Você está na página 1de 9

As pginas seguir devem ser cortadas e grampeadas na lateral, formando um caderno.

ATTCGATTACAGGAATACACTTGC TCCGCTAATGTCCTTATGTGAACG TTAACGCCTCATAGGGCATCTCTA AATTGCGGAGTATCCCGTAGAGAT GCGCGCATTAGATTCTCCGATATG CGCGCGTAATCTAAGAGGCTATAC

Caderno do Professor
Este material foi desenvolvido especificamente para voc professorcomplementaaprofunda Ele e questes prticas e pedaggicas relacionadas ao Clula Adentro Sugerimos sua leitura aps travar conhecimento com as regras do jogo, j faremos que referncias a elas.

O jogo Clula Adentro


Clula Adentro jogo tabuleiro um de investigativo qual no os Casos propostos abordam questes que envolvem a Biologia Celular e Molecular. O jogo permite que os alunos entendam, de forma ldica, como cientistas os construram alguns conceitos atuais fundamentais relacionados s clulas. O jogo se baseia na interpretao de Pistas que podem conter esquemas, figuras, experincias resultados com os quais ou a comunidade cientfica se deparou, alm de informaes atuais. Os jogadores agem como investigadores fazendo anotaes, discutindo e chegando as prprias concluses para solucionar os Casos suas Grupos de at alunos 12 divididos duplas trios desafiados a encontrar em ou so a soluo correta para o Caso. O Clula Adentro pode ser jogado de duas maneiras: competitiva ou cooperativa. Nos dois casos o professor tem o papel de coordenador e orientador das discusses Cabe ele a tambm receber avaliar diferentes solues apresentadas pelos alunos, assim e as como guiar uma rica discusso final do jogo ao O Cl ul a Adentro a p res enta op ortuni da des p a ra o desenvolvimento de habilidades de raciocnio, interpretao, sntese e associao de idias, alm de possibilitar a interpretao de figuras e grficos tpicos da linguagem cientfica jogo Este possibilita aos alunos a construo do conhecimento de temas atuais relacionados Biologia Celular Molecular forma e de ldica. Alguns temas podem ser explorados no Ensino Mdio e outros no Ensino Superior, dependendo do contexto de ensino. No caso do Ensino Superior, o jogo contempla reas de interesse de Bioqumica, Evoluo, Microbiologia, Biofsica e Imunologia.

O tempo da atividade, incluindo explicao das regras, o jogo e a discusso final com a turma, dura em mdia 90 minutos (uma hora e meia), o que o torna compatvel com os tempos de aula comuns no ambiente escolar e universitrio De forma resumida, no Clula Adentro os jogadores so desafiados a resolver os Casos meio coleta por da interpretao e discusso de Pistas Para isso movimentam eles seus pees pelo tabuleiro que representa de forma esquemtica uma clula eucaritica resolverem Caso, os Ao o estudantes descobrem algumas caractersticas e funes da clula, das como sugere o nome do Jogo

Objetivos Pedaggicos do jogo


O Clula Adentro foi desenvolvido por um grupo de educadores e pesquisadores das reas de Bioqumica, Biologia Celular e Ensino que, vivenciando o ensino de Biologia em vrios nveis, se uniram para criar uma estratgia que pudesse resgatar o prazer da descoberta e do aprendizado por meio uma atividade de ldica que estimulassem o raciocnio e o trabalho em grupo. Os principais objetivos deste jogo so: 1) convidar os alunos a serem mais ativos no processo de aprendizagem 2) oferecer uma oportunidade interativa e ldica para o aprendizado de Biologia3) estimular curiosidade o a e trabalho equipe em a discusso e troca de idias promover interpretao de dados cientficos sua linguagem 4) a representaes (grficos, tabelas, imagens) e 5) simular, at certo ponto, etapas do processo de pesquisa cientfica, estimulando os alunos a relacionarem diferentes informaes para a resoluo de um problema. Em cada Pista procuramos sempre explorar resultados experincias de introduzindo formas de apresentao de dados comuns na linguagem cientfica, tais como grficos, tabelas, micrografias sempre tendo como objetivo o uso destes recursos em associao com uma linguagem acessvel estudantes aos Nenhuma pista sozinha capaz fornecer de a soluo para o Caso. importante portanto interpretar cada uma delas e relacion com as demais para chegar las soluo do Caso
AF BN DV SH CG Ci Bulbo
1

Lipdeos extrados das hemcias espalhados na gua Hemcias


Tempo gasto para viajar 10cm

bactria livre

B
Reproduzido sob permisso de Julie Theriot & Tim Mitchison
10m m

clula hospedeira fagocitose

rea total (m m)

