Bioquímica: Metabolismo e Biologia Molecular (QBQ0214 Noturno) Segunda e Quarta-Feira das 19 às 23 h

QBQ 0214 Departamento de Bioquímica Instituto de Química 2009 Docentes: Prof Dr. Alexander Henning Ulrich (Coordenador) Bloco 8 Sup. Sala 854 Profa Dra. Deborah Schechtman Bloco 10 Inf. Sala 1013/1018

Monitores: Cecília Midori Ikegami (cikegami@usp.br) Mariana Lemos Duarte (mlduarte@gmail.com)

Programa Os tópicos apresentados ao longo do semestre são: enzimas; metabolismo; glicólise; gliconeogênese; oxidação de triacilgliceróis; ciclo de krebs; cadeia de transporte de elétrons; fosforilação oxidativa; glicogênio; controle hormonal; corpos cetônicos; síntese de triacilgliceróis; aminoácidos; regulação integrada; diabetes; biologia molecular; alimentos transgênicos. Bibliografia - Bioquímica Básica: A. Marzzoco & B.B. Torres – Ed. Guanabara Koogan - 2a ed.; 1999. - Princípios de Bioquímica: A.L. Lehninger, D.L. Nelson & M.M. Cox – 3a ed. Sarvier; 2002. - Bioquímica: L. Stryer – Ed. Guanabara Koogan – 4a ed.; 1996. - Fundamentos de Bioquímica – D. Voet, J. G. Voet & C. W. Pratt – Artmed Editora; 2000. - Biochemistry: D. Voet & J.G. Voet – John Wiley & Sons – 3ttded; 2004. - Biochemistry: J. M. Berg, J.L. Tymoczko & L. Stryer -.Freeman and Company – 5thed.; 2002. - Textbook of Biochemistry with Clinical Correlations: T.M. Devlin – John Wiley & Sons, Inc., 5th ed New York; 2001. - Biochemistry: C. K. Mathews & K.E. van Holde – The Benjamin/Cummings Publishing Company; 1996. - Principles of Biochemistry: H.R. Horton, L.A. Moran, R.S. Ochs, J.D. Rawn & K.G. Scrimgeour Prentice Hall; 1993. - Principles of Biochemistry: G.L. Zubay, W.W. Parson & D.E. Vance – WCB Publishers; 1995. - Nutritional Biochemistry: T. Brody – Academic Press; 1994. - Biochemistry – A Foundation: P. Ritter – Brooks/Cole Publishing Company; 1996. Critério de Avaliação O aluno será avaliado por três avaliações, testes e ainda um seminário que serão realizados ao longo do semestre. A nota das avaliações será obtida pela média aritmética das notas da Avaliação 1 (peso 1), Avaliação 2 (peso 2) e Avaliação 3 (peso 4). A média dos testes somará 1,5, os relatórios de aulas práticas valerão 1,0 e os seminários valerão 0,5. O cálculo da nota final deverá ser feito através da seguinte equação: NF = A1 + (A2X2) + (A3X4) + 1,5 + 1,0 + 0,5 10

2

Cronograma de Aulas 17/08 19/08 24/08 26/08 31/08 02/09 07/09 09/09 14/09 16/09 21/09 23/09 28/09 30/09 05/10 07/10 12/10 14/10 19/10 19/10 21/10 26/10 28/10 02/11 04/11 09/11 11/11 16/11 18/11 23/11 25/11 30/11 02/12 Aula 9 Aula 10 Aula 11 Aula 12 Aula 13 Aula 14 Aula 15 Aula 16 Aula 17 Aula 17 Aula 18 Aula 19 Aula 20 Aula 21 Aula 22 Aula 1 Aula 2 Aula 3 Aula 4 Aula 5 Aula 6 Aula 7 Aula 8 Enzima (funções e propriedades) Catabolismo/ Anabolismo (introdução) Glicolise (via das pentoses) Gliconeogênese – 1° Teste Oxidação de Triacilgliceróis Formação AcetilCoA (vitaminas e cofatores) – 2° Teste Feriado Ciclo de Krebs 1° Prova Fosforilação Oxidativa Laboratório1: Aceptores eletrônicos e efeitos de drogas na cadeia de transporte de elétrons. Sala multimídia - Cadeia de transporte de elétrons e fosforilação oxidativa Metabolismo de Glicogênio – 3° Teste Controle Hormonal (insulina, glucagon e vitaminas) Controle Hormonal (insulina, glucagon e vitaminas) Síntese de Triacilglicerol – 4° Teste Feriado 2° Prova Metabolismo de aminoácidos Ciclo da uréia Fonte de Nutrição – 5° Teste Feriado Regulação Integrada Feriado Regulação Integrada Diabetes – 6° Teste Tradução e Código Genético Regulação da Expressão Gênica Biologia Molecular (testes diagnósticos) Técnicas de Biologia Molecular; Transgênicos – 7° Teste Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose Apresentação de Seminários (Alimentação e BioMol) 3° Prova

3

AULA 1: ENZIMAS I. Classifique as afirmações abaixo como verdadeiras ou falsas: 1.1. Sempre que o número de moléculas de substrato for maior que o número de moléculas de enzimas, todas as moléculas de enzimas estarão ligadas a uma molécula de substrato. ( ) 1.2. A velocidade da reação é proporcional ao tempo da reação. ( ) 1.3. A velocidade da reação é proporcional à concentração de substrato.( ) 1.4. A velocidade da reação é proporcional à concentração de enzima, desde que a concentração de substrato não seja limitante. ( ) 1.5. A velocidade da reação é proporcional à concentração do complexo enzima-substrato. ( ) 1.6. A quantidade de produto formado depende do tempo da reação. ( ) 1.7. Ao final de cada experimento todo substrato foi convertido em produto. ( ) 2. Definir enzima, substrato e sítio ativo 3. Fazer o gráfico da velocidade da reação S →P, catalisada enzimaticamente, em função da concentração de S. 4. Definir constante de Michaelis-Menten (Km) e mostrar a relação entre seu valor e a afinidade da enzima pelo seu substrato 5. Fazer o gráfico da velocidade de uma reação enzimática em função de: a. Concentração de enzima; b. Temperatura; c. pH. Justificar a forma dos gráficos 6. Mantendo o sabor doce do milho. O sabor doce de um milho recém-colhido é devido ao alto nível de açúcar nas sementes. Milho armazenado (vários dias depois da coleta) não é tão doce porque cerca de 50% do açúcar livre é convertido em amido dentro de um dia após a coleta. Para preservar a doçura do milho fresco, as espigas podem ser imersas em água fervendo por alguns minutos (“escaldada”), depois esfriadas em água fria. O milho processado dessa maneira e armazenado em congelador mantém sua doçura. Qual é a base bioquímica para esse procedimento. 7. Para produzir um medicamento que atuasse sobre uma enzima bacteriana, qual seria o tipo de inibidor escolhido, competitivo ou não competitivo?

4

CASO 3 5 . trazido por colegas. Com o passar dos minutos esses sintomas foram aumentando em intensidade e surgiram uma intensa fraqueza e sudorese fria. vindo de Salvador. Embora tenha feito refeições corretas.Aula 2: Introdução ao Catabolismo e Anabolismo Obtenção de energia pelo Metabolismo MP I AA E q e ag ra d d g a a ã d n tr n s s u m e l a e r d ç o e u ie te A IM N O L ET S P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G oe lic s A in á id s m oc o Á id G x c o ra o C O ND A FD A + 2 ND AH FD AH 2 A P+P D O2 H2O i AP T A . tendo tido necessidade de um esforço intenso. nesta manhã. sendo conduzido ao Pronto Atendimento. fumante. vindo a cair da própria altura.. O paciente chegou no dia anterior a La Paz. extremidades frias e referindo forte dor de cabeça. CASO 1 P. foi posto sob respiração em balão de oxigênio e rapidamente sentiu-se melhor. Insistindo com a atividade que fazia.P. encontra-se pálido. saiu de casa sem comer nada e iniciou o trabalho. analisador de sistemas. Conta que nos últimos dias alimentou-se mal e. desmaiou. Depois dos exames preliminares.Ler o relato dos três casos apresentados a seguir. trabalhador da construção civil. masculino. precisou subir um lance de escada e sentiu-se muito cansado. após ter desmaiado no trabalho. Após 60 minutos de trabalho relata que começou a sentir dor de cabeça e tonturas. sudoreico.. 27 anos. Deu entrada no serviço de emergência. por volta das 10:00 horas da manhã. o cansado persistiu e agravava-se com atividades físicas que até a véspera fazia sem problemas.T. 32 anos. Foi dispensado do hospital.B. CASO 2 R. a tontura tornou-se muito forte e escureceu– lhe a vista. No final do terceiro dia. com a recomendação de que ingerisse chá ou outra bebida estimulante. No momento do exame. Relata que logo ao sair do aeroporto.

3. quais são excretados e qual é aproveitado pelas células? 6. Quais são os passos irreversíveis que aparecem no mapa? 2. o paciente sentiu forte dor no peito. de inicio abrupto. Que compostos são produzidos como conseqüência desta reação? Entre os compostos produzidos. O paciente iniciou há seis meses um quadro de dor no peito. Resuma: por que é necessário comer e por que é necessário respirar? 7. quer ocorra in vivo. A dor melhorava com o repouso. Uma parte da energia derivada da oxidação dos alimentos é usada para sintetizar um composto rico em energia (ATP). A manutenção destas concentrações é espontânea? Como o organismo consegue mantê-las? 8. Acrescentar O2. o número de átomos de carbono de alguns compostos. proteínas e lipídios? 6 . responder as questões seguintes. Que partes do Mapa I devem ser suprimidas quando referente exclusivamente ao cérebro? A síntese de ATP é obtida por oxidação ou redução dos alimentos? Discutir as seguintes afirmações: a. foi constatada obstrução parcial de uma das artérias coronárias. b. executivo. A oxidação biológica consiste na retirada de hidrogênio do substrato. fumante. ou ao sentir emoções. masculino. em aperto. Logo ao sair para o trabalho. HPO42-. relata o filho que o estava acompanhando. ADP e ATP nos espaços do esquema abaixo. Conta que o seu pai ficou pálido. 1. Os compostos característicos de um dado organismo devem ser supridos pela dieta. 5. A quantidade de energia derivada da oxidação de nutrientes é a mesma.. Com esse quadro foi trazido ao pronto socorro e embora fossem tentadas todas as manobras e medicações para a reanimação cardíaca. o paciente foi a óbito. Desde então vinha fazendo uso de remédios que promovem dilatação das coronárias. 42 anos. c.P. As concentrações celulares de Na+ e K+ são. começou a suar frio e dentro de poucos minutos perdeu a consciência e caiu. entre parênteses. A única função dos alimentos é fornecer energia. como subir uma ladeira caminhando. Os processos celulares que requerem energia utilizam a energia térmica proveniente da oxidação dos alimentos. Alimentos + Processos que requerem energia VIAS METABÓLICAS DEGRADATIVAS No Mapa II (página seguinte) encontra-se. d. no máximo.F. 2. A falta de que composto provocou os sintomas relatados nos três casos descritos? O que restringiu a síntese deste composto em cada um dos casos? Os sintomas dos casos 1 e 2 são claramente neurológicos. B – Com base no Mapa I. e. com duração de cinco a dez minutos. 4.J. Fazendo exames de avaliação cardíaca. 1. respectivamente 25 mmols/L e 150 mmols/L e as concentrações plasmáticas são 140 mmols/L e 5 mmols/L. quer se processe in vitro. f. Qual o primeiro composto comum à degradação de carboidratos. sempre que fazia algum esforço físico.

