120-202 Lab Manual Spring 2012

Federated Department of Biological Sciences
120:202 Foundations of Biology Laboratory:

Cell and Molecular Biology
Student Manual

Spring 2012 Prepared by Miguel Cervantes-Cervantes, Ph.D. Laboratory Coordinator Instructors Mr. Yinghan Hank Chen Ms. Soumyashree Das Ms. Diana Martnez Ms. Rucha Sha Mr. Pavan Vedula Laboratory Technician Ms. Harbans Kaur Laboratory Location Life Sciences Center 112
120:202 Foundations of Biology Laboratory
ii

120:202 Foundations of Biology Laboratory Spring 2012
Calendar of Exercises Week of Jan 17-20 01 Jan 24-27 Jan 31-Feb 3 Feb 7-10 Feb 14-17 Feb 21-24 Feb 28-Mar 2 Mar 6-9 March 10-17 March 19-23 Mar 27-30 April 2-6 April 10-13 April 17-20 April 24-27
Updated: 15Jan12
Experiment title Orientation Bioinformatics (please use the Microsoft Word version posted on Blackboard) Biological Buffers I: Titration of glycine Biological Buffers II: Phosphate buffer, PBS Determination of protein (Bradford method) Molecular Evolution: PAGE of fish proteins Exam 1
Page
1-14 15-18 19-23 24-29 30-37 38-46
02 03 04 05
06 07 08
Enzyme kinetics: Acid Phosphatase Bioenergetics IMitochondria: Assay of cytochrome c Oxidase Bioenergetics IIChloroplasts: The Hill Reaction Spring Break Exam 2
47-57 58-63 64-71
09A 10 09B 11
Genetic Fingerprinting: PCR Set up Molecular Biology of Sickle Cell Anemia Genetic Fingerprinting: Electrophoresis of DNA products Signal Transduction Lab notebook final review Exam 3
72-75 81-85 76-80 86-98
iii
Section distribution/Meeting day and time It is important that you know what section you are in as well as your instructors name (I am in section 03 with Mr. Kasparov instead of I am in the Tuesday afternoon section with a grumpy T.A.). This will greatly facilitate communication among you, your instructor and the coordinator. Please make a note of your sections number, day and meeting time; the index number is the one you used to register for the course but we will use the two-digit section number.
01
Index 70223
Tuesday 8:30-11:20 A.M.
06
Index 71507
Thursday 11:30 A.M.-2:20 P.M.
Instructor: Diana Martnez

dianama@andromeda.rutgers.edu
Instructor: Rucha Shah

ruchas@pegasus.rutgers.edu
02
Index 71503
Tuesday 4:00-6:50 P.M.
07
Index 71508
Thursday 4:00-6:50 P.M.
Instructor: Pavan Vedula

pavanv@pegasus.rutgers.edu
Instructor: Soumyashree Das

soumyasd@pegasus.rutgers.edu
03
Index 71504
Wednesday 8:30-11:20 A.M.
08
Index 71509
Friday 8:30-11:20 A.M.
Instructor: Diana Martnez

dianama@andromeda.rutgers.edu
Instructor: Soumyashree Das

soumyasd@pegasus.rutgers.edu
04
Index 71505
Wednesday 4:00-6:50 P.M.
09
Index 71510
Friday 11:30 A.M.-2:20 P.M.

yinghanchen@gmail.com
Instructor: Pavan Vedula

pavanv@pegasus.rutgers.edu
Instructor: Yinghan Hank Chen
05
Index 71506
Thursday 8:30-11:20 A.M.
10
Index 71756
Friday 2:30-5:20 P.M.

yinghanchen@gmail.com
Instructor: Rucha Shah

ruchas@pegasus.rutgers.edu
Instructor: Yinghan Hank Chen
FEDERATED DEPARTMENT OF BIOLOGICAL SCIENCES
General Laboratory Instructions A) Academic integrity and grading policy Course structure: Foundations of Biology 120:201 (Lecture) and 120:202 (Laboratory) are different courses but must be taken concurrently. Students will not receive credit for 120:201 (Lecture) unless 120:202 (Lab) is completed at the same time. The Rutgers University and NJITs policies on academic honesty and integrity will be followed. You may familiarize yourselves with these policies at: http://academicintegrity.rutgers.edu/academic-integrity-at-rutgers http://studentconduct.rutgers.edu/ http://www.njit.edu/academics/integrity.php Grading policy The overall grade for Foundations Laboratory will be determined by the following components:
Attendance (10%) + Notebook (30%) + Report (25%) + Exams (45%) = Final Grade (100%)
Determination of letter grades: As per University policy, Grades represent the level of quality of the student's performance measured against standards of knowledge, skill, and understanding as evaluated by the instructor. Grades are reported to the university registrar at the end of each term by the following symbols:1
% Letter Meaning <59.5 F Failing 60-69.5 D Poor 70-74.5 75-79.5 C C+ Satisfactory 80-84.5 B Good 8589.5 B+ Excellent >89.5 A Outstanding
Grading errors: If there is a possible error in grading on one of the exams, students must submit the exam and a written description of the error to your instructor within one week after the exam is returned to them. After one week following the exam, regrading will not be considered. Final grades are definitive and will not be changed after the final exam is given. Exam grades will be posted as indicated by the instructor and will not be given out over the telephone or, for safety reasons, by replying to e-mail messages.
Adapted from http://catalogs.rutgers.edu/generated/nwk-ug_0608/pg23594.html, downloaded on 29Aug08.
120:202 Foundations of Biology CMB Laboratory
Attendance policy Laboratory attendance is mandatory and will be taken at the beginning of each laboratory meeting. Late work will not be accepted unless there is an excused absence as defined in the universitys undergraduate catalog (e.g. physicians note, official documents, etc.). A student is allowed to miss a maximum of two laboratory sessions with valid excuses (e.g. physicians note, official documents, etc.). More than two absences will result in an F grade for the laboratory unless the student officially withdraws from the course. If a student must quit the course but s/he misses the official withdrawal period, he or she must consult the Office of the Dean of Students Affairs to solve this problem. Each unexcused absence will result in a grade of 0 (zero) for that lab: this includes the notebook grade If you were not present you can not properly write up the lab. There are no make-ups for laboratory exercises or pop-quizzes. Plan to complete all assignments as scheduled and be ready for quizzes. Assignments must be delivered to the instructors on or before the due date; otherwise, that assignment will be worth 0%. Late assignments, notebooks, reports will not be accepted. They are due on the due date and not after. Important: You cannot attend or take exams in a laboratory section other than yours. Make sure you know what section you are registered in. Since the laboratory has physical limitations, all assignments must be fulfilled in your section. If you have been justifiably allowed by your instructor to make-up the lab in a different section, make sure to notify Dr. Cervantes via e-mail. Please indicate what section you want to attent to make-up the lab. Remember that labs are set up only for a week (Tuesday-Friday) and it is logistically impossible to recoup labs extemporaneously. Please notice the list of sections for Bio202 with schedules and instructors on the board near the entrance to LSC112. Exams must be taken on the day they are given. The only allowed excuse for not taking the exam during the assigned exam period must be accompanied by the proper note and the instructor must be notified before the exam. Failure to notify of absence of an exam will result an automatic zero. If you have an excusable reason for missing an exam (e.g. physicians note, official documents, etc.), you have one week from the original exam date to take the make-up exam. It is your responsibility to schedule the make-up with the instructor. Failure to do so, will result in an automatic zero for the exam.
Plagiarism (Lack of authenticity of work) Students are not allowed to submit work that has either been copied, or taken from sources without proper documentation. For instance, you may not copy the introduction to the laboratory manual for an exercise and submit that as either part of the lab report or the lab notebook. All work must be in your own words. The lab notebook for example, must be completely in your own words. If you use outside sources, proper citations are to be used. This also applies to the lab reports, exercises and anything that is handed in to be graded.
The following must be signed and given to your instructor at the start of the second lab, on the date indicated by your instructor. If you fail to do so, you will be given a zero for lab until it is submitted.
I, ______________________________________, am taking Foundations of Biology Laboratory 202 in the spring semester 2012. I have read the policies regarding Attendance, Assignments, and Authenticity of Work. I understand the ramifications that will occur if I do not adhere to policy.
_________________________________ Print Name _________________________________ Signed Name _________________________________ Date
If you need further clarification on any of these issues, please e-mail Dr. Cervantes
B) Laboratory Safety Rules The following is a listing of specific laboratory safely rules for the Foundations Laboratory course that you are required to read and abide by. 1. Eye protection will be worn at all times. No contact lenses! (Obviously we cannot monitor this; you must be your own policeman). Goggles can be purchased in the Rutgers Bookstore or at New Jersey Books. 2. No food, drink or smoking in the laboratory. Do not bring food with you into the laboratory, even if you plan to keep it for later. Do not dispose of snack wraps or food containers: Inspectors will not distinguish between food eaten outside or inside the laboratory. 3. Never pipet by mouth. Pipette pumps are provided for this purpose. 4. Long hair should be tied back to prevent contact with flame or chemicals. 5. Keep the laboratory benches free of clutter. Place coats on the coat racks provided and books in your locker. 6. Work in the fume hoods with volatile or corrosive compounds. Do not remove any chemicals from under the hoods. 7. Clean up spills promptly. Ask for assistance if you are not sure what to do, but do not wait! 8. Always wear closed shoes to the lab. No sandals. 9. Place broken glass in the containers labeled Broken Glass, not in the Biohazard container. 10. Always be alert. No horseplay in the lab.
This is not an all-encompassing list of safety practices. You should consult the Laboratory Safely Rules notice placed by the Department of Radiation and Environmental Health and Safely in this lab. Please wear a lab coat. We avoid the use of toxic substances in the lab but dyes or staining liquids may get onto your clothes. Here are a few places where lab coats are sold:
Life Uniforms, West 158, Route 4 East, Paramus, NJ (near Paramus Road). Phone: (201) 843-2288. Hours: Mon-Fri 10 A.M.-9:30 P.M., Sat 10 A.M.-8 P.M., Sun Closed Scrubs and Beyond, Jersey Gardens Mall, 651 Kapkowski Road, Elizabeth, NJ. Phone: (908) 558-1661. Hours: Mon-Sat 10 A.M.-9 P.M., Sun 11 A.M.-7 P.M. Atlantic Uniform, 444 Washington Avenue, Belleville NJ, Phone: (973) 751-1242. Hours: Mon-Fri 9:30 A.M.-5 P.M., Sat 10 A.M.-5 P.M., Sun 11 A.M.-4 P.M.
C) Procedures for Emergency Medical Care at the Newark Campus The Rutgers-Newark Health Center is located at 249 University Avenue, Blumenthal Hall, room 104 and is open Monday through Friday, 8:30 A.M to 4:30 P.M. Their telephone number is (973) 353-5231. 1. Life-Threatening Emergencies: Suspected Heart Attacks, Severe Bleeding and Unconscious State. a) First contact Campus Police (x-5111), give patient's condition and exact location, and request the Emergency Rescue Squad. b) Then, notify the Student Health Service (x5231), giving patient's name, location and condition, 2. Non-Lethal Medical Emergencies and Accidents. a) Notify Campus Police (x-5111) or the Student Health Service (x-5231), stating problem, and patient's condition, name and location. Campus Police will either transport the patient, or bring the nurse or doctor to the accident scene, as necessary. b) The nurse or doctor will evaluate the situation and render any care indicated. If the patient needs hospital attention and can be moved, Campus Police will notify St. Michael's Hospital and provide or arrange transportation. This section is based on directives and advice from the Rutgers Newark Health Center. You should become familiar with these procedures and follow them in case of a lab accident or other medical emergency. It can be found in Appendix 1, at the end of the manual. The following instructions are to clarify these procedures in the Foundations of Biology Laboratory:
Biology staff will not attempt any first aid other than to make cold packs for burns of wash off chemical spills with plain water. More than this might make them legally liable in the event of complications from such accidents and the University has not agreed to assume liability for first aid given by its non-medical staff. If the accident is relatively trivial, the student will be instructed to visit the Student Health Service and immediately be dismissed from lob. If the student needs to be transported or accompanied this will be done by the Campus Police (whose job it is), not by Biology staff because of the risk of liability. In the event of more serious injury Campus Police will be immediately contacted for assistance. A campus phone is provided in the laboratory for this purpose. For any incident receiving professional medical attention, the instructor must notify the Biology Department Office at extension 5347. If the student does not return by the end of the lab period, the instructor will put the students equipment away, close the locker securely and place any personal property in the protection of Campus Police.
Many chemical compounds are toxic, flammable, explosive or corrosive. It is not possible to remove every hazardous material from student experiments, nor even desirable, since this would prevent the students from learning how to deal with routine hazards, an important part of laboratory training. We make every effort to minimize certain hazards and to make students aware of any others and give supervision. However, for a large number of compounds so little is known about toxicity and mutagenicity towards unborn children that we recommend that any woman who knows or suspects she is pregnant, or who is trying to become pregnant, postpone taking Foundations Laboratory.
D) Pipetting Proficient pipetting is probably the most crucial part of this class, for three reasons: Accurate pipetting of very small volumes is crucial to the success of molecular projects. Mistakes during pipetting may cause your experiments to fail or to be irreproducible, and thus cause long delays and considerable expense Pipettes are delicate pieces of equipment with high accuracy, which can easily be knocked off their calibration. Furthermore, they are expensivethe pipette set in front of you costs about $ 1,500, plus maintenance expenses. Pipettes must be kept clean; for example, dirty pipettes are the main source of contamination in PCR, and thus can cause problems. Fig. 1. Rainin Pipetman
You may have some experience with pipettes, but a refresher on pipetting is probably quite useful. Pipette tip choice Pipette P-1000 P-200 P-20 Volume Adjustment Top Blue Yellow Yellow Volumes (l) 100 - 1000 20 - 200 2 - 20 Blue
Tips Yellow or white White
Fig. 2. Pipetman adjustor windows. Notice that for P-20 and P-10 the red digit indicates the decimal point.
Please
Never rotate volume adjuster beyond the upper limit!

This changes calibrationand may break the pipetting mechanism. In addition, this contributes to develop your logic: For example, one cannot pipet 1020 L using a P-1000, nor one can pipet fractions of a microliter with a pipette whose maximum capacity is larger than 20 L. Liquid will get into piston damage and contamination. Liquid could run back into the piston, and damage/contaminate it. Use pipette holders provided Damages piston
Never use without a tip.
Never lay down or turn upside down a pipette with filled tip.

Never let plunger snap back after withdrawing or ejecting fluid
Use of the pipette Use the correct pipette according to the volume that you need to transfer. Never adjust the volume beyond the maximum setting, but also do not use pipettes that are too large. Accuracy and precision drop rapidly towards the lower limit of settings. Adjust volume by turning the volume adjustment knob or the plunger. Be sure to locate the decimal point correctly when reading the volume setting (see above). Always dial down to the desired volume to avoid mechanical backlash affecting accuracy. Firmly seat the proper-sized tip on end of the pipette. If the fit is lose, you will draw up less volume than intended and the liquid will drip from the tip during use. When withdrawing or expelling fluid, always hold the tube firmly between thumb and forefinger. Hold close to eye level to observe change in fluid level in tip. Do not pipet with the tube in rack or when someone else is holding the tube. The pipettes have a two-stop position plunger. Depressing to the first stop measures the desired volume. Depressing to the second stop introduces an additional volume of air to blow out any remaining fluid from the tip. To withdraw fluid from tube. Hold the pipette almost vertically (< 20 from vertical) Depress plunger to first stop and hold. Dip tip 2-4 mm into the fluid. Do not push down to the bottom of the vial, otherwise the tip is blocked and you draw less liquid than intended. Gently release thumb. If you release quickly, you will create aerosols (small droplets) which will contaminate the pipette.
Wait for a second or so, to confirm that all the liquid has been taken up. Slide pipette tip out along wall of tube to dislodge remaining droplets adhering to the outside of the tip. Check that there is no air space at the very end of the tip. Learn the approximate levels that particular volumes fill the tip this will allow you to check your pipetting visually.
To expel sample into tube Touch tip to wall of tube Slowly depress plunger to first, and then to the second stop to expel fluid. While keeping the plunger at the second stop, slide the tip out of the fluid, along the tube wall and out of the tube.
Eject the tip into trash, by pressing the tip ejector button. Preventing cross contamination Use a fresh tip each time Do not touch the tube with the pipette, only with the tip If you suspect pipette contamination, wipe with ethanol on the outside. If the inside is contaminated, notify your instructor. Draw up liquid slowly to prevent the formation of aerosols For specific applications, use pipette tips with filters
10
E) Guidelines for keeping laboratory notebooks Good laboratory notebook-keeping is not only part of the skills that you must acquire in this experimental laboratory course. It is also the way to document your activities, results, and thoughts related to your experiments; and, when you eventually work in the laboratory, the clinic, or the field, your must keep track of your data as official records, which are important during corroboration or repetition of your results or for patent purposes. Please get a bound laboratory notebook in the Rutgers bookstore (Bradley Hall) or at New Jersey Books. Here are some suggested brands:

