Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno) Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214 Departamento de Bioquímica Instituto de Química 2009 Docentes: Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup. Sala 854 Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala 1013/1018

Monitores: Cecília Midori Ikegami (cikegami@usp.br) Mariana Lemos Duarte (mlduarte@gmail.com)

Programa Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise; gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons; fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos transgênicos. Bibliografia - Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999. - Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002. - Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996. - Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000. - Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004. - Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002. - Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc., 5th ed New York; 2001. - Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing Company; 1996. - Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G. Scrimgeour Prentice Hall; 1993. - Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995. - Nutritional Biochemistry: T. Brody – Academic Press; 1994. - Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996. Critério de Avaliação O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará 1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final deverá ser feito através da seguinte equação: NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5 10

2

Cronograma de Aulas 17/08 19/08 24/08 26/08 31/08 02/09 07/09 09/09 14/09 16/09 21/09 23/09 28/09 30/09 05/10 07/10 12/10 14/10 19/10 19/10 21/10 26/10 28/10 02/11 04/11 09/11 11/11 16/11 18/11 23/11 25/11 30/11 02/12 Aula 9 Aula 10 Aula 11 Aula 12 Aula 13 Aula 14 Aula 15 Aula 16 Aula 17 Aula 17 Aula 18 Aula 19 Aula 20 Aula 21 Aula 22 Aula 1 Aula 2 Aula 3 Aula 4 Aula 5 Aula 6 Aula 7 Aula 8 Enzima (funções e propriedades) Catabolismo/ Anabolismo (introdução) Glicolise (via das pentoses) Gliconeogênese – 1° Teste Oxidação de Triacilgliceróis Formação AcetilCoA (vitaminas e cofatores) – 2° Teste Feriado Ciclo de Krebs 1° Prova Fosforilação Oxidativa Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia de transporte de elétrons. Sala multimídia - Cadeia de transporte de elétrons e fosforilação oxidativa Metabolismo de Glicogênio – 3° Teste Controle Hormonal (insulina, glucagon e vitaminas) Controle Hormonal (insulina, glucagon e vitaminas) Síntese de Triacilglicerol – 4° Teste Feriado 2° Prova Metabolismo de aminoácidos Ciclo da uréia Fonte de Nutrição – 5° Teste Feriado Regulação Integrada Feriado Regulação Integrada Diabetes – 6° Teste Tradução e Código Genético Regulação da Expressão Gênica Biologia Molecular (testes diagnósticos) Técnicas de Biologia Molecular; Transgênicos – 7° Teste Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose Apresentação de Seminários (Alimentação e BioMol) 3° Prova

3

AULA 1: ENZIMAS I. Classifique as afirmações abaixo como verdadeiras ou falsas: 1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( ) 1.2. A velocidade da reação é proporcional ao tempo da reação. ( ) 1.3. A velocidade da reação é proporcional à concentração de substrato.( ) 1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração de substrato não seja limitante. ( ) 1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( ) 1.6. A quantidade de produto formado depende do tempo da reação. ( ) 1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( ) 2. Definir enzima, substrato e sítio ativo 3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da concentração de S. 4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade da enzima pelo seu substrato 5. Fazer o gráfico da velocidade de uma reação enzimática em função de: a. Concentração de enzima; b. Temperatura; c. pH. Justificar a forma dos gráficos 6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse procedimento. 7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de inibidor escolhido, competitivo ou não competitivo?

4

masculino.Aula 2: Introdução ao Catabolismo e Anabolismo Obtenção de energia pelo Metabolismo MP I AA E q e ag ra d d g a a ã d n tr n s s u m e l a e r d ç o e u ie te A IM N O L ET S P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G oe lic s A in á id s m oc o Á id G x c o ra o C O ND A FD A + 2 ND AH FD AH 2 A P+P D O2 H2O i AP T A . desmaiou. sudoreico.P. CASO 1 P. Conta que nos últimos dias alimentou-se mal e. fumante. extremidades frias e referindo forte dor de cabeça. vindo a cair da própria altura. Embora tenha feito refeições corretas. vindo de Salvador. encontra-se pálido.B. 32 anos. sendo conduzido ao Pronto Atendimento. após ter desmaiado no trabalho. com a recomendação de que ingerisse chá ou outra bebida estimulante. nesta manhã.. CASO 2 R. No momento do exame. Insistindo com a atividade que fazia.Ler o relato dos três casos apresentados a seguir. Relata que logo ao sair do aeroporto. saiu de casa sem comer nada e iniciou o trabalho. 27 anos. trazido por colegas. por volta das 10:00 horas da manhã. CASO 3 5 . foi posto sob respiração em balão de oxigênio e rapidamente sentiu-se melhor. precisou subir um lance de escada e sentiu-se muito cansado. Com o passar dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e sudorese fria. Deu entrada no serviço de emergência. Depois dos exames preliminares. trabalhador da construção civil. Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas. analisador de sistemas. a tontura tornou-se muito forte e escureceu– lhe a vista.T. tendo tido necessidade de um esforço intenso. Foi dispensado do hospital.. No final do terceiro dia. o cansado persistiu e agravava-se com atividades físicas que até a véspera fazia sem problemas. O paciente chegou no dia anterior a La Paz.

P. em aperto. 4. 1. quer se processe in vitro. Quais são os passos irreversíveis que aparecem no mapa? 2. proteínas e lipídios? 6 . 2. de inicio abrupto. quais são excretados e qual é aproveitado pelas células? 6. Alimentos + Processos que requerem energia VIAS METABÓLICAS DEGRADATIVAS No Mapa II (página seguinte) encontra-se. Fazendo exames de avaliação cardíaca. 5. Com esse quadro foi trazido ao pronto socorro e embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca.J. começou a suar frio e dentro de poucos minutos perdeu a consciência e caiu. no máximo. HPO42-. masculino. o paciente foi a óbito. Que partes do Mapa I devem ser suprimidas quando referente exclusivamente ao cérebro? A síntese de ATP é obtida por oxidação ou redução dos alimentos? Discutir as seguintes afirmações: a. 3. fumante. Acrescentar O2. f. Resuma: por que é necessário comer e por que é necessário respirar? 7. executivo. ou ao sentir emoções.. sempre que fazia algum esforço físico.F. como subir uma ladeira caminhando. A única função dos alimentos é fornecer energia. As concentrações celulares de Na+ e K+ são. A quantidade de energia derivada da oxidação de nutrientes é a mesma. b. A falta de que composto provocou os sintomas relatados nos três casos descritos? O que restringiu a síntese deste composto em cada um dos casos? Os sintomas dos casos 1 e 2 são claramente neurológicos. Que compostos são produzidos como conseqüência desta reação? Entre os compostos produzidos. 1. Logo ao sair para o trabalho. relata o filho que o estava acompanhando. e. B – Com base no Mapa I. A dor melhorava com o repouso. d. foi constatada obstrução parcial de uma das artérias coronárias. quer ocorra in vivo. Os processos celulares que requerem energia utilizam a energia térmica proveniente da oxidação dos alimentos. A manutenção destas concentrações é espontânea? Como o organismo consegue mantê-las? 8. responder as questões seguintes. O paciente iniciou há seis meses um quadro de dor no peito. c. o número de átomos de carbono de alguns compostos. o paciente sentiu forte dor no peito. respectivamente 25 mmols/L e 150 mmols/L e as concentrações plasmáticas são 140 mmols/L e 5 mmols/L. Desde então vinha fazendo uso de remédios que promovem dilatação das coronárias. 42 anos. Os compostos característicos de um dado organismo devem ser supridos pela dieta. ADP e ATP nos espaços do esquema abaixo. Qual o primeiro composto comum à degradação de carboidratos. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um composto rico em energia (ATP). A oxidação biológica consiste na retirada de hidrogênio do substrato. entre parênteses. Conta que o seu pai ficou pálido. com duração de cinco a dez minutos.

