinato desidrogenase. Seguir o protocolo 1. Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no gelo.000 rpm por 10 minutos.25M (previamente resfriada a 0 graus). Sacrificar um rato em jejum por concussão cerebral. Novamente você obterá o precipitado2 e o sobrenadante 2. não sendo reoxidado pelo O2 do ar. Antes de iniciar a experiência o grupo deve: 1. Seguir o protocolo 2. mergulhá-lo em 20 ml de uma solução de sacarose 0. Para verificar a oxidação do succinato. planejar o controle da experiência. aqueça os tubos a 37°C por 5 minutos e os compare novamente. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE TRANSPORTE DE ELÉTRONS. A redução do azul de metileno pode ser obtida a partir da oxidação do succinato. Se a reação estiver lenta (isto dependerá da sua preparação mitocondrial). Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando as tabelas que se seguem. A. misturar. B. homogeneizar o fígado e centrifugar a 4. Os aceptores e doadores são fornecidos na forma oxidada. Remover o fígado. existe o fator cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS INTERVALOS DE TEMPO. discutir as funções do succinato. sacarose. Esta será a fração celular I. PAR REDOX NADH/NAD+ 15 EO’ -0. Separar o sobrenadante 1 e centrifugá-lo novamente a 10. com exceção do reagente pfenilenodiamina. Decantar e descartar o sobrenadante. 2.a) Fracionamento celular b) Verificação da atividade de succinato desidrogenase O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). NÃO ESQUEÇA a inibição é competitiva. Esta será a fração celular II.25M. INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO Sabendo em que fração celular se encontra a atividade da succinato desidrogenase. picando-o bem com a tesoura. Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores.000 rpm por 30 minutos. as frações devem ser incubadas a 37°C. por 10 minutos. Ressuspender o precipitado 2 obtido em 4ml de sacarose 0. Adicionar outros 20 ml da solução de sacarose. Adicionar novamente 20ml de sacarose 0. observe a inibição competitiva da enzima por malonato. escrever a reação que está sendo analisada.32 . azul de metileno e óleo mineral. 3.

6.3 0.40 0.1 0.22 0.3 0.82 ACEPTORES E DOADORES ARTIFICIAIS Piocianina red/ox 2.3 0.06 0.Succinato/Fumarato FADH2/FAD Azul de metileno red/ox Cit b (Fe 2+)/ Cit b (Fe 3+) Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) Cit c (Fe 2+)/ Cit c (Fe 3+) Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) H2O / ½ O2 -0.diclorofenolindofenol (DCPI) Benzilviológeno Ferricianeto Incolor Incolor Incolor Incolor 16 VOLUME UTILIZADO 0.2 Azul Azul Violeta Amarelo .25 0.1 0.6-diclorofenolindofenol (DCPI) red/ox Benzilviológeno red/ox Ferricianeto Fe(CN)64-/Fe(CN)63p-fenilenodiamino (p-FDA) red/ox EO’ -0.27 COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E OXIDADA REDUZIDO OXIDADO Piocianina 2.20 -0.34 0.36 0.00 0.36 0.

2 ml 25µ l 0. PROTOCOLO 1 TUBO Tampão A Sacarose 0.1 ml 1.0 ml 0.4 ml 0.3 ml 1.p-fenilendiamino (p-FDA) Incolor Violeta 0.3 ml 0.1 ml 1.3 ml 0.2 ml 0.0 ml 0.5 .5M Azul de Metileno Água Destilada Fração Celular Nujol 1 0.1 ml 0.1 (I) 0.2 ml 25µ l 0.5 cm 2 0.2 ml 4 0.1 ml 25µ l 0.4 ml 25µ l 0.3 ml 1.2 ml 0.5 cm PROTOCOLO 2 TUBO Tampão A Malonato Succinato 0.5 cm 4 0.2 ml 3 0.4 ml 0.6 ml 0.1 ml 0.2 ml 2 0.2 ml 7 0.2 ml 0. Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas.2 ml 0.5 ml 0.1 ml 1.3 ml 1.1 ml 1.4 ml 0.2 ml 5 0.5 cm 5 0.1 ml 25µ l 0.5 ml 0.1 ml 0.1 ml 0.7M Succinato 0.2 ml 0.0 ml 0.0 ml 0.2 ml 0.1 ml 1.Seguir o protocolo 3.1 (II) 0.0 ml 0. identificando as drogas A e B.2 ml 0.3 ml 0.2 ml 0.5 cm 3 0.1 (I) 0.5 ml 0.2 ml PROTOCOLO 3 17 .5M MTT Água Destilada Fração Celular 1 0.1 ml 25µ l 0.5 ml 0.3 ml 1.2 ml 6 0.1 (II) 0.3 ml 1.2 ml 25µ l 0.2 ml 0.

8 0.2 1.5 0.5 0.0 0.5 0.9 0.3 0.2 0. responder as questões seguintes: Sempre que há consumo de oxigênio há síntese de ATP? Sempre que há síntese de ATP há consumo de oxigênio? Sempre que há aumento do potencial de membrana há consumo de oxigênio? Sempre que há consumo de oxigênio há aumento do potencial de membrana? Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana? Pode haver síntese de ATP sem aumento do potencial de membrana? Pode haver consumo de oxigênio sem aumento do potencial de membrana? A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto? i. g.0 0. c. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele composto.0 0.2 0.5 0.4 1. f.0 0.4 1. Correto? 5.1 0.2 0.9 0. j. Com auxílio do software. Hemácia e tecido nervoso fazem fosforilação oxidativa? 18 .5 1.5 0.4 1.0 0.5 0.4 1.8 0.5 0.0 0.0 0.3 1. h.0 0. b.0 0. d.7M Succinato 0.4 1.2 0.0 0.5 0.4 1.2 0.0 0. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 3.1 0.4 1.5 0.3 0. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum composto? A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto? 2.TUBO Volume (ml) Tampão A Sacarose 0.2 0.5 0.2 1.1 0.9 0.2 0.2 0.4 1.2 0.1 0. a.1 0.4 1. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de controle fisiológico da velocidade da cadeia de transporte de elétrons? 4.5M Droga A ou B Ferricianeto DCPI p-FDA Água Destilada Fração Celular Nujol (cm) 1 2 3 4 5 6 7 8 9 0.2 0.5 AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA 1. Software Cadeia de Transporte de Elétrons.3 0. e.

