P. 1
Lista de Bioquimica Genetica Molecular

Lista de Bioquimica Genetica Molecular

4.5

|Views: 43.724|Likes:
Lista de exercícios de biologia e química sobre Genética Molecular e as biomoléculas envolvidas: nucleotídeos, ácidos nucléicos, aminoácidos e proteínas
Lista de exercícios de biologia e química sobre Genética Molecular e as biomoléculas envolvidas: nucleotídeos, ácidos nucléicos, aminoácidos e proteínas

More info:

Published by: Fabio Dias Magalhães on Jul 11, 2011
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

02/18/2015

pdf

text

original

Prof Fabio Dias Magalhães

Primeira Lista de exercícios de Bioquímica
Temas: nucleotídeos, ácidos nucléicos, aminoácidos, proteínas, síntese protéica, replicação.
Saiba mais em salabioquimica.blogspot.com

TEXTO PARA AS PRÓXIMAS 2 QUESTÕES. (Uerj 2001) O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. 1. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. 2. Calcule as proporções dos três tipos de DNA dupla hélice - LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. 3. (Fuvest 89) O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

pag.1

Prof Fabio Dias Magalhães 4. (Ufrrj 2000) A membrana basal das células tireoideanas tem a capacidade específica de bombear iodeto para o interior da célula. Isto é chamado de seqüestro de iodeto. Na glândula normal, a bomba de iodeto é capaz de concentrar o iodeto até cerca de 30 vezes sua concentração no sangue. Quando a glândula tireóide está em sua atividade máxima, a proporção entre as concentrações pode chegar a um valor de até 250 vezes. (...) O retículo endoplasmático e o complexo de Golgi sintetizam e secretam para dentro dos folículos uma grande molécula glicoprotéica chamada de tireoglobulina.

(Adap. de GUYTON, A. C. e HALL, J. E.. "Tratado de Fisiologia Médica". Rio de Janeiro, Guanabara Koogan, 1997. p.859-860.) A partir da análise do texto e da figura, responda às questões propostas. a) Que tipo de transporte é utilizado para manter as concentrações altas de iodeto no interior da célula? b) De que forma o retículo endoplasmático rugoso e o complexo de Golgi participam na produção de tireoglobulina?

pag.2

Prof Fabio Dias Magalhães 5. (Uerj 98) O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. 6. (Unicamp 96) Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. 7. (Unicamp 92) Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. pag.3

Prof Fabio Dias Magalhães 8. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. 9. (Ufrj 96) A fenilcetonúria é uma doença que resulta de um defeito na enzima fenilalanina hidroxilase, que participa do catabolismo do aminoácido fenilalanina. A falta de hidroxilase produz o acúmulo de fenilalanina que, por transaminação, forma ácido fenilpirúvico. Quando em excesso, o ácido fenilpirúvico provoca retardamento mental severo. Por outro lado, o portador desse defeito enzimático pode ter uma vida normal desde que o defeito seja diagnosticado imediatamente após o nascimento e que sua dieta seja controlada. A fenilcetonúria é tão comum que mesmo nas latas de refrigerantes dietéticos existe o aviso: "Este produto contém fenilcetonúricos!". Qual o principal cuidado a tomar com a dieta alimentar de um portador desse defeito enzimático? Por quê? 10. (G1) Quais são os principais elementos químicos de que são formados os seres vivos? 11. (Ufrj 97) A glicoquinase e a hexoquinase são duas enzimas que reagem com o mesmo substrato, a glicose. Ambas são enzimas intracelulares que fosforilam a glicose formando glicose 6-fosfato (G6P). Dependendo da enzima produtora, a G6P pode ser degradada na via da glicólise para gerar energia, ou então ser usada para síntese de glicogênio. A glicólise ocorre nos tecidos em geral e a síntese de glicogênio ocorre principalmente no fígado. A síntese do glicogênio somente acontece quando existe excesso de glicose no sangue. Essa é uma forma de armazenar esse açúcar. Observe a figura a seguir, que apresenta as velocidades de reação dessas duas enzimas em função da concentração da glicose. Níveis normais de glicose no sangue estão ao redor de 4mm.

Qual das duas enzimas gera G6P para síntese de glicogênio hepático? Justifique sua resposta. pag.4

Prof Fabio Dias Magalhães 12. (Ufrj 99) O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. 13. (Ufscar 2001) O gene A é responsável pela produção do polipeptídeo X. Seu alelo a não produz o polipeptídeo X. Assim, indivíduos de genótipos AA ou Aa produzem o polipeptídeo X, que está ausente nos indivíduos aa. Os dois gráficos, I e II, referem-se à velocidade de formação de um determinado produto (VFP), em mg/hora, em dois indivíduos da mesma espécie, quando suas temperaturas variam.

Sabendo que a velocidade de formação do produto (VFP) está relacionada à presença ou ausência do polipeptídeo X, responda. a) Qual dos gráficos se refere a indivíduo AA ou Aa e qual se refere a indivíduo aa? b) Pelos dados dos gráficos, qual seria a função mais provável do polipeptídeo X no processo de formação do produto? Como você explicaria o comportamento da curva no gráfico correspondente ao indivíduo AA ou Aa? 14. (Unesp 2003) Os antibióticos e as vacinas fazem parte do arsenal da medicina, auxiliando-nos no combate às doenças provocadas por agentes infecciosos. Dentre essas doenças, podemos citar: tuberculose, gripe, hepatite, febre-amarela, gonorréia. a) Das doenças citadas, para quais delas se prescreve tratamento com antibiótico? b) Por que os antibióticos são indicados para os casos de infecções cujos agentes são bactérias, enquanto as vacinas são indicadas para a prevenção de infecções virais? 15. (Unesp 2003) São muitas as lojas que vendem animais exóticos para serem criados em casa como animais de estimação. Em uma dessas lojas, lagartos eram expostos em caixas de vidro, nas quais havia uma lâmpada acesa. a) Qual a razão da lâmpada na caixa em que está colocado o animal? Este procedimento tem alguma relação com algo que o animal experimenta em seu ambiente natural? b) Se esta caixa fosse deixada na vitrine, diretamente sob luz solar intensa, durante todo o dia, haveria prejuízo ao lagarto? pag.5

Prof Fabio Dias Magalhães 16. (Ufscar 2003) Em artigo publicado na "Folha de S.Paulo" (29.09.2002), I. Raw, P. Buss, E. Camargo e A. Homma afirmam: Vacinas são usadas para prevenir doenças infecciosas. Soros são usados, junto de outras medidas, para controlar as doenças que não puderam ser prevenidas. a) De que modo as vacinas previnem doenças? b) De que modo os soros controlam doenças que não puderam ser prevenidas? 17. (Uerj 2005) As estatinas, por seu grande êxito na prevenção da doença coronariana, estão entre os medicamentos mais prescritos no mundo. Essas substâncias atuam sobre a enzima que regula a síntese de colesterol pelo fígado, denominada, simplificadamente, de HMG-CoA redutase. Para testar a eficiência de vários derivados de estatinas, utilizou-se uma preparação de HMG-CoA redutase isolada de tecido hepático. A velocidade de reação dessa preparação enzimática foi medida em função de concentrações crescentes de seu substrato HMG-CoA, na ausência e na presença de uma concentração fixa de três derivados de estatina. Nesses experimentos, o pH, a temperatura, a concentração da enzima e a concentração dos co-fatores necessários foram sempre mantidos constantes. O gráfico a seguir representa os resultados encontrados; a curva 1 foi obtida na ausência de estatinas.

a) Nomeie o tipo de mecanismo de ação das estatinas sobre a enzima HMG-CoA redutase hepática e justifique sua resposta. b) Aponte uma substância sintetizada a partir do colesterol em nosso organismo, não caracterizada como hormônio, e sua respectiva função.

pag.6

Prof Fabio Dias Magalhães 18. (Ufrj 2005) A anemia falciforme é causada por uma mutação que produz uma alteração na seqüência de aminoácidos da hemoglobina. Essa alteração pode ser detectada pela técnica da eletroforese. O diagrama a seguir mostra o resultado do fracionamento por eletroforese da hemoglobina extraída de três indivíduos: A, normal, e B e C com anemia falciforme. Cada banda representa uma hemoglobina, alterada ou não.