Não havendo outras restrições na dieta.3. prever que grupo de animais sobreviveria. são reversíveis. 7 . com três átomos de carbono a menos que o substrato original. Estas reações. Isomerases: Catalisam reações de isomerização. Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma posição para outra.O SENTIDO DAS REAÇÕES 2 – ALGUNS TIPOS DE ENZIMAS: Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em geral ATP) para um aceptor. por transferência de hidrogênio do substrato para uma coenzima. na maior parte dos casos. ácido graxo a partir de glicose b. Desidrogenases: Catalisam reações de óxido-redução. dando origem a diidroxiacetona fosfato e a outro açúcar. verificando se é possível sintetizar: a. glicose a partir de ácido graxo d. na mesma molécula. ácido graxo a partir de proteína Indicar no mapa a via utilizada para cada conversão. Estes três tipos de compostos são essenciais para a sobrevivência. página 45 . ou lipídios ou proteínas. Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato. Aldolases: Cindem açúcares fosforilados. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose. Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos. Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se insuficientes para manter a glicemia? M P II AA P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G IC S L OE A sp F sfo o iru ato (3 o en lp v ) A IN Á ID S M OC O G ly A la S er Cs y L eu Ile Ls y Pe h G lu Á ID S G A O C O R X S L actato P v (3 iru ato ) C 2 O A cetil-C A(2 o ) C 2 O O alo x acetato (4 ) C 2 O M alato (4 ) Iso citrato (6) C 2 O Fm u arato (4 ) S ccin (4 u ato ) eto lu ) α C g tarato (5 C 2 O C itrato (6 ) 1 – Ler CAPÍTULO 4. geralmente NAD+ ou FAD. glicose a partir de proteína f. 4. proteína a partir de glicose c. proteína a partir de ácido graxo e.

6 bisfosfato H2C-O.P HC-OH H2C-O P ADP ATP O =C-O HC-O H H2C-O. a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos alunos.P ADP AT P Diidroxiacetona fosfato Gliceraldeído 3-fosfato Pi NAD + NADH 1. 8 .P C=O H2C-OH HC=O HC-OH H2C-O P Pi NAD + N ADH O= C-O.P Frutose 6-fosfato ATP ADP HO OH HO Frutose 1. Os parâmetros medidos estão apresentados nas figuras 1 e 2.P OH2COH H2O COO C.3 Bisfosfoglicerato 3-Fosfoglicerato COO HC.P OCH 2 A DP A TP C OO HCOH CH 3 NAD + NADH CO O C= O CH 3 2-Fosfoglicerato Fosfoenolpiruvato AD P ATP Lactato NAD + NADH Piruvato Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas.AULA 3: GLICÓLISE H OCH 2 OH O OH OH ATP ADP H O GLICÓLISE Glicose ATP ADP P -OCH 2 O HO OH OH OH Glicose 6-fosfato PO-CH 2 O CH 2OH HO OH HO AT P A DP P -OCH 2 O CH 2O.

Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante? 4. Para cada molécula de glicose consumida qual é o número de moléculas de piruvato produzido? 9. Examinando a via metabólica que converte glicose a lactato (a glicólise).124). Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M.170 Freqüência Cardíaca (bat/min) 160 150 140 130 120 110 100 90 80 0 0 2 4 B B (tiro de 30s) A (caminhada) Figura 1: freqüência cardíaca durante caminhada de 15 min (A) e tiro de 30 s (B) A 30s 6 8 10 14 15 min 16 tempo Figura 2: Níveis de lactato plasmático durante caminhada de 15 min (A) e tiro de 30 s (B) 9 8 7 B B (tiro de 30s) A (caminhada) Lactatemia (mmol/L) 6 5 4 3 2 1 0 0 0 2 4 30s A 6 8 10 14 15min 16 tempo Analisando os dados acima e com auxilio de livros responda as questões: 1. O esforço físico leva à produção de lactato? 2. a hemácia poderia excretar piruvato? 11. é possível estimar a quantidade de glicose que pode ser convertida a lactato? 10. O exercício é o único processo que leva à produção de lactato? 3. 6. 7. do aumento da freqüência cardíaca? Para responder as questões de 6 a 14. Em lugar de excretar lactato. 9 . Quais são os produtos finais da via glicolítica? 8. utilizar apenas o mapa da glicólise (p. estabelecer o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica. localize as reações que produzem ATP. para a musculatura em exercício. esta adaptação foi suficiente para manter a lactemia basal? 5. Em caso afirmativo. Qual a utilidade. Considerando o número de moléculas de ATP consumidas e formadas.

pode ser convertido a glicose por um processo chamado gliconeogênese. b) Se a dieta contiver quantidades insuficientes de carboidratos. usando glicose como fonte de carbono e produzindo etanol. 13. AULA 4: GLICONEOGÊNESE 1. 2. b) mantê-la em funcionamento 10 . Indicar a função da via glicolítica. à p. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese. consultando o Mapa I. 5. Explicar este aparente paradoxo. Seria possível excretar piruvato em lugar de etanol? Que semelhança tem este metabolismo com o do tecido muscular em condições de esforço extenuante? 3. Citar as vitaminas necessárias para as seguintes conversões: a) glicose → lactato b) lactato → glicose 7. a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via glicolítica. É possível converter lactato a glicose por um processo chamado gliconeogênese. a glicólise é anaeróbia e produz ATP. por sua vez. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? 4.6 bisfosfato nos hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições. Citar os compostos que devem ser fornecidos à via glicolítica para: a) iniciá-la (haver formação de lactato). 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a conversão de glicose a glicose 6-fosfato. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase. a partir de que tipo de macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as células que dependem deste açúcar? [Consulte o MAPA II. No entanto. Levar em consideração o fato de o nível de frutose 2. usando as informações do quadro apresentado acima. 7] c) Muitos aminoácidos podem ser convertidos a piruvato que. Os Casos clínicos 2 e 3 (p. Citar o tecido responsável pela gliconeogênese. 6. 10) indicavam que o oxigênio é necessário para a produção de energia pelo organismo.12. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise e da gliconeogênese? e) Explicar como é feito o controle das duas vias. Explique. f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Saccharomyces cerevisiae (levedo) cresce anaerobiamente.

11 .

4. Após passar por avaliação médica e de capacidade física. Exame Físico: Peso na admissão 105. 12 . nasceu o primeiro filho. Quando o primeiro filho completava um ano e meio ano. casada. Citar a localização celular da beta-oxidação. Como é possível obter ATP a partir de etanol? Caso clínico Identificação: A. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo de Lynen: riboflavina. seu peso chegou a 105 kg. que casou há cinco anos pesando 60 kg. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior da mitocôndria se processe com eficiência. Apresenta boa função cardíaca e pulmonar. o levedo pode oxidar etanol. C. entretanto. É possível haver oxidação completa de um ácido graxo sem a presença de carnitina? 5. que compostos deveriam ser adicionados a um tubo de ensaio que contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA? 7. Em aerobiose. Após dois anos de casamento.67 m. pantotenato. Por esse motivo deu entrada em um spa. Não apresenta problemas de saúde e não se queixa de nenhum mal estar.AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS 1. nicotinamida e/ou ácido lipóico? 8. Exames Laboratoriais: Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%) Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL) Soro lipêmico Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL) Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias. O ciclo de Lynen pode ser feito em condições anaeróbias? 6. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos dos radicais acila do triacilglicerol estiverem marcados com C14. Encontra-se com leve edema dos membros inferiores.4 kg. Por que hemácia e tecido nervoso não oxidam ácidos graxos? 10.. quando todos os carbonos do glicerol estiverem marcados ou em ambos os casos? 3. na admissão a um centro de emagrecimento. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito pouco após o parto. Explicar este aparente paradoxo. Essa enzima. biotina. 9. O que provoca a degradação dos triacilgliceróis no tecido adiposo? 2. Altura de 1. distribuída em cinco refeições. 35 anos. e após esse segundo parto. a paciente engravidou novamente. Queixa e Duração: Aumento de peso após as gestações História Pregressa da Moléstia Atual: A paciente relata. catalisa uma reação da qual os ácidos graxos não participam. Além das enzimas.

Por volta do 4o dia de estadia. Após oito meses de tratamento. Definir vitaminas. sensação de enjôo e gosto amargo na boca. as 5 coenzimas necessárias. AULA 7: CICLO DE KREBS 13 . levando a 45 kg de aumento no peso da paciente? Citar o tecido de armazenamento corpóreo do composto. b. relacionando sua função com atividade enzimática. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas). Manutenção: Regime alimentar. com uma dieta de aproximadamente 900 kcalorias. Por que a inibição da piruvato translocase provoca o acúmulo de lactato? 2. Ingerindo uma dieta de 600 kcalorias. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar: a. a paciente tem um déficit energético. dança (cerca de uma hora por dia) e atividades na piscina. Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA? 4. três vezes na semana. 7. Definir cofator. a localização celular. Após completar 30 dias de estadia a paciente retornou para casa pesando 85. 3.1 kg e prepara-se para submeter-se a uma cirurgia plástica. Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação. 2. A paciente sempre foi orientada a praticar exercícios físicos. 8. a paciente sentiu-se com sonolência. No 10o dia da estadia a paciente pesava 94. com caminhadas de uma hora por dia e natação com aulas de 50 minutos. feitos de maneira fracionada e diversificada. tendo sido orientada quanto ao caráter reversível desses sintomas. Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia. encontra-se com 71. 5. carboidratos e lipídios). 6. 1. Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de piruvato. Em que esses exercícios colaboram para a perda de peso? AULA 6: FORMAÇÃO DE ACETIL-COA 1. Que composto o organismo armazenou. e manutenção de prática de exercícios físicos. com cerca de uma hora de cada vez). portanto com perda de cerca de 10% do peso inicial. hidroginástica e natação (no mínimo uma hora por dia). como jogos.7 kg (18.7%). Explicar a razão. dando ênfase às caminhadas. dispensando mais tempo para as caminhadas (duas vezes ao dia.iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de exercícios. c. totalizando uma perda total de 19.8 kg. verificando a estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina dinucleotídio (FAD) nas suas formas oxidada e reduzida. As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as dos macronutrientes (proteínas. as vitaminas envolvidas. De que forma isso contribui para o emagrecimento da paciente? 3.7 kg.

