P. 1
Seminário sobre Clonagem, Projeto Genoma e Transgênicos

Seminário sobre Clonagem, Projeto Genoma e Transgênicos

|Views: 712|Likes:
Seminário apresentado no ano de 2011 pelo primeiro período de psicologia na aula de Genética e Evolução da Universidade Federal Fluminense (UFF)
Temas abordados: Projeto Genoma, Transgênicos e Clonagem
Seminário apresentado no ano de 2011 pelo primeiro período de psicologia na aula de Genética e Evolução da Universidade Federal Fluminense (UFF)
Temas abordados: Projeto Genoma, Transgênicos e Clonagem

More info:

Categories:Types, School Work
Published by: Gabriela Cabral Paletta on Jul 06, 2011
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PPTX, PDF, TXT or read online from Scribd
See more
See less

06/29/2013

pdf

text

original

G TAC CAG G AAC TAC GAC T G TACAG T T GAC CAGAC T CAC TA AG C C G TAACAAC G C T C G G T CAAC G ACAT G TAC G T G GACAC G T GAC

T C GAC GAT T CAC T G TAC CAG GAAC TAC GAC T G TAC AG T T GAC CAGAC T CAC TA AG C C G TAACAAC G C T C G G T CAA CGACATGTACGTGGACACGTGACTCGACGATTCACTGTAC CAG GAAC TAC GAC T G TACAG T T GAC CAGAC T CAC TA AG C C G TAACAAC G C T C G G T CAAC GACAT G TAC G T G GACAC G T GA C T C GAC GAT T CAC T G TAC CAG GAAC TAC GAC T G TACAG T T GAC CAGAC T CAC TA AG C C G TAACAAC G C T C G G T CAAC GAC ATGTACGTGGACACGTGACTCGACGATTCACTGTACCAGG AAC TAC GAC T G TACAG T T G AC CAGAC T CAC TA AG C C G TAA CAAC G C T C G G T CAAC GACAT G TAC G T G GACAC G T GAC T C G AC GAT T CAC T G TAC CAG GAAC TAC GAC T G TACAG T T GAC C AGAC T CAC TA AG C C G TAACAAC G C T C G G T CAAC GACAT G T AC G T G GACAC G T GAC T C GAC GAT T CAC T G TAC CAG GAAC T AC GAC T G TACAG T T GAC CAGAC T CAC TA AG C C G TAACAAC GC T C G G T CAAC GACAT G TAC G T G GACAC G T GAC T C GAC GA T T CAC T G TAC CAG GAAC TAC GAC T G TACAG T T GAC CAGAC T CAC TA AG C C G TAACAAC G C T C G G T CAAC GACAT G TAC G T G GACAC G T G AC T C GAC GAT T CAC T G TAC CAG G AAC TAC GAC T G TACAG T T GAC CAGAC T CAC TAAG C C G TAACAAC G C T C G GT CAAC GACAT G TAC G T G GACAC G T GAC T C GAC GAT T CAC T G TAC CAG G AAC TAC GAC T G TACAG T T GAC CAGAC T CAC TA AG C C G TAACAAC G C T C G G T CAAC G ACAT G TAC G T G GACAC G T GAC T C GAC GAT T CAC T G TAC CAG GAAC TAC GAC T G TAC

Decifrando o ho

Clique aqui para: Ou aqui:

Aqui

Objetivos e importância
` `

Identificar e mapear os milhares de genes Determinar sequências das bases nitrogenadas
`

Armazenar, analisar esses dados e torná-los acessíveis tornápara novas pesquisas biológicas

`

Descobrir todos os genes na seqüência de DNA
Construir uma série de diagramas descritivos de cada cromossomo humano Busca pelo melhoramento humano e a tentativa de tratar, prevenir ou até mesmo curar doenças genéticas

`

`

Primeiros Genomas Inteiramente Mapeados

Vírus MS2 e SV40, donos no máximo de 6.000 nucleotídeos

Primeiras Conquistas do Genoma Humano
`

Mapeamento de 95% do cromossomo 21,20% do X e 50% do Y.