proteína a partir de ácido graxo e. são reversíveis. prever que grupo de animais sobreviveria. Animais de laboratório foram submetidos a dietas compostas exclusivamente de carboidratos. ou lipídios ou proteínas. ácido graxo a partir de glicose b. página 45 . verificando se é possível sintetizar: a. proteína a partir de glicose c. Mutases: Isomerases que catalisam a transferência de grupos fosfatos de baixa energia de uma posição para outra. 7 .O SENTIDO DAS REAÇÕES 2 – ALGUNS TIPOS DE ENZIMAS: Quinases: Catalisam a transferência de um grupo fosfato de um composto de alta energia (em geral ATP) para um aceptor. Fosfatases: Catalisam reações de hidrólise de ésteres de fosfato. Aldolases: Cindem açúcares fosforilados. por transferência de hidrogênio do substrato para uma coenzima. Desidrogenases: Catalisam reações de óxido-redução. dando origem a diidroxiacetona fosfato e a outro açúcar. glicose a partir de proteína f. na mesma molécula. Como é possível garantir sua sobrevivência quando as reservas de glicogênio tornam-se insuficientes para manter a glicemia? M P II AA P L S C R IO O IS A A ÍD S P OE A R T ÍN S L ÍD S IP IO G IC S L OE A sp F sfo o iru ato (3 o en lp v ) A IN Á ID S M OC O G ly A la S er Cs y L eu Ile Ls y Pe h G lu Á ID S G A O C O R X S L actato P v (3 iru ato ) C 2 O A cetil-C A(2 o ) C 2 O O alo x acetato (4 ) C 2 O M alato (4 ) Iso citrato (6) C 2 O Fm u arato (4 ) S ccin (4 u ato ) eto lu ) α C g tarato (5 C 2 O C itrato (6 ) 1 – Ler CAPÍTULO 4. Alguns tecidos (nervoso) e células (hemácias) obtêm ATP exclusivamente a partir de glicose. Estas reações. Não havendo outras restrições na dieta. 4. ácido graxo a partir de proteína Indicar no mapa a via utilizada para cada conversão.3. com três átomos de carbono a menos que o substrato original. Estes três tipos de compostos são essenciais para a sobrevivência. Isomerases: Catalisam reações de isomerização. glicose a partir de ácido graxo d. geralmente NAD+ ou FAD. na maior parte dos casos.

P C=O H2C-OH HC=O HC-OH H2C-O P Pi NAD + N ADH O= C-O.P Frutose 6-fosfato ATP ADP HO OH HO Frutose 1.P OH2COH H2O COO C.6 bisfosfato H2C-O.P ADP AT P Diidroxiacetona fosfato Gliceraldeído 3-fosfato Pi NAD + NADH 1.AULA 3: GLICÓLISE H OCH 2 OH O OH OH ATP ADP H O GLICÓLISE Glicose ATP ADP P -OCH 2 O HO OH OH OH Glicose 6-fosfato PO-CH 2 O CH 2OH HO OH HO AT P A DP P -OCH 2 O CH 2O. a fim de determinar as fontes de energia para o trabalho muscular e a capacidade física dos alunos. 8 .P OCH 2 A DP A TP C OO HCOH CH 3 NAD + NADH CO O C= O CH 3 2-Fosfoglicerato Fosfoenolpiruvato AD P ATP Lactato NAD + NADH Piruvato Alunos ingressantes em um curso de Educação Física foram submetidos a provas físicas. Os parâmetros medidos estão apresentados nas figuras 1 e 2.3 Bisfosfoglicerato 3-Fosfoglicerato COO HC.P HC-OH H2C-O P ADP ATP O =C-O HC-O H H2C-O.

Quais são os produtos finais da via glicolítica? 8. 6. 7. O esforço físico leva à produção de lactato? 2. Para cada molécula de glicose consumida qual é o número de moléculas de piruvato produzido? 9. Em caso afirmativo. a hemácia poderia excretar piruvato? 11. Qual a utilidade. estabelecer o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica. localize as reações que produzem ATP. Examinando a via metabólica que converte glicose a lactato (a glicólise). Sabendo que a concentração celular de NAD+ é da ordem de 10-5 M. utilizar apenas o mapa da glicólise (p. para a musculatura em exercício. é possível estimar a quantidade de glicose que pode ser convertida a lactato? 10. O exercício é o único processo que leva à produção de lactato? 3. do aumento da freqüência cardíaca? Para responder as questões de 6 a 14. esta adaptação foi suficiente para manter a lactemia basal? 5. Em lugar de excretar lactato.170 Freqüência Cardíaca (bat/min) 160 150 140 130 120 110 100 90 80 0 0 2 4 B B (tiro de 30s) A (caminhada) Figura 1: freqüência cardíaca durante caminhada de 15 min (A) e tiro de 30 s (B) A 30s 6 8 10 14 15 min 16 tempo Figura 2: Níveis de lactato plasmático durante caminhada de 15 min (A) e tiro de 30 s (B) 9 8 7 B B (tiro de 30s) A (caminhada) Lactatemia (mmol/L) 6 5 4 3 2 1 0 0 0 2 4 30s A 6 8 10 14 15min 16 tempo Analisando os dados acima e com auxilio de livros responda as questões: 1. 9 .124). Houve adaptação da freqüência cardíaca ao exercício físico leve e ao extenuante? 4. Considerando o número de moléculas de ATP consumidas e formadas.

Saccharomyces cerevisiae (levedo) cresce anaerobiamente. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? 4. Como é possível esta transformação se há reações irreversíveis na glicólise? Todos os tecidos operam esta conversão? Que outros compostos podem ser convertidos a glicose pela gliconeogênese? d) Quais seriam as conseqüências para uma célula do funcionamento simultâneo da glicólise e da gliconeogênese? e) Explicar como é feito o controle das duas vias. à p. 3-Mercaptopicolinato inibe a conversão de glicose 6-fosfato a glicose mas não inibe a conversão de glicose a glicose 6-fosfato. 6. 10) indicavam que o oxigênio é necessário para a produção de energia pelo organismo. consultando o Mapa I. 13. a partir de que tipo de macronutriente pode ser mantido o nível glicêmico adequado para prover glicose para as células que dependem deste açúcar? [Consulte o MAPA II. No entanto. AULA 4: GLICONEOGÊNESE 1. usando as informações do quadro apresentado acima. Verificar quais são os efetuadores alostéricos da fosfofrutoquinase. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese. Explicar este aparente paradoxo. Indicar a função da via glicolítica. Seria possível excretar piruvato em lugar de etanol? Que semelhança tem este metabolismo com o do tecido muscular em condições de esforço extenuante? 3. a glicólise é anaeróbia e produz ATP. Levar em consideração o fato de o nível de frutose 2.12. pode ser convertido a glicose por um processo chamado gliconeogênese. Os Casos clínicos 2 e 3 (p. 7] c) Muitos aminoácidos podem ser convertidos a piruvato que. Citar as vitaminas necessárias para as seguintes conversões: a) glicose → lactato b) lactato → glicose 7. 5. Citar o tecido responsável pela gliconeogênese. Citar os compostos que devem ser fornecidos à via glicolítica para: a) iniciá-la (haver formação de lactato). f) Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. É possível converter lactato a glicose por um processo chamado gliconeogênese.6 bisfosfato nos hepatócitos variar com a disponibilidade da glicose: é baixo no jejum e alto após as refeições. a) Verificar se é possível produzir glicose a partir de lactato ou de piruvato pela via glicolítica. Explique. b) Se a dieta contiver quantidades insuficientes de carboidratos. b) mantê-la em funcionamento 10 . por sua vez. usando glicose como fonte de carbono e produzindo etanol. 2.

11 .

Em aerobiose. Exame Físico: Peso na admissão 105. catalisa uma reação da qual os ácidos graxos não participam. quando todos os carbonos do glicerol estiverem marcados ou em ambos os casos? 3. que casou há cinco anos pesando 60 kg. 4. Após dois anos de casamento. É possível haver oxidação completa de um ácido graxo sem a presença de carnitina? 5. Apresenta boa função cardíaca e pulmonar. Exames Laboratoriais: Glicemia = 95mg% (Valor de Referência = 70 – 105 mg%) Colesterol = 357 mg/dL (Valor de Referência = 120-220 mg/dL) Soro lipêmico Triacilgliceróis = 680mg/dL (Valor de Referência = 40 – 150 mg/dL) Evolução: A partir da admissão a paciente foi submetida a uma dieta de 600 kcalorias. Além das enzimas. O ciclo de Lynen pode ser feito em condições anaeróbias? 6. a paciente engravidou novamente. nicotinamida e/ou ácido lipóico? 8. 12 . distribuída em cinco refeições. seu peso chegou a 105 kg. biotina. Como é possível obter ATP a partir de etanol? Caso clínico Identificação: A. Quando é possível detectar a formação de glicose radioativa: quando todos os carbonos dos radicais acila do triacilglicerol estiverem marcados com C14.4 kg. Explicar este aparente paradoxo. na admissão a um centro de emagrecimento.67 m. Altura de 1. Não apresenta problemas de saúde e não se queixa de nenhum mal estar. Quando o primeiro filho completava um ano e meio ano. Após passar por avaliação médica e de capacidade física.. que compostos deveriam ser adicionados a um tubo de ensaio que contém um mol de palmitoil-CoA para sua conversão completa a acetil-coA? 7. Por que hemácia e tecido nervoso não oxidam ácidos graxos? 10. A pirofosfatase é uma enzima essencial para que o fluxo de ácidos graxos para o interior da mitocôndria se processe com eficiência. Por esse motivo deu entrada em um spa. Queixa e Duração: Aumento de peso após as gestações História Pregressa da Moléstia Atual: A paciente relata. A deficiência de qual (quais) das seguintes vitaminas compromete a realização do ciclo de Lynen: riboflavina. e após esse segundo parto. pantotenato. O que provoca a degradação dos triacilgliceróis no tecido adiposo? 2. Citar a localização celular da beta-oxidação. Encontra-se com leve edema dos membros inferiores. Nessa gestação a paciente engordou cerca de 20 kg e perdeu muito pouco após o parto. entretanto. casada.AULA 5: OXIDAÇÃO DE TRIACILGLICERÓIS 1. C. 9. Essa enzima. 35 anos. nasceu o primeiro filho. o levedo pode oxidar etanol.

