Você está na página 1de 35

Bioinformtica Introduo

Costa de Oliveira, Antonio Maia, Luciano Carlos da


Centro de Genmica e Fitomelhoramento FAEM - Universidade Federal Pelotas

FUNDAMENTOS DA BUSCA DE INFORMAOES EM BANCOS DE DADOS DE DIFERENTES GENOMAS

Evoluo reaproveitar ou reinventar !?


B ILH O E S A N O S % 100 76 70 FATO S

5 .0 3 .8 3 .5 2 .8 2 .2 1 .8 1 .5 1 .0 0 .7 0 .5 0 .4 0 .3 0 .1

te rra o ce a no s so p a d e a m in o a cid o s, m em bra n a s (C O H ) D N A /R N A (que m p rim e iro ) fo tossin te se p rim e ira s celu la s n u clea d a s re sp ira cao d e o xige n io e sta b e le cim e n to na su p e rficie re p ro d u ca o se xu a d a p rim e iro s a n im a is p rim e ira s p la n ta s a n im ais te rre stre s d ino ssa uro s flore s, p rim a ta s

56 44 36 30 20 14 10 8 6 2

Evoluo mesmas condies para vrias coisas...

GUA SAIS OXIGNIO

oceanos

COMPOSTOS ORGNICOS

CALOR

FRIO

terra

RADIAO

CO-EXISTNCIA

GENMICA ESTRUTURAL E COMPARATIVA

Home x macaco

Initial sequence of the chimpanzee genome and comparison with the human genome
MIT, Harvard, Cambridge- Nature 437, 69-87,Sep 2005.

Homem x rato

10%

genes homem/rato

Schwartz et ali, HumanMouse Alignments with BLASTZ Genome Research, Vol 13, Issue 1, 103-107, January 2003

Evoluo Divergncia da Panicoideae (Wilson et al., 1999)

ORTLOGOS / PARLOGOS

Genmica estrutural e comparativa

SINTENIA

Waxy
1.4
7.1 7.4

1.1

L S

Shattering
3
L S
5.1

S L S

6p t
1.2

2.4

8pt
T
1.3

9pt
2.5

6p t
5.2

7.2

1pt

7pt

9pt

8pt
B

1pt
T T BE

BT T

5pt
B

4 .3

5.3

2pt H IV 6
LL

5p t

1p t

7pt
7 .3 L

5.4

6
B T

BB

5pt

10pt.4 1

4.1

G
T B L

4pt 1pt

IIIpt L S 5

A
B T

4pt T
B 5pt

I
T

5.5 L

S L

B B

Ligule-less
2.4 2.1

2pt

2p t

10pt5.1
T L B

3.2

3pt

B T

IIIpt 12 VII
B B S L S L

8 3

VI

4 .2 B9p 5.6

S S

2.1

1p t

GA-ins
dwarfing
S 5. 8 1. 2 L

IXp t IXpt
T L S

B
B B

4 7
L

10 9 IIpt
SL B T T

Bt

Cp

2pt
T T

5p t

5pt

5pt

IIpt S

11 VIII

2
S L T

I
B

L S

Cp t
B

2pt 5pt
2. 6 3. 1

2.3

Fpt T 7pt
T

D
T

2pt

5.7 5.2

Rice Foxtail millet 2pt Sorghum Pearl millet Photoperiod Maize sensitivity Triticeae
S
2.2

7pt 2pt
L S

Fpt 7pt 7pt 2pt

J 1pt

4pt
B
4.4

3p t
T

5.5 B

2.2 5.4

5p t

1p t

1pt

1. 3 S

1. 1

2. 3 5.6

5pt

5 .3

5pt

DEVOS K, BENNETZEN J., GALE M.

Genmica estrutural e comparativa


Tripsacum (2n=18,36,72, x=9) Andropogoneae sorgo(x=10), cana-de-aucar (x=8 e/ou 10) 16 m.a Paniceae (milhetos (2n=20, x=10) Oryzoideae (2n=24, 48, x=12) 5.Progenitor do milho (2n=16, x=8) 4. Progenitor Maydeae (2n=20, x=10) 25 m.a 3. Progenitor Andropogoneae/Maydeae(2n=20, x=10 Zea mays (2n=20, x=10) 6. Milho tetraploide 16 m.a.

2. Progenitor Panicoideae Ancestral (linhagens de gramneas, muitas com 2n=24, x=12

1. 60 m.a

Evoluo Divergncia da Panicoideae (Wilson et al., 1999)

Nem tudo to simples...

DIFERENTE DO ANCESTRAL ??? O milho apresenta um genoma 6X maior (2400 Mb) ARROZ 60-80% de DNA repetitivo e em rpida evoluo
Do Plants Have a One-Way Ticket to Genomic Obesity? BENNETZEN and KELLOG, Plant Cell. v.9, p.1509-1514, set. 1997.

