Você está na página 1de 20

SIMULANDO A TCNICA DE SEQUENCIAMENTO DO DNA

Autores: Jos Mariano Amabis e Solange Soares de Camargo


Verso inicial: Jos Mariano Amabis Ilustraes: Pablo Candiani Editorao: Gledsley Muller

Ficha Tcnica: Tema central: Compreender a tcnica utilizada para o seqenciamento do DNA rea de interesse: Biologia Molecular/Gentica Pblico Alvo: Alunos do Ensino Mdio ou da Graduao Nmero de participantes: 40 alunos em grupos de trs a cinco. necessrio que
se forme pelo menos 10 grupos, para que todos os nucleotdeos da fita molde possam ser seqenciados. Tempo da atividade: Cerca de 30 min (sem a discusso posterior)

PROJETO MICRO&GENE
Apoio Financeiro Pr-reitoria de Graduao da Universidade de So Paulo Projeto Promat

RESUMO

Esta atividade tem por objetivo ilustrar como se faz o seqenciamento de DNA. Para tanto, cada grupo de alunos recebe um basto de madeira contendo algumas contas com letras que representa a cadeia de DNA a ser seqenciada. A partir dessa cadeia molde, cada grupo sintetiza dez cadeias complementares. A sntese das novas cadeias feita pelo sorteio, em seqncia, do nucleotdeo complementar a cada um dos nucleotdeos da cadeia molde. O sorteio de uma conta branca indica que a sntese deve continuar com o sorteio do nucleotdeo seguinte. O sorteio de uma conta colorida indica a interrupo da sntese. A seguir, as cadeias obtidas por todos os grupos so reunidas e ordenadas por tamanho, simulando a separao das mesmas pela eletroforese. A traduo da cor da ltima conta incorporada em cada uma das cadeias ordenadas por tamanho, leva seqncia complementar da cadeia molde. Compreender a tcnica utilizada para o seqenciamento do DNA. A Biologia Molecular o ramo da Biologia que mais tem se desenvolvido nos ltimos anos. O conhecimento sobre os genes e seu funcionamento deixou os laboratrios e passou a ter interesses econmicos e ticos. Ao abordar os conhecimentos relacionados s tcnicas empregadas em Biologia Molecular, estamos contribuindo para que a escola cumpra seu papel de transmitir o conhecimento socialmente produzido, e, a partir da motivao que tais conhecimentos proporcionam, explorar aquilo que estudiosos de pedagogia consideram contedos sempre presentes: fatos, conceitos, princpios, procedimentos, atitudes, normas e valores. Esta atividade tem como funo pedaggica principal aproximar o conhecimento cientfico do conhecimento escolar, tornando a tcnica de seqenciamento de DNA compreensvel, tanto para os alunos do ensino mdio como os da graduao. Uma maior proximidade com o conhecimento cientfico pode despertar no aluno o interesse por outras questes relacionadas ao DNA e amplamente divulgadas pela mdia: projetos genomas, testes de DNA, transgnicos, entre outros. despeito da ampla divulgao, essas questes so muito mal compreendidas pelos alunos, como atestam vrios estudos. Para a graduao, os objetivos poderiam ser ainda ampliados de acordo com o contexto em que a atividade fosse empregada. No incio de um curso de Biologia Molecular, por exemplo, esta atividade poderia ser utilizada para introduzir o conceito de replicao do DNA, ou at mesmo para aprofundar o conhecimento j adquirido sobre a estrutura desta molcula. Outras funes pedaggicas, intrnsecas do trabalho em grupo podem ser ainda mencionadas: a troca de informaes, o estabelecimento coletivo de uma estratgia de ao, a anlise conjunta de dados, a transposio de linguagem, entre outras.

OBJETIVO JUSTIFICATIVA

FUNO PEDAGGICA

PREPARANDO A ATIVIDADE

1. Conceitos prvios requisitados Para que os alunos do ensino mdio possam compreender o significado da atividade, necessrio que eles tenham noes sobre a estrutura do DNA e entendam a relao existente entre DNA cromossomo, gene, ncleo e clula. Para os alunos da graduao, alm das relaes citadas, ideal que o aluno possua tambm algum conhecimento sobre a natureza e funo das enzimas, o processo de desnaturao do DNA e a formao das ligaes covalentes, pois, com a atividade, esses conceitos podero ser compreendidos de forma mais significativa. Como seqncia da atividade, o professor da graduao poder explorar o processo de replicao do DNA. 2. Verificao dos conhecimentos sobre o sequenciamento de DNA Antes do incio da atividade interessante que o professor verifique quais so os conhecimentos dos alunos sobre o que seqenciar o DNA. Isto pode ser feito por meio de uma pergunta simples do tipo: qual a primeira palavra que ocorre quando voc ouve a expresso seqenciar o DNA?. O professor dever registrar todas as palavras mencionadas e construir, a partir desse conjunto, o conhecimento prvio dos alunos e sua rede conceitual. Pode ser que os alunos fiquem intimidados e digam que nada sabem. Cabe ao professor estimular a tempestade cerebral e deixar que os alunos se manifestem livremente. Algumas expresses como: Programa do Ratinho podem soar estranhas, mas guardam estreita relao com o tema, uma vez que o apresentador de TV um dos maiores divulgadores do teste de paternidade que tambm emprega molculas de DNA. O registro das manifestaes dos alunos pode facilitar as aes do professor na preparao adequada da atividade