Partcula
0,5

Dimetro (nm) 33 90 105

Em H2O (dias) 45 122 169

No citoplasma (dias) 22.265


60.590

bactria escapa bactria mvel formao da cauda de actina

Partcula de Poliovrus Partcula de Adenovrus Partcula de vrus Herpes simplex


bode homem

84.315
bactria segue para clula vizinha

O Clula Adentro pretende trazer para a sala de aula a discusso sobre temas importantes, interessantes e atuais sobre a clula, sua fisiologia, funo, interao com outras clulas e microrganismos, alm de sua homeostase e evoluo. A compreenso das Pistas permite ao aluno desvendar algum mistrio em relao clula e aprender mesmo ao

tempo pouco um mais sobre suas organelas e estruturas. O objetivo maior fazer com que alunos os construam autonomamente conceitos os de forma ldica. O jogo no pretende substituir o professor em sala de aula, e sim servir como um instrumento adicional para estimular os alunos, ao abordar temas complexos de Biologia Celular e Molecular. O clima de descontrao gerado pelo "jogar" em grupo fundamental para o processo aprendizagem de relacionado Clula Adentro ao

O Papel do Professor no Jogo


O professor desempenha um papel fundamental antes, durante e aps a partida. Apresentaremos aqui algumas sugestes para orientao dos alunos ajudam tornar jogo que a o mais eficiente divertido e Como o tempo de aula normalmente curto importante uma rpida separao dos grupos e uma explicao clara das regras do jogo. O ideal que joguem, no mximo, 4 duplas ou trios por tabuleiro. No entanto quando a turma grande a for e disponibilidade tabuleiros de pequena pode se dividir grupos em maiores quais um representante dos dever rolar dado o movimentar peo e levar a pista para o restante do grupo. Ou seja, ao o invs de 4 duplas em torno de um tabuleiro, poder havergrupos at de alunos cada Lembramos que jogo est o disponvel gratuitamente na internet para impresso bastando dispor de dados e objetos que substituam os pees (botes, pees de outros jogos, etc). Sendo assim, aconselhamos jogar com grupos menores fim a a de obter melhor desempenho individual Deve tambm se antes comear o jogo, de salientar a importncia dos alunos coletarem lerem maior nmero de e o Pistas possvel preferncia todas as 10 Pistas cada de de Caso alunos Os devem ser orientados para escreverem Caderno de Anotaes apenas no um resumodapista Elesno devemcopiar a pista poisisso comprometeria o dinamismo do jogo aumentar as chances de sem resoluo do Caso. Alm disso, deve-se frisar a importncia de que ao apresentarem uma proposta de soluo para cada Caso alunos os devem incluir explicitamente as evidncias que levaram formular os a aquela hiptese. Durante a partida: comum alunos os solicitarem ajuda do professor para entender Pistas aconselhamos que isto seja feito, a as No menos que eles tenham uma carta de sorte ajuda do professor A busca autnoma das respostas pelos alunos estimula discusso nas a equipes e, em geral, medida que vo conseguindo outras Pistas suas dvidas so esclarecidas. A idia do jogo que alunos os tenham tempo para interpretar ler discutir raciocinar e para poder elaborar suas prprias concluses Osproblemasdeinterpretao que eventualmente

permanecerem at fim partida o da sero sanados no momento da discusso aps a partida. Ao fim do jogo: Na forma competitiva a regra indica que a partida acaba quando a primeira dupla apresentar uma soluo correta para o Caso Sugerimos porm, que o professor mais d tempo para que outras duplas tentem escrever suas solues mesmo que ainda no tenham coletado todas as Pistas Eventualmente se pode fazer algum tipo de pdio, com diferentes colocaes. Na forma cooperativa, deve-se fazer um controle rgido do tempo, para que ele seja um desafio real. O momento de escrever a soluo tambm fundamental de importncia para que os alunos desenvolvam e pratiquem a interpretao, sntese e articulao de idias. Mesmo que no cheguem soluo totalmente correta, a discusso em grupo sempre uma boa oportunidade para organizar consolidarestruturar idias. e as A discusso final Consideramos discusso a como parte jogo do do ponto vista de pedaggico apesar de ocorrer aps o final da partida nesse momento que professor o desempenha um papel fundamental discutir as dvidas dos alunos acerca dos contedos das Pistaslevantar de questes sobre o Caso e/ou temas do programa de ensino a ele relacionados Para isto o professor deve coordenar a discusso, apresentando pista por pista para garantir que as dvidas questionamentos curiosidades relao ao e em vocabulrio, aos grficos, experimentos o papel de cada pista no Caso, sejam abordados e Por favor, entrem em contato conosco atravs de nosso site: www.celulaadentro.com.br para qualquer dvida e/ou sugesto.

Por que jogar de forma cooperativa?