O uso da Bioinformtica na prospeco de genes para estudos genticos/melhoramento

Do genoma ao fentipo
From genome to phenome (Varshney et al. 2005)

Uma nova abordagem!

Melhoramento convencional
-se baseia na anlise de mdias e varincias para selecionar melhores gentipos -pouco se sabe sobre os genes que controlam a caracterstica -seleo baseada no somatrio dos efeitos dos genes que controlam a caracterstica

Melhoramento assistido por marcadores moleculares


-RFLP, AFLP, RAPD, SSRS -idia associar variaes em regioes anonimas do genoma (gentipo) com as variaes do fentipo

Melhoramento assistido por genes candidatos


-idia associar variaes allicas em certos genes candidatos com variaes do fentipo -idia tornou-se palpvel a partir do desenvolvimento da Genmica

Bioinfomtica toda a ajuda bem vinda!

seqncias genmicas ESTs

cDNA

anlise de mutantes

protemica

bioinformtica gentica vegetal

gene

fentipo

variao gentica

melhoramento vegetal variao fenotpica

O melhorista objetiva relacionar variantes de um gene (alelos) com variaes em fentipos de modo a identificar os melhores alelos

Montando o quebra-cabea

Genes candidatos! O que so?

Dormncia, Viviparidade, Estresse bitico e abitico

Quem so nossos candidatos (genes)

Conhecer/estudar o assunto antes de tudo!!!

Quem so nossos candidatos (genes)

AUSNCIA O2

Quem so nossos candidatos (genes)

Frutas / Estresse

Quem so nossos candidatos (genes)

Seca

Onde buscar

Onde buscar

Vasculhar as informaes disponveis para espcie ou espcies prximas algum j inventou a roda? ou pelo menos parte dela?

Arroz o modelo entre as gramneas

Arroz o modelo entre as gramneas

Arroz o modelo entre as gramneas

Arroz o modelo entre as gramneas

Arroz o modelo entre as gramneas


>gi|115439622|ref|NM_001050626.1| Oryza sativa (japonica cultivar-group) Os01g0720600 (Os01g0720600) mRNA, complete cds GTCTTGCGCCGCTGAGTTTCTGACCCCGCCGCGGCCTCCGCCGTTTCGTACGCC TTCTCCTCTCCCGCGCGCACCCGCCTCCGCCTCCGCCTTCCCCGGCCGCCGCCG CCGCCGCAGGAGAGGAGACGCAGGCCGCGGCGGCGTCAACCGCCGCTCTCCCTT TGCCACCATCTCCGCTCCCGACACACACTCCACTCCACTCCAGTCCACAGCACT AACCCATCGGTCCCGGCGATCCCCACTAGTGCCCCTCCTCGCCCGCTTGCCATG GCGGCTTGCGGCGCCGCGGCGGCGGAGTATTCAGCTCTCCTGTCCCTCTCATGT GGGCCTATCACTCGCCGCCGTTTCGCCGTCTCCTGCCGCGCTCGACCGCCCGGC AACCTCAGTGCACAGCAGAAGAAGAAGCGAGGGAAAAACATTGCTCCAAAACAG CGCTCTTCAAATGCAAAACTCTTGCTTACTACTGAGGAAAATGGACAGCTTCCA AGTACCAGTTTGAGGACTTCTATGGAACGTCCTCAGAAGAGTACATCCAGTGAG GACGATACCAATGGGGCTATTAGCCAGATAGATGAAAAAATTGCAGCCATTGGT AATGAACAGCAAGAGAGGTCAAAGGATAAACATTTCGAATCAGACTTTCAACTT GAAGATTTTGGGGAAATGATACAAAACATGGAAAAGAATATTCTGCTCCTAAAT CAAGCTCGTCTTCAAGCAATTGAAGATGTTGACAAAATTCTTACTGAAAAGGAA GCTTTGCAGAAAAAGGTTGACACTCTAGAGATGAATTTGTCAAAAGCACTTGCA ACCAAAGGGAACATAAATACAGATATCCCTGGTGATCATTTAGAGAAATTTACA AAAGAAATTTTGATAGAAAGTGCTCTAAGTGGAGGCAATCCAGCACATTTGTGT GAGTCTCCACTTTTCATGGAGCTGACTGTTCTAAAAGAAGAGAATATGCTACTT AAGGCTGACGCACAATTTCTTAAAGCAAAGATTGTTGAGTTTGCTGAAACAGAG GAATTCCTATTCAAATTGGAGAAAGAAAGGTCACTGTTAGACGCTACAGTTAGG GAGCTGGAAGCTAGGTTTCTAGTTGCTCAAACTGATATCTGGAAAGTTGTCCCT CTGCAATATGATGTTTGGATGGAGAAAGTAGAAAATCTGCAACACATGCTTGGA TGTTTGAAAAATCATGTAGAGAAGTATGCTGCATTGTTGGATCAGCATGATGAT CTGCATGACAAGATTGATGAGCTAGAAGCATCACTAAAAGAAGGGAAAACATCT GAGTTTTCTCCTTATGTTGTTGAACTTCTGCAACAGAAGTTGAAAGCAGCAAAA AGCCATCACCAAGCAGGCCATCAAGAAACAAACACTCACATTCAAGTATATCAG CAGTTAACTGAGGAATTTCAAGATAACCTAGGTAAACTAATAGAAGAAAGTGGC AGACTGGAGCATTCTGCAAATAGTATGCCATCAGAATTCTGGAGTCACATCCTG CTCATGATTGATGGTTGGTTCCTTGAGCGGAAAATACCAAATACTGATGCACGT ATGCTGAGAGAAATGGCATGGAAGAGAGATGACCGTATCTGTGAAGCCTACTTT GCTTGCAAGGGTGCAAAAGAAAGTGATGTTATGGAAACTTTCCTAAAGCT