observa-se também a descoloração do corante (azul de metileno reduzido é incolor). além das enzimas e coenzimas: (a) acetil-CoA. Uma suspensão de mitocôndrias foi incubada. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve sofrer redução? 3. Quando incubação semelhante foi feita substituindo o malato por succinato. separadamente. Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que contém. AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA 1. Em qual (quais) caso(s) aumentou a concentração de oxaloacetato? 5. com acetil-CoA. que porcentual do composto adicionado estará presente no final da reação? 6. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a regulação principal do ciclo de Krebs Enzima Isocitrato desidrogenase Efetuadores alostéricos Positivos Negativos ADP – NAD+ ATP . Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de citrato. se a rotenona fosse substituída por cianeto ou por antimicina A? LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA ATIVIDADE DA SUCCINATO DESIDROGENASE -Protocolo Experimental 14 . Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo de oxigênio. nos dois casos. a. piruvato. Que resultado haveria. (b) oxaloacetato. Em cada caso. 1. 7). A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação estequiométrica com a quantidade de NADH oxidado? 3. suplementada com acetil-CoA marcada com C14 só produz CO2 marcado em aerobiose. ocorreu consumo de oxigênio. Explicar este resultado. há produção de CO2 marcado se for adicionado azul de metileno. 4. neste caso. (c) acetil-CoA + oxaloacetato. Por que? b. Que composto é oxidado no ciclo de Krebs? 2. 5 ) e II (p. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos que fazem parte da cadeia de transporte de elétrons? 2. Explique estes dados. (d) acetil-CoA + succinato. citrato e ácidos graxos.Para responder às questões de 1 a 4 usar apenas os Mapas I (p. Uma suspensão de mitocôndrias. Em anaerobiose.NADH 7. glutamato.

3.25M. tornar a decantar e descartar o sobrenadante. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE TRANSPORTE DE ELÉTRONS. Você obterá o precipitado 1 e um sobrenadante 1 . 2. Ressuspender o precipitado 2 obtido em 4ml de sacarose 0. B. Adicionar outros 20 ml da solução de sacarose. um processo historicamente importante na elucidação das etapas de ciclo de Krebs. Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no gelo. discutir as funções do succinato. Os aceptores e doadores são fornecidos na forma oxidada. escrever a reação que está sendo analisada. observe a inibição competitiva da enzima por malonato. planejar o controle da experiência. misturar. Para verificar a oxidação do succinato. Seguir o protocolo 2.000 rpm por 10 minutos. Esta será a fração celular II. sacarose. Adicionar novamente 20ml de sacarose 0. Seguir o protocolo 1.a) Fracionamento celular b) Verificação da atividade de succinato desidrogenase O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO Sabendo em que fração celular se encontra a atividade da succinato desidrogenase. NÃO ESQUEÇA a inibição é competitiva. aqueça os tubos a 37°C por 5 minutos e os compare novamente. Esta será a fração celular I. mergulhá-lo em 20 ml de uma solução de sacarose 0. Se a reação estiver lenta (isto dependerá da sua preparação mitocondrial). as frações devem ser incubadas a 37°C. Decantar e descartar o sobrenadante. com exceção do reagente pfenilenodiamina. A redução do azul de metileno pode ser obtida a partir da oxidação do succinato.25M (previamente resfriada a 0 graus). Antes de iniciar a experiência o grupo deve: 1. Novamente você obterá o precipitado2 e o sobrenadante 2. Remover o fígado. Sacrificar um rato em jejum por concussão cerebral.25M gelada. azul de metileno e óleo mineral. homogeneizar o fígado e centrifugar a 4. PAR REDOX NADH/NAD+ 15 EO’ -0. Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando as tabelas que se seguem. por 10 minutos. Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores.000 rpm por 30 minutos. catalisada pela succinato desidrogenase.32 . Separar o sobrenadante 1 e centrifugá-lo novamente a 10. não sendo reoxidado pelo O2 do ar. existe o fator cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS INTERVALOS DE TEMPO. picando-o bem com a tesoura. A. Você utilizará a redução do MTT via succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido.

20 -0.1 0.3 0.34 0.diclorofenolindofenol (DCPI) Benzilviológeno Ferricianeto Incolor Incolor Incolor Incolor 16 VOLUME UTILIZADO 0.6.25 0.40 0.3 0.22 0.6-diclorofenolindofenol (DCPI) red/ox Benzilviológeno red/ox Ferricianeto Fe(CN)64-/Fe(CN)63p-fenilenodiamino (p-FDA) red/ox EO’ -0.36 0.Succinato/Fumarato FADH2/FAD Azul de metileno red/ox Cit b (Fe 2+)/ Cit b (Fe 3+) Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) Cit c (Fe 2+)/ Cit c (Fe 3+) Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) H2O / ½ O2 -0.1 0.3 0.82 ACEPTORES E DOADORES ARTIFICIAIS Piocianina red/ox 2.06 0.2 Azul Azul Violeta Amarelo .36 0.00 0.27 COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E OXIDADA REDUZIDO OXIDADO Piocianina 2.

2 ml 25µ l 0.1 ml 0.2 ml 0.3 ml 1.1 ml 0.7M Succinato 0.1 ml 25µ l 0.p-fenilendiamino (p-FDA) Incolor Violeta 0.5 ml 0.2 ml 0. Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas.4 ml 0.1 ml 1.Seguir o protocolo 3.2 ml 25µ l 0.1 (II) 0.1 ml 0.1 ml 25µ l 0.1 (I) 0. PROTOCOLO 1 TUBO Tampão A Sacarose 0.4 ml 0.0 ml 0.5 cm 3 0.5 ml 0.2 ml 25µ l 0.0 ml 0.5 cm 5 0.5 ml 0.3 ml 0.5 cm 4 0.3 ml 1.1 ml 1.0 ml 0.2 ml 0.0 ml 0.5M Azul de Metileno Água Destilada Fração Celular Nujol 1 0.1 ml 0.2 ml 6 0.3 ml 0.2 ml 5 0.2 ml 2 0.1 ml 25µ l 0.0 ml 0.2 ml 0. identificando as drogas A e B.3 ml 1.1 ml 1.3 ml 1.2 ml 0.2 ml 4 0.5M MTT Água Destilada Fração Celular 1 0.4 ml 0.1 (I) 0.1 ml 1.1 ml 1.1 (II) 0.5 ml 0.4 ml 25µ l 0.2 ml 7 0.2 ml 0.6 ml 0.3 ml 1.2 ml PROTOCOLO 3 17 .3 ml 0.2 ml 0.5 cm 2 0.5 cm PROTOCOLO 2 TUBO Tampão A Malonato Succinato 0.2 ml 0.2 ml 3 0.2 ml 0.5 .

3 1. g.0 0.0 0. Hemácia e tecido nervoso fazem fosforilação oxidativa? 18 .8 0.TUBO Volume (ml) Tampão A Sacarose 0.1 0.2 0.0 0.1 0.0 0.2 1.5 0.5 0.7M Succinato 0.5 0.2 0.5 0.2 0. h. responder as questões seguintes: Sempre que há consumo de oxigênio há síntese de ATP? Sempre que há síntese de ATP há consumo de oxigênio? Sempre que há aumento do potencial de membrana há consumo de oxigênio? Sempre que há consumo de oxigênio há aumento do potencial de membrana? Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana? Pode haver síntese de ATP sem aumento do potencial de membrana? Pode haver consumo de oxigênio sem aumento do potencial de membrana? A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto? i.2 0.2 0.0 0.5 0. e.4 1. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele composto.2 0.2 0.5 0.2 0.9 0.0 0.3 0.4 1. j.5 0. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 3.4 1. Com auxílio do software. c.1 0. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de controle fisiológico da velocidade da cadeia de transporte de elétrons? 4.1 0.5 0. b.9 0. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum composto? A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto? 2. f.0 0.2 0.3 0.3 0.4 1.4 1.2 0.5 1.5 0.1 0.5 AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA 1.5 0.0 0.4 1.4 1.0 0.4 1. Correto? 5.2 1.9 0.4 1.0 0.5M Droga A ou B Ferricianeto DCPI p-FDA Água Destilada Fração Celular Nujol (cm) 1 2 3 4 5 6 7 8 9 0.0 0. Software Cadeia de Transporte de Elétrons. d.8 0. a.

Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e do glicerol-fosfato)? AULA 10: METABOLISMO DE GLICOGÊNIO 1. Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de transporte de elétrons em presença de malato e de antimicina A? 7. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 19 . Hemácia e tecido nervoso fazem fosforilação oxidativa? 13. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 6. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a grande utilização no citossol do ATP produzido na mitocôndria? 12. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas encontradas no glicogênio são do tipo α -1-4 ou α -1-6. Escrever os substratos e os produtos das reações catalisadas por a) proteína quinase b) glicogênio fosforilase quinase c) fosfoproteína fosfatase 3. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 9. Explicar estes resultados. A adição de dinitrofenol restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a inibição da síntese de ATP. A fosfodiesterase catalisa a conversão de cAMP a AMP. 7. 11. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do glicogênio. Apontar as que utilizam ATP e as que utilizam HPO42--. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina inibe tanto o consumo de oxigênio quanto a síntese de ATP. A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH oxidado? 8. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem fornecimento de substrato oxidável? 10. a) glicogênio fosforilase b) proteína quinase c) glicogênio fosforilase quinase 4. Correto? 2.6. Qual o efeito da ativação desta enzima sobre a degradação do glicogênio a glicose 1-fosfato? 5.

5. 12. c. fígado e ilhotas de Langerhans. AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. 2. síntese de glicoquinase (fígado) Transportadores de glicose para o interior das células: 20 . Verificar os diferentes transportadores de glicose e sua dependência de insulina. 11. libera glucagon. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. indicando o hormônio que atua em cada caso. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. 3. permeabilidade da célula à glicose. permeabilidade da célula à glicose b. síntese de glicogênio c. b. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 11. O glucagon estimula a gliconeogênese? Como? 9. Verificar também se são independentes de insulina para a captação de glicose: cérebro. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de jejum noturno e após uma refeição rica em carboidratos. Mostrar a relação entre AMP cíclico e a síntese de glicogênio. 13. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Como a insulina leva a ativação da proteína quinase B? 12. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no músculo. ocorre degradação de proteínas de músculo. hemácia. 7. síntese de glicogênio.8. adrenalina e insulina no metabolismo de triacilgliceróis. GLUCAGON) 1. síntese de glicoquinase (fígado). Como são desfosforiladas as enzimas. Descrever as ações de glucagon. quando cessa o efeito do glucagon? Se a célula contém proteína fosfatase. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. rim. 10. No jejum. 6. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a) permeabilidade da célula à glicose b) síntese de glicogênio c) síntese de glicoquinase (fígado) 9. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 8. como é possível manter proteínas fosforiladas? 10. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a última refeição. 4.

O tecido muscular não sintetiza glicerol 3-fosfato. 5. Verificar os diferentes transportadores de glicose e sua dependência de insulina. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. seria possível encontrar ácidos graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir de acetil-CoA marcada com C14.Transportador GLUT1 GLUT2 GLUT3 GLUT4 Distribuição Hemácias. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato é elevada? 4. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A. células β do pâncreas Neurônio. Analisar a regulação desta via. 13. O que impede a síntese e degradação simultânea de ácidos graxos? 11. placenta. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para gerar os equivalentes redutores necessários à síntese de palmitato? 7. testículo Adipócito.músculo esquelético. rim. AULA 13 SÍNTESE DE TRIACILGLICEROL 1. quais carbonos apareceriam marcados? 6. Há conseqüências derivadas da produção excessiva de corpos cetônicos? 12. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades apreciáveis de acetil-CoA no citossol? 2. placenta. libera glucagon. 14. outras células Fígado. Que decorrência isto tem? 9. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de triacilgliceróis? AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA 21 . hemácia. Se fosse fornecida a uma célula glicose marcada com H3. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos? 8.coração. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6fosfato desidrogenase? 3. Propriedades Baixo KM Alto KM Baixo KM Baixo KM Dependente de insulina Transporte ativo Co-transporte com Na+ GLUT5 Intestino. rim 13. Verificar também se são independentes de insulina para a captação de glicose: cérebro. fígado e ilhotas de Langerhans. rim. Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato? 10.

Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase (glutâmico-oxaloacético transaminase . Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. Um adulto normal. 2.GOT) e alanina aminotransferase (glutâmicopirúvico transaminase . Citar as condições que levam a um balanço positivo ou negativo de nitrogênio. 9. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido? 15. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos. 10.GTP). Exemplos destes compostos e seus precursores: Glicina purina porfirina glutationa Lisina carnitina Aspartato purina pirimidina Histidina histamina Tirosina adrenalina tiroxina melanina Triptofano nicotinamida 7. com uma dieta rica em carboidratos e lipídios. tem necessidade de ingestão proteica. Esquematizar a reação catalisada pela glutamato desidrogenase. Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato sintetase. Citar a coenzima que participa das reações e a vitamina presente na sua estrutura. 5. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 12. 6. com uma dieta rica em carboidratos e lipídios. Um adulto normal. com uma dieta desprovida de proteínas. 4. Por quê? AULAS 16 : FONTE DE NUTRIÇÃO 1. Por que? 2. 22 . Por que? 3. 3. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Por quê? 2. 13 . No ciclo da uréia (da ornitina): a) indicar a procedência dos átomos de nitrogênio da molécula de uréia. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. Definir balanço de nitrogênio. tem necessidade de ingestão protéica. Um adulto normal. Um adulto normal.1. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio? QUESTÕES PARA DISCUSSÃO 1. 11. b) calcular o balanço de ATP c) qual o aminoácido proteico sintetizado? 14. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina hidroxilase? 8. elimina uréia. com uma dieta desprovida de proteínas. elimina uréia.

A concentração citossólica de citrato é maior em B do que em A. C. entre as enzimas alistadas a seguir. D. lipídios e proteínas no fígado. isocitrato desidrogenase d. c. Planejar a distribuição entre carboidratos.é maior em B do que em C. 9 kcal/g). Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em desenvolvimento. b. lipídios e proteínas de uma dieta normal e de uma dieta para emagrecimento. a. Incapacidade de fazer a oxidação completa de glicose e lipídios. aquela cuja perda de atividade seria responsável por cada um daqueles defeitos: a. 23 . Descrever as conseqüências metabólicas de uma dieta com valor calórico normal. 5. e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas. Incapacidade de utilizar glicose para obtenção de energia. f) nove aminoácidos são essenciais para o organismo humano. fosfoglicomutase 3. 2. fosfofrutoquinase 1. 6. De a até j. tendo em vista que: a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g. os processos que levam ao acúmulo de lipídios a partir de uma dieta rica em carboidratos. hidroxiacil-CoA desidrogenase. 5.800 kcal por dia. 6. b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2. b. Incapacidade de fazer gliconeogênese a partir de lactato. 4. O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à ingestão de uma refeição (tempo zero). Caracterizar as síndromes de desnutrição mais comuns. 9. 8. Segue-se uma lista de defeitos metabólicos hereditários hipotéticos: A. com base em regulações hormonal e alostérica. e a de lipídios. músculo e adiposo. AULAS 17 : REGULAÇÃO INTEGRADA 1. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas).100 kcal por dia. fosfoenolpiruvato carboxiquinase e.4. mas contendo proteínas de baixo valor biológico. Fazer um resumo dos efeitos do glucagon. d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos poliinsaturados. adrenalina. Escolher. c) o metabolismo basal de um adulto consome cerca de 1. A concentração plasmática de HCO3. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de proteínas de origem vegetal. B. Incapacidade de sintetizar diidroxiacetona a partir de lactato. glicose 6-fosfatase f. Descrever. 7. Os valores de ordenadas são diferentes para cada curva. e insulina no metabolismo de carboidratos. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de proteínas. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos. verificar se a sentença é falsa ou verdadeira.

e. A B C II III I 0 5 10 15 20 25 Horas 12. Um indivíduo adulto recebeu. a concentração de acetil-CoA e a síntese de ácidos graxos. A carnitina acil transferase de hepatócitos é mais ativa em A. Em C. a maior parte da glicose. a. a síntese de glicogênio. a gliconeogênese. Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase dependente de cAMP. lipídios e proteínas adequadas para seu peso. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do que em B. g. b. Para cada hipótese feita. Em B a lipogênese é mais intensa que a lipólise no tecido adiposo. o caso poderia ser normalizado aumentando a ingestão de carboidratos e diminuindo a de lipídios? AULAS 18 : DIABETES DIABETES MELITTUS 24 . Escolha uma das hipóteses e descreva como estão. o indivíduo apresentou perda lenta e contínua de peso. h. a concentração de frutose 2. A curva II pode representar a atividade da via das pentoses. Segundo as hipóteses formuladas. Faça duas hipóteses explicativas deste quadro. o ciclo de Krebs. a utilização de corpos cetônicos pelo cérebro. aminoácidos e corpos cetônicos plasmáticos é originária do fígado. durante várias semanas. c. Em B ocorre oxidação de aminoácidos essenciais no fígado. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais. A curva I pode representar a concentração de glicogênio hepático e a curva III.6-bisfosfato. d. analise o balanço de nitrogênio e a produção de corpos cetônicos. d. faixa etária e atividade física. sexo. uma dieta com quantidades de carboidratos.c. no fígado deste indivíduo.

