Você está na página 1de 44

Aulas prticas

Biologia Molecular Licenciatura Bioqumica


Trabalho 1. Extraco de DNA genmico de Drosophila melanogaster Semana: 6 8 de Maro Trabalho 2. Extraco de DNA plasmdico de Escherichia coli Semana: 13 15 de Maro Trabalho 3. Anlise electrofortica de DNA digerido com enzimas de restrio Semana: 20 22 de Maro Trabalho 4. Elaborao do mapa de restrio de um plasmdeo recombinante Semana: 3 5 de Abril Trabalho 5. PCR - Polimerase Chain Reaction Semana: 10 12 de Abril Trabalho 6. Transformao de Escherichia coli com DNA plasmdico Semana: 17 19 de Abril Trabalho 7. Sequenciao de DNA Semana: 15 17 de Maio Trabalho 8. Clonagem de cDNA -TUB (Parte I) Semana: 22 24 de Maio Trabalho 9. Clonagem de cDNA -TUB (Parte II) Semana: 5 - 7 de Junho

BIOLOGIA MOLECULAR I

Protocolos Experimentais

Cludio Sunkel Instituto de Cincias Biomdicas Abel Salazar Universidade do Porto 20012/2013

Precaues a ter nos trabalhos de Biologia Molecular

Segurana pessoal Agentes qumicos - Grande parte dos reagentes utilizados em Biologia Molecular so carcinognicos, mutagnicos, txicos, inflamveis ou altamente reactivos. Deve-se sempre consultar as indicaes disponibilizadas pelos fabricantes ou atravs da internet: http://physchem.ox.ac.uk/MSDS http://www.epa.gov/enviro/html/emci/chemref/ http://siri.org http://hazard.com http://www-portfolio.stanford.edu/100369

Radiaes - Muitos trabalhos com cidos nucleicos envolvem a utilizao de nucleotides marcados radioactivamente, nomeadamente com 32P.

Agentes Biolgicos O modelo biolgico com que se trabalha pode ser patognico. Materiais biolgicos como anticorpos, hormonas e clulas podem conter agentes patognicos e a manipulao de plasmdeos bacterianos pode levar a problemas de disseminao de resistncia a antibiticos.

Electricidade Uma das tcnicas mais utilizadas na manipulao e anlise de cidos nucleicos e protenas a electroforese em que se empregam elevadas voltagens.

Proteco do material em anlise DNA e RNA degradado por DNases (ou RNases) e desnaturado reversivelmente com o aumento da temperatura. Protenas So degradadas por proteases e desnaturadas irreversivelmente com o aumento da temperatura e, por vezes reversivelmente, com alteraes de pH e agentes

qumicos que promovam oxidao. H inibidores qumicos de RNAases e proteases disponveis comercialmente que so de ampla utilizao. Reagentes Devem ser de elevado grau de pureza (suitable for molecular biology), de modo a se encontrarem isentos de proteases, DNases e RNases. No entanto, esto sempre sujeitos a contaminao aps abertura das embalagens por spatulas, poeiras, etc. Material de vidro A autoclavagem desnatura irreversivelmente as DNAases e as proteases. As RNases so apenas desnaturadas reversivelmente. Para as desnaturar de um modo irreversvel, deve-se empregar calor seco prolongado: 180 - 200C, durante ~12h. Material de plstico descartvel Este material isento de DNAases, RNAases e protease, sendo tambm sujeito a contaminaes aps a abertura das respectivas embalagens

AULA 1 Extraco de DNA genmico de Drosophila melanogaster


O procedimento bsico de qualquer protocolo de extraco de DNA envolve lise celular, com libertao de todo o material intracelular e purificao do DNA. O processo de rompimento das clulas a parte do protocolo que mais varia se compararmos os diferentes mtodos de extraco de diferentes materiais biolgicos: bactrias, leveduras, clulas vegetais, clulas animais, etc. Com a lise celular, todos os compostos intracelulares so libertadas para a soluo: protenas, lpidos, polissacardeos, cidos nucleicos, molculas orgnicas de baixo peso molecular e ies. Nos protocolos vulgarmente utilizados para a purificao de DNA genmico, a lise celular geralmente promovida por rompimento mecnico ou se necessrio por aco enzimtica que cataliza a degradao da parede celular. Em ambos os casos, frequente empregar-se um detergente para completar a lise. Assim, a purificao do DNA consistir em libertar o DNA de todos os compostos referidos, o que feito usualmente por precipitaes diferenciais e aco de enzimas especificas como proteases e RNAases. Nas precipitaes diferenciais, recorre-se geralmente a extraces repetidas com fenol/clorofrmio/lcool isoamlico (25:24:1, v/v/v), em que o fenol e o clorofrmio desnaturam as protenas, ficando estas solubilizadas na fase orgnica enquanto os cidos nucleicos permanecem na fase aquosa. Os passos posteriores de purificao baseiam-se na insolubilidade do DNA em etanol na presena de concentraes relativamente elevadas de caties monovalentes. Em soluo vo permanecer solutos orgnicos e resduos de fenol e clorofrmio. Posteriormente, utilizado etanol a 70%, no qual se dissolvem a maioria dos caties, resultando DNA praticamente puro no precipitado. O DNA genmico extrado por estes processos pode ser usado para a construo de bancos genmicos, para anlise de Southern blot, como molde para amplificao in vitro por PCR, entre outras aplicaes moleculares possveis. O DNA deve ser guardado solubilizado a 70C (ou 20C). No entanto, a congelao e descongelao sucessivas provoca quebras nas cadeias de DNA. Como tal, para armazenamento por longos perodos, o DNA dever ser guardado em alquotas. Se o armazenamento for por um curto perodo de tempo, guardado a 4C. Regra geral, o DNA dissolvido, para 5

armazenamento, em tampo TE (pH 8,0) em que o EDTA previne a degradao do DNA por aco queladora de metais pesados e caties que promovem a quebra das ligaes fosfodister por aco das DNAases. 1. Extrao de DNA genmico de Drosophila melanogaster Este trabalho tem por objectivo a continuao do isolamento de DNA genmico de Drosophila melanogaster, e a verificao das consequncias da aco de tratamentos fsicos sobre a integridade do DNA isolado. Foram recolhidas cerca de 200 moscas adultas, e homogeneizadas em 5 ml de tampo de lise previamente arrefecido em gelo. Tampo de lise: - 100 mM Tris-HCl (pH, 8.0) - 50 mM NaCl - 50 mM EDTA (pH, 8.0) - 1 % SDS - 0,15 mM espermina - 0,15 M espermidina O homogeneizado foi depois centrifugado a 1000 rpm, durante 1 minuto. O sobrenadante, correspondendo suspenso de ncleos foi posteriormente transferido para um tubo Falcon. Adicionou-se 50 l de soluo de proteinase K (a 10 mg/ml) suspenso de ncleos e procedeu-se incubao a 37 C, durante 2 horas. O trabalho experimental a ser realizado compreender o isolamento de DNA genmico das moscas a partir da fraco de ncleos isolados e ressuspendida em 500 l. 1. Adicionar 500 l de soluo de fenol equilibrado em tampo TE (10 mM TrisHCl pH, 8.0; 1 mM EDTA pH, 8.0) suspenso de ncleos. Agitar cuidadosamente por inverso do tubo. Centrifugar a 5000 rpm, durante 2 minutos e transferir a fase aquosa (correspondente fase superior) para um novo tubo.