Material / grupo:

4 saquinhos de cores diferentes (verde, vermelho, amarelo e azul) contendo contas brancas e coloridas; 1 placa de madeira com 2 fileiras de 10 furos; 1 basto de madeira contendo contas com letras; 10 bastes de madeira contendo contas transparentes 1 placa grande de madeira

Material / classe:

PROCEDIMENTO -

1 Organizar o material como indica a figura 2 Iniciar uma simulao de sntese da cadeia complementar cadeia molde atravs do sorteio da conta complementar primeira letra da conta encontrada aps as contas transparentes (na Fig. 1, a letra T). O saquinho escolhido para o sorteio dever ser, portanto, o verde, pois ele contm os nucleotdeos complementares a T, ou seja, A. A relao entre a cor do saquinho e a conta dentro dele : Verde Adenina (A) Amarelo Guanina (G) Azul Citosina (C) Vermelho Timina (T) Lembrar que as relaes de complementaridade so: A-T e C-G.

Fig. 1 Posicionamento inicial dos bastes na placa de madeira: contas com letras (a), contas transparentes (b), placa de madeira (c).

3 Colocar a conta sorteada no basto em frente cadeia molde (Fig. 2 - superior). Caso a conta sorteada seja de cor branca, repetir o procedimento com um novo sorteio, agora relacionado com a letra da 2 conta (no caso da Fig. 2, C). Caso seja sorteada uma conta colorida, o processo deve ser interrompido e a cadeia molde deslocada para o furo seguinte. Reiniciar o mesmo procedimento (1 e 2) para a formao de uma nova cadeia complementar (Fig. 2 - inferior) 4 Repetir os mesmos passos at que todas as cadeias sintetizadas terminem com uma conta colorida ou sejam totalmente completadas com contas brancas (Fig. 3).

Fig. 2 Movimento inicial da cadeia molde.

Fig. 3 Movimento da cadeia-modelo aps interrupo da sntese pelo sorteio de uma conta colorida.

5 Por fim, as cadeias sintetizadas pelos grupos devem ser ordenadas na placa grande de madeira de acordo com seus tamanhos, ao longo do eixo maior da placa. Os bastes com maior nmero de contas devem ser colocados nos primeiros furos, seguidos pelos de menor nmero, e assim sucessivamente, at que o ltimo contenha apenas uma conta colorida .

COMPREENDENDO A ATIVIDADE

A avaliao da compreenso da atividade, por parte dos alunos, poder ser feita com a utilizao de um texto que explica o princpio da tcnica empregada. A tarefa dos alunos consiste na substituio das palavras em negrito pelos nomes de cada material utilizado durante a atividade.
O seqenciamento do DNA baseia-se na interrupo da sntese da cadeia complementar pela incorporao de um nucleotdeo quimicamente modificado, um didesoxinucleotdeo. Na reao de seqenciamento, da qual esta atividade uma simulao, so misturados num mesmo tubo: o segmento de DNA a ser seqenciado (1), cadeias curtas de DNA denominadas de iniciadores ou primers (2), a enzima DNA polimerase (3), os desoxinucleotdeos das quatro bases nitrogenadas: A, T, C e G (4) e os seus respectivos didesoxinucleotdeos (5). Inicialmente, as duas cadeias de cada molcula de DNA so separadas, aquecendo-se a amostra a temperaturas superiores a 90C. Em seguida, a temperatura reduzida, permitindo que os iniciadores ou primers (2), se associem, por complementaridade, ao segmento a ser seqenciado (1). A DNA polimerase (3) sintetiza, ento, a cadeia nova: onde houver um nucleotdeo de Adenina na cadeia-modelo, ser acrescentado um nucleotdeo de Timina e vice-versa, onde houver um de Guanina, ser acrescentado um de Citosina e vice-versa. Como no h, por parte da DNA polimerase, nenhuma preferncia entre os desoxinucleotdeos (4) ou didesoxinucleotdeos (5), esses ltimos podem ser incorporados em lugar de um nucleotdeo normal. No entanto, quando a cadeia nova (6) recebe um didesoxinucleotdeo, a seqncia interrompida, uma vez que no h nesta molcula um radical hidroxila (OH) disponvel para a formao da ligao covalente com o nucleotdeo seguinte. Cada didesoxinucleotdeo empregado na reao est associado a um cromforo, uma substncia que apresenta uma determinada cor quando estimulada por um feixe de laser. Desta forma, para conhecer a seqncia da cadeia-molde (1), um aparelho chamado seqenciador automtico de DNA, separa os fragmentos sintetizados de diferentes tamanhos por meio da eletroforese (7), na qual fragmentos menores migram mais rpido que fragmentos maiores. Finalmente, o aparelho identifica o ltimo nucleotdeo do conjunto de fragmentos de mesmo tamanho pelo seu cromforo correspondente, obtendo-se, assim, a seqncia da cadeia de DNA desconhecida (Fig.4).

Texto
1) As palavras em negrito do texto ao lado podem ser substitudas pelo nome dos materiais empregados na atividade. Como voc faria esta substituio? Coloque o nmero correspondente palavra do texto no parntese que segue ao nome do material empregado. Algumas palavras podem ser empregadas mais de uma vez
a) Contas brancas ( ) b) Contas coloridas ( ) c) Voc ou seus colegas de grupo ( ) d) Cadeia sintetizada ( ) e) Cadeia molde ( ) f) Placa grande de madeira com furos ( ) g) Contas transparentes ( )

Fig. 4 - Imagem obtida aps o seqenciamento de DNA. Cada pico colorido representa um nucleotdeo na seqncia do DNA. Neste caso, uma seqncia pode ser lida entre a posio 264 e 333 a partir do incio da seqncia.