De que forma isso contribui para o emagrecimento da paciente? 3. 6. dispensando mais tempo para as caminhadas (duas vezes ao dia. as vitaminas envolvidas. Após oito meses de tratamento. 2. e manutenção de prática de exercícios físicos. verificando a estrutura química da nicotinamida adenina dinucleotídio (NAD+) e da flavina adenina dinucleotídio (FAD) nas suas formas oxidada e reduzida. totalizando uma perda total de 19. Que composto o organismo armazenou. b. 7. Por que a inibição da piruvato translocase provoca o acúmulo de lactato? 2.iniciou um treinamento adequado à sua capacidade e com cerca de quatro horas diárias de exercícios. 5. as 5 coenzimas necessárias. portanto com perda de cerca de 10% do peso inicial. a paciente tem um déficit energético. Ingerindo uma dieta de 600 kcalorias. carboidratos e lipídios).1 kg e prepara-se para submeter-se a uma cirurgia plástica. com caminhadas de uma hora por dia e natação com aulas de 50 minutos. As necessidades nutricionais de vitaminas são quantitativamente muito menores do que as dos macronutrientes (proteínas. hidroginástica e natação (no mínimo uma hora por dia). como jogos. relacionando sua função com atividade enzimática.7 kg (18. feitos de maneira fracionada e diversificada.7 kg. Descrever a ação da acetil-CoA sobre a piruvato carboxilase e as conseqüências desta ação. encontra-se com 71. c. Após completar 30 dias de estadia a paciente retornou para casa pesando 85. Por volta do 4o dia de estadia. Foi aconselhada a aumentar o ritmo dos exercícios físicos para 6 horas/dia. AULA 7: CICLO DE KREBS 13 . No 10o dia da estadia a paciente pesava 94. 3. Definir cofator. com cerca de uma hora de cada vez). levando a 45 kg de aumento no peso da paciente? Citar o tecido de armazenamento corpóreo do composto. dando ênfase às caminhadas. 8.7%). Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar: a. A paciente sempre foi orientada a praticar exercícios físicos. a localização celular. Indicar as vitaminas necessárias para a reação de formação de acetil-CoA a partir de piruvato. Uma célula alimentada exclusivamente com glicose poderia excretar acetil-CoA? 4. a paciente sentiu-se com sonolência. Manutenção: Regime alimentar. sensação de enjôo e gosto amargo na boca. com uma dieta de aproximadamente 900 kcalorias.8 kg. dança (cerca de uma hora por dia) e atividades na piscina. Em que esses exercícios colaboram para a perda de peso? AULA 6: FORMAÇÃO DE ACETIL-COA 1. Definir vitaminas. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas). três vezes na semana. tendo sido orientada quanto ao caráter reversível desses sintomas. Explicar a razão. 1.

A quantidade de oxigênio consumido pela cadeia de transporte de elétrons tem relação estequiométrica com a quantidade de NADH oxidado? 3. Simultaneamente deve haver redução de alguma substância? Que tipo de composto deve sofrer redução? 3. Em qual (quais) caso(s) aumentou a concentração de oxaloacetato? 5. Uma suspensão de mitocôndrias. citrato e ácidos graxos. Quais são os grupos responsáveis pelo transporte de elétrons em cada um dos compostos que fazem parte da cadeia de transporte de elétrons? 2. com acetil-CoA. Que composto do ciclo de Krebs acumula-se quando a razão ATP/ADP é alta? E quando a razão NAD+/NADH é baixa? Levar em conta os dados da tabela seguinte que mostram a regulação principal do ciclo de Krebs Enzima Isocitrato desidrogenase Efetuadores alostéricos Positivos Negativos ADP – NAD+ ATP . Que composto é oxidado no ciclo de Krebs? 2. Quando incubação semelhante foi feita substituindo o malato por succinato. suplementada com acetil-CoA marcada com C14 só produz CO2 marcado em aerobiose. 7). AULA 8: CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA 1. se a rotenona fosse substituída por cianeto ou por antimicina A? LABORATÓRIO 1: FRACIONAMENTO CELULAR E VERIFICAÇÃO DA ATIVIDADE DA SUCCINATO DESIDROGENASE -Protocolo Experimental 14 . nos dois casos. (c) acetil-CoA + oxaloacetato. Uma suspensão de mitocôndrias incubada com malato e rotenona não apresentou consumo de oxigênio. 1. há produção de CO2 marcado se for adicionado azul de metileno. Em cada caso. piruvato. neste caso. a.Para responder às questões de 1 a 4 usar apenas os Mapas I (p.NADH 7. Explique estes dados. Que resultado haveria. glutamato. Em anaerobiose. ocorreu consumo de oxigênio. observa-se também a descoloração do corante (azul de metileno reduzido é incolor). Explicar este resultado. que porcentual do composto adicionado estará presente no final da reação? 6. 5 ) e II (p. Por que? b. Explicar por que dietas ricas em carboidratos e/ou proteínas levam a um acúmulo de citrato. 4. (d) acetil-CoA + succinato. além das enzimas e coenzimas: (a) acetil-CoA. (b) oxaloacetato. Uma suspensão de mitocôndrias foi incubada. Verificar se é possível a ocorrência completa do ciclo de Krebs adicionando a um tubo que contém. separadamente.

Remover o fígado.32 . planejar o controle da experiência. com exceção do reagente pfenilenodiamina.000 rpm por 30 minutos. observe a inibição competitiva da enzima por malonato. Você obterá o precipitado 1 e um sobrenadante 1 . B. escrever a reação que está sendo analisada. as frações devem ser incubadas a 37°C. mergulhá-lo em 20 ml de uma solução de sacarose 0. Antes de iniciar a experiência o grupo deve: 1. PAR REDOX NADH/NAD+ 15 EO’ -0. Deixe os tubos 10 minutos à temperatura ambiente e compare suas cores. existe o fator cinético e você deverá fazer as comparações ATENTAMENTE A CURTOS INTERVALOS DE TEMPO. Novamente você obterá o precipitado2 e o sobrenadante 2. INIBIÇÃO DA SUCCINATO DESIDROGENASE POR MALONATO Sabendo em que fração celular se encontra a atividade da succinato desidrogenase. catalisada pela succinato desidrogenase. picando-o bem com a tesoura. azul de metileno e óleo mineral. por 10 minutos. aqueça os tubos a 37°C por 5 minutos e os compare novamente. Esta será a fração celular II.25M. Decantar e descartar o sobrenadante. Ressuspender o precipitado 2 obtido em 4ml de sacarose 0.25M (previamente resfriada a 0 graus). Recolher o sobrenadante2 com uma pipeta Pasteur em um tubo de ensaio e conservá-lo no gelo. misturar. NÃO ESQUEÇA a inibição é competitiva. Seguir o protocolo 2. Esta determinação deve ser feita com o uso de aceptores e doadores artificiais de elétrons: a escolha dos aceptores e doadores artificiais de elétrons deve ser feita consultando as tabelas que se seguem. Sacrificar um rato em jejum por concussão cerebral. tornar a decantar e descartar o sobrenadante. Você utilizará a redução do MTT via succinato desidrogenase: o MTT é amarelo quando oxidado e violeta quando reduzido. Adicionar novamente 20ml de sacarose 0. Para verificar a oxidação do succinato. discutir as funções do succinato.a) Fracionamento celular b) Verificação da atividade de succinato desidrogenase O azul de metileno pode apresentar-se na forma oxidada (azul) ou reduzida (incolor). A redução do azul de metileno pode ser obtida a partir da oxidação do succinato. A. um processo historicamente importante na elucidação das etapas de ciclo de Krebs.000 rpm por 10 minutos. sacarose. Os aceptores e doadores são fornecidos na forma oxidada. 3. Seguir o protocolo 1. Adicionar outros 20 ml da solução de sacarose. DETERMINAÇÃO DO PONTO DE AÇÃO DE DROGAS NA CADEIA DE TRANSPORTE DE ELÉTRONS. Se a reação estiver lenta (isto dependerá da sua preparação mitocondrial). 2.25M gelada. Esta será a fração celular I. Separar o sobrenadante 1 e centrifugá-lo novamente a 10. não sendo reoxidado pelo O2 do ar. homogeneizar o fígado e centrifugar a 4.

1 0.40 0.20 -0.36 0.36 0.00 0.82 ACEPTORES E DOADORES ARTIFICIAIS Piocianina red/ox 2.22 0.1 0.06 0.Succinato/Fumarato FADH2/FAD Azul de metileno red/ox Cit b (Fe 2+)/ Cit b (Fe 3+) Cit c1 (Fe 2+)/ Cit c1 (Fe 3+) Cit c (Fe 2+)/ Cit c (Fe 3+) Cit a-a3 (Fe 2+)/ Cit a-a3 (Fe 3+) H2O / ½ O2 -0.3 0.diclorofenolindofenol (DCPI) Benzilviológeno Ferricianeto Incolor Incolor Incolor Incolor 16 VOLUME UTILIZADO 0.6.6-diclorofenolindofenol (DCPI) red/ox Benzilviológeno red/ox Ferricianeto Fe(CN)64-/Fe(CN)63p-fenilenodiamino (p-FDA) red/ox EO’ -0.3 0.25 0.3 0.2 Azul Azul Violeta Amarelo .27 COR DOS ACEPTORES E DOADORES ARTIFICIAIS NAS FORMAS REDUZIDA E OXIDADA REDUZIDO OXIDADO Piocianina 2.34 0.

5 cm 2 0.p-fenilendiamino (p-FDA) Incolor Violeta 0.5 ml 0.2 ml 0.2 ml 25µ l 0.2 ml 0.2 ml 0.0 ml 0.5 ml 0.5M MTT Água Destilada Fração Celular 1 0.2 ml 6 0.1 ml 1.2 ml 25µ l 0.1 ml 1.2 ml 0.2 ml 5 0.0 ml 0. PROTOCOLO 1 TUBO Tampão A Sacarose 0.2 ml 0.1 ml 0.2 ml 3 0.1 ml 1.1 ml 25µ l 0.2 ml 7 0.3 ml 0.1 (II) 0.5 ml 0.2 ml 0.1 ml 0.5 .3 ml 1.3 ml 1.2 ml 4 0.1 ml 1.0 ml 0.3 ml 0.3 ml 1.4 ml 0. Incubar os tubos a 37°C por 10 minutos e discutir o resultado com os colegas.5 cm 3 0.5 ml 0.2 ml PROTOCOLO 3 17 .1 ml 25µ l 0.0 ml 0.4 ml 0.3 ml 1.1 ml 0.5M Azul de Metileno Água Destilada Fração Celular Nujol 1 0.7M Succinato 0.6 ml 0.2 ml 0.2 ml 25µ l 0.1 ml 1.2 ml 2 0.1 (I) 0.5 cm 5 0.1 ml 25µ l 0.0 ml 0.2 ml 0.4 ml 25µ l 0.4 ml 0.Seguir o protocolo 3. identificando as drogas A e B.5 cm PROTOCOLO 2 TUBO Tampão A Malonato Succinato 0.5 cm 4 0.1 ml 0.1 (I) 0.2 ml 0.3 ml 0.3 ml 1.1 (II) 0.