National Brand Quad Ruled Computation & Lab Notebook ("Rediform") 43-591 or 43-648 (this is also Staples Item 567644) Tops Business Forms Lab & Research Book 35061 Ampad 22-156 or 2-157 Roaring Spring 77645 Student Laboratory Notebook (ISBN 9781555813581) produced by the American Society for Microbiology, available through Amazon) Hayden-McNeil (ISBN 978-1930882744)
Marbled collegiate-ruled notebooks are not adequate for the lab. They were designed by people who have no idea what we do in a science lab. A good notebook to be used in a science laboratory (for instruction or research) must have pages that are numbered pages, preferably printed with a quadrille pattern (no lines or blank pages), slightly smaller than (or up to) letter size (8.5 X 11 in, i.e. 28 X 21 cm). First thing to do is to number the pages of your book with ink if they are not already numbered (all of the brands above satisfy these requirements). Second, you should set aside the first two sheets for a table of contents. Notebooks will be checked every laboratory session with your pre-lab, as indicated by the instructor. You should read the entire laboratory so you have a clear idea of what you are going to do. Then, write or print and cut and paste the lab up to the Procedure. A brief note about writing the different sections of your lab as you go through the experiment: Pages of lab notebooks are asymmetrical, that is, the odd-numbered pages should contain the description of the procedure to follow (you may paste a print-out of the protocol). Even-numbered pages should display the description of composition of solutions (if any were prepared), your personal notes and observations and the results, as graphs, pictures, diagrams, descriptions, etc. Your instructor will indicate if s/he prefers to use the pages of the notebook continuously, instead. The format for keeping the notebook must include the sections below. Remember: You must fill up to the Procedure part as a prelab. Title of the experiment(s). Introduction: This part should be short, one or two paragraphs. Please do not paraphrase the introductions to the labs in the manual; instead, come up with your own.
11
Date, preferably in the international system (day/month/year, as in 8Nov03). It is fine if you keep the American style (month/day/year, as in 11/08/03) as long as you use it consistently throughout your entire notebook. Objective: a very short statement of the purpose(s) of the experiment (10 words or less). Procedure: Refers to the protocol(s) to be followed to perform the experiment and can be given as a flow chart, a bulleted or numbered list, or a table. Please write this on your notebook; no pasting of photocopies or print-outs will be allowed (except for graphs produced in Excel, pictures or drawings resulting from your experimental results). Do not make a list of materials and equipment. Such list is unnecessary for your lab notebook entry, as it is already embedded in the Procedure. Records of the procedures and the data collected during the session. The way data are recorded will depend on the particular laboratory, but it may include readings from the spectrophotometer, or the pH-meter, descriptions, drawings, tables, graphs, scans, photographs, etc. Results, analysis and conclusions should be included in your notebook. This will facilitate writing your discussion. Discussion: This section should contain an evaluation of the significance of the results. Try to bring everything together here. Point out why you think the observed results were obtained. Remember: no result is a result. Any opinions stated in your discussion must have a sound basis on fact. Mention in your discussion if any calculation helped you in particular in interpreting your data. Discuss and interpret the information you obtained in the experiment. Indicate if the data were what you expected, according with the purpose of the lab. Refer to your tables or figures (e.g., As it can be seen in Fig. 2, two distinct bands are present and correspond to 100 and 400 bp). If you obtain unexpected results or made any mistakes, this is the right place to include them: Learning from your own errors is an important part of the learning process (e.g. although we expected a pH of 7.5, the pH-meter indicated 6.8 or I neglected to add 0.25-mL aliquots and added it in increments of 0.5-mL instead. As a result, I missed the midpoint in the titration procedure.). You may include suggestions on how to improve your results. Questions: At the end of each laboratory exercise, are a list of questions that are present. These are to be answered in your notebook, numbered and listed after the discussion. They will be graded as your total notebook grade. Bibliography: Please cite references correctly. You may use the examples below. Styles vary from journal to journal, but you may stick to a standard form that feels comfortable. You may choose not to follow this citation in which case you must choose a style of your own and follow it. Please do not use this manual as a bibliographic source. The writings here are based on other authors work and have been adapted by Dr. Cervantes and other professors at Rutgers-Newark. Citing a bibliography comprises two aspects: How to cite within the text and how to write down the references cited.
12
Citing works within the text you are writing When citing as you write, there is a difference if the referenced work was produced by one or more authors. For example: One author: (Carretero-Paulet, 1999) Two authors: (Matista and Silk, 1997) Three or more authors: (Byron et al., 2010) Please notice several things: When citing in the text, do not write authors initials; only their last name should be written and respecting as much as possible the original spelling, e.g. (Ltcke, 1987), is preferred over (Lutcke, 1987). Regarding the locution et al., it comes from the Latin et alli (and friends), so there should not be a period the word et and no plural s after al. And finally the requirement for adding (or not) a comma between the author names and the year varies from journal to journal. If you are describing work done by several people, both the name of the author(s) and the year should be in parenthesis: Measurements of tendril tension were made daily (Matista and Silk, 1997). If quoting or mentioning the name of the authors, it is correct to only write the year in parenthesis: Nobel (1999) described an equation for K+ fluxes in guard cells. Standard abbreviations are preferred when citing journals. You may omit the issue number, but the volume and the first and final page of the article should be indicated; the volume number should be either in bold type or underlined (see examples above). You should not cite references that you did not consult, even if they are cited in articles that you actually read or at the end of the lab exercises in this manual. It is unethical to cite works that you did not read. Examples of references from different bibliographic sources Book Bowsher C, Steer M, Tobin A (2008) Plant Biochemistry. Garland and Francis. Boston. Pp. 87-90. Nobel PS (2003) Environmental Biology of Agaves and Cacti. Cambridge University Press, Cambridge, UK. P. 55. Biswal UC, Biswal B, Raval MK (2003) Chloroplast Biogenesis: From Proplastid to Gerontoplast. Kluwer Academic Publishers, Dordrecht, 353 pp. [NB: This is not a citation from a portion of a publication, but the reference is to the book as a whole, as in a suggestion to read it in its entirety or for purchase] Review chapter in a book Schroeder JI, Hagiwara S (1990) Voltage-dependent activation of Ca2+-regulated anion channels and K+ uptake channels in Vicia faba guard cells. Pp. 144-150, in: Leonard, R.T. and P.K. Hepler (eds.), Calcium in Plant Growth and Development, Current Topics in Plant Physiology, Vol. 4. American Society of Plant Physiologists. Rockville, Maryland.
13
Robertson, D., I. Anderson, and M. Bachmann. 1978. Pigment-deficient mutants: Genetic, biochemical and developmental studies. Pp. 461-494, in: Walden, D. (ed.), Maize Breeding and Genetics. John Wiley & Sons, New York. Journal article Liu CI, Liu GY, Song Y, Yin F, Hensler ME, Jeng WY, Nizet V, Wang AH, Oldfield E (2008) A cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulence. Science 319:1391-1394. Matista A, Silk (1997) An electronic device for continuous in vivo measurement of forces exerted by twining vines. Am J Bot 84:1164-1168. Szabo CM, Matsumura Y, Fukura S, Martin MB, Sanders JM, Sengupta S, Cieslak JA, Loftus TC, Lea CR, Lee HJ, Koohang A, Coates RM, Sagami H, Oldfield E (2002) Inhibition of geranylgeranyl diphosphate synthase by bisphosphonates and diphosphates: A potential route to new bone antiresorption and antiparasitic agents. J Med Chem 45:2185-2196. Wentz CT, Magavi SSP (2009) Caffeine alters proliferation of neuronal precursors in the adult hippocampus. Neuropharmacology 56:994-1000. Internet article Given the wide variety of web pages, one may follow a very simple style (e.g. that of the American Pychological Association, which is: Contributors names (last edited date). Title of resource. Retrieved (date of retrieval) from http://web address for resource). Angeli, E., Wagner, J., Lawrick, E., Moore, K., Anderson, M., Soderland, L., & Brizee, A. (2010, May 5). General format. Retrieved from http://owl.english.purdue.edu/owl/resource/560/01/ The Edinborough Cell Wall Group. Professor Stephen Frys Research Interests. Retrieved January 27, 2007 from the Word Wide Web: http://homepages.ed.ac.uk/sfry/research.html Wolf A, Beegle D (1995) Recommended soil tests for macronutrients: Phosphorus, potassium, calcium and magnesium. In: Recommended soil testing Procedures for the Northeastern United States, 2nd Edn., Chapter 5, Delaware Cooperative Extension, Publications from the Soil Testing Laboratory. Northeastern Regional Publication N 493. Retrieved August 24, 2009 from the World Wide Web: http://ag.udel.edu/extension/agnr/pdf/soiltesting/CHAP5-95.pdf. A final brief note about using Internet citations: Many of the web pages you will find today will not be indefinitely available. Web page turnover is very fast! You should not cite more than 2-out-of-10 web pages per bibliography and that you save the corresponding HTML files for future reference (or print them as PDFs). The way to do this varies according to your computer; in the Mac environment you can print to PDF from any application.
14
You may check websites such as The Write Source of the Modern Language Association for examples of how to cite Internet references: http://www.thewritesource.com/mla/ or the Purdue Online Writing Lab (http://owl.english.purdue.edu/owl/resource/560/01/), cited above. Finally, remember: No Wikipedia. No Ask! No dubious or non-curated sources. You may try Google Scholar (http://scholar.google.com/schhp?hl=en&tab=ws, if you must use a popular engine) and the intelligently designed WolframAlpha (http://www.wolframalpha.com). Enjoy your laboratory experiences in Foundations!
15
Laboratory N 1 Bioinformatics
Self-Guided Internet-based Exercise on Databases for the Storage and Mining of Biomolecular Sequences
Please use the Word version (posted on Blackboard) to work on (enter your answers by double-clicking on the phrase STARTSTYPINGGHERE) and send to your instructor via e-mail or provide them with a hard copy, as they prefer. You may use Appendix 2 as a primer. The exercises below are designed to introduce you to some of the relevant databases and the tools they contain for examining and comparing different bits of information. Biological databases are an important resource for the study of biochemistry at all levels. These databases contain huge amounts of information about the sequences and structures of nucleic acids (DNA and RNA) and proteins. They also contain software tools that can be used to analyze the data. Some of the softwarealso known as web applicationscan be used directly from a web browser. Other softwarecalled freestanding applicationsmust be downloaded and installed on your local computer. Please notice that Internet hyperlinks are active. I. Finding Databases. We'll start with finding databases. 1. The major online databases that contain DNA and protein sequences are: a) Genbank: http://www.ncbi.nlm.nih.gov/entrez/ b) European Bioinformatics Institute http://www.ebi.ac.uk/ c) GenomeNet in Japan http://www.genome.jp/ (this site includes the Kyoto Encyclopedia of Genes and Genomes, KEGG) 2. Databases contain entire genomes include: a) National Center for Genome Resources: http://www.ncgr.org/pathdb/ b) NCBI Human Genome Resources: http://www.ncbi.nlm.nih.gov/genome/guide/human/ c) The J. Craig Venter Institute (formerly, The Institute for Genomic Research or TIGR): http://www.jcvi.org/ 3. Using your lecture textbook and online resources make sure you understand the meaning of the terms below (remember, do not use Wikipedia; although you may use resources such as Google Scholar http://scholar.google.com/schhp?hl=en&tab=ws, which will refer you to original sources). a) BLAST = STARTSTYPINGGHERE b) Taxonomy = STARTSTYPINGGHERE c) Gene ontology = STARTSTYPINGGHERE d) Phylogenetic tree = STARTSTYPINGGHERE e) Multiple sequence alignment = STARTSTYPINGGHERE
16
4. Once you have defined these terms, find resources on the Internet that enable you to study or use them. a) BLAST: http://www.ncbi.nlm.nih.gov/BLAST/ b) Taxonomy: c) http://dictionary.reference.com/search?q=taxonomy http://www.hyperdictionary.com/dictionary/taxonomy d) http://www.merriam-webster.com/dictionary/taxonomy e) Gene ontology: f) http://www.yeastgenome.org/help/glossary.html, http://smd.stanford.edu/help/glossary.shtml g) Phylogenetic trees: h) http://encyclopedia.thefreedictionary.com/phylogenetic tree i) http://aleph0.clarku.edu/~djoyce/java/Phyltree/cover.html j) http://www.phylogenetictrees.com/ k) Multiple sequence alignment: http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html, http://pbil.univ-lyon1.fr/alignment.html
II. Case study: The Rh blood type. One of the informal objectives in Foundations CMB lecture is to bust myths that we might have found in previous classes or even in textbooks. One of the myths that many students assume is true, is the famous Rh type. People, we have been told, are Rh(+) or Rh() or are we? In eukaryotic cells, genes are located along chromosomes, in specific physical regions called loci. The Rh factor was assumed to be a cell membrane glycoprotein, which was named Rh because it cross-reacted with an antigen that was supposedly found in Maccacus rhesus. Research on the molecular genetics of Rh factor has yielded several important findings. There is no single Rh epitope or antigenic determinant but several. This is called Rh polymorphism. Besides, the classical Rh(+) reaction is mainly caused by one of these antigens. 1. Lets start with some working definitions. a. Find out what is an epitope (for starters, proteins are not the only molecules with epitopes; and epitope is not a synonym of antigen): STARTSTYPINGGHERE b. What is an antigen? STARTSTYPINGGHERE Define polymorphism: STARTSTYPINGGHERE
c.
d. Define allele: STARTSTYPINGGHERE e. Define homozygote and heterozygote (or homozygous and heterozygous individuals): STARTSTYPINGGHERE If an active gene product is represented by the capital letter W, underline the symbol for the gene that encodes such product: i) W ii) W iii) w iv) w v) None of these
f.
17
2.
Search the databases at the National Center for Biotechnology Information/Online Mendelian Inheritance in Man (NCBI/OMIM, http://www.ncbi.nlm.nih.gov/omim) and cite three examples of epitope polymorphism in the Rh antigen CE. Heres a quick guide:
a. Set up your Internet browser and:
Type rh ce antigen in the OMIM search field. Select the top choice [+111700. RHESUS BLOOD GROUP, CcEe ANTIGENS; RHCE] and click on the link. On the table of contents, click the See List link under Allelic Variants. Single epitope mutations are indicated as WildTypeAminoAcid-PositionMutantAminoAcid (for example, the amino acid in a wild type protein is a valine at position 62; in a mutant protein, amino acid 62 is tryptophan; the way to express this is V62W; use the amino acid single-letter abbreviation at the end of the manual). An example is already given below. Finish the table with the information you found in OMIM. Protein domain (C or E), indicated by the phenotype: RH C/c Polymorphism STARTSTYPINGGHERE STARTSTYPINGGHERE Mutation SER68ASN
(I bet you cannot find this cool information in Wikipedia!!!) Because Im sure you didnt even think of using that monstrosity!!! I mean, anyone can write anything they want on it If you want to take a break, check out this YouTube video, you wont regret it: http://www.youtube.com/watch?v=kFBDn5PiL00 3. How many RhCE epitope polymorphisms do you see registered to date? (Remember that there is no such a thing as scientific fact. There is evidence and a high probability that a certain phenomenon is reproducible despite human or machine-introduced experimental error, so this number may change in the future). STARTSTYPINGGHERE 4. Besides the RhCE epitope polymorphism, there is an additional epitope which is important in blood transfusions: RhD. a. Define RhD positive, RhD negative and weak RhD reactions. STARTSTYPINGGHERE b. How does the RhD epitope correlate with the typical Rh(+) and Rh() reactions? Hint: Check OMIM information for RhD at http://omim.org/entry/111680. You can find this entryan more, including RhCEby searching RhD in the OMIM website (http://www.ncbi.nlm.nih.gov/omim). STARTSTYPINGGHERE c. How many CcDEe antigens are known to date? STARTSTYPINGGHERE d. During the evolution of species, some alleles remain in a population despite an apparent disadvantage (keep in mind that alleles code for a certain gene product, either proteins or RNA). For example, higher tolerance of RhD-positive heterozygotes against impairment of reaction time and increased risk of traffic accident caused by infection with Toxoplasma gondii. This could counteract a disadvantage of the rarer allele [RhD-()] and could be responsible
18
both for the initial spread of the RhD(+) allele among the RhD() population and for a high frequency of RhD polymorphism in most human populations. STARTSTYPINGGHERE e. Along this line of thought, what is the advantage of heterozygotes HbA/HbS (sickle-cell anemia carriers) over homozygotes HbA/HbA? (Obviously homozygous HbS/HbS combinations are present in individuals who have the disease.) STARTSTYPINGGHERE Assume Hardy-Weinberg (H-W) equilibrium for RhD/rhd (the alleles coding for RhD(+) and its absence, respectively. Assume that 85% of individuals in a certain country are phenotypically RhD(+) and 15% RhD(). RhD(+) people can be genotypically RhD/RhD or RhD/rhd. i. What is the Hardy-Weinberg equilibrium? STARTSTYPINGGHERE ii. You may consult any genetics textbook to find the mathematical expression that represents H-W and how to find allelic frequency: STARTSTYPINGGHERE iii. No need to show your calculations here (use your notebook for that matter). Use p to represent the frequency of allele RhD and q for rhd, what is the frequency of RhD? STARTSTYPINGGHERE
f.
5. NCBI is a comprehensive network of databases that include information on nucleotidyl sequences

(e.g. chromosomal DNA, mRNA, non-proteincoding RNAs), amino acyl sequences (proteins), taxonomy, genetically-based diseases (also known as inborn errors of metabolism. Heres a diagram that illustrates the relationships among these different databases:*
You may want to continue exploring NCBI. This link will take you to a comprehensive list of all databases in it: http://www.ncbi.nlm.nih.gov/guide/all/databases_. And, if you still want to explore some more on the origins of research on the Rh(+) factor, you may download this paper from http://www.ncbi.nlm.nih.gov/pubmed/18860341:
Race RR, Mourant AE, Lawler SD, Sanger R (1948) The Rh chromosome frequencies in England. Blood 3:689695.
Figure source: http://www.muhlenberg.edu/main/academics/biology/courses/bio152/bioinformatics_lab/index.html
19
Laboratory N 2 Biological Buffers ITitration of the Amino Acid Glycine The exercises in this laboratory are designed to illustrate the ionization properties of weak acids and amino acids as a basis for understanding the properties of proteins and their use as biological buffers. You will calculate the components and prepare a buffer of a known pH. This exercise is intended to provide you with practical experience in basic laboratory procedures and illustrate the buffering properties of common biochemical solutions. pH Most intracellular processes take place in aqueous environments. Water is an amphoteric substance that serves as a proton donor (acid) or a proton acceptor (base). It exists in equilibrium as represented in equation 1: (equation 1) H2O H+ + OH In pure water, [H+] = [OH] = 10-7 M. However, the concentration of H+ and OH in aqueous solutions can vary greatly because many solutes contribute (acids) or absorb (bases) protons. Although the ratio [H+]/[OH] can vary greatly in aqueous solutions, the product of the proton and hydroxide ion concentration in aqueous solutions is always 1014 M (i.e. [H+] X [OH] = 10-7 X 10-7 = 10-14 M). Therefore, [OH] of an aqueous solution can be calculated if [H+] is determined experimentally and vice versa. As a convenient way of expressing the concentration of [H+] in a solution, chemists use the term pH. The alkalinity or acidity of a solution is expressed in pH units. pH is defined as the negative logarithm of the concentration of protons in a solution: (equation 2) pH = log [H+] (equation 3) 1 or pH = log + [H ] + -7 Therefore, with [H ] = 10 M the pH of pure water should be 7. However, many acidic and basic solutes inside of the cell react with the protons or hydroxyl groups. This could potentially shift the equilibrium of the water equilibrium reaction above and therefore dramatically change the intracellular pH. As one might imagine, such wide fluctuations in cellular pH would seriously affect normal physiological processes. In order to maintain a constant pH, cells utilize natural buffering agents that absorb or contribute protons to maintain a constant pH. In fact, some organelles have subcompartments that lead to the formation of pH gradients, which form part of important physiological activities (e.g., ATP production across the inner membrane (cristae) of the mitochondrion or the thylakoids in the chloroplast). In addition, to study biological reactions in vitro, it is necessary for investigators to use artificial (biological) buffers to maintain a constant pH during a reaction, cell manipulation, or when culturing tissues and cells. Buffers A buffer is a solution that resists pH change upon the addition of acid or base. All laboratory pH buffers can be thought of as weak acids and their dissociation in water can be described by the following equation: (equation 4) Where HA = any weak acid. The degree of the dissociation of HA into A and H+ can be described by Ka, an equilibrium constant: HA A + H+
20
Ka =
[A][H+] [HA]
(equation 5)
By taking the reciprocal of both sides of equation 2: 1 Ka and by taking the log of both sides: From the definition of pH in equation 3, in a similar manner we may establish: log Therefore: pKa = pH + log [HA] [A] (equation 9) 1 Ka = pKa log 1 Ka = log [HA] [A][H+] (equation 7) = [HA] [A][H+] (equation 6)
(equation 8)
By reorganizing the terms in equation 9, we can derive an expression that describes the pH of a solution containing a solute with a known pKa: pH = pKa + log [A] [HA] (equation 10)
This is the Henderson-Hasselbalch equation and it will be useful throughout the course and during your scientific career to understand the importance of pH in biological systems and, in the laboratory, for making buffer solutions.
Fig. 3. Titration of a weak monoprotic acid (such as acetic acid), at 0.1 M, with a strong base (i.e. 0.1 M NaOH); pKa = 4.8. (Adapted from Siegel, 1976.)
21
Buffering capacity of amino acids Amino acids are the basic building blocks of protein molecules. Amino acids present in proteins have a carboxyl group and an amino group bound to the same carbon atom (the carbon). Together with a hydrogen atom and a lateral (R) group, the -COOH and -NH2 groups are present in the L-configuration (Fig. 5).2

Fig. 4. Generalized structure of an L-amino acid.
+ In free amino acids, the -COO and -NH 3 groups are weak acid groups that ionize in aqueous solutions by donating a proton. These groups have pKa values between 2 and 3 and 9 to 10, respectively, depending on the R group. In addition some amino acids (i.e. lysine and aspartic acid) have lateral side chains that also act as weak acids and bases see pKa values of R groups in Appendix 3). With the exception of the -amino and -carboxy + terminal groups, the -COO and -NH 3 from the aminoacyl residues in proteins are engaged in peptide bonds; therefore, the ability of the ionizable lateral groups to donate and accept protons is essential to the chemical properties of proteins, and the ionization of these groups often take part in the formation of protein structure and the catalytic activities of enzymes.
pH Measurement The pH of a solution can be measured by a number of methods. The two most common methods are pH paper and the pH-meter. The so-called pH paper is impregnated with a mixtures of dyes. The dyes in the paper will change color depending on the pH of the surrounding solution. The pH of an unknown solution can be determined by placing a drop of a solution on the paper and comparing the papers color to a set of color standards generated from known pH values. This method is accurate only within 0.5 pH units because of the human error involved when comparing the colors of the unknown vs. the standard papers. In consequence, pH paper cannot be used to quantitatively determine the pH of a solution. However, pH paper is useful in situations where the researcher needs to quickly determine the approximate pH of a solution or when a pH meter is not available. The pH-meter is used to determine the exact pH of a solution and it consists of a voltmeter attached to an electrode that is permeable to H+ ions. Submerging the electrode in a solution will result in a voltage reading that corresponds to the concentration of H+ in the solution. The display of the voltmeter is usually altered to give a direct reading of the pH rather than a voltage. The pH meter will give an exact measurement of the [H+] in a solution. In this exercise, you will use the pH meter to prepare solutions of a given pH. The use of the instruments and their calibration is described on a guide that is placed next to each instrument. Please be careful not to hit the electrode, for example, when using a magnetic stir bar inside a container.
Fig. 4 source: University of Nebraska-Lincoln, Plant and Soil Sciences eLibrary (plantandsoil.unl.edu/croptechnology2005/weed_science).
22
Titration of the amino acid glycine To illustrate the ionization properties of the functions groups of amino acids, you will + perform a titration of the -COO and -NH 3 groups of glycine (Gly), the simplest amino acid, which has a non-ionizable R group (H; see Fig. 5). From your titration data, you will determine the pKa values of these two functional groups. 1. Calibrate the pH meter according to the instructions supplied with the instrument and using the standard provided by the instructor (red, pH 4; yellow, pH 7; blue, pH 10). 2. Transfer 50 mL of a 0.1 M solution of Gly to a clean 250-mL beaker and add 50 mL of deionized water (diH2O). Place a stir bar in the beaker and place the beaker on a stir plate next to the pH meter. 3. Rinse the electrode of the pH meter and place it in the Gly solution. Stir the solution very gently and read the initial pH. 4. Fill a 25-mL burette with a solution of 1 M NaOH and place it over the Gly solution. 5. Begin titrating the Gly solution by adding 0.2-mL increments of 1 M NaOH while gently stirring the solution. Record the precise volume of NaOH added at each step. Be sure that the electrode remains submerged during the procedure. Stop between the addition of each increment of 1 M NaOH and record the pH. Be sure that you allow the pH to stabilize before you record the value on your notebook. 6. Continue the titration until pH reaches 12 or 13. 7. Tabulate the data on your notebook. Follow the format established in the table below. Calculate the equivalents of base added at each step of the titration, and calculate the accumulated equivalents at each step.
Increment (mL NaOH) Vol. of 1 M NaOH (mL) Equivalents added at increment Accumulated equivalents
pH
1 2 3 4 n 8. An equivalent refers to the moles of OH- or H+ added with each addition of NaOH. It is determined by multiplying the volume of NaOH added by the concentration of the NaOH: 1 mole/L X 0.0002 L = 2 X 10-4 (moles/L)L = 2 X 10-4 moles] 9. Plot the accumulated equivalents of NaOH added vs. the pH on a linear graph similar to that shown in Fig. 1 (part A). Label your graph properly, i.e., the independent variable is NaOH equivalents; the dependent variable is pH. + 10. From your plot, estimate the pKa values for the -COOH and -NH 3 groups of Gly.
23
QUESTIONNAIRE Lab 2. Titration of the amino acid glycine 1. Following the format established in the table on p. 23, tabulate the titration data on your notebook and calculate the equivalents of base added at each step of the titration 2. Calculate the accumulated equivalents at each step using the formula on your lab manual NaOH Equivalent: 1 mole/L X 0.0002 L = 2 X 10-4 (moles/L)L = 2 X 10-4 moles] Plot the the pH (Y-axis or ordinate) vs. accumulated equivalents of NaOH added (Xaxis or abscissa) on a linear graph similar to that shown in Fig. 1 (part A). Label your graph properly, i.e., the independent variable is NaOH equivalents; the dependent variable is pH. From your plot, estimate the pKa values for the -COOH and -NH + groups of Gly. 3 Use arrows to indicate these pKa values on the curve. Make a photocopy of the table and the plot and attach both them to this report. of What is the proportion of HOOC-Gly- NH + /OOC-Gly- NH + at pKa1? 3 3
3.
4. 5. 6.
7.
What is the proportion of OOC-Gly- NH + /OOC-Gly- NH2 at pKa2? 3
8.
We will use glycine buffers in experiments later in the semester. Why is it that different proportions of the ionic species of glycine at certain pH values allow this molecule to be used as pH buffer?
9.
Would glycine be a better buffer in a higher animal circulatory system than phosphates or bicarbonate/carbonate? Yes No Explain your answer to the question above.
10.
24
Laboratory N 3 Biological Buffers IIPreparation of a Phosphate Buffer When the concentrations of the conjugate acid and base of a buffering compound are equal, then pH = pKa. This is the point of maximum buffering capacity of the solution. This is most obvious when a titration curve of the substance is generated by the titration of a buffer of a known concentration with varying amounts of a strong acid or base. For a monoprotic buffer (i.e. made from a weak acid that contributes only a single proton, such as CH3COOH) the titration curve will look similar to that in Figure 3 but the volume of base required will vary depending on the initial concentration of the acid. For acids whose physical state is liquid in laboratory conditions, one must factor in their density ( = m/v) and, in some instances, their purity (if it is considerably lower than 100% v/v). Blood buffers3,4 An excellent example of buffer capacity is found in the blood plasma of mammals, which has a remarkably constant pH. Consider the results of an experiment that compares the addition of an aliquot of a strong acid to a volume of plasma with a similar addition to of strong acid to either physiological saline (0.15 M NaCl) or water. When 1 mL of 10 M HCl is added to 1 L of physiological saline or water that is initially at pH 7.0, the pH is lowered to 2.0 (in other words, H+ from HCl is simply diluted to 10-2 M). However, when 1 mL of 10 M HCl is added to 1 L of human blood plasma at pH 7.4, the pH is lowered to only 7.2 impressive evidence for the effectiveness of physiological buffering. The bicarbonate/carbon dioxide (HCO /CO2) system is one of the two major blood 3 buffers, the other being the protein hemoglobin. Carbonic acid (H2CO3) ionizes as a typical weak diprotic acid: H2CO3 HCO + H+ CO 2 + H+ 3 3
However, most of the conjugate acid dissolved in blood and cytoplasm is present as CO2, not H2CO3. The dissolved CO2 is in equilibrium with CO2 in the gas phase: CO2 (gas) CO2 (dissolved) + H2O H2CO3 HCO + H+ CO 2 + H+ 3 3 The equilibrium between CO2 (gas) and CO2 (dissolved) is given by: [CO2]dissolved = k (PCO )
2
Keq1
Ka1
Ka1
That is, the concentration of dissolved CO2 is directly proportional to the partial pressure of CO2 (PCO ) in the gas phase. At 37C and an ionic strength of 0.5, k = 3.01 X 10-5 when PCO is expressed in terms of mm Hg.
2 2
The equilibrium constant for the reaction CO2 (dissolved) + H2O H2CO3 is about 5 X 10-3: Keq1 = [H2CO3] = 5 X 10-3 [CO2]dissolved
Thus, the overall equilibrium constant between dissolved CO2 and HCO + H+ is given by: 3
3 4
Siegel IH (1976) Biochemical Calculations, 2nd Edition, John Wiley & Sons, pp. 83-86. Horton HR, Moran LA, Ochs RS, Rawn JD, Scrimgeour KG (2002) Principles of Biochemistry, 3rd edition, Prentice-Hall, Upper Saddle River, NJ, p. 41.
25
[HCO ][H+] 3 K = = Keq1 X Ka1 = (5 X 10-3)(1.58 X 10-4) = 7.9 X 10-7 [CO2]dissolved pKa = 6.1
a
At any pH: pH = 6.1 + log [HCO ] 3 [CO2] and pH = 6.1 + log [HCO ] 3 (3.01 X 10-5) PCO
2
For all practical purposes, a bicarbonate buffer can be considered to be composed of HCO 3 (conjugate base) and dissolved CO2 (conjugate acid). The pH of blood is maintained at about 7.4. If the p K'a of CO2 is 6.1, how can the HCO /CO2 system help buffer blood at pH 7.4? (Remember that a buffer is supposed to be 3 effective only in the region of its pKa.) In vivo, the HCO /CO2 is an open system in which 3 [CO2]dissolved is maintained constant. Any excess CO2 produced by the reaction HCO + H+ 3 H2O + CO2 is expelled by the lungs. In contrast, the usual laboratory buffer is a closed system: The concentration of conjugate acid increases when H+ reacts with the conjugate base.
Fig. 5. Titration of phosphoric acid, a multiprotic molecule, with a strong base. The initial point, where 100% of the H3PO4 molecules are not ionized, is indicated by a. Equivalence points for each ionizable group are indicated by c, f. and h. (Adapted from Siegel, 1976.)
26
Multiprotic buffers Many laboratory buffers are multiprotic (e.g. phosphoric acid, glycine). Therefore, these buffers have multiple pKa values (cf. Fig. 4), corresponding to the dissociation of protons from each functional group. For phosphoric acid the proton dissociation equations can be written as: pKa1 = 2.12 H3PO4 H2PO + H+ 4 + pKa2 = 7.21 H2PO 4 HPO 4 + H + 2 3 pKa3 = 12.32 HPO 4 PO 4 + H
To use the Henderson-Hasselbalch equation with multiprotic buffers, one must select the pKa and the corresponding dissociation equation that is closest to the desired pH of the solution.
Examples 1. Acetic acid (CH3COOH) has a pKa of 4.8. How many mL of 0.1 M acetic acid and 0.1 M sodium acetate (CH3COONa+) are required to prepare 1 liter of 0.1 M acetate buffer, pH 5.8?5 Substitute the values for the pKa and the desired pH into equation 10: 5.8 = 4.8 + log [CH3COO] [CH3COOH] = 5.8 4.8 = 1.0
Solve for the ratio of acetate to acetic acid: log [CH3COO] [CH3COOH]
[CH3COO] = antilog 1 = 10 [CH3COOH] [CH3COO] = 10 [CH3COOH] For each volume of acetic acid, 10 volumes of acetate must be added (making a total of 11 volumes of the two ionic species). Multiply the proportion of each component by the desired volume (in this case, 1000 mL) and mix: 0.1 M CH3COOH needed: 0.1 M CH3COONa+ needed: 1/11 (1000 mL) = 10/11 (1000 mL) = 91 mL 909 mL 1,000 mL
Note that when the ratio of [A] to [HA] is 10:1, the pH is exactly one unit above the pKa. If the ratio were 1:10, the pH would be one unit below the pKa. 2. Calculate mL of glacial acetic acid (17.6 N; assume 99.7% purity)6 and g of sodium acetate (f.w. = 82 g/mole) that is required to make 100 ml of 0.2 M buffer at pH 3.9. Again, substituting in equation 10 with the desired pH: 3.9 =
5 6
4.8 + log
[CH3COO] [CH3COOH]
Source: Horton et al., 2002, op. cit., pp. 38-42. Other important information for CH3COOH: f.w. (formula weight) = 60.05 g/mole; = 1.05 g/cm3.
27
Let [CH3COOH] = x1 mole/L, then [CH3COO] = (0.2 x1) mole/L Therefore, pH = pKa + log (0.2 x1/ x1) and 3.9 = 4.8 + log (0.2 x1/ x1) 0.9 = log (0.2 - x1/ x1) and x1 = 0.178 mole/L = [CH3COOH] The concentration of acetate ion can be found from the equation: moles of CH3COOH/L + moles of CH3COO/L= 0.2 moles/L or x1 + x2 = 0.2 mole/L. where x2 represents moles/L of CH3COO. This expression indicates that [acid] and [conjugated base] must account for the final concentration of the buffering chemical species in the solution. Because concentrations are not additive, the number of moles for acid and conjugated base are added instead, but relative to a volume (i.e. per liter). Also, recall that 1 mole/L = f.w. (g)/L and, for monoprotic acids, 1M = 1N. From the equation above: 0.178 mole/L + x2 = 0.2 mole/L x2 = 0.2 mole/L 0.178 mole/L = 0.022 mole/L of [CH3COO] For 100 mL of solution: 0.1 L X 0.178 mole/L (L/17.6 mole) = 0.00101 L = 1.01 mL of CH3COOH and 0.1 L X 0.022 mole/L X 82 g/mole = 0.18 g CH3COONa Mix the above in ~25 mL of water and bring to volume to 100 mL in a volumetric flask. 3. Calculate the pH of a solution that was prepared by dissolving 1.83 g of KH2PO4 (anhydrous; f.w. = 136) and 1.16 g of K2HPO4 (anhydrous; f.w. = 174) in 0.2 L of water. Solution: The applicable dissociation equation for this solution corresponds to pKa2 = 7.21 (see Fig. 4). Therefore: [K2HPO4] pH = pKa2 + log [KH2PO4] [K2HPO4] = 1.16 g X mole/174 g X 1/0.2 L = 0.033 M [KH2PO4] = 1.83 g X mole/136 g X 1/0.2 L = 0.067 M pH = 7.21 + log (0.033/0.067) pH = 6.92 4. The pH of a sample of arterial blood is 7.42. Upon acidification of 10 mL of the blood, 5.91 mL of CO2, corrected for standard temperature and pressure (S.T.P.), are produced. Calculate (a) the total concentration of dissolved CO2 in the blood [CO2 + HCO ], (b) the 3 concentration of dissolved CO2 and HCO , and (c) the partial pressure of the dissolved 3 CO2 (in mm Hg). (a) First, calculate the number of moles of CO2 represented by 5.91 mL at S.T.P. One mole of a perfect gas occupies 22.4 L at S.T.P.; for CO2, the experimental value is 22.26 L. 5.91 X 10-3 L 22.6 L/mole = 26.5 X 10-5 moles of CO2
28
This amount of CO2 came from 10 mL (0.01 L = 1 X 10-2 L) of blood concentration of total CO2 = (b) pH = Ka1+ log 7.42 = 6.1 + log [HCO ] 3 [CO2]
26.5 X 10-5 moles = 2.65 X 10-2 M 1 X 10-2 L [HCO ] 3 [CO2] 1.32 = log 20.89 1 [HCO ] 3 [CO2]
[HCO ] 3 [CO2] [HCO ] = 3 [CO2] =
= antilog 1.32 = 20.89 =
20.89 X 2.65 X 10-2 M = 2.53 X 10-2 M 21.89 1 X 2.65 X 10-2 M = 1.21 X 10-3 M 21.89
(c) [CO2]dissolved = k (PCO ) mm Hg PCO =