A aprendizagem cooperativa vem sendo amplamente utilizada desde a dcada de 1960 por educadores que acreditam em seu potencial na formao pessoal e profissional dos estudantes. A cooperao pode promover uma aprendizagem mais ativa, estimulando o pensamento crtico, desenvolvendo capacidades de interao, negociao de informaes e resoluo de problemas. Essas caractersticas levam o aluno a assimilar e construir conceitos de modo mais autnomo, permitindo assim um aprendizado mais centrado no aluno do que no professor. A cooperao aumenta ainda a sociabilidade dos indivduos, visto que todos os membros do grupo devem aprender a dialogar organizadamente resolver conflitos democraticamente dividir igualmente tarefas levar as e em considerao outras idias (Johnson & Johnson, 1994). fundamental destacar que o simples trabalho em grupo no caracteriza uma estratgia como cooperativa: extremamente importante que cada membro do

grupo desempenhe uma tarefa reconhecida como importante para o coletivo Nossa equipe acredita que a melhor maneira de jogar o Clula Adentro forma cooperativa de Nessa estratgia, os jogadores dividem-se em equipes que cooperam para coletar e interpretar as Pistas tendo com nico adversrio o tempo que, por esse motivo, dever rigorosamente ser controladoregras As deste modo jogar de encontram no se caderno de Regras do JogoOs resultados das pesquisas e avaliaes do Clula Adentro jogado forma de cooperativa mostram os alunos no sentem que falta da competio alunos Os reconhecem que trabalhar em grupo facilita aprendizado citam o e mais diverso como um aspecto positivo a do jogo do que quando esto competindo. Alm disso, avaliamos que jogar cooperando funciona, pois o desempenho do grupo e de cada aluno igual maior do que competindo ou Melim cols. e Dessa forma alm de trabalhar aspectos relacionados cognio, a cooperao aumenta o dilogo entre os alunos, uma vez que ao final do jogo as duplas devem relatar umas as outras o contedo das Pistas por elas coletadas, a fim de propor a soluo do grupo. Isto estimula a participao de todos os alunos durante a atividade e exercita a capacidade dos alunos lidarem com diferentes pontos vista de sobre mesmo um assunto sem que se percacarter ldico do jogo. o

Quando Jogar Clula Adentro?


O Clula Adentro possui cinco Casos que foram desenvolvidos abordando diferentes temas relacionados estudo ao da clula: 1) a origem evolutiva da mitocndria a apoptose desenvolvimento no embrionriobiologia molecular forensea estrutura membrana da plasmtica e a utilizao do citoesqueleto na infeco viral. Segue um quadro com uma breve descrio dos diferentes Casos com objetivo o a ser alcanado, a pergunta contida em cada um deles e os temas abordados (veja os detalhes no Quadro 1prxima na pgina

Quadro 1: Contedo dos 5 Casos do Jogo


PROBLEMA PROSPOSTO TEMAS ABORDADOS SUGESTES DE QUANDO JOGAR - Ao abordar a origem da clula eucariota - Quando estiver discutindo o tpico de mitocndria e respirao celular

CASO

OBJETIVO

Hspede do Barulho

Entender como surgiu a mitocndria na clula primitiva, causando mudanas to drsticas na evoluo dos seres complexos.

Voc dever descobrir como a mitocndria surgiu na clula eucariota.

- Evoluo Simbiose - Fagocitose - Estrutura e funo da mitocndria

O Caso da Membrana Plasmtica

Entender como os lipdeos esto organizados na membrana plasmtica, e como isso foi descoberto.

Voc dever, partir das pistas deixadas por Gorter e Grendel, descobrir como os lipdeos esto organizados na membrana plasmtica das clulas.

- Lipdeos e membranas celulares

- Quando estiver abordando as biomolculas da clula - Ao iniciar o tema membrana plasmtica

Surfando na Clula

Atravs do exemplo do caminho utilizado pelo vrus Herpes para chegar no ncleo da clula, abordar a estrutura e funes do citoesqueleto da clula eucariota. Discutir a importncia da apoptose no apenas no desenvolvimento embrionrio (tema do caso), mas tambm ao longo da vida do organismo, sendo necessria ao seu bom funcionamento e sobrevivncia. Exemplificar como os conhecimentos de DNA e da biologia forense so importantes numa investigao criminal.

Descubra o meio atravs do qual o Virus da Herpes consegue chegar rapidamente ao ncleo de uma clula eucaritica.

- Funo e estrutura do citoesqueleto - Infeco viral - Transmisso da Herpes

- Ao abordar os temas de organelas e estruturas celulares - Para introduzir o tema do citoesqueleto

Um por Todos

Como as clulas das membranas entre os dedos de um feto desaparecem para que eles se formem?

- Apoptose

- Ao introduzir o desenvolvimento embrionrio - Ao discutir morte celular - Ao final do ciclo celular

- Necrose

A prola do Nilo

Quem roubou a jia A Prola do Nilo? Como foi possvel, a partir de um nico fio de cabelo, encontrar o criminoso?