TUBO Volume (ml) Tampão A Sacarose 0.2 0.4 1.1 0.2 0.5 0.5 0. j.9 0. Hemácia e tecido nervoso fazem fosforilação oxidativa? 18 .0 0.4 1.0 0. e.4 1.0 0.7M Succinato 0. d.1 0.0 0.5 0.4 1.8 0.2 1.0 0.2 0.5 0.3 0.5 0. Correto? 5.0 0. a.3 0. Na presença de dinitrofenol a oxidação de NADH é mais lenta do que na ausência daquele composto. h.2 0.0 0.2 1.9 0.5 0.0 0. Com auxílio do software. É possível a oxidação contínua de NADH na ausência de ADP? Qual é o mecanismo de controle fisiológico da velocidade da cadeia de transporte de elétrons? 4.1 0.5 0.0 0.1 0.5M Droga A ou B Ferricianeto DCPI p-FDA Água Destilada Fração Celular Nujol (cm) 1 2 3 4 5 6 7 8 9 0.0 0.2 0. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 3.5 1.5 AULA 9: CADEIA DE TRANSPORTE DE ELÉTRONS MULTIMÍDIA 1.2 0.4 1.2 0.0 0.4 1.5 0.3 0.1 0. c. responder as questões seguintes: Sempre que há consumo de oxigênio há síntese de ATP? Sempre que há síntese de ATP há consumo de oxigênio? Sempre que há aumento do potencial de membrana há consumo de oxigênio? Sempre que há consumo de oxigênio há aumento do potencial de membrana? Dinitrofenol (DNP) afeta o consumo de oxigênio? Afeta o potencial de membrana? Pode haver síntese de ATP sem aumento do potencial de membrana? Pode haver consumo de oxigênio sem aumento do potencial de membrana? A inibição do consumo de oxigênio por rotenona pode ser revertida por algum composto? i.2 0.3 1. Software Cadeia de Transporte de Elétrons. b.9 0.5 0.2 0.8 0. A inibição do consumo de oxigênio por oligomicina pode ser revertida por algum composto? A inibição do consumo de oxigênio por cianeto pode ser revertida por algum composto? 2.2 0.4 1.5 0. f.4 1. g.4 1.

Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 6. A fosfodiesterase catalisa a conversão de cAMP a AMP. Ordenar a atuação das enzimas listadas abaixo para que seja obtida a degradação do glicogênio. Há gasto de ATP para a síntese de glicogênio a partir de glicose? 19 . Apontar as que utilizam ATP e as que utilizam HPO42--. 11. A intensidade da fosforilação oxidativa tem relação direta com a quantidade de NADH oxidado? 8. Escrever os substratos e os produtos das reações catalisadas por a) proteína quinase b) glicogênio fosforilase quinase c) fosfoproteína fosfatase 3. Correto? 2. 7. Explicar estes resultados. As duas extremidades do glicogênio são idênticas? Todas as ligações glicosídicas encontradas no glicogênio são do tipo α -1-4 ou α -1-6. Qual o efeito da ativação desta enzima sobre a degradação do glicogênio a glicose 1-fosfato? 5. O tratamento de uma suspensão de mitocôndrias com cianeto ou com oligomicina inibe tanto o consumo de oxigênio quanto a síntese de ATP. A adição de dinitrofenol restaura o consumo de oxigênio apenas em um dos casos mas não tem efeito sobre a inibição da síntese de ATP.6. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. Qual seria o estado de oxidação (oxidado/reduzido) dos componentes da cadeia de transporte de elétrons em presença de malato e de antimicina A? 7. a) glicogênio fosforilase b) proteína quinase c) glicogênio fosforilase quinase 4. É possível a oxidação contínua de NADH na ausência de ADP? Como é possível a grande utilização no citossol do ATP produzido na mitocôndria? 12. É possível promover a síntese de ATP por uma suspensão de mitocôndrias sem fornecimento de substrato oxidável? 10. Por que o número de moléculas de ATP sintetizadas para cada succinato oxidado a fumarato é diferente da quantidade de moléculas sintetizadas para cada malato oxidado a oxaloacetato? 9. Como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e do glicerol-fosfato)? AULA 10: METABOLISMO DE GLICOGÊNIO 1. Hemácia e tecido nervoso fazem fosforilação oxidativa? 13.

permeabilidade da célula à glicose b. Reservas de glicogênio de um adulto normal: cerca de 100 g no fígado e 300 g no músculo. 5. indicando o hormônio que atua em cada caso. AULAS 11 E 12 : CONTROLE HORMONAL (INSULINA. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica. 12. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. 3.8. permeabilidade da célula à glicose. libera glucagon. No jejum. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Verificar os diferentes transportadores de glicose e sua dependência de insulina. 6. c. ocorre degradação de proteínas de músculo. como é possível manter proteínas fosforiladas? 10. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. síntese de glicogênio c. Como são desfosforiladas as enzimas. Que transformações permitem a utilização de glicose 1-fosfato pela via glicolítica e para a exportação do hepatócito? 8. rim. 7. síntese de glicogênio. adrenalina e insulina no metabolismo de triacilgliceróis. fígado e ilhotas de Langerhans. 2. quando cessa o efeito do glucagon? Se a célula contém proteína fosfatase. Verificar também se são independentes de insulina para a captação de glicose: cérebro. 11. GLUCAGON) 1. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a. Descrever o metabolismo do glicogênio hepático e muscular ao longo do período de jejum noturno e após uma refeição rica em carboidratos. 13. síntese de glicoquinase (fígado) Transportadores de glicose para o interior das células: 20 . Descrever as ações de glucagon. 10. Descrever a ação da insulina sobre o metabolismo de carboidratos quanto à: a) permeabilidade da célula à glicose b) síntese de glicogênio c) síntese de glicoquinase (fígado) 9. O glucagon estimula a gliconeogênese? Como? 9. Mostrar a relação entre AMP cíclico e a síntese de glicogênio. b. hemácia. 4. A glicemia é mantida exclusivamente pelo glicogênio hepático até 8 horas após a última refeição. Como a insulina leva a ativação da proteína quinase B? 12. síntese de glicoquinase (fígado). Há gasto de ATP para a síntese de glicogênio a partir de glicose? 11.

AULA 13 SÍNTESE DE TRIACILGLICEROL 1. seria possível encontrar ácidos graxos também marcados com esse isótopo? E se a síntese do ácido graxo fosse feita a partir de acetil-CoA marcada com C14. 5. Quais são os tecidos onde ocorre a biossíntese de ácidos graxos? 8. hemácia. Que decorrência isto tem? 9. Se fosse fornecida a uma célula glicose marcada com H3. outras células Fígado. 14. placenta. Apontar semelhanças e diferenças na estrutura e na função de ACP e coenzima A. rim. O que impede a síntese e degradação simultânea de ácidos graxos? 11.coração. Verificar os diferentes transportadores de glicose e sua dependência de insulina. Propriedades Baixo KM Alto KM Baixo KM Baixo KM Dependente de insulina Transporte ativo Co-transporte com Na+ GLUT5 Intestino. Quantas moléculas de glicose precisariam ser oxidadas a glicono δ lactona 6-fosfato para gerar os equivalentes redutores necessários à síntese de palmitato? 7. Há conseqüências derivadas da produção excessiva de corpos cetônicos? 12. Verificar também se são independentes de insulina para a captação de glicose: cérebro.Transportador GLUT1 GLUT2 GLUT3 GLUT4 Distribuição Hemácias. Que semelhança existe entre as reações catalisadas pela enzima málica e pela glicose 6fosfato desidrogenase? 3. Analisar a regulação desta via. Citar o precursor básico e as coenzimas necessárias para a síntese de colesterol. Por que grande concentração mitocondrial de ATP resulta no aparecimento de quantidades apreciáveis de acetil-CoA no citossol? 2. Como o fígado e o tecido adiposo obtêm glicerol 3-fosfato? 10. testículo Adipócito. rim 13. Em situação de hiperglicemia o pâncreas libera insulina e de hipoglicemia. Por que a síntese de malonil-CoA é favorecida quando a concentração citossólica de citrato é elevada? 4.músculo esquelético. rim. fígado e ilhotas de Langerhans. quais carbonos apareceriam marcados? 6. libera glucagon. células β do pâncreas Neurônio. Como a hipoglicemia e uma descarga de adrenalina interferem no metabolismo de triacilgliceróis? AULAS 14 E 15 : METABOLISMO DE AMINOÁCIDOS E CICLO DA URÉIA 21 . O tecido muscular não sintetiza glicerol 3-fosfato. placenta. 13.

2. Uma dieta hipercalória afeta o equilíbrio nitrogenado de um indivíduo adulto e hígido? 15. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. com uma dieta rica em carboidratos e lipídios. 13 . Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. Um adulto normal. Verificar o destino dos esqueletos de carbono dos aminoácidos em seu catabolismo e indicar aqueles que podem originar glicose. 9. 4. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 3. Exemplos destes compostos e seus precursores: Glicina purina porfirina glutationa Lisina carnitina Aspartato purina pirimidina Histidina histamina Tirosina adrenalina tiroxina melanina Triptofano nicotinamida 7. elimina uréia. O nitrogênio presente em todos os compostos biológicos provém de aminoácidos. Definir aminoácido essencial e citar os aminoácidos essenciais para o homem. 10. tem necessidade de ingestão proteica. Definir balanço de nitrogênio. 11. 6. com uma dieta rica em carboidratos e lipídios. Por que? 3. Por quê? AULAS 16 : FONTE DE NUTRIÇÃO 1. Um adulto normal.1. Esquematizar as reações catalisadas pelas seguintes enzimas: aspartato aminotransferase (glutâmico-oxaloacético transaminase . Uma dieta hipocalórica leva a balanço positivo ou negativo de nitrogênio? QUESTÕES PARA DISCUSSÃO 1. Por quê? 2.GTP). Por que? 2. elimina uréia. No ciclo da uréia (da ornitina): a) indicar a procedência dos átomos de nitrogênio da molécula de uréia. 5. Esquematizar a reação catalisada pela glutamato desidrogenase. Um adulto normal. Citar a coenzima que participa das reações e a vitamina presente na sua estrutura. Citar as condições que levam a um balanço positivo ou negativo de nitrogênio. Citar o principal produto de excreção de nitrogênio no homem e o órgão que o produz. 12. com uma dieta desprovida de proteínas. 22 . tem necessidade de ingestão protéica.GOT) e alanina aminotransferase (glutâmicopirúvico transaminase . b) calcular o balanço de ATP c) qual o aminoácido proteico sintetizado? 14. Esquematizar a reação de formação de carbamoil fosfato catalisada por carbamoil fosfato sintetase. Um adulto normal. Quais as conseqüências do defeito genético que causa a inativação da fenilalanina hidroxilase? 8. com uma dieta desprovida de proteínas.