2
[HCO ] 3 [CO2]
1.21 X 10-3 = 40.22 mm Hg 3.01 X 10-5
Experimental Procedure
1. Prepare 100 mL of 0.3 M phosphate buffer, pH 7.5. Start with solid Na2HPO4 and KH2PO4 and diH2O. Use the Henderson-Hasselbalch equation to calculate the number of moles/100 mL of each phosphate salt that you need to prepare the solution. Convert the molar amount to g using the formula weight given on the chemical containers and weigh out the appropriate amount of each component on the balance. 2. Set up a 100 mL beaker on a stir plate. Add 80 mL of diH2O7 and a stir bar and start stirring the liquid. Dissolve the solid phosphate salts by slowly adding each powder to the beaker. Allow the solid to dissolve completely. When they are dissolved, adjust the volume to 100 mL using a 100 ml graduated cylinder (Erlenmeyer flasks and beakers have less accurate volumes than cylinders). 3. Transfer the solution back to the beaker and measure the pH of the solution using the pH-meter. Does it agree with the desired pH of 7.5? If not, can you explain why? 4. One of the most common buffers used in experimental biology is called phosphate buffered saline (PBS). There are many formulations for PBS. For example: weigh 8 g sodium chloride (NaCl), 0.2 g potassium chloride (KCl), 2.17 g sodium phosphate dibasic (Na2HPO4)8, 0.2 g potassium phosphate monobasic (KH2PO4); dissolve in 80 mL of diH2O. Measure the pH using; adjust pH to 7.5 if necessary and add dH2O to 100 mL. What are the final concentrations of each ion in your PBS?
[PO 3 ] = 4
7
mM
[Na+] =
mM
[K+] =
mM
[Cl] =
mM

8 Phosphate salts might contain chemically-bound water (v.g., monohydrate, dihydrate, etc.). You must factor in water
diH2O = deionized water; dH2O = distilled water, ddH2O = double-distilled water molecule number in the formula weight if not specified on the container.
29
QUESTIONNAIRE Lab 3. Preparation of a phosphate buffer. 1. Your lab manual contains a deduction of the Henderson-Hasselbalch equation using the dissociation of a weak acid, HA, to its conjugate base (A) and a H+. Use the dissociation of a weak base to estimate pOH of a weak base in solution using the parameter pKb. BOH B+ + OH where BOH = a weak base. Start by describing the degree of dissociation of BOH into OH and B+ using Kb. Hint: pOH = log [OH]
2. Describe, stepwise, how you would prepare 0.5 L of a 0.15 M phosphate buffer, pH 12.5, using K3PO4H2O (f.w. = 230.28) and K2HPO4 (f.w. = 174.18). Assume that after dissolving the salts your pH-meter reading is 11.9.
3. What is the enzyme that catalyzes the reaction CO2 + H2O H2CO3 in human tissues, including blood?
4. Since this reaction takes place in the absence of the enzyme, what is the physiological advantage in having such enzyme in the blood? [Hint: find what the turnover number is for this enzyme.]
5. This enzyme is also found in chloroplasts. What do you think the role of this enzyme is in plants?
30
Laboratory N 4 Determination of Protein Concentration using the Bradford Method Introduction Proteins are the most diverse and abundant group of macromolecules within cells. Their functions include catalysis and regulation of numerous cellular metabolic processes (i.e., enzymes and signaling components, respectively) as well as forming structural components (e.g., the cytoskeleton and microtubules, etc.). Among the most useful parameters used in the study and characterization of proteins are their molecular weight and their concentration in the tissue or culture of interest. In this laboratory we will determine the concentration of proteins in the mitochondria, chloroplast and wheat germ samples that you have stored tin previous experiments. Protein concentration in cells or tissues is usually determined on a solution derived from breaking down the source cells followed by serial dilutions of the extract in an appropriate buffer or, for extracellular enzymes, dilutions of the growth medium or the perfusion fluid. Determination of protein concentration aids in characterizing enzymatic activity, which can be expressed as the amount of enzyme that catalyzes the transformation of one mole of substrate to product per minute. Activity per mg protein is a paramater called specific activity. For non-enzyme proteins, measuring concentration will indicate their abundance and importance in the physiology of the cell. Spectrophotometry The equation known as the Lambert-Beer law9 describes the absorbance of a substance or a mixture in solution: A = Elc where: A = Absorbance, which has no units.10 E = Extinction coefficient, which is more accurately termed the absorption coefficient. This is a proportionality constant which defines the efficiency or extent of absorbance by the compound. For macromolecules, such as proteins, DNA and RNA, E is used in the form molar absorption coefficient, , which can be defined as the absorbance of a 1 M solution of the molecule at a given wavelength () through a 1 cm path length. The units of are M-1cm-1. Please note that there are several forms of E (e.g. E % ). 1cm l = Path length in cm. The path length is the thickness of the sample through which the light beam passes and, for standard equipment, it is 1 cm. Instrumentation The measurement of light absorbance is usually obtained in an instrument called a spectrophotometer. The instrument consists of four major components (cf. Fig. 1): 1) Light sources, usually a visible wavelength lamp (VIS, 350-800 nm) and an ultraviolet wavelength lamp (UV, 180-350 nm) 2) A monochromator that can be adjusted to allow only a single wavelength of electromagnetic energy to exit the light source 3) A sample holder that allows you to insert your sample between the light source and
9
10
Although widely known as the Lambert-Beer law, based on the principle of priority it should be called the BouguerBeer-Lambert law. The dimensional equation for A = Elc explains why it has no units. The units of E are M-1cm-1, c is expressed as M, and length (l) is measured in cm and they cancel each other: [A] = (M-1cm-1)Mcm
31
the photodetector. 4) Two photodetectors that quantifies the amount of light that is transmitted through the sample from the light source.
Fig. 1. Optical path of a typical spectrophotometer. One photodetector is positioned behind the sample. This detector quantifies the amount of light that passes through the sample. The second detector, called the reference detector, quantifies the amount of light that is incident upon the sample. Both detectors work simultaneously because the light beam is split into two parts by a half-mirror. Therefore, the absorbance is a ratio of the light detected by the sample detector versus that detected by the reference detector. The photodetectors are attached to a digital or meter readout. In addition to these main components, the instrument may contain additional optical systems (e.g. lenses, slits, filters) to focus the light beam as it passes into the sample or into the photodetector. During a spectrophotometric reading, the sample is contained in a small rectangular tube called a cuvette (or cell), which is inserted in the sample holder. For readings in the visible range, the cuvette is made of glass or polystyrene. Readings in the UV range require cuvettes that are made of quartz, because glass and polystyrene absorb in the UV. Examples 1. The absorbance of a solution of the amino acid tyrosine ( = 280 nm) is 0.75. The E280 for the amino acid tyrosine is 1,500 M-1cm-1. The path length of the cuvette is 1 cm. What is the concentration of the tyrosine solution? Solution: A = Elc c = A/El Substituting l = 1 cm and E = 1,500 M-1cm-1, c = 0.75/(1500 M-1cm-1)(1 cm) = 5 X 10-4 M 2. E470 = 108,427 M-1cm-1 for -carotene in hexane. If A470 of a 1:10 dilution of a hexane extract from carrots is 0.432, what is the concentration of -carotene in the original extract (in mg/mL)? Light path length = 1 cm, spectrophotometer is zeroed with
32
hexane, -carotene f.w. = 536.87 g/mol; measurements are made in glass cuvettes. Solution: as above, c = 0.432/(108,427 M-1cm-1)(1 cm) = 3.98 X 10-6 M (1:100 dilution) = 3.98 X 10-4 M in the original hexane extract. Since 1M of -carotene contains 536.87 g/L solvent, 3.98 X 10-4 M = (536.87 g)(3.98 X 10-4 g/L) = 2.14 X 10-1 g/L = 2.14 X 10-1 mg/mL. Spectrophotometric Determination of Protein Concentration Most proteins do not display any color when seen under visible light. If a protein has a large content of aromatic amino acids, its concentration can be measured by UV absorbance, specifically A280. 11 However, this method is not accurate if the proteins of interest do not have aromatic amino acids. The most common method for determining the concentration of proteins in solution relies on developing a colored complex between a protein and a dye. The protein-dye complex will absorb light at specific wavelengths. This absorption is directly proportional to the concentration of the protein and therefore measurable with an apparatus such as the spectrophotometer. The method that we will use to determine protein concentration is Bradfords protein dye-binding assay. The dye Coomassie brilliant blue G-250 is a relatively hydrophobic substance that binds avidly to the hydrophobic regions of proteins. In dilute acid solution, the color of the Coomassie blue dye changes proportionally as it binds to protein, within a certain concentration range. As a result, the absorption maximum (max) of the dye shifts from 465 nm to 595 nm, a bathochromic effect. This change in absorption can be used to quantify indirectly the amount of protein in the solution using a spectrophotometer. Assays that involve color changes due to the interaction of a protein with a reagent are called colorimetric or chromogenic assays. The Bradford assay offers two major advantages, one being the ease of performance and the other that very few substances interfere with it. Some of the interfering substances are high concentrations of detergents such as Triton X-100 and sodium lauryl sulfate (SDS) that disrupt the binding of the dye to protein due to their amphipatic nature. The sensitivity of the Bradford assay is in the range of 1 g to 100 g of protein. The standard curve In this lab, a standard curve provides a reference for measuring the amount of protein in a solution of unknown concentration. It is constructed by measuring the absorption of several solutions with known concentrations of protein in the range of 10-100 g12. Then, when a solution of unknown concentration is measured, its absorbance at 595 nm can be compared to the standard curve. The concentration of the unknown must be in the range of the standard curve, that is somewhere between 10-100 g. A useful strategy for dealing with unknowns is to prepare serial dilutions. Because the linear region of a standard curve may extend over a full order of magnitude of concentration, a fail-safe approach for a serial dilution of the unknown is one based on the order-of-magnitude dilutions. To determine the concentration of protein in your preparations, you will first construct a standard curve using a solution of known concentration of bovine serum albumin (BSA). Later, using serial dilutions, the unknown protein concentration of mitochondria will be determined by interpolation in the standard curve.
11
12
Whereas concentration of proteins rich in aromatic amino acids can be determined by A280, unstained nucleic acid concentrations are estimated by their A260.
Some dyes such as the bicinchoninic acid or alternate protocols for the Bradfords method may render standard curves and protein readings in the ng to mg range.
33
Procedure Obtain a solution of protein whose concentration is known. BSA has been prepared in 0.15 M NaCl at a concentration of 1.0 mg/mL. Label a set of test tubes (13 X 100 mm) as B and 1 to 5 using a black Sharpie marker. Construct a table in your notebook (see example below). BSA standard curve Tube N T 1 2 3 4 5 1 mg/mL BSA (L) 0 10 20 30 40 50 0.15 M NaCl (L) 50 40 30 20 10 0 Bradford reagent (mL) 2.5 2.5 2.5 2.5 2.5 2.5 Protein (g/tube) A595
Following the table, fill the tubes sequentially with BSA/0.15 M NaCl dilutions and the Bradford reagent, which contains the dye Coomassie Brilliant Blue G-250.13 Full color development should occur in 5 minutes. Calculate the amount of protein each tube contains and enter in the column headed Protein (g/tube). Quantify color development using the spectrophotometer. Assay the tubes within 1 hour. Use tube B (the blank) to set A595 to zero. Measure A595 tubes 1 to 5. Write the values in the table in your notebook. Plot your data on graph paper with g protein on the abscissa and A595 on the ordinate. Strive to trace your standard curve within as many points as possible.14
Assay of the unknown In this portion of the laboratory you will determine the concentration of protein in previously made mitochondria, chloroplast and wheat germ extract preparations. This part of the exercise will prepare you to measure your own samples in subsequent labs. Dealing with unknowns and obtaining as much information about them as possible is one of the things that makes science so much fun. However, the enjoyment factor is nearly canceled out by the frustration level if the investigation is not carried out in an orderly fashion. For example, the way to ascertain the concentration of protein in the unknown is to compare its absorbance to the standard curve created in the first part of this exercise. You might guess that a five-fold or a ten-fold dilution might do the trick. However, if the A595 does not fit in the curve, it will be necessary to dilute the sample again. If the absorbance reading still does not fit, you would have to try yet another dilution. This shot in the dark technique not only takes a lot of time but it also uses up quite a bit of sample and
13 Note:
It is important to mix the tubes rapidly and thoroughly immediately after the dye is added, one tube at a time. Because the Bradford reagent contains phosphoric acid, avoid contact with the mouth or skin. 14 If you do not obtain a linear graph, repeat the assay being more careful with you pipetting technique.
34
provides plenty of opportunity for error. The most efficient way to determine the concentration of an unknown is by using serial dilutions. For example, by diluting the unknown by 10-fold each time, you will be guaranteed to have one tube with an absorbance value that fits on the standard curve. Once the concentration of unknown is determined for a particular tube, it is only a matter of a simple back calculation (using a dilution factor) to determine the amount of protein in the original sample. Procedure C.2.1) Preparation of serial dilutions Label a set of microfuge tubes 1 to 3 and pipet 225 L of 0.15 M NaCl into each tube (you may use a 200P pipette). To the first tube add 25 L of mitochondria, chloroplast or wheat germ preparation for a total of 250 L. Tube 1 now contains a 10-fold dilution of the unknown or an order of magnitude less protein than the original tube. Mix the tube gently by pipetting up and down; try to avoid creating bubbles. This action also rinses the walls of the pipet so that any solution remaining in the pipet will be of the same protein concentration as the tube. Transfer 25 L from tube 1 to tube 2; mix gently. The second tube now contains a 10fold dilution of the protein in tube 1, or 100-fold (102) less protein than the original. Now transfer 25 L from tube 2 to tube 3, mix gently as above. How many orders of magnitude less than the original do you have in this last tube? ______. Express it as a fraction (___/____) and also as powers of 10 (_____X 10 ). What volume of solution would you have ended up with if you had made this dilution directly from the original sample? _____________ [In other words, starting with 25 L of unknown, how much 0.15 M NaCl would be necessary to achieve this same degree of dilution without using the serial dilution technique?]
C.2.2) Color development of the unknowns Label another set of eppendorf tubes as 1 to 4 and transfer 50 l of each of the dilutions to the corresponding tubes. Construct a table in your notebook similar to the table used below for generating the standard curve; you may use the following table as an example:
Sample source Mitochondria Tube N U1 U2 U3 Chloroplast U4 U5 U6 Wheat germ U7 U8 U9 Dilution Inverse 1:10 1:100 1:1000 1:10 1:100 1:1000 1:10 1:100 1:1000 Powers of 10 10-1 10 10 10 10 10 10 10 10
-2 -3 -1 -2 -3 -1 -2 -3
Bradford reagent (mL) 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5
A595
Dilution factor 10 100 1000 10 100 1000 10 100 1000
Protein (g/tube)
35
Add 2.5 ml of the Bradford reagent to each tube. Wait at least 5 minutes and then measure A595. Select the A595 value that falls in the middle region of the standard curve. This is the sample that falls within the useful range of the standard curve. Use this A595 value for the back-calculation to determine the concentration of BSA in your original unknown solution.
Example Lets say that by interpolation on the standard curve, the A595 of your unknown tube N 2 corresponds to 35 g/tube, which should be transformed to g/mL. Since the standard BSA tubes and the unknowns had a total volume of 2.55 mL we have: [Total protein] = (35 g/2.55 mL)= 13.72 g/mL. The concentration in the original unknown tube is given by multiplying the concentration of protein in tube 2 times its dilution factor, reported in g/mL and converted to mg/mL: (13.72 g/mL)(100) = 1,372 g/mL = 1.372 mg/mL
36
QUESTIONNAIRE Lab 4. Bradford Method 1. When preparing the protein standards, we used a tube (T) without protein, but including Bradford reagent and an equivalent volume of 0.15 M NaCl instead of protein. Can we just use plain water to prepare tube T instead? Yes No Explain.
2. The objective of this exercise was to train you in determining protein concentration in different extracts from biological samples. The protein concentration in a particular sample is used to standardize the activity of a protein such as an enzyme, a transporter, or receptor. Define the term specific activity in regards to an enzymatically catalyzed reaction:
3. Report your protein concentration for each preparation (i.e., your best determination) in the following table:
Sample source Mitochondria Chloroplast Wheat germ Tube N Dilution factor used for best determination Protein (g/mL)
4. Why did you choose those particular dilution factors to get your best determination?
5. Include a print-out of your protein standard curve with your report. Indicate how can you estimate protein concentration of an unknown sample using the A595/c slope. Remember: c in this case is the absorbance of the sample before multiplying by the dilution factor.
37
Use this sheet after you have completed labs 5, 6 and 9. You will save samples from tissue extracts prepared for these exercises and measure protein after the fact. Cyt c Oxidase Specific Activity (Mitochondrial Sample) Preparation dilution that falls in standard curve linear region: 10 100 1000 A595 of this unknown dilution: ________ (Raw A595) Corrected A595 = (Raw A595 X Dil. factor) (1 mg/1000 g) g/mL = ________ (103 mg/mL) = _____ mg/mL COX activity (units/mL) from Lab 3: ______, [Mitochondria total protein] = ____ mg/mL COX Specific activity = (______ units/mL)/(_____ mg/mL) = ________ units/mg protein Chloroplast sample concentration: Preparation dilution that falls in standard curve linear region: 10 100 1000 A595 of this unknown dilution: ________ (Raw A595) Corrected A595 = (Raw A595 X Dil. factor) (1 mg/1000 g) g/mL = ________ (103 mg/mL) = _____ mg/mL protein in chloroplast prep (Lab 4). Acid Phosphatase Specific Activity (Wheat Germ Extract) Preparation dilution that falls in standard curve linear region: 10 100 1000 A595 of this unknown dilution: ________ (Raw A595) Corrected A595 = (Raw A595 X Dil. factor) (1 mg/1000 g) g/mL = ________ (103 mg/mL) = _____ mg/mL Phosphatase activity (M/s) from Lab 5: ______, [Wheat germ total protein] = ____mg/mL Acid phosphatase specific activity = (______ units/mL)/(_____ mg/mL) = ________ units/mg protein
38
Laboratory N 5 Molecular Evolution: Separation of Fish Proteins Using Polyacrylamide Gel Electrophoresis Introduction In his classical book The Origin of Species, Charles Darwin proposed that all living organisms are derived from a common ancestor through a process that he called descent with modification, in which hereditary changes occur over many generations. Hereditary changes are brought about by alterations in the DNA (genotype) called mutations (see exercise Detection of a Mutant Hemoglobin in this manual) which result in the alteration of the structure of DNA-encoded proteins, leading to novel (phenotypic) traits. Thus, DNA provides both for the continuity of the traits through generations but it also accounts for the variation that can lead to genetic diversity within populations. At the genetic level, evolution can be defined as changes in a gene pool (collective genotype of a certain species) over time. Changes in the gene pool are produced by natural selection, a process that favors some individuals and not others, by giving them traits that may enhance, for example, their survival, reproductive rate, capacity for adaptation, or metabolic processes. Evidence for genetic evolution comes from the knowledge of the nucleotide sequences in the DNA of many contemporary organisms who display a great deal of similarity in their genes. For example, the Hox gene family has been shown to control the embryonic development in animals from groups as diverse as fruit flies, leeches, zebrafish, and humans. These high levels of similarityor homologyin gene sequences among markedly different organisms can only be due to common ancestry, or homology. DNA currently is the focus of much research, but one must not overlook that its essential role is to determine protein amino acid sequences and, therefore, their structure and function. Proteins are the molecules that actually perform the functions programmed by the genome. Among other types, proteins are enzymes, ion transporters, gene activators, gene replicators. In animals, proteins constitute a great proportion of the body mass as part of the muscles. In this exercise, you will approach the study of evolutionary relationships among several groups of fish through the analysis of the protein composition of their muscles. Protein analysis will be accomplished by SDS-PAGE (polyacrylamide gel electrophoresis in the presence of the denaturing agent sodium dodecyl sulfate), a technique in which proteins are separated on the basis of their size (molecular mass). You will compare a traditional phylogenetic tree of fish groups with the phenetic relationships among the fishes studied here as inferred from your data.
Part A. Experimental Procedures 1. Sample preparation Following the directions of your lab instructor, setup electrophoresis rig (MiniProtean 3 or equivalent) and add (1X) TGS (Tris-Glycine-SDS) electrophoresis buffer to the chamber. Your instructor will provide you with several fish muscle samples, 20 g each. Check the labels and write the identity of the samples on the table below. Samples have been prepared in a solution similar to the SDS-containing (1X) TGS electrophoresis buffer. SDS is a detergent that facilitates the separation of proteins
Adapted from Biotechnology Explorer Protein Fingerprinting Instruction Manual, Prod. N 166-0100EDU; BioRad, Hercules, CA.
120:202 Foundations of Biology
39
by electrophoresis because, besides being a denaturing agent, it gives them a negative electrical charge, hence they all migrate towards the anode (+). 2. Electrophoretic separation of fish muscle proteins Request the Bio-Rad Kaleidoscope size markers (KS) from your instructor. Using a 20-L pipettor, load your gel in the following order (4 lanes/group, unless your instructor indicates otherwise): Lane 1 2
3
Volume (L) Empty 10