Explique por que o indivíduo B apresenta os dois tipos de hemoglobina. 19. (Unesp 2008) Em abril de 2007, astrônomos suíços, portugueses e franceses descobriram um planeta semelhante à Terra fora do sistema solar, o Gliese 581c. A descoberta desse planeta representa um salto da ciência na busca pela vida extraterrestre, visto que os cientistas acreditam que há água líquida em sua superfície, onde as temperaturas variam entre 0 °C e 40 °C. Tais condições são muito propícias à existência de vida. Por que a água na forma líquida e temperaturas entre 0 °C e 40 °C são propícias para a existência da vida tal como a conhecemos? 20. (G2) Por que as mitocôndrias e os cloroplastos apresentam vida relativamente independente dentro das células eucarióticas? 21. (Unicamp 2002) A indústria do entretenimento tem mostrado imagens ilusórias de robôs de ficção como o jovial R2D2 e o chato C3PO, de "Guerra nas Estrelas", e o Exterminador do Futuro. Entre os brinquedos japoneses, há uma série de robôs que imitam movimentos de seres humanos e de animais. Isso deixa as pessoas desapontadas quando se deparam com os robôs reais, que executam tarefas repetitivas em fábricas. Eles não são tão esplêndidos como os anteriormente citados, mas significam menos esforço muscular no mundo real. (Adaptado de James Meek, "Robôs mais baratos tomam fábricas européias", "O Estado de S. Paulo", 23/9/2000.) a) Uma das diferenças entre robôs e seres humanos é que nos homens existem quatro grupos de moléculas orgânicas. Quais são esses grupos? Explique o que essas moléculas têm em comum na sua composição. b) O sistema robótico armazena energia em baterias. Indique dois órgãos ou tecidos de armazenamento de energia nos seres humanos. Que composto é armazenado em cada um desses órgãos ou tecidos?

pag.7

Prof Fabio Dias Magalhães 22. (Unesp 2003) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

a) Segundo o resultado acima, qual dos homens, A ou B, é o provável pai da criança? Justifique. b) Em linhas gerais, como é feito o teste de identificação individual pelo método do DNA-Fingerprint? 23. (Unesp 2004) Os biólogos moleculares decifraram o código genético no começo dos anos 60 do século XX. No modelo proposto, códons constituídos por três bases nitrogenadas no RNA, cada base representada por uma letra, codificam os vinte aminoácidos. Considerando as quatro bases nitrogenadas presentes no RNA (A, U, C e G), responda. a) Por que foram propostos no modelo códons de três letras, ao invés de códons de duas letras? b) Um dado aminoácido pode ser codificado por mais de um códon? Um único códon pode especificar mais de um aminoácido?

pag.8

Prof Fabio Dias Magalhães 24. (Ueg 2005) A figura a seguir refere-se à hereditariedade:

a) Qual a característica do DNA, enquanto molécula mandatária da informação genética, que permite a transmissão dessa informação do organismo para seus descendentes? b) A ocorrência de mutações é importante para a evolução da espécie? Justifique sua resposta. 25. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 26. (G2) Por que o processo de replicação do DNA é chamado semiconservativo? 27. (G2) Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? 28. (G2) Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir, responda aos itens adiante. TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? 29. (Fuvest 95) No DNA de um organismo, 18% das bases nitrogenadas são constituídas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta. pag.9

Prof Fabio Dias Magalhães 30. (Unitau 95) Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.

31. (G2) Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. Utilizando seus conhecimentos sobre o material genético, responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? 32. (G2) No DNA de um organismo, 20% das bases nitrogenadas são constituídas por adenina. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 33. (G2) Mencione duas diferenças de natureza molecular entre o DNA e o RNA. 34. (G2) Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA. 35. (G2) O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? 36. (G2) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA?

pag.10

Prof Fabio Dias Magalhães 37. (G2) O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1, 2 e 3, respectivamente, sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)?

38. (G2) No desenho a seguir, que representa a estrutura da molécula de DNA, o que representam os números 1, 2 e 3 respectivamente?

39. (G2) Uma molécula de DNA contém 15% de guanina. Que outras bases nitrogenadas possui essa molécula e em quais proporções? 40. (G2) Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. a) Represente um nucleotídeo apontando seus três constituintes moleculares. b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA?

pag.11

Prof Fabio Dias Magalhães 41. (G2) Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. São elas: I - AUTODUPLICAÇÃO II - TRANSCRIÇÃO Explique essas duas propriedades. 42. (G2) Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina, responda quais são as outras bases dessa molécula e em que proporções ocorrem. 43. (G2) Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA, qual será a seqüência de bases desse RNA? 44. (G2) Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? 45. (G2) No DNA de um organismo, 32% das bases nitrogenadas são constituídas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 46. (Unesp 90) A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina; Molécula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta. pag.12

Prof Fabio Dias Magalhães 47. (Ufrj 96) O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. Para replicar o genoma, antes da divisão celular, existe uma enzima, a DNA polimerase, cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. Assim, para replicar todo o genoma de uma bactéria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias! Sabemos, no entanto, que o tempo de geração da "E.coli" é de cerca de 20 minutos, e que o tempo médio de replicação de uma célula eucariota é de 12 horas. Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas, explique essa aparente contradição. 48. (Ufrj 96) O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA, ou seja, a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos). Assim, a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). a) Qual a influência da transfusão sugerida no resultado do exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? 49. (Unesp 97) A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1¡. lâmina: ribose 2¡. lâmina: uracila 3¡. lâmina: dupla-hélice 4¡. lâmina: timina 5¡. lâmina: 15% de guanina e 25% de citosina. a) Entre estas lâminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5¡. lâmina.

pag.13

Prof Fabio Dias Magalhães 50. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. Os novos bacteriófagos formados estavam marcados radioativamente. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. A marcação radioativa foi detectada dentro destas bactérias. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se, em vez de fósforo, tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas, os resultados seriam os mesmos? Justifique. 51. (Uerj 97) CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro, conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes, casamentos ancestrais e os ataques de doenças. (adaptado de, "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. b) "... suas andanças pelos continentes, casamentos ancestrais e os ataques de doenças" podem ser estudados através de observações de características morfológicas e fisiológicas da célula. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula. 52. (Ufrj 99) A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. Para se realizar uma análise patrilínea, isto é, a investigação dos ancestrais paternos, usa-se um marcador do cromossomo Y, que não se altera ao longo das gerações (salvo em casos de mutações). Por outro lado, para uma análise matrilínea (materna), lança-se mão do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a análise matrilínea?

pag.14

Prof Fabio Dias Magalhães 53. (Uerj 99) Em células eucariotas mantidas em cultura, adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. Após algum tempo, as células foram transferidas para um novo meio que não continha o isótopo. Amostras destas células foram retiradas 3, 15 e 90 minutos após a transferência, sendo, então, colocadas em lâmina de vidro, fixadas e submetidas a auto-radiografia. Esse processo marca a posição aproximada do isótopo dentro da célula, como representado no esquema a seguir.

a) Cite o tipo de molécula à qual a uridina se incorporou. Justifique sua resposta. b) Nomeie o compartimento celular que seria marcado, se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta. 54. (Uff 99) A mutação em um gene humano provoca cegueira. Com a utilização de técnicas de genética clássica e molecular, verificou-se que este gene está localizado no genoma mitocondrial. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal, mas sim o gene mutado. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego; II) cuja mulher é cega e o homem é normal. b) Justifique as respostas ao item a. 55. (Ufrrj 99) Considerando as propriedades de duplicação do DNA, observe o resultado do experimento a seguir. 1• etapa: Em uma cultura com ¢¦N, obtém-se o crescimento de colônias de bactérias; após esse crescimento promove-se o desenvolvimento de mais duas gerações, em cultura com ¢¥N. 2• etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: - Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N. - Cultura de 1• geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. - Cultura de 2• geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta.

pag.15

Prof Fabio Dias Magalhães

56. (Ufrj 2001) No ADN, a transcrição dos genes não está restrita a somente uma das suas cadeias. Para alguns genes, a seqüência de nucleotídeos transcrita pode estar em uma cadeia, ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. Tal evento inibiria o processo da tradução. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo em que a transcrição da sua cadeia complementar, no mesmo trecho. 57. (Ufal 99) Para desempenhar sua função como material hereditário, o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas.

pag.16

Prof Fabio Dias Magalhães 58. (Unirio 2002) A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico, ressaltando a interação entre as duas cadeias do polímero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrogênio podem ser rompidas por calor, o que produz a dissociação das cadeias. Esse processo reversível chama-se de desnaturação. A temperatura necessária para desnaturar o DNA depende de vários fatores, mas um deles é a composição dos nucleotídeos de um determinado DNA. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior. Justifique a sua resposta. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 59. (Unifesp 2003) Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. Após esse bacteriófago composto infectar uma bactéria, os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA, será de qual deles? b) Justifique sua resposta.

pag.17

Prof Fabio Dias Magalhães 60. (Unifesp 2003) No heredograma seguinte, a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias, que faz com que a produção de energia para os músculos seja deficiente, ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra, aparentemente normal. O casal (P) teve filhos (F1) e estes, por sua vez, também tiveram filhos (F2).

a) Copie o heredograma, pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta.

pag.18

Prof Fabio Dias Magalhães 61. (Fuvest 2004) Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. De uma amostra dessas bactérias (amostra A), extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. Retirou-se uma segunda amostra (amostra B), quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C), quando as bactérias completaram duas divisões celulares. O DNA das bactérias das amostras B e C foi também extraído e centrifugado.