Qual o efeito da ativação desta enzima sobre a degradação do glicogênio a glicose 1-fosfato? 5. A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH oxidado? 8. Apontar as que utilizam ATP e as que utilizam HPO42--. Escrever os substratos e os produtos das reações catalisadas por a) proteína quinase b) glicogênio fosforilase quinase c) fosfoproteína fosfatase 3. a) glicogênio fosforilase b) proteína quinase c) glicogênio fosforilase quinase 4. 7. Correto? 2. A fosfodiesterase catalisa a conversão de cAMP a AMP.6. Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e do glicerol-fosfato)? AULA 10: METABOLISMO DE GLICOGÊNIO 1. Hemácia e tecido nervoso fazem fosforilação oxidativa? 13. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem fornecimento de substrato oxidável? 10. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 6. Explicar estes resultados. A adição de dinitrofenol restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a inibição da síntese de ATP. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do glicogênio. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a grande utilização no citossol do ATP produzido na mitocôndria? 12. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas encontradas no glicogênio são do tipo α -1-4 ou α -1-6. 11. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina inibe tanto o consumo de oxigênio quanto a síntese de ATP. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 19 . Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 9. Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de transporte de elétrons em presença de malato e de antimicina A? 7.

8. GLUCAGON) 1. b. 7. síntese de glicoquinase (fígado) Transportadores de glicose para o interior das células: 20 . síntese de glicogênio c. quando cessa o efeito do glucagon? Se a célula contém proteína fosfatase. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. 6. indicando o hormônio que atua em cada caso. como é possível manter proteínas fosforiladas? 10. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a última refeição. rim. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. c. Verificar os diferentes transportadores de glicose e sua dependência de insulina. 2. No jejum. 5. Verificar também se são independentes de insulina para a captação de glicose: cérebro. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. Como a insulina leva a ativação da proteína quinase B? 12. hemácia. Descrever as ações de glucagon. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a) permeabilidade da célula à glicose b) síntese de glicogênio c) síntese de glicoquinase (fígado) 9. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no músculo. Mostrar a relação entre AMP cíclico e a síntese de glicogênio. síntese de glicoquinase (fígado). Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 8. 3. fígado e ilhotas de Langerhans. 12. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. 13. 10. síntese de glicogênio. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 11. permeabilidade da célula à glicose. 11. 4. permeabilidade da célula à glicose b. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. ocorre degradação de proteínas de músculo. adrenalina e insulina no metabolismo de triacilgliceróis. AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA. Como são desfosforiladas as enzimas. O glucagon estimula a gliconeogênese? Como? 9. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de jejum noturno e após uma refeição rica em carboidratos. libera glucagon. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação.

Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato? 10. testículo Adipócito. AULA 13 SÍNTESE DE TRIACILGLICEROL 1. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A. células β do pâncreas Neurônio. seria possível encontrar ácidos graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir de acetil-CoA marcada com C14.Transportador GLUT1 GLUT2 GLUT3 GLUT4 Distribuição Hemácias. O tecido muscular não sintetiza glicerol 3-fosfato. Verificar também se são independentes de insulina para a captação de glicose: cérebro. Há conseqüências derivadas da produção excessiva de corpos cetônicos? 12. rim 13. quais carbonos apareceriam marcados? 6. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato é elevada? 4. rim. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. O que impede a síntese e degradação simultânea de ácidos graxos? 11. Propriedades Baixo KM Alto KM Baixo KM Baixo KM Dependente de insulina Transporte ativo Co-transporte com Na+ GLUT5 Intestino. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos? 8.coração. Se fosse fornecida a uma célula glicose marcada com H3. fígado e ilhotas de Langerhans. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de triacilgliceróis? AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA 21 . Verificar os diferentes transportadores de glicose e sua dependência de insulina. 5.músculo esquelético. libera glucagon. outras células Fígado. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6fosfato desidrogenase? 3. hemácia. placenta. Que decorrência isto tem? 9. rim. 14. 13. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. placenta. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades apreciáveis de acetil-CoA no citossol? 2. Analisar a regulação desta via. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para gerar os equivalentes redutores necessários à síntese de palmitato? 7.

com uma dieta desprovida de proteínas. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 6. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio? QUESTÕES PARA DISCUSSÃO 1. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido? 15. Esquematizar a reação catalisada pela glutamato desidrogenase. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos.GTP). Um adulto normal. Um adulto normal. Citar a coenzima que participa das reações e a vitamina presente na sua estrutura. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 13 . Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato sintetase. Por que? 2. Um adulto normal. tem necessidade de ingestão proteica. 5. 22 . com uma dieta rica em carboidratos e lipídios. Por que? 3. Definir balanço de nitrogênio. Citar as condições que levam a um balanço positivo ou negativo de nitrogênio.1. Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase (glutâmico-oxaloacético transaminase . Um adulto normal. 9. com uma dieta desprovida de proteínas. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. b) calcular o balanço de ATP c) qual o aminoácido proteico sintetizado? 14. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Por quê? 2. Por quê? AULAS 16 : FONTE DE NUTRIÇÃO 1. elimina uréia. No ciclo da uréia (da ornitina): a) indicar a procedência dos átomos de nitrogênio da molécula de uréia.GOT) e alanina aminotransferase (glutâmicopirúvico transaminase . 4. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina hidroxilase? 8. 12. 2. com uma dieta rica em carboidratos e lipídios. 11. elimina uréia. 3. tem necessidade de ingestão protéica. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Exemplos destes compostos e seus precursores: Glicina purina porfirina glutationa Lisina carnitina Aspartato purina pirimidina Histidina histamina Tirosina adrenalina tiroxina melanina Triptofano nicotinamida 7. 10.