10
Sample Kaleidoscope markers (KS) Fish muscle sample 1: Fish muscle sample 2: Fish muscle sample 3: Fish muscle sample 4: Fish muscle sample 5: Fish muscle sample 6: Kaleidoscope markers (KS)
4 5
6
10 10
10
7
8
10
10
9 10
10 Empty
Run the electrophoretic separation for ~1 h at 200 V in (1X) TGS buffer or as indicated by your instructor.
3. Staining After electrophoresis, remove gel from cassette and transfer gel to a container with 40 mL of Coomassie Blue stain. Stain gel for 20-30 min, with gentle shaking for best results. Discard stain in the container located in the hood and destain gels in a large volume of destaining solution for at least 30 min to overnight (in which case you will coordinate with the laboratory staff to return to the lab to change the destaining solution). Destaining solution may need to be changed during the process. It helps to add a few tightly scrunched kimwipes to adsorb the Coomassie Blue stain. Just be careful to avoid paper touching the gel. Kaleidoscope markers and blue-stained bands will be visible on a clear background after destaining.
4. Imaging Document your gel using one of the following methods: (as directed by your instructor):
40
Take a picture using the labs camera or your cell phone. Remember to place a ruler along the side of the gel. Scan the gel by placing a transparent support underneath (such as an acetate sheet or transparency) and another one on top (to protect the scanner) Dry the gel using GelAir cellophane (or similar method) and paste on your notebook.
Fig. 10. Phylogenetic tree of Metazoan organisms with emphasis on fish.
41
Part B. Data analysis 1. Phylogeny of fish groups. Familiarize yourself with the phylogeny and evolution of fish groups in the internet. You may visit the following web sites: Icthyology Web Resources (http://www2.biology.ualberta.ca/jackson.hp/IWR/index.php) The Tree of Life (http://tolweb.org/tree?group=Vertebrata&contgroup=Craniata) Study the phylogenetic tree above (Fig. 9) and observe the positions of the fishes from which the protein samples were obtained. (Illustration taken from BioRads Protein Fingerprinting Manual, p. 14.) Notice how fishes can be classified, according to morphological, physiological and other criteria, in relatively different and sometimes distant groups. For example, sharks are classified in a branch totally separate from other fishes because their skeletons are cartilaginous (hence the name Chondrichthyes) and not bony as they are in the fishes in the Ostheichthyes group. The Agnatha group includes the lampreys. Members of this group are characterized by the absence of a mandible, which is considered to be a primitive character (that is, a trait that precedes more modern ones). Notice how the Agnatha branch has been drawn on the diagram below the Chondrichtyes and also how both Agnatha and Chondrichtyes constitute phylogenetic groups as separate between themselves and other fishes as they are from the other four main classes of Chordates. Hypothesize which fishes from which you obtained samples will have similar patterns of muscle proteins.
2. Comparison of protein composition. Use the picture or scan of your SDS-PAGE separation of fish muscle proteins and measure the distance from the application well to each one of the molecular weight markers (KS) bands. The small proteins will move further down the gel. Use this table to identify the proteins and write down their migration distance: Protein 1. Myosin-heavy chain 2. -Galactosidase 3. Bovine serum albumin 4. Carbonic anhydrase 5. Soybean trypsin inhibitor 6. Lysozyme 7. Aprotinin Molecular weight Distance migrated (kDa) from well (mm) 203.0 135.0 86.0 41.5 33.4 19.5 8.0
Construct a standard curve on semi-logarithmic paper with three-cycles (on next page) by plotting size (molecular weight) of standards in kilodaltons (kDa) in the log axis (Y) versus migrated distance (mm) in the linear axis (X). In your gel, the actin/myosin-laden sarcomere appears as myosin (210 kDa) and actin (43 kDa). The major band below actin is tropomyosin, with a MW of 40 kDa and several myosin light chains are below 30 kDa.
42
Observe that some bands are prominent across the gel, but their positions are slightly different. Their abundance may also vary, as evidenced by the intensity of their staining. Notice which samples are more similar than others and fine-tune your analysis by determining the molecular weight of those protein bands that vary from sample to sample and those that are common to two or more samples. Please note that it is difficult to assign identities to the proteins in your gel, since the fish muscle extracts contain complex mixtures of proteins. However, since the samples are all from muscle tissue, one may safely assume that there would be large quantities of the predominant proteins actin and myosin. Definitive identification of a protein would require sequencing its amino acid residues, mass spectrometry, or immunodetection with specific antibodies. Molecular weights are estimated by measuring the distance migrated by the bands from the well (in mm) and interpolate this value in the X-axis (distance) of your standard curve; find the corresponding size (kDa) on the Y-axis (size).
43
QUESTIONNAIRE-Part 1 Lab 7. Molecular Evolution Your report must include (a) a print-out of the stained polyacrylamide gel; (b) protein standard curve (this page); (c) table containing estimates of protein size for each sample; and (d) answers to the questionnaire on the following page.
Semi-log graph paper

(Notice that the abscissa is not to scale)
44
b) Construct a table in the following format for comparison of protein samples: Fish Samples Most similar Least similar Molecular weight (kDa)

n n n n
Comparing the molecular weights of your proteins across the gel, confirm or reject the hypotheses that you elaborated while working with the phylogenetic tree regarding how close or how far the fishes you used as sample sources are from each other.
45
QUESTIONNAIRE-Part 2 Lab 7. Molecular Evolution: Separation of Fish Proteins Using Polyacrylamide Gel Electrophoresis Your discussion should include, but not necessarily be limited to the following questionnaire: 1. List the names of the fishes whose muscle proteins you are investigating. 2. According to the phylogenetic tree, which of your fishes are most closely related to each other? Which fishes are most distantly related to each other? 3. Which samples shared the most protein banding similarity? The least protein banding similarity? 4. How did you distinguish the protein profiles of different species from each other? 5. What are possible explanations for this variation? 6. Before you conducted the investigation, which two fish species did you list as being most related? 7. Of all the muscle proteins that you found in these two species, how many are present in both species? 8. What is the total number of different kinds of proteins that you were able to detect on your gel in these two species? 9. Of the total number of proteins in this pool, how many are found in common to both species listed in question 6 above?
( Nof proteins in question 7 ) X 100 = ____% Nof proteins in question 8
10. Prior to starting this laboratory, which two fish species did you think were the least related? 11. Of all the muscle proteins that you found in these two species, how many are present in both species? 12. What is the total number of different kinds of proteins that you were able to detect on your gels, in these two species? 13. What percent of the muscle proteins were common to these least similar species?
( Nof proteins in question 11 ) X 100 = ____% Nof proteins in question 12
14. Do your protein size data confirm your hypotheses about the relationships of the fishes you worked with? Do your data correlate with the arrangement of branches of the evolutionary tree?
46
15. What do the relative positions of the bands on the gel indicate about the proteins in the bands? 16. Are all the bands of equal thickness? 17. How would you explain the observation that some proteins form thin bands while others form thick bands? 18. Actin and myosin are proteins found in muscle tissue of all animals. Based on your data, what can you say about these proteins in the fishes you have investigated? What might you find if you looked at actin and myosin in other animals? 19. Based on the apparent molecular weights of actin from your gel, predict the number of amino acids in this protein using an average molecular weight of 110 daltons per amino acid. 20. What implications could the kind of molecular data like these protein comparisons have in relation to the theory of evolution? (In terms of support, rejection, neutrality, etc.)

47
Laboratory N 6 Enzyme Kinetics Introduction: Part 1. Enzymes Chemical reactions, including those that take place in biological systems, would proceed at very slow rates under standard temperature and pressure (STP) conditions. An increase in reaction rates could be achieved by raising the temperature of the environment, lowering the reactions activation energy, or both. For most living organisms, heat is not a viable option to speed up biochemical reactions. Biological systems have evolved organic catalysts, known as enzymes, without which biochemical reaction rates would be too slow to maintain metabolism and growth processes. The great majority of known enzymes are proteins but a few of them, the ribozymes, depend on RNA for their catalytic activity/ Like other catalysts, enzymes lower the activation energy of reactions; they are not consumed themselves during their catalytic activity; and they are required in very small amounts. Enzymes differ from inorganic catalysts in several ways, among them: with some exceptions, enzymes are denatured by heat; they work optimally within a narrow range of pH and ionic strength; and, very importantly, they catalyze very specific reactions, allowing for the coexistence of a wide variety of catabolic and anabolic pathways in living organisms. Definition of enzymes15 The study of enzymes and their activities is indispensable in understanding the molecular mechanisms of biological systems. An enzyme-catalyzed reaction in which a molecule (the substrate) is modified into a different one (the product) can be described as follows:
k1 k-1 kp
E + S ES E + P
(equation 11)
where: E = enzyme S = substrate ES = enzyme-substrate complex P = product of the reaction k = rate constants that describe the rate at which each of the reactions proceeds, as indicated by the arrows. The term substrate refers to the molecule that is acted on by the enzyme. In general, enzymes exhibit a high degree of substrate specificity. In other words, they bind to a single type of substrate and catalyze a single chemical reaction. Enzymes are usually named according to their substrate or the reaction they catalyze and the suffix -ase. For example, an enzyme that hydrolyzes proteins into smaller polypeptide chains is called a protease. An enzyme that catalyzes the synthesis of ATP is called an ATP synthetase. The first step in enzyme-mediated catalysis is the binding of the enzyme to its substrate to form an enzyme-substrate complex. This interaction is responsible for the reactions specificity. Only substrates that fit into the binding site of the enzyme will undergo catalytic conversion to the product (cf. Fig. 6). In many cases, the actual binding of the substrate to the enzyme distorts the spatial conformation of both enzyme and substrate in such a way that the formation of the product is facilitated. In the most common mechanism, the binding of substrate to the binding site brings certain chemical bonds of the substrate in close proximity to the lateral groups of certain amino acids of an enzyme.
15
Segel IH (1975) Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. Wiley Interscience (Wiley Classic Library Edition, 1993), New York.
48
The chemical microenvironment formed by the R groups facilitates the chemical reaction resulting in the conversion of substrate to product. The region of the enzyme that contains the lateral groups that bind the substrate and facilitates the chemical reaction is called the active site of the enzyme. The lateral groups involved in the reaction are called functional groups. The formation of the ES complex is what lowers the activation energy of the reaction, allowing it to proceed toward the formation of the product. Upon conversion of the substrate to the product, the enzyme and product(s) dissociate from one another, and the enzyme is free to interact with another substrate molecule. This property of enzymes makes them very efficient in catalysis. As a result, very few molecules of enzyme are required to convert large quantities of substrate to product.
Fig. 7. Induced-fit model for the activity of 5-enolpyruvylshikimate-3-phosphate synthase. This enzyme catalyzes the formation of a precursor of aromatic amino acids from the substrate molecules phosphoenolpyruvate and shikimate-3-phosphate (Funke et al, 2006).15
Figure 7 shows a ribbon-model of the enzyme 5-enolpyruvuylshikimate-3phosphate synthase, which is found in organisms capable of aromatic amino acid biosynthesis, such as bacteria and plants. The figure shows the reaction in which two substrate molecules (phosphoenolpyruvate and shikimic acid) are combined to form the molecule 5-enolpyruvylshikimate-3-phosphate, a precursor of shikimic acid, which in turn is precursor of aromatic amino acids.16 Notice the formation of the ES1S2 complex and the recovery of the enzymes conformation after the reaction is complete. Despite the participation of two substrates in the reaction, the induced-fit mechanism has been demonstrated for this enzyme, which changes its conformation in order to condense the two substrates into a single product. Introduction: Part 2. Measurement of enzyme activity The rate of enzyme reaction is referred to as the velocity of the reaction. It is most common to express the velocity in amount of product formed per minute. The initial reaction velocity, v0, of an enzymatic reaction varies with the substrate concentration, [S]. This can be illustrated by plotting v0 vs. [S] (Fig. 8). The resulting curve is known as the Michaelis-Menten plot, which was named for Leonor Michaelis17 and Maud Menten, two pioneers in the field of enzyme kinetics analysis. From this plot, an equation can be derived to describe the characteristics of an
16
Adapted from Fig. 2 in: Funke T, Han H, Healy-Fried ML, Fischer M, Schnbrunn (2006) Molecular basis for the herbicide resistance of Roundup Ready crops. Proc Natl Acad Sci USA 103:13010-13015. 17 Do not be misled by this first name. Dr. Michaelis was a man, while Dr. Maud Menten was a woman.

49
enzyme-catalyzed reaction. The equation is called the Michaelis-Menten equation. The common form of the equation is: v0 = Vmax[S] Km + [S] (equation 12)
where: v0 = initial reaction velocity, expressed as amount of product produced per unit time, i.e. mol L-1 s-1 Vmax = maximal reaction velocity; achieved when all the enzyme active sites are occupied with substrate molecules. This condition is called substrate saturation.
Fig. 8. The Michaelis-Menten plot for an enzyme-catalyzed reaction as a function of initial velocity on substrate concentration. [S] = substrate concentration (mol L-1) Km = Michaelis constant = (k-1+ kp)/k1 Two important parameters, Vmax and Km, can be determined graphically from the Michaelis-Menten plot (Fig. 8). Vmax is the maximal rate at which an enzyme catalyzes a reaction. It is expressed as the amount of product formed per unit time. The units of Vmax are the same as for v0. This value can be extrapolated from the asymptotic plateau of the curve on the MichaelisMenten plot. The plateau region represents reaction conditions in which the concentration of substrate far exceeds the concentration of enzyme active sites. Therefore, all active sites will be occupied at any given time. Under these conditions, the enzyme is said to be saturated with the substrate. The Vmax is not a constant because it depends on the amount of enzyme in the reaction but it is a very useful number because it can be used to calculate a constant called the turnover number, kp, the number of substrate molecules transformed to product by one enzyme molecule per unit time. It can be calculated from Vmax using the equation: kp = Vmax [Et] (equation 13)
where [Et] = the total concentration of enzyme in the reaction with units of g/mL or molarity (M), if molecular weight of the enzyme is known.
50
The turnover number is useful because it is a measure of the efficiency of the enzyme. The higher the kp, the more effective the enzyme. The Km or Michaelis constant is the other very useful parameter that is derived from the Michaelis-Menten equation. Km is related to the rate constants of the reaction. In simple terms, it is the ratio of the rate at which ES forms (k1) to the rate at which ES dissociates (k-1 + kp). The dissociation of ES is the sum of the rate that the substrate dissociates from the enzyme before it undergoes the enzyme catalyzed reaction (k-1) and the dissociation of product following the reaction (kp). There are three important points to remember about Km: 1) The Km is a measure of the apparent affinity of the substrate for the enzyme. In other words, it indicates how well the substrate fits into the binding site of the enzyme. The substrate with the lowest Km value has the highest apparent affinity for the enzyme. The best substrate is that which has the highest Vmax/Km. 2) Km is directly related to Vmax as it represents the substrate concentration at half the maximal velocity ( Vmax) of the enzyme. 3) The Km of an enzyme is a constant for every individual enzyme with a particular substrate. Therefore, it serves as a fingerprint for the presence of a specific enzyme. This is very useful for investigators who are determining whether an enzyme is present or absent in a particular cell or tissue or to determine the affinity for similar substrates. The units of Km are molarity (M).
Fig. 9. The double-reciprocal (Lineweaver-Burk) plot is derived from a linear transformation of the Michaelis-Menten equation. Values of 1/v0 are plotted as a function of 1/[S].