Os valores de ordenadas são diferentes para cada curva. os processos que levam ao acúmulo de lipídios a partir de uma dieta rica em carboidratos. aquela cuja perda de atividade seria responsável por cada um daqueles defeitos: a.100 kcal por dia. D. Fazer um resumo dos efeitos do glucagon.4. 5. 4. tendo em vista que: a) a oxidação total de proteínas e carboidratos fornece 4 kcal/g. fosfofrutoquinase 1. Incapacidade de sintetizar diidroxiacetona a partir de lactato. Caracterizar as síndromes de desnutrição mais comuns. com base em regulações hormonal e alostérica. A insulina aumenta a permeabilidade celular a aminoácidos e estimula a síntese de proteínas. A concentração plasmática de HCO3. f) nove aminoácidos são essenciais para o organismo humano. Incapacidade de utilizar glicose para obtenção de energia. lipídios e proteínas no fígado. verificar se a sentença é falsa ou verdadeira. adrenalina. C. b. lipídios e proteínas de uma dieta normal e de uma dieta para emagrecimento. fosfoglicomutase 3. 23 . AULAS 17 : REGULAÇÃO INTEGRADA 1. 2. músculo e adiposo. a. Justificar a necessidade de ingerir uma quantidade mínima de carboidratos. B. Incapacidade de fazer a oxidação completa de glicose e lipídios. c) o metabolismo basal de um adulto consome cerca de 1. Segue-se uma lista de defeitos metabólicos hereditários hipotéticos: A. Descrever as conseqüências metabólicas de uma dieta com valor calórico normal. 6. Planejar a distribuição entre carboidratos. Escolher. Comparar a qualidade nutricional de proteínas de origem animal com a qualidade de proteínas de origem vegetal. entre as enzimas alistadas a seguir. 5. 9 kcal/g). isocitrato desidrogenase d. glicose 6-fosfatase f. e insulina no metabolismo de carboidratos. 8. d) é necessária uma ingestão mínima diária de 10 g de lipídios ricos em ácidos graxos poliinsaturados. 7. Alistar os fatores que tornam obrigatória a ingestão de aminoácidos (proteínas). fosfoenolpiruvato carboxiquinase e.800 kcal por dia. b. e a de lipídios. Incapacidade de fazer gliconeogênese a partir de lactato. hidroxiacil-CoA desidrogenase. mas contendo proteínas de baixo valor biológico. De a até j. c. e) é necessária uma ingestão mínima de 5 g de carboidratos para cada 100 kcal ingeridas. A concentração citossólica de citrato é maior em B do que em A.é maior em B do que em C. Indicar o valor recomendado de ingestão proteica para indivíduos adultos de países em desenvolvimento. 6. O gráfico a seguir foi obtido medindo-se alguns parâmetros em tempos subseqüentes à ingestão de uma refeição (tempo zero). b) um adulto com atividade física moderada requer 100 g de proteínas + cerca de 2. Descrever. 9.

o ciclo de Krebs. c. h. uma dieta com quantidades de carboidratos. A curva II pode representar a atividade da via das pentoses. a utilização de corpos cetônicos pelo cérebro. d.c. Em B a lipogênese é mais intensa que a lipólise no tecido adiposo.6-bisfosfato. a concentração de acetil-CoA e a síntese de ácidos graxos. aminoácidos e corpos cetônicos plasmáticos é originária do fígado. no fígado deste indivíduo. Em C a atividade da fosfoproteína fosfatase 1 é maior do que a da proteína quinase dependente de cAMP. b. a síntese de glicogênio. faixa etária e atividade física. a concentração de frutose 2. analise o balanço de nitrogênio e a produção de corpos cetônicos. Segundo as hipóteses formuladas. e. Apesar da dieta conter também o suprimento correto de vitaminas e sais minerais. A curva I pode representar a concentração de glicogênio hepático e a curva III. a. Faça duas hipóteses explicativas deste quadro. Em B ocorre oxidação de aminoácidos essenciais no fígado. lipídios e proteínas adequadas para seu peso. d. Para cada hipótese feita. o indivíduo apresentou perda lenta e contínua de peso. A oxidação dos esqueletos carbônicos dos aminoácidos pelo fígado é maior em C do que em B. g. a gliconeogênese. A carnitina acil transferase de hepatócitos é mais ativa em A. Escolha uma das hipóteses e descreva como estão. a maior parte da glicose. sexo. o caso poderia ser normalizado aumentando a ingestão de carboidratos e diminuindo a de lipídios? AULAS 18 : DIABETES DIABETES MELITTUS 24 . durante várias semanas. A B C II III I 0 5 10 15 20 25 Horas 12. Um indivíduo adulto recebeu. Em C.

10 a 20% dos casos de diabetes são do tipo I. pela perda de eletrólitos. Quando os níveis de glicose sobem. • Diminui a atividade da triacilglicerol lipase no tecido adiposo. A falta de insulina acarreta aumento na concentração de glicose nos compartimentos extracelulares do músculo e adipócito. também chamada de DM insulina dependente (DMID). ele desperdiça glicose eliminando-a na urina. 2) A tipo II. nervos e vasos sanguíneos.Diabetes melittus é uma doença que ocorre devido a anomalias no metabolismo e pode comprometer o funcionamento de rins. Antes de verificar as diferenças e semelhanças nas manifestações dessas duas diabetes. A DMID é causada pela grande redução ou ausência da produção de insulina e o indivíduo adquire um estado de hiperglicemia sustentada. qualquer incremento é acompanhado por perda de água. É uma doença que pode ser definida como um estado de tolerância diminuída à glicose. • Aumenta o transporte de aminoácidos para os músculos e outros tecidos. principalmente potássio. cujos aminoácidos são usados na gliconeogênese. ou DM não dependente de insulina (DMNDI). . inibindo a mobilização de ácidos graxos. vamos lembrar os efeitos da insulina: . Há dois tipos mais comuns de diabetes melittus (DM): 1) A tipo I. bem como da perda de água. Ocorre cetoacidose. ele perde peso. água intracelular é perdida para o interstício resultando em desidratação celular. pois não há mais a ação anti-lipolítica da insulina e há perda de proteína muscular. Evidências implicam a infecção viral e resposta auto-imune como maiores fatores contribuintes. usualmente devido à deficiência ou resistência à insulina. diluição dos eletrólitos extracelulares e maior concentração dos intracelulares. embora não só a genética possa explicá-la. • Diminui os níveis de AMPc nos hepatócitos por ativação da fosfodiesterase. Ela tem início entre a infância e 35 anos e tem um componente genético (40% dos gêmeos idênticos de uma pessoa portadora de DMID adquirirá a doença). devido à alta lipólise com conseqüente produção de corpos cetônicos e fraqueza. lipídeo e glicogênio em proporções variadas. oxidando-a para gerar energia ou usando-a para síntese de outros compostos. músculo e tecido adiposo e outras células. A perda de peso é decorrente de perda de tecido muscular e adiposo. Devido a isso.Esse hormônio. Diabetes melittus não dependente de insulina (DMNDI) ou Tipo II. com conseqüente aumento da pressão osmótica. • Diminui a quantidade de glucagon circulante por diminuição da expressão gênica. Como tudo que tem que ser excretado na urina deve estar solubilizado. Assim. • Aumenta a síntese de proteína. 25 . o rim não consegue reabsorvê-la e ocorre glicosúria. O desarranjo de todas essas reações é encontrado no diabético. Diabetis melittus insulino dependente (DMID) ou Tipo I.Por ação indireta: • Antagoniza os efeitos de glucagon no fígado pela inibição da proteína quinase dependente de AMPc. olhos. Um indivíduo normal mantém os níveis plasmáticos normais de glicose convertendo-a em glicogênio. dependendo do tecido. por ação direta: • Aumenta o transporte de glicose para o fígado. caso não seja tratado.

Atualmente. ocorrendo. Não há relação necessária entre diabetes tipo I e obesidade.Tipo I é. Diagnóstico Para diagnosticar diabetes tipo I em estado agudo basta demonstrar que as observações clínicas como perda de peso. toda uma gama de variação das intensidades dos dois sintomas. Nesses pacientes dieta e exercícios físicos são um bom meio de alcançar o controle da glicemia. pacientes com DMNDI podem manifestar hiperglicemia não acompanhada de um correspondente grau de cetose. Na tipo II. O que há no diabetes tipo II é uma relativa resistência ao desenvolvimento de cetose. provavelmente por defeito nos receptores de insulina nas células. Assim. DMNDI geralmente é diagnosticada após os 40 anos de idade em pessoas com obesidade e que tenham parentes diabéticos. O indivíduo ingere uma solução contendo 75g de glicose e o diabetes tipo II é diagnosticado quando uma dessas situações ocorre: O nível plasmático de glicose em jejum é maior que 140 mg/dL ou glicose em jejum é normal.Presente em 80 a 90 % dos diabéticos. baseado numa relativa mas não absoluta deficiência de glicose. silencioso Em geral obesidade 80 a 90% dos casos . com alto fator genético (100% dos irmãos gêmeos idênticos de um diabético tipo II desenvolverão a doença). Nos diabéticos tipo II. atingindo 200mg/dL após 2h de ingestão da solução de glicose. Tratamento Depende do tipo de diabetes.DMNDI Em geral após 35 anos Lento. sugerindo que não há a utilização correta do hormônio pelo organismo. cetoacidose e glicosúria. como sepsis. na verdade. Tipo I –DMID Idade de início Início Estado nutricional no início Prevalência Em geral infância ou puberdade Em geral repentino Em geral desnutrido 10 a 20% dos casos 26 Tipo II . No período inicial da doença observa-se glicemia de jejum normal e após 2h valores entre 140 e 200 mg/dL. Deve haver reposição adequada de Na+ e água. A tabela na página a seguir apresenta um resumo das diferenças entre os dois tipos de diabetes. Diabetes tipo II é mais certamente diagnosticada por uma demonstração da tolerância diminuída à glicose. considera-se que não existem apenas duas situações extremas: cetoacidose diabética ou hiperglicemia não cetônica. Alguns pacientes podem necessitar de injeções de insulina. poliúria (aumento na quantidade de urina) e polipsia (sede) são acompanhadas por testes laboratoriais positivos para hiperglicemia. dependente de insulina por toda a vida. ou tornar-se-á. a cetose pode aparecer em certas condições de estresse metabólico. Os pacientes apresentam normalmente níveis normais ou elevados de insulina. perda de peso já pode influenciar na capacidade do corpo de controlar o nível de glicose. Agentes hipoglicemiantes orais (geralmente aumentam secreção de insulina pelas células β ) pode ajudar obesos ou não.

causando desidratação celular. Tanto a hiperglicemia como a hipernatremia afetam muito o cérebro. Quando a osmolaridade alcança 340 a 350 mosmol/kg. que leva a perda de água e eletrólitos. que causa a perda de sensibilidade nas extremidades inferiores. principalmente a neuropatia simétrica. Diabéticos podem desenvolver retinopatia (principal causa de cegueira). A glicosilação de lipoproteínas plasmáticas leva a sua ligação com o endotélio vascular provocando aterosclerose e doença periférica vascular. A neuropatia de nervos periféricos é comum em diabéticos. a conseqüência mais provável é o coma. Faça hipóteses para explicar esse fato. Há tendência a hipovolemia e deslocamentos de água intracelular para o espaço extracelular.e neuropatia. Vírus e toxinas Baixa a ausente Obesidade Normal a elevada Poliúria. Uma explicação para isso é haver glicosilação de proteínas. Complicações decorrentes do diabetes A ultraestrutura de todas as doenças decorrentes do diabetes tem em comum apresentar depósito de proteínas contendo carboidratos nos vasos sanguíneos. A retinopatia é quase universal entre os diabéticos. Essas proteínas ficam com conformação alterada e são mais resistentes ao ataque proteolítico. polidipsia. a água move-se para fora das células cerebrais. que ocorre principalmente no ε amino da Lys. tornando os pacientes propensos a lesões nas pernas e pés. Aumentando a osmolaridade plasmática. Quando essa doença se desenvolve o paciente necessita de hemodiálise e transplante renal. cetoacidose comum tipo I mais suaves Comum Rara Retino-. com alta incidência de gangrena e amputação. nefro. β produzem menos de insulina ou igual insulina. sem produção Cel. β destruídas. Complicações similares a surgimento após 5 anos tipo I. neuropatia e doenças cardiovasculares. mais tardias Cetoacidose Coma hiperosmolar Responde Em geral não necessário Resposta a hipoglicemiantes Não responde orais Administrar insulina Sempre necessário Coma diabético A glicose sanguínea em concentrações maiores que o limite de reabsorção renal provoca uma rápida diurese osmótica. enquanto o desenvolvimento de doença renal de estágio final ocorre em 35 a 45 % dos portadores de DMID e em menos de 20% daqueles com DMNDI. nefropatia. A dosagem de Hb glicosilada plasmática é um teste mais sensível que a medida de glicemia.Predisposição genética Defeito ou deficiência Outros fatores Insulina plasmática Sintomas iniciais Cetose Efeitos a longo prazo Complicações agudas Moderada Muito forte Cel. perda de Nenhum ou os mesmos do peso. 27 . fome.