d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos poliinsaturados. Caracterizar as síndromes de desnutrição mais comuns.4. tendo em vista que: a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g. os processos que levam ao acúmulo de lipídios a partir de uma dieta rica em carboidratos. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas). Incapacidade de fazer a oxidação completa de glicose e lipídios. b. lipídios e proteínas no fígado. e insulina no metabolismo de carboidratos. 7. 9 kcal/g). Incapacidade de sintetizar diidroxiacetona a partir de lactato. A concentração citossólica de citrato é maior em B do que em A. adrenalina. e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de proteínas de origem vegetal. 8. b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2.800 kcal por dia. Incapacidade de fazer gliconeogênese a partir de lactato. 6. fosfoglicomutase 3. A concentração plasmática de HCO3. Segue-se uma lista de defeitos metabólicos hereditários hipotéticos: A. Escolher. 23 . a. 5. Descrever. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de proteínas.100 kcal por dia. c) o metabolismo basal de um adulto consome cerca de 1. mas contendo proteínas de baixo valor biológico. entre as enzimas alistadas a seguir.é maior em B do que em C. músculo e adiposo. Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em desenvolvimento. B. fosfofrutoquinase 1. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos. 5. Incapacidade de utilizar glicose para obtenção de energia. C. c. hidroxiacil-CoA desidrogenase. De a até j. glicose 6-fosfatase f. isocitrato desidrogenase d. 6. Os valores de ordenadas são diferentes para cada curva. aquela cuja perda de atividade seria responsável por cada um daqueles defeitos: a. AULAS 17 : REGULAÇÃO INTEGRADA 1. 2. b. Descrever as conseqüências metabólicas de uma dieta com valor calórico normal. fosfoenolpiruvato carboxiquinase e. lipídios e proteínas de uma dieta normal e de uma dieta para emagrecimento. 4. 9. f) nove aminoácidos são essenciais para o organismo humano. Planejar a distribuição entre carboidratos. e a de lipídios. O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à ingestão de uma refeição (tempo zero). Fazer um resumo dos efeitos do glucagon. D. com base em regulações hormonal e alostérica. verificar se a sentença é falsa ou verdadeira.

durante várias semanas.6-bisfosfato. aminoácidos e corpos cetônicos plasmáticos é originária do fígado. d. Escolha uma das hipóteses e descreva como estão. A curva I pode representar a concentração de glicogênio hepático e a curva III. A curva II pode representar a atividade da via das pentoses. A carnitina acil transferase de hepatócitos é mais ativa em A. a concentração de frutose 2. A B C II III I 0 5 10 15 20 25 Horas 12. Para cada hipótese feita. Segundo as hipóteses formuladas. Em B a lipogênese é mais intensa que a lipólise no tecido adiposo. a síntese de glicogênio. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais. g. Faça duas hipóteses explicativas deste quadro. Em B ocorre oxidação de aminoácidos essenciais no fígado. faixa etária e atividade física. d. o indivíduo apresentou perda lenta e contínua de peso. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do que em B. a. lipídios e proteínas adequadas para seu peso. o ciclo de Krebs. sexo.c. o caso poderia ser normalizado aumentando a ingestão de carboidratos e diminuindo a de lipídios? AULAS 18 : DIABETES DIABETES MELITTUS 24 . analise o balanço de nitrogênio e a produção de corpos cetônicos. a gliconeogênese. a utilização de corpos cetônicos pelo cérebro. b. Em C. no fígado deste indivíduo. a maior parte da glicose. e. Um indivíduo adulto recebeu. Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase dependente de cAMP. a concentração de acetil-CoA e a síntese de ácidos graxos. c. uma dieta com quantidades de carboidratos. h.

nervos e vasos sanguíneos. ou DM não dependente de insulina (DMNDI). músculo e tecido adiposo e outras células. usualmente devido à deficiência ou resistência à insulina. inibindo a mobilização de ácidos graxos. cujos aminoácidos são usados na gliconeogênese. água intracelular é perdida para o interstício resultando em desidratação celular. dependendo do tecido. • Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase. o rim não consegue reabsorvê-la e ocorre glicosúria. Ela tem início entre a infância e 35 anos e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de DMID adquirirá a doença). É uma doença que pode ser definida como um estado de tolerância diminuída à glicose. 2) A tipo II.Por ação indireta: • Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase dependente de AMPc. Diabetis melittus insulino dependente (DMID) ou Tipo I. vamos lembrar os efeitos da insulina: . qualquer incremento é acompanhado por perda de água. Ocorre cetoacidose. caso não seja tratado. bem como da perda de água. Há dois tipos mais comuns de diabetes melittus (DM): 1) A tipo I. com conseqüente aumento da pressão osmótica. Antes de verificar as diferenças e semelhanças nas manifestações dessas duas diabetes. 25 . • Diminui a atividade da triacilglicerol lipase no tecido adiposo. por ação direta: • Aumenta o transporte de glicose para o fígado. devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza. Devido a isso. principalmente potássio. A DMID é causada pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de hiperglicemia sustentada. A falta de insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do músculo e adipócito. pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular. . A perda de peso é decorrente de perda de tecido muscular e adiposo. Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II. O desarranjo de todas essas reações é encontrado no diabético.Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e pode comprometer o funcionamento de rins. diluição dos eletrólitos extracelulares e maior concentração dos intracelulares.Esse hormônio. Assim. Um indivíduo normal mantém os níveis plasmáticos normais de glicose convertendo-a em glicogênio. Como tudo que tem que ser excretado na urina deve estar solubilizado. ele perde peso. • Diminui a quantidade de glucagon circulante por diminuição da expressão gênica. olhos. 10 a 20% dos casos de diabetes são do tipo I. oxidando-a para gerar energia ou usando-a para síntese de outros compostos. Evidências implicam a infecção viral e resposta auto-imune como maiores fatores contribuintes. • Aumenta a síntese de proteína. embora não só a genética possa explicá-la. Quando os níveis de glicose sobem. lipídeo e glicogênio em proporções variadas. pela perda de eletrólitos. também chamada de DM insulina dependente (DMID). • Aumenta o transporte de aminoácidos para os músculos e outros tecidos. ele desperdiça glicose eliminando-a na urina.