The fact that the Michaelis-Menten plot is a rectangular hyperbola makes it difficult to accurately determine the Vmax and Km values from a graph. Therefore, the terms in equation 2 are often rearranged and used to generate a plot that gives a straight line. This equation is called the Lineweaver-Burk equation: 1 K = m v0 Vmax 1 + [S] 1 Vmax (equation 14)
This equation is in the form y = mx + b and the plot 1/v0 versus 1/[S] is a straight line (Fig. 8). The intercept on the 1/v0 axis is 1/Vmax and the intercept on the 1/[S] axis is -1/Km. The slope of the line on the plot is Km/Vmax.
51
Experimental Procedures In this laboratory exercise you will analyze the activity and kinetic properties of an enzyme derived from wheat germ. The wheat kernel, or caryopsis, consists of three parts: 1) the embryo or germ that will develop into the new plant, 2) the starchy endosperm and the aleurone which supply the embryo with nutrition, and 3) the hull or bran which protects the grains. The wheat germ also is a common source of enzymes and nucleic acids for studies in biochemistry and cell biology. You will analyze the enzyme acid phosphatase from wheat germ. Acid phosphatase catalyzes the hydrolysis of phosphate groups from proteins, nucleic acids and lipids that are stored in the seed. The phosphate is utilized by the growing embryo upon germination. To measure the enzyme activity, you will use the artificial enzyme substrate p-nitrophenol phosphate. This substance is colorless. However, after hydrolisis by acid phosphatase, it yields phosphate and nitrophenol, which is yellow. The amount of yellow color generated by the catalysis is a direct measure of the amount of nitrophenol produced and therefore is an indicator of the enzyme activity.
p-Nitrophenol phosphate
Acid phosphatase
PO 2 4
+ Niittrophenoll (yellow at pH > 7) N ro p h en o
In the first exercise you will measure the velocity of the reaction catalyzed by acid phosphatase that is extracted from wheat germ. In addition you will measure the velocity of commercially available purified acid phosphatase (part 2) as a standard for the enzymes activity (part 3). By comparing the two values, you will determine the amount of enzyme that is present in the wheat germ extract. 1) Preparation of acid phosphatase from wheat germ extract The preparation of the wheat germ extract will be performed by the instructor at the beginning of class. Observe the procedure and record it in your notebook. Place 1 g of wheat germ into a mortar containing 30 mL of enzyme extraction buffer. Grind the tissue with a pestle until the mixture forms a homogeneous suspension. Transfer the solution to a centrifuge tube and spin for 15 min at 10,000 rpm. Remove the supernatant to a clean tube. This is the wheat germ extract. Label this tube as Extracted Acid Phosphatase. Save 100 l of the wheat germ extract and freeze at 20C. Label accordingly. 2) Determination of acid phosphatase activity in a commercial preparation. All steps in this assay are to be performed by students Obtain a tube rack containing 18 test tubes. Number six of the tubes A1 through A6 and six more as B1 through B6. Place 0.5 mL of 1.5 % (w/v) KOH into each of the 12 tubes. Obtain two larger (25 mL) tubes and label them A and B. Add 5 mL of Phosphatase Substrate Solution to tube A and 5 mL to tube B. Tube A will contain the reaction catalyzed by purified acid phosphatase. Tube B will contain the reaction catalyzed by the extracted acid phosphatase. Transfer 0.5 mL of the substrate solution from tube A to tube A1. Transfer 0.5 mL of
52
the substrate solution from tube B to tube B1. These two tubes are the 0-time values for each reaction. Place 50 L of pure (commercial) acid phosphatase (125 g at 2.5 g/L) into tube A and 0.2 mL of wheat germ extract into tube B. Mix the tubes gently and immediately start timing the reactions. At the times indicated below, remove 0.5 mL of the solutions in tubes A and B and place them into the corresponding tubes. 2.5 min 5 min 10 min 15 min 20 min A2, B2 A3, B3 A4, B4 A5, B5 A6, B6
The KOH in the numbered tubes serves two functions. First, it stops the reaction because the acid phosphatase is inactive at alkaline pH (hence the name acid phosphatase). Second, the alkaline conditions turn the liberated nitrophenol to a more intense yellow (why?). This makes the assay more sensitive. In order to quantify to the amount of nitrophenol generated in your enzymatic assays, prepare six standards containing known concentrations of nitrophenol. Place 1 mL of each of the standards into six test tubes that have been labeled C1-C6. Read A410 of the tubes with the spectrophotometer. Use the C1 tube as your blank to adjust the spectrophotometer to A410 = 0. Enter the data in a table such as the one below:
Nitrophenol standard curve for acid phosphatase assays
Tube Nitrophenol (M) A410 Tube Nitrophenol (M) A410
C1 C2 C3
0 12.5 25
C4 C5 C6
50 100 200
Construct a nitrophenol standard curve by plotting the A410 of tubes C1-C6 on the ordinate vs. the concentration of nitrophenol on the abscissa for each tube. You may use Excel or millimetric paper (http://newarkbioweb.rutgers.edu/bio202/mm3.pdf). Read the absorbance of your assay tubes A1-A6 and B1-B6. Enter the data into tables such as the ones below:
Acid phosphatase assay for commercial preparation (An) and wheat germ extract (Bn)
Tube A410 Nitrophenol (M) Tube A410 Nitrophenol (M)
A1 A2 A3 A4 A5 A6
B1 B2 B3 B4 B5 B6
53
Using the nitrophenol standard curve, determine the concentration of nitrophenol produced (M) in each assay tube (A1-A6 and B1-B6) and record your data on the tables above. Plot the concentration of nitrophenol produced (Y axis) against time (X axis) for sets A and B. Convert min to s. Strive to trace a straight line through the plotted points. You may find that the latest time points may not fall onto a straight line with respect to the earlier time points. If this is the case, draw the line through the first three time points on the plot. These three points should have a linear relationship. (Alternatively, you may do your plot in Excel and estimate the v0 for the reactions through an equation.) From the graph, calculate the initial velocities (v0) for the two reactions in M/s. The v0 that you calculate actually represents the Vmax for the enzyme because the amount of p-nitrophenol phosphate added to each reaction was at a concentration that saturates the enzyme. Given the fact that you added 125 g of purified acid phosphatase to tube A (or 50 L of a 2.5 g/L stock), estimate the amount (g) of acid phosphatase that was present in the 0.2 mL of wheat germ extract in tube B. Hint: To calculate the amount of enzyme in the wheat germ extract, you must first convert the Vmax from the purified enzyme to a constant that can be applied to the enzyme in the wheat germ extract. This constant is the turnover number (kp). This constant can then be used to calculate the amount of enzyme in the wheat germ extract. 3) Determination of Vmax and Km for Acid Phosphatase
In this part of the exercise, you will use the information on v0 that you obtained above to determine the Vmax and Km of purified (commercial) acid phosphatase. This is to doublecheck the value for Vmax that we assumed in the first part of the laboratory. First, you will choose a time point in the enzyme assay that lies within the linear range of the initial velocity. This is critical because enzyme catalytic rates decline with time due to depletion of the substrate, accumulation of the product, and inactivation of the enzyme. Therefore, it is important that you choose a time that represents a true initial velocity for the reaction. Second, you will set up a set of acid phosphatase assays containing increasing amounts of substrate, but a constant amount of enzyme. After incubating the assays for the predetermined time, you will determine the v0 for each assay and prepare a LineweaverBurk plot for the enzyme. From this plot, you will determine the Km and Vmax for acid phosphatase. Look closely at the plot of M nitrophenol vs. time generated above. Choose a time point at which the accumulation of product is still within the linear range of the assay, i.e., find a time-point that lies on the straight line. An incubation time of 5 min (300 sec) might still be in the linear region of the curve. This time point will be the incubation time for the kinetic assay in this exercise. Seven solutions with different concentrations of p-nitrophenyl phosphate have been prepared for your use by the instructor. Label test tubes from 1 to 7 and transfer 1 mL of each substrate solution to a corresponding tube as given on the table below. These tubes represent assay mixtures with varying amounts of substrate. Add 50 l of purified acid phosphatase (125 g) to each tube at 30-second intervals.
54
Start timing when you add the enzyme to the first tube. At the end of 2.5 min, add 1 mL of 1.5% (w/v) KOH to each tube at 30-second intervals to stop the reactions. Note: By staggering the addition of enzyme and KOH at 30-second intervals, you ensure that each reaction has proceeded for exactly 2.5 minutes. Quantify the concentration of nitrophenol produced (M) in each reaction using the standard curve from part 2). Convert these values to v0 values by dividing the concentration of nitrophenol produced by the reaction time. Enter all values in a table such as the one given below.
Data set for estimation of Vmax and Km for purified acid phosphatase Nitrophenol (M) v0 (M/s) 1/v0 (s/M) [S] (M) 1/[S] (M-1)
Tube
1 2 3 4 5 6 7
0 50
100 250 500 750 1000
Prepare a Michaelis-Menten plot with the above data using millimetric paper or Excel. Estimate the Km and Vmax values from this plot. Express the values in the units of M and M/s, respectively. Prepare a Lineweaver-Burk plot of 1/v0 versus 1/[S]. Determine the Km and Vmax from the Lineweaver-Burk plot. Are the values different from those that you estimated from the Michaelis-Menten plot?
55
QUESTIONNAIRE Lab 8. Enzyme Kinetics Part 1. Standard curve Record your data for the nitrophenol standard curve in the table below:
Nitrophenol standard curve for acid phosphatase assays
Tube Nitrophenol (M) A410 Tube Nitrophenol (M) A410
C1 C2 C3
0 12.5 25
C4 C5 C6
50 100 200
Construct a nitrophenol standard curve by plotting the A410 of tubes C1-C6 on the ordinate vs. the concentration of nitrophenol on the abscissa for each tube. You may use the millimetric grid posted at http://newarkbioweb.rutgers.edu/bio202/mm3.pdf or you may plot your values in the Excel sheet at http://newarkbioweb.rutgers.edu/bio202/acid_phosphatase.xls Obtain a curve in the form y = mx + b in which y = A410 and b = ordinate to the origin. In either case, determine the slope (m) and the ordinate to the origin (b). Establish a conversion factor (A410 to Concentration) by obtaining 1/m: m = F = 1/m = ________
Read the absorbance of your assay tubes A1-A6 and B1-B6. Enter the data into tables such as the ones below and convert A410 to nitrophenol produced (M) in each assay tube (M)
Part 2. Determination of initial velocity of acid phosphatase preparations

Acid phosphatase assay for commercial preparation (Series A) and wheat germ extract (Series B)
Tube A410 Nitrophenol produced (M) = FA410 Tube A410 Nitrophenol produced (M) = FA410
A1 A2 A3 A4 A5 A6
B1 B2 B3 B4 B5 B6
Plot the concentration of nitrophenol produced (ordinate) against time (abscissa) for sets A and B. Convert min to s. Strive to trace straight lines through the plotted points or you may want to use Excel and plot a trendline. You may find that the latest time points may not fall onto a straight line with respect to the earlier time points. If this is the case, draw the line through the first three or
56
four time points on the plot. These points should have a linear relationship. If you use Excel to plot, estimate the v0 for the reactions through a linear equation (restrict the data rage to the first three or four points). From the graph, calculate the initial velocities (v0) for the two reactions in M/s: Commercial preparation (A) M/s Wheat germ (B) M/s
The v0 that you calculate actually represents the Vmax for the enzyme because the pnitrophenol phosphate added to each reaction was added at a concentration that saturates the enzyme. If 125 g of commercial acid phosphatase added to tube A (50 L from a 2.5 g/L stock) produced ____ g of nitrophenol, estimate the amount in g of acid phosphatase in the 0.2 mL of wheat germ extract in tube B by comparing its acid phosphatase activity (_____ g of nitrophenol, equivalent to the activity of _____ g of purified enzyme). Given that you added 125 g (in 50 L from a 2.5 g/L stock) of the commercial prep of acid phosphatase to tube A, estimate the amount (g) of acid phosphatase that was present in the 0.2 mL of wheat germ extract in tube B. Convert Vmax to kp (turnover number ) for the commercial preparation:
kp = Vmax/[E]t = _____ g/L (= mg/mL); where [E]t = 2.5 mg/mL for wheat germ extract: [E]t = Vmax/kp = _____ g/L (= mg/mL) Part 3. Determination of Vmax and Km for Acid Phosphatase Time point in the enzyme assay that lies within the linear range of the initial velocity: min (= sec). Prepare a Lineweaver-Burk plot for the enzyme. From this plot, you will determine the Km and Vmax for acid phosphatase. Enter all vo values in a table such as the one given below.
Data set for estimation of Vmax and Km for purified acid phosphatase Nitrophenol (M) v0 (M/s) 1/v0 (s/M) [S] (M) 1/[S] (M-1)
Tube
1 2 3 4 5 6 7
0 50
100 250 500 750 1000
Prepare a Michaelis-Menten plot with the above data. You may use graph paper or Excel. Estimate the Km and Vmax values from this plot. Express the values in the units of M

Segel IH (1975) Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. John Wiley & Sons, Co., New York.
57
and M/s, respectively. Km = M and Vmax =

(M/s)
Prepare a Lineweaver-Burk plot of 1/v0 versus 1/[S]. Determine the Km and Vmax from the Lineweaver-Burk plot. Km1 = and Vmax1 = M1 Km = M
(M/s)
(M/s) 1 Vmax1 =
How are these values different from those that you estimated from the MichaelisMenten plot?
58
Laboratory N 7 Assay of Cytochrome c Oxidase in Potato Tuber Mitochondria Purpose To assay the activity of the last component of the electron transport system in mitochondria, namely the enzyme cytochrome c oxidase, which is in charge of O2 consumption in cellular respiration. Introduction Mitochondria are organelles that originated through endosymbiosis from aerobic bacteria capable of using O2 as the final electron acceptor in respiration. The mitochondrion is also the subcellular compartment where the Krebs cycle takes place in eukaryotic organisms. The Krebs cycle provides donors to the electron transport chain in the mitochondrial inner membrane system, namely: FADH2 (flavin adenine dinucleotide, reduced) and NADH + H+ (nicotinamide adenine dinucleotide, reduced). Cytochrome c oxidase (EC. 1.9.3.1), abbreviated COX, is also known as Complex IV of the electron transport system in the inner mitochondrial membrane and the bacterial plasma membrane. It accepts electrons from cytochrome c (cyt c) and transfers them to an acceptor oxygen molecule in the final step of the electron transport chain. Among COX inhibitors are CO and cyanide. 4 Fe2+-cyt c + 8 H+ + O2 4 Fe3+-cyt c + 2 H2O + 4 H+ [out] COXs activity is responsible for more than 90% of the oxygen utilized by respiring organisms.The extrusion of protons from the mitochondrial matrix towards the intermembrane space allows for ATP synthesis as a pH gradient is formed across the inner mitochondrial membrane. Protons go through a [H+]-ATP synthase when returning to the matrix before the gradient is dissipated (Fig. 13). According to the chemiosmotic theory, a proton motive force is formed by the pH gradient and the electrochemical potential across the inner mitochondrial membrane provide energy for ATP synthesis. The measurement of COX activity in vitro requires the use of glycosidic detergents to maintain its quaternary structure, a dimer in which each monomeric component contains thirteen apoproteins. In mammals, ten of the proteins that compose COX are encoded in the nucleus, whereas genes for the other three are in the mitochondrial genophore. Several maternally inherited diseases in humans are due to defects in the gene expression of the mitochondrial DNA, including some that affect COX structure (e.g., assembly) or function. These diseases include fatal metabolic disorders such as Leigh syndrome, cardiomyopathy, Lebers hereditary optic neuropathy, and sensorineural deafness. Symptoms of these diseases start appearing in early childhood and chiefly affect tissues and organs with high-energy requirements (e.g., muscles, heart, brain) and therefore with a high Fig. 6. Mitochondrial complex IV. Adapted from Qin et mitochondrial activity. al. (2007) and other works by S. Ferguson-Miller. In this laboratory, we will use potato tubers as the source of mitochondria to assay the activity of the redox enzyme cytochrome c oxidase. We will be using cyt c as the substrate, since cyt c oxidation can be followed spectrophotometrically by the oxidation (electron loss) of the heme iron in cyt c, which goes from Fe2+ (ferrocytochrome) to F3+ (ferricytochrome) and thereby causing a decrease in the Amax for ferrocytochrome at 550 nm (A550).
59
Procedure Part A. Isolation of mitochondria from potato (Solanum tuberosum) tubers Wash potatoes thoroughly and make sure that there is no fungal or bacterial contamination. Peel potatoes and be careful not to leave any skin. Cut tubers in small cubes of approximately 1 cm3, and pour 50 g into a pre-cooled blender jar. Keep on ice at all times. Homogenize tissue in ice-cold Mitochondria Extraction Buffer in a ratio of 2 mL buffer/g tissue (i.e., 100 mL). Blend for 15 seconds or until the tissue is reduced to a creamy consistency. Filter homogenate through four layers of cheesecloth into a beaker cooled on ice.
Filtrate Residue Pass through two layers of sterile Discard muslin supported by a funnel. Squeeze fabric to ensure removal of most of the fluid and collect into two 50-mL centrifuge tubes Balance tubes and centrifuge at 2 C for 5 min at 1000 X g (1,000 rpm)
Pellet Discard
Supernatant Carefully decant into fresh 50-mL centrifuge tubes and spin at 2 C for 20 min at 14,000 X g (8,000 rpm)
Supernatant Discard
Pellet Gently resuspend in 1-2 mL of Mitochondria Extraction Buffer
Proceed to cytochrome c activity assay
60
Part B. Cytochrome c oxidase activity in Solanum tuberosum mitochondria Warm up the spectrophotometers tungsten lamp (make sure to turn off the deuterium lamp) and set the wavelength () to exactly 550 nm. While the spectrophotometer warms up, freeze 50 L of the mitochondrial extract. Set up a reaction scheme according to the following table:
Sample Assay Buffer (L) Enzyme Dilution Buffer (L) Sample (L) Ferrocytochrome c Substrate Solution (L)
Blank Unknown sample 1 Unknown sample 2 Unknown sample 3
950 950 950 950
100 100 x1 = 100 x2 = 100 x3 =
= x1 = x2 = x3
50 50 50 50
Notice that xi can represent increasing volumes of the mitochondrial prep (e.g. 50, 75 and 100 L); therefore the enzyme dilution buffer that needs to be added is 100 x1 L. For example, if you are instructed to use 75 L of mitochondrial prep you must add 25 L of enzyme dilution buffer. Zero the spectrophotometer with 950 L of 1X Assay Buffer. Add a suitable volume of mitochondrial suspension to the cuvette and bring the reaction volume to 1,050 L with 1X Enzyme Dilution Buffer and mix by inversion. Start the reaction by the addition of 50 L of ferrocytochrome c substrate solution and mix by inversion. Read the A550 immediately (t0) due to the rapid reaction rate of cyt c oxidase. Keep taking readings every 15 seconds for 3 to 5 min. Background values are expected between 0.001 and 0.005 A550/minute. Estimate your A550/minute by dividing the A550 by the total number of minutes you kept taking readings. A550 = A550 tf A550t0, where tf = time at last reading (e.g., 3 min) and t0 = zero time (initial reading). Recall that 30 sec = 0.5 min, 20 sec = 0.333 min, 15 sec = 0.25 min and so on. Calculate the activity of the sample as follows: Units/mL =
(A550/min)(dilution)(1.1) (21.84)(vol. of enzyme)
where: A550/min = A550/min (sample) A550/min (blank) dilution is the dilution factor of enzyme or sample18 1.1 refers to reaction volume in mL vol. of enzyme (= mitochondria sample) should be converted to mL 21.84 = mM between ferrocytochrome c and ferricytochrome c at 550 nm
If your mitochondrial preparation is not diluted, the dilution factor is 1.
18
61
Bibliography Klug W.S., M.R. Cummins, C.A. Spencer, and M.A. Palladino. 2009. Concepts of Genetics, 9th Edition. Benjamin Cummins. Pp. 233-235. Leaver C.J., E. Hack, and B.G. Forde. 1983. Protein synthesis by isolated plant mitochondria. Meth Enzymol 97:476-484. Nelson D.L. and M.M. Cox. 2008. Lehninger Principles of Biochemistry, 5th Edition. W.H. Freeman and Company, New York. Pp. 183-189. Qin L. M.A. Sharpe, R.M. Garavito, and S. Ferguson-Miller. 2007. Conserved lipid-binding sites in membrane proteins: A focus on cytochrome c oxidase. Curr Opin Struct Biol 17:444-50 Sigma Technical Bulletin CYTOCOX1. 2006. St. Louis. Voet D., and J.G. Voet. 2004. Biochemistry, 3rd Edition. John Wiley & Sons, New York. Pp. 818-820 Preparation of reagents Mitochondria Extraction Buffer (200 mL per section) (0.4 M Mannitol, 1 mM EGTA, 25 mM MOPS, 0.1% (w/v) bovine albumin serum, 8 mM cysteine, 40 mM -mercaptoethanol; pH 7.8 adjusted with KOH). (5X) Assay Buffer Stock (10 mL per section) (50 mM Tris-HCl, pH 7.0; 600 mM KCl) (1X) Assay Buffer Stock (10 mM Tris-HCl, pH 7.0; 120 mM KCl) In a 15-mL Falcon tube, place 2.5 mL of (5X) Assay Buffer stock and add 10 mL of sterile diH2O. Mix well and keep at room temperature. (2X) Enzyme Dilution Buffer (10 mL per section) (20 mM Tris-HCl, pH 7.0; 500 mM sucrose) (1X) Enzyme Dilution Buffer (10 mM Tris-HCl, pH 7.0; 250 mM sucrose) In a 15-mL Falcon tube, place 5 mL of (2X) Enzyme Dilution Buffer stock and add 5 mL of sterile diH2O. Mix well and keep at room temperature. 0.1 M Dithiotreitol for DTT Working Solution Dissolve 200 L of 1 M DTT stock (D7959) to 0.1 M by the addition of 0.8 mL of sterile diH2O. Mix well, keep chilled. Return to freezer after use. Ferrocytochrome c Substrate Solution (0.22 mM) Dissolve 2.7 mg of cytochrome c (MW 12,384 Da) in 1 mL of sterile diH2O and add 5 L of 0.1 M DTT solution.
62
Mix gently and wait for 15 min. The color of the solution should go from dark-orange red to pale-purple red. Mix 50 L of the cytochrome c solution prepared above and 950 L of (1X) Assay Buffer, respectively. This renders a 1:20 dilution of cytochrome c. Using (1X) Assay Buffer as a blank to zero the spectrophotometer, measure A550 and A565 of the 1:20 cytochrome c dilution, and determine the A550/A565 ratio: A550 = A565 = A550/A565 =
Note: The A550/A565 ratio should be between 10 and 20. If the ratio is less than 10, the substrate has not been sufficiently reduced and it should be left for an additional 15-20 min or prepared with a fresher 0.1 M DTT solution.
Cytochrome c Oxidase Positive Control Dissolve the vial of cytochrome c oxidase (Sigma) in the amount of sterile diH2O indicated on the label. Mix gently. For enzymatic assays, further dilute the sample 10-fold with (1X) Enzyme Dilution Buffer and use 20-40 L for each control reaction mixture. Sample may be refrigerated at 4C for at least 3 weeks or frozen in aliquots at 20C.
Enzyme sample Best results are achieved when enzyme activity is between 0.4 and 4.0 milliunits of cytochrome c oxidase. Different amounts of enzyme preparation should be assayed to find a linear range for a particular sample.
63
QUESTIONNAIRE Lab 5. Cytochrome c Oxidase Activity Your lab discussion should include, but not necessarily be limited to the following questionnaire: 1. Graph your reactions A550 vs. time (sec) (your raw values). Include the results obtained by other groups in your section. That way you will have activities from several dilutions of the mitochondrial preparation. 2. Compare the raw values (from your graph) for all dilutions. Do their curves show the same slope? Yes No a. If yes, is this expected? b. If no, what could be the reason? 3. Once the units/mL are calculated for all dilutions, are they the same? Yes No a. If yes, is this expected? b. If no, what could be the reason? 4. From a subjective perspective, in your opinion, is this reaction slow or fast? Explain your answer.
5. Is it an exaggeration to say that cytochrome c oxidase is one of the most important enzymes for aerobic organisms? Explain your answer.
6. Find examples of poisons whose target is cytochrome c oxidase (or, from a biochemical perspective, examples of cytochrome c oxidase inhibitors!).
64
Laboratory N 8 Studies on Photosynthesis Using the Hill Reaction Purpose To demonstrate the capacity of chloroplasts to perform redox reactions in vitro. Introduction Plastids are organelles that occur exclusively in plant cells and some protists, such as algae and euglenoids. In eukaryotes, the photosynthetic phenomenon takes place in one type of plastid, the chloroplast, but there are other types of plastids, especially in plants: chromoplasts, which contain carotenoids; amyloplasts, proteinoplasts, and elaioplasts, which store starch, proteins, and lipids, respectively; proplastids, precursors of other plastids; etioplasts, in which development toward the formation of chloroplasts has been arrested by the absence of light; and statoliths, which are responsible for gravitropism in the roots. Besides containing the photosynthetic machinery, chloroplasts (and presumably other plastids) participate in the metabolism of nitrogen and sulfur. Plastids are similar to mitochondria in that they are semiautonomous organelles and they can be studied independently from the cells that harbor them. Protocols for the isolation of plastids aim to maintain them intact, that is, with all their membrane systems unbroken; functional, i.e., capable of performing their metabolic and genetic functions; and pure, with no traces of other cell components. A large number of experimental methods have been developed for the isolation of plastids. Other than a pH, salts, and other biochemical requirements, an important ingredient for the isolation of plastids is an osmoticum, which will keep membranes intact and avoid leakage of the organelles components. Several classes of molecules have been used with this purpose: silica sol (e.g. Ludox), silica particles coated with polyvinylpyrrolidone (Percoll), sorbitol, and sucrose, which we will use in this lab. In 1939, Robert Hill demonstrated that isolated chloroplasts were able to evolve oxygen when they were incubated in a medium containing hydrogen acceptors (that is, molecules capable of being reduced). The first hydrogen acceptors utilized were artificial, i.e., compounds that are not naturally found in plants such as ferricyanide, benzoquinone and several dyes. Basically, Hill demonstrated that, upon illumination of the chloroplasts, the electron and proton source for the production of ATP and reducing equivalents in photosynthesis is water and not carbon dioxide. The hydrogen acceptor in vivo is NADP+ (oxidized nicotinamide dinucleotide phosphate) and the product, NADPH + H+ (the reducing equivalent), is used in the reactions conducing to carbon dioxide fixation in the Calvin cycle. In brief, the Hill reaction is the reduction of natural or artificial compounds as a consequence of illumination of chloroplasts with the concomitant production of oxygen. In this laboratory we will utilize chloroplasts isolated from ground spinach leaves to demonstrate their capacity to perform redox reactions, in particular, the reduction of the dye 2,6-dichlorophenolindophenol (DCPIP). When oxidized, DCPIP is blue, but it is colorless when it is reduced, i.e., after it has accepted electrons. This color change can be followed and measured using a spectrophotometer, detecting absorbance in the red region of the spectrum, at 600 nm (A600). Besides observing the reduction of DCPIP by isolated spinach chloroplasts, we will analyze the effect on DCPIP reduction caused by the herbicide 3-(3,4-dichlorophenyl)-1,1-dimethylurea (a.k.a. Diuron or DCMU); the electron transport inhibitor dinitrophenol (DNP); and the detergent Triton-X-100, an agent that diffuses the pH gradient across the chloroplast subcompartments by disrupting the integrity of the plastid envelope and other chloroplast membranes.
65
Procedure a) Chloroplast isolation Select youngest leaves from baby spinach plants bought in a local market. Wash briefly, remove main veins and petioles and cut into 2-cm2 pieces Weigh 50 g of tissue and place in a pre-chilled blender jar. Add 100 mL of isolation buffer and 1 mL of antioxidant solution. Blend for 10 sec and filter slurry through 4 layers of cheesecloth into centrifuge tubes. Centrifuge for 90 seconds at 0C at 1600 rpm in benchtop centrifuge.
Supernatant Pour into two clean centrifuge tubes Centrifuge for 10 min at 0C at 6,000.
Pellet Discard
Supernatant Discard
Pellet Carefully resuspend in 3 mL of cold isolation buffer by sucking into pipettes
Pool pellets and keep on ice until use b) Spectrophotometer use Please take some time to familiarize yourself with the use of the spectrophotometer. Instructions are posted above the apparatus. Make sure to use only the VIS (tungsten) lamp, not the UV (deuterium) lamp, which should be turned off. c) Chlorophyll determination19 Take 10 L of chloroplast suspension and add to 2 mL acetone (1:200 dilution). Shake mix gently and briefly spin at 10,000 rpm in microcentrifuge. Decant and read A652 using acetone as a blank. Use glass spectrophotometer cuvettes. Computations: When A652 = 0.2, there is 1 mg of chlorophyll per milliliter of chloroplast suspension, hence:
19
Notice that the acetone extraction step was performed only to measure chlorophyll in the chloroplast prep. All steps involving biological activities should be performed suspending the chloroplast prep in a buffer containing osmoticum.
66
For example, you read A652 = 0.6, therefore: 0.6 = 3 mg chl/mL. 0.2 c) Dilution of chloroplast suspension Dilute the chloroplast suspension with isolation buffer to give a final concentration of 0.1 mg chl/mL. Remember to use the equation V1C1 = V2C2 to make your dilutions. E.g., if your suspension is 3 mg chl/mL, to make 10 mL of 0.1 mg chl/mL you have: V1 = ?, V2 = 10 mL, C1 = 3 mg chl/mL, C2 = 0.1 mg chl/mL; hence: V1 = V2C2/C1 = (0.1 mg chl/mL)(10 mL)/ 3 mg chl/mL = 0.33 mL. Write down all computations on your notebook. Keep acetone pellet! It contains protein to be measured by the Bradford Method. d) Reactions d.1) General instructions i. One of the spectrophotometer cuvettes is going to be utilized to prepare your reagents blanks. The blanks are utilized to set A600 = 0 in the spectrophotometer. Please read important footnote about blanks and controls.20 Prepare all tubes by adding components in the order indicated on the table in section d.3). Chloroplast suspension should be added last, right before you are ready to read in the spectrophotometer. As soon as you add the chloroplast suspension, transfer about 4 mL to a plastic spectrophotometer cuvette and take the first reading. This will be your time zero (also referred to as t = 0). Then, take at least 9 readings, one every 15 seconds. If your readings are still changing after N 9, keep reading until change is not significant. Take spectrophotometer readings as quickly as possible. Tube number 1 should be kept in the dark by covering with aluminum foil and kept at room temperature between readings. Tubes treated with light should be kept in a beaker containing some water at room temperature to avoid heating chloroplasts. Always zero the spectrophotometer between each reaction. The first two tubes (dark and light controls) use reagent blank A, while tubes containing DCMU, DNP and Triton should be read against their own reagents blank (B, C and D, respectively).
A652 = mg chl 0.2 mL
ii.
iii.
iv.
v.