Respiração tendendo a ofegante. aliadas à fraqueza. segundo seus familiares. há uma hora.L. de descompensação diabética. branco. Foi-lhe dito que. Tratamento: O paciente foi submetido a hidratação intensa e administração de insulina. 25 anos. Refere que procura seguir as recomendações dietéticas. comeu pizza e tomou sorvete. Faz uso de insulina. CASO 2 Identificação: J. Relata que no entardecer do dia esteve em uma lanchonete com amigos. Exames Laboratoriais: Glicemia = 65 mg/dL (Referência = 70 a 100 mg/dL) Cetonúria = +++ / ++++ Tratamento: A paciente foi informada que esses sintomas são provenientes da diminuição de ingestão calórica e que a cetonúria indica que o organismo está respondendo à dieta. Exame Físico: Regular estado geral. para resolver seus sintomas. pulsos finos. não é lhe indicada já que está sob regime de emagrecimento. feminina. no terceiro dia de estadia. onde ingeriu quatro ou cinco chopes. Hoje. 1. Exame Fïsico: Bom estado geral. Relata que no primeiro dia nada sentiu.. porém. Dados de gasometria revelam acidose. executiva do ramo de cosméticos. quando falava as pessoas sentiam cheiro de acetona. por via muscular. Na seqüência sentiu um hálito amargo. há oito horas.CASO 1 Identificação: J. pressão arterial = 100 x 60 torr.B. Está submetida a uma dieta de 300 kcalorias/dia. Como já passou por situações semelhantes. branca. hálito cetônico bastante evidente. administrada por via subcutânea. principalmente nos acontecimentos sociais. Exames Laboratoriais: Glicemia (não é de jejum) = 457 mg/dL (referência = 70 a 100 mg/dL) Cetonúria = +++/++++ (O normal é negativo). mas a cetonúria ainda se mantinha em + / +++. História Pregressa da Moléstia Atual: A paciente deu entrada no centro endocrinológico de emagrecimento em um spa há três dias. História pregressa da Moléstia Atual: Paciente sabidamente diabético desde os 12 anos de idade. masculino. a fim de ser medicado antes do agravamento do quadro. Tudo seguido de uma intensa fraqueza e leve falta de ar. Queixa e Duração: Sensação de fraqueza há doze horas. Hálito amargo há um dia. Indicou-se que aguardasse por mais alguns dias até que os sintomas regredissem. a boca seca e. mas que não é incomum a transgressão da dieta.P.M. hálito cetônico. Gosto amargo na boca e sensação de fraqueza. ritmo cardíaco regular. começou a urinar intensamente. precisando levantar várias vezes da cama. bastaria uma refeição calórica que. Queixa e Duração:Aumento do volume urinário há 4 horas. Dor de cabeça intermitente. Sinais clínicos de desidratação. Após três horas de cuidados a glicemia já havia baixado para 185 mg/dL. Qual o sinal clínico comum aos dois casos relatados? 28 . de hora em hora. Passadas quatro horas. Procurou o ambulatório médico para esclarecimentos. duas vezes ao dia. bancário. o gosto ruim na boca é muito intenso e acompanhado de um hálito próximo ao cheiro de acetona. a partir do segundo dia. a paciente passou a sentir também fortes dores de cabeça. porém. palidez cutâneo-mucosa. procurou o serviço médico. ritmos cardíaco e respiratório normal. notou gosto ruim na boca e o apetite diminuiu. 35 anos. levemente taquicárdico.

Tabela de códons 29 . 14. Bloqueando a tradução: Crie uma estratégia experimental para desligar a expressão de um mRNA específico sem mudar o gene codificante da proteína os elementos controladores do gene. Citar a fonte de energia utilizada pelo cérebro. Indicar as condições metabólicas que levam a uma aumento na produção de corpos cetônicos 18. Nos dois casos apresentados. A partir de que compostos a paciente do caso 2 está mantendo sua glicemia em 65 mg/dL? Que via metabólica é utilizada para a síntese de glicose? 8.6 bisfosfato. hemácias. lipídios e proteínas provocadas por jejum prolongado e por diabetes. Qual é a relação entre a glicemia e a presença plasmática de acetona? 4. Qual a principal fonte de ATP para a contração muscular. o paciente do Caso 1 fica impossibilitado de usar a glicose sangüínea em células como as do músculo.2. Descrever as alterações do metabolismo de carboidratos. Citar as enzimas da glicólise e gliconeogênese que têm sua concentração alterada por ação hormonal. Após alguns dias no spa. adrenalina e insulina no metabolismo de triacilgliceróis AULA 19: TRADUÇÃO E CÓDIGO GENÉTICO 1. 17. manutenção ou ganho de peso? 10. Descrever as ações de glucagon. Que composto é produzido pela via de degradação dessas reservas corpóreas nos Casos 1 e 2? 7. Descrever a regulação da glicólise e da gliconeogênese em função da concentração de frutose 2. indicando o hormônio que atua em cada caso. 16. Pela deficiência de insulina. Por que o valor da glicemia difere tanto entre os casos 1 e 2? 3. 15. pois a entrada de glicose nessas células é estimulada pela insulina. que tipo de reserva a paciente do caso 2 deve estar utilizando para a obtenção de ATP? 6. nesse caso? 5. Explicar como um indivíduo mantém-se vivo em jejum extremamente prolongado (três a quatro semanas. Qual dos compostos é responsável pelo sinal comum apresentado pelos pacientes dos casos 1 e 2? 9. desde que hidratado) como nos casos de greve de fome. a tendência dos pacientes é de perda. músculo e fígado neste jejum extremo.

Suponha que você tenha um sistema de síntese de proteínas que está produzindo uma proteína chamada A. Finalmente.terminal e A5 é o carbpxi-terminal. c) Tanto o trp mRNA e a enzima triptofano sintase são degradadas mais rapidamente que o normal. Um transcrito para um gene contem a seqüência de bases abaixo: 5´ AACUGCACGAGGUAACACAAGAUGGCU 3´ Preveja o efeito de uma mutação que altere o G sublinhado para um A nas três diferentes fases. Tryptofano é adicionado. tRNA e rRNA? Aula 20: Regulação da Expressão Gênica 1. você sabe que seu sistema precisa de 4 minutos para produzir uma molécula de proteína A completa. As células continuam a crescer e dividem a cada 30 minutos. Células de E. coli são crescidas no meio com glicose como única fonte de carbono. Descreva qualitativamente como a atividade da triptofano sintase varia nas seguintes condições: a) O trp mRNA é estável (degrada lentamente após algumas horas) b) O trp mRNA é degradado rapidamente. é o amino. A4 e A5. (A) Em t=1 minuto. Indique em cada uma das situações abaixo se a expressão do operon lac aumenta. coli são crescidas no meio contendo lactose. A2. você isola a proteína A intacta do sistema. corta-a com tripsina e isola os cinco peptídeos. você sabe que a proteína A tem quatro pontos sensíveis à tripsina igualmente espaçados na proteína que na digestão produzem os peptídeos A1.2. 2. Qual peptídeo é mais intensamente marcado? (B) Em t=3 minutos. Células de E. As aminoacil-tRNA sintetases são os únicos componentes da expressão gênica que decodificam o código genético. qual será a ordem de marcação dos peptídeos do mais para o menos marcado? (C) O eu esta experiência lhe diz sobre o sentido da síntese de proteínas? 6. 7. você adiciona todos os 20 amino-ácidos. O peptídeo A1. Explique. Descreva os prováveis efeitos na expressão do gene operon lac quando sofre mutações em: a) o gene lacI que inativa o repressor b) o promotor é eliminado na região próxima a posição -10 3. Aponte três mutações que não modificam a sequência da proteína. Em t=0. Compare a precisão de (a) replicação do DNA (b) síntese de RNA e (C) síntese de proteínas. 3. Além disso. 4. cada um levando uma marcação com 14C . Quais mecanismos são usados para garantir a fidelidade de cada um destes processos. Quais são as funções do mRNA. A3. porém não glicose. reduz ou não é 30 . porém a enzima triptofano sintase é estável. 5.

e) Eliminando o sítio de ligação para o ribossomo que transcreve o peptídeo iniciador. monitores e colegas de grupo.alterada. destacando os termos que você não compreenda ou de que nunca tenha ouvido falar. Transgênicos – 7° Teste Questões para Estudo Leia os textos que se seguem a respeito de alimentos transgênicos. c) Removendo a seqüência 4 d) Trocando os dois códons trp no peptídeo iniciador para códons de His. a) Aumento da distância (número de pares de base) entre o peptídeo iniciador e a seqüência 2. coli pode ser afetada pelas seguintes manipulações da região promotora do mRNA trp. Desenhe um modelo descrevendo o que acontece em cada uma destas situações. A atividade desta RNA polimerase é reduzida quando a enzima é purificada. Esses termos deverão ser esclarecidos com o auxílio dos professores. d) Uma mutação que inativa completamente a permease galactosidase e) Uma mutação que previne a ligação de CRP para o sítio de ligação próximo a região do promotor lac. acesse os sites recomendados ao final dos textos. na sua opinião. b) Aumento da distância (número de pares de base) entre a seqüência 2 e a 3. Sugira uma explicação para esta observação. Como a transcrição do gene operon trp da E. 4. Uma nova RNA polimerase é descoberta a partir de extratos protéicos obtidos por um fungo exótico. 31 . c) Uma mutação que inativa completamente a β -galactosidase. Esta RNA polimerase inicia somente a transcrição a partir de uma única região promotora altamente especializada. a) Adição de alta concentração de glicose b) Uma mutação que impede a dissociação do repressor lac na região reguladora. Aula 22: Técnicas de Biologia Molecular. os pontos favoráveis e desfavoráveis ao emprego da tecnologia para produção de alimentos transgênicos. Façam uma lista contendo. 5. Para complementar seus estudos.