Ela tem início entre a infância e 35 anos e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de DMID adquirirá a doença). caso não seja tratado. bem como da perda de água. nervos e vasos sanguíneos. inibindo a mobilização de ácidos graxos. pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular. Como tudo que tem que ser excretado na urina deve estar solubilizado. 25 . Assim. É uma doença que pode ser definida como um estado de tolerância diminuída à glicose. músculo e tecido adiposo e outras células. Evidências implicam a infecção viral e resposta auto-imune como maiores fatores contribuintes. por ação direta: • Aumenta o transporte de glicose para o fígado. Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II. principalmente potássio. olhos. ele desperdiça glicose eliminando-a na urina. vamos lembrar os efeitos da insulina: .Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e pode comprometer o funcionamento de rins. oxidando-a para gerar energia ou usando-a para síntese de outros compostos. Ocorre cetoacidose. o rim não consegue reabsorvê-la e ocorre glicosúria. ou DM não dependente de insulina (DMNDI). Há dois tipos mais comuns de diabetes melittus (DM): 1) A tipo I. Quando os níveis de glicose sobem.Esse hormônio. dependendo do tecido. 2) A tipo II. O desarranjo de todas essas reações é encontrado no diabético. qualquer incremento é acompanhado por perda de água. • Diminui a quantidade de glucagon circulante por diminuição da expressão gênica. A perda de peso é decorrente de perda de tecido muscular e adiposo. com conseqüente aumento da pressão osmótica. Diabetis melittus insulino dependente (DMID) ou Tipo I. . também chamada de DM insulina dependente (DMID). embora não só a genética possa explicá-la. lipídeo e glicogênio em proporções variadas. cujos aminoácidos são usados na gliconeogênese. devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza. 10 a 20% dos casos de diabetes são do tipo I. • Aumenta a síntese de proteína.Por ação indireta: • Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase dependente de AMPc. Um indivíduo normal mantém os níveis plasmáticos normais de glicose convertendo-a em glicogênio. pela perda de eletrólitos. diluição dos eletrólitos extracelulares e maior concentração dos intracelulares. A DMID é causada pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de hiperglicemia sustentada. A falta de insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do músculo e adipócito. usualmente devido à deficiência ou resistência à insulina. • Aumenta o transporte de aminoácidos para os músculos e outros tecidos. Antes de verificar as diferenças e semelhanças nas manifestações dessas duas diabetes. Devido a isso. • Diminui a atividade da triacilglicerol lipase no tecido adiposo. água intracelular é perdida para o interstício resultando em desidratação celular. • Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase. ele perde peso.

silencioso Em geral obesidade 80 a 90% dos casos . perda de peso já pode influenciar na capacidade do corpo de controlar o nível de glicose.Presente em 80 a 90 % dos diabéticos. com alto fator genético (100% dos irmãos gêmeos idênticos de um diabético tipo II desenvolverão a doença). O indivíduo ingere uma solução contendo 75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal. baseado numa relativa mas não absoluta deficiência de glicose. Nesses pacientes dieta e exercícios físicos são um bom meio de alcançar o controle da glicemia. Diagnóstico Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as observações clínicas como perda de peso. Diabetes tipo II é mais certamente diagnosticada por uma demonstração da tolerância diminuída à glicose. DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com obesidade e que tenham parentes diabéticos. Tratamento Depende do tipo de diabetes. ou tornar-se-á. a cetose pode aparecer em certas condições de estresse metabólico. poliúria (aumento na quantidade de urina) e polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia. Alguns pacientes podem necessitar de injeções de insulina.DMNDI Em geral após 35 anos Lento.Tipo I é. considera-se que não existem apenas duas situações extremas: cetoacidose diabética ou hiperglicemia não cetônica. Atualmente. ocorrendo. A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de diabetes. dependente de insulina por toda a vida. Os pacientes apresentam normalmente níveis normais ou elevados de insulina. Assim. atingindo 200mg/dL após 2h de ingestão da solução de glicose. cetoacidose e glicosúria. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de cetose. Deve haver reposição adequada de Na+ e água. na verdade. sugerindo que não há a utilização correta do hormônio pelo organismo. provavelmente por defeito nos receptores de insulina nas células. Tipo I –DMID Idade de início Início Estado nutricional no início Prevalência Em geral infância ou puberdade Em geral repentino Em geral desnutrido 10 a 20% dos casos 26 Tipo II . Agentes hipoglicemiantes orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou não. Não há relação necessária entre diabetes tipo I e obesidade. Nos diabéticos tipo II. como sepsis. No período inicial da doença observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL. pacientes com DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de cetose. Na tipo II. toda uma gama de variação das intensidades dos dois sintomas.

principalmente a neuropatia simétrica. Diabéticos podem desenvolver retinopatia (principal causa de cegueira). a conseqüência mais provável é o coma. fome. Há tendência a hipovolemia e deslocamentos de água intracelular para o espaço extracelular. que ocorre principalmente no ε amino da Lys. polidipsia. com alta incidência de gangrena e amputação. β produzem menos de insulina ou igual insulina. A glicosilação de lipoproteínas plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença periférica vascular. A retinopatia é quase universal entre os diabéticos. Complicações decorrentes do diabetes A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. sem produção Cel. neuropatia e doenças cardiovasculares. 27 . A neuropatia de nervos periféricos é comum em diabéticos. cetoacidose comum tipo I mais suaves Comum Rara Retino-. causando desidratação celular. β destruídas. Complicações similares a surgimento após 5 anos tipo I. Tanto a hiperglicemia como a hipernatremia afetam muito o cérebro. nefropatia. que causa a perda de sensibilidade nas extremidades inferiores. perda de Nenhum ou os mesmos do peso. A dosagem de Hb glicosilada plasmática é um teste mais sensível que a medida de glicemia.e neuropatia. Quando essa doença se desenvolve o paciente necessita de hemodiálise e transplante renal. Essas proteínas ficam com conformação alterada e são mais resistentes ao ataque proteolítico. a água move-se para fora das células cerebrais. nefro. mais tardias Cetoacidose Coma hiperosmolar Responde Em geral não necessário Resposta a hipoglicemiantes Não responde orais Administrar insulina Sempre necessário Coma diabético A glicose sanguínea em concentrações maiores que o limite de reabsorção renal provoca uma rápida diurese osmótica.Predisposição genética Defeito ou deficiência Outros fatores Insulina plasmática Sintomas iniciais Cetose Efeitos a longo prazo Complicações agudas Moderada Muito forte Cel. Quando a osmolaridade alcança 340 a 350 mosmol/kg. que leva a perda de água e eletrólitos. Vírus e toxinas Baixa a ausente Obesidade Normal a elevada Poliúria. enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 % dos portadores de DMID e em menos de 20% daqueles com DMNDI. Aumentando a osmolaridade plasmática. Faça hipóteses para explicar esse fato. Uma explicação para isso é haver glicosilação de proteínas. tornando os pacientes propensos a lesões nas pernas e pés.