20
The difference between blank and time-zero or control tube is that, in experiments when a background factor may affect readings of the variable that is being modified, a corrective measure has to be put in place. In the Hill reaction experiment, although we are measuring the change in A600 for DCPIPred, the affecting chemicals may show a certain coloration that could affect the readings; case in hand, the DNP solution is yellow and absorbs at = 600 nm; therefore, a reagents blank containing DNP must be prepared. A control is a reaction tube with all components of a reaction mix without the molecule being investigated. In the case of enzymatic reactions, a time-zero contains all reaction components, including the enzyme, but this is inactivated before it can act upon the substrate(s), hence, there is no product formed at t = 0.
67
vi.
Always keep chloroplast suspension on ice before use, but not reaction tubes or cuvettes, as they may fog and interfere with your spectrophotometric reading.
d.2) Reagents blanks
Components Isolation buffer diH2O Chloroplast suspension (0.1 mg chl/mL) Components Isolation buffer diH2O 0.8 mM DCMU Chloroplast suspension (0.1 mg chl/mL) Components Isolation buffer diH2O 0.15 mM DNP Chloroplast suspension (0.1 mg chl/mL) Components Isolation buffer diH2O 0.2% (v/v) Triton X-100 Chloroplast suspension (0.1 mg chl/mL)
Volume (mL) 3.5 1.0 0.5 Volume (mL) 3.5 0.5 0.5 0.5 Volume (mL) 3.5 0.5 0.5 0.5 Volume (mL) 3.5 0.5 0.5 0.5
d.3) Preparation of reaction tubes (read instructions in part d.1) above before proceeding!).
Tube No. 1 2 3 4 5 Isolation buffer 3.5 3.5 3.5 3.5 3.5 ii diH2O 0.5 0.5 1 mM DCPIP 0.5 0.5 0.5 0.5 0.5
Volume (mL)
0.8 mM 0.5 mM 0.2% (v/v) Chloroplast DCMU DNP Triton suspension 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 d.1) Instructions related to tube preparation: v v v iii, vi Treatment Dark Light Light Light Light iv Reagents blank A A B C D i, v
68
Results
Present A600 readings in a table, then calculate the differences at each time with respect to time zero (A600). Do not forget to write a zero before the decimal point, as in 0.0684.
Time point
Tube 1 (dark control) Tube 2 (light control) Tube 3 DCMU Tube 4 DNP Tube 5 Triton
A600
0 1 2 3 5 6 7 8 9 10 11 12
A600
A600
A600
A600
A600
A600
A600
A600
A600
Construct a graph with A600 versus time. Plot the five sets of results on a sheet of millimetric (engineering) paper (downloadable from a large number of websites; you may want to try http://www.mathinary.com/download_millimeter_paper.jsp or a computer application to create all types of graphing paper Or, alternatively, use Excel.
69
Preparation of reagents (for 50 groups of four) Isolation buffer (0.1 M KCl, 0.4 M sucrose, 5 mM MgCl2, 25 mM KH2PO4, pH 7.4), In an appropriate container, add diH2O to approximately 25% of final volume, then add the following components of the buffer: Component KCl Sucrose MgCl2.6H2O KH2PO4 f.w. 74.56 342 203.3 136.09 100 mL 0.75 13.68 0.102 0.34 Amount (g) 250 mL 500 mL 1.87 3.73 34.2 68.4 0.254 0.508 0.85 1.7 1 L 7.46 136.8 1.07 3.4 2 L 15 273.6 2.14 6.8
Dissolve in diH2O to ~80% of final volume, and adjust pH to 7.4 using 1N KOH. Add diH2O to final volume, aliquot and autoclave. Store at 4 C. Antioxidant (0.2 M L-ascorbic acid; f.w. 176.1) Weigh 0.881 g of L-ascorbic acid and dissolve in diH2O to a final volume of 25 mL. Prepare fresh before use. 0.25 mM DCPIP (f.w. 290.1) a) Preparation of 25 mM stock Dissolve 0.145 g of 2,6-dichlorophenolindophenol (DCPIP) to al total volume of 20 mL H2O. This is a 25 mM stock (0.00725 g/mL). b) Preparation of 0.25 mM working solution Take 5 mL of 25 mM DCPIP stock and dissolve in 500 mL H2O to get a 0.25 mM solution (0.00725 g/100 mL). Distribute in ten 50-mL Falcon tubes. 0.8 mM DCMU (f.w. 233.1) a) Preparation of 80 mM stock Dissolve 0.186 g of herbicide 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU or Diuron) in 10 mL H2O. This is an 80 mM stock (0.0186 g/mL). b) Preparation of 0.8 mM working solution Take 1 mL of 80 mM DCMU stock and dissolve in 100 mL H2O to get a 0.8 mM solution (0.0186 g/100 mL). Aliquot in ten 15-mL Falcon tubes. 0.5 mM DNP (f.w. 184.1) a) Preparation of 50 mM stock Dissolve 0.184 g of 2,4-dinitrophenol (DNP) in 20 mL H2O. This is a 50 mM stock (0.0092 g/mL). b) Preparation of 0.5 mM working solution Take 1 mL of 50 mM DNP stock and dissolve in 100 mL H2O to get a 0.5 mM solution (0.0092 g/100 mL). Aliquot in ten 15-mL Falcon tubes.
70
0.2% Triton X-100 (v/v) a) Preparation of 20% (v/v) stock NB: Triton X-100 is very viscous; do not use pipettes to dispense. Instead, pour 2 mL of the detergent in a 10-mL cylinder. Add diH2O to 10 mL. Cover with Parafilm and dissolve by shakingbubbles are unavoidable! b) Preparation of 0.2% (v/v) working solution In a 100-mL cylinder, place 1 mL of 20% Triton X-100 (v/v) stock. Add diH2O to 100 mL. Cover with Parafilm and dissolve. Aliquot in ten 15-mL Falcon tubes. Bibliography Hall, D.O. and K.K. Rao. 1987. Photosynthesis, 4th ed. Arnold, London. Maier R.M., Schmitz-Linneweber C. 2004. Plastic genomes. Pp. 115-150 in: Daniell H. and Chase C. (eds.), Molecular Biology and Biotechnology of Plant Organelles. Springer, Dordrecht, The Netherlands. Newcomb, E.H. 1980. The General Cell. Pp. 1-54, in: Tolbert, N. (ed.), The Biochemistry of Plants, Vol. 1. Academic Press, Inc., New York, London.
71
QUESTIONNAIRE Lab 6. Hill Reaction in Chloroplasts Your discussion should include, but not necessarily be limited to the following questionnaire: 1. Describe the shape of all the experimental curves you obtained. Pay attention to changes in the slope, i.e., A600/t. 2. Compare the dark control versus the light control, then compare the other three experiments.
3. Are the results what you might expect from the reduction of DCPIP?
4. Are the effects of DCMU, DNP and Triton X-100 the same on the Hill reaction?
5. Which effect is more pronounced?
6. Where does DCMU affect electron transport in the thylakoid?
7. Is this reflected in your Hill reaction experiment? If yes, how?
8. How does DNP affect photosynthesis? 9. Is this reflected in your Hill reaction experiment? If yes, how?
10. How does the detergent Triton X-100 affect the photosynthetic process?
11. How is this reflected in your Hill reaction experiment?
72
Laboratory N 9 Genetic Fingerprinting Introduction The DNA sequences of human genomes are 99.9% identical among individuals. Although the DNA from different individuals is more alike than different, there are many regions of the human chromosomes that exhibit a great deal of diversity. Such variable sequences are termed polymorphic (meaning many forms) and provide the basis for the diagnosis of some inherited diseases, forensic identification, and paternity testing. In this experiment, the now ubiquitous polymerase chain reaction (PCR) will be used to amplify a small DNA region from chromosome 8, to look for an insertion of a short nucleotide sequence called Alu. This Alu sequence may appear within the tissue plasminogen activator (TPA) gene. Principle of the polymerase chain reaction PCR is used to make many copies (i.e. to clone or amplify) of specific fragments or regions of DNA (Fig. 10). Two oligonucleotides (short single-stranded DNA fragments) are used as primers for a series of synthetic reactions that are catalyzed by DNA polymerase. These primers (one forward and one reverse) are complementary to sequences found in the DNA fragments of interest that we want to amplify. The oligonucleotide primers possess two important characteristics: 1) they correspond to opposite strands of the DNA template and 2) they flank a segment of DNA that is to be amplified in the polymerase reaction. The polymerase chain reaction contains a mixture of template DNA, oligonucleotide primers, DNA polymerase, and the four DNA nucleotide triphosphates (dNTPs) in a buffer solution. The amplification reaction consists of three separate stages: First, the reaction mixture is heated at high temperature (94C) to separate the double-stranded DNA template into two complementary strands, a process known as denaturation or melting.
Fig. 11. Schematic representation of the polymerase chain reaction.
73
Second, the temperature is lowered (to a variable value, such as 58C) to allow the oligonucleotide primers to anneal with their corresponding sequences on the single-stranded DNA template. This annealing temperature is dependent on the nucleotide composition of both primers. Third, the temperature is raised to the optimal temperature for the synthesis of the complementary DNA strand by the DNA polymerase (usually 72C). In this third step, the polymerase will use the annealed oligonucleotide primers to synthesize single stranded DNA molecules that are complementary to the template strands and precisely the size of the DNA between the 5ends of the primers. These steps of denaturation, annealing, and DNA synthesis are repeated many times with the same reaction mixture. Because the products of one round of amplification serve as templates for the next round, each successive cycle doubles the amount of the desired DNA product. Therefore, PCR results in an exponential amplification of a specific double-stranded DNA segment whose termini are defined by the two oligonucleotide Fig. 12. Two copies of the original DNA template are primers. In practice, PCR can result in an amplification 6 produced after each PCR cycle, level of 10 after 25-30 cycles of the reaction, namely, the describing a function of the x number of copies of DNA synthesized is given by y = 2 , form y = 2x. This hypothetical where x = number of reaction cycles (cf. Fig. 11, where graph assumes an unlimited 1024 copies are present after 10 replication cycles). supply of primer pairs. Notice that the temperatures used at each step in PCR are very high compared to the 37C optimum for most enzymes purified from mammalian or bacterial sources, or around 20C, for enzymes from fungal and plant origin. High temperatures would normally denature an ordinary DNA polymerase. Thermostable DNA polymerases purified from the bacterium Thermus aquaticus and other extremophiles, are utilized in PCR. These organisms live in hydrothermal vents, such as the ones that are present in Yellowstone National Park. The temperatures of the vent waters are typically 95 to 100C (boiling water) and the enzymes from these organisms exhibit unusual thermotolerance. The DNA sequence we want to amplify is the Alu insertion in the TPA gene. The Alu family of repeated DNA sequences is found throughout the genomes of primates. Alu elements are approximately 300-bp in length and their name derives from their bearing a single recognition site for the endonuclease Alu I located near the middle of this 300-bp sequence. Over the past 65 million years, the Alu sequence has been amplified in humans to about 500,000 copies, comprising an estimated 5% of our genome. Perhaps 500-2,000 of these Alu insertions are only found in Homo sapiens. Some insertions are so recent (approximately 1-2 million years ago) that they are not fixed in human populations. Batzer et al. (1990)21 described a specific insertion of an Alu element within the tissue plasminogen activator gene. This Alu element, called TPA-25, is dimorphic meaning that it is present in some individuals but not others. The insertion of Alu occurs within an intron
21
Batzer MA, Kilroy GE, Richard PE, Shaikh TH, Desselle TD, Hoppens CL, Deininger PL (1990) Structure and variability of recently inserted Alu family members. Nucleic Acids Res 18:6793. Corrected in: Nucleic Acids Res 18:699 (1991).
74
(a region of the gene whose transcribed RNA is eliminated before translation); this way, the presence of the Alu sequence does not affect the production of a complete TPA protein. Batzers group used the olymerase chain reaction (PCR) to screen individuals for the presence of the TPA-25 insertion. Primers were designed to flank the insertion site and allow the amplification of a 400-bp fragment when TPA-25 is present. In the absence of TPA-25, the fragment is only 100-bp long. There are three possible genotypes: homozygotes for the presence of TPA-25 (+/+), producing the 400-bp fragment only; homozygotes for the absence of TPA-25 (/), producing the 100-bp fragment only; and heterozygotes, producing both 400-bp and 100-bp fragments (+/). Individuals from each genotype would produce either a single band of 400 (+/+) or 100 nucleotides (/) in length, or two bands (+/). Therefore, PCR products from homozygous and heterozygous individuals can be distinguished by amplifying the region of the TPA intron of interest followed by sizing in agarose gel electrophoresis. Template DNA, from your two copies of chromosome 8, will be obtained by saline mouthwash, a painless, bloodless and noninvasive procedure. The cells are collected by centrifugation and resuspended in a solution containing the matrix Chelex, which binds metal ions that inhibit the PCR reaction. The cells are lyzed by boiling and centrifuged to remove cell debris. A sample of the supernatant containing chromosomal DNA is mixed with Taq DNA polymerase, oligonucleotide primers, the four deoxyribonucleotide phosphates (dNTPs), and the cofactor Mg2+ (as MgCl2). Temperature cycling is used to denature the target DNA, anneal the primers, and extend a complementary DNA strand. As explained above, the size of the amplification products depends on the presence or absence of the Alu insertion at the TPA-25 locus on each copy of chromosome 8. In order to compare the genotypes from a number of individuals, aliquots of the amplified sample and those of fellow students are loaded into wells of an agarose gel. Following electrophoresis and staining, amplification products appear as distinct bands in the gel - the distance moved from the well is inversely proportional to the presence or absence of the TPA-25 insertion. Size is determined by comparison with standards run in the same gel. One or two bands are visible in each lane, indicating that an individual is either homozygous or heterozygous for the Alu insertion.
75
Experimental procedure22 A) Collection and amplification of your DNA Isolation of Cheek Cell DNA for PCR Amplification Obtain a 15 mL conical culture tube containing 12 mL of 0.9% (w/v) NaCl solution. Pour all of the saline solution into your mouth and vigorously swish for 10 seconds; additional gently scraping with a sterile stick could be done as instructed. Do not discard the empty tube that contained the saline solution. Expel the sample solution back into the 50 mL sterile tube and close cap tightly. o Spin sample in the J-6B centrifuge at 2,000 rpm for 10 min at 4 C. Carefully, slowly pour off supernatant (liquid on top) into the sink and place the tube containing your cells (pellet) on ice. Use the 1000L micropipettor to transfer 500 L Chelex solution to the tube containing your cell pellet in the following way: Set the micropipettor to 500 L and pipet the Chelex solution in and out of the pipet tip several times to suspend the Chelex beads. Before the Chelex has a chance to settle, add the 500 L to the centrifuge tube containing your cell pellet. Mix cells and Chelex by pipeting up and down several times until no visible cell clumps cells remain. Do not discard pipette tip. Using the same pipette tip, transfer 500 L of your resuspended sample into a clean 1.5mL tube. Be sure to use a Sharpie to label the cap of the tube with your initials. Place your tube in a boiling water bath for 10 min. Carefully remove your tube from the boiling water bath and place on ice for 1 min. Place your tube in a microcentrifuge (opposite someone else's tube or a tube with the same volume of water) and centrifuge for 30 seconds. If the number of tubes is not even, place a balance tube containing 500 L of Chelex beads suspension. Use a fresh pipette tip to transfer 200 L of supernatant (the clear solution on top) to another clean 1.5-mL tube. Using a Sharpie, label with your name. Be careful not to transfer any Chelex or debris from the bottom pellet in the tube. Place the tube on ice. Mark the lid of a 0.5-mL microcentrifuge tube with your initials.
Amplification of Alu sequences by PCR Your instructor will explain and demonstrate the following steps. Add the following components to 0.5-mL microcentrifuge tube: 5 L cheek cell DNA preparation 45 L PCR reaction mixture (provided by instructor) which includes the oligonucleotide primers, Taq polymerase, dNTPs, buffer and the cofactor MgCl2 Mix the components gently and start the thermocycler program. The amplification protocol will be as follows: 30 cycles of 94 C for 1 min o 58 C for 2 min o 72 C for 2 min
o