A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior é X, que quantidade de DNA há na faixa superior? 62. (Ufrj 2004) Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200.000 anos. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. 63. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes. a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molécula. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN. pag.19

Prof Fabio Dias Magalhães 64. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa "Nature" intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 65. (Uerj 2006) Num experimento, foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio, ainda no estágio de girino, com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. Explique por que, entre essas células: a) as características genotípicas são iguais; b) as características fenotípicas são diferentes. 66. (G2) Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 67. (G2) Observe o esquema adiante e responda:

a) Quais são as moléculas representadas pelos números 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA). b) Qual é o nome dessa unidade estrutural? 68. (G2) Uma cadeia de RNA tem 200 nucleotídeos. Quantos nucleotídeos tinha o DNA que originou esse RNA?

pag.20

Prof Fabio Dias Magalhães 69. (G2) Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? 70. (Uerj 2004) A enzima poligalacturonase, que digere a parede celular de células vegetais, é a principal responsável pela maturação de frutos como o tomate. Para retardar o amadurecimento e evitar as perdas durante o armazenamento, utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido, de maneira invertida, no genoma de um tomateiro. O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido, ambos ativos nesse tomate geneticamente modificado.

a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado. 71. (Fuvest 92) De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas?

pag.21

Prof Fabio Dias Magalhães 72. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns códons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

73. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. Por que sempre encontramos N > P?

pag.22

Prof Fabio Dias Magalhães 74. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir, é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene, ou do RNA-m correspondentes.

Entretanto, o oposto não é verdadeiro, isto é, a partir da seqüência de aminoácidos de uma proteína, não se pode deduzir a seqüência de nucleotídeos do gene. Explique por quê. 75. (Ufv 2000) Considere a tabela abaixo, contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes, para resolver os itens seguintes:

a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. b) Se ocorresse uma substituição, por uma purina, na 3• base do código correspondente ao 6¡. aminoácido do polipeptídeo, qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado?

pag.23

Prof Fabio Dias Magalhães 76. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. Já o código genético desses organismos é determinado por códons de 2 bases. a) As proteínas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente, 13, 16 e 19 tipos diferentes de aminoácidos. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3,5 bilhões de anos, faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre, a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. 77. (Uff 2004) O fumo está relacionado ao aumento de risco para o câncer de pulmão. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica. O Benzo[a]pireno, um dos principais agentes carcinogênicos presentes na fumaça do cigarro, tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presença do Benzo[a]pireno, em um dos dois sítios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios, justificando cada resposta com a utilização do código genético da figura 2:

pag.24

Prof Fabio Dias Magalhães 78. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. Entretanto, esse código segue o padrão do código genético universal, no qual três bases codificam um aminoácido.

Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA, após uma deleção do TERCEIRO nucleotídeo?

pag.25

Prof Fabio Dias Magalhães 79. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. a) Considere o segmento de DNA, cuja seqüência de nucleotídeos é 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do código genético apresentada a seguir, forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana).

b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual, do tipo substituição, pode afetar a saúde e a qualidade de vida do portador dessa mutação.

pag.26

Prof Fabio Dias Magalhães 80. (Ueg 2007) O esquema a seguir é uma representação do código genético.

De acordo com o esquema apresentado, responda ao que se pede. a) O que é o código genético? b) Explique por que se diz que ele é degenerado. 81. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais. a) Faça um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqüência de DNA, obtém-se uma proteína. b) A partir de uma proteína, é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique.

pag.27

Prof Fabio Dias Magalhães 82. (Fuvest 2005) A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene. --- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda, corresponde ao aminoácido metionina. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.

a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de código genético fornecida, indique a seqüência dos três aminoácidos seguintes à metionina, no polipeptídio codificado por esse gene. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotídios (ou seja, a deleção do par de bases T = A)? 83. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique. 84. (G2) Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido, no ribossomo, a partir desse RNA?

pag.28

Prof Fabio Dias Magalhães 85. (G2) Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma destruição do(s) nucléolo(s) de uma célula?. 86. (Ufrj 97) Em um organismo pluricelular com vários tecidos, como no caso dos seres humanos, todas as células possuem um genoma idêntico. Analogamente, é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta 87. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servirá de molde para a fita de RNA mensageiro, há 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas. Levando-se em consideração essas informações, responda. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipeptídeos que será formada? Justifique sua resposta. 88. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e, em sua cadeia complementar, a seqüência ATG AGG CGA ATC, quais são as seqüências de bases de RNAm por ele produzido? 89. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as seqüências de bases do RNA por ele produzido?

pag.29

Prof Fabio Dias Magalhães 90. (Ufrj 98) Suponha um gene de um eucarioto responsável pela síntese de uma proteína. Nesse gene existem íntrons, ou seja, regiões do ADN cujas informações não estão presentes na proteína em questão. As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem.

A figura mostra cinco regiões, identificadas por números de 1 a 5. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta. 91. (Unirio 2002) Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos; os genes reguladores que codificam proteínas que regulam outros genes; e uma terceira classe de genes que não codificam polipeptídios. Qual o produto final da classe de genes que não codificam polipeptídios? 92. (Uerj 2004) Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA, encontramos aqueles que são RNA (-), como o do resfriado comum, e os que são RNA (+), como o da poliomielite. Observe que: - nos vírus RNA (-), apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada; - nos vírus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vírus necessitam, para sua replicação, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA; - o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus, mas a enzima só é encontrada nas partículas virais RNA (-). a) Explique por que é necessário, para sua replicação, que os vírus RNA (-) já contenham a enzima RNA replicase, enquanto os RNA (+) não precisam armazenar esta enzima. b) Apresente um argumento contrário à hipótese de que os vírus, devido à simplicidade de sua estrutura, foram precursores das primeiras células.

pag.30

Prof Fabio Dias Magalhães 93. (Unicamp 2002) O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal. Os genes autossômicos A, B e C são responsáveis pela produção das enzimas A, B e C que atuam nesse processo metabólico. Mutações nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

a) Do ponto de vista genético, quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique. 94. (Fuvest 93) O que são ácidos nucléicos? Como atuam na síntese de proteínas? 95. (G2) Quais os papéis do gene e do ribossomo na síntese das proteínas celulares?

pag.31

Prof Fabio Dias Magalhães 96. (Fuvest-gv 91) Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausência de crescimento.

Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado, explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura.

pag.32

Prof Fabio Dias Magalhães 97. (Ufrj 95) Na espécie humana há dois tipos de hemoglobinas, conhecidas como hemoglobinas A e S, que diferem apenas em um aminoácido: Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-ácido glutâmico... Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x... Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. Os códons de RNA-m que codificam esses aminoácidos são: valina - GUU, GUG, GUC, GUA histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA ácido glutâmico - GAG, GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir:

a) Qual é o aminoácido que aparece, na hemoglobina S, no lugar do ácido glutâmico? Justifique sua resposta. b) Todas as células, a partir da célula que sofre a mutação, serão anômalas? Justifique sua resposta. 98. (Unicamp 98) O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula. a) Explique a relação que existe entre gene e proteína. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica?

pag.33

Prof Fabio Dias Magalhães 99. (Unicamp 2000) Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga, em quatro espécies próximas. Cada letra representa um aminoácido.

a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. c) Considerando que as espécies 2, 3 e 4 se originaram da espécie 1, que tipo de mutação originou cada seqüência? 100. (Unirio 2002) Sabe-se que a bactéria 'E.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). Isso se deve a dois fatos: primeiro, a lactose não é tão facilmente incorporada pelas bactérias; segundo, porque a lactose necessita ser hidrolisada pela enzima ’-galactosidase em glicose e galactose. O gráfico a seguir resultou de experimento em que 'E.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase, a concentração de glicose e o número de bactérias no meio de cultura em função do tempo.

Identifique as curvas da figura, correlacione os parâmetros concentração de ’-galactosidase, concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase.

pag.34

Prof Fabio Dias Magalhães 101. (Ufrj 2002) Nos procariotos, o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG, que corresponde ao aminoácido metionina. No entanto, além do código AUG, existe uma seqüência curta de nucleotídeos que antecede esse códon. Essa seqüência, que é chamada de Shine-Dalgarno, em homenagem aos pesquisadores que as detectaram, permite que o sítio correto de iniciação da tradução seja selecionado. O diagrama a seguir ilustra a localização dessa seqüência. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação, em azul.

Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm. 102. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína, um grupo de pesquisadores desenvolveu o seguinte experimento: - Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de células, porém no qual haviam todos os componentes necessários à síntese protéica, incluindo os diferentes aminoácidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas, cada uma delas com um único tipo de aminoácido: serina ou alanina ou glutamina. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas?

pag.35

Prof Fabio Dias Magalhães 103. (Uerj 2006) Para investigar possíveis efeitos de uma determinada droga, utilizou-se uma cultura de células, à qual foram adicionadas quantidades adequadas das seguintes substâncias, marcadas com isótopos: uridina ¢¥C, timidina ¤H e leucina ¢¦N. Após algum tempo, a droga foi também introduzida no meio de cultura. Ao longo do experimento, amostras das células foram coletadas a intervalos regulares. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula. Os resultados do experimento estão mostrados no gráfico a seguir.

a) Considere as etapas de replicação, transcrição e tradução nas células analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As proteínas, após sintetizadas, adquirem uma conformação tridimensional. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. 104. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ação da DNA-polimerase, qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição, qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 105. (Uerj 2007) Diversas técnicas são utilizadas para determinar, em genes de uma célula eucariota, a seqüência de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primária da proteína a ser sintetizada. A abordagem experimental mais freqüente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da célula, sintetizar os seus DNA-complementares e, então, proceder ao seqüenciamento das bases presentes nesses DNA. Em uma bactéria, no entanto, é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA.

pag.36

Prof Fabio Dias Magalhães 106. (Ufg 2007) Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas.