2. Adicionar 500 l da mistura fenol/clorofrmio/lcool isoamlico (25:24:1, v/v/v) e agitar cuidadosamente por inverso do tubo. Proceder a uma nova centrifugao a 5000 rpm durante 2 minutos. A fase aquosa novamente transferida para um novo tubo. 3. Adicionar 500 l da soluo de clorofrmio, repetindo-se a mistura da preparao por inverso dos tubos. Proceder a uma nova centrifugao a 5000 rpm durante 2 minutos. A fase aquosa novamente transferida para um novo tubo. 4. Adicionar fase aquosa 100 l de soluo de NaCl (1 M) e 900 l de etanol absoluto frio, misturar bem e centrifugar a 12000 rpm durante 10 minutos a 4C. 5. Remover cuidadosamente o sobrenadante com uma micropipeta Adicionar ao DNA precipitado 500 l de uma soluo de lavagem de etanol 70% (frio) e centrifugar a 12000 rpm durante 2 minutos a 4C. 6. Remover cuidadosamente o sobrenadante como no passo 5, tentando eliminar todas as gotas de etanol que tenham ficado aderentes s paredes do microtubo. Deixar o microtubo aberto durante 5 minutos na estufa a 37C para secar completamente o sedimento. 7. Dissolver o sedimento em 50 l de tampo TE. 8. Guardar a -20C.

Determinao da concentrao e grau de pureza do DNA


O mtodo mais usado para a determinao da concentrao DNA o mtodo espectrofotomtrico. Baseia-se na absoro de radiao ultravioleta, por parte dos cidos ncleicos. A quantidade de radiao ultravioleta absorvida directamente proporcional quantidade de DNA na amostra. Assim, a leitura de absorvncia a 260 nm proporcional quantidade de cidos nucleicos, sendo a seguinte a proporcionalidade: Absorvncia 260 nm Equivalncia ~50 g/ml dsDNA ~37 g/ml ssDNA ~40 g/ml ssRNA

Para a determinao do grau de pureza a leitura da absorvncia feita a 280 nm que proporcional quantidade de protenas e fenol presentes na amostra. O grau de pureza calculado atravs da relao A260/A280 que dever ser entre 1,8 e 2,2 para amostras consideradas puras. Para valores inferiores a 1,8, considera-se a amostra contaminada com protenas e fenol. No entanto, por vezes a quantidade de DNA no suficiente para ser determinada espectrofotometricamente (< 250 ng/ml), ou o DNA pode se encontrar intensamente contaminado com outras substncias que absorvem no comprimento de onda ultravioleta (RNA por exemplo), impedindo uma correcta anlise da amostra. Uma maneira rpida de estimar a quantidade de DNA em tais amostras utilizar a fluorescncia, induzida pela radiao ultravioleta, emitida pelo brometo de etdeo intercalado na cadeia de cidos nucleicos. Como a quantidade de fluorescncia proporcional massa total de DNA, a quantidade de cidos nucleicos na amostra pode ser facilmente estimada por comparao da fluorescncia da amostra com aquela de uma srie de padres. Um dos padres que se pode utilizar o DNA de clivado com HindIII, que produz uma gama de fragmentos com vrias dimenses, correspondendo cada banda a uma concentrao de DNA bem definida. 2. Determinao da concentrao e grau de pureza do DNA por espectrofotometria 1. Ligar o espectrofotmetro e regular para 260 nm. 2. Fazer o zero da absorvncia com 1 ml de gua ultra-pura numa cuvette de quartzo. 3. Na mesma cuvette adicionar 695 l de gua ultra-pura e 5 l da amostra de DNA (diluio de 140). Tapar a cuvette com parafilm e inverter vrias vezes. 4. Fazer a leitura da absorvncia a 260nm. 5. Repetir o procedimento e fazer a leitura a 280nm. 6. Calcular a concentrao de DNA e o grau de pureza da amostra.

AULA 2
(continuao da aula anterior)

Verificao da aco de tratamentos fsicos sobre a integridade do DNA genmico Cada um dos grupos proceder s condies abaixo indicadas: 1. Retirar 10 l da amostra de DNA genmico para um tubo eppendorf para posteriormente correr em gel. 2. Retirar 10 l da amostra de DNA genmico para um tubo eppendorf e vortexar vigorosamente durante 2 minutos. Colocar em gelo. 3. Retirar 10 l da amostra de DNA genmico para um tubo eppendorf e aquecer em gua em ebulio, durante 10 minutos e depois arrefecer em gelo. 4. Retirar 10 l da amostra de DNA genmico para um tubo eppendorf e sujeitar a mltiplas passagens atravs da ponta de uma pipeta e depois conservar em gelo.

AULA 2 Extraco de DNA plasmdico de Escherichia coli


Para alm do seu DNA genmico (com cerca de 4 milhes de pares de bases) muitas bactrias possuem grandes quantidades de pequenas molculas de DNA denominadas plasmdeos, as quais podem chegar a conter vrios milhares de pares de bases. Estas molculas de DNA, hoje em dia extremamente manipuladas pelo homem, revelaram-se bastante teis em Engenharia Gentica por permitirem numerosas aplicaes moleculares. Algumas destas aplicaes iro ser evidenciadas no decorrer das aulas prticas. Os plasmdeos bacterianos so molculas de DNA extracromossmico, circulares de cadeia dupla e replicao autnoma. Nos habitats naturais, os plasmdeos so frequentes podendo conter genes que conferem aos seus hospedeiros caractersticas (fentipos) que podero constituir vantagem selectiva. Destes fentipos, contam-se a resistncia a antibiticos, a resistncia a metais pesados, produo de enzimas de restrio, produo de toxinas, produo de aminocidos raros e a produo ou catabolismo de molculas orgnicas complexas. Muitos plasmdeos possuem ainda a capacidade de transferir o seu DNA para outros hospedeiros que 9

podero ser de estirpes diferentes e, at de espcies diferentes por um processo denominado conjugao bacteriana na qual est envolvido um gene: mob. Na replicao dos plasmdeos esto envolvidos vrios genes que podero ser exclusivamente do genoma do hospedeiro ou ento, deste e do prprio plasmdeo. Apesar da replicao ser independente da replicao do cromossoma bacteriano, depende sempre de enzimas e protenas codificadas pelo hospedeiro para a sua replicao. O local de origem de replicao (ori) juntamente com os elementos de controlo cis constituem o replicon ou replicador. Para replicadores diferentes o mecanismo de replicao diferente, podendo envolver mais ou menos genes (e consequentemente mais ou menos enzimas) do hospedeiro. Uma consequncia do tipo de replicador do plasmdeo constitui uma propriedade extremamente importante: o nmero de cpias por clula. Plasmdeos cujo mecanismo de replicao no depende grandemente de protenas codificadas exclusivamente pelo genoma so ditos multicpia (mais de 20 cpias). Por outro lado, os plasmdeos em que a replicao est fortemente dependente de protenas do hospedeiro, apresenta um baixo nmero de cpias por clula (menos de 20 cpias). Tal deve-se ao facto da sua replicao estar dependente de da sntese de factores de replicao pelo hospedeiro (que apenas ocorre no inicio da diviso celular) e de protenas iniciadoras da replicao. Os plasmdeos so tambm caracterizados pelas marcas selectivas que exibem. As marcas selectivas so fentipos conferidos por alelos dominantes plasmdicos que permitem distinguir clulas portadoras desse plasmdeo das no portadoras, atravs de testes simples em que se tenta evidenciar esse fentipo. As marcas selectivas mais comuns em plasmdeos bacterianos so as de resistncia a antibiticos. Assim, clulas portadoras destes plasmdeos so resistentes a um determinado antibitico, enquanto que as que no o possuem mantm a susceptibilidade. Por exemplo, no caso frequente da ampicilina, o gene plasmdico que lhe confere a resistncia codifica uma -lactamase que cataliza a degradao do anel -lactmico caracterstico das penicilinas. As clulas portadoras deste plasmdeo so capazes de formar colnias em meios de cultura contendo ampicilina, enquanto que as clulas que no o possuem perdem a viabilidade nesses meios. Aos plasmdeos de ocorrncia natural, foram feitas alteraes para melhorar as suas qualidades para as vrias aplicaes na Biologia Molecular, entre as quais a clonagem e expresso de genes. Assim foram criados os chamados vectores plasmdicos de clonagem e os vectores plasmdicos de expresso. Por manipulao das marcas 10