Procedimentos para a obtenção de vegetais transgênicos: Para obter plantas transgênicas são necessários: . . ocorreu a partir da década de 70 com o desenvolvimento da Engenharia Genética (ou Tecnologia do DNA Recombinante). pelo uso de técnicas modernas de Engenharia Genética. sanidade animal e produção de alimentos. a mais utilizada era a do Melhoramento Clássico. Tecnologia do DNA recombinante: A tecnologia do DNA Recombinante permite a transferência do material genético de um organismo para outro. Histórico: A Genética é uma ciência característica do século XX. Ao invés de promover o cruzamento entre organismos relacionados para obter uma característica desejada. na qual a transferência de genes se dava por meio de cruzamentos (reprodução sexuada). .o gene de interesse. aumentando a produtividade de animais e contribuindo para uma maior longevidade humana. 32 . produzindo maiores safras de alimentos de origem vegetal. pois. amplificação do número de cópias desse gene e introdução do gene em um sistema que possa expressá-lo. abrindo novas perspectivas econômicas nos campos da saúde humana. Surgiram técnicas biotecnológicas como a produção e pesquisa de plantas e animais transgênicos. cientistas podem identificar e inserir no genoma de um determinado organismo um único gene responsável pela característica em particular. entretanto. resultando em um organismo geneticamente modificado (OGM). O gene artificial ou intencionalmente inserido no genoma de um organismo é denominado transgene. produção de proteínas humanas em microorganismos. aceleraram as descobertas científicas e suas aplicações biotecnológicas. a partir de 1900 as Leis de Mendel foram redescobertas e começaram a ser aplicadas. mapeamento do genoma humano. plantas e microorganismos. O sistema ou organismo que expressará o gene deve ter a característica principal de ser de fácil cultivo e permitir a purificação e recuperação do produto do gene.uma técnica para gerar uma planta inteira a partir de uma só célula transformada. plantas e animais. Nos primeiros ¾ deste século. Para a introdução do gene em outro organismo são utilizados vetores de clonagem (plasmídeos ou vírus) nos quais a seqüência de DNA de interesse é inserida. clonagem de mamíferos.Definição de transgênicos: Os Transgênicos são organismos que adquiriram características de outro organismo. A técnica exigia uma enorme demanda de tempo e não era precisa. A clonagem molecular consiste no isolamento do gene de interesse. misturando todo o conjunto de genes dos dois organismos em combinações aleatórias. cuja característica adquirida passa a ser transmitida para as futuras gerações. Antes do desenvolvimento desta técnica. A decifração do código genético e a manipulação do DNA neste último quarto de século.uma técnica para transformar células vegetais através da introdução do gene de interesse. a genética mendeliana contribuiu significativamente para a sustentação do crescimento populacional de nosso planeta. O crescimento acelerado do campo da biotecnologia. O termo geneticamente modificado tem sido utilizado para descrever a aplicação da tecnologia do DNA recombinante para a alteração genética de animais. técnicas de detecções e diagnósticos por PCR e Terapia Gênica.

Este gene poderia ser usado para aumentar o valor nutricional de culturas importantes como feijão e soja.Após esta última etapa. entre eles temos:  Gene que codifica proteína capaz de modificar herbicidas. Genes de Interesse: O genoma de uma bactéria contém em média 5. onde este material é inserido e replicado por várias vezes.000 genes. o DNA do organismo contendo o gene de interesse é extraído. Diversos genes de interesse agronômico já foram isolados. porque ela contém. Em seguida o DNA é cortado em fragmentos menores utilizando as enzimas de restrição. algumas culturas não sobrevivem à aplicação deste produto.000. além dos genes naturais. levando ao seu controle na cultura. culturas contendo este gene poderiam tornar-se resistentes ao herbicida. facilitando assim o controle das ervas. uma bactéria ou até um animal. Depois. Estes fragmentos são. Os genes são segmentos de um mesmo tipo de molécula: o ácido desoxirribonucléico (DNA) e é esta característica que permite que genes de um organismo sejam potencialmente funcionais em outro. entretanto.000 e 60. presente na castanha-do-pará. ligados a outros fragmentos de DNA. Os insetos que se alimentassem de plantas expressando este gene morreriam ou se desenvolveriam com menor eficiência. tem-se uma planta transgênica. Os herbicidas são muito usados no controle de ervas daninhas. entre 40. então.000 genes. o de plantas.  Gene que codifica uma proteína de alto valor nutricional. inativando-os.  Genes bacterianos que codificam proteínas com propriedades tóxicas para insetos. seleciona-se a colônia de bactérias que contém o fragmento de DNA correspondente ao gene de interesse. 33 . Deste modo. mas que podem se replicar em bactérias. enquanto o genoma humano consiste de aproximadamente 30. que pode ser uma planta. um gene adicional proveniente de outro organismo. para isso. Uma das possibilidades para isolamento de um gene é a construção de uma “biblioteca genômica” e.

B) Biobalística: Baseia-se na utilização de microprojéteis de ouro ou tungstênio cobertos com os genes de interesse. Papel dos transgênicos na economia mundial: O século passado teve um grande desenvolvimento na biotecnologia microbiana. O plasmídeo encontrado na bactéria Agrobacterium tumefaciens é um dos vetores mais importantes para a transformação de plantas. os objetivos finais são mudanças operadas no nível celular. inserindo-se aleatoriamente nas organelas celulares. desprovidas de parede celular. Os genes entram nas células junto com o projétil de maneira não-letal. o DNA é dissociado das micropartículas pela ação do líquido celular. Em seguida. em seguida. No entanto. um choque elétrico de alta voltagem é aplicado por curtíssimo tempo. ocorrendo o processo de integração do gene exógeno no genoma do organismo a ser modificado. como plantas e animais.especialmente para o caso de monocotiledôneas) ou através de agrobactérias. quando Stanley e Cohen. em São Francisco. A transformação de uma célula vegetal é um tipo de manipulação genética que atende ao mesmo princípio da transformação de microrganismos. esta etapa ainda representa o maior gargalo na criação de plantas transgênicas. C) Infecção por Agrobacterium tumefaciens: O plasmídeo é uma molécula de DNA extracromossomal que pode se replicar independentemente do cromossomo. Neste século. nutricionais e ambientais para a regeneração. E. Parte do plasmídeo é um transposon (T DNA) que produz cópias de si mesmo nos cromossomos da planta infectada. Ou seja. estabelecido pela primeira vez em 1973. 34 . o domínio das técnicas de regeneração de plantas inteiras a partir de uma única célula é condição sine qua non na biotecnologia aplicada para a agricultura. esta célula ou grupos delas são estimuladas a gerar uma planta transformada. são incubados em soluções que contêm os genes a serem transferidos e. enquanto que em eucariotos superiores. é esperado um rápido desenvolvimento na biotecnologia animal e vegetal. introduziram o gene proveniente de uma rã em uma bactéria. Regeneração das plantas a partir das células transformadas: Uma vez inserido o gene na célula vegetal. as mudanças obtidas no nível celular não são significativas. Para a transformação. Os transposons são assim denominados (ou também chamados elementos de transposição) justamente porque são elementos genéticos móveis capazes de integrar-se ao genoma do hospedeiro e duplicar-se. o que permite a penetração e eventual integração dos genes no genoma.Transferência dos genes de interesse em plantas: A transferência dos genes se dá diretamente na célula vegetal (processo mais utilizado . embora esta técnica já esteja estabelecida para inúmeras plantas de interesse econômico. A produção direta de trigo rico em lisina é uma das pesquisas em desenvolvimento e deverá resultar em um produto mais economicamente viável que o enriquecimento do trigo com a lisina obtida de microorganismos. O choque causa uma alteração da membrana celular. há diferenças conceituais entre a situação com microrganismos e com plantas: nos primeiros. a não ser que possam ser transferidas para todas as células do organismo. como cada espécie de planta tem diferentes exigências hormonais. A transferência é alcançada por um dos métodos seguintes: A) Eletroporação de protoplastos e células vegetais: Protoplastos são células vegetais. Os microprojéteis são acelerados com pólvora ou gás em direção aos alvos (as células vegetais).

A modificação genética de microrganismos continua sendo uma importante complementação para as modificações genéticas de plantas e animais. Falck-Zepeda et al 1999). em princípio.1999. muitos alimentos transgênicos importados já são comercializados e estima-se a importação de 3 milhões de toneladas de milho da Argentina e dos E. Esses esforços devem ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da agricultura. O ritmo atual de liberação de OGMs indica que na primeira década deste século já teremos uma centena de produtos geneticamente modificados nas prateleiras dos supermercados. estáveis quando armazenados e. Na década de 90. organizados. dando resistência contra pragas de insetos ou viroses. biofertilizantes e biopesticidas.A.A. em casos limitados. algumas tendo se tornado sucessos comerciais. No entanto.U. É essencial melhorar a produção e a distribuição de gêneros alimentícios para livrar da fome uma população mundial crescente. os E. podem promover saúde trazendo benefícios para consumidores. Alimentos produzidos através de tecnologias de modificação genética podem ser mais nutritivos. principalmente com características preferidas pelo mercado. Vegetais geneticamente modificados: A maioria dos produtos já liberados para a comercialização contém transgenes que codificam características que visam minimizar estresses ambientais. podendo-se chegar na casa dos milhares em algumas décadas. devem ser feitos para investigar os efeitos potenciais no meio ambiente (positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas. especialmente para a produção de metabólitos secundários. enquanto reduzimos os impactos ambientais. resistência a insetos e vírus. bioprocessamento.. um decréscimo no preço devido a custos reduzidos e aumento da facilidade de produção (University of Illinois. é necessário utilizar de forma adequada e responsável as novas tecnologias e descobertas científicas.A aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade apareceu no mercado europeu. e produzindo tolerância a determinados herbicidas. No Brasil. a agricultura tem um grande potencial de crescimento e uma forte posição nas vendas em volume. Benefícios promovidos pelos transgênicos na agricultura: A tecnologia dos transgênicos tem sido utilizada para produzir uma variedade de plantas para alimentação. Enquanto essas características têm trazido benefícios aos agricultores. as características que visam aumentar a qualidade nutricional dos alimentos vêm se tornando progressivamente mais importantes e deverão prevalecer nas próximas gerações de produtos transgênicos. incluindo tolerância a herbicidas. onde as lavouras transgênicas são permitidas oficialmente. biorremediação e tratamento de águas. que estejam atualmente em uso. Já existem sementes manipuladas sendo cultivadas no mundo em uma área de 30 milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. A seguir são apresentados alguns exemplos do uso da tecnologia da modificação genética de vegetais aplicada a alguns problemas específicos da agricultura: 35 .U.U. os consumidores dificilmente notaram qualquer benefício além de. Os desenvolvimentos resultantes em variedades comercialmente produzidas em países como EUA e Canadá têm se centralizado no aumento de vida em prateleiras de frutas e vegetais. seja em nações industrializadas ou em desenvolvimento. Para isso. De acordo com uma pesquisa sobre a expectativa de comercialização de produtos obtidos de organismos geneticamente modificados nos E. Esforços em conjunto.

de forma a combater a anemia. 36 . A introdução desses genes faz com que se obtenha uma planta mais baixa. mais forte e que aumenta o rendimento da safra diretamente. e o desenvolvimento da sua parte reprodutiva (comestível) é aumentado. os pesquisadores utilizaram uma técnica de imunização genética. deve-se considerar o fato de que populações de pragas ou organismos causadores de doenças podem vir a se adaptar à planta transgênica. Uso de terras marginalizadas: Solos com elevados índices de salinidade e alcalinidade podem ser utilizados caso se consiga obter um transgênico que tenha resistência a essas condições. Segundo a revista Nature Biotechnology. Benefícios nutricionais: Já foi desenvolvido o arroz transgênico com elevados níveis de ferro.Resistência a pragas: a papaia resistente ao vírus Ringspot tem sido comercializada e plantada no Hawai desde 1996 (Gonsalves. por exemplo. Colheitas mais abundantes: Algumas pesquisas envolvem a produção de alimentos de alto rendimento como. Após o fracasso dos métodos convencionais de cruzamentos entre o arroz selvagem e cultivado. através da criação de plantas de arroz transgênico resistentes ao RYMV. Estes genes (NORIN 10) agem da mesma forma quando utilizados para transformar outras espécies de plantas importantes como alimento. tomates perfeitamente comestíveis. Como exemplo. uma vez que o alongamento das células na parte vegetativa é reduzido. que devasta os arrozais africanos. O gene introduzido atua sobre uma proteína como um filtro capaz de captar e isolar o sódio excedente. cientistas conseguiram fazer crescer e desenvolver em água contendo forte teor de sódio. graças à injeção de um único gene capaz de absorver um excedente de sal em plantações de tomate. Porém. Um exemplo de combate ao stress abiótico é a produção de ácido cítrico nas raízes e a melhor tolerância ao alumínio em solos ácidos (de La Fuente et al 1997). temos um gene de tolerância em manguezais (Avicennia marina) que foi clonado e transferido para outras plantas que se mostraram mais tolerantes a altas concentrações de sal. como acontece com o uso de inseticidas. temos o vírus Mottle Amarelo do arroz (RYMV). Como exemplo. o trigo semi-anão que possui genes insensíveis à giberelina. 1999). É resultado do uso de modificação genética em vegetais visando obter maior resistência a uma praga específica. As plantas transgênicas contêm entre 2 e 4 vezes mais ferro do que normalmente encontrado no arroz convencional. Ele foi produzido usando-se genes envolvidos na produção de proteínas capazes de ligar o ferro e de uma enzima que facilita a disponibilidade de ferro na dieta humana (Goto et al. Tolerância a pressões bióticas e abióticas: O desenvolvimento de plantações que tenham uma resistência inata ao stress biótico ou abiótico ajudaria a estabilizar a produção anual. 1998). com conseqüente diminuição ou eliminação da necessidade do uso de pesticidas.