O candidato
>gi|115439622|ref|NM_001050626.1| Oryza sativa (japonica cultivar-group) Os01g0720600 (Os01g0720600) mRNA, complete cds GTCTTGCGCCGCTGAGTTTCTGACCCCGCCGCGGCCTCCGCCGTTTCGTACGCCTTCTCCTCTCCCGCGCGCACCCGCCTCCGCCTCCGCCTTCCCCGGCCGCCGCC GCCGCCGCAGGAGAGGAGACGCAGGCCGCGGCGGCGTCAACCGCCGCTCTCCCTTTGCCACCATCTCCGCTCCCGACACACACTCCACTCCACTCCAGTCCACAGCA CTAACCCATCGGTCCCGGCGATCCCCACTAGTGCCCCTCCTCGCCCGCTTGCCATGGCGGCTTGCGGCGCCGCGGCGGCGGAGTATTCAGCTCTCCTGTCCCTCTCA TGTGGGCCTATCACTCGCCGCCGTTTCGCCGTCTCCTGCCGCGCTCGACCGCCCGGCAACCTCAGTGCACAGCAGAAGAAGAAGCGAGGGAAAAACATTGCTCCAAA ACAGCGCTCTTCAAATGCAAAACTCTTGCTTACTACTGAGGAAAATGGACAGCTTCCAAGTACCAGTTTGAGGACTTCTATGGAACGTCCTCAGAAGAGTACATCCA GTGAGGACGATACCAATGGGGCTATTAGCCAGATAGATGAAAAAATTGCAGCCATTGGTAATGAACAGCAAGAGAGGTCAAAGGATAAACATTTCGAATCAGACTTT CAACTTGAAGATTTTGGGGAAATGATACAAAACATGGAAAAGAATATTCTGCTCCTAAATCAAGCTCGTCTTCAAGCAATTGAAGATGTTGACAAAATTCTTACTGA AAAGGAAGCTTTGCAGAAAAAGGTTGACACTCTAGAGATGAATTTGTCAAAAGCACTTGCAACCAAAGGGAACATAAATACAGATATCCCTGGTGATCATTTAGAGA AATTTACAAAAGAAATTTTGATAGAAAGTGCTCTAAGTGGAGGCAATCCAGCACATTTGTGTGAGTCTCCACTTTTCATGGAGCTGACTGTTCTAAAAGAAGAGAAT ATGCTACTTAAGGCTGACGCACAATTTCTTAAAGCAAAGATTGTTGAGTTTGCTGAAACAGAGGAATTCCTATTCAAATTGGAGAAAGAAAGGTCACTGTTAGACGC TACAGTTAGGGAGCTGGAAGCTAGGTTTCTAGTTGCTCAAACTGATATCTGGAAAGTTGTCCCTCTGCAATATGATGTTTGGATGGAGAAAGTAGAAAATCTGCAAC ACATGCTTGGATGTTTGAAAAATCATGTAGAGAAGTATGCTGCATTGTTGGATCAGCATGATGATCTGCATGACAAGATTGATGAGCTAGAAGCATCACTAAAAGAA GGGAAAACATCTGAGTTTTCTCCTTATGTTGTTGAACTTCTGCAACAGAAGTTGAAAGCAGCAAAAAGCCATCACCAAGCAGGCCATCAAGAAACAAACACTCACAT TCAAGTATATCAGCAGTTAACTGAGGAATTTCAAGATAACCTAGGTAAACTAATAGAAGAAAGTGGCAGACTGGAGCATTCTGCAAATAGTATGCCATCAGAATTCT GGAGTCACATCCTGCTCATGATTGATGGTTGGTTCCTTGAGCGGAAAATACCAAATACTGATGCACGTATGCTGAGAGAAATGGCATGGAAGAGAGATGACCGTATC TGTGAAGCCTACTTTGCTTGCAAGGGTGCAAAAGAAAGTGATGTTATGGAAACTTTCCTAAAGCT

Ele tambm existe em outras espcies? Ele unico na espcie? Quanto se conhece sobre ele? Quem trabalhou com ele?