selectivas, dos replicadores e de sequncias sem funo aparente, foram criados novos plasmdeos com marcas selectivas convenientes, com maior nmero de cpias e mais pequenos em tamanho. Por outro lado foram introduzidas novas sequncias (reconhecidas por enzimas de restrio) de modo a aumentar o nmero de locais de clonagem (locais de clonagem mltipla) e no caso dos vectores de expresso foram introduzidos promotores de expresso fortes a montante do local de clonagem. Deste modo, para serem teis em Biologia Molecular, os plasmdeos devem possuir: (i) uma origem de replicao, estando esta, se possvel, sob controlo relaxado, permitindo a replicao autnoma independente do cromossoma bacteriano, originando vrias cpias de plasmdeo por clula. (ii) locais de corte nico para enzimas de restrio de classe II, permitindo linearizar o plasmdeo, introduzir no local de corte o fragmento de DNA estranho de interesse, e recircularizar a molcula resultante. (iii) genes responsveis por resistncia a antibiticos, permitindo assim seleccionar facilmente as clulas portadoras do plasmdeo. (iv) locais de corte nico referidos em (ii) dentro de um ou mais dos genes referidos em (iii), permitindo a seleco de clulas contendo o plasmdeo recombinante, uma vez que o gene fica inactivo pela insero. O primeiro passo na utilizao deste tipo de vectores , obviamente, o seu isolamento da bactria hospedeira. Este trabalho tem como objectivo a preparao em pequena escala, para uso de rotina, do plasmdeo pSK-polo de E. coli. A estratgia de purificao de plasmdeos, a partir de uma cultura bacteriana, muito semelhante estratgia utilizada na preparao de DNA genmico. No entanto, na preparao de plasmdeos necessrio separar o DNA plasmdico da enorme quantidade de DNA cromossomal, que tambm est presente nas clulas bacterianas. Devido sua dimenso e s formas conformacionais que pode adquirir, particularmente a forma circular fechada - denominada cccDNA (covalently-closed-circular DNA), o DNA plasmdico pode ser facilmente separado do DNA cromossmico. Quando a lise bacteriana efectuada em condies cuidadosamente controladas, a maioria do DNA cromossmico sedimentado com os resduos celulares atravs de uma centrifugao, deixando o DNA plasmdico em soluo. Alternativamente, o DNA cromossmico pode ser desnaturado a pH bsico (Birnboim & Doly, 1979) ou por 11

fervura rpida (Holmes & Quigley, 1981), originando cadeias simples de DNA. Aps a neutralizao, ou o arrefecimento, a desnaturao do cccDNA plasmdico facilmente reversvel, no acontecendo o mesmo com o DNA cromossmico, o que vai permitir a sua fcil separao. Em qualquer dos casos, para uma purificao completa, necessria uma desproteinizao da soluo, assim como de outros passos suplementares de purificao. Neste trabalho, ser seguido para isolamento de DNA plasmdico: o procedimento de minipreparao de DNA por fervura rpida, vulgarmente denominado miniprep ,o qual correntemente utilizado no isolamento de pequenas quantidades de DNA parcialmente purificado (1 - 5 g). 1. Extraco de DNA plasmdico de Escherichia coli (miniprep)

Inoculao da estirpe de E. coli (contendo o plasmdeo a purificar) em 10 ml de meio LB contendo o antibitico apropriado na concentrao desejada.

2 3

Incubar a 37C durante a noite sob agitao. Colocar 1,5 ml de cultura num tubo Eppendorf e centrifugar as clulas a durante 3 minutos velocidade mxima numa microcentrifuga. Aspirar o sobrenadante com uma micropipeta.

Adicionar mais 1.5 ml da cultura bacteriana ao sedimento obtido e repetir o passo 1.

Adicionar 200 l de tampo STET e ressuspender o sedimento com uma micropipeta ou vortex.

Adicionar 4 l de lisozima (a 50 mg/ml) e incubar temperatura ambiente durante 5 minutos.

7 8

Incubar a 95C durante 1 minuto. Centrifugar o lisado celular durante 10 minutos velocidade mxima na microcentrifuga.

Descartar o sedimento e adicionar 200 l de isopropanol ao sobrenadante e vortexar.

12

10 Centrifugar velocidade mxima durante 10 minutos. 11 Aspirar o sobrenadante com uma micropipeta e deixar secar o sedimento (DNA plasmdico) ao ar durante 30 minutos ou na estufa a 37C durante 10 minutos. 12 Ressuspender o DNA em 30 l da gua ultra-pura. 13 Verificar o estado da preparao plasmdica por electroforese em gel de agarose 1%. Aplicar 5 l da amostra misturados com 5 l de tampo de aplicao.

Aplicar tambm em gel de agarose a amostra de DNA genmico isolada na aula anterior.

Electroforese de DNA em gel de agarose A electroforese de DNA consiste na separao de diferentes fragmentos de DNA de acordo com as suas diferentes mobilidades num campo elctrico. A electroforese pode ser analtica, tendo por objectivo a anlise de determinada amostra de DNA por identificao de fragmentos constituintes, quantificao e determinao do peso molecular. Este mtodo pode tambm ser utilizado como um mtodo preparativo para separar e purificar fragmentos de DNA especficos. As bandas de DNA podem ser directamente visualizadas no gel de agarose atravs da colorao com brometo de etdio, permitindo a deteco, no mnimo, de 1 ng. Num campo elctrico, definido pela diferena de potencial em Volts e pela distncia entre os etctrodos em centmetros (V/cm), as molculas de DNA migram para o elctrodo positivo (nodo) devido s cargas negativas dos grupos fosfato. Esta migrao retardada pelo atrito das molculas com o suporte da electroforese. Sendo a relao carga/massa igual para os diferentes fragmentos de DNA, o parmetro principal a condicionar a migrao do DNA a dimenso dos fragmentos. A mobilidade dos diferentes fragmentos varia de forma inversamente proporcional ao logaritmo decimal do peso molecular (numero de pares de bases), dado o maior atrito com a matriz com o aumento do nmero de pares de bases. A conformao do DNA igualmente um

13

parmetro importante a ter em conta na migrao do DNA. Consideram-se trs conformaes do DNA: forma I o DNA circular fechado (cccDNA, covalently closed circular DNA); forma II o DNA circular com uma quebra numa ligao fosfodister (nicked); forma III o DNA linear em cadeia dupla (dsDNA, double stranded DNA). Duma maneira geral, sob condies normais, cccDNA migra mais rapidamente do que os fragmentos do mesmo tamanho de dsDNA porque a conformao circular tem menor raio hidrodinmico devido aos super enrolamentos. Na forma II, os enrolamentos desaparecem devido quebra de uma ligao fosfodister o que faz com que seja a forma mais lenta de migrao dado apresentar o maior raio hidrodinmico. A distncia de migrao dos vrios fragmentos depende tambm da voltagem aplicada e da concentrao de agarose empregue. Pelas mesmas razes da influncia do peso molecular na mobilidade, o aumento da concentrao da agarose leva a um retardamento da migrao electrofortica. A concentrao de agarose a usar deve ser adaptada gama de tamanhos de fragmentos que se pretende resolver. Para a visualizao do DNA aps a corrida, usa-se brometo de etdeo como corante especifico do DNA por ter a capacidade de se intercalar entre pares de bases. Sob radiao ultra-violeta, o brometo de etdeo emite fluorescncia, surgindo corado apenas o DNA. 2. Preparao de gel de agarose 1% para separao electrofortica do DNA genmico isolado. 1. Pesar 0,4g de agarose para um matraz e adicionar 40 ml de tampo 1xTAE. 2. Num forno micro-ondas, aquecer 30 segundos o tampo e a agarose at esta se dissolver totalmente. 3. Depois de arrefecer a soluo de agarose, adicionar 1l de soluo de brometo de etdeo (10 mg/ml). 4. A soluo de agarose ainda fundida vertida sobre um molde, utilizando-se um pente para a formao dos poos, onde sero colocadas as amostras de DNA. O gel deixado arrefecer para que solidifique. 5. Cuidadosamente remover o pente e colocar o gel na tina de electroforese submergido em tampo 1xTAE. 6. Aps colocao do tabuleiro na tina de electroforese, cobrir o gel com tampo de electroforese, 1 a 2 mm acima da superfcie do gel. 14