22
Adapted from Cold Spring Harbor Laboratory (1994) Detection of Alu by PCR: A Human DNA Fingerprinting Lab Protocol, as posted in Access Excellence: http://www.accessexcellence.org/AE/AEPC/DNA/detection.php, The National Health Museum, accessed March 13, 2008.
76
B) Interpreting your DNA B.1) Determining your TPA-25 genotype Your amplified DNA will be subjected to gel electrophoresis. Oligonucleotide primers, flanking the insertion site, were selected to amplify a 400-bp fragment when TPA-25 is present (known as the + allele) and a 100-bp fragment when it is absent (the allele). Each of the three possible genotypes, namely homozygotes (+/+) for the presence of TPA-25 (400-bp fragment only), homozygotes (/) for absence of TPA-25 (100-bp fragment only), and heterozygotes (+/) (both 400-bp and 100-bp fragments) can be distinguished following electrophoresis in agarose gels. You will receive a melted agarose suspension in a flask. Follow the instructors directions for pouring the gel into the communal electrophoresis apparatus. Take care to eliminate bubbles as you pour. Mix 18 L of PCR sample with 2 L of sample-loading buffer. Follow the instructors instructions for loading the sample into the well of the gel. Load molecular weight standards (100-bp ladder) as indicated by your instructor (depending on the brand and concentration, 5 or 10 L). At the end of the electrophoretic run, observe the stained gel containing your sample under UV light and compare it to those from others. First, ascertain whether or not you can see a diffuse (fuzzy) band of primer-dimers that appears at the same position in each lane toward the bottom of the gel. Primer dimers are not amplified human DNA, but is an artifact of the PCR reaction that results from the primers amplifying themselves. Draw a picture illustrating the gel results, but make sure to scan it or photograph it. Excluding the primer-dimers band (if present), interpret the allele bands in each lane of the gel: No bands visible. This usually results from an error during sample preparation, such as losing the cell pellet or using a too-acidic Chelex solution. One visible band. Establish whether it corresponds to the 400 bp or 100 bp PCR product. Remember, the 400 bp band migrates slower than the 100 bp band and is therefore located closer to the sample wells. If only the 400 bp band is present, then that individual is homozygous for the TPA-25 Alu insertion (+/+). If only the 100 bp band is present, then that individual is homozygous for the absence of the TPA-25 Alu insertion (/). Two visible bands. This individual is heterozygous for the TPA-25 Alu insertion (+/). Three or more bands visible. The one or two bright bands are likely the true alleles. Additional bands may occur when the primers bind nonspecifically to chromosomal loci other than TPA-25 and give rise to additional amplification products. Please notice that some of the questions below are also contained in the report, so work diligently here and working on your report will be much easier. Determine the genotypes of the student samples in your class. How many homozygous for the presence of the TPA-25 Alu insertion (+/+) or its absence (/) and heterozygous (+/)?
77
B.2) Interpreting your DNA: Population Genetics If an allele benefits an organism carrying it, its frequency may increase in the population over time. For example, in rabbits, an allele that results in a camouflage fur color becomes more common than an alternative conspicuous color allele. This is because more of the camouflage-colored rabbits survive long enough to have offspring who will then inherit the allele and pass it on. The other allele decreases as those rabbits with the non-camouflage color are killed by predators before they pass along the allele. Not every beneficial allele increases rapidly over time. In humans the 32 allele gives protection against HIV. However this allele is not noticeably increasing in frequency. This may be because the allele is so rare in populations with high HIV rates. In fact 32 is most common in Scandinavia and Scotland, where is found in about 10 % of the population. These are places where this allele once protected those people against the Bubonic Plague in the 1300s! Its just a coincidence that the same protection works against HIV, but very few carriers of 32 are exposed to HIV. The benefits or costs of having an allele can be studied by using population genetics. An allelic frequency is a ratio that compares the number of copies of a particular allele to the total number of alleles present in the population. If a population is genetically stable, the allelic frequencies will remain constant from one generation to the next. Such a population is said to be in Hardy-Weinberg equilibrium. Because humans are diploid, the total number of alleles present in your class equals the total number of students times two. Determine this number for your class. Your instructor will record the genotype for each group on the board and the number of students in each group. Assume that every member of each group has the same genotype. Record this information for your class population. For example, for a class of 20 students, their genotype distribution was as follows: Group 1: 5 students with (+/+) genotype (homozygous for the + allele) Groups 2 and 4: 11 students (+/) genotype (heterozygous) Group 3: 4 students = (/) genotype (homozygous for the allele) Determine the total number of + alleles by counting the number of students who are homozygous for the allele and multiplying by 2, and counting the heterozygous students once, since they carry only one copy of the + allele. Number of + alleles in the example above: ________ Number of + alleles in your class:_______ The allelic frequency is the ratio of the number of a particular allele to the total number of alleles in the population. Determine the allelic frequency for the + allele. For the example above: _________ For your class: _________ What is the allelic frequency for the allele? For the example above: _________ For your class: _________
Because your class population is so small it doesn't reveal much about how common the TPA-25 Alu insertion is and whether it is decreasing or increasing. However this type of analysis is used to track changes in the frequency of more important alleles such as 32 or other alleles that might affect human populations over time.
78
B.3) Interpreting your DNA: Practical applications Forensics The allele we are examining occurs too frequently to be used in DNA fingerprinting. However, if the () TPA-25 Alu allele only occurred in one out of 1,000 people, and if we also uncovered another genotype which occurs once in 1,000 people, then those 2 alleles would only be expected to occur together once in 103 X 103, i.e. once in 1 million people (or a frequency of 1/106 or 10-6). If they were found together in DNA collected at a crime scene, and if the suspect also had that rare combination of alleles, this might be used in a trial to prove guilt. However the defense could argue that it was just a coincidence (as in highly publicized trials in recent years), because in a country with 300 million people, you would expect about 300 people to have that combination. So the DNA at the crime scene might belong to any one of those 300 people. a) What is the practical problem with this argument? How convincing is DNA fingerprinting at proving guilt? b) On the other hand, if the suspect does not have the allele combination present at the crime scene, can anything be concluded about the suspect?
79
QUESTIONNAIRE Lab 9. Genetic Fingerprinting Part 1. Determining the TPA-25 genotypes of students in your section 1. Paste a scan of your gel as obtained by your section. Include only the gel region(s) containing the MW markers (100-bp ladder) and the amplicon bands.
2. Excluding the primer-dimers band (if present), interpret the allele bands in each lane of the gel and determine the genotypes of the student samples in your class. How many homozygous for the presence of the TPA-25 Alu insertion (+/+) [_____] or its absence (/) [______] and heterozygous (+/) [______]? 3. Because humans are diploid, the total number of alleles present in your class equals the total number of students times two. Determine this number for your class. TPA-25 allele present (+) = N (+/+) + N (+/)/2 = ______ TPA-25 allele absent () = N (/) + N (+/)/2 = ______ Total ______ 4. The allelic frequency is the ratio of the number of a particular allele to the total number of alleles in the population. Determine the allelic frequency for the + allele for your class. 5. Determine the allelic frequency for the allele for your class. 6. Assume that the TPA-25 Alu insertion is in Hardy-Weinberg (H-W) equilibrium. Use the W-H model to determine the allelic frequency of the alleles + and in your class (you already did something similar in Lab 1. Bioinformatics). 7. Do your results for p and q coincide with your answers in the previous questions? Yes No If they do not, what could be the reason(s)?
80
Part 2. Forensic applications 1. How convincing is DNA fingerprinting at proving guilt if used as forensic evidence? If you consult any bibliographic source, do not forget to cite it.
2. If a suspect in a crime does not have the allele combination found in evidence collected at a crime scene, can anything be concluded about the suspect? Read again part B.3 (above) if necessary.
3. The mouth of a bottle found at the scene of a crime has a sufficient number of epithelial cells from which enough nucleic acids can be extracted and analyzed by PCR. Shown below are the results of genotyping for three probes (loci 1, 2 and 3) of the evidence (X) and cells from five suspects (A-E).
Although this is only a piece of evidence, which suspect cannot be excluded as a perpetrator? ___. Explain.
1. A woman is uncertain which of two men is the father of her child. DNA typing is carried out on blood from the child (C), the mother (M) and on the two males (A and B). Primers were used as probes for a highly polymorphic DNA marker on two different chromosomes (loci 1 and 2). Diagrams of the agarose gels in which genomic DNA digestion products were run are shown on the right. Based on these results, who might possibly be the father (A or B)? __. Explain.
81
Laboratory N 10 Molecular Biology of Sickle-Cell Anemia Purpose: To separate, by electrophoresis in agarose gels, two allelic forms of hemoglobin: the normal molecule, HbA, and the form found in people with sickle-cell anemia, HbS. Introduction In previous laboratories we have used electrophoresis to separate protein mixtures (PAGESDS) or DNA samples (agarose gels). In this exercise will use agarose gels to separate two allelic forms of the red-blood-cell protein hemoglobin, responsible for oxygen exchange in higher animals. In the adult human, hemoglobin is a tetramer composed by two each of two different types of polypeptides, and , hence Hb = 2 + 2. The most common form (normal) is hemoglobin A (HbA). The change of a single nucleotide in the gene for the subunit causes the substitution of an amino acid residue: Glutamic acid, at position 6 of the chain in HbA, has a negatively charged lateral group (R = -(CH2)2-COO-). A point-mutation in the hemoglobin gene in which the middle adenine in the codon for glutamic acid (GAA) is substituted by uracil (resulting in GUA), causes it to change to valine, which has a nonpolar lateral group (R = -CH-(CH3)2). This mutated form can be notated23 as HbS: 6 Glu Val, or simply HbS (S for sickle). The allelic form HbS is found in people with sickle-cell disease and sickle-cell trait. When an individual has two copies of the HbS (meaning, s/he has received mutated genes from both parents), all hemoglobin tetramers contain mutated subunits and the shape of the entire hemoglobin molecule is altered. As a consequence, erythrocytes become sickleshaped (Figure 12), a structure that makes the cells fragile and causing them to break more easily when going through capillaries, causing sickle-cell disease, also known as falciform anemia.
Fig. 13. Erythrocytes containing (A) hemoglobin A, with non-mutated chain, and (S) hemoglobin S. [Adapted from Encyclopdia Brittanica Online.]
If only one allele of the mutated gene is present (i.e., the person is heterozygote for the character), both HbS and HbA will be produced, with a predominance of HbA. This condition is called sickle-cell trait, and it does not produce occlusion of blood vessels. In contrast with sickle-cell disease, sickle-cell trait does not adversely affect the individual's life expectancy.

23
This mutation can also be written as E6V (cf. Lab 1. Bioinformatics)
82
Procedure Gel preparation Follow instructions in the Solutions needed section. Notice that we will be using Trisglycine buffer without the denaturing agent SDS, since we are working with proteins, in native conditions, in an agarose gel matrix. Preparation of femoglobin samples While agarose gel solidifies, prepare the samples in small Eppendorf tubes as follows: Simulated blood samples Normal individual Sickle-cell trait Sickle-cell anemia Gel run

10 mg/mL Hemoglobin A 8 L 8 L
10 mg/mL Hemoglobin S 8 L 8 L
Water 8 L 8 L
Loading buffer 4 L 4 L 4 L
Fill electrophoresis rig with Tris-glycine buffer, pH 9.4 as indicated by the instructor. After the gel is completely set, carefully remove the comb and mount the gel in the electrophoresis tank. Add buffer just enough to cover the gel. Load the samples in the order indicated in the table above. Use a pipettor and be careful not to break the agarose at the bottom of the wells. Make sure to change tips between loadings. Carefully, plug the electrophoresis box to the power supply. Run the electrophoresis at 80 V (constant voltage) for 60 min or until the fastest-running hemoglobin band reaches 3/4 of the gel length. Wearing gloves, take the gel out of the electrophoresis chamber. Since the hemoglobin possesses a red heme group, there is no need to stain the gel. Notice the protein bands pattern and measure the distance (in mm) that they have migrated from the origin (i.e., the well in the gel). If possible, take a picture using a white light box (at first try an f/32 aperture and a shutter speed of 1/125 s or use your cell phone)
83
Equipment required Minigel apparatus (includes combs, casting tray, and cover) Power supply Micropipettors and tips Digital camera and a light-table or flatbed scanner. Preparation of solutions 25 mM Tris-100 mM Glycine, pH 9.4 3 g Tris base 7.2 g Glycine Dissolve in 900 mL distilled water and adjust pH to 9.4 with 10 N NaOH. Adjust volume to 1 L with distilled water. Agarose gel
Weigh 1 g of powdered agarose and add to 100 mL of Tris-glycine buffer, pH 9.4, contained in a flask suitable for boiling. Swirl to mix and microwave at high power for 3 min (or until mix starts boiling). Lower the microwave oven power to 2 or 3 and let simmer until agarose is completely dissolved (by visual inspection). If necessary, add sterile deionized water to compensate for lost volume. Cool the solution to about 60C, pour in gel cast and place an appropriate comb. Make sure that there is at least 1 mm of agarose between the bottom of the comb's teeth and the base of the gel. Let solidify at room temperature.
10 mg/mL Hemoglobin A 5 mg Hemoglobin A (Sigma H0267) Resuspend in 0.5 mL distilled water 10 mg/mL Hemoglobin S 5 mg Hemoglobin A (Sigma H0392) Resuspend in 0.5 mL distilled water Loading buffer 3 mL Glycerol 7 mL distilled water Dispense in ten 1-mL aliquots and keep frozen at -20C until use. Bibliography Fox M, Gaynor JJ (1996) A demonstration of the molecular basis of sickle-cell anemia. J Coll Sci Teach 26:147-149. Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Pp. 5.4-5.13.
84
QUESTIONNAIRE Lab 10. Molecular Biology of Sickle Cell Anemia 1. Compare the picture of your gel with the expected migration as per the actual picture of a gel on the left (from a section in the Summer 2009 Bio202 lab): Your picture (or scan):
HbS HbA

2. Consult a biochemistry textbook or handbook: What is the molecular weight of hemoglobin A and S (in kilodaltons, kDa)? 3. Does the change GluVal (E6V) explain the unequal migration of HbA and HbS in your gel? 4. Enter the accession numbers for the chain in hemoglobin alleles HbA (DQ026227) and HbS (AY136510) in the nucleotide database at the NCBI website (http://www.ncbi.nlm.nih.gov/). Use the drop-down menu to use the Nucleotide database. 5. Can you spot the difference(s) in the nucleic acid sequences for these alleles? Yes No If not, try a comparison between these two sequences at http://blast.ncbi.nlm.nih.gov/ 6. To learn more about hemoglobin-related disorders, check the entry for information about the -hemoglobins gene at http://www.ncbi.nlm.nih.gov/gene/3043. What other diseases are associated with estraneous forms of hemoglobin subunits
85
(other than HbS) in the human adult?
7. How do we call the type of point mutation in which an AU change occurs in the codon for the sixth amino acid in hemoglobin chain ? Inversion Transversion Transition Transamination 8. What does the term heterozygous advantage mean?
9. What is the heterozygous advantage of people having sickle-cell trait in areas where malaria is a major cause of death?
86
Purpose To study the effects of the phytohormone gibberellic acid on the synthesis and release of -amylase and the inhibitory effects of abscisic acid during the germination of cereal seeds. Introduction The cereal seed is a good model for studies of the effects of hormones on germination. In cereals, the embryo is located on one side of the caryopse, which makes it easy to excise. Other components of the seed are the starchy endosperm and the aleurone, a layer of cells that contains storage proteins. During germination (see diagram below), gibberellins (GAs) are produced in the embryo and are transported to the aleurone cells. Once there, they start signal transduction pathways that turn on genes coding for the hydrolytic enzymes required for the degradation of starch in the endosperm and proteins in the aleurone itself. Abscisic acid (ABA) has an important role in germination too, partly because seed dormancy is controlled by the ratio ABA/GA more so than the absolute concentrations of these phytohormones. ABA is a natural constraint that keeps developing embryos in their embryogenic state, but it also participates in other embryogenic processes; for example, it induces the synthesis of proteins that may have a role during periods of stress. In contrast, during germination, ABA inhibits the GA-dependent synthesis of hydrolytic enzymes, including -amylase, by suppressing the transcription of its mRNA. Since the embryo is the source of both GA and ABA, detaching it from the rest of the seed allow us to add hormones to these embryoless seeds (which we will call half-seeds). In this way, the effects of these hormones could be distinguished from each other. During germination of the barley seed, five events can be defined (cf. Figure 14):
(1) The embryo produces and releases GA. (2) GA migrates to the aleurone layer. (3) GA induces the biosynthesis of hydrolytic enzymes. (4) Hydrolytic enzymes are secreted from the aleurone layer into the endosperm. (5) Starch is hydrolyzed to simple sugars.
Laboratory N 11 Signal Transduction: Antagonistic effects of Gibberellin and Abscisic Acid on the Production of -Amylase in Barley Seeds
In this laboratory, we are going to study the GA-induced production of -amylases (EC 3.2.1.1) in the aleurone of barley (Hordeum vulgare cv. Himalaya), a layer of two to four tiers of cells located below the testa/pericarp layers of the seed/achene. This enzyme is responsible for the degradation of amylose, a component of the Fig. 14. GA-induced mobilization of starch starch in the endosperm, to maltose, a and other reserves in the cereal aleurone. disaccharide that is more readily mobilized into the embryo cells to serve as an energy source and larger oligosaccharides as well. The effect of adding ABA in conjunction with GA will also be studied. Specifically, we will vary the amounts of gibberellic acid and corroborate the hypothesis that the production of -amylase is a function of the gibberellic acid concentration in the medium. In 1967, Jones and Varner showed that the release of amylase, induced by GA, is proportional to the logarithm of the concentration of GA applied to barley half-seeds. By interpolation, one may be able to determine the amount of GA present in unknown samples, plant-derived or otherwise.
87
Procedure Part 1. Preparation and imbibition of half-seeds

Date:
Time:
25
Obtain 175 grains of huskless barley26 (Hordeum vulgare cv. Himalaya; _____ harvest). Using a razor blade and a cutting board, cut them transversely, eliminating only the portion carrying the embryo. From this point on, work under a flame to preserve sterility
Place the half-seeds in a 100-mL sterile beaker containing 50 mL of a 10% (v/v) solution of commercial bleach. Stir with a magnetic bar for 20 min. Pour off bleach solution (be careful not to spill it on your clothes!) and quickly add 50 mL (or more) of sterile diH2O. Stir and let sit for about 5 min. Pour off water and wash at least twice more as described. Be careful not to throw the half-seeds away with the water. Transfer surface-sterilized seeds onto one layer of sterile filter paper inside a 10-cm Petri dish moistened with 5 mL of sterile diH2O. Notes: Do not place more than 50 seeds per plate and do not exceed water volume. Work with great care: bacterial or fungal contamination will affect and invalidate your results, since some microorganisms produce GA.
Cover petri dishes with aluminum foil and incubate room temperature for 3 to 4 days to allow imbibition. Clean sterile hood after you have finished your work. Date: Time:
Part 2. Induction of -amylase
The table below indicates the final concentrations of hormones that are going to be used in the different treatments of barley half-seeds and if the experiment will include calcium (required for -amylase activity; Bush et al., 1989) or not. Please analyze it.
Flask N 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 CaCl2 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM 5 mM GA3 5 M 0.05 M 0.1 M 0.5 M 1 M 5 M 0.05 M 0.1 M 0.5 M 1 M 5 M ? ABA 50 M 50 M 50 M 50 M 50 M 50 M Unknown ?

25 26
Using the date format ddMthYY (as in 27Nov98) and the 24-h (e.g., 1900 = 7 p.m.), allows international collaborators (be it researchers or students) to communicate more efficiently. If no barley seeds are available, wheat can be used. The aleurone cells in wheat seeds are arranged in a monolayer.
88
Work in sterile conditions. In the sterile Erlenmeyer flasks provided, add the following solutions in the amounts indicated in the table: All volumes in mL
Flask N 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 diH2O 2.0 1.9 1.8 1.0 1.8 1.7 0.9 1.7 0.9 1.7 1.6 0.8 1.6 0.8 1.8 0.1 M CaCl2 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 1 M GA3 0.1 0.2 1.0 0.1 0.2 1.0 10 M GA3 1.0 0.2 1.0 0.2 1.0 1 mM ABA 0.1 0.1 0.1 0.1 0.1 0.1 Unknown sample 0.1
Transfer 10 sterile half-seeds under sterile conditions to each one of the flasks and incubate for 48 h at room temperature with continuous shaking at 40-60 cycles/min. Start: Stop: Part 3. Preparation of incubation medium for -amylase activity Date: .
Measure volume of incubation medium and transfer to clean centrifuge tubes or 100 X 7.5 mm test tubes. Rinse flasks and seeds with some sterile diH2O to make a total volume equal to 4 mL in each tube. (Be careful not to exceed volume.)
Part 4. Determination of -amylase activity Assay principle We are going to measure the enzymatic activity of -amylase by following the disappearance of its substrate, amylose. In the presence of potassium iodide, amylose forms a blue-purple complex with iodine. The higher the activity of -amylase, the smaller the amount of amylose-iodine complex in the reaction tube. The intensity of the bluepurple complex can be determined spectrophotometrically by changes in absorbance at 625 nm (A625). Changes in A625 are proportional to the quantity of -amylase present in the reaction mixture. Performing the assay 4.1) Reagents blank Make sure starch substrate is at room temperature (it should have been stored at 4C). Set apart five test tubes. Proceed, for each tube, as indicated in the leftmost column. Start with "Trial number 1," using 3 mL diH2O.
89
If A625 0.7, repeat with the volume indicated for "Trial number 2." Vary the volumen until you get A625 ~ 0.7.
1 4 mL Trial number 2 3 4 5 mL 6 mL 7 mL 5 8 mL
1. Place 1 mL starch in a test tube 2. Add 1 mL IKI solution 3. Add diH2O 4. Read A625 in spectrophotometer