Dados de gasometria revelam acidose. de descompensação diabética.B. principalmente nos acontecimentos sociais. segundo seus familiares. Exame Físico: Regular estado geral. masculino. Sinais clínicos de desidratação. Qual o sinal clínico comum aos dois casos relatados? 28 . mas a cetonúria ainda se mantinha em + / +++. a paciente passou a sentir também fortes dores de cabeça. bancário. onde ingeriu quatro ou cinco chopes. 35 anos. hálito cetônico..L. por via muscular. porém. precisando levantar várias vezes da cama. Procurou o ambulatório médico para esclarecimentos. Hálito amargo há um dia. para resolver seus sintomas. Foi-lhe dito que. Refere que procura seguir as recomendações dietéticas. pulsos finos. palidez cutâneo-mucosa. Indicou-se que aguardasse por mais alguns dias até que os sintomas regredissem. porém. Queixa e Duração:Aumento do volume urinário há 4 horas. Tudo seguido de uma intensa fraqueza e leve falta de ar. Passadas quatro horas. bastaria uma refeição calórica que. Após três horas de cuidados a glicemia já havia baixado para 185 mg/dL. 1. branca. a boca seca e. executiva do ramo de cosméticos. Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL) Cetonúria = +++ / ++++ Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. Faz uso de insulina. a partir do segundo dia. Exame Fïsico: Bom estado geral. procurou o serviço médico. duas vezes ao dia. Hoje. 25 anos. Respiração tendendo a ofegante. Na seqüência sentiu um hálito amargo. Como já passou por situações semelhantes. Relata que no entardecer do dia esteve em uma lanchonete com amigos. Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina. de hora em hora. Relata que no primeiro dia nada sentiu. Queixa e Duração: Sensação de fraqueza há doze horas. Dor de cabeça intermitente. pressão arterial = 100 x 60 torr. começou a urinar intensamente. feminina. ritmos cardíaco e respiratório normal. administrada por via subcutânea. levemente taquicárdico. hálito cetônico bastante evidente. ritmo cardíaco regular. branco. há oito horas. comeu pizza e tomou sorvete. mas que não é incomum a transgressão da dieta. História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de idade. aliadas à fraqueza.CASO 1 Identificação: J. Está submetida a uma dieta de 300 kcalorias/dia. não é lhe indicada já que está sob regime de emagrecimento. História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de emagrecimento em um spa há três dias. quando falava as pessoas sentiam cheiro de acetona. há uma hora. notou gosto ruim na boca e o apetite diminuiu. o gosto ruim na boca é muito intenso e acompanhado de um hálito próximo ao cheiro de acetona. no terceiro dia de estadia. Gosto amargo na boca e sensação de fraqueza.M. a fim de ser medicado antes do agravamento do quadro.P. Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL) Cetonúria = +++/++++ (O normal é negativo). CASO 2 Identificação: J.

Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a quatro semanas. 14. Descrever as alterações do metabolismo de carboidratos. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65 mg/dL? Que via metabólica é utilizada para a síntese de glicose? 8. nesse caso? 5. Qual é a relação entre a glicemia e a presença plasmática de acetona? 4. desde que hidratado) como nos casos de greve de fome. Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos casos 1 e 2? 9. adrenalina e insulina no metabolismo de triacilgliceróis AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO 1. pois a entrada de glicose nessas células é estimulada pela insulina. Nos dois casos apresentados. Pela deficiência de insulina. Citar a fonte de energia utilizada pelo cérebro. que tipo de reserva a paciente do caso 2 deve estar utilizando para a obtenção de ATP? 6. 16. músculo e fígado neste jejum extremo. Tabela de códons 29 . hemácias. Indicar as condições metabólicas que levam a uma aumento na produção de corpos cetônicos 18. Por que o valor da glicemia difere tanto entre os casos 1 e 2? 3. o paciente do Caso 1 fica impossibilitado de usar a glicose sangüínea em células como as do músculo. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de um mRNA específico sem mudar o gene codificante da proteína os elementos controladores do gene. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1 e 2? 7. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de frutose 2. Descrever as ações de glucagon.2. Qual a principal fonte de ATP para a contração muscular. Após alguns dias no spa. indicando o hormônio que atua em cada caso.6 bisfosfato. manutenção ou ganho de peso? 10. 15. lipídios e proteínas provocadas por jejum prolongado e por diabetes. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. 17. a tendência dos pacientes é de perda.

Além disso. você sabe que a proteína A tem quatro pontos sensíveis à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1. A2. Quais mecanismos são usados para garantir a fidelidade de cada um destes processos. Quais são as funções do mRNA. As células continuam a crescer e dividem a cada 30 minutos. coli são crescidas no meio com glicose como única fonte de carbono.terminal e A5 é o carbpxi-terminal. Indique em cada uma das situações abaixo se a expressão do operon lac aumenta. A4 e A5. A3. Finalmente. Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma proteína chamada A. você isola a proteína A intacta do sistema. Qual peptídeo é mais intensamente marcado? (B) Em t=3 minutos. coli são crescidas no meio contendo lactose. reduz ou não é 30 . 5. 7. Aponte três mutações que não modificam a sequência da proteína. porém a enzima triptofano sintase é estável. Explique. você adiciona todos os 20 amino-ácidos. porém não glicose. qual será a ordem de marcação dos peptídeos do mais para o menos marcado? (C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas? 6. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações em: a) o gene lacI que inativa o repressor b) o promotor é eliminado na região próxima a posição -10 3. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que decodificam o código genético. corta-a com tripsina e isola os cinco peptídeos. tRNA e rRNA? Aula 20: Regulação da Expressão Gênica 1. Em t=0. Um transcrito para um gene contem a seqüência de bases abaixo: 5´ AACUGCACGAGGUAACACAAGAUGGCU 3´ Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes fases. 3. (A) Em t=1 minuto. é o amino. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de proteínas. Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes condições: a) O trp mRNA é estável (degrada lentamente após algumas horas) b) O trp mRNA é degradado rapidamente. O peptídeo A1.2. cada um levando uma marcação com 14C . c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente que o normal. Tryptofano é adicionado. Células de E. 4. você sabe que seu sistema precisa de 4 minutos para produzir uma molécula de proteína A completa. Células de E. 2.

5. Esta RNA polimerase inicia somente a transcrição a partir de uma única região promotora altamente especializada. Sugira uma explicação para esta observação. Façam uma lista contendo. Esses termos deverão ser esclarecidos com o auxílio dos professores. Desenhe um modelo descrevendo o que acontece em cada uma destas situações. d) Uma mutação que inativa completamente a permease galactosidase e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região do promotor lac. destacando os termos que você não compreenda ou de que nunca tenha ouvido falar. c) Uma mutação que inativa completamente a β -galactosidase. Como a transcrição do gene operon trp da E. monitores e colegas de grupo. Aula 22: Técnicas de Biologia Molecular. coli pode ser afetada pelas seguintes manipulações da região promotora do mRNA trp. A atividade desta RNA polimerase é reduzida quando a enzima é purificada.alterada. b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3. Transgênicos – 7° Teste Questões para Estudo Leia os textos que se seguem a respeito de alimentos transgênicos. a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a seqüência 2. Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um fungo exótico. os pontos favoráveis e desfavoráveis ao emprego da tecnologia para produção de alimentos transgênicos. 4. 31 . c) Removendo a seqüência 4 d) Trocando os dois códons trp no peptídeo iniciador para códons de His. acesse os sites recomendados ao final dos textos. na sua opinião. e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador. Para complementar seus estudos. a) Adição de alta concentração de glicose b) Uma mutação que impede a dissociação do repressor lac na região reguladora.

O termo geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia do DNA recombinante para a alteração genética de animais. aceleraram as descobertas científicas e suas aplicações biotecnológicas. produção de proteínas humanas em microorganismos. a genética mendeliana contribuiu significativamente para a sustentação do crescimento populacional de nosso planeta. Surgiram técnicas biotecnológicas como a produção e pesquisa de plantas e animais transgênicos. abrindo novas perspectivas econômicas nos campos da saúde humana. ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou Tecnologia do DNA Recombinante). entretanto. O sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil cultivo e permitir a purificação e recuperação do produto do gene. clonagem de mamíferos. plantas e microorganismos.o gene de interesse. O crescimento acelerado do campo da biotecnologia.Definição de transgênicos: Os Transgênicos são organismos que adquiriram características de outro organismo. cientistas podem identificar e inserir no genoma de um determinado organismo um único gene responsável pela característica em particular. resultando em um organismo geneticamente modificado (OGM). mapeamento do genoma humano. aumentando a produtividade de animais e contribuindo para uma maior longevidade humana. cuja característica adquirida passa a ser transmitida para as futuras gerações. Ao invés de promover o cruzamento entre organismos relacionados para obter uma característica desejada. pois. Procedimentos para a obtenção de vegetais transgênicos: Para obter plantas transgênicas são necessários: . . 32 . . a partir de 1900 as Leis de Mendel foram redescobertas e começaram a ser aplicadas. técnicas de detecções e diagnósticos por PCR e Terapia Gênica. produzindo maiores safras de alimentos de origem vegetal. Histórico: A Genética é uma ciência característica do século XX. a mais utilizada era a do Melhoramento Clássico. Para a introdução do gene em outro organismo são utilizados vetores de clonagem (plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida. Antes do desenvolvimento desta técnica. O gene artificial ou intencionalmente inserido no genoma de um organismo é denominado transgene. Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a transferência do material genético de um organismo para outro. na qual a transferência de genes se dava por meio de cruzamentos (reprodução sexuada). A clonagem molecular consiste no isolamento do gene de interesse. amplificação do número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. misturando todo o conjunto de genes dos dois organismos em combinações aleatórias. A técnica exigia uma enorme demanda de tempo e não era precisa. sanidade animal e produção de alimentos. A decifração do código genético e a manipulação do DNA neste último quarto de século. Nos primeiros ¾ deste século. plantas e animais. pelo uso de técnicas modernas de Engenharia Genética.uma técnica para gerar uma planta inteira a partir de uma só célula transformada.uma técnica para transformar células vegetais através da introdução do gene de interesse.