Com base nos gráficos, explique a atuação dos antibióticos I e II sobre a síntese protéica. 107. (Ufrj 2008) Se extrairmos o DNA total de células de músculo, baço e rim de um mesmo indivíduo, verificaremos que os tecidos apresentam genomas idênticos. Os RNA mensageiros das células desses três tecidos serão os mesmos? Justifique sua resposta. 108. (G2) Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula, não-patogênicas, em pneumococos com cápsula, patogênicas. 109. (G2) Como os cientistas O. Avery, M. MacLeod e M. McCarthy chegaram à conclusão, em 1944, de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? 110. (G2) O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 111. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias, bem como suas conclusões a partir deste trabalho. 112. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula), analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. pag.37

Prof Fabio Dias Magalhães 113. (G2) Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique. 114. (G2) A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. Certo ou errado? Justifique. 115. (Ufrj 2007) As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes.

Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta.

pag.38

Prof Fabio Dias Magalhães 116. (Ufc 2008) Uma biotecnologia conhecida como "construção anti-senso" (sem sentido) foi utilizada para a produção de tomate transgênico. A transformação genética do tomateiro consistiu na incorporação (no genoma da planta) e na expressão de um segmento de DNA, que apresenta uma seqüência de nucleotídeos, complementar àquela do gene natural. Esse gene natural codifica para a produção de uma enzima, essencial à biossíntese do etileno. Com base no exposto, responda as questões a seguir. a) Qual o resultado da transcrição do gene natural (I) e do "gene anti-senso" (II), presentes no segmento de DNA (molde) das plantas modificadas, mostrado a seguir? 3'___ATTCGGC___TAAGCCG___TAAGCCG___5'(DNA) b) Segundo as regras de emparelhamento dos pares de bases, que fenômeno ocorrerá como resultado do encontro, no citoplasma, entre esses dois RNA mensageiros, determinados no item anterior, e qual a conseqüência para o processo de tradução? c) A transformação genética foi realizada de modo que a expressão do "gene anti-senso" ocorra apenas nos tecidos do ovário floral. Qual o resultado final mais provável de todo esse processo? d) Qual a principal vantagem para os produtores de tomate que passarem a utilizar essas plantas transgênicas? 117. (Ufrn 2005) O teste de paternidade usando o DNA tornou-se muito freqüente hoje. No entanto, as pessoas têm muitas dúvidas a respeito desse tipo de exame. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www.gene.com.br). I. "O exame de DNA só pode ser feito com sangue." II. "Sou primo da mãe e estou com medo do resultado ser positivo, mesmo que eu não seja o verdadeiro pai." III. "Ele já morreu e não deixou nenhum outro parente vivo. Nunca poderei provar que ele era o pai do meu filho." Justifique por que cada uma das frases constitui um "mito". 118. (Ufrn 2002) Uma prática corriqueira na preparação de comida é colocar um pouco de "leite" de mamão ou suco de abacaxi para amaciar a carne. Hoje em dia, os supermercados já vendem um amaciante de carne industrializado. a) Explique o amaciamento da carne promovido pelo componente presente no mamão, no abacaxi ou no amaciante industrializado e compare esse processo com a digestão. b) Se o amaciante, natural ou industrializado, for adicionado durante o cozimento, qual será o efeito sobre a carne? Por quê? TEXTO PARA A PRÓXIMA QUESTÃO (Uerj 2001) A enzima transcriptase reversa é encontrada em retrovírus. Muitos pesquisadores, atualmente, procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima. 119. Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids. TEXTO PARA A PRÓXIMA QUESTÃO (Unicamp 2002) A Química está presente em toda atividade humana, mesmo quando não damos a devida atenção a isso... Esta pag.39

Prof Fabio Dias Magalhães história narra um episódio no qual está envolvido um casal de policiais técnicos, nossos heróis, famosos pela sagacidade, o casal Mitta: Dina Mitta, mais conhecida como "Estrondosa" e Omar Mitta, vulgo "Rango". A narrativa que se segue é ficção. Qualquer semelhança com a realidade é pura coincidência. 120. Os nossos heróis estranharam a presença dos dois copos sobre a mesa, indicando que teria passado mais alguém por ali. Além disso, havia leite e, pela ficha cadastral, eles sabiam que o guarda não podia tomá-lo, pois sofria de deficiência de lactase, uma enzima presente no intestino delgado. Portanto, se o guarda tomasse leite, teria diarréia. Na presença de lactase, a lactose, um dissacarídeo, reage com água dando glicose e galactose, monossacarídeos. a) Complete a equação a seguir, que representa a transformação do dissacarídeo em glicose e galactose: C‚H‚‚O + = + C†H‚O†

b) Se, com a finalidade de atender as pessoas deficientes em lactase, principalmente crianças, um leite for tratado com a enzima lactase, ele terá o seu "índice de doçura" aumentado ou diminuído? Justifique. Lembre-se de que o "poder edulcorante" é uma propriedade aditiva e que traduz quantas vezes uma substância é mais doce do que o açúcar, considerando-se massas iguais. A lactose apresenta "poder edulcorante" 0,26, a glicose 0,70 e a galactose 0,65. 121. (Unesp 2000) Escreva a fórmula estrutural e dê o nome oficial de: a) uma cetona, de cadeia carbônica ramificada saturada, com o total de 7 átomos de carbono. b) um aminoácido, com 4 átomos de carbono. 122. (Unicamp 99) O ácido para-amino-benzóico (PABA) já foi muito utilizado em protetores solares, por conseguir absorver uma parte da radiação ultravioleta oriunda da luz solar. O PABA pode ser considerado como derivado do benzeno no qual um hidrogênio foi substituído por um grupo carboxila e outro por um grupo amino. a) Escreva a fórmula estrutural do PABA. b) Um di-peptídeo é uma molécula formada pela união entre dois amino-ácidos através de uma ligação peptídica. Escreva a fórmula estrutural de uma molécula que seria formada pela união de duas moléculas de PABA através de uma ligação peptídica.

pag.40

Prof Fabio Dias Magalhães 123. (Unifesp 2002) Pacientes com o mal de Parkinson apresentam deficiência de dopamina, um neurotransmissor. L-dopa é uma das drogas usadas no tratamento desses pacientes (D-dopa é menos efetiva e mais tóxica do que a forma L e, por isso, não é usada). A L-dopa, ao contrário da dopamina, é capaz de atravessar a barreira sangue-cérebro e então produzir dopamina pela ação da dopa decarboxilase.

a) Explique o que você entende por forma L da dopa, ilustrando-a por meio de figura. b) Explique a função da dopa decarboxilase na transformação da L-dopa em dopamina. 124. (Unicamp 95) Os ‘-aminoácidos são moléculas que têm um grupo amino e um grupo carboxila ligados a um mesmo átomo de carbono. Um dos vinte ‘-aminoácidos encontrados em proteínas naturais é a alanina. Esta molécula possui também um átomo de hidrogênio e um grupo metila ligados ao carbono ‘. Na formação de proteínas, que são polímeros de aminoácidos, estes se ligam entre si através de ligações chamadas peptídicas. A ligação peptídica forma-se entre o grupo amino de uma molécula e o grupo carboxila de uma outra molécula de aminoácido, com a eliminação de uma molécula de água. Com base nestas informações, pede-se: a) A fórmula estrutural da alanina. b) A equação química que representa a reação entre duas moléculas de alanina formando uma ligação peptídica.

pag.41

Prof Fabio Dias Magalhães 125. (Ufrj 96) Os aminoácidos são moléculas orgânicas constituintes das proteínas. Eles podem ser divididos em dois grandes grupos: os essenciais, que não são sintetizados pelo organismo humano e os não-essenciais. A seguir são apresentados dois aminoácidos, um de cada grupo:

a) A glicina pode ser denominada, pela nomenclatura oficial, de ácido amino etanóico. Por analogia, apresente o nome oficial da leucina. b) Qual desses dois aminoácidos apresenta isomeria óptica? Justifique sua resposta. 126. (Unicamp 2000) Esta prova é uma homenagem à Química, evidenciando alguns de seus aspectos relevantes que ajudaram a entender, a continuar ou a melhorar a vida na Terra. Comecemos por procurar entender, do ponto de vista químico, a origem da vida na Terra. Ainda hoje persiste a dúvida de como surgiu a vida na Terra. Na década de 50, realizou-se um experimento simulando as possíveis condições da atmosfera primitiva (pré-biótica), isto é, a atmosfera existente antes de originar vida na Terra. A idéia era verificar como se comportariam quimicamente os gases hidrogênio, metano, amônia e o vapor d'água na presença de faíscas elétricas, em tal ambiente. Após a realização do experimento, verificou-se que se havia formado um grande número de substâncias. Dentre estas, detectou-se a presença do mais simples ‘-aminoácido que existe. a) Sabendo-se que este aminoácido possui dois átomos de carbono, escreva sua fórmula estrutural. b) Este aminoácido poderia desviar o plano da luz polarizadas? Justifique. c) Escreva a fórmula estrutural da espécie química formada quando este aminoácido é colocado em meio aquoso muito ácido.

pag.42

Prof Fabio Dias Magalhães 127. (Fuvest 2000) O aspartame, adoçante artificial, é um éster de um dipeptídeo.