Notice volume of water added to get A625 ~ 0.7:_____ mL. Measure room temperature: ______ C.
4.2) Assay of sample with the highest activity Assay first the sample suspected to have the highest activity, namely the medium coming from the flask with the highest GA concentration and no ABA. Try several sample volumes and/or incubation times. Start with sample volumes of 20 L and short times (e.g. 30 sec) and modify as necessary. For example, using 20-L aliquots, increase time; or maintain time constant but use 40 L of sample, then 60 L, etc. The idea is to obtain a value of A625 ~ 0.3 for the sample with the highest activity.
1. Place 1 mL starch in a test tube 2. Add sample (10-200 L). Write down vol. used: 3. Incubate at room temperature (30 sec-15 min). Time: 4. Add 1 mL IKI solution 5. Add diH2O (vol. determined in step 4.1) 6. Read A625
1 L min mL
Trial number 2 3 4 L L L min min min mL mL mL
5 L min mL
Write down sample volume used: _____ L assay time: _____ min; and diH2O volume:______ mL.
4.3) Assay of samples Using the sample volume and the assay time determined in 4.2), as well as the water volume determined in 4.1), proceed to assay all samples, including a new reagents blank. Take in account that, if your assay times are very short (say, less than one minute) you have to work on one tube at a time. But remember, everything has to be constant, except the source of your sample. Prepare your samples and write down your data in the table on the next page.
90
Flask Blank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Starch substrate 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL
-Amylase activity determination Sample Incubation IKI volume time reagent diH2O min 1 mL mL min 1 mL mL L min 1 mL mL L L L L L L L L L L L L L L min min min min min min min min min min min min min 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL 1 mL mL mL mL mL mL mL mL mL mL mL mL mL mL
A625
4.4) Determination of -amylase units Jones and Varner (1967) proposed the following equation to calculate units of -amylase:
A625 X TV UA = tXv
Where: A625 = A625 water blank - A625 sample Tv = volume of supernatant (mL) t = time of incubation with starch (min) v = volume of supernatant tested (mL); remember that 1 L = 0.001 mL
Calculate your -amylase units with a programmable calculator, an Excel spreadsheet or using this table:
Calculation of UA
1 A625 water blank 2 A625 sample 3 =12 A625 4 = 3 X Tv A625 X Tv 5 v (mL) 6 = 5 X t t X v 7 = 4/6
UA = A625 X TV
Flask N
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
tXv
91
Bibliography Bush, D.S., L. Stich, R. Van Huystee, D. Wagner, and R.L. Jones. 1989. The calcium requirement for stability and enzymatic activity of two isoforms of barley aleurone -amylase. J. Biol. Chem. 264:19392-19398 Bush, D.S. 1994. Plant Physiology Laboratory Manual. Department of Biological Sciences; Rutgers, The State University of New Jersey; Campus at Newark. Firn, R.D. and H. Kende. 1974. Some effects of applied gibberellic acid on the synthesis and degradation of lipids in isolated barley aleurone layers. Plant Physiol. 54:911-915. Jones, R.L., and J.E. Varner. 1967. The bioassay of gibberellins. Planta 72:155-161. Taiz, L., and E. Zeiger. 2002. Plant Physiology, 3rd edn., Sinauer Assoc., Sunderland, MA. Xu, D., X. Duan, B. Wang, B. Hong, T.H.D. Ho, and R. Wu. 1996. Expression of a late embryogenesis abundant (LEA) protein gene, HvA1, from barley confers tolerance to drought and salinity in transgenic rice. Plant Physiol. 110:249- 257. Zhang, L., A. Ohta, M. Takagi, and R. Imai. 2000. Expression of plant group 2 and group 3 lea genes in Saccharomyces cerevisiae revealed functional divergence among LEA proteins. J. Biochem. 127:611-616. Preparation of reagents 100 mM CaCl2 stock Dissolve 1.47 g of CaCl2.2H2O (f.w. 147) in diH2O to a final volume of 100 mL. 5 mM GA3 stock Dissolve 19.2 mg of gibberellic acid, potassium salt (GA3; f.w. 384.5) in 10 mL of 95% (v/v) ethanol. 10 M GA3 Dissolve 20 L of 5 mM GA3 stock in 10 mL diH2O. 1 M GA3 1 mL of 10 M GA3 Q.s. ad 10 mL with diH2O 10 mM ABA stock Dissolve 26.4 mg abscisic acid (f.w. 264.3) in 10 mL 95% (v/v) ethanol. 1 mM ABA 1 mL of 10 mM Q.s. ad 10 mL with diH2O 0.05 N HCl 2 mL HCl (conc., 37%, f.w. 36.46, = 1.19 g/mL)
92
Q.s. ad 500 mL with diH2O Iodine stock Dissolve 6 g KI and 600 mg I2 in diH2O to a final volume of 100 mL. IKI solution 1 mL Iodine stock 99 mL 0.05 N HCl 50 mM MES buffer stock, pH 5.6/20 mM Ca2+ (1 L) Dissolve 10.7 g of 2-(N-morpholino)ethanesulfonic acid (monohydrate, f.w. 213.26) in about 700 mL of diH2O. Add 200 mL of 0.1 M CaCl2 stock and adjust pH to 5.6 with 1N NaOH. Q.s. ad 1 L with diH2O.
93
Starch substrate Dissolve 1.5 g of insoluble potato starch (e.g. Sigma S-4251) in 1 L of 50 mM MES buffer, pH 5.6/20 mM Ca2+ Boil for exactly 1 min Centrifuge at 4C for 10 min at 10,000 rpm
Pellet Discard
Supernatant Decant onto a fresh container and keep refrigerated
Let warm up to room temperature before use
94
QUESTIONNAIRE Lab 11. Signal Transduction Part 1. Presentation of Results 1. Using Excel, construct a bar graph of UA versus treatments (this is graph GA-1). Hints: What is a histogram? Why we cannot graph all data points as a single function? 2. Make a separate, semilog graph of UA from flasks 5 to 9 (UA in the ordinate vs. log [GA] in the abscissa, namely: 0.05, 0.1, 0.5, 1, and 5 g/mL). This is graph GA-2. Note: Do not label the X-axis as "5, 6, ..., 9." Instead, indicate GA concentrations. 3. In another semilog graph, repeat the trace of graph GA-2 but add the data from flasks 10 to 14. Carefully indicate the GA concentrations on the X-axis and the legend "[GA] + 50 M ABA." Remember that the X-axis should be logarithmic. This is graph GA+ABA. Note: Do not label the X-axis as "10, 11, ..., 14." Instead, indicate GA concentrations. 4. Flask number 15 contains an unknown sample, which contains some GA3. The idea is to estimate the concentration of GA3 in this sample by comparison with the amylase activities in the known samples. Interpolate the UA value from flask 15 in graph GA-2 and estimate the concentration of your unknown sample. Another way to do this is by determining the equation of your curve (using a spreadsheet program) and substituting the value of UA in it. This system is used as a bioassay for GA activity in extracts of plant materials or for synthetic gibberellins. Part 2. Discussion guide 1. What is the purpose of working with embryoless seeds?
2. Was there any difference between A625 for the reagents blank versus that of flask 1, the control with no additions, i.e., where half-seeds were incubated only with water? Yes No Explain. 3. Was there any difference in UA values for flasks 2 (no GA3) and 3 (added with ABA)? Yes No Explain.
4. Flask 4 has 5 M GA, but no Ca2+. How does its -amylase activity compare with that of flasks 9 (same [GA] + 5 mM CaCl2) and 14 (same as flask 9 plus 50 M ABA)?
95
5. From your graph GA-1, how is the production of -amylase related to GA concentration (directly proportional; geometric proportion, no correlation)?
6. Is that what you expected? Yes No Why? 7. From your graph GA-2, what is the concentration of GA3 in your unknown sample? _____ AU [GA3] = _____ 8. From your graph GA+ABA, what was the effect of ABA on -amylase activity? Is that what you expected? Why? Was it equally effective at all concentrations of GA?
Appendix 1
DEPARTMENT OF BIOLOGICAL SCIENCES
The section Procedures for Emergency Medical Care at the Newark Campus in the lab manual is based on directives and advice from the Rutgers Newark Health Center. You should become familiar with these procedures and follow them in case of a lab accident or other medical emergency. The following instructions are to amplify the use of these procedures in the Foundations of Biology Laboratory:
Biology staff will not attempt any first aid other than to make cold packs for burns of wash off chemical spills with plain water. More than this might make them legally liable in the event of complications from such accidents and the University has not agreed to assume liability for first aid given by its non-medical staff. If the accident is relatively trivial, the student will be instructed to visit the Student Health Service and immediately be dismissed from lob. If the student needs to be transported or accompanied this will be done by the Campus Police (whose job it is), not by Biology staff because of the risk of liability. In the event of more serious injury Campus Police will be immediately contacted for assistance. A campus phone is provided in the laboratory for this purpose. For any incident receiving professional medical attention, the instructor must notify the Biology Department Office at extension 5347. If the student does not return by the end of the lab period, the instructor will put the students equipment away, close the locker securely and place any personal property in the protection of Campus Police. Many chemical compounds are toxic, flammable, explosive or corrosive. It is not possible to remove every hazardous material from student experiments, nor even desirable, since this would prevent the students from learning how to deal with routine hazards, an important part of laboratory training. We make every effort to minimize certain hazards and to make students aware of any others and give supervision. However, for a large number of compounds so little is known about toxicity and mutagenicity towards unborn children that we recommend that any woman who knows or suspects she is pregnant, or who is trying to become pregnant, postpone taking Foundations Laboratory.
Please sign below and hand-in to your instructor. I have read and understood the above, the Procedures for Emergency Medical Care at the Newark Campus, and the Laboratory Rules.
Last Name, First Name (printed)
Signature
Date
Appendix 2
BIOINFORMATICS EXERCISES
DEVELOPED BY PAUL CRAIG
Department of Chemistry Rochester Institute of Technology
functions to more conveniently perform tasks involving extensive sequences of text that would otherwise need to be typed in.
INTRODUCTION
Over the last two decades, bioinformatics has become increasingly important in both teaching and learning biochemistry. The most obvious case is the sequencing of the human genome and those of many other species. In 1990, the determination of the sequence of a protein was often the topic of a full publication in a peer-reviewed journal such as Science, Nature, or The Journal of Biological Chemistry. Now entire genomes are the topic of individual research papers. The term bioinformatics is a catch-all phrase that generally refers to the use of computers and computer science approaches to the study of biological systems. This information is discussed in the text, mainly in Chapters 3 (Nucleotides, Nucleic Acids, and Genetic Information), 5 (Proteins: Primary Structure), 6 (Proteins: Three-Dimensional Structure), 12 (Enzyme Kinetics, Inhibition, and Regulation), and 13 (Introduction to Metabolism). Here we provide exercises appropriate to these chapters in order to introduce the techniques of bioinformatics that involve the use of computers, Internet-accessible databases, and the tools that have been developed to mine those databases. As much as possible, the exercises are based on well established, stable web sites. If it is necessary to use less reliable sites and/or resources, attempts have been made to provide multiple sites that perform similar functions. The stable online resources that you will use most frequently include: Genbank (http://www.ncbi.nlm.nih.gov/) Protein Data Bank (http://www.rcsb.org) ExPASy Proteomics Server (http://us.expasy.org/) European Bioinformatics Institute (http://www.ebi.ac.uk/) SCOP (http://scop.mrc-lmb.cam.ac.uk/scop/) CATH (http://www.biochem.ucl.ac.uk/bsm/cath/) PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi) PubMed Central (http://www.pubmedcentral.nih.gov/) The exercises include some questions that have definite answers, but many questions may be answered in a number of ways, depending on the approach you take or the topic you select. In most cases, the answer key includes the definite answers. For some open-ended questions, a typical correct answer may be presented. Please note that because biological databases are continually being expanded by the addition of new entries, the results of some database queriesparticularly quantitative resultsmay appear to shift slightly over time. These exercises are available on the website (www.wiley. com/college/voet). The online format offers you easy access to resources within the web environment by simply clicking on the relevant links. You can also use your computers cut-and-paste
CHAPTER 3 DATABASES FOR THE STORAGE AND MINING OF GENOME SEQUENCES

Chapter 3 is an introduction to nucleotides, nucleic acids (DNA and RNA), and the processes of transcription and translation. The exercises below are designed to introduce you to some of the relevant databases and the tools they contain for examining and comparing different bits of information (see Sections 3-4C and 3-4D). Biological databases are an important resource for the study of biochemistry at all levels. These databases contain huge amounts of information about the sequences and structures of nucleic acids (DNA and RNA) and proteins. They also contain software tools that can be used to analyze the data. Some of the softwarecalled web applicationscan be used directly from a web browser. Other softwarecalled freestanding applications must be downloaded and installed on your local computer. 1. Finding Databases. Well start with finding databases. (a) What major online databases contain DNA and protein sequences? (b) Which databases contain entire genomes? (c) Using your textbook and online resources (http://www.google. com), make sure you understand the meaning of the following terms: BLAST, taxonomy, gene ontology, phylogenetic trees, and multiple sequence alignment. Once you have defined these terms, find resources on the Internet that enable you to study them. 2. TIGR (The Institute for Genomic Research). Open the TIGR site (http://www.tigr.org). Find the Comprehensive Microbial Resource. (a) What 2001 publication describes the Comprehensive Microbial Resource at TIGR? (b) How many completed genomes from Pseudomonas species have been deposited at TIGR? (c) Which Pseudomonas species are these? (d) Identify the primary reference for Pseudomonas putida KT2440. (e) Find the link on the Comprehensive Microbial Resource home page for restriction digests. Perform a computer-generated restriction digest on Pseudomonas putida KT2440 with BamH1. How many fragments form and what is the average fragment size? (See Section 3-4A for a discussion of restriction endonucleases.) (f) In addition to microbial genomes, TIGR also contains the genomes of many higher organisms. Identify five eukaryotic genomes that are available at TIGR. 3. Analyzing a DNA Sequence. Using high-throughput methods, scientists are now able to sequence entire genomes in a very 1115
1116
Bioinformatics Exercises Once you have found a pair, highlight the text of the proposed ORF and use the programs Word Count function to count the number of characters between (or including) the Start and Stop codons. This number must be evenly divisible by 3. You can also use a fixed-width font such as Courier, enlarge the size of the text, and adjust the margins so that each line holds just three characters (one codon). Once you find the first ATG, delete the characters that precede it. Then search for a Stop codon that fits all on one line (is in the same reading frame as the Start codon). (b) Admittedly, Part (a) is a tedious approach. Here is an easier one: Highlight the entire DNA sequence again and copy it. Then go to the Translate tool on the ExPASy server (http://www. expasy.org/tools/dna.html). Paste the sequence into the box entitled Please enter a DNA or RNA sequence in the box below (numbers and blanks are ignored). Then select Verbose (Met, Stop, spaces between residues) as the Output format and click on Translate Sequence. The Results of Translation page that appears contains six different reading frames. What is a reading frame and why are there six? (Refer to Section 26-1A, the Internet, or the PubMed bookshelf for an answer.) Identify the reading frame that contains a protein (more than 100 continuous amino acids with no interruptions by a Stop codon) and note its name. Now go back to the Translate tool page, leave the DNA sequence in the sequence box, but select Compact (M, -, no spaces) as the Output format. Go to the same reading frame as before and copy the protein sequence (by one-letter abbreviations) starting with M for methionine and ending in - for the Stop codon. Save this sequence to a separate text file. (c) Now you will identify the protein and the bacterial source. Go to the NCBI BLAST page (http://www.ncbi.nlm.nih. gov/BLAST/). What does BLAST stand for? You will do a simple BLAST search using your protein sequence, but you can do much more with BLAST. You are encouraged to work the Tutorials on the BLAST home page to learn more. On the BLAST page, select Protein-protein BLAST. Enter your protein sequence in the Search box. Use the default values for the rest of the page and click on the BLAST! button. You will be taken to the formatting BLAST page. Click on the Format! button. You may have to wait for the results. Your protein should be the first one listed in the BLAST output. What is the protein and what is the source? Note to instructors: You can do this exercise with any DNA sequence. You can also start from a DNA sequence directly in BLAST (use blastn) and find the genes that way. It is probably best to choose a DNA segment that encodes only one protein. 4. Sequence Homology. You will use BLAST to look at sequences that are homologous to the protein that you identified in Problem 3. (a) First, some definitions: What do the terms homolog, ortholog, and paralog mean? Go to the NCBI BLAST page (http://www.ncbi.nlm.nih.gov/BLAST/) and choose Proteinprotein BLAST. Paste your protein sequence into the Search box. Before clicking on the BLAST! button, narrow the search by kingdom. As you look down the BLAST page, youll see an Options section. Under Limit by entrez query (followed by an empty box) or select from: (followed by a drop-down menu), select Eukaryota. Now click on the BLAST! button. Click on
short period of time. Sequencing a genome is quite an accomplishment in itself, but it is really only the beginning of the study of an organism. Further study can be done both at the wet lab bench and on the computer. In this problem, you will use a computer to help you identify an open reading frame, determine the protein that it will express, and find the bacterial source for that protein. Here is the DNA sequence:
TACGCAATGCGTATCATTCTGCTGGGCGCTCCGGGCGCAGGTAAA GGTACTCAGGCTCAATTCATCATGGAGAAATACGGCATTCCGCAA ATCTCTACTGGTGACATGTTGCGCGCCGCTGTAAAAGCAGGTTCT GAGTTAGGTCTGAAAGCAAAAGAAATTATGGATGCGGGCAAGTT GGTGACTGATGAGTTAGTTATCGCATTAGTCAAAGAACGTATCACA CAGGAAGATTGCCGCGATGGTTTTCTGTTAGACGGGTTCCCGCGT ACCATTCCTCAGGCAGATGCCATGAAAGAAGCCGGTATCAAAGTT GATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAG CGCATTGTCGGCCGTCGGGTACATGCTGCTTCAGGCCGTGTTTATC ACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTAC CGGTGAAGAGCTGACTATTCGTAAAGATGATCAGGAAGCGACTGT CCGTAAGCGTCTTATCGAATATCATCAACAAACTGCACCATTGGTT TCTTACTATCATAAAGAAGCGGATGCAGGTAATACGCAATATTTTAA ACTGGACGGAACCCGTAATGTAGCAGAAGTCAGTGCTGAACTGG CGACTATTCTCGGTTAATTCTGGATGGCCTTATAGCTAAGGCGGTT TAAGGCCGCCTTAGCTATTTCAAGTAAGAAGGGCGTAGTACCTACA AAAGGAGATTTGGCATGATGCAAAGCAAACCCGGCGTATTAATGG TTAATTTGGGGACACCAGATGCTCCAACGTCGAAAGCTATCAAGC GTTATTTAGCTGAGTTTTTGAGTGACCGCCGGGTAGTTGATACTTC CCCATTGCTATGGTGGCCATTGCTGCATGGTGTTATTTTACCGCTTC GGTCACCACGTGTAGCAAAACTTTATCAATCCGTTTGGATGGAAG AGGGCTCTCCTTTATTGGTTTATAGCCGCCGCCAGCAGAAAGCACT GGCAGCAAGAATGCCTGATATTCCTGTAGAATTAGGCATGAGCTAT GGTTCAC
(a) First, try to find an open reading frame in this segment of DNA. What is an open reading frame (ORF)? You can find the answer in your textbook (Section 3-4D) or online with a simple Internet search (http://www.google.com). You may also wish to try the bookshelf at PubMed (http://www.ncbi.nlm.nih.gov/ entrez/query.fcgi?db=Books). In bacteria, an open reading frame on a piece of mRNA almost always begins with AUG, which corresponds to ATG in the DNA segment that codes for the mRNA. According to the standard genetic code (Table 26-1), there are three Stop codons on mRNA: UAA, UAG, and UGA, which correspond to TAA, TAG, and TGA in the parent DNA segment. Here are the rules for finding an open reading frame in this piece of bacterial DNA: (1) It must start with ATG. In this exercise, the first ATG is the Start codon. In a real gene search, you would not have this information. (2) It must end with TAA, TAG, or TGA. (3) It must be at least 300 nucleotides long (coding for 100 amino acids). (4) The ATG Start codon and the Stop codon must be in frame. This means that the total number of bases in the sequence from the Start to the Stop codon must be evenly divisible by 3 (see Section 26-1A). Hints: Try this search by pasting the DNA sequence into a word processing program, then searching for the Start and Stop codons.
Bioinformatics Exercises the Format! button on the next page. Can you find a homologous sequence from yeast? (Hint: Use your browsers Find tool to search for the term Saccharomyces.) Note the Score and E value given at the right of the entry. Can you find a homologous sequence from humans? (Hint: Search for the term Homo.) Note its Score and E value. Most biochemists consider 25% identity the cutoff for sequence homology, meaning that if two proteins are less than 25% identical in sequence, more evidence is needed to determine whether they are homologs. Click on the Score values for the yeast and human proteins to see each sequence aligned with the Yersinia pestis sequence and to see the percent sequence identity. Are the yeast and human sequences homologous to the Yersinia pestis sequence? (b) Use the BLAST online tutorial (http://www.ncbi.nlm.nih. gov/Education/BLASTinfo/information3.html) to discover the meaning of the Score and E value for each sequence that is reported. What is the difference between an identity and a conservative substitution? Provide an example of each from the comparison of your sequence and a homologous sequence obtained from BLAST (see Section 5-4A for a discussion of conservative substitution). (c) BLAST uses a substitution matrix to assign values in the alignment process, based on the analysis of amino acid substitutions in a wide variety of protein sequences. Be sure you understand the meaning of the term substitution matrix. What is the default substitution matrix on the BLAST page? What other matrices are available? What is the source of the names for these substitution matrices? Repeat the BLAST search in Problem 4(a) using a different substitution matrix. Do you find different answers? 5. Plasmids and Cloning (a) REBASE is the Restriction Enzyme Database (http://rebase. neb.com/rebase/rebase.html), which is supported by a number of commercial restriction enzyme suppliers (restriction enzymes are described in Section 3-4A). Go to the REBASE Enzymes page (http://rebase.neb.com/rebase/rebase.enz.html) and find a restriction enzyme from Rhodothermus marinus (it starts with the letters Rma). What is the abbreviation for this enzyme? Click on the enzymes abbreviation to be taken to the page for this enzyme. Follow the links there to answer the following two questions. What is the recognition sequence for this enzyme? What are the expected and actual frequencies of restriction enzyme recognition sites for this enzyme in Bacillus halodurans C-125? (b) What is a plasmid? pBR322 was one of the first plasmids to be developed for experimental work. Go to the Entrez site (http://www.ncbi.nlm.nih.gov/Entrez) and find the sequence of pBR322 by searching for the terms pBR322, complete genome. You must select Nucleotide as your search option on the Entrez main page. Look through the Entrez description of pBR322 and identify one gene encoded by pBR322 and name the antibiotic that it targets. You can get Entrez to display your sequence in FASTA format by selecting this option next to the Display button.
1117
(Here are two of many sites that describe the FASTA format: http://ngfnblast.gbf.de/docs/fasta.html; http://bioinformatics.ubc. ca/resources/faq/?faq_id=1). Save the pBR322 sequence in FASTA format. (c) Go to PubMedCentral and search for a 1978 article in Nucleic Acids Research about restriction mapping of pBR322. Download the article in pdf format (use Adobe Acrobat to read it; you can get this program at http://www.adobe.com). What is the size of the pBR322 plasmid in number of base pairs? How many cut sites are there for the restriction enzyme HaeIII on pBR322? (d) Some restriction enzymes generate blunt ends, and some generate sticky ends. Explain the meaning of those terms and provide an example of each. (e) Go to the RESTRICT site at the Pasteur Institute (http://bioweb.pasteur.fr/seqanal/interfaces/restrict.html). Enter your email address at the top, then input the pBR322 sequence file. Scroll down to the Required section and note that you have a Minimum recognition site length of four nucleotides and you have selected all the enzymes available in REBASE to digest pBR322 at the same time. Click on the Run Restrict button. On the output screen, click on the outfile.out link. This takes you to a simple text page that lists all the cuts that were made in the pBR322 plasmid. How many pBR322 fragments did all the enzymes generate? (Look for the HitCount number on the output.out page). What happens to the number of fragments when the minimum recognition site length is changed to six nucleotides? Why did the number change? (f) Now change the enzyme name from all to BamHI in the enzymes box under the Required section on the RESTRICT page. How many fragments are generated? How many fragments are obtained using AvaI? What is the size of the restriction site for AvaI? How many fragments are obtained using Eco47III? What is the size of the restriction site for Eco47III? (g) How many pBR322 fragments are produced when the three different enzymes are combined (separate the enzyme names by commas)? How large are the fragments? (h) Use a mixture of the restriction enzymes BamHI, AvaI, and PstI to construct a restriction map of pUC18 similar to the one shown in Fig. 3-25. How does this procedure for restriction mapping differ from that used in Problem 10 at the end of Chapter 3? (i) For the adventurous: Find an enzyme or combination of enzymes that will produce 10 fragments from pUC18. Draw a restriction map of your results.
CHAPTER 5 USING DATABASES TO COMPARE AND IDENTIFY RELATED PROTEIN SEQUENCES

1. Obtaining Sequences from BLAST. Triose phosphate isomerase is an enzyme that occurs in a central metabolic pathway called glycolysis (see Chapter 14). It is also known as an enzyme that demonstrates catalytic perfection (see Section 12-1B). For this problem, youll start with the sequence of triose phosphate isomerase from rabbit muscle and look for related proteins in the online databases. Here is the sequence of rabbit muscle triose phosphate isomerase in FASTA format:
Appendix 3 The Universal Genetic Code
Source: Griffiths AJF, Wessler SR, Lewontin RC, Carroll SB (2008) Introduction to Genetic Analysis, 9th Edition. W.H. Freeman, New York. P. 329. ISBN 978-0-7167-6887-6
Appendix 4
Proteins are composed of 19 amino acids and one imino acid (Pro). The indicated pKa corresponds to the R lateral group.
Source: New England BioLabs, Technical Reference, General Molecular Biology Data (http://www.neb.com/nebecomm/tech_reference/general_data/amino_acid_structures.asp) Downloaded August 19, 20009.

120-202 Lab Manual Spring 2012

Enviado por

Dados do documento

Descrição original:

Título original

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

120-202 Lab Manual Spring 2012

Enviado por

Direitos autorais:

Formatos disponíveis

Federated Department of Biological Sciences

120:202 Foundations of Biology Laboratory:

120:202 Foundations of Biology Laboratory

1-14 15-18 19-23 24-29 30-37 38-46

47-57 58-63 64-71

72-75 81-85 76-80 86-98

120:202 Foundations of Biology Laboratory

Tuesday 8:30-11:20 A.M.

Thursday 11:30 A.M.-2:20 P.M.

Instructor: Diana Martnez

Instructor: Rucha Shah

Tuesday 4:00-6:50 P.M.

Thursday 4:00-6:50 P.M.

Instructor: Pavan Vedula

Instructor: Soumyashree Das

Wednesday 8:30-11:20 A.M.

Friday 8:30-11:20 A.M.

Instructor: Diana Martnez

Instructor: Soumyashree Das

Wednesday 4:00-6:50 P.M.

Friday 11:30 A.M.-2:20 P.M.

Instructor: Pavan Vedula

Instructor: Yinghan Hank Chen

Thursday 8:30-11:20 A.M.

Friday 2:30-5:20 P.M.

Instructor: Rucha Shah

Instructor: Yinghan Hank Chen

FEDERATED DEPARTMENT OF BIOLOGICAL SCIENCES

Adapted from http://catalogs.rutgers.edu/generated/nwk-ug_0608/pg23594.html, downloaded on 29Aug08.

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

_________________________________ Print Name _________________________________ Signed Name _________________________________ Date

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

Tips Yellow or white White

120:202 Foundations of Biology CMB Laboratory

Never rotate volume adjuster beyond the upper limit!

Never use without a tip.

Never let plunger snap back after withdrawing or ejecting fluid

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology CMB Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

5. NCBI is a comprehensive network of databases that include information on nucleotidyl sequences

Figure source: http://www.muhlenberg.edu/main/academics/biology/courses/bio152/bioinformatics_lab/index.html

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

What is the proportion of OOC-Gly- NH + /OOC-Gly- NH2 at pKa2? 3

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

120:202 Foundations of Biology Laboratory

_________________ Print Name _ Signed Name _________________ Date