Os insetos que se alimentassem de plantas expressando este gene morreriam ou se desenvolveriam com menor eficiência. tem-se uma planta transgênica. Diversos genes de interesse agronômico já foram isolados. além dos genes naturais.000 e 60. Os genes são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta característica que permite que genes de um organismo sejam potencialmente funcionais em outro. Os herbicidas são muito usados no controle de ervas daninhas. Uma das possibilidades para isolamento de um gene é a construção de uma “biblioteca genômica” e. Depois. culturas contendo este gene poderiam tornar-se resistentes ao herbicida. que pode ser uma planta. o de plantas. Em seguida o DNA é cortado em fragmentos menores utilizando as enzimas de restrição.Após esta última etapa. inativando-os. porque ela contém. uma bactéria ou até um animal. o DNA do organismo contendo o gene de interesse é extraído. entre 40.  Gene que codifica uma proteína de alto valor nutricional. entretanto.  Genes bacterianos que codificam proteínas com propriedades tóxicas para insetos. onde este material é inserido e replicado por várias vezes. enquanto o genoma humano consiste de aproximadamente 30. facilitando assim o controle das ervas. então. seleciona-se a colônia de bactérias que contém o fragmento de DNA correspondente ao gene de interesse. entre eles temos:  Gene que codifica proteína capaz de modificar herbicidas. algumas culturas não sobrevivem à aplicação deste produto. mas que podem se replicar em bactérias. um gene adicional proveniente de outro organismo.000 genes. presente na castanha-do-pará. 33 .000 genes. para isso. Genes de Interesse: O genoma de uma bactéria contém em média 5. levando ao seu controle na cultura. Deste modo. ligados a outros fragmentos de DNA.000. Este gene poderia ser usado para aumentar o valor nutricional de culturas importantes como feijão e soja. Estes fragmentos são.

Regeneração das plantas a partir das células transformadas: Uma vez inserido o gene na célula vegetal. como cada espécie de planta tem diferentes exigências hormonais. introduziram o gene proveniente de uma rã em uma bactéria. o domínio das técnicas de regeneração de plantas inteiras a partir de uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. Os transposons são assim denominados (ou também chamados elementos de transposição) justamente porque são elementos genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se. Os microprojéteis são acelerados com pólvora ou gás em direção aos alvos (as células vegetais). o que permite a penetração e eventual integração dos genes no genoma. enquanto que em eucariotos superiores. A produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá resultar em um produto mais economicamente viável que o enriquecimento do trigo com a lisina obtida de microorganismos. C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA extracromossomal que pode se replicar independentemente do cromossomo. o DNA é dissociado das micropartículas pela ação do líquido celular. Em seguida. O choque causa uma alteração da membrana celular.especialmente para o caso de monocotiledôneas) ou através de agrobactérias. como plantas e animais. em São Francisco. as mudanças obtidas no nível celular não são significativas. são incubados em soluções que contêm os genes a serem transferidos e. A transformação de uma célula vegetal é um tipo de manipulação genética que atende ao mesmo princípio da transformação de microrganismos. Papel dos transgênicos na economia mundial: O século passado teve um grande desenvolvimento na biotecnologia microbiana. O plasmídeo encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a transformação de plantas. Neste século. 34 . A transferência é alcançada por um dos métodos seguintes: A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais. esta etapa ainda representa o maior gargalo na criação de plantas transgênicas. Os genes entram nas células junto com o projétil de maneira não-letal. Ou seja. estabelecido pela primeira vez em 1973. a não ser que possam ser transferidas para todas as células do organismo. em seguida. embora esta técnica já esteja estabelecida para inúmeras plantas de interesse econômico. um choque elétrico de alta voltagem é aplicado por curtíssimo tempo. E. Parte do plasmídeo é um transposon (T DNA) que produz cópias de si mesmo nos cromossomos da planta infectada. inserindo-se aleatoriamente nas organelas celulares. desprovidas de parede celular. é esperado um rápido desenvolvimento na biotecnologia animal e vegetal. há diferenças conceituais entre a situação com microrganismos e com plantas: nos primeiros. Para a transformação. B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio cobertos com os genes de interesse. ocorrendo o processo de integração do gene exógeno no genoma do organismo a ser modificado. No entanto.Transferência dos genes de interesse em plantas: A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado . esta célula ou grupos delas são estimuladas a gerar uma planta transformada. nutricionais e ambientais para a regeneração. quando Stanley e Cohen. os objetivos finais são mudanças operadas no nível celular.

U. Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30 milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. biofertilizantes e biopesticidas. resistência a insetos e vírus. podem promover saúde trazendo benefícios para consumidores. Falck-Zepeda et al 1999).1999. incluindo tolerância a herbicidas. dando resistência contra pragas de insetos ou viroses. Alimentos produzidos através de tecnologias de modificação genética podem ser mais nutritivos. é necessário utilizar de forma adequada e responsável as novas tecnologias e descobertas científicas. Esforços em conjunto. os E. Para isso. a agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em volume. devem ser feitos para investigar os efeitos potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas.A. Vegetais geneticamente modificados: A maioria dos produtos já liberados para a comercialização contém transgenes que codificam características que visam minimizar estresses ambientais. De acordo com uma pesquisa sobre a expectativa de comercialização de produtos obtidos de organismos geneticamente modificados nos E.A aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade apareceu no mercado europeu.U. biorremediação e tratamento de águas. podendo-se chegar na casa dos milhares em algumas décadas. as características que visam aumentar a qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e deverão prevalecer nas próximas gerações de produtos transgênicos. É essencial melhorar a produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial crescente. enquanto reduzimos os impactos ambientais. estáveis quando armazenados e. um decréscimo no preço devido a custos reduzidos e aumento da facilidade de produção (University of Illinois. em casos limitados. os consumidores dificilmente notaram qualquer benefício além de. Os desenvolvimentos resultantes em variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado no aumento de vida em prateleiras de frutas e vegetais. bioprocessamento. onde as lavouras transgênicas são permitidas oficialmente.. Benefícios promovidos pelos transgênicos na agricultura: A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de plantas para alimentação. Na década de 90. Esses esforços devem ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da agricultura. seja em nações industrializadas ou em desenvolvimento. A seguir são apresentados alguns exemplos do uso da tecnologia da modificação genética de vegetais aplicada a alguns problemas específicos da agricultura: 35 . No Brasil. muitos alimentos transgênicos importados já são comercializados e estima-se a importação de 3 milhões de toneladas de milho da Argentina e dos E. organizados. No entanto. especialmente para a produção de metabólitos secundários.U. em princípio. que estejam atualmente em uso. e produzindo tolerância a determinados herbicidas. principalmente com características preferidas pelo mercado.A. algumas tendo se tornado sucessos comerciais. Enquanto essas características têm trazido benefícios aos agricultores.A modificação genética de microrganismos continua sendo uma importante complementação para as modificações genéticas de plantas e animais. O ritmo atual de liberação de OGMs indica que na primeira década deste século já teremos uma centena de produtos geneticamente modificados nas prateleiras dos supermercados.

temos o vírus Mottle Amarelo do arroz (RYMV). Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual. 36 . As plantas transgênicas contêm entre 2 e 4 vezes mais ferro do que normalmente encontrado no arroz convencional. o trigo semi-anão que possui genes insensíveis à giberelina. Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições. 1999).Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada no Hawai desde 1996 (Gonsalves. Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto rendimento como. através da criação de plantas de arroz transgênico resistentes ao RYMV. Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro. e o desenvolvimento da sua parte reprodutiva (comestível) é aumentado. que devasta os arrozais africanos. os pesquisadores utilizaram uma técnica de imunização genética. Estes genes (NORIN 10) agem da mesma forma quando utilizados para transformar outras espécies de plantas importantes como alimento. Porém. Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e cultivado. A introdução desses genes faz com que se obtenha uma planta mais baixa. O gene introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio excedente. cientistas conseguiram fazer crescer e desenvolver em água contendo forte teor de sódio. de forma a combater a anemia. temos um gene de tolerância em manguezais (Avicennia marina) que foi clonado e transferido para outras plantas que se mostraram mais tolerantes a altas concentrações de sal. tomates perfeitamente comestíveis. Como exemplo. É resultado do uso de modificação genética em vegetais visando obter maior resistência a uma praga específica. com conseqüente diminuição ou eliminação da necessidade do uso de pesticidas. uma vez que o alongamento das células na parte vegetativa é reduzido. mais forte e que aumenta o rendimento da safra diretamente. por exemplo. Como exemplo. Um exemplo de combate ao stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em solos ácidos (de La Fuente et al 1997). como acontece com o uso de inseticidas. 1998). deve-se considerar o fato de que populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta transgênica. Ele foi produzido usando-se genes envolvidos na produção de proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na dieta humana (Goto et al. graças à injeção de um único gene capaz de absorver um excedente de sal em plantações de tomate. Segundo a revista Nature Biotechnology.