Variaes para a sala de aula

Cada grupo pode utilizar somente um dos dideoxinucleotdios marcados (ou coloridos). No final, cada grupo organiza o material obtido (as fitas novas) em uma canaleta especfica da placa grande de madeira. O professor pode explicar que esta era a maneira como o seqenciamento de DNA era feito na dcada de 80-90, antes que o seqenciador automtico de DNA fosse desenvolvido. Alguns laboratrios, com menos recursos, ainda utilizam esta metodologia. Complementando a aula, os alunos poderiam pesquisar sobre esse tipo de seqenciamento manual e analisar figuras de auto-radiografias de gis de seqenciamento, tentando descobrir a seqncia de DNA da cadeia molde Complementando a aula, os alunos poderiam pesquisar sobre o seqenciamento manual e analisar figuras de autorradiografias de gis de seqenciamento, tentando descobrir a seqncia de DNA da fita molde. As seguintes questes tm por objetivo avaliar o que o aluno j sabe ou o que ele aprendeu com as aulas sobre o DNA e com a atividade de seqenciamento. Algumas so questes de resposta direta, com o intuito principal de verificar a leitura a compreenso da nomenclatura. Outras so questes mais investigativas, que requerem maior elaborao mental. H tambm algumas questes de vestibular que podem ser respondidas pelos alunos do ensino mdio como forma de treinamento. Algumas destas questes podem ser utilizadas na fase final da atividade ou no incio, para avaliar o conhecimento prvio do aluno. Alguns textos complementares sobre o tema se encontram no anexo 1 e podem auxiliar o aluno a responder as questes. Revendo Conceitos Fundamentais (Amabis e Martho, 2001Conceitos de Biologia, vol. 3, cap. 3) 1) a) b) c) d) e)
f)

Sugestes de atividades posteriores

Gene o mesmo que cromossomo. o mesmo que cromossomo qualquer segmento da molcula do DNA. conjunto de molculas de DNA de uma espcie. conjunto de molculas de DNA de uma espcie. um segmento de molcula de DNA que transcreve um RNA.

O material hereditrio dos seres vivos a desoxirribose. o acido desoxirribonuclico (DNA). o acido ribonuclico (RNA). d) a base nitrogenada. Complete as frases de 3 a 5 preenchendo cada espao com um dos termos a seguir: (a) base nitrogenada (b) desoxirribose (c) nucleotdio 3) Cada uma das subunidades que constituem o polmero conhecido pela sigla de DNA um (a) ( ).

2) a) b) c)

4) ( ) um composto qumico presente no DNA, constitudo por um ou dois anis de carbono e nitrognio, capaz de formar ligaes de hidrognio. 5) O glicdio com 5 atomos de carbono (pentose) que entra na composio do DNA chamado ( ). 6) Uma associao fraca de natureza eltrica entre tomos de hidrognio de uma molecula e tomos eletronegativos de outra molcula chamada ligao a) de hidrognio. b) covalente. c) Inica d) peptdica. 7) O modo pelo qual uma molcula de DNA se reproduz chamado de a) duplicao conservativa. b) duplicao semiconservativa. c) reproduo assexuada. d) reproduo sexuada. 8) A polimerase do DNA uma enzima que a) separa as duas cadeias de um RNA. b) atua na fabricao de nucleotdios. c) sintetiza RNA a partir de um modelo de DNA. d) promove a unio de desorribonucleotdios. Ligando Conceitos e Fatos (Amabis e Martho, 2001- Conceitos de Biologia, vol. 3, cap. 3) pg. 103 1. Se as ligaes de hidrognio de uma molcula de DNA forem quebradas obtm-se a) bases nitrogenadas livres. b) cadeias polinucleotdicas isoladas. c) desoxirriboses livres. d) nucleotdos livres. 2. Uma substncia constituda por um fosfato, uma pentose e uma base nitrogenada entre si um a) acido nuclico. b) aminocido. c) nucleotdio. d) polipeptidio. 3. Dizer que as duas cadeias de uma molcula de DNA so complementares significa que a) elas tm os mesmos tipos de bases nitrogenadas. b) uma delas formada apenas pelas bases A e T, e a outra, por C e G. c) uma delas formada apenas pelas letras A e G, e a outra, por T e C. d) onde houver uma base A em uma delas, havera um T na

outra, e onde houver um C em uma cadeia, haver um G na outra. 4. Um pesquisador determinou que a seqncia de bases de um segmento de molcula de DNA ATTACGAGGTACATTCG. A seqncia de bases do segmento correspondente da cadeia complementar a) b) c) d) 5. a) b) c) d) ser ATTACGAGGTACATTCG. ser GCCGTAGAACGTGCCTA. sera TAATGCTCCATGTAAGC. no pode ser determinada. Um cromossomo possui inmeras molculas de DNA intercaladas com molculas de protenas. inmeras molculas de DNA intercaladas com molculas de RNA. inmeras molculas de DNA intercaladas com complexos de RNA e protenas. uma nica molcula de DNA que percorre de ponta a ponta.