No período inicial da doença observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL. Diabetes tipo II é mais certamente diagnosticada por uma demonstração da tolerância diminuída à glicose. Os pacientes apresentam normalmente níveis normais ou elevados de insulina. com alto fator genético (100% dos irmãos gêmeos idênticos de um diabético tipo II desenvolverão a doença).Tipo I é. silencioso Em geral obesidade 80 a 90% dos casos . Atualmente. Tratamento Depende do tipo de diabetes. considera-se que não existem apenas duas situações extremas: cetoacidose diabética ou hiperglicemia não cetônica. na verdade. ou tornar-se-á. pacientes com DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de cetose. sugerindo que não há a utilização correta do hormônio pelo organismo. ocorrendo. O indivíduo ingere uma solução contendo 75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal. como sepsis.DMNDI Em geral após 35 anos Lento. poliúria (aumento na quantidade de urina) e polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia. Nos diabéticos tipo II. Agentes hipoglicemiantes orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou não. Alguns pacientes podem necessitar de injeções de insulina. Nesses pacientes dieta e exercícios físicos são um bom meio de alcançar o controle da glicemia. Diagnóstico Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as observações clínicas como perda de peso. A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de diabetes. DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com obesidade e que tenham parentes diabéticos. atingindo 200mg/dL após 2h de ingestão da solução de glicose. Deve haver reposição adequada de Na+ e água. Na tipo II. provavelmente por defeito nos receptores de insulina nas células. baseado numa relativa mas não absoluta deficiência de glicose. toda uma gama de variação das intensidades dos dois sintomas. a cetose pode aparecer em certas condições de estresse metabólico.Presente em 80 a 90 % dos diabéticos. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de cetose. Tipo I –DMID Idade de início Início Estado nutricional no início Prevalência Em geral infância ou puberdade Em geral repentino Em geral desnutrido 10 a 20% dos casos 26 Tipo II . Não há relação necessária entre diabetes tipo I e obesidade. Assim. dependente de insulina por toda a vida. perda de peso já pode influenciar na capacidade do corpo de controlar o nível de glicose. cetoacidose e glicosúria.

que leva a perda de água e eletrólitos. nefropatia. perda de Nenhum ou os mesmos do peso. enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 % dos portadores de DMID e em menos de 20% daqueles com DMNDI.e neuropatia. nefro. a conseqüência mais provável é o coma. causando desidratação celular.Predisposição genética Defeito ou deficiência Outros fatores Insulina plasmática Sintomas iniciais Cetose Efeitos a longo prazo Complicações agudas Moderada Muito forte Cel. Complicações similares a surgimento após 5 anos tipo I. Tanto a hiperglicemia como a hipernatremia afetam muito o cérebro. Essas proteínas ficam com conformação alterada e são mais resistentes ao ataque proteolítico. que ocorre principalmente no ε amino da Lys. Aumentando a osmolaridade plasmática. mais tardias Cetoacidose Coma hiperosmolar Responde Em geral não necessário Resposta a hipoglicemiantes Não responde orais Administrar insulina Sempre necessário Coma diabético A glicose sanguínea em concentrações maiores que o limite de reabsorção renal provoca uma rápida diurese osmótica. Vírus e toxinas Baixa a ausente Obesidade Normal a elevada Poliúria. com alta incidência de gangrena e amputação. A retinopatia é quase universal entre os diabéticos. Diabéticos podem desenvolver retinopatia (principal causa de cegueira). Complicações decorrentes do diabetes A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. a água move-se para fora das células cerebrais. cetoacidose comum tipo I mais suaves Comum Rara Retino-. polidipsia. Quando essa doença se desenvolve o paciente necessita de hemodiálise e transplante renal. β produzem menos de insulina ou igual insulina. A neuropatia de nervos periféricos é comum em diabéticos. Quando a osmolaridade alcança 340 a 350 mosmol/kg. 27 . β destruídas. tornando os pacientes propensos a lesões nas pernas e pés. A glicosilação de lipoproteínas plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença periférica vascular. sem produção Cel. fome. A dosagem de Hb glicosilada plasmática é um teste mais sensível que a medida de glicemia. Uma explicação para isso é haver glicosilação de proteínas. principalmente a neuropatia simétrica. neuropatia e doenças cardiovasculares. que causa a perda de sensibilidade nas extremidades inferiores. Faça hipóteses para explicar esse fato. Há tendência a hipovolemia e deslocamentos de água intracelular para o espaço extracelular.

precisando levantar várias vezes da cama. Tudo seguido de uma intensa fraqueza e leve falta de ar. Respiração tendendo a ofegante. de hora em hora. ritmo cardíaco regular. pulsos finos. no terceiro dia de estadia. a boca seca e. Dados de gasometria revelam acidose. hálito cetônico. levemente taquicárdico. a fim de ser medicado antes do agravamento do quadro. 1. branca. segundo seus familiares. aliadas à fraqueza. bancário. pressão arterial = 100 x 60 torr. Exame Físico: Regular estado geral. mas que não é incomum a transgressão da dieta. Passadas quatro horas. mas a cetonúria ainda se mantinha em + / +++. Faz uso de insulina.CASO 1 Identificação: J. Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL) Cetonúria = +++ / ++++ Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. Como já passou por situações semelhantes. Relata que no entardecer do dia esteve em uma lanchonete com amigos. Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina. comeu pizza e tomou sorvete. Queixa e Duração: Sensação de fraqueza há doze horas. onde ingeriu quatro ou cinco chopes. a paciente passou a sentir também fortes dores de cabeça. bastaria uma refeição calórica que. para resolver seus sintomas. Após três horas de cuidados a glicemia já havia baixado para 185 mg/dL. Na seqüência sentiu um hálito amargo. quando falava as pessoas sentiam cheiro de acetona. Refere que procura seguir as recomendações dietéticas. começou a urinar intensamente. notou gosto ruim na boca e o apetite diminuiu. hálito cetônico bastante evidente. ritmos cardíaco e respiratório normal. feminina. porém. executiva do ramo de cosméticos.P. Indicou-se que aguardasse por mais alguns dias até que os sintomas regredissem.M. masculino. Exame Fïsico: Bom estado geral. branco. duas vezes ao dia. há oito horas. 35 anos. Hoje. Relata que no primeiro dia nada sentiu. Qual o sinal clínico comum aos dois casos relatados? 28 . a partir do segundo dia. Dor de cabeça intermitente. há uma hora. por via muscular. Está submetida a uma dieta de 300 kcalorias/dia. o gosto ruim na boca é muito intenso e acompanhado de um hálito próximo ao cheiro de acetona. administrada por via subcutânea. palidez cutâneo-mucosa. porém. História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de idade. Queixa e Duração:Aumento do volume urinário há 4 horas.B. principalmente nos acontecimentos sociais. Gosto amargo na boca e sensação de fraqueza.L. Hálito amargo há um dia.. de descompensação diabética. procurou o serviço médico. Procurou o ambulatório médico para esclarecimentos. História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de emagrecimento em um spa há três dias. Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL) Cetonúria = +++/++++ (O normal é negativo). não é lhe indicada já que está sob regime de emagrecimento. 25 anos. CASO 2 Identificação: J. Foi-lhe dito que. Sinais clínicos de desidratação.