7. amostra de DNA, misturar o tampo de aplicao (Azul bromofenol 0,25% (p/v); Glicerol 0,30% (p/v)) numa relao de 5l de tampo por cada 10 l de amostra. 8. Aplicar cuidadosamente as amostras e o marcador de pesos moleculares nos respectivos poos. 9. Quando todas as amostras tiverem sido aplicadas, colocar a tampa da tina e conectar os cabos fonte de alimentao. 10. As electroforeses so realizadas a voltagem constante, do elctrodo negativo para o positivo.
Visualizao

11. No final da electroforese, retirar o gel da tina de electroforese, drenar o excesso de tampo e vizualizar num transiluminador de U.V. 12. Tomando como referncia a distncia (mm) percorrida pelos fragmentos de DNA padro, cujas dimenses so conhecidas (pb), construr em papel semilogartmico, um grfico do log dos fragmentos do DNA padro vs. a mobilidade no gel dos fragmentos. 13. Tomando a distncia percorrida pelo DNA amostra e aplicando esse valor no grfico determinar as dimenses dos fragmentos do DNA da amostra. Alternativamente, utilizando a equao da recta da calibrao, determinar as dimenses dos fragmentos.

O fenol um forte oxidante. Evitar inalar e contacto com a pele. Colocar os resduos
de fenol e o material com que tenha entrado em recipientes prprios.

O brometo de etdeo um agente mutagnico potente, usar sempre luvas e colocar


em recipiente prprio todo o material que tenha entrado em contacto com este corante

As radiaes U.V. so extremamente perigosas, particularmente para os olhos,

provocando leses na retina. Evitar qualquer exposio dos olhos a estas radiaes.

15

AULA 3 Anlise electrofortica de DNA digerido com enzimas de restrio


Os rpidos avanos da investigao cientifica, em particular da Biologia Molecular, que tiveram lugar nas duas ultimas dcadas foram possveis em grande parte, devido capacidade de isolar determinados segmentos de interesse de DNA procaritico e eucaritico. A clonagem de genes requer que as molculas de DNA sejam cortadas de um modo muito preciso e reprodutvel. Atravs da utilizao das enzimas de restrio esse objectivo facilmente conseguido, pois possuem a capacidade de ligao especfica a determinados locais de DNA de cadeia dupla (sequncia de reconhecimento) e sua posterior clivagem, no interior dessa sequncia ou adjacente a ela. De acordo com as caractersticas de corte, as endonucleases de restrio so classificadas em trs tipos. As enzimas do tipo I e III, para alm da aco nuclesica, tm aco modificadora (metilao) no mesmo domnio de reconhecimento da protena. Apesar destas enzimas reconhecerem sequencias especificas de DNA, a actividade nuclesica ocorre de modo aleatrio na proximidade da sequencia de reconhecimento e dependente de ATP. Acresce que as enzimas do tipo III apenas efectuam metilao numa das cadeias. Por estas razes, as enzimas do tipo I e III no so frequentemente usadas em investigao de rotina em Biologia Molecular. As endonucleases de restrio de tipo II so sistemas binrios em que uma das subunidades tem aco nuclesica e a outra de metilao. Ambas as aces so efectuadas em locais especficos dentro da sequncia reconhecida. A maior parte das enzimas de restrio do tipo II, reconhecem sequncias com 4 8 pares de bases com simetria palindrmica. A enzima EcoRI (produzida por Escherichia coli) reconhece a sequncia GAATTC, enquanto AluI (produzida por Arthrobacter luteus) corta em AGCT. Como h especificidade para o local de corte, estas enzimas podem ser usadas

16

para a degradao de molculas de DNA com obteno de fragmentos de menor tamanho, cujas extremidades so conhecidas em termos de sequncia nucleotdica. As sequncias das extremidades e o tamanho dos fragmentos obtidos variam de acordo com a enzima de restrio usada. Dada a possibilidade de manipulao em locais especficos do DNA, as enzimas de restrio constituem nos dias de hoje, ferramentas bsicas em Biologia Molecular. Duma maneira geral, so usadas para o estabelecimento de mapas de restrio de fragmentos de DNA cuja sequncia desconhecida, fragmentao de DNA genmico para separao electrofortica e posterior anlise, criao de fragmentos de DNA para subclonagem num vector apropriado e a criao de sondas marcadas para anlises por southern e northern. Existem trs tipos de extremidade resultantes do corte consoante o modo de corte da cadeia dupla. Enzimas de restrio que cortam exactamente no meio da sequncia do palindroma (Sma I) originam extremidades sem nenhuma das duas cadeias protuberante (blunt ends). Outras enzimas cortam na extremidade 5do palindroma reconhecido originando extremidades protuberantes 5de 2-4 bases na forma de cadeia simples (EcoRI) denominadas por extremidades 5coesivas (5 sticky-ends). Outras enzimas cortam na extremidade 3do palindroma originando extremidades protuberantes 3de 2-4 bases na forma de cadeia simples (KpnI) denominadas por extremidades 3 coesivas (3 sticky-ends).

17

Como estas enzimas de restrio so, na sua maioria, especficas em relao sequncia de reconhecimento e corte, duas molculas de DNA diferentes que foram digeridas com a mesma enzima, por exemplo BamHI, possuiro extremidades 5 iguais que podem assim emparelhar utilizando as bases que ficaram em cadeia simples, numa reaco catalisada por uma DNA Ligase. O resultado da ligao destas duas cadeias ser uma molcula recombinante.

18

Dois factores so essenciais para a eficincia de corte das endonucleases de restrio: pureza do DNA e o tampo de digesto. As impurezas habituais presentes em amostras de DNA (protenas, fenol, clorofrmio, EDTA, SDS e a elevada concentrao de sais) podem inibir por completo determinadas enzimas de restrio. A influncia de todos estes factores varia de enzima para enzima, pelo que se devem ter em conta quando se verifica ausncia de actividade, assegurando-se que as condies de reaco foram as ideais. Os componentes essenciais dos tampes de digesto so: tampo Tris (pH 7.58.0), ies de magnsio, cloro, sdio, e potssio; um agente redutor como ditioeritriol, ditiotreitol ou 2-mercaptoetanol. Embora haja especificidade da actividade em relao a todos estes factores, o mais importante a concentrao de ies (fora inica). Assim, dividem-se as enzimas em trs gupos: as que requerem elevada fora inica, mdia fora inica e baixa fora inica. Esta propriedade particularmente importante para digestes com vrias enzimas de restrio em que impossvel a digesto simultnea com enzimas que requerem foras inicas diferentes. Nestes casos, as digestes devem ser feitas em separado, comeando pela enzima de menor fora inica, desnaturar a enzima por calor, ajustar a concentrao de sais e proceder segunda digesto. As consequncias do uso de condies no ideais em digestes com enzimas de restrio