Posicionamento do Conselho Nacional de Nutricionistas: www.H. O debate não deve. ser limitado a aspectos nutricionais. portanto.br/cienciahoje/ch/ch146. Oxford University Press.: www.htm . envolvendo tópicos como impacto ambiental. precursor da vitamina A.arroz normal arroz transgênico Pesquisadores desenvolveram arroz com alto teor de beta-caroteno. • Zaha. • Purves. New Yourk. Em ambos os casos os argumentos devem ser os mais variados possíveis. redigida nas “questões para estudo” para auxiliar o debate.ctnbio. W..H. Foram inseridos genes de bactérias que fazem a conversão do precursor presente no arroz em beta-caroteno. J.uol. • Okamuro. & Goldberg.B. H. Referências • Lewin. 37 . benefício para a saúde etc.org. Porto Alegre. (2001) Life – the science of Biology. (Coord. devido à presença de beta-caroteno.C.htm . R.K.br/variavel/destaque/pgdestaque2. (1994) Genes.gov. Utilize sua lista. Orians. aumento da produtividade. & Heller. redução do custo ou aumento do preço dos alimentos. Sinauer AssociaTES. Cerca de 300 g desse arroz cozido por dia suprem as necessidades de betacaroteno de um indivíduo.com.Posicionamento da SBBq: http://www. Academic Press Inc. diarréias e sarampo. Mercado Aberto. que ajuda a combater diversas doenças. 1ed.Freeman and Company. ressecamento da córnea.sbbq.. Inc & W. Sadava.br/start.org.cfn. Polêmica sobre os Alimentos Transgênicos . o grupo contra deverá utilizar argumentos que condenem os transgênicos.htm . como a cegueira noturna. Será iniciado um debate em que o grupo pró deverá utilizar argumentos que justifiquem a produção e o consumo de alimentos transgênicos.Artigo da revista Ciência Hoje com link para arquivo pdf. (1989) The Biology of Plants.K.Conselho Nacional de Biossegurança: www. agroeconomia.D.br/ctnbio/bio/artigos/004.php?id=port Questões para Discussão Cada sala deve ser organizada em dois grandes grupos – pró e contra. Ed.G. O resultado desse experimento foi a produção de grãos amarelados de arroz. A.) (1996) Biologia Molecular Básica. 6th. B. Em cada sala haverá um professor para mediar o debate e esclarecer as regras da atividade.

coli em meio LB-A (50µ g/ml ampicilina). 18. O DNA plasmidial purificado é em seguida concentrado por precipitação com etanol. Ribonuclease A 150µ g/ml em TrisHCl 25mM pH 8. Incubar a mistura por 5 min á temperatura ambiente. Centrifugar a 12000xg por 5 min á temperatura ambiente. Adicionar 100µ l de tampão GET/ Rnase e ressuspender as bactérias por agitação no Vórtex. Centrifugar a 12000xg por 10 min á temperatura ambiente .Laboratório 2: Transformação de bactérias com DNA plasmidial e eletroforese em gel de agarose . Secar o sedimento sob vácuo (“speed vac”) e ressuspendê-lo em 25µ l de T. 13. Transferir 440µ l do sobrenadante resultante da centrifugação do passo 9 para outro eppendorf contendo 300µ l de Isopropanol. Utilizaremos cultura de E.7% de Agarose em TBE. Aplicar a amostra em gel 0. EDTA 10mM. 3. 16.Solução de lise – SDS 1% em NaOH 0. Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min. Neste procedimento o DNA cromossomal e as proteínas são desnaturados e precipitados sendo removidos por centrifugação. 1. Observar o DNA obtido na preparação por iluminação do gel com luz ultravioleta. 5. 15. Centrifugar a 12000xg por 5 min á temperatura ambiente. Procedimento Experimental: A partir das bactérias transformadas obtidas na experiência anterior. separando-o do DNA cromossomal bacteriano. 7. extrair e purificar o DNA plasmidial.E . Desprezar o sobrenadante e lavar o sedimento com 500µ l de etanol á 70%. 38 . contendo 0. 4. Incubar o tubo em gelo por 20 min. Incubar por 5 min à 65 °C. Adicionar 200µ l de solução neutralizadora e inverter 10 vezes o tubo lenta e delicadamente. 6. Centrifugar a 12000xg por 15 min á temperatura ambiente. Soluções utilizadas: . 8. Tomar um volume apropriado da solução de plasmídeos e adicionar tampão de amostra na proporção 1:10.8.Preparação do DNA plasmidialFundamento: Existem vários procedimentos para purificação em pequena escala de DNA plasmidial de células bacterianas. 14.GET / Rnase – dextrose 50mM. Adicionar 200µ l de solução de lise e inverter 10 vezes o tubo lenta e delicadamente. 17. 9.2 N . . 11. Um dos métodos mais utilizados consiste na lise das bactérias em meio alcalino na presença de SDS (dodecil sulfato de sódio). 2.5 µ l/ml de Brometo de etídio e submeter a eletroforese a 100V em Tampão TBE. 10.0.Solução Neutralizadora – Acetato de potássio 3M pH 4. Tomar 1 ml da cultura e colocar em um tubo de eppendorf. 12.

Por que se dissolve a preparação de DNA em tampão Tris-EDTA ? 7. ou seja.Transformação de bactéria com plasmídeo contendo genes de resistência a antibióticos Fundamento: A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua manutenção como um elemento autônomo auto-replicativo. Se o DNA cromosomal tiver sido muito quebrado durante as manipulações. Usaremos o plasmídeo pBR322 (ver mapa). O que é lisozima e para que é usada na preparação de plasmídeos ? 3.coli que normalmente é sensível tanto à ampicilina como à tetraciclina. leva ao aparecimento de bactérias capazes de crescer em meio (líquido ou sólido) contento estes antibióticos. Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da resistência à ampicilina. EDTA e Tris) ? 2. onde espera encontrá-lo após precipitação com KAc ? Quais as conseqüências para a preparação de DNA plasmidial? 5. Na aula prática usaremos o método do CaCl2. genes que codificam para proteínas que conferem resistência a ampicilina (ampr) e tetraciclina (tetr). será revelada através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de Luria Bertani) na ausência e na presença de antibióticos: placas LB-A ou LBtet.5 mg/ml tetraciclina. Várias técnicas são disponíveis para transformar uma bactéria.Questões 1.coli) o pBR322 apresenta duas marcas genéticas. em resistentes. Este plasmídeo pode conferir à bactéria hospedeira certas propriedades (por exemplo resistência a drogas) que podem ter valor seletivo no meio. Que papel desempenha cada componente do tampão GET (glicose. Contendo 50 mg/ml ampicilina ou 12. Como age o isopropanol ? Este álcool poderia ser substituído por etanol. Portanto a introdução de pBR322 em E. Transformação de bactérias que são sensíveis a um antibiótico. clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina. 39 . Além da origem de replicação que permite sua propagação em bactérias (E.. Qual a função do NaOH e do SDS presentes na solução de lise ? 4. por exemplo ? 6. Quantas bandas do DNA plasmidial são visualizadas no gel corado com EtBr Quantas bandas você esperaria caso o pBR322 purificado fosse digerido com enzima EcoRI ? . Neste método as bactérias são submetidas a um tratamento num meio hipotônico contendo cálcio que as torna competentes para a transformação pelo DNA do plasmídeo. uma vez que este sítio está localizado na região amp r. Da mesma forma. O plasmídeo pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de genes.

9 ml/tubo de meio LB e incubar a 37°C sem agitação. Incubar em gelo por 15 min. incubar à 37°C sob agitação até OD600nm=0. As bactérias competentes para transformação são preparadas a partir de uma cultura em fase exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma solução de CaCl2. 1. 8. Coletar as bactérias (4000 rpm. coletar as bactérias por centrifugação (4000 rpm. No gelo estas BACTÉRIAS COMPETENTES podem ser transformadas. Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E. Transferir a cultura para o gelo. Transferir 25µ l ou 250µ l da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. em banho-maria. distribuir 0. Incubar no gelo por 20 minutos. 40 . 6. 4.5 contendo CaCl2 0. Diluir a pré-cultura 1/10 em 10 ml de meio LB. O outro tubo será usado como controle (bactéria apenas). 9.1 ml/tubo da suspensão de bactérias competentes para cada um de 2 tubos.1 M. 5.coli) e incubar 2. 5 min).Procedimento experimental: O ideal é que a experiência seja realizada em ambiente asséptico (fluxo laminar). 5 min á 4 °C) e ressuspender em 1 ml do mesmo tampão (frio). 3. Adicionar 0. As bactérias competentes assim preparadas podem ser armazenadas a –80°C. Após pelo menos 30 min.3 (fase logarítmica de crescimento).5 contendo 1 mM EDTA) a um dos tubos.5 µ g DNA de pBR322 em 10µ l de tampão 10mM Tris pH7. Transferir os tubos para o gelo por 2 min. previamente flambada e em seguida resfriada na própria tampa da placa de Petri. NÃO ABRA AS PLACAS DE ÁGAR ATÉ O MOMENTO DE USO. Manipule convenientemente o material estéril fornecido. à 37°C até o dia seguinte sob agitação forte (200-250 rpm). Ressuspender o sedimento de bactérias em 5 ml de tampão acetato de sódio (frio) 20mM pH6. para uso posterior. Para transformar. Espalhar as bactérias com o auxílio de uma alça de vidro. por uma hora. 7. Antes de dar o choque térmico (42°C por exatamente 90 segundos) . Adicionar o DNA transformante (0. para evitar contaminação.

Qual a eficiência de transformação obtida. em termos de n° de colônias / µ g de DNA? Questões 1.Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| ANÁLISE DOS RESULTADOS 1. Preencher a tabela com o número de colônias obtido em cada caso: Número de Colônias / Placas Placa LB # 1 Bactérias controle 25µ l # 2 Bactérias controle 250µ l # 3 Bactérias transformadas 25µ l # 4 Bactérias transformadas 250µ l ||||||||||||| ||||||||||||| ||||||||||||| Placa LB-A ||||||||||||| 2. Por que as bactérias devem ser incubadas por 60 min. Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes? 2. Qual o papel do choque térmico? 3. 41 . a 37°C antes de espalhá-las em placas de ágar? 4. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo.

Sign up to vote on this title
UsefulNot useful