Você está na página 1de 4

AS IMPRESSES DIGITAIS DO DNA (DNA FINGERPRINTS)

GENOMA HUMANO ESTRUTURA

MICROSSATLITES
Seqncias hipervariveis (tambm chamadas polimrficas) repetitivas de 1 a 4 pb com distribuio ao longo do genoma. O polimorfismo destas seqncias resultado de diferentes rearranjos envolvendo segmentos de DNA de tamanhos diferentes. Herana Mendeliana (os filhos sempre recebem metade dos alelos de origem materna e metade de origem paterna). Exemplos de seqncias de microssatlites: Repetio de 1 base: GTAAAAAAAAAAAAAAAGGAT Repetio de 2 bases: GTCACACACACACACACAGGAT (dinucleotdeo) Repetio de 3 bases: GTCACCACCACCACCACCACGGAT (trinucleotdeo) Repetio de 4 bases: GTCAGACAGACAGACAGAGGAT (tetranucleotdeo) Polimorfismo so devido a diferenas no nmero de repeties. So tambm conhecidos como short tandem repeat(STR).

GENOMA NUCLEAR

IMPRESSES DIGITAIS DO DNA (DNA FINGERPRINTS) - O QUE SIGNIFICA?


Com base no estudo de uma bateria de 12-20 microssatlites, possvel obter perfis genticos praticamente indivduo-especficos, muito teis na investigao de paternidade, identificao de vtimas e criminosos.

- TCNICAS RFLP (Restriction Fragment Lenght Polymorphism). PCR (Polymerase Chain Reaction).

Ana Luisa Miranda Vilela

www.bioloja.com

Ana Luisa Miranda Vilela

www.bioloja.com

RFLP

Eletroforese em gel de agarose

Polimorfismo de Comprimento de Fragmento de Restrio: P 1) Coleta de amostras biolgicas que podem ser saliva, sangue, esperma e cabelo, entre outros. 2) Extrao e purificao do DNA.

3) Corte com enzimas de restrio (tesouras moleculares que reconhecem e cortam seqncias especficas do DNA).

4) Eletroforese: onde, atravs de uma corrente eltrica, so separados os fragmentos de DNA por tamanho. A partir da, formada uma espcie de cdigo de barras que a identificao individual e intransfervel de cada indivduo.

+
Ana Luisa Miranda Vilela www.bioloja.com 3 Ana Luisa Miranda Vilela www.bioloja.com 4

VISUALIZAO DO DNA

SONDAS : SLP (single-locus probe) e MLP (multi-locus-probe). SLP: detecta um nico segmento de DNA repetitivo em um nico cromossomo. Seu uso resulta em um padro que contm no mximo duas bandas: uma para cada segmento de DNA reconhecido em cada membro do par de cromossomos homlogos. Para a obteno de padres mais caractersticos de cada pessoa, so necessrias vrias sondas. Devido sua sensibilidade, so empregadas nas investigaes criminais.

5) Transferncia para membrana de nylon (southern blotting).

MLP: detecta vrios segmentos de DNA repetitivo localizados em muitos cromossomos. O padro obtido consiste em aproximadamente 20 a 30 bandas. Por isso, a probabilidade de duas pessoas tomadas ao acaso apresentarem todas as bandas exatamente com a mesma posio extremamente baixa (1:10 trilhes).

6) Uso de sondas: pequenos segmentos de DNA radioativados, cuja seqncia de bases conhecida. Acoplam-se s seqncias de DNA das quais so complementares, ligando-se s mesmas.

Ana Luisa Miranda Vilela

www.bioloja.com

Ana Luisa Miranda Vilela

www.bioloja.com

RESULTADO DO TESTE R 1- Anlise forense: assassinato

3- Paternidade:

2- Anlise forense: estupro A simulao acima demonstra que, biologicamente, h apenas um filho e uma filha do casal.

No caso acima, a me no sabe quem o pai biolgico.


Ana Luisa Miranda Vilela www.bioloja.com 7 Ana Luisa Miranda Vilela www.bioloja.com 8

Reao em Cadeia da Polimerase: permite que um fragmento especfico da molcula de DNA seja amplificado milhares de vezes em apenas algumas horas.