19

so a ausncia de actividade ou o fenmeno de star activity em que a enzima perde a especificidade para a sequncia de reconhecimento, passando a fazer cortes no s nos locais especficos mas tambm noutros locais. Um factor que pode ser importante em alguns casos o grau de metilao do DNA. A produo de enzimas de restrio um mecanismo de defesa das bactrias contra a infeco por DNA exgeno. Para precaver a aco contra o prprio DNA, estas enzimas de restrio promovem a metilao de nucletidos, ficando ento a sequncia de reconhecimento imune sua aco. Assim, quando se trabalha com DNA plasmdico proveniente de estirpes bacterianas com uma elevada capacidade de metilao, deve-se ter em ateno, tambm, a sensibilidade da enzima a usar para a metilao dos nucletidos da sequncia de reconhecimento. A estratgia mais usada o uso de estirpes bacterianas manipuladas geneticamente para a perda dessa capacidade. A acrescentar aos cuidados a ter nas condies de digesto, as enzimas de restrio so extremamente instveis e de elevado preo. Assim, devem-se cumprir normas rigorosas para evitar desperdcios e perdas de actividade. Normas de utilizao das enzimas de restrio a) As enzimas de restrio so extremamente caras e susceptveis de contaminao. Colocar as enzimas SEMPRE NO GELO (ou no Stratacooler). Aps cada utilizao coloc-las novamente a -20C. b) No contaminar as enzimas entre si ou com o DNA: para isso utilizar sempre tips novas e esterilizadas todas as vezes que retirar enzima do recipiente onde se encontra. c) 1 unidade de enzima de restrio define-se como a quantidade necessria para a digesto completa de 1g de DNA, durante 1 h, nas condies recomendadas de tamponamento do meio e de temperatura. d) Quando pretendida a anlise imediata em gel dos produtos digeridos, so utilizados pequenos volumes de reaco. Para digestes de grandes quantidades de DNA, ou nos casos em que a enzima se encontra muito diluda, esta no pode contribuir com mais de 10% do total do volume da reaco, pois o glicerol em que esta se encontra armazenada pode inibir a sua actividade. 1. Digesto de DNA plasmdico com enzimas de restrio 20

1. Pipetar para um tubo eppendorf, usando pontas de pipeta diferentes e limpas, por esta ordem: 15l de H2O destilada e esterilizada 2l de 5tampo de enzima de restrio 2l de DNA plasmdico 1l de enzima de restrio (EcoRI, HindIII) Misturar cuidadosamente batendo levemente com o dedo no fundo do tubo. 2. Incubar a 37 C durante 1 hora 3. Preparar um gel 1% de agarose (40 mL) 4. Preparar as amostras para carregar o gel em trs tubos eppendorf: 5 l de marcador de peso molecular ( Bioline) 5 l de DNA no digerido + 5 l de tampo de aplicao 20 l de DNA digerido + 5 l de tampo de aplicao 5. Carregar o gel com as trs amostras 6. Correr o gel a 100V at a frente do gel chegar a cerca de dois teros do gel. 7. Visualizar o DNA num transiluminador de U.V.

5l HyperLadder/lane, 1% agarose

21

AULA 4 Elaborao do mapa de restrio de um plasmdeo

recombinante
O isolamento de genes envolve, normalmente, o rastreio de bancos de DNA genmico clonados em vectores apropriados. Uma vez que estes fragmentos de DNA so quase sempre, demasiado grandes para poderem ser manuseados directamente, de interesse obter fragmentos de menores dimenso que permitam o seu estudo e manipulao posteriores. As utilizao de enzimas de restrio que cortam o DNA em sequncias especificas permite a construo de mapas fsicos ao longo da molcula de DNA, por originarem fragmentos menores em que o peso molecular determinado em gel de agarose e a sequencia nucletidica das extremidades conhecida (corresponde sequencia de reconhecimento da enzima de restrio utilizada na reaco). A construo de mapas de restrio detalhados possibilita a escolha da fragmentos de DNA de menores dimenses que podem ser subclonados para trabalhos posteriores. Os mapas de restrio para alm de permitirem a localizao fsica do local de corte de vrias enzimas ao longo do DNA so igualmente teis na identificao de fragmentos de DNA homlogos entre outras potenciais aplicaes. Neste trabalho pretende-se a elaborao do mapa de restrio de um plasmdeo recombinante que contm um gene que codifica para uma subunidade da enzima NADH desidrogenase da cadeia respiratria. Dois fragmentos de DNA (L e R) foram inseridos no plasmdeo pGEM-3. Elaborar para cada uma das molculas recombinantes o mapa de restrio com base na anlise do peso molecular dos fragmentos obtidos aps digesto de cada plasmdeo recombinante com as enzimas de restrio SalI, HindIII, PstI, XhoI, PvuII, SacI e BamHI.

22

PCR Polimerase Chain Reaction Trabalho 5


Instituto de Cincias Bioqumicas Abel Salazar Universidade do Porto 2006/2007

23

24

25

AULA 5 PCR Polimerase Chain Reaction


A reaco de polimerase em cadeia (PCR) um mtodo rpido que permite a amplificao in vitro de um segmento especifico de DNA ou RNA. Tal como a clonagem molecular, a tcnica de PCR permitiu a concretizao de ensaios e trabalhos moleculares que at ento seriam impossveis. O numero de aplicaes do PCR parece ser infinito, estando ainda em crescimento. Incluem a clonagem directa a partir de DNA genmico ou cDNA, mutagenese in vitro e engenharia gentica do DNA; fingerprinting de amostras forenses; ensaios para a determinao da presena de agentes infecciosos, diagnostico pr-natal de doenas genticas, anlise de variaes de sequencias alelicas, anlise da estrutura de transcritos de RNA, footprinting genmico, e sequenciao directa de DNA genmico e cDNA.

26

A base terica da reaco de PCR para a amplificao de um dado segmento de DNA encontra-se representada na figura. Neste processo explorada a actividade cataltica de uma DNA polimerase e envolve dois iniciadores oligonucleotdicos (primers), que flanqueiam o fragmento de DNA a ser amplificado (sequncia alvo), e sucessivos ciclos de aquecimento e arrefecimento. Cada ciclo da reaco envolve desnaturao de DNA de cadeia dupla (promovida por aquecimento), hibridao dos primers s suas sequncias complementares e extenso destes com a referida DNA polimerase. Nucletidos so adicionados s extremidades 3' dos primers, de acordo com o molde de DNA alvo. Cada segmento de DNA sintetizado de novo, cuja extremidade 5' no mais do que o primer, torna-se uma nova sequncia alvo para um novo ciclo, o que resulta numa amplificao exponencial do DNA alvo original. O primeiro ciclo resulta na sntese de novas cadeias de tamanho indeterminado, que tal como as cadeias moldes, vo hibridar com os primers. No entanto estes produtos so apenas acumulados aritmeticamente com os subsequentes ciclos de desnaturao, hibridao e extenso, pelo que pouco contribuem para o produto final da reaco de PCR. Aps uma srie de hibridaes de primers, extenses e dissociaes dos produtos formados, o comprimento das cadeias de DNA amplificadas ser fixo, porque as suas extremidades sero definidas pelas extremidades 5' dos primers oligonucleotdicos. Apesar de ser necessria a optimizao de muitas variveis para a execuo correcta de uma reaco de PCR, o parmetro mais critico normalmente o correcto desenho dos primers a usar na reaco. A escolha correcta dos primers dita frequentemente o sucesso ou insucesso da amplificao. Deste modo, o desenho atento e cuidado dos primers a usar pode poupar tempo valioso de investigao e simultaneamente reduzir os custos do trabalho. A maior parte das regras para o desenho de primers so empricas sem garantia de sucesso. No entanto, o seu cumprimento ir 27

aumentar significativamente a probabilidade de um PCR com sucesso. Vrios parmetros devem ser tomados em considerao para garantir uma correcta hibridao dos primers. O primeiro destes a escolha de primers que possuam uma sequncia nica na regio a ser amplificada. A sequncia do primer deve complementar correctamente a sequncia de bases da cadeia molde. O segundo parmetro a ser considerado a incluso de um resduo G ou C na terminao 3do primer. O G-C clamp que se forma ajuda a uma correcta hibridao na terminao 3 (devido s fortes pontes de hidrognio entre os pares de bases G/C) e eficiente extenso da nova cadeia. No entanto, a presena de mais de trs G ou C seguidos na terminao 3deve ser evitada. Os primers devem ser desenhados sem qualquer homologia entre eles de modo a impedir a hiptese de emparelhamento entre ambos. Minimizar a formao de hbridos parciais entre os pares de primers essencial uma vez que estes dimeros sero sintetizados preferencialmente em relao a qualquer outro produto de PCR desejado. Auto-complementaridade entre sequencias (com mais de 4 bases) contguas no primer indesejada de modo a evitar a formao de estruturas secundrias no primer (hairpins).

