Você está na página 1de 10

Nucleotdeos

TRANSCRIO E TRADUO GNICAS

a unidade formadora dos cidos nuclicos: DNA e RNA. composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada (Adenina, Guanina, Citosina, Timina e Uracila).

Prof. Viviane C. Longuini Disciplina Gentica Farmcia 3 semestre/2012

DNA
Adenina

RNA

RNA
cido Ribonuclico Molcula de fita simples dividido em: RNA mensageiro (RNAm) RNA transportador (RNAt) RNA ribossmico (RNAr)

Guanina

Citosina

Timina

Uracila

RNAm
Leva a informao da seqncia protica a ser formada do ncleo para o citoplasma, onde ocorre a traduo. Ele contm uma seqncia de trincas correspondente a uma das fitas do DNA. Cada trinca (trs nucleotdeos) no RNAm denominada cdon e corresponde a um aminocido na protena que ir se formar:

1 cdon

3 nucleotdeos no RNAm

7 cdons

21 nucleotdeos

TRANSCRIO
Processo pelo qual uma molcula de RNA sintetizada a

TRANSCRIO
Caractersticas Gerais:
Complementaridade Antiparalelismo ( T = U) Sntese 5' 3 RNA Polimerase (RNAP): Funes reconhecem e ligam-se desnaturam DNA mantm estvel a dupla fita aberta mantm estvel DNA:RNA terminam sntese restauram DNA

partir da informao contida na seqncia de nucleotdeos de uma molcula de DNA fita dupla. A transcrio representa a diversidade e a complexidade da expresso dos genes contidos em um determinado genoma. Enquanto a sntese de DNA deve ser precisa e uniforme, a transcrio reflete o estado fisiolgico da clula e, portanto, extremamente varivel para atender s suas necessidades.

TRANSCRIO
Apenas uma das fitas do DNA utilizada como molde, portanto, a molcula de RNA sintetizada complementar fita de DNA que lhe deu origem e idntica outra fita de DNA, sendo as timinas substitudas por uracilas Em 1960, Hurwitz, Stevens e Weiss descobriram, independentemente, uma enzima capaz de sintetizar RNA na presena de DNA fita dupla e dos nucleotdeos A, U, C, G. Esta enzima foi denominada RNA polimerase.

RNA POLIMERASE
Reconhece e liga-se a seqncias especficas de DNA; Desnatura o DNA expondo a seqncia de nucleotdeos a ser copiada; Mantm as fitas de DNA separadas na regio de sntese; Renatura o DNA na regio imediatamente posterior da sntese; Sozinha, ou com o auxlio de protenas especficas, termina a sntese do RNA.

RNA POLIMERASE
Em eucariotos existem vrios subtipos de RNA polimerases especficos:
RNA polimerase I localizada no nuclolo, responsvel pela sntese do RNA ribossmico RNA polimerase II localizada no nucleoplasma, responsvel pela sntese do RNA mensageiro RNA polimerase III tambm localizada no nucleoplasma, responsvel pela sntese do RNA transportador

envolvidas

na

sntese

de

RNAs

TRANSCRIO
1.INCIO Reconhecimento de seqncias especficas no DNA 2. ALONGAMENTO Incorporao dos ribonucleotdeos 3. TERMINAO Seqncias interrompida no DNA so reconhecidas e a sntese

INCIO DA TRANSCRIO
O DNA apresenta seqncias especficas, denominadas PROMOTORES, que sinalizam exatamente onde a sntese do RNA deve ser iniciada. Os promotores so, primeiramente, reconhecidos por fatores de transcrio que, ligados ao DNA, interagem com outros fatores, formando um complexo ao qual a RNA polimerase se associa.

INCIO DA TRANSCRIO
As seqncias reguladoras da transcrio podem ser divididas em:

INCIO DA TRANSCRIO
As fitas do DNA se separam 10 bases upstream ao stio de

Elementos promotores: seqncias de 100 a 200 nucleotdeos prximos ao stio de incio da transcrio que possuem seqncias consenso TATA denominadas TATA box Elementos amplificadores: seqncias pequenas de DNA que podem ocorrer na regio 5 do gene. Ativam a expresso do mesmo.

iniciao, mais especificamente no TATA box. A fita molde fica exposta e, desta forma, a sntese da cadeia complementar de RNA pode ser iniciada.

ALONGAMENTO DA CADEIA
A polimerase desliza ao longo da fita molde entendendo uma cadeia de RNA crescente no sentido 5 3 atravs da adio de ribonucleotdeos. Este processo ocorre at a RNA polimerase encontrar uma seqncia especfica no DNA que determina o trmino do alongamento.

TRMINO DA TRANSCRIO
Quando a RNA polimerase encontra o stio de terminao na fita molde, ela se desliga do DNA juntamente com a nova cadeia de RNA sintetizada devido uma desestabilizao do complexo de transcrio O desligamento do RNA do sistema provoca a ruptura do complexo de transcrio e as fitas do DNA so renaturadas.

O PROCESSAMENTO DO RNA
Os diferentes RNAs sintetizados no processo de transcrio so chamados de transcritos primrios; Na maioria das vezes, esses transcritos no representam a molcula madura, ou seja, aquela cuja seqncia e estrutura correspondem forma final do RNA funcional; Esses transcritos necessitam sofrer modificaes que fazem parte do processamento do RNA.