Será iniciado um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o consumo de alimentos transgênicos. o grupo contra deverá utilizar argumentos que condenem os transgênicos..br/start. (2001) Life – the science of Biology. H. Orians. Utilize sua lista. benefício para a saúde etc. Referências • Lewin.C.) (1996) Biologia Molecular Básica.Freeman and Company..Posicionamento da SBBq: http://www.Conselho Nacional de Biossegurança: www.br/cienciahoje/ch/ch146. como a cegueira noturna.br/ctnbio/bio/artigos/004. Polêmica sobre os Alimentos Transgênicos .php?id=port Questões para Discussão Cada sala deve ser organizada em dois grandes grupos – pró e contra.Artigo da revista Ciência Hoje com link para arquivo pdf. Oxford University Press. W. portanto.ctnbio.gov. Porto Alegre.: www. O resultado desse experimento foi a produção de grãos amarelados de arroz. (Coord. redigida nas “questões para estudo” para auxiliar o debate. (1989) The Biology of Plants. • Zaha. 37 . agroeconomia.uol. • Okamuro.arroz normal arroz transgênico Pesquisadores desenvolveram arroz com alto teor de beta-caroteno. ressecamento da córnea. & Goldberg. Academic Press Inc.Posicionamento do Conselho Nacional de Nutricionistas: www. Inc & W. A.B. Ed. Cerca de 300 g desse arroz cozido por dia suprem as necessidades de betacaroteno de um indivíduo. R.D.G. 6th. New Yourk.K.htm .H. Sinauer AssociaTES. devido à presença de beta-caroteno. Sadava. 1ed. & Heller.com.org. J. Foram inseridos genes de bactérias que fazem a conversão do precursor presente no arroz em beta-caroteno. redução do custo ou aumento do preço dos alimentos. aumento da produtividade.br/variavel/destaque/pgdestaque2. precursor da vitamina A. Em cada sala haverá um professor para mediar o debate e esclarecer as regras da atividade.htm . Mercado Aberto.K. O debate não deve.H. Em ambos os casos os argumentos devem ser os mais variados possíveis. B.htm .org. diarréias e sarampo.sbbq. (1994) Genes. ser limitado a aspectos nutricionais.cfn. envolvendo tópicos como impacto ambiental. • Purves. que ajuda a combater diversas doenças.

Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta. 17. 3. 1.0.Preparação do DNA plasmidialFundamento: Existem vários procedimentos para purificação em pequena escala de DNA plasmidial de células bacterianas. 11. contendo 0. 2.2 N .Solução de lise – SDS 1% em NaOH 0. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro eppendorf contendo 300µ l de Isopropanol. Um dos métodos mais utilizados consiste na lise das bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio). Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra na proporção 1:10. 15. 4. 12. . separando-o do DNA cromossomal bacteriano. Incubar a mistura por 5 min á temperatura ambiente. Neste procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo removidos por centrifugação. Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no Vórtex. 16. 5. 14. Incubar o tubo em gelo por 20 min. Centrifugar a 12000xg por 15 min á temperatura ambiente.Solução Neutralizadora – Acetato de potássio 3M pH 4. Centrifugar a 12000xg por 5 min á temperatura ambiente.Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose . EDTA 10mM. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e delicadamente. Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min. Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência anterior. Incubar por 5 min à 65 °C. Centrifugar a 12000xg por 5 min á temperatura ambiente.7% de Agarose em TBE. 8. 10. Ribonuclease A 150µ g/ml em TrisHCl 25mM pH 8. Soluções utilizadas: . Centrifugar a 12000xg por 10 min á temperatura ambiente . Tomar 1 ml da cultura e colocar em um tubo de eppendorf. Utilizaremos cultura de E.E . O DNA plasmidial purificado é em seguida concentrado por precipitação com etanol. 18. Aplicar a amostra em gel 0.8. 13.5 µ l/ml de Brometo de etídio e submeter a eletroforese a 100V em Tampão TBE. 7. extrair e purificar o DNA plasmidial. 6. 9.coli em meio LB-A (50µ g/ml ampicilina). Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T. 38 .GET / Rnase – dextrose 50mM. Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente.

Qual a função do NaOH e do SDS presentes na solução de lise ? 4. Portanto a introdução de pBR322 em E. em resistentes.Questões 1.coli) o pBR322 apresenta duas marcas genéticas. 39 .Transformação de bactéria com plasmídeo contendo genes de resistência a antibióticos Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua manutenção como um elemento autônomo auto-replicativo.5 mg/ml tetraciclina. Na aula prática usaremos o método do CaCl2. Por que se dissolve a preparação de DNA em tampão Tris-EDTA ? 7. Usaremos o plasmídeo pBR322 (ver mapa). Neste método as bactérias são submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes para a transformação pelo DNA do plasmídeo.. EDTA e Tris) ? 2. Como age o isopropanol ? Este álcool poderia ser substituído por etanol. Se o DNA cromosomal tiver sido muito quebrado durante as manipulações. genes que codificam para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). onde espera encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de DNA plasmidial? 5. O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de genes. será revelada através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LBtet. Que papel desempenha cada componente do tampão GET (glicose. Da mesma forma.coli que normalmente é sensível tanto à ampicilina como à tetraciclina. Transformação de bactérias que são sensíveis a um antibiótico. por exemplo ? 6. clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina. Contendo 50 mg/ml ampicilina ou 12. uma vez que este sítio está localizado na região amp r. O que é lisozima e para que é usada na preparação de plasmídeos ? 3. Várias técnicas são disponíveis para transformar uma bactéria. Além da origem de replicação que permite sua propagação em bactérias (E. leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido) contento estes antibióticos. Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ? . ou seja. Este plasmídeo pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas) que podem ter valor seletivo no meio. Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da resistência à ampicilina.

1 M.5 contendo 1 mM EDTA) a um dos tubos. Antes de dar o choque térmico (42°C por exatamente 90 segundos) . Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E. por uma hora. O outro tubo será usado como controle (bactéria apenas). incubar à 37°C sob agitação até OD600nm=0. 7.Procedimento experimental: O ideal é que a experiência seja realizada em ambiente asséptico (fluxo laminar). 40 . As bactérias competentes assim preparadas podem ser armazenadas a –80°C. à 37°C até o dia seguinte sob agitação forte (200-250 rpm). em banho-maria.9 ml/tubo de meio LB e incubar a 37°C sem agitação. Coletar as bactérias (4000 rpm. 8. 6. No gelo estas BACTÉRIAS COMPETENTES podem ser transformadas. Após pelo menos 30 min. Espalhar as bactérias com o auxílio de uma alça de vidro. 1. 4. Incubar em gelo por 15 min. Transferir a cultura para o gelo. 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão (frio).3 (fase logarítmica de crescimento). para evitar contaminação. Manipule convenientemente o material estéril fornecido. Para transformar.5 µ g DNA de pBR322 em 10µ l de tampão 10mM Tris pH7.5 contendo CaCl2 0. 9. Incubar no gelo por 20 minutos. para uso posterior. Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM pH6.1 ml/tubo da suspensão de bactérias competentes para cada um de 2 tubos. distribuir 0. As bactérias competentes para transformação são preparadas a partir de uma cultura em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma solução de CaCl2. Diluir a pré-cultura 1/10 em 10 ml de meio LB. previamente flambada e em seguida resfriada na própria tampa da placa de Petri. 3. 5. coletar as bactérias por centrifugação (4000 rpm. Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO. Adicionar 0.coli) e incubar 2. 5 min). Adicionar o DNA transformante (0. Transferir os tubos para o gelo por 2 min.

Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes? 2. Por que as bactérias devem ser incubadas por 60 min. Qual a eficiência de transformação obtida. 41 . em termos de n° de colônias / µ g de DNA? Questões 1. Qual o papel do choque térmico? 3.Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| ANÁLISE DOS RESULTADOS 1. a 37°C antes de espalhá-las em placas de ágar? 4. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo. Preencher a tabela com o número de colônias obtido em cada caso: Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| 2.