28

A composio de bases do primer um importante parmetro a ser considerado. De um modo geral os primers devero possuir entre 17 a 25 nucletidos e um contedo em G/C entre 45 e 55%. igualmente importante possuir pares de primers com temperaturas de hibridao (Tm) semelhantes. A temperatura de hibridao depende directamente da dimenso e composio do primer e pode ser calculada pela expresso:

Tm = (n G+C 4C) + (n A+T 2C)

A Tm calculada para ambos os primers da reaco no dever diferir em mais de 5 C. Em Drosophila melanogaster, o gene polo, codifica uma protena cinase necessria para a correcta progresso da mitose celular. Neste trabalho, a partir da sequncia de cDNA fornecida, os alunos tero de desenhar primers destinados amplificao por PCR do gene polo. Recorrendo reaco de PCR a partir de DNA genmico e de cDNA os alunos tero de inferir sobre a presena de regies intrnicas na sequencia do gene.

1. Procedimento experimental A Desenho dos primers 1. Desenhar os primers oligonucleotdeos 9R1 (sense primer) e 9R2IC

(antisense primer) obedecendo s regras para a correcta escolha de primers 2. Calcular a temperatura de hibridao dos primers .(Tm) de acordo com a

formula fornecida.

29

Para o primer sense considerar a sequncia: 5 AGCTATGCTATGCTATGCTAGCCAGTCAGCTGAACGTG 3

Para o primer antisense considerar a sequncia: 5 TCTAATTCCAAGCCAATTGCCAAAAAGGAACCG 3

B Amplificao por PCR 1. Preparar as misturas de reaco num tubo de PCR de acordo com a seguite composio para um volume de reaco final de 50 l:

cDNA 1 ng, DNA genmico 5 ng Primers: 0,1 M 9R1 0,1 M 9R2IC dNTPs : 200 M Tampo de reaco 1 Taq DNA polimerase: 0,25 U Perfazer o volume com H2O ultrapura estril. Nota: Adicionar todos os componentes da mistura, excepto a Taq polimerase. Misturar suavemente e centrifugar. S ento aplicar a Taq polimerase, que dever ser misturada muito suavemente com a ponta da pipeta.

Quadro resumo das quantidades a usar: Mistura de reao


cDNA gDNA Tampo da reao 5x Primer1 Primer 2 dNTPs

Volume (ul)
1 5 1 1 8

Volume (ul)
1 5 1 1 8

30

Mgcl2 dH2O Taq polimerase Volume total da reao

6 x 0,25 50

6 x 0,25 50

2. Colocar os vrios tubos no suporte do amplificador termocclico e efectuar um programa com 40 ciclos e com a seguinte sequncia de temperaturas: Desnaturao Hibridao Extenso aps o ltimo ciclo: 94C -15 segundos 50C - 30 segundos 72C - 1 minuto 72C - 10 minutos

3. Retirar os tubos do termo-amplificador e coloc-los a 4C. 4. Efectuar uma electroforese em gel de agarose 1 %. Registar os resultados

AULA 6 Transformao de Escherichia coli com DNA plasmdico


Transformao o processo de introduo de DNA em clulas. Esta tcnica foi inicialmente explorada em estudos clssicos de gentica. Com o avano da engenharia 31

gentica, a transformao de bactrias com plasmdeos recombinantes tornou-se uma tcnica bsica de extrema importncia para a amplificao de fragmentos de DNA especficos. A primeira descrio de trasnformao de E. coli data de 1970 quando Mandel e Higa demonstraram que clulas de E. coli tratadas com solues geladas de cloreto de clcio e depois brevemente aquecidas, podiam importar para o seu interior DNA do bacterifago . Embora nunca se tenha conseguido compreender o mecanismo de transformao, est bem estabelecido que a exposio de clulas de E. coli a caties na presena de baixas temperaturas induz um estado de competncia em que as clulas so capazes de importar DNA exgeno. Atravs da experimentao emprica, o processo de transformao foi modificado para melhorar a eficincia e reprodutibilidade de modo a adaptar esta tcnica rotina da Biologia Molecular. Assim, foram feitas modificaes no tempo de exposio das clulas ao clcio; foram usados outros caties como o rubdio, mangans e potssio, e a adio de outros compostos como o dimetilsulfxido, ditiotreiol ou cobalto de hexamina. Muitas das alteraes introduzidas levaram a uma melhoria da eficincia embora, por vezes, sem se conseguir explicar as razes, sendo frequente a adopo de protocolos diferentes de acordo com o laboratrio e tambm de acordo com o experimentador. Neste trabalho, efectuado o processo qumico de transformao mais usado-a tcnica clssica que utiliza cloreto de clcio para a preparao de clulas competentes. Neste mtodo as clulas so cultivadas at meio da fase exponencial, lavadas e concentradas com uma soluo de cloreto de clcio. O DNA adicionado suspenso e depois as clulas so sujeitas a um choque trmico. Aps breve incubao em meio no selectivo, so espalhadas em placa com meio selectivo. A eficincia da transformao calculada em funo do n de transformantes por g de DNA. Na transformao com o mtodo do cloreto de clcio podem ser obtidas eficincias superiores a 108 transformantes/g DNA. No entanto, em rotina laboratorial de esperar obter valores na ordem dos 106-7 transformantes/g DNA. Para obter uma boa eficincia do processo de transformao vrios factores so essenciais: colheita das clulas na fase exponencial de crescimento; manuteno das clulas no gelo; contacto prolongado das clulas com cloreto de clcio e o uso de reagentes de mxima pureza e limpeza do material. Se qualquer destes parmetros no for cumprido, a eficincia da transformao pode ser drasticamente reduzida. Imediatamente a seguir transformao por choque trmico, adicionado meio no selectivo s clulas e procede-se a uma breve incubao (30-60 min a 37 C) para 32

que ocorra expresso do gene plasmdico de resistncia ao antibitico, de modo a haver suficiente protena sintetizada para conferir resistncia no momento em que as clulas forem plaqueadas no meio selectivo. No caso frequente de seleco de transformantes resistentes ampicilina, o gene plasmdico que confere a resistncia codifica a enzima -lactamase responsvel pela degradao do antibitico. Depois de sintetizada, esta enzima segregada para o exterior celular, formando-se uma zona em redor das colnias transformantes com menor concentrao de antibitico. Assim, em placas com incubao muito prolongada, pode ocorrer o surgimento de colnias satlite, identificveis por serem muito pequenas comparativamente s colnias de transformantes, e que so resultantes do crescimento de clulas no transformadas, mas que deste modo so viveis no meio selectivo. Foram construdos dois plasmdeos diferentes a utilizar neste trabalho, de forma a exemplificar os tipos de vectores usados e como seleccionar clulas transformadas com plasmdeos recombinantes. O plasmdeo clssico pBR322 na sua forma original possui genes responsveis pela resistncia tetraciclina e ampicilina. Este plasmdeo foi modificado dando origem ao plasmdeo pBR322-CAT, o qual tem inserido o gene CAT (codifica a enzima bacteriana Clornfenicol acetil transferase) no local do gene que codifica a resistncia tetraciclina que fica assim inactivo. O segundo plasmdeo, pEMBL9, pertence a uma nova gerao de vectores onde a insero de fragmentos de DNA se d num polylinker localizado na extremidade 5 do gene que codifica a enzima -galactosidase. O plasmdeo contem tambm todos os elementos do promotor necessrios induo da expresso desta enzima nas bactrias transformadas com este plasmdeo quando expostas lactose, o seu indutor natural. Quando as clulas transformadas com este plasmdeo so cultivadas em meio MacConkey/Lactose/Ampicilina, a lactose induz a expresso da -galactosidase, permitindo a sua metabolizao com produo de substncias acdicas que vo alterar o pH do meio em torno da colnia. Esta alterao de pH identificada por um indicador (neutral red) no agar de MacConkey, produzindo colnias vermelhas. No meio Mac/Lac/Amp, colnias de bactrias com plasmdeos contendo um fragmento exgeno inserido no polylinker, e que portanto no possuem actividade -gal, adquirem uma cor amarela. O plasmdeo pEMBL-CAT foi construdo pela insero, nos locais BamHI e HindIII, do gene CAT. A clonagem deste gene no polylinker permite estudar a induo da sua expresso em resposta presena de lactose no meio. A correcta induo do CAT 33