6. Uma clula humana que possui 46 cromossomos, ter em seu ncleo, aps a duplicao de seu material genetico a) 46 molculas de DNA. b) 46 molculas de DNA e 46 molculas de RNA. c) 92 molculas de DNA. d) 92 molculas de RNA. 7. As diversas clulas de um organismo multicelular so diferentes entre si porque a) possuem genes diferentes. b) apesar de produzirem os mesmos tipos de RNAm, estes so traduzidos por ribossomos diferentes com produo de proteinas diversas. c) apesar de produzirem os mesmos tipos de RNAm, estes so traduzidos por RNA transportadores diferentes com produo de proteinas diversas. d) em cada uma delas est em fucionamento um conjunto diferente de genes. Questes de verificao de leitura: 1. a) b) c) d) 2. I. II. III. IV. V. O significado da sigla DNA cido desoxirribose. cido desoxiribonucleico. desoxirribose nucleotdio cido. cido nuclico de desoxirribose So exemplos de macromolculas: DNA e RNA. Aminocidos. Protenas. Acares. Polissacardios.

a) b) c) d)

Apenas I I, III e IV I, III e V I, II, III, IV e V

3. O nmero de bases nitrogenadas encontradas em um trecho de DNA de 2kb a) b) c) d) 2.000. 20.000. 200. no possvel determinar.

4. Rompendo-se as ligaes (ou pontes) de hidrognio de uma molcula de DNA, obtm-se a) b) c) d) nucleotdios livres. bases nitrogenadas livres. desoxirriboses livres. cadeias polinucleotdicas isoladas.

5. Duas cadeias complementares de DNA so a) duas hlices paralelas. b) duas fitas com a mesma seqncia de nucleotdios. c) duas cadeias de nucleotdios,nas quais A se pareia com T e C com G. d) duas cadeias de nucleotdeos antiparalelas. 6. Na natureza, vrias macromolculas so formadas por subunidades menores que se repetem: o amido formado por resduos de glicose, as protenas, por aminocidos, etc. A subunidade que forma o DNA a) b) c) d) a desoxirribose. a ribose. o nucleotdio. a base nitrogenada.

7. As bases nitrogenadas que compem o DNA so de quatro tipos, cujos nomes so a) b) c) d) Adenina, Timina, Citosina e Guanina. Adenina, Timidina, Citosina e Guanina. Adenosina, Timina, Citosina e Guanina. Adenina, Timina, citosina e Guanidina.

8. A enzima que participa ativamente da sntese de uma nova cadeia de DNA a partir de um molde chamada de a) DNA polimerase. b) DNAase. c) DNA sintetase.

d) DNA ligase.

9. Se um certo fragmento de DNA tem a seguinte seqncia de nucleotdios ATTGGCTCT, a seqncia esperada na fita complementar ser a) b) c) d) TTAGGAAGA. TAAGGCAGA. UAACCGAGA. TAACCGAGA.

10. Sobre a molcula de DNA, responda V (verdadeiro) ou F (falso). a) A + C sempre igual a G + T. (__) b) A + G sempre igual a C + T. (__) c) A sempre igual a T, e G a C. (__) d) A relao de contedo de bases depende da espcie que est sendo considerada. (__) Questes de vestibular: 1. (Unitau 95) No caracterstica do DNA: a) o acar com cinco tomos de carbono. b) a presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) a presena de cido fosfrico. d) polinucleotdeo. e) ocorre nos cromossomos. 2. (Fuvest 2003) Qual das alternativas se refere a um cromossomo? a) Um conjunto de molculas de DNA com todas as informaes genticas da espcie. b) Uma nica molcula de DNA com informao gentica para algumas protenas. c) Um segmento de molcula de DNA com informao para uma cadeia polipeptdica. d) Uma nica molcula de RNA com informao para uma cadeia polipeptdica. e) Uma seqncia de trs bases nitrogenadas do RNA mensageiro correspondente a um aminocido na cadeia polipeptdica. 3. (Puc-rio 99) Os cromossomos so constitudos principalmente por: a. b. c. d. e. fosfolipdeos. protenas. cido ribonuclico. enzimas. cido desoxirribonuclico.

4. (Ufal 99) Para desempenhar sua funo como material hereditrio, o DNA possui duas propriedades.Identifique-as e descreva resumidamente cada uma delas. 5. (Ufrj 97) O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos. Por que sempre encontramos N > P ? 6. (Unesp 94) No filme "Parque dos Dinossauros", um cientista cria em laboratrio novas geraes de dinossauros, extintos h 65 milhes de anos, por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no mbar. Com o sangue, foi possvel determinar o DNA dos dinossauros, chegando-se assim frmula para recuperar a espcie. Considere a possibilidade de que o DNA obtido pertena a um nico dinossauro e que deste DNA foram recuperados vrios exemplares. a) O que se poderia dizer dos exemplares recuperados, caso um dos animais seja sensvel a uma bactria que cause pneumonia? b) Justifique sua resposta. 7. (Ufrj 2000) No incio do projeto do genoma humano, havia duas estratgias a considerar: I) seqenciar o ADN total dos cromossomos diretamente; II) extrair todos os ARNs mensageiros, produzir ADN a partir desses ARNs mensageiros e seqencial apenas esse ADN. Nos dois casos, a tcnica de seqenciamento era a mesma. Por que a segunda estratgia mais rpida e, portanto, mais econmica? 8. (Ufrj 2001) Uma tcnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este , ento, marcado com fsforo radioativo. O ADN radioativo ento desnaturado (suas cadeias so separadas por calor) e posto em contato com o ADN de um outro organismo, igualmente desnaturado, porm no radioativo. Aps a hibridao (reassociao formando molculas hbridas), possvel medir quanto ADN radioativo existe num ADN de cadeia dupla. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN no radioativo de trs outros organismos, obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN hbrido

ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN hbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN hbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN hbrido Qual o organismo que pertence mesma espcie do organismo 1? Justifique sua resposta. 9. (Ufrj 2002) Em Junho de 2001, foi publicada a seqncia quase completa do genoma humano. Esse projeto contou com a participao de diversos laboratrios, que individualmente determinaram a seqncia de vrios trechos diferentes do ADN de todos os cromossomos, a partir da amostra de somente um indivduo, que permaneceu annimo. Sabe-se, no entanto, que o ADN era de um indivduo do sexo masculino. Por que foi importante determinar a seqncia do ADN de um homem e no de uma mulher? 10. (Cesgranrio 99) "EXAME DE PATERNIDADE, NO BRASIL, J PODE SER FEITO COM SALIVA" "Novo teste pode, pela anlise do DNA das clulas, identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. Esse tipo de teste particularmente indicado para bebs e crianas pequenas." (O GLOBO, 20/08/98) Nesse tipo de teste, a semelhana estrutural existente entre as molculas de DNA tomada por base para a identificao da paternidade. Essa diferena consiste na(o): a) seqncia de bases nitrogenadas. b) aspecto da dupla hlice presente. c) nmero de fosfatos contidos. d) tipo de pentose existente. e) tipo de desoxirriboses presentes. 11. (Fuvest 2001) O anncio do seqenciamento do genoma humano, em 21 de junho de 2000, significa que os cientistas determinaram a) a seqncia de nucleotdeos dos cromossomos humanos. b) todos os tipos de protena codificados pelos genes humanos. c) a seqncia de aminocidos do DNA humano. d) a seqncia de aminocidos de todas as protenas humanas. e) o nmero correto de cromossomos da espcie humana. Questes para pesquisar: 1. Por que o DNA tambm chamado de molcula da hereditariedade?

2. De que forma voc ordenaria as seguintes estruturas:

Cromossomo, DNA, Gene, Ncleo? Qual o critrio voc utilizou em sua ordenao? 3. O que acontece se durante o processo de replicao, ocorrer a insero de um nucleotdio no complementar fita molde? 4. Qual a importncia da DNA polimerase para a clula? Por que a sua taxa de erro deve ser baixa? 5. Quantas molculas de DNA existem no ncleo de uma clula somtica humana (da mucosa da boca, por exemplo)? a) Na fase G1 da interfase. b) Na fase G2 da interfase. c) Na metfase 6. Como voc imagina que deveria ser a definio de gene nas diferentes pocas: a) Quando Charles Darwin prope a teoria da Evoluo. b) Quando Mendel publica os resultados de sua pesquisa com ervilhas (1865). c) Quando publicada a Teoria Cromossmica da Herana (1902). d) Quando Avery, Mac Leod e MacCaarthy concluem que o DNA o material gentico (1944). e) Quando descrito o cdigo gentico (1966). f) Quando concluram o seqenciamento do Genoma Humano (2003). 7. Quais so as foras que mantm a dupla hlice do DNA juntas como uma unidade estvel? Na sua opinio, o que aconteceria a esta unidade se o DNA fosse submetido a uma temperatura de 96C por 10 min? Justifique a sua resposta: 8. Pesquise em revistas e jornais textos nos quais as expresses: cdigo gentico; mapa preliminar e rascunho do genoma tenham sido usadas de forma ambgua e reescreva-o substituindo as expresses por explicaes mais claras. 9. Depois de ler o texto a seguir, qual a sua opinio sobre o que o autor escreve? Considera uma humilhao, ter apenas 300 genes diferentes dos camundongos? Elabore um texto discordando ou concordando do autor, justificando a sua opinio pessoal. Ratos Humanos (Drauzio Varella. Folha de So Paulo, 24/02/2001) Mulheres e homens tm apenas 30 mil genes! A divulgao deste dado pelo Projeto Genoma foi um balde de gua fria no orgulho humano: imaginvamos que fossem pelo menos 100 mil. Se as moscas tm 13 mil genes, qualquer verme, 20 mil, um abacateiro, 25 mil, e os camundongos que caamos nas ratoeiras, 30 mil, para ns, 100 mil parecia estimativa razovel (...). Admitir, no entanto, que nosso genoma formado pelo mesmo nmero de genes camundongos e que somente 300 genes so responsveis pelas diferenas entre ns e eles, constitui humilhao inaceitvel.