Esse adoçante sofre hidrólise, no estômago, originando dois aminoácidos e uma terceira substância. a) Escreva as fórmulas estruturais dos aminoácidos formados nessa hidrólise. b) Qual é a terceira substância formada nessa hidrólise? Explique de qual grupo funcional se origina essa substância. 128. (Unifesp 2002) Glicina, o ‘-aminoácido mais simples, se apresenta na forma de um sólido cristalino branco, bastante solúvel na água. A presença de um grupo carboxila e de um grupo amino em sua molécula faz com que seja possível a transferência de um íon hidrogênio do primeiro para o segundo grupo em uma espécie de reação interna ácido-base, originando um íon dipolar, chamado de "zwitterion". a) Escreva a fórmula estrutural da glicina e do seu "zwitterion" correspondente. b) Como o "zwitterion" se comporta frente à diminuição de pH da solução em que estiver dissolvido?

pag.43

Prof Fabio Dias Magalhães 129. (Ufg 2001) No rótulo de alguns refrigerantes light encontram-se as informações "sem açúcar" e "contém fenilalanina". As fórmulas estruturais planas da fenilalanina e do açúcar, às quais o rótulo se refere, são representadas, a seguir:

a) A qual classe de biomoléculas pertencem I e II? b) Circule, nas estruturas I e II, três grupos funcionais diferentes, citando seus nomes. c) Cite uma propriedade química comum às substâncias I e II. 130. (Fuvest 97) Proteínas são formadas por várias cadeias peptídicas que se mantêm unidas através de ligações do tipo I, II e III, formando uma estrutura complexa, como a esquematizada a seguir:

a) Explique de que tipo são as ligações I, II e III assinaladas no esquema da proteína. b) Assinale, com um círculo, uma ligação peptídica na proteína esquematizada acima. 131. (G2) Os códons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminoácidos arginina, leucina e treonina. Escreva esses aminoácidos na ordem correspondente à seqüência TGA - TCT - GAC de um segmento de DNA.

pag.44

Prof Fabio Dias Magalhães

GABARITO
1. Na primeira geração, cada hélice do DNA que contém ¢¥N molda a sua hélice complementar usando bases com ¢¦N. Forma-se, portanto, DNA dupla hélice do tipo intermediário. 2. leve = zero intermediário = 50% pesado = 50% 3. Procarioto porque não existe a carioteca separando o material genético (DNA) do citoplasma, onde se localizam os ribossomos. 4. a) Transporte ativo que ocorre com gasto de energia. b) O retículo endoplasmático rugoso é o responsável pela síntese da porção protéica da tireoglobulina. O complexo de Golgi realiza a associação das partes protéica e glicídica na formação da tireglobulina iodada. 5. a) Em ribossomos isolados não há síntese de cadeias polipeptídicas. O RNA mensageiro é necessário pois transmite a mensagem genética para a síntese dos polipeptídeos. b) Polipeptídeos são formados a partir do encadeamento de aminoácidos. Polirribossomos são constituídos de ribossomos ligados ao RNA mensageiro. 6. a) O núcleo contém DNA que comanda a produção das proteínas através da síntese de RNA. b) Proteínas e Glicoproteínas porque os ribossomos produzem as proteínas que são associadas aos açúcares no Complexo de Golgi. 7. a) Transcrição no núcleo ao nível dos cromossomos e tradução no citoplasma ao nível dos ribossomos. b) Sem a região organizadora do nucléolo não haverá RNA ribossômico, matéria-prima para a produção destes organóides e, conseqüentemente, cessará a síntese de proteínas na célula. 8. a) Os animais têm 2n = 63 cromossomos, porque são resultantes da união de espermatozóide, com n = 31 cromossomos, e óvulo, com n = 32 cromossomos. b) Os cromossomos são de 2 espécies diferentes e, portanto, não ocorre pareamento dos chamados cromossomos homólogos, impossibilitando a meiose e a gametogênese. 9. Evitar a ingestão de alimentos que contenham o aminoácido fenilalanina, pois os "fenilcetonúricos" são incapazes de metabolizar essa substância e correm risco de apresentar graves distúrbios metabólicos com conseqüências irreversíveis. 10. Carbono, Hidrogênio, Oxigênio e Nitrogênio. 11. A hexoquinase possui uma grande afinidade pela glicose, ou seja, ela atinge a velocidade máxima com uma concentração muito pequena de glicose. A glicoquinase exibe uma afinidade bem menor pois somente atinge sua velocidade máxima em concentrações bem mais altas do substrato. Logo, a enzima que contribui para a formação de glicogênio hepático é a pag.45

Prof Fabio Dias Magalhães glicoquinase, pois esta somente produz G6P com máxima eficiência quando há excesso de glicose no sangue. 12. As extremidades do corpo perdem calor para o meio ambiente com mais facilidade e costumam, portanto, apresentar uma temperatura inferior à do restante do corpo. Como a enzima só é ativa abaixo de 34°C, a síntese do pigmento que confere cor negra só ocorrerá nas extremidades do corpo. 13. a) O gráfico I refere-se a um indivíduo AA ou Aa, capazes de produzir o polipeptídeo. O gráfico II representa a formação da substância no indivíduo aa. b) O polipeptídeo X é uma enzima. A análise do gráfico I revela que a velocidade da formação do produto é dependente da temperatura, o que indica tratar-se de uma reação catalisada. 14. a) Tuberculose e gonorréia. b) Os antibióticos atuam como bacteriostáticos (impedindo a reprodução de bactérias) ou bactericidas (provocando a morte de bactérias), sendo inócuos em relação aos vírus. As vacinas levam à produção de anticorpos que atuam sobre os vírus, neutralizando sua ação. 15. a) A lâmpada aumenta a temperatura ambiental. O aumento da temperatura eleva a taxa metabólica do animal, aumentando a sua atividade, uma vez que ele é pecilotermo. No ambiente natural, o animal expõe-se periodicamente à luz solar para aumentar a temperatura corpórea. b) Sim. O lagarto teria um aumento excessivo da temperatura corpórea, o que poderia levar à desnaturação de suas enzimas (hipertermia), podendo, inclusive, ocorrer a morte do animal. 16. a) As vacinas contêm antígenos, substâncias que estimulam o sistema imunológico para a produção de anticorpos específicos. b) Os soros possuem anticorpos específicos que apresentam um efeito terapêutico. 17. a) Inibição competitiva. Na inibição enzimática do tipo competitivo, o inibidor, mantido em concentração constante, exerce seu efeito com maior intensidade em concentrações baixas de substrato. Com o aumento da concentração do substrato, devido ao efeito competitivo, a inibição tende a diminuir. Dessa forma, em excesso de substrato, a velocidade máxima de reação é a mesma na ausência ou na presença do inibidor. b) Uma dentre as substâncias e respectiva função: - sais biliares - emulsificação de gorduras durante a digestão. - vitamina D (Dƒ) - metabolismo do cálcio e desenvolvimento do tecido ósseo. 18. Porque o indivíduo B é um heterozigoto, portador do alelo para anemia falciforme e do alelo normal, e por isso produz as duas formas de hemoglobina. 19. Toda forma de vida depende de reações enzimáticas. As enzimas são catalizadores que dependem, para seu funcionamento, de água (na forma líquida) e temperaturas adequadas, geralmente entre 0 °C e 40 °C. 20. Porque possuem DNA e RNA próprios, podendo sintetizar suas proteínas e se autoduplicar.