o paciente do Caso 1 fica impossibilitado de usar a glicose sangüínea em células como as do músculo. adrenalina e insulina no metabolismo de triacilgliceróis AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO 1. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1 e 2? 7. Descrever as ações de glucagon. Pela deficiência de insulina. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de um mRNA específico sem mudar o gene codificante da proteína os elementos controladores do gene. 16. indicando o hormônio que atua em cada caso. Após alguns dias no spa. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. 14. Nos dois casos apresentados. Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos casos 1 e 2? 9. 17. Tabela de códons 29 . nesse caso? 5. a tendência dos pacientes é de perda. hemácias. desde que hidratado) como nos casos de greve de fome. Indicar as condições metabólicas que levam a uma aumento na produção de corpos cetônicos 18. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de frutose 2. pois a entrada de glicose nessas células é estimulada pela insulina.6 bisfosfato. manutenção ou ganho de peso? 10. Por que o valor da glicemia difere tanto entre os casos 1 e 2? 3. músculo e fígado neste jejum extremo. Descrever as alterações do metabolismo de carboidratos. Qual é a relação entre a glicemia e a presença plasmática de acetona? 4. Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a quatro semanas. que tipo de reserva a paciente do caso 2 deve estar utilizando para a obtenção de ATP? 6.2. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65 mg/dL? Que via metabólica é utilizada para a síntese de glicose? 8. Qual a principal fonte de ATP para a contração muscular. Citar a fonte de energia utilizada pelo cérebro. 15. lipídios e proteínas provocadas por jejum prolongado e por diabetes.

(A) Em t=1 minuto. A2. A3. O peptídeo A1. reduz ou não é 30 . 2. A4 e A5. Finalmente. Células de E. Quais mecanismos são usados para garantir a fidelidade de cada um destes processos. 7. Além disso. você adiciona todos os 20 amino-ácidos. você sabe que seu sistema precisa de 4 minutos para produzir uma molécula de proteína A completa. Indique em cada uma das situações abaixo se a expressão do operon lac aumenta. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que decodificam o código genético. Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes condições: a) O trp mRNA é estável (degrada lentamente após algumas horas) b) O trp mRNA é degradado rapidamente. 3. você isola a proteína A intacta do sistema. Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma proteína chamada A. corta-a com tripsina e isola os cinco peptídeos. Tryptofano é adicionado.2. porém a enzima triptofano sintase é estável. Aponte três mutações que não modificam a sequência da proteína. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de proteínas. c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente que o normal. porém não glicose. As células continuam a crescer e dividem a cada 30 minutos. Em t=0. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações em: a) o gene lacI que inativa o repressor b) o promotor é eliminado na região próxima a posição -10 3. 5. Quais são as funções do mRNA. qual será a ordem de marcação dos peptídeos do mais para o menos marcado? (C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas? 6. coli são crescidas no meio com glicose como única fonte de carbono. Células de E. 4. você sabe que a proteína A tem quatro pontos sensíveis à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1. Explique. tRNA e rRNA? Aula 20: Regulação da Expressão Gênica 1. coli são crescidas no meio contendo lactose.terminal e A5 é o carbpxi-terminal. Qual peptídeo é mais intensamente marcado? (B) Em t=3 minutos. Um transcrito para um gene contem a seqüência de bases abaixo: 5´ AACUGCACGAGGUAACACAAGAUGGCU 3´ Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes fases. cada um levando uma marcação com 14C . é o amino.

a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a seqüência 2. Como a transcrição do gene operon trp da E. d) Uma mutação que inativa completamente a permease galactosidase e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região do promotor lac. Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um fungo exótico. Sugira uma explicação para esta observação. e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador. 4. c) Uma mutação que inativa completamente a β -galactosidase. destacando os termos que você não compreenda ou de que nunca tenha ouvido falar. os pontos favoráveis e desfavoráveis ao emprego da tecnologia para produção de alimentos transgênicos.alterada. b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3. Para complementar seus estudos. a) Adição de alta concentração de glicose b) Uma mutação que impede a dissociação do repressor lac na região reguladora. Esses termos deverão ser esclarecidos com o auxílio dos professores. Desenhe um modelo descrevendo o que acontece em cada uma destas situações. acesse os sites recomendados ao final dos textos. A atividade desta RNA polimerase é reduzida quando a enzima é purificada. Transgênicos – 7° Teste Questões para Estudo Leia os textos que se seguem a respeito de alimentos transgênicos. 5. 31 . Esta RNA polimerase inicia somente a transcrição a partir de uma única região promotora altamente especializada. monitores e colegas de grupo. Façam uma lista contendo. Aula 22: Técnicas de Biologia Molecular. na sua opinião. c) Removendo a seqüência 4 d) Trocando os dois códons trp no peptídeo iniciador para códons de His. coli pode ser afetada pelas seguintes manipulações da região promotora do mRNA trp.