Respostas das questes propostas:


1 2 3 4 5 6 7 8 9
10 11

Revendo conceitos fundamentais D B C A B A B D

Ligando conceitos e fatos B C D C D C D

Verificao de leitura

Questes de vestibular

B C A D C C A A D V-F-V-F

B B E

A A

ANEXOS Notas para o professor

O sequenciamento de DNA e o projeto Genoma Humano


No dia 28 de junho de 2000, vrios jornais anunciaram o "Mapeamento do Genoma Humano". A notcia trouxe para a humanidade uma grande interrogao: "E agora? O que isto significa? As notcias na poca continham expresses como: "decifrado o cdigo da vida", "seqenciados os 3,1 bilhes de letras do cdigo gentico", "concludo o rascunho do trabalho, com cerca de 97% do genoma, "conhecida a linguagem na qual Deus criou a vida" . A busca de um significado para essas informaes requer, por parte dos professores, a construo prvia de conhecimentos sobre a estrutura e funo do DNA. O DNA uma macromolcula formada por unidades que se repetem, chamadas de nucleotdios. Cada nucleotdio formado por um grupamento fosfato, uma pentose (a desoxirribose) e uma base nitrogenada (A=Adenina,T=Timina, G=Guanina ou C=Citosina) (Fig. 5). Os nucleotdios se associam formando duas fitas complementares que se mantm unidas por pontes de hidrognio (Fig. 6). Em virtude das ligaes existentes entre as fitas complementares do DNA, esta molcula assume uma estrutura em forma de escada em caracol, na qual as bases nitrogenadas representaram os degraus (Fig. 7 - a) e o esqueleto acarfosfato representa o corrimo (Fig. 7 - b).

Nucleotdio
Fig. 5 Exemplo de um nucleotdio que compe o DNA.

(b)

(a)

Fig. 7 Estrutura em dupla-hlice do DNA que lembra uma escada em caracol: (a) degraus e (b) corrimo.

Vrios nucleotdios juntos formam um gene, ou parte de um gene, como o do hormnio de crescimento humano, apresentado a seguir: Seqncia de parte do gene do Hormnio de Crescimento Humano Fonte: NCBI

gatcttaacatttttcccctatcatttttcccgtcttcatttgtcattttttccagaaaaaatcgtcattcgactcatgtcta caacacgtctctctcggcttatcccctgacaccgcccgccgacagcccgcatggacgaatctatcaattcagc ggagtctagttttatattgcagaatgcgagattgctggtttattataacaatataagttttcattattttcaaaaaggg tttattgtgggtttaggtaagaaattgtctagtgctgtagccgcttcctttatgagtttaaccatcagtctgccgggtg ggccgctgagaatcctcagcttaaagaaaacctgacgaattttgtaccgaagcattctttggtgcaagggatc gttcccaaccattcccttatccaggctttttgacaacgctagtctccgcgcccatcgtctgcaccagctggcctttg cctaccaggagtttgaagaagcctatatcccaaaggaacagaagtattcattcctgcagaacccccagacct tctgtttctcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagagctgc gcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcaggagtgtcttcgccaacagcctg acggcgcctctgacagcaacgtctatgacctcctaaaggacctagaggaaggcatccaaacgctgatggg gctggaagatggcagcccccggactgggcagatcttcaagcagacctacagcaagttcgacacaaactca aacgatgacgcactagtcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgagac cctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttctag
Fitas complementares do DNA Fig. 6 Associao dos nucleotdios formando as fitas complementares do DNA.

Esses nucleotdios, representados apenas pelas letras correspondentes s bases nitrogenadas que o compem, esto ordenados em uma seqncia especfica, e esta seqncia que caracteriza o gene do hormnio de crescimento. O gene da insulina, por exemplo, que um outro hormnio, tem outra seqncia. Genes so definidos, portanto, como trechos do DNA que contm informao para gerar, como produto final, um RNA que pode gerar uma protena. Localizam-se no interior da clula em estruturas chamadas cromossomos. Cada ser vivo tem em suas clulas um nmero determinado de cromossomos: 8 como a mosca das frutas, 16 como a cebola ou 46 como ns, humanos. O Projeto Genoma Humano tinha por objetivo descobrir quais so as seqncias que temos em nosso genoma. Mas, quantas "letras" h em uma nica clula para serem seqenciadas? Estima-se que haja cerca de 3,1 bilhes de letras em uma nica clula humana haplide que formariam cerca de 30.000 a 40.000 genes e milhares de outras seqncias sem funo conhecida.
Genoma e Proteoma: os dois lados da mesma moeda. Eliana Dessen - Departamento de Biologia, Instituto de Biocincias, Universidade de So Paulo.

Do DNA s protenas

O DNA o material hereditrio que passa de uma gerao a outra e determina as propriedades inerentes de uma espcie. No DNA a informao est codificada na seqncia de subunidades qumicas denominadas nucleotdeos, cada um deles composto por um grupamento fosfato, uma molcula do acar desoxirribose, e uma das quatro bases nitrogenadas: adenina (A), citosina (C), timina (T) e guanina (G). Cada clula de um organismo contm um ou dois conjuntos do complemento bsico de DNA, o genoma. No caso da espcie humana o genoma

O que nos conta a seqncia do genoma humano?