`

Primeiro cromossomo a ser inteiramente codificado: o Cromossomo 21

A genética fracassou?
`

Promessa 1: Promessas desvendadas

`

Promessa 2: Remédios Personalizados
`

Ele não desistiu

`

Promessa 3: Fama e fortuna As novas promessas

`

As descobertas que frustraram as promessas da genética:
` ` ` ` ` `

No que acreditavam - Cada gene fabrica uma proteína. A verdade - Cada gene pode produzir várias proteínas. No que acreditavam - Os genes agem sozinhos. A verdade - A interação entre genes pode dar novas funções a células. No que acreditavam - O DNA lixo não tem função. A verdade - O DNA antes considerado lixo na verdade regula a interação entre os genes. No que acreditavam - Proteínas recebem ordens dos genes. A verdade - Proteínas podem assumir novas funções de acordo com as reações químicas por que passam no corpo, a influência do ambiente em que a pessoa vive e o envelhecimento do corpo

` `

Como?

Os primeiros experimentos
`

DNA de rato foi introduzido em um camundongo em 1982

`

Nascimento dos primeiros porcos P33 em 1998 e do primeiro primata transgênico em 2001

Usos e benefícios:
`

Agricultura, medicina e indústria.

`

Pesquisas laboratoriais

`

Produção de proteínas, hormônios e afins

Tipos de transgenia
`

Microinjeção pronuclear

`

Recombinação homóloga em células ES

As primeiras:
`

Planta transgênica ² 1983

`

Tomate transgênico nos EUA -1992
`

Comercializações em 1994

Benefícios
`

Redução nos custos de produção

`

Desenvolvimento de espécies com características desejáveis

`

Produtos de uso farmacêutico
`

Mais baratos e podem ser mais seguros

`

Controle de plantas daninhas e insetos

Riscos
`

Uso intensificado de agrotóxicos, herbicidas e inseticidas no caso de plantas mais resistentes

`

Polinização cruzada de plantas geneticamente modificadas com seus parentes selvagens

`

A incerteza da consequência do seu uso a longo prazo

Situação global na produção de transgênicos

No Brasil:
`

Primeiras linhas de ´camundongos nocauteµ totalmente produzidas no Brasil em 2001, depois de 2001, 12 anos de atraso em relação aos países pioneiros Defasagem de 7 anos relacionado às pesquisas de células tronco embrionárias humanas

`

`

Liberação, ainda que restrita, a produção de soja transgênica no país
Voltar

Histórico
` ` ` `

`

Final do século XIX - Conseguiu-se que suas duas células se separassem, dando origem, então, a dois ouriços. Começo do século XX - Obtiveram dois girinos através das duas primeiras células de um ovo de rã 1952 - O núcleo do embrião de um sapo foi inserido em um óvulo anucleado, dando origem a um novo animal. 1995 - Os carneiros Megan e Morag, os primeiros mamíferos clonados a partir de células diferenciadas a sobreviver até a vida adulta. 1996 - Os mesmos cientistas do experimento anterior criaram Dolly, transferindo para óvulos os núcleos retirados de glândulas mamárias de uma ovelha de 6 anos, chamada Bellinda. A ovelha, da raça Finn Dorset, foi dada à luz por uma ovelha de outra raça, a Scottish Blackface.

`

`

`

1998 - Dolly teve um filhote, a ovelha Bonnie, em um cruzamento habitual, o que provou que ela era fértil e capaz de reproduzir. 2002 - Uma forma rara de artrite foi diagnosticada nela. A doença foi, por muitos, interpretada como sinal de envelhecimento precoce, e foi constatado que os telômeros da Dolly eram 20% menores que o previsto para animais de sua idade. Levantou-se outra questão: a idade de Dolly deveria ser interpretada como equivalente aos seus 5 anos somados aos 6 de Bellinda? 2003 - O surgimento de uma infecção pulmonar não controlável, comum em animais velhos mantidos em confinamento, fez com que os pesquisadores optassem por fazer a eutanásia de Dolly, com o objetivo de acabar com seu sofrimento. As dúvidas acerca das suas doenças e se seriam consequências da clonagem persistem.