COMO ENCONTRAR ESTAS INFORMAES?

BLAST Resultado Mais informaes do gene homlogo

BLAST Resultado Mais informaes do gene homlogo

BLAST Foi escolhido!!!! E agora ??!!


>gi|115439622|ref|NM_001050626.1| Oryza sativa (japonica cultivar-group) Os01g0720600 (Os01g0720600) mRNA, complete cds GTCTTGCGCCGCTGAGTTTCTGACCCCGCCGCGGCCTCCGCCGTTTCGTACGCCTTCTCCTCTCCCGCGCGCACCCGCCTCCGCCTCCGCCTTCCCCGGCCGCCGCCGCCGCCGCAGGAGAGGAGACGCAGGCCG CGGCGGCGTCAACCGCCGCTCTCCCTTTGCCACCATCTCCGCTCCCGACACACACTCCACTCCACTCCAGTCCACAGCACTAACCCATCGGTCCCGGCGATCCCCACTAGTGCCCCTCCTCGCCCGCTTGCCATG GCGGCTTGCGGCGCCGCGGCGGCGGAGTATTCAGCTCTCCTGTCCCTCTCATGTGGGCCTATCACTCGCCGCCGTTTCGCCGTCTCCTGCCGCGCTCGACCGCCCGGCAACCTCAGTGCACAGCAGAAGAAGAAG CGAGGGAAAAACATTGCTCCAAAACAGCGCTCTTCAAATGCAAAACTCTTGCTTACTACTGAGGAAAATGGACAGCTTCCAAGTACCAGTTTGAGGACTTCTATGGAACGTCCTCAGAAGAGTACATCCAGTGAG GACGATACCAATGGGGCTATTAGCCAGATAGATGAAAAAATTGCAGCCATTGGTAATGAACAGCAAGAGAGGTCAAAGGATAAACATTTCGAATCAGACTTTCAACTTGAAGATTTTGGGGAAATGATACAAAAC ATGGAAAAGAATATTCTGCTCCTAAATCAAGCTCGTCTTCAAGCAATTGAAGATGTTGACAAAATTCTTACTGAAAAGGAAGCTTTGCAGAAAAAGGTTGACACTCTAGAGATGAATTTGTCAAAAGCACTTGCA ACCAAAGGGAACATAAATACAGATATCCCTGGTGATCATTTAGAGAAATTTACAAAAGAAATTTTGATAGAAAGTGCTCTAAGTGGAGGCAATCCAGCACATTTGTGTGAGTCTCCACTTTTCATGGAGCTGACT GTTCTAAAAGAAGAGAATATGCTACTTAAGGCTGACGCACAATTTCTTAAAGCAAAGATTGTTGAGTTTGCTGAAACAGAGGAATTCCTATTCAAATTGGAGAAAGAAAGGTCACTGTTAGACGCTACAGTTAGG GAGCTGGAAGCTAGGTTTCTAGTTGCTCAAACTGATATCTGGAAAGTTGTCCCTCTGCAATATGATGTTTGGATGGAGAAAGTAGAAAATCTGCAACACATGCTTGGATGTTTGAAAAATCATGTAGAGAAGTAT GCTGCATTGTTGGATCAGCATGATGATCTGCATGACAAGATTGATGAGCTAGAAGCATCACTAAAAGAAGGGAAAACATCTGAGTTTTCTCCTTATGTTGTTGAACTTCTGCAACAGAAGTTGAAAGCAGCAAAA AGCCATCACCAAGCAGGCCATCAAGAAACAAACACTCACATTCAAGTATATCAGCAGTTAACTGAGGAATTTCAAGATAACCTAGGTAAACTAATAGAAGAAAGTGGCAGACTGGAGCATTCTGCAAATAGTATG CCATCAGAATTCTGGAGTCACATCCTGCTCATGATTGATGGTTGGTTCCTTGAGCGGAAAATACCAAATACTGATGCACGTATGCTGAGAGAAATGGCATGGAAGAGAGATGACCGTATCTGTGAAGCCTACTTT GCTTGCAAGGGTGCAAAAGAAAGTGATGTTATGGAAACTTTCCTAAAGCT

Primers

Validao como Marcador Molecular

Enfim, o marcador molecular

MARCADORES

Ganho gentico

mapeamento, seleo assistida, conhecer os genes

??? !!!
lmaia.faem@ufpel.edu.br acostol@terra.com.br

??? !!!