composto por 24 molculas extremamente longas de DNA que formam os cromossomos. No DNA cromossmico encontram-se unidades funcionais denominadas genes que informam a clula como produzir protenas. Os genes codificam protenas de um modo indireto e composto por vrios passos. No primeiro passo a informao contida no DNA copiada (transcrita) em uma molcula de RNA mensageiro. Nos eucariotos o produto inicial da transcrio, o transcrito primrio, processado de vrias maneiras, antes de ser traduzido no citoplasma. O processamento do transcrito primrio inclui uma srie de reaes de splicing. Essas reaes removem os ntrons, segmentos intercalados na regio de cdigo de um gene, e unem os segmentos de cdigo, os xons, formando um RNA mensageiro maduro. Subseqentemente, a informao contida no RNA mensageiro traduzida (decodificada) numa fila de aminocidos, ou seja, em um polipeptdio. Os polipeptdios, por si prprios ou ento agregados com outros polipeptdios e constituintes celulares formam as protenas funcionais da clula. Uma vez sintetizadas nos ribossomos, as protenas sofrem vrios tipos de modificaes. Elas so clivadas, eliminando assim seqncias sinal, e podem se ligar a muitos grupamentos qumicos simples ou a molculas mais complexas tais como aucares e lipdios. O alto nvel de diversidade que o splicing alternativo do RNA mensageiro de um gene pode produzir faz com que muitas protenas diferentes possam ser produzidas a partir de um nico gene. Por isso, a seqncia de DNA de um genoma conta apenas uma pequena parte da histria do que uma clula especifica est fazendo. Os pesquisadores tambm devem prestar ateno histria contada pelo proteoma, ou seja, o conjunto de protenas feitas de acordo com as instrues dos RNAs mensageiros produzidos por uma clula em um dado momento. Na ltima dcada, o genoma humano foi objeto de intensa pesquisa biolgica e continuar a ser o centro das atenes por muitos anos mais. A seqncia do genoma humano nos conta que nosso genoma possui cerca de 3.200.000.000 de bases (A, T, C, G). Porm, menos de 2% do genoma codifica protenas. Estima-se que a frao do genoma que codifica protenas contm de 30.000 a 35.000 genes, muito menos do que estimativas anteriores previram, cerca de 100.000. Considerando-se o nmero de genes ns somos apenas trs vezes mais complexos que uma mosca de frutas e apenas duas vezes mais complexos que o verme microscpico Caenohabditis elegans. Ainda no so conhecidas as funes de mais do que 50% dos genes descobertos. Quase um quarto dos genes que codificam protena esto relacionados expresso, replicao e manuteno do genoma e outros 20% especificam componentes das vias de transduo de sinal que regulam a expresso do genoma e outras atividades celulares em resposta a sinais recebidos do meio externo. Todos esses genes podem ser considerados como tendo funes que, de um modo ou de outro, esto relacionadas atividade do genoma. As enzimas responsveis pelas funes bioqumicas gerais da clula justificam outros 17,5% dos genes com funo conhecida; e o restante est envolvido em atividades como transporte de composto para dentro e para fora das clulas, o dobramento das protenas em suas estruturas tridimensionais

Comparando genomas

corretas, e a sntese de protenas estruturais tais como as encontradas no citoesqueleto e nos msculos. Uma grande poro de nosso genoma (cerca de 50%) contm seqncias repetitivas compostas principalmente por elementos de transposio no funcionais. Esses elementos so unidades genticas que podem se inserir num cromossomo, sair e se movimentar para um outro sitio cromossmico. O excesso de DNA no codificador no genoma descrito com DNA lixo, significando seqncias sem qualquer funo aparente. Na realidade, essas seqncias repetitivas constituem um rico registro paleontolgico, pois fornecem indcios cruciais sobre eventos e foras evolutivas. Como marcadores passivos, elas possibilitam o estudo dos processos de mutao e seleo. Como agentes ativos, as repeties deram nova forma ao genoma promovendo rearranjos, criando genes inteiramente novos, modificando e embaralhando os genes existentes. A comparao da seqncia de nucleotdeos de diferentes indivduos das populaes humanas mostra que quase 99,9% das bases so exatamente as mesmas em todas as pessoas. As diferenas entre genomas individuais so devidas a polimorfismos de um nico nucleotdeo (SNPs). Esses SNPs (pronuncia-se snips) so variaes que ocorrem quando uma nica letra do nosso genoma alterada, por exemplo, existe um A ao invs de um G numa determinada posio. Os geneticistas podem usar os SNPs como marcadores em grandes trechos de cada cromossomo permitindo assim que eles acompanhem variantes gnicas numa populao e verifiquem o papel que elas desempenham em doenas. Uma vez que seqncias especficas de DNA so relacionadas a doenas, o prximo passo ir at os genes naquela regio e procurar as seqncias tpicas que eles contm. Os estudos dos SNPs podem revolucionar os novos modos de previso de risco mais elevado de determinadas doenas. Todavia, a seqncia do genoma no nos conta quando um gene expresso, onde seu produto est localizado, com que outro produto gnico ele interage e que fentipo resulta se o gene sofrer mutao. O que ns temos em comum com moscas, vermes, leveduras e camundongos? A primeira vista, no muito. Por que ento to importante para os cientistas conhecer essas similaridades? A genmica comparada um mtodo importante para a compreenso da seqncia do genoma. Similaridades entre genes homlogos de diferentes organismos proporcionam uma maneira de designar a funo de um gene desconhecido. Esse um exemplo de como o conhecimento sobre o genoma de um organismo pode ajudar a compreenso do genoma de um segundo organismo. Existem informaes que com certeza a seqncia do genoma fornece. Isso inclui a seqncia de aminocidos. Entretanto, para se obter as informaes adicionais sobre a protena incluindo as modificaes ps-traduo, as associaes com outros polipeptdios e, como esses processos so afetados por diferentes condies internas e externas necessrio que se estude as prprias protenas.