Definição de transgênicos: Os Transgênicos são organismos que adquiriram características de outro organismo. abrindo novas perspectivas econômicas nos campos da saúde humana. clonagem de mamíferos. Procedimentos para a obtenção de vegetais transgênicos: Para obter plantas transgênicas são necessários: . cuja característica adquirida passa a ser transmitida para as futuras gerações. produção de proteínas humanas em microorganismos.uma técnica para gerar uma planta inteira a partir de uma só célula transformada.o gene de interesse. pois. O gene artificial ou intencionalmente inserido no genoma de um organismo é denominado transgene. aumentando a produtividade de animais e contribuindo para uma maior longevidade humana. aceleraram as descobertas científicas e suas aplicações biotecnológicas. Para a introdução do gene em outro organismo são utilizados vetores de clonagem (plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida. sanidade animal e produção de alimentos. a mais utilizada era a do Melhoramento Clássico. pelo uso de técnicas modernas de Engenharia Genética. O termo geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia do DNA recombinante para a alteração genética de animais. O sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil cultivo e permitir a purificação e recuperação do produto do gene. O crescimento acelerado do campo da biotecnologia. Ao invés de promover o cruzamento entre organismos relacionados para obter uma característica desejada. plantas e microorganismos. Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a transferência do material genético de um organismo para outro. misturando todo o conjunto de genes dos dois organismos em combinações aleatórias. a partir de 1900 as Leis de Mendel foram redescobertas e começaram a ser aplicadas. cientistas podem identificar e inserir no genoma de um determinado organismo um único gene responsável pela característica em particular. A técnica exigia uma enorme demanda de tempo e não era precisa. Histórico: A Genética é uma ciência característica do século XX. entretanto. A clonagem molecular consiste no isolamento do gene de interesse. . Surgiram técnicas biotecnológicas como a produção e pesquisa de plantas e animais transgênicos. produzindo maiores safras de alimentos de origem vegetal. mapeamento do genoma humano. ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou Tecnologia do DNA Recombinante). a genética mendeliana contribuiu significativamente para a sustentação do crescimento populacional de nosso planeta. plantas e animais.uma técnica para transformar células vegetais através da introdução do gene de interesse. amplificação do número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. Nos primeiros ¾ deste século. Antes do desenvolvimento desta técnica. 32 . resultando em um organismo geneticamente modificado (OGM). na qual a transferência de genes se dava por meio de cruzamentos (reprodução sexuada). técnicas de detecções e diagnósticos por PCR e Terapia Gênica. . A decifração do código genético e a manipulação do DNA neste último quarto de século.

Este gene poderia ser usado para aumentar o valor nutricional de culturas importantes como feijão e soja. além dos genes naturais. levando ao seu controle na cultura. entre eles temos:  Gene que codifica proteína capaz de modificar herbicidas. o de plantas. mas que podem se replicar em bactérias. Os genes são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta característica que permite que genes de um organismo sejam potencialmente funcionais em outro. Os insetos que se alimentassem de plantas expressando este gene morreriam ou se desenvolveriam com menor eficiência.000. um gene adicional proveniente de outro organismo. Deste modo. facilitando assim o controle das ervas. entre 40.  Genes bacterianos que codificam proteínas com propriedades tóxicas para insetos. tem-se uma planta transgênica. então. enquanto o genoma humano consiste de aproximadamente 30. onde este material é inserido e replicado por várias vezes. Estes fragmentos são. porque ela contém. culturas contendo este gene poderiam tornar-se resistentes ao herbicida. seleciona-se a colônia de bactérias que contém o fragmento de DNA correspondente ao gene de interesse.000 genes. o DNA do organismo contendo o gene de interesse é extraído. algumas culturas não sobrevivem à aplicação deste produto. 33 . que pode ser uma planta.000 genes.Após esta última etapa. entretanto. Depois. Os herbicidas são muito usados no controle de ervas daninhas. ligados a outros fragmentos de DNA. presente na castanha-do-pará.000 e 60. uma bactéria ou até um animal. Genes de Interesse: O genoma de uma bactéria contém em média 5. Uma das possibilidades para isolamento de um gene é a construção de uma “biblioteca genômica” e. Diversos genes de interesse agronômico já foram isolados. Em seguida o DNA é cortado em fragmentos menores utilizando as enzimas de restrição. para isso.  Gene que codifica uma proteína de alto valor nutricional. inativando-os.

os objetivos finais são mudanças operadas no nível celular. 34 . a não ser que possam ser transferidas para todas as células do organismo. inserindo-se aleatoriamente nas organelas celulares. Para a transformação. Regeneração das plantas a partir das células transformadas: Uma vez inserido o gene na célula vegetal. A transformação de uma célula vegetal é um tipo de manipulação genética que atende ao mesmo princípio da transformação de microrganismos. Os transposons são assim denominados (ou também chamados elementos de transposição) justamente porque são elementos genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se. o que permite a penetração e eventual integração dos genes no genoma. desprovidas de parede celular. é esperado um rápido desenvolvimento na biotecnologia animal e vegetal. Em seguida. um choque elétrico de alta voltagem é aplicado por curtíssimo tempo. como cada espécie de planta tem diferentes exigências hormonais. há diferenças conceituais entre a situação com microrganismos e com plantas: nos primeiros. são incubados em soluções que contêm os genes a serem transferidos e. esta célula ou grupos delas são estimuladas a gerar uma planta transformada. as mudanças obtidas no nível celular não são significativas. E. em São Francisco. B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio cobertos com os genes de interesse. o DNA é dissociado das micropartículas pela ação do líquido celular. nutricionais e ambientais para a regeneração. Parte do plasmídeo é um transposon (T DNA) que produz cópias de si mesmo nos cromossomos da planta infectada. embora esta técnica já esteja estabelecida para inúmeras plantas de interesse econômico. introduziram o gene proveniente de uma rã em uma bactéria. esta etapa ainda representa o maior gargalo na criação de plantas transgênicas. em seguida. Ou seja. ocorrendo o processo de integração do gene exógeno no genoma do organismo a ser modificado. C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA extracromossomal que pode se replicar independentemente do cromossomo. A transferência é alcançada por um dos métodos seguintes: A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais. Papel dos transgênicos na economia mundial: O século passado teve um grande desenvolvimento na biotecnologia microbiana.Transferência dos genes de interesse em plantas: A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado . No entanto. O choque causa uma alteração da membrana celular. Os microprojéteis são acelerados com pólvora ou gás em direção aos alvos (as células vegetais). quando Stanley e Cohen. como plantas e animais. A produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá resultar em um produto mais economicamente viável que o enriquecimento do trigo com a lisina obtida de microorganismos. Os genes entram nas células junto com o projétil de maneira não-letal. o domínio das técnicas de regeneração de plantas inteiras a partir de uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. Neste século.especialmente para o caso de monocotiledôneas) ou através de agrobactérias. enquanto que em eucariotos superiores. estabelecido pela primeira vez em 1973. O plasmídeo encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a transformação de plantas.