`

Aplicação

`

Células Tronco Adultas X Embrionárias

`

Futuro do embrião

Clonagem Reprodutiva X Terapêutica

Pontos positivos:
`

Utilização da técnica de clonagem para obtenção de células tronco a fim de restaurar a função de um órgãos ou tecido. A clonagem "terapêutica" teria a vantagem de não oferecer riscos de rejeição se o doador fosse a própria pessoa. (ex.: reconstituir a medula em alguém que se tornou paraplégico após um acidente, ou substituir o tecido cardíaco em uma pessoa que sofreu um infarto). Diminuição/fim do tráfico clandestino de órgãos Ajudar casais inférteis que não podem ter filhos, mesmo após anos de tratamento de infertilidade. Melhoramento animal, resgate de material genético, maximização do potencial genético de uma raça.

`

` `

`

Pontos negativos:
` `

Técnica de baixa eficiência. Vários fetos morrem durante a gestação ou logo após o nascimento. Grande número de anomalias Envelhecimento precoce Os clones seriam maiores do que o normal, denominado de síndrome do filhote grande (large offspring syndrome ² LOS) Lesões hepáticas, tumores, baixa imunidade

` ` `

`

Voltar

Ética Médica
`

Juramento de Hipócrates (Sigilo e Beneficência).

`

Experimentos Nazistas em Humanos.

Hipócrates

`

Código de Nuremberg.

Declaração de Genebra da Associação Médica Mundial
Aprovada pela 2ª Assembleia Geral da Associação Médica Mundial, Genebra, Suíça, setembro de 1948 e alterada pela 22ª Assembleia Médica Mundial, em Sydney, Austrália, agosto de 1968 e pela 35ª Assembleia Médica Mundial, Veneza, Itália, outubro de 1983 e pela 46ª Assembleia Geral da Associação Médica Mundial, Estocolmo, Suécia, setembro de 1994 e revisada na 170ª Sessão do Conselho, Divonne-les-Bains, França, Maio de 2005 e na 173ª Sessão do Conselho, Divonne-les-Bains, França, Maio de 2006 A saúde do meu paciente será minha primeira consideração; [...] Eu não permitirei que concepções de idade, doença ou deficiência, religião, origem étnica, sexo, nacionalidade, filiação política, raça, orientação sexual, condição social ou qualquer outro fator intervenham entre o meu dever e meus pacientes; [...] Eu manterei o máximo respeito pela vida humana; [...] Eu não usarei meu conhecimento médico para violar direitos humanos e liberdades civis, mesmo sob ameaça;

Bibliografia:
http://edutec.net/tecnologia%20e%20educacao/apoio/edtransg.htm http://www.infobibos.com/Artigos/2006_3/transgenicos/index.htm http://www.ufpel.edu.br/iqg/db/e-book%20Plantas%20Transgenicas/situa%E7%E3o/situacao.htm http://salvemmaeterrarosyluzes.blogspot.com/2009/11/alimentos-transgenicos.html http://www.consumidorbrasil.com.br/consumidorbrasil/textos/cidadao/alimentostrans.htm http://www.biotec-ahg.com.br/index.php/pt/acervo-de-materias/agrobiotecnologia/146-racoestransgenicas-sao-seguras-como-as-convencionais

http://www.ghente.org/temas/clonagem/index.htm http://www.saocamilo-sp.br/novo/noticias/controversia-etica.php http://clonagem-etica.blogspot.com/

Psicologia 11.1

http://noticias.universia.com.br/ciencia-tecnologia/noticia/2002/08/28/540705/clonagem-implicaes-juridicas-eticas-religiosas-ecomportamentais.html http://www.ghente.org/temas/celulas-tronco/discussao_etica.htm# http://biologia12ano.blogspot.com/2006/04/implicaes-ticas-dos-transgnicos.html http://transgenicosap.webs.com/implicaessade.htm http://transgenicosap.webs.com/implicaesticas.htm http://super.abril.com.br/superarquivo/2000/conteudo_118965.shtml

Grupo:
Bernardo Gabriela Heloiza Jéssika Oliveira Júlia Matheus Costa Monyze Patrick Raphael

Revista SuperInteressante: edições 9 ² 1988-; 58 ² 1992.; 158 - 2000

Monte aqui seu filho:

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->