pag.46

Prof Fabio Dias Magalhães 21. a) Os seres humanos possuem em sua composição os seguintes compostos orgânicos: - carboidratos (hidratos de carbono ou glicídios) - proteínas - lipídios (gorduras) - ácidos nucléicos (DNA e RNA) - vitaminas Todos os compostos citados anteriormente possuem em sua composição química átomos de carbono, além de hidrogênio e oxigênio. b) Músculos, fígado e tecido adiposo são estruturas armazenadoras de substâncias energéticas. Glicogênio é armazenado nos músculos e no fígado, gorduras ou lipídios são armazenadas no tecido adiposo. 22. a) As três bandas de DNA de origem paterna (não encontradas na mãe) ocorrem no homem B. b) O teste é feito comparando-se as bandas do DNA repetitivo da mãe da criança com os possíveis pais. Estas bandas não correspondem aos genes e são altamente específicas para cada organismo, daí o seu uso. 23. a) Pois códons de duas letras codificam poucos aminoácidos b) Pela existência do código degenerado, poderá mais de um códon determinar um único aminoácido, porém o códon sempre especifica um único tipo de aminoácido. 24. a) A duplicação e replicação semi-conservativa das moléculas de DNA. b) Sim, pois junto com a recombinação gênica, as mutações aumentam a variabilidade genética. 25. REPLICAÇÃO para que possa ser transmitido à descendência e TRANSCRIÇÃO, ou produção do RNA, para controlar as atividades celulares através da síntese de proteínas. 26. A replicação do DNA sempre CONSERVA, nas moléculas-filhas, metade da molécula-mãe. 27. a) TTACCGTAG b) UUACCGUAG 28. a) AAATTACCCGTA b) AAAUUACCCGUA 29. Na fita deverá existir 18% de guanina, 32% de adenina e 32% de timina. O DNA é formado por uma dupla cadeia de polinucleotídeos. Sabendo-se que as cadeias são complementares e o pareamento é sempre adenina com timina e citosina com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser igual a de timina. 30. 1) Ácido fosfórico 2) Desoxirribose 3) Base nitrogenada

pag.47

Prof Fabio Dias Magalhães 31. a) Os genes são constituídos por DNA e se duplicam para que possam ser transmitidos da célula-mãe para as células-filhas durante as divisões celulares e também à descendência dos seres vivos. b) A replicação é semiconservativa porque as moléculas-filhas produzidas sempre conservam metade da molécula-mãe. 32. Timina = 20%, Guanina = 30% e Citosina = 30% 33. O DNA é um polinucleotídeo formado por uma dupla hélice, contém a pentose desoxirribose e Timina como base pirimídica exclusiva. No RNA observa-se uma hélice simples contendo nucleotídeos com ribose e como base pirimídica exclusiva encontramos a Uracila. 34. As moléculas-filhas sempre conservam metade da molécula-mãe 35. Unidades estruturais dos ácidos nucléicos (DNA e RNA). Constituídos por ácido fosfórico + açúcar + base nitrogenada 36. DNA - Desoxirribose (pentose) e Timina (base nitrogenada exclusiva) RNA - Ribose (pentose) e Uracil (base nitrogenada exclusiva) 37. 1 - ácido fosfórico 2 - açúcar desoxirribose 3 - base nitrogenada (Adenina, Guanina, Citosina ou Uracila) 38. 1 - fosfato (PO„­­) 2 - desoxirribose 3 - base nitrogenada 39. Segundo a relação de Chargaff (A + G = T + C), pode-se concluir que as outras bases são: Citosina (C) = 15%, Adenina (A) = 35%, Timina (T) = 35%. 40. a) Observe a figura a seguir:

b) DNA - desoxirribose e timina RNA - ribose e uracila pag.48

Prof Fabio Dias Magalhães 41. A autoduplicação permite que o DNA produza cópias e possa ser transmitido à descendência. Transcrição é a capacidade do DNA produzir o RNA que será traduzido em proteína específica nos ribossomos das células. 42. Timina = 21% Guanina = 29% Citosina = 29% 43. a) TAA GAT GCG TTT CCG b) UAA GAU GCG UUU CCG 44. a) TTT CCG TAA b) UUU CCG UAA 45. As outras bases serão: Guanina =32% Adenina = 18% Timina = 18% 46. A única afirmação possível, face aos dados, é que as duas moléculas possuem as mesmas proporções de bases nitrogenadas. Somente seriam idênticas se a ordenação das bases fosse exatamente a mesma nas duas moléculas. 47. Várias moléculas de DNA-polimerase iniciam a replicação do DNA, simultâneamente, em diversos sítios do genoma denominados sítios de origem de replicação. 48. a) A influência pode ser crucial pois é analisado o DNA fornecido por células nucleadas, como os glóbulos brancos, que podem viver muitos anos e se duplicar ativamente. b) A fraude pode ser evitada colhendo-se células brancas da medula óssea vermelha do indivíduo a ser testado. 49. a) Contém DNA as lâminas de números 3 e 4. b) As proporções desiguais de citosina e guanina indicam a presença, na quinta lâmina, de um ácido nucléico formado por uma hélice simples, podendo ser DNA ou RNA. 50. a) Os bacteriófagos utilizam nucleotídeos que contém ¤£P da bactéria para construir seu material genético (DNA). b) Os bacteriófagos injetam seu DNA com ¤£P no interior da bactéria hospedeira, deixando-a marcada com radioatividade. c) Não. Os vírus não injetam sua capa protéica na célula bacteriana. O ¤¦S radioativo entra na composição de proteínas e não no DNA introduzido pelo vírus. 51. a) O DNA produz cópias idênticas de si mesmo. b) Síntese protéica. 52. Durante a fertilização, somente o DNA nuclear do espermatozóide penetra no óvulo. Por esse motivo, o DNA mitocondrial do pag.49

Prof Fabio Dias Magalhães zigoto é necessariamente materno. 53. a) Tipo de molécula: ácido ribonucléico (RNA) Justificativa: a uridina se incorpora ao ácido ribonucléico. Este ácido é principalmente sintetizado no nucléolo, deslocando-se posteriormente para o citoplasma. b) Compartimento: núcleo Justificativa: a timidina é exclusiva do DNA, encontrado principalmente no núcleo. 54. a) I) filhas: 0% filhos: 0% II) filhas: 100% filhos: 100% b) Em seres humanos, a herança do genoma mitocondrial é, exclusivamente, materna, pois as mitocôndrias do espermatozóide não penetram no óvulo. Portanto, o pai não transmitirá esta característica (cegueira) para a sua prole. Por outro lado, no caso de a mãe ser afetada (cega), esta característica será transmitida para todos os seus filhos. 55. Cultura de crescimento ¢¦N ë 100% de moléculas de DNA com ¢¦N. Cultura de 1• geração ë 100% de moléculas, cada uma com parte da hélice do DNA com ¢¦N e parte com ¢¥N. Cultura de 2• geração ë 50% de moléculas com ¢¥N e 50% com ¢¥N - ¢¦N. A justificativa se baseia na propriedade semiconservativa da duplicação do DNA. 56. Se houvesse a transcrição simultânea das cadeias complementares dos genes, as moléculas de ARN sintetizadas também teriam seqüências complementares. Tal situação provocaria então a formação de moléculas de ARN de cadeia dupla, que não poderiam ser traduzidas nos ribossomas. 57. REPLICAÇÃO: duplicação do material genético (DNA), relacionado com a transmissão das características hereditárias. TRANSCRIÇÃO: síntese de RNA, relacionada com o controle das atividades celulares através da síntese de proteínas. 58. Na cadeia 2 há maior quantidade de pares CG. Devido a este fato, é maior o número de pontes de hidrogênio a serem rompidas, o que justifica a necessidade de uma temperatura de desnaturação mais elevada. 59. a) Os bacteriofagos produzidos pela bactéria infectada terão a cápsula protéica e o DNA do fago T4. b) Durante a infecção, apenas o DNA do fago T4 penetra na bactéria hospedeira. O DNA do fago, passa a comandar a produção da nova linhagem viral. 60. a) Observe a figura a seguir: pag.50

Prof Fabio Dias Magalhães

b) O tipo de herança se justifica, pois apenas o DNA mitocondrial, presente no óvulo (gameta feminino) será transmitido à descendência. 61. a) no tubo B a densidade é intermediária devido a presença do isótopo normal e do isótopo pesado, dada a característica do DNA ser semiconservativo. b) na faixa superior, há X de DNA, com densidade menor (isótopo normal). 62. As mutações ocorrem aleatoriamente, com uma taxa média constante. Logo, a variabilidade genética é diretamente proporcional à antiguidade, o que confirma que nosso ancestral comum mais recente viveu na África. 63. a) C = G = 29% e A = T = 21%. b) Porque a proporção de bases apresentada refere-se às duas cadeias da molécula de DNA, não sendo possível determinar a proporção de citosina na cadeia que será transcrita. 64. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os 'degraus' são constituídos por pares de bases nitrogenadas, unidas por pontes de hidrogênio, onde adenina pareia com timina, e citosina com guanina. b) O DNA realiza a transcrição, isto é, produz o RNA mensageiro, que conduz os códons para a síntese da proteína nos ribossomos. c) As proteínas podem ser diferenciadas pelo número, tipos e seqüências de seus aminoácidos. 65. a) Porque elas possuem DNA idênticos. b) Porque, embora essas células possuam o mesmo DNA, diferentes genes podem ser ativados ou não durante as etapas do desenvolvimento do indivíduo. 66. RNA mensageiro - determina a ordem dos aminoácidos na cadeia polipeptídica RNA transportador - ativação e transporte de aminoácidos para os ribossomos no processo de síntese protéica pag.51