1999. algumas tendo se tornado sucessos comerciais. podem promover saúde trazendo benefícios para consumidores. especialmente para a produção de metabólitos secundários.U.U. De acordo com uma pesquisa sobre a expectativa de comercialização de produtos obtidos de organismos geneticamente modificados nos E.A aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade apareceu no mercado europeu. enquanto reduzimos os impactos ambientais. principalmente com características preferidas pelo mercado.U. No entanto. em princípio. estáveis quando armazenados e. a agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em volume. onde as lavouras transgênicas são permitidas oficialmente. devem ser feitos para investigar os efeitos potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas. Esses esforços devem ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da agricultura. os E. Benefícios promovidos pelos transgênicos na agricultura: A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de plantas para alimentação. organizados. Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30 milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. No Brasil. É essencial melhorar a produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial crescente. é necessário utilizar de forma adequada e responsável as novas tecnologias e descobertas científicas. Os desenvolvimentos resultantes em variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado no aumento de vida em prateleiras de frutas e vegetais. que estejam atualmente em uso. biofertilizantes e biopesticidas. incluindo tolerância a herbicidas. as características que visam aumentar a qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e deverão prevalecer nas próximas gerações de produtos transgênicos. os consumidores dificilmente notaram qualquer benefício além de. Esforços em conjunto. um decréscimo no preço devido a custos reduzidos e aumento da facilidade de produção (University of Illinois. A seguir são apresentados alguns exemplos do uso da tecnologia da modificação genética de vegetais aplicada a alguns problemas específicos da agricultura: 35 . podendo-se chegar na casa dos milhares em algumas décadas.A modificação genética de microrganismos continua sendo uma importante complementação para as modificações genéticas de plantas e animais. O ritmo atual de liberação de OGMs indica que na primeira década deste século já teremos uma centena de produtos geneticamente modificados nas prateleiras dos supermercados.A. dando resistência contra pragas de insetos ou viroses. Vegetais geneticamente modificados: A maioria dos produtos já liberados para a comercialização contém transgenes que codificam características que visam minimizar estresses ambientais. Alimentos produzidos através de tecnologias de modificação genética podem ser mais nutritivos. seja em nações industrializadas ou em desenvolvimento. Na década de 90. muitos alimentos transgênicos importados já são comercializados e estima-se a importação de 3 milhões de toneladas de milho da Argentina e dos E. resistência a insetos e vírus. Falck-Zepeda et al 1999). Enquanto essas características têm trazido benefícios aos agricultores.. bioprocessamento. em casos limitados. e produzindo tolerância a determinados herbicidas.A. Para isso. biorremediação e tratamento de águas.

36 . 1998). por exemplo. Porém. graças à injeção de um único gene capaz de absorver um excedente de sal em plantações de tomate. 1999). os pesquisadores utilizaram uma técnica de imunização genética. Como exemplo. deve-se considerar o fato de que populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta transgênica. Como exemplo. Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e cultivado. de forma a combater a anemia. As plantas transgênicas contêm entre 2 e 4 vezes mais ferro do que normalmente encontrado no arroz convencional. com conseqüente diminuição ou eliminação da necessidade do uso de pesticidas. o trigo semi-anão que possui genes insensíveis à giberelina. A introdução desses genes faz com que se obtenha uma planta mais baixa. Segundo a revista Nature Biotechnology. temos um gene de tolerância em manguezais (Avicennia marina) que foi clonado e transferido para outras plantas que se mostraram mais tolerantes a altas concentrações de sal. Estes genes (NORIN 10) agem da mesma forma quando utilizados para transformar outras espécies de plantas importantes como alimento. mais forte e que aumenta o rendimento da safra diretamente. O gene introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio excedente. temos o vírus Mottle Amarelo do arroz (RYMV). Um exemplo de combate ao stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em solos ácidos (de La Fuente et al 1997). Ele foi produzido usando-se genes envolvidos na produção de proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na dieta humana (Goto et al. através da criação de plantas de arroz transgênico resistentes ao RYMV. que devasta os arrozais africanos. e o desenvolvimento da sua parte reprodutiva (comestível) é aumentado. É resultado do uso de modificação genética em vegetais visando obter maior resistência a uma praga específica.Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada no Hawai desde 1996 (Gonsalves. Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto rendimento como. Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições. tomates perfeitamente comestíveis. como acontece com o uso de inseticidas. Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro. cientistas conseguiram fazer crescer e desenvolver em água contendo forte teor de sódio. uma vez que o alongamento das células na parte vegetativa é reduzido. Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual.

Sinauer AssociaTES. B.G.br/cienciahoje/ch/ch146.: www. R.arroz normal arroz transgênico Pesquisadores desenvolveram arroz com alto teor de beta-caroteno.Posicionamento do Conselho Nacional de Nutricionistas: www.B.htm ..br/start.C. Porto Alegre. • Purves. envolvendo tópicos como impacto ambiental. W. que ajuda a combater diversas doenças. (1989) The Biology of Plants.Artigo da revista Ciência Hoje com link para arquivo pdf. & Goldberg.uol.ctnbio.br/variavel/destaque/pgdestaque2. 1ed. & Heller.htm . Ed.Freeman and Company.K. o grupo contra deverá utilizar argumentos que condenem os transgênicos. Sadava. Mercado Aberto. portanto. Referências • Lewin. aumento da produtividade. redução do custo ou aumento do preço dos alimentos.H.gov. redigida nas “questões para estudo” para auxiliar o debate. Inc & W. Cerca de 300 g desse arroz cozido por dia suprem as necessidades de betacaroteno de um indivíduo. (1994) Genes.php?id=port Questões para Discussão Cada sala deve ser organizada em dois grandes grupos – pró e contra.) (1996) Biologia Molecular Básica. Polêmica sobre os Alimentos Transgênicos . Orians.cfn. H. O resultado desse experimento foi a produção de grãos amarelados de arroz.Posicionamento da SBBq: http://www. Em ambos os casos os argumentos devem ser os mais variados possíveis. ressecamento da córnea.com. • Okamuro.Conselho Nacional de Biossegurança: www. Será iniciado um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o consumo de alimentos transgênicos.htm . ser limitado a aspectos nutricionais. Academic Press Inc. devido à presença de beta-caroteno. (2001) Life – the science of Biology. Foram inseridos genes de bactérias que fazem a conversão do precursor presente no arroz em beta-caroteno. diarréias e sarampo. • Zaha. Em cada sala haverá um professor para mediar o debate e esclarecer as regras da atividade.org. Oxford University Press. agroeconomia. benefício para a saúde etc..sbbq. Utilize sua lista. 37 . New Yourk. A. (Coord. J. O debate não deve. 6th.K. precursor da vitamina A. como a cegueira noturna.org.D.H.br/ctnbio/bio/artigos/004.