Do genoma ao proteoma

O proteoma o conjunto de protenas expressas por um genoma ou tecido. Os projetos proteoma, que tem por objetivo a identificao e a caracterizao de todas as protenas expressas por um tecido ou organismo, so o complemento necessrio para a anlise em grande escala do genoma. O conceito de proteoma fundamentalmente diferente daquele do genoma: enquanto o genoma de fato esttico e pode ser bem definido para um organismo, o proteoma muda continuamente em resposta a eventos externos e internos. Por exemplo, um hepatcito e um neurnio humano expressam protenas diferentes embora possuam genomas idnticos. A idia da proteomica a obteno de um quadro geral de centenas de milhares de protenas diferentes presentes em cada tipo de clula e a verificao de como ele muda em resposta aos estgios do desenvolvimento, perodos de crescimento, influncias ambientais ou doenas do organismo. Como o proteoma converte as informaes fisiolgicas recebidas do genoma nas aptides biolgicas da clula? O primeiro aspecto a ser considerado a ligao direta entre a seqncia de aminocidos da protena, determinada pelo DNA, e suas propriedades qumicas. Alm disso, a enorme variabilidade de protenas diferentes permite que elas desempenhem uma vasta gama de atividades bioqumicas diferentes tais como catlise, movimento, armazenamento, estrutura celular, transporte de materiais, proteo e regulao de processos celulares. As novas tecnologias da proteomica identificam, caracterizam e acompanham as interaes de protenas numa grande variedade de vias. Esse conhecimento permitir progressos na pesquisa bsica e fornecer muitas ferramentas clinicas, incluindo novas abordagens de descoberta de drogas e de diagnstico de doenas. Estudos que combinam genes e protenas permitiro que os pesquisadores se aproximem muito mais da compreenso das causas moleculares das doenas e que planejem drogas que intervenham exatamente no ponto desejado. Onde obter informaes complementares http://www.ornl.gov/sci/techresources/Human_Genome/education/ education.shtml http://www.phrma.org/issues/genomics/genomics.news.html http://www.genome.gov http://www.dnai.org/index.htm Base Nitrogenada molcula que faz parte do nucleotdeo Cromforo molcula orgnica capaz de absorver a luz e emitila em uma cor especfica Cromossomo estrutura presente no ncleo, na qual esto os genes Didesoxinucleotdeo nucleotdeo cujo radical OH foi removido quimicamente DNA cido desoxirribonuclico DNA polimerase enzima que sintetiza DNA promovendo a ligao de nucleotdeo e tendo uma cadeia de DNA como molde. Eletroforese processo no qual molculas so separadas por tamanho num campo eltrico Enzima um tipo de protena, cuja funo auxiliar as reaes qumicas para que aconteam de modo mais rpido.

GLOSSRIO

Gene segmento de DNA responsvel por uma informao, que poder gerar como produto final uma molcula de RNA ou uma protena Genoma DNA existente no ncleo haplide das clulas Haplide clula que apresenta apenas um lote de cromossomos (n). Macromolcula molculas muito grandes, geralmente formadas por subunidades que se repetem, ex: DNA, RNA e protenas Nucleotdeo subunidade que forma o DNA, composta por um grupo fosfato, um acar e uma base nitrogenada Primers ou iniciadores curtos segmentos de DNA de cadeia simples, que tm como funo iniciar o processo de sntese de DNA Protena macromolcula biolgica formada por aminocidos Radical hidroxila radical formado por um tomo de hidrognio e outro de oxignio e que faz parte de vrias molculas biolgicas importantes - OH RNA cido ribonuclico. Tipo de cido nuclico de cadeia simples que difere do DNA por apresentar em sua composio a ribose, ao invs da desoxirribose e a uracila ao invs da timina. Seqenciamento de DNA determinao da ordem exata de nucleotdeos num segmento de DNA Leituras complementares para alunos do ensino mdio GAINOTTI, Alba; MODELLI, Alessandra, Biologia para o Ensino Mdio : Serie Parmetros Vol nico, pag. 334, Ed Scipione, 2002. SILVA JUNIOR, Cezar; SASSON, Sezar; Biologia, Vol. 3, cap. 10, 1995. AMABIS, Jos Mariano; MARTHO, Gilberto, Conceitos de Biologia, vol. 3, cap. 3, Ed. Moderna, 2001 CHEIDA, Luiz Eduardo, Biologia Integrada, Vol. 3, cap 10, Ed FTD, 2002. Demais referncias bibliogrficas ALBERTS, Bruce; BRAY, Dennis; LEWIS, Julian; RAFF, Martin; ROBERTS, Keith; WATSON, James D. Molecular Biology of the Cell. 3 ed. Nova York, Garland Publishing, 1994. CAMPBELL, Neil A., REECE, Jane B., MITCHELL, Lawrence G. Biology. 5. ed. Menlo Park, California, The Benjamin/Cummings Publishing Company, Inc., 1999. COOPER, Geoffrey M. The Cell - A Molecular Approach. 2 ed. Sunderland (MA): Sinauer Associates, Inc., 2000. LODISH, Harvey; BERK, Arnold; MATSUDAIRA, Paul; KAISER, Chris A.; KRIEGER, Monty; SCOTT, Matthew P.; Zipursky, S. Lawrence; Darnell, James Molecular Cell Biology. 5 ed. Nova York, W. H. Freeman & Co., 2004. MADER, Sylvia S. Biology. 6.ed. Boston, McGraw-Hill, Inc., 1998.