Prof Fabio Dias Magalhães 67. a) (1) = ácido fosfórico, (2) = ribose, (3) = base nitrogenada b) nucleotídeo 68. 400 nucleotídeos porque o DNA é constituído por duas cadeias complementares e apenas uma cadeia com 200 nucleotídeos serviu de molde para a produção de RNA. 69. a) TTT AAG CCC CTA b) 12 nucleotídeos. 70. a) Os RNA mensageiros transcritos do gene normal e do gene inserido formam um RNA de dupla hélice ou híbrido. A disposição das bases destes dois RNA mensageiros são exatamente complementares. b) Havendo a interação entre os RNA mensageiros transcritos a partir destes dois genes, restarão menos mensageiros normais (fita simples) capazes de serem traduzidos em enzima, ao nível ribossomal. Em conseqüência, a concentração da enzima diminuirá nas células, o que retardará o processo de maturação. 71. O DNA é um polinucleotídeo capaz de produzir o RNA mensageiro. Cada três nucleotídeos (códon) do RNAm será traduzido por um aminoácido ao nível dos ribossomos. 72. a) Proteína normal: Val - Leu - Tre - Pro - Tir - Val - Lis Indivíduo A: Val - Leu - Tre - Pro Indivíduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivíduo C: Val - Met - Tre - Pro - Tir - Val - Lis b) A é afetado porque produz uma proteína menor. B é normal, apesar da substituição de uma base nitrogenada no seu DNA, porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína. 73. Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. Logo, o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos. 74. Porque o código genético é degenerado, isto é, para um mesmo aminoácido existem vários códons diferentes. 75. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado, TTA, especificaria o terceiro aminoácido da tabela. c) UUA 76. a) As proteínas produzidas pelos extraterrestres em questão poderiam ter, no máximo, 16 tipos diferentes de aminoácidos. pag.52

Prof Fabio Dias Magalhães Seu código genético, formado por pares de bases, permite a formação de apenas 16 códons diferentes. Isso sem considerar a possibilidade da existência de um, ou mais, códons de finalização. Neste caso, não seria possível a produção das proteínas B e C com, respectivamente, 16 e 19 aminoácidos. b) A diversidade no planeta Terra seria maior, pois o código genético dos terráqueos é formado por 64 códons, sendo 3 códons de finalização. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria, obviamente, maior. c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena, uma vez que o equipamento ribossômico da bactéria que incorporou o gene, está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. 77. Quando a mutação for localizada: a) no sítio 1 A seqüência do DNA será modificada pelo benzo[a]pireno de ATG para ATT levando, na transcrição, a formação de um RNAm com a seqüência UAA ao invés de UAC. UAA é um códon de terminação, portanto, a mutação provocará a produção de uma proteína menor. b) no sítio 2 A seqüência do DNA de CCG será modificada para CCT levando na transcrição, a formação de um RNAm com a seqüência GGA ao invés de GGC. Nessa situação, a modificação de GGC para GGA não provocará alteração na proteína; os dois códons na tradução produzem uma proteína com o aminoácido glicina, nesta posição. 78. a) RNA-polimerase. b) UAC. c) W - A - T - S - O - N - E - C - R - I - C - K. d) A proteína não será formada, pois foi alterado o códon de iniciação. 79. a) Produto da síntese protéica (polipeptídio): val - his - leu - thr - pro - glu - glu - lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. Conseqüência: anemia falciforme - alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina); - alteração da função da proteína (globina); - redução da capacidade de transporte de oxigênio; - manifestação dos sintomas da anemia falciforme. 80. a) É a correspondência entre as trincas de bases dos códons e os aminoácidos por eles codificados. b) Por que um único aminoácido pode ser codificado por mais de um códon.

pag.53

Prof Fabio Dias Magalhães 81. a) Observe a figura a seguir:

b) Não. Sendo o código genético degenerado, diferentes trincas de nucleotídeos especificam o mesmo aminoácido. 82. a) AUG AGU UGG CCU G b) Serina - triptofano - Prolina c) Metionina - Serina - Glicina 83. a) CAU CGG AUC b) Somente se formará o mesmo peptídeo se os códons transcritos a partir da fita complementar especificarem os mesmos aminoácidos, devido à degeneração do código genético. 84. a) TTA CAT CCG b) três 85. a) núcleo e ribossomos. b) cessa o processo de tradução. 86. Não. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes proteínas que contêm. Assim, a diferenciação dos tecidos resulta principalmente da transcrição de genes diferentes, o que naturalmente produz uma composição de RNAm qualitativamente diferente de tecido para tecido. 87. a) DNA ýcadeia complementar: 30A-20C-12T-10G þ ÿcadeia ativa: 30T-20G-12A-10C RNA-mensageiro: 30A-20C-12U-10G Portador, o RNA-m terá 12 uracilas e 10 guaninas. pag.54

Prof Fabio Dias Magalhães b) A cadeia ativa apresenta 72 bases. Cada aminoácido é codificado por um códon constituído por 3 bases. Daí concluímos que 72 bases formam 24 códons que produzirão uma cadeia polipeptídica com 24 aminoácidos. 88. AUG AGG CGA AUC e UAC UCC GCU UAG 89. UGA GGC GAA e ACU CCG CUU 90. As regiões 2 e 4. Essas regiões formam alças justamente por não possuírem as seqüências de nucleotídeos complementares, que foram eliminadas após o processo de transcrição. 91. Os genes que não codificam polipeptídeos transcrevem para produzir RNA ribossômico e RNA transportador. 92. a) Para que o genoma RNA (-) seja expresso em proteínas na célula infectada, é primeiro necessário que seja transcrito em RNA complementar, o que é feito, apenas, pela RNA replicase, que não existe na célula. Desta forma, o próprio vírus terá de já possuir a enzima em sua estrutura. Os vírus RNA (+) já funcionam como mensageiros na célula infectada, sendo diretamente traduzidos em proteínas virais, inclusive a RNA replicase. b) Os vírus só existem em virtude de sua habilidade de utilizar a maquinaria metabólica das células hospedeiras, direcionando-a para a formação de novas partículas virais. Portanto, os vírus só devem ter surgido após o aparecimento das primeiras células. 93. a) Do ponto de vista genético, poderiam ocorrer três tipos de albinismo, pois estão envolvidos três pares de genes para a produção do pigmento no animal. Defeitos no gene A, impedem a formação do composto 1, interrompendo toda a cadeia de reações que levam ao desenvolvimento da cor. Alterações no gene B, acarretam a não formação do composto 2, resultando também na não formação da pigmentação. Mutações no gene C, impedindo a síntese do composto 3, também causariam albinismo. b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo: AAbbCC x AABBcc Geração: AABbCc - 100% pigmentados

c) Devido à degeneração do código genético, um aminoácido pode ser determinado por diferentes códons. Assim, uma mutação em um gene, pode não causar qualquer alteração na proteína codificada. 94. São moléculas (DNA e RNA) que comandam, através da síntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a tradução do código genético em uma proteína. 95. O gene (cístron) determina a ordenação dos aminoácidos das proteínas produzidas em uma célula. Os ribossomos fazem a tradução do código genético do DNA através da leitura do RNA mensageiro. 96. Cada mutante possui um gene alterado. Z só cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta pag.55

Prof Fabio Dias Magalhães alteração. 97. a) Valina, porque houve uma substituição (T x A) no codon do DNA correspondente a esse aminoácido. b) Não, porque após a replicação do DNA é semiconservativa. 98. a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código químico representado por seqüências de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma proteína. A seqüência de trincas determinará a seqüência dos aminoácidos de um polipeptídeo. b) Mutações são modificações na seqüência ou na composição das bases do DNA (gene) que podem causar a produção de uma proteína alterada, ou mesmo a não produção da proteína. c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma alteração na proteína produzida pela célula porque o código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por diferentes trincas de bases. 99. a) São necessários pelo menos 84 nucleotídeos pois cada aminoácido de uma proteína é codificado por uma trinca de nucleotídeos. b) Não. Devido à degeneração do código genético, um aminoácido pode ser codificado por mais do que uma trinca de nucleotídeos. c) A mutação que originou a espécie 2 foi uma SUBSTITUIÇÃO. Uma INVERSÃO produziu a alteração verificada na espécie 3 e uma DELEÇÃO acarretou o surgimento da espécie 4. 100. Os círculos pretos representam o número de bactérias; os círculos brancos representam a concentração de glicose; os triângulos pretos a concentração da enzima ’-galactosidase. Enquanto existe glicose no meio a ’-galactosidase está reprimida. Quando a glicose se esgota a expressão dessa enzima é induzida. 101. Como o ARNm pode conter outros códons AUG, além do códon de iniciação, a iniciação da tradução poderia ocorrer em qualquer região onde houvesse um outro códon AUG, o que geraria peptídeos truncados ou incompletos. A tradução só ocorre quando a seqüência de Shine-Dalgarno e o códon AUG estão presentes. 102. a) As proteínas obtidas possuíam apenas um tipo de aminoácido porque o DNA utilizado apresentava um único tipo de códon (AGC). b) O tipo de aminoácido utilizado na produção da proteína poderá variar dependendo do local onde os ribossomos iniciam a tradução do código genético. O aminoácido utilizado é a serina quando a leitura começa no A, do códon AGC. O aminoácido é a alanina quando a leitura começa no G, do códon GCA. O aminoácido utilizado é a glutamina, quando a leitura começa no C, do códon CAG. 103. a) Replicação: não interfere; não há alterações na incorporação de timidina marcada no DNA. Transcrição: não interfere; não há alteração na incorporação de uridina marcada no RNA. Tradução: interfere; esta etapa é bloqueada porque há uma queda acentuada na incorporação de aminoácido marcado na proteína.