PCR

Parte a ser duplicada selecionada por dois iniciadores (primers) oligonucleotdeos sintticos de RNA, complementares ao DNA fitamolde combinam-se exatamente com cada regio terminal da parte a ser copiada. Mquina de PCR (termociclador) basicamente um forno controlado por computador, onde um programa controla o tempo e a temperatura.

VANTAGENS: Permite a amplificao de qualquer seqncia de DNA coletada de amostras de materiais biolgicos como sangue, urina, outros fluidos corporais, cabelo e fragmentos teciduais. Amostras de microorganismos, clulas vegetais ou animais mesmo que com milhares de anos, tambm podem ser detectadas pela PCR. ETAPAS: 1- Extrao do DNA da amostra que se pretende estudar. 2- Purificao do DNA. 3- Preparao de uma mistura chamada Master Mix, que conter todas as substncias necessrias sntese de novas cpias de DNA. 4- Incubao em um termociclador, que o aparelho responsvel pela execuo de todos os ciclos da reao, aquecendo e resfriando os tubos. 5- Eletroforese em gel de poliacrilamida dos produtos da PCR. A partir da PCR possvel obter-se cpias de uma parte do material gentico em quantidade suficiente que permita detectar e analisar a seqncia que alvo do estudo. Durante o processo, o DNA original copiado por uma enzima, a DNA-polimerase, que duplica uma pequena parte da molcula de DNA.
Ana Luisa Miranda Vilela www.bioloja.com 9 Ana Luisa Miranda Vilela www.bioloja.com 10

6- Revelao e fixao do gel.

Cada ciclo dobra o nmero de cpias do DNA dupla fita.

TERMOCICLADOR (ETAPAS): Reao se processa em ciclos de diferentes temperaturas ~30 ciclos sntese exponencial de molculas de DNA. Etapas de cada ciclo: 1- Desnaturao (94-95C por 5 minutos) separao do DNAmolde dupla fita em duas fitas simples de DNA. 2- Pareamento ("Annealing ou anelamento) (55-60C) iniciadores ligam-se ao DNA fita simples. O tempo necessrio para o anelamento de 30-45 segundos. 3- Extenso (72C) DNA-polimerase termoestvel (taqpolimerase extrada da bactria Thermus aquaticus) adiciona nucleotdeos polimerizao cada uma das novas fitas extendidas a partir dos iniciadores serve de molde para a sntese de novas fitas.

Nmero de ciclos adequado: 30 (at o 3 ciclo no h produtos; nmero de ciclos maior do que 35 tem pouco efeito positivo mutaes). RESULTADO DO TESTE R 1- Anlise forense: estupro Mary Higgins foi violentada no Central Park em Nova York. Trs suspeitos foram presos. O DNA revelou o verdadeiro agressor. As evidncias (sangue do agressor e um fio de cabelo) foram usadas no teste para achar o culpado. O indivduo 2 foi condenado.

Ana Luisa Miranda Vilela

www.bioloja.com

11

Ana Luisa Miranda Vilela

www.bioloja.com

12

2- Anlise forense: um crime (quase) perfeito. Uma esposa desaparecida. Um marido desesperado. Ingredientes de uma trama quase perfeita para eliminar uma pessoa. Phillipe Landmeier tinha planejado tudo. S no contava que oito anos depois o seu crime viria tona.

4- Anlise forense: o assassino de Rodman Dam, 1987. 1987: casal de noivos Matthew Brock e Kelly Lynn Perry (tambm estuprada) - achado baleado na cabea (bala de rifle calibre 30) em Rodman Dam, rea de recreao na Flrida. Principais suspeitos: os adolescentes Randall Scott Jones e Chris Reesh.

Phillipe aguarda a execuo desde 1995.

3- Anlise forense: o assassinato de JonBennet Ramsey: um crime sem soluo?

A morte da inocncia.

Tristeza ou remorso?
Ana Luisa Miranda Vilela www.bioloja.com 13 Ana Luisa Miranda Vilela www.bioloja.com 14