PROCESSAMENTO DO mRNA
O transcrito primrio da molcula de mRNA tambm conhecido como pr-mRNA Este RNA precursor sintetizado no ncleo e sofre vrias alteraes transformado-se no que se chama mRNA maduro ou processado. O RNA maduro , ento, transportado ao citoplasma onde ser traduzido

PROCESSAMENTO DO mRNA
Aps o incio da transcrio da molcula de mRNA adicionado um resduo de guanina sua extremidade 5. O cap protege a extremidade 5 da ao de exonucleases e, tambm, utilizado para reconhecimento, pelo ribossomo, do stio de incio do processo de sntese protica.

PROCESSAMENTO DO mRNA
Splicing
Funo: ajuda a clivar no stio de splicing remove intron impede afastamento dos xons une os xons

MOLCULAS DE RNA
RNA mensageiro carrega a informao copiada do DNA sob a forma de inmeros triplets cada um especificando um aminocido

TRADUO
Processo que se baseia na seqncia do mRNA para determinar e unir os aminocidos formando, assim, a protena. Cada aminocido codificado na seqncia de DNA como

RNA transportador decifra o cdigo representado pelo mRNA RNA ribossmico associa-se com uma srie de protenas para formar os ribossomos

um cdon contendo uma seqncia de trs nucleotdeos. Molculas de RNA transportador transferem a informao contida no genoma uma seqncia de aminocidos nas protenas.

RNA TRANSPORTADOR
Liga-se quimicamente um aminocido especfico, atravs da enzima aminoaciltRNA sintetase, sendo chamado, desta forma, de aminoacil-tRNA; Pareia com a seqncia do codon do mRNA adicionando o aminocido que carrega uma cadeia de peptdeos crescente.

RNA TRANSPORTADOR

RIBOSSOMOS
A eficincia da traduo se deve, principalmente, ligao da molcula de mRNA e dos aminoacil-tRNAs ao maior complexo RNA-protena da clula o ribossomo que direciona o crescimento da cadeia polipeptdica Durante a sntese protica, o ribossomo se move ao longo da cadeia de mRNA interagindo com vrios fatores proticos e o tRNA

CDIGO GENTICO
A relao entre a seqncia de bases no DNA e a seqncia correspondente de aminocidos, na protena, chamada de cdigo gentico O cdigo gentico encontra-se na forma de triplets os cdons

TRADUO
O codon AUG, que codifica o aminocido metionina, age como o codon de iniciao na maioria das molculas de mRNA. Quando AUG est colocado no incio este lido como uma formil-metionina; quando est dentro da regio codificadora, lido como metionina.

TRADUO
Durante a sntese de protenas, os ribossomos deslocam-se ao longo do mRNA, possibilitando um pareamento entre esse e os tRNAs que carregam os diferentes aminocidos que iro compor as protenas

TRADUO
A terminao da sntese de protenas ocorre pelo aparecimento de cdons de terminao na molcula de mRNA O reconhecimento desses cdons realizado por

Os ribossomos deslocam-se ao longo do mRNA, na direo 5 3, sintetizando a protena no sentido amino-terminal para carboxi-terminal

protenas e no por molculas de tRNA, diferentemente do que ocorre nos outros cdons

Dogma Central da biologia Molecular


RNA polimerase

Ncleo

Gene

Transcrio
hnRNA

Processamento
mRNA

Traduo
Citoplasma

protena

Traduo:
aa livre Ribossomo Protena
Asp Met Ala Cys Glu Phe Gly His Asp Met Ala Glu Phe Gly His

tRNA

Cys

5 AUGGCAUGCGACGAAUUCGGACACAUA

AUGGCAUGCGACGAAUUCGGACACAUA Molcula de mRNA Direo do avano do ribossomo

codon

Met Ala Cys

Glu Asp

Phe

Gly

His

Met Ala Cys Asp

Phe

Gly

His

Glu

5 AUGGCAUGCGACGAAUUCGGACACAUA

5 AUGGCAUGCGACGAAUUCGGACACAUA

Lys Met Ala Cys Asp Glu His Ile Met Ala Cys Asp Glu Phe Ile His

Gly

Phe

Gly

5 AUGGCAUGCGACGAAUUCGGACACAUA

5 AUGGCAUGCGACGAAUUCGGACACAUA

Met Ala Cys Asp Glu Phe Gly

Lys Ile

His

Met Ala Cys Asp Glu Phe Gly His

Lys

Ile

5 AUGGCAUGCGACGAAUUCGGACACAUA

5 AUGGCAUGCGACGAAUUCGGACACAUA

Met Ala Cys Asp Glu Phe Gly His Ile

Leu

Lys

Met Ala Cys Asp Glu Phe Gly His Ile Lys

Met

Leu

5 GCAUGCGACGAAUUCGGACACAUAAAA

5 UGCGACGAAUUCGGACACAUAAAAUUA

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu

Asn

Met

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met

Pro

Asn

5 GACGAAUUCGGACACAUAAAAUUAAUG

5 GAAUUCGGACACAUAAAAUUAAUGAAC

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn

Gln

Pro

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro

Gln

5 UUCGGACACAUAAAAUUAAUGAACCCA

5 GGACACAUAAAAUUAAUGAACCCACAA

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln

Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln

STOP 3

STOP

CACAUAAAAUUAAUGAACCCACAAUAA

AUAAAAUUAAUGAACCCACAAUAAAAA

Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln

Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met

STOP

5 AUAAAAUUAAUGAACCCACAAUAATAC

AUAAAAUUAAUGAACCCACAAUAATAC

10