pag.56

Prof Fabio Dias Magalhães b) Duas dentre as ligações ou interações: - ponte dissulfeto - ponte de hidrogênio - forças de van der Walls - interações hidrofóbicas - interações eletrostáticas 104. a) 3'TACGCA5'. b) 5'AUGCGU3'. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). 105. Os organismos eucariotos possuem íntrons, regiões não codificantes em seu DNA, que serão eliminadas no processo de maturação do RNA-mensageiro, antes que ele seja traduzido em proteína. 106. O antibiótico I atua sobre a tradução, pois, ao ser administrado, reduz imediatamente a síntese protéica. O antibiótico II pode atuar inibindo a transcrição e/ou a replicação gênica, pois no momento da administração até o início da redução da síntese protéica, decorrem 20 minutos; isso significa que havia ácido ribonucléico mensageiro sendo traduzido e produzindo proteína. 107. Não, porque a diferenciação celular envolve a expressão (transcrição) e a inativação de diferentes genes nos diversos órgãos. 108. Experimento realizado com bactérias 'Pneumococo pneumoniae' sem cápsula (não patogênicas) e com cápsula (patogênicas). 1¡.) bactérias pneumococo sem cápsula ë ratos = ratos vivos. 2¡.) bactérias pneumococo com cápsula ë ratos = ratos mortos. 3¡.) bactérias pneumococo sem cápsula + bactérias capsuladas mortas pelo calor ë ratos = ratos vivos. 4¡.) bactérias sem cápsula + extrato de bactérias capsuladas mortas pelo calor ë ratos = ratos mortos. Conclusão: Existe algum agente transformante no extrato de bactérias capsuladas mortas pelo calor que é capaz de modificar as não capsuladas. Esse agente seria o Ácido Desoxirribonucléico (DNA). 109. Trataram o extrato de bactérias pneumococo capsuladas mortas pelo calor com a enzima desoxirribonuclease. Esta enzima hidrolisa o DNA, destruindo, portanto, o agente transformante capaz de modificar as bactérias sem cápsula não patogênicas em capsuladas patogênicas e letais para os ratos utilizados nos experimentos. 110. Vírus utilizados nos experimentos que serviram para demonstrar que o DNA é de fato o material genético. 111. 1¡.) bactérias 'Escherichia coli' cultivadas em meio contendo P¤£ e S¤¦ ë bactérias marcadas com os elementos radioativos. 2¡.) Vírus bacteriofagos parasitam as bactérias marcadas e ficam também marcados com P¤£ no DNA e S¤¦ na cápsula protéica.

pag.57

Prof Fabio Dias Magalhães 3¡.) Vírus marcados parasitam bactérias não marcadas. 4¡.) Antes da lise bacteriana o preparado é levado ao liquidificador e centrifugado. 5¡.) O sobrenadante apresenta as cápsulas protéicas marcadas com S¤¦ e no precipitado há bactérias contendo DNA marcado com P¤£. Conclusão: O DNA viral é a substância capaz de TRANSFORMAR as bactérias em "fábricas" de novos vírus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substância que controla a hereditariedade. 112. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada, que interrompe a leitura do ARNm pelo ribossoma. 113. Não necessariamente, pois a substituição de bases nitrogenadas na cadeia do DNA poderá determinar os mesmos aminoácidos, na mesma ordem, em uma proteína, já que o código genético é degenerado. 114. Não. O código genético é degenerado, ou seja, diferentes trincas podem especificar o mesmo aminoácido na síntese das proteínas celulares. 115. A mudança 2, pois essa é a única que provoca troca de aminoácidos. Essa troca altera a estrutura do peptídeo, o que pode alterar sua função. 116. a) (I): UAAGCCG; (II): AUUCGGC; b) b1. Emparelhamento dos RNA / Formação de RNA de fita dupla; b2. A tradução será inibida; c) Não haverá a síntese de etileno nos tecidos do fruto, e o fruto não amadurecerá; d) Poderão armazenar os frutos por mais tempo, depois de colhidos. 117. I. O teste de paternidade é viabilizado através da obtenção de DNA não somente de células sanguíneas, mas de qualquer tecido que contenha DNA. II. O filho apresenta 50% do seu material genético proveniente da mãe e 50% do pai. A semelhança genética do primo em questão seria menor que 50%. III. O material genético pode ser colhido de cadáveres a partir de restos mortais, tais como ossos ou fios de cabelo. 118. a) Os amaciantes naturais e industrializados contêm proteases, enzimas relacionadas com a hidrólise das proteínas fibrosas que "endurecem" a carne. No corpo humano, a digestão das proteínas da carne tem início na cavidade gástrica, por ação da enzima pepsina. Prossegue no duodeno, onde atua a tripsina presente no suco pancreático e é finalizada pela atividade das peptidases existentes no suco entérico. b) O cozimento causará a desnaturação das enzimas presentes nos amaciantes. Desta forma, a carne não sofrerá qualquer efeito, pois as enzimas desnaturadas não poderão desempenhar seu papel como catalisadores biológicos. 119. O vírus da AIDS é um retrovírus que, para multiplicar-se em células humanas, precisa transcrever o código genético contido pag.58

Prof Fabio Dias Magalhães em sua molécula de RNA, sintetizando um DNA que será incorporado ao genoma da célula infectada. Para isso, emprega a transcriptase reversa contida no próprio vírus. 120. a) C‚H‚‚O + H‚O = C†H‚O† + C†H‚O† b) O leite tratado com enzima lactase terá o seu "índice de doçura" aumentado, pois o "poder edulcorante" da lactose é inferior ao "poder edulcorante" da glicose e da galactose. 121. a) Uma das várias cetonas de cadeia ramificada saturada, com total de 7 átomos de carbono, é:

122. Observe as figuras a seguir

123. a) A forma L da dopa representa o isômero óptico levógiro (desvia o plano de luz polarizada para a esquerda). b) A dopa decarboxilase atua como catalisador. 124. Observe a figura a seguir:

pag.59

Prof Fabio Dias Magalhães

125. a) ácido 2 - amino - 4 - metilpentanóico b) A leucina, pois apresenta carbono assimétrico. 126.

a) fórmula estrutural figura I. b) Este aminoácido não desvia o plano da luz polarizada porque não representa carbono assimétrico ou quiral, ou seja, sua molécula não é assimétrica. c) fórmula estrutural figura II. 127. a) Observe a figura a seguir:

b) A terceira substância formada é o metanol, HƒC-OH, que é produzida na hidrólise do grupo éster. 128. a) Observe a fórmula estrutural a seguir: pag.60

Prof Fabio Dias Magalhães

b) Como base de Bronsted-Lowry e transforma-se em um íon positivo. 129. a) I - Proteína II - Carboidrato do tipo halosídeo b) Observe o esquema a seguir:

c) Ambas sofrem hidrólise. 130. a) I - Ponte dissulfeto, ligação covalente pelo compartilhamento de elétrons entre os átomos de enxofre. II - Ponte de hidrogênio, ligação intermolecular entre elementos que apresentam grande diferença de eletronegatividade. III - Ligação iônica, atração eletrostática entre íons positivo (cátion) e negativo (ânion). b) Observe as ligações peptídicas assinaladas na figura a seguir:

pag.61

Prof Fabio Dias Magalhães

131. Treonina - Arginina - Leucina

Conheça os cursos da Sala Bioquímica em salabioquimica.blogspot.com

1.Química , com o professor Adriano Guimarães, nas tardes de quarta-feira. Aulas teóricas e simulados objetivos e discursivos semanais.
Conteúdos para Julho, Agosto, Setembro e Outubro: Ligações Químicas, Química Orgânica, Funçôes Inorgânicas e Estequiometria, Equilíbrio, Termoquimica, Cinética e Eletroquímica. Curso de Química (Novembro e Dezembro): Revisão para a 2 etapa UFMG com simulados discursivos semanais e carga horária mais elevada, com mais de 6 horas semanais.

2.Biologia, com o professor Fabio Dias Magalhães
Março:Método Científico, Biotecnologia e Características Gerais da Vida Abril a Maio:Genética e Evolução Junho:Ecologia Agosto e Setembro: Por dentro: aprofundamento em fisiologia para o vestibular de Medicina. Outubro: Ambiente e Saúde Novembro e Dezembro: Revisão e aprofundamento para 2a etapa Dias 26 a 30 de dezembro (última semana do ano): Curso Intensivo de Revisão Encontre e Destrua

Cursos direcionados para estudantes que já fizeram pré-vestibular e procuram aprofundamento e revisão para o vestibular de Medicina.

pag.62

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->