EDTA 10mM. Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente. Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta. Centrifugar a 12000xg por 5 min á temperatura ambiente.Solução de lise – SDS 1% em NaOH 0. Um dos métodos mais utilizados consiste na lise das bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio). 12. 3. 2. 14. Incubar por 5 min à 65 °C. separando-o do DNA cromossomal bacteriano. Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência anterior. Ribonuclease A 150µ g/ml em TrisHCl 25mM pH 8.Solução Neutralizadora – Acetato de potássio 3M pH 4. Aplicar a amostra em gel 0. 5. 4. O DNA plasmidial purificado é em seguida concentrado por precipitação com etanol. 15. Incubar o tubo em gelo por 20 min. Tomar 1 ml da cultura e colocar em um tubo de eppendorf. Centrifugar a 12000xg por 15 min á temperatura ambiente. Centrifugar a 12000xg por 10 min á temperatura ambiente . Soluções utilizadas: . Incubar a mistura por 5 min á temperatura ambiente. Centrifugar a 12000xg por 5 min á temperatura ambiente. 11. . Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T.0. 7. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no Vórtex. Utilizaremos cultura de E. 17. Neste procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo removidos por centrifugação.8.7% de Agarose em TBE. extrair e purificar o DNA plasmidial. 6. Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%.GET / Rnase – dextrose 50mM.Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose . 16. Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min.coli em meio LB-A (50µ g/ml ampicilina).Preparação do DNA plasmidialFundamento: Existem vários procedimentos para purificação em pequena escala de DNA plasmidial de células bacterianas.5 µ l/ml de Brometo de etídio e submeter a eletroforese a 100V em Tampão TBE. contendo 0. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro eppendorf contendo 300µ l de Isopropanol. 38 . 1. 13. Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra na proporção 1:10. 9. 18. 10.E .2 N . 8. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e delicadamente.

Como age o isopropanol ? Este álcool poderia ser substituído por etanol. Por que se dissolve a preparação de DNA em tampão Tris-EDTA ? 7. ou seja. Na aula prática usaremos o método do CaCl2. Transformação de bactérias que são sensíveis a um antibiótico. Contendo 50 mg/ml ampicilina ou 12. 39 . em resistentes.5 mg/ml tetraciclina. Além da origem de replicação que permite sua propagação em bactérias (E. Da mesma forma. O que é lisozima e para que é usada na preparação de plasmídeos ? 3. Neste método as bactérias são submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes para a transformação pelo DNA do plasmídeo. Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da resistência à ampicilina.Transformação de bactéria com plasmídeo contendo genes de resistência a antibióticos Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua manutenção como um elemento autônomo auto-replicativo. O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de genes. por exemplo ? 6.Questões 1. EDTA e Tris) ? 2. uma vez que este sítio está localizado na região amp r. será revelada através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LBtet. leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido) contento estes antibióticos.. Várias técnicas são disponíveis para transformar uma bactéria.coli) o pBR322 apresenta duas marcas genéticas. Usaremos o plasmídeo pBR322 (ver mapa). Qual a função do NaOH e do SDS presentes na solução de lise ? 4. Se o DNA cromosomal tiver sido muito quebrado durante as manipulações. Portanto a introdução de pBR322 em E. Este plasmídeo pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas) que podem ter valor seletivo no meio. genes que codificam para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ? . onde espera encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de DNA plasmidial? 5. Que papel desempenha cada componente do tampão GET (glicose.coli que normalmente é sensível tanto à ampicilina como à tetraciclina. clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina.

5 µ g DNA de pBR322 em 10µ l de tampão 10mM Tris pH7. As bactérias competentes para transformação são preparadas a partir de uma cultura em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma solução de CaCl2. coletar as bactérias por centrifugação (4000 rpm. incubar à 37°C sob agitação até OD600nm=0. em banho-maria. à 37°C até o dia seguinte sob agitação forte (200-250 rpm). Incubar em gelo por 15 min. Incubar no gelo por 20 minutos. 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão (frio).1 ml/tubo da suspensão de bactérias competentes para cada um de 2 tubos. 8. distribuir 0. Após pelo menos 30 min. Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. O outro tubo será usado como controle (bactéria apenas).Procedimento experimental: O ideal é que a experiência seja realizada em ambiente asséptico (fluxo laminar). 9. Diluir a pré-cultura 1/10 em 10 ml de meio LB. Espalhar as bactérias com o auxílio de uma alça de vidro. Antes de dar o choque térmico (42°C por exatamente 90 segundos) . Manipule convenientemente o material estéril fornecido.coli) e incubar 2. 5 min). Adicionar o DNA transformante (0. 5. 40 . Transferir a cultura para o gelo. 3. 6. Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM pH6. por uma hora. 7.5 contendo CaCl2 0.3 (fase logarítmica de crescimento). Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E.9 ml/tubo de meio LB e incubar a 37°C sem agitação. 1. Para transformar. As bactérias competentes assim preparadas podem ser armazenadas a –80°C. Adicionar 0. Transferir os tubos para o gelo por 2 min.1 M. para uso posterior. para evitar contaminação. Coletar as bactérias (4000 rpm. NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO. No gelo estas BACTÉRIAS COMPETENTES podem ser transformadas. 4.5 contendo 1 mM EDTA) a um dos tubos. previamente flambada e em seguida resfriada na própria tampa da placa de Petri.

a 37°C antes de espalhá-las em placas de ágar? 4. em termos de n° de colônias / µ g de DNA? Questões 1. Qual o papel do choque térmico? 3. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo. 41 . Preencher a tabela com o número de colônias obtido em cada caso: Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| 2. Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes? 2.Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| ANÁLISE DOS RESULTADOS 1. Por que as bactérias devem ser incubadas por 60 min. Qual a eficiência de transformação obtida.

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->