permite que as clulas portadoras deste gene sejam resistentes ao cloranfenicol quando crescidas na presena de lactose. Material: Escherichia coli JM101 Plasmdeos: - pEMBL9 - pMEBL9-CAT - pBR322 - pBR322-CAT Meios de Cultura: - LB - LA - Mac/Lac Placas de cultura: - LA/Amp - LA/Amp/Tet - Mac/Lac/Cloranfenicol

1. Preparao de clulas competentes 1. 2. 3. Inocular 50 ml de LB com a estirpe apropriada de E. coli e incubar a 37 C Inocular 200 ml de LB, previamente aquecido a 37 C, com 2 ml da cultura Colocar a cultura em tubos pr-arrefecidos e deixar no gelo durante 15 34 com agitao durante a noite. anterior e incubar a 37 C com agitao, at DO600 de 0,2-0,375.

minutos. 4. 5. Centrifugar a 3000 rpm durante 15 minutos, a 4C. Cuidadosamente decantar o sobrenadante e ressuspender lentamente o

sedimento em 20 ml de uma soluo 100 mM CaCl2 (previamente arrefecida). Incubar no gelo durante 20 minutos. 6. 7. Centrifugar novamente a 3000 rpm durante 15 minutos, a 4C. Ressuspender as clulas em 0.5 ml de soluo 100 mM CaCl2 (a 4 C). Nota: A eficincia de transformao aumenta consideravelmente durante a incubao em gelo at 24 horas. Aps este perodo, as clulas perdem rapidamente a sua competncia. Para manter as clulas competentes durante mais tempo, adiciona-se glicerol (concentrao final 10% v/v) s clulas competentes e congela-se a mistura a -70C. 2. Transformao 1. Descongelar uma alquota de clulas E. coli JM101 competentes em gelo. 2. 3. pipeta. Tubo n 1 2 3 4 5 4. 5. 6. Incubar em gelo durante 20 minutos. Provocar um choque trmico s clulas, colocando o microtubo num banho a 42 C durante 2 minutos. Colocar novamente em gelo, durante 2 minutos. 7. Adicionar 200 l de meio LB e incubar a 37 C durante 30 minutos 35 Plasmdeo pEMBL9 pEMBL9-CAT pBR322 pBR322-CAT Nenhum (tubo contendo apenas clulas) Alquotar 5 l de soluo de DNA plasmdico em quatro microtubos A cada microtubo, adicionar 50 l de clulas competentes (microtubo identificados com o nome do plasmdeo. Manter os tubos em gelo. no identificado) e misturar com movimentos circulares com a ponta da

Incubar em gelo durante 4-24 horas.

com agitao. 8. Plaquear as clulas de acordo com a seguinte tabela:

Tubo n 1

Volume (l) 125 125

Meio de cultura Mac/Lac/Amp LA/Amp Mac/Lac/Amp LA/Amp LA/Amp/Tet LA/Amp LA/Amp/Tet LA/Amp LA/Amp

125 125

125 125

125 125

125

9.

Incubar as placas de petri a 37 C durante a noite. 10. Tomar nota do nmero e cor das colnias crescidas em cada uma das placas com meio Mac/Lac

11.

Para induzir a expresso do gene CAT e testar a resistncia das

clulas ao cloranfenicol, transferir, com palitos esterelizados, 10 colnias individuais (das placas crescidas no meio inicial fornecidas) para novos meios de acordo com a seguinte tabela:

36

Plasmdeo pEMBL9 pEMBL9-CAT pBR322-CAT 12. 13.

Meio inicial LA/Amp LA/Amp LA/Amp

Novo meio Mac/Lac/Clo Mac/Lac/Clo Mac/Lac/Clo

Incubar as placas a 37C durante a noite e verificar o crescimento das Determine as eficincias de transformao para os 4 plasmdeos.

colnias nos diferentes meios. Observe as diferenas nos vrios meios em que as 4 estirpes foram plaqueadas. Verifique se h ou no induo da expresso do gene CAT em meio com lactose.

AULA 7 Sequenciao de DNA


O sucesso da clonagem de um dado gene de interesse apenas o incio de uma segunda etapa de anlises que tm como propsito final a caracterizao estrutural e 37

funcional desse gene. Determinar a sequencia nucletidica de um gene de extrema importncia, uma vez que esta representa em ultima anlise a caracterizao da sua estrutura gentica. Um dos requerimentos para a sequenciao de DNA a capacidade de obter fragmentos definidos de DNA. Deste modo, existe uma forte interdependncia entre a clonagem e a sequenciao de DNA, uma vez que a clonagem possibilita a obteno de um elevado numero de amostras de fragmentos definidos de DNA. No contexto da tecnologia de DNA recombinante, o conhecimento da sequencia de DNA um pr-requisito para a sua posterior manipulao. A sequenciao do DNA seguida da procura assistida por software de locais de restrio frequentemente o meio mais rpido para a obteno de mapas de restrio extremamente detalhados. Esta informao particularmente til quando vectores, destinados superexpresso de protenas ou construo de fuses proteicas, so utilizados para a subclonagem do gene de interesse. Determinada a sequencia nucletidica, recorre-se identificao assistida por software das regies codificantes (ORFs) para posterior alinhamento com sequncias nucletidicas e aminoacdicas registadas nas bases de dados. Geram-se assim importantes pistas acerca da funo e estrutura do gene clonado e do seu produto, bem como da relao evolutiva com genes semelhantes. O conhecimento da sequencia de DNA igualmente um pr-requisito para uma anlise detalhada das regies regulatrias no-codificantes 5e 3 de um dado gene (auxiliando assim na pesquisa de mecanismos de regulao da expresso do gene) e para a potencial aplicao de mutagnese dirigida. Aplicaes da sequenciao de cidos nucleicos incluem ainda a deteco de alteraes no DNA que sejam relevantes em doenas genticas, bem como o conhecimento de regies alvo na sequencia para uma aco mais eficaz de um dado frmaco na protena resultante. Em meados da dcada de 70, quando as tcnicas de clonagem molecular comearam a dar bons resultados, foram tambm desenvolvidos mtodos simples para determinar a sequncia de nucletidos do DNA. O investigador Robert Holley, tinha criado cerca de 10 anos antes, um mtodo de sequenciao de tRNA que foi inmeras vezes aplicado ao DNA nos anos 70, mas os resultados eram desanimadores. Nas Universidades de Harvard e de Cambridge, os investigadores Gilbert e Sanger, respectivamente, trabalharam durante longos anos na descoberta de um mtodo de sequenciao de DNA. Como resultado dos seus trabalhos surgiram duas tcnicas de sequenciao: o mtodo da degradao qumica de Maxam e Gilbert e o mtodo enzimtico de Sanger. Embora muito diferentes no que respeita a princpios, ambos os 38

mtodos geram populaes de oligonucletidos que comeam num ponto fixo e terminam num resduo particular. Os pontos de terminao so nucletidos especficos, mas ocorrem aleatoriamente ao longo do DNA. Quatro tipos de populaes de fragmentos podem ser criados durante a reaco, populaes essas que terminam no nucletido A, C, G ou T. Em cada uma destas populaes existiro no final da reaco inmeros fragmentos de DNA tendo cada um deles um tamanho diferente. Estas populaes de DNA so visualizadas por electroforese em gel desnaturante de poliacrilamida em condies que permitem diferenciar fragmentos cujo comprimento difere em apenas um nucletido. As quatro populaes correm lado a lado em gel e no final do processo a ordem dos nucletidos pode ser lida pela imagem observada no gel. O mtodo de Gilbert, actualmente em desuso, baseia-se na marcao radioactiva de um dos extremos do fragmento de ADN e sua subsequente degradao parcial atravs de reaces especficas para determinadas bases do DNA. Deste modo, a posio de cada base na cadeia de ADN poderia ser determinada medindo a distncia entre o ponto de degradao e a extremidade radioactiva visualizada por autoradiografia.

O mtodo de terminao das cadeias de Sanger de longe o mais difundido na sequenciao de DNA. Esta tcnica caracteriza-se pelo uso de didesoxinucletidos (ddNTPs) que uma vez incorporados nas cadeias de DNA crescente impedem a sua extenso pela DNA polimerase. Este tipo de nucletidos em vez do grupo OH em C3, que estabelece a ligao fosfodister com o nucletido vizinho, tm um tomo de H que impede a formao dessa ligao obrigando o alongamento da cadeia a terminar nesse

39

ponto. Neste mtodo, um primer hibridiza com uma regio de uma cadeia simples de DNA e so efectuadas quatro reaces diferentes em que est presente uma DNA polimerase e os 4 desoxirribonucletidos que habitualmente constituem a cadeia de DNA (dNTPs). O primer utilizado est marcado radioactivamente ou com um composto fluorescente. Cada uma destas 4 reaces contm uma pequena proporo do respectivo didesoxirribonucletido (ddNTP). Quando uma pequena quantidade de um destes tipos de nucletidos includa numa reaco de sntese de DNA que contm os 4 nucletidos convencionais (dNTPs) ocorre uma competio entre o processo de elongao da cadeia de DNA e o processo menos frequente de terminao da cadeia. Os produtos de reaco sero um conjunto de cadeias de oligonucletidos cujos comprimentos so determinados pela distncia entre a extremidade 5 do primer utilizado para iniciar a sntese de DNA e os locais de terminao da cadeia. Por exemplo, numa reaco contendo ddATP todos os pontos de terminao das cadeias correspondero a zonas normalmente ocupadas pela base A convencional. Utilizando cada um dos 4 ddNTPs em 4 reaces enzimticas separadas, os vrios fragmentos obtidos terminam nas posies habitualmente ocupadas pelas bases A, T, C e G na cadeia molde. Separando estas populaes de oligonucletidos por electroforese pode ser determinada a localizao de cada banda por emisso de fluorescncia ou aps exposio a um filme de raio X. Quando as 4 populaes correm lado a lado no gel de sequenciao a sequncia de DNA sintetizada pode ser lida na direco 5para 3 lendo as bandas do fundo do gel para o topo. Mais recentemente, em vez de ser o primer a estar marcado com um composto fluorescente so os ddNTPs que esto marcados. Cada ddNTP est marcado com um fluorforo de cor diferente. Deste modo basta uma reaco de sequenciao e no quatro como at aqui. Os produtos de sequenciao so corridos em gis existentes no interior de capilares muito finos (electroforese capilar) e visualizados com detectores lasers em aparelhos automticos.

40

Nesta aula terico/prtica pretende-se demonstrar a aplicao da tcnica de sequenciao de Sanger assim como a aplicao de PCR para a clonagem de cDNA. A experincia consistiu em isolar uma protena por mtodos bioqumicos e determinar a sequncia dos primeiros 10 aminocidos da regio N-terminal. Com base na sequncia de aminocidos foram desenhados primers degenerados para amplificao do correspondente cDNA por PCR a partir de uma biblioteca de cDNA orientada. Como segundo primer na reaco de PCR utilizou-se um primer do vector no qual a biblioteca foi construda. Os vrios produtos de PCR obtidos foram posteriormente clonados num plasmdeo de forma orientada (5EcoRI para 3HindIII). Foram isolados trs clones independentes que foram sequenciados utilizando um primer do vector localizado na regio 3 do local de insero dos fragmentos de PCR.

41

a) Determine a sequncia de cada clone de forma a obter a sequncia original de cada cDNA amplificado. b) Identifique os locais de clonagem EcoRI e HindIII c) Identifique o primer degenerado em cada clone que foi utilizado para a reaco de PCR. d) Baseado na sequncia de aminocidos previamente determinada indique qual dos trs clones codifica para a protena que se pretende clonar. Sequncia de aminocidos: N terminal-Ser-Tyr-Cys-Leu-Pro-Met-Ser-Pro-Arg-Ala-C terminal

AULA 8 Clonagem de cDNA -TUB


Parte I A. Digesto e purificao de DNA 1. O plasmdeo recombinante pSK-TUB foi previamente digerido com EcoRI de acordo com o protocolo descrito no trabalho da aula 3. 42

2. Aplicar no gel o marcador de pesos moleculares, o plasmdeo recombinante pKSTUB no digerido, e os produtos da digesto resultantes do passo 1. 3. Correr o gel a 100V at a frente do gel chegar a cerca de dois teros do gel. 4. Visualizar o DNA num transiluminador de U.V. 5. Com uma lmina de bisturi limpa, excisar as bandas do gel, correspondentes aos produtos da digesto. 6. Colocar cada banda num eppendorf e determinar o respectivo peso. 7. Adicionar 1l de Membrane Binding Solution por cada 1 mg de gel. Vortexar vigorosamente e incubar a 65 C at a agarose estar completamente dissolvida. 8. Transferir a mistura dissolvida para uma Mini-coluna SV previamente inserida num tubo colector. 9. Centrifugar velocidade mxima durante 1 minuto. Descartar o filtrado e voltar a colocar a coluna dentro do tubo. 10. Adicionar 700 l de Membrane Wash Solution. Centrifugar velocidade mxima durante 1 minuto. Descartar o filtrado e voltar a colocar a coluna dentro do tubo. 11. Repetir o passo 10 com 500 l de Membrane Wash Solution. 12. Cuidadosamente transferir a mini-coluna para um tubo eppendorf limpo. Adicionar 50 l de gua ultra-pura e centrifugar velocidade mxima durante 1 minuto. 13. Descartar a mini-coluna e guardar o DNA em gelo para posterior manipulao. B. Ligao

43

1. Pipetar para um tubo eppendorf, usando pontas de pipeta diferentes e limpas, por esta ordem: 5 l de vector pKS (resultante da digesto) 10 l de cDNA -TUB 4l de Tampo de ligao (5) 1 l T4-Ligase Misturar cuidadosamente batendo levemente com o dedo no fundo do tubo. 2. Incubar a 37 C durante 1 hora, ou a 4C durante a noite. 3. Congelar a mistura a 20C. Parte II C. Transformao (realizado em laboratrio) 1. Descongelar uma alquota de clulas E. coli JM101 competentes em gelo. 2. Colocar num eppendorf 5 l de pKS e num outro 5 l da mistura da ligao da aula anterior. Usar 5 l de Agua ultra-pura como controlo negativo. 3. A cada microtubo, adicionar 50 l de clulas competentes e misturar com movimentos circulares com a ponta da pipeta. 4. Incubar em gelo durante 20 minutos. 5. Provocar um choque trmico s clulas, colocando o microtubo num banho a 42 C durante 2 minutos. 6. Colocar novamente em gelo, durante 2 minutos. 7. Adicionar 200 l de meio LB e incubar a 37 C durante 30 minutos com agitao 8. Plaquear as clulas em meio Mac/Lac/Amp. 9. Incubar as placas de petri a 37 C durante a noite. RESULTADOS 10. Avaliar o sucesso da clonagem.

44