- Tcnicas de biologia molecular - DNA - Biologia Forense

- Ao terminar de estudar o tema DNA e replicao

Um pouco de teoria...
Este jogo foi formulado baseando-se na abordagem do aprendizado pela soluo de problemas (PBL - Problem Based Learning) (Pozo, 1998 Stevens cols e Neste tipo estratgia, os estudantes de devem colaborar para resolver situaes-problema. No contexto do jogo, estes problemas relacionam-se a importantes questes do campo da biologia celular e molecular. Diferente de abordagens educacionais mais tradicionais, envolvendo somente aulas expositivas, o ensino baseado na soluo de problemas envolve a discusso entre pequenos grupos de estudantes, discusses essas apoiadas e facilitadas pela figura do tutor ou professor (Aspy e cols., 1993). A formulao didtica das situaes problema apresentadas no jogo levam em conta a preparao e as limitaes inerentes ao nvel educacional dos jogadores Houve orientao para uma ao a investigativa, com carter dinmico e, acima de tudo, com uma soluo que resulte na construo do conhecimento. Ao jogar o Clula Adentro o aluno deve ser capaz de pesquisar, buscar informaes, abaliz e las selecion em lugar praticar las de exerccios de memorizao preciso que sejam realizadas diferentes atividades acompanhadas situaes de problematizadoras, questionadoras e de dilogo, envolvendo resoluo de problemas e levando introduo de conceitos novos, para que os alunos possam construir seu conhecimento. Utilizar atividades investigativas como ponto de partida para desenvolver a compreenso de conceitos uma maneiras levar aluno sair de uma postura passiva, tornadodas de o a se mais participativo processo aprendizagem ativo no de e sobre seu o objeto estudo de Carvalhocols e

Resultados da Avaliao do Jogo


Em estudo recente, verificamos a grande aceitao do jogo entre o pblico jovem (Spiegel e cols Neste trabalho envolvendo alunos rede da pblica e privada do Rio de Janeiro, 94% dos jogadores declararam que gostariam de jogar o Clula Adentro novamente, porque consideravam jogo o divertido bom e para aprendizado seu A maioria dos alunos chegou soluo dos Casos propostos construindo conceitos de Biologia forma de dinmica e reforando ainda seus conhecimentos de outros contedos. Alm disso, as observaes realizadas neste trabalho sugeriram um importante papel do trabalho em grupo (em pares ou trios) para atingir os principais objetivos educacionais jogo do O Clula Adentro foi avaliado e obteve boa aceitao tanto em universidades quanto em escolas pblicas e privadas do ensino mdio no Rio de Janeiro (Spiegel e cols e Sua (Cardona e cols , na

Nossos resultados tambm apontam para uma boa aceitao do jogo como estratgia de ensino por parte dos professores entrevistados (Cardona e cols. por seu no apenas carter ldico mas tambm pelo desenvolvimento de importantes habilidades resultados Os indicam portanto o que Clula Adentro motivador estimula raciocnio, gera o o entrosamento e troca de idias entre os alunos e, principalmente, torna ldico o aprendizado em temas de biologia celular e molecular. Dessa forma, este jogo tem grande potencial para uso na difuso de cincias entre jovens de diferentes faixas etrias e nveis de escolaridade.

Para saber mais sobre o Clula Adentro


Cardona TS, Spiegel CN, Alves GG, Ducommun J, Pons AH, Arajo-Jorge TC (2007) Introducing DNA Concepts to Swiss High School Students Based a on Brazilian Educational Game Biochemistry and Molecular Biology Education 35(6), 416421. Melim LMC, Alves GG, Spiegel CN, Arajo-Jorge TC & Luz MRMP (2009) Surfing in the Cell an investigative game teaching for cytoskeleton concepts for undergraduate students Enseanza de las Cincias, volume extra VIII Congreso Internacional sobre Investigacin en Enseanza de las Ciencias Melim LMC, Spiegel CN, Alves GG Luz MRMP Cooperao ou competio? Avaliao de uma estratgia ldica de ensino de Biologia para estudantes do ensino mdio. VII Encontro Nacional de Pesquisa em Educao em Cincias. Spiegel CN, Alves GG, Cardona TS, Melim LMC, Luz MRMP, Arajo-Jorge TC & Henriques-Pons A (2008). Clula Adentro Discovering Cell educational the an game in cell and molecular biology for secondary-level students. Journal of Biology Education, 43(1), 27-35.

Bibliografia
Aspy DN, Aspy CB and Quimby PM (1993). What doctors can teach teachers about problem-based learning. Educational Leadership, 50 (7), 22-24. Carvalho AMP, Azevedo MCPS, Nascimento VB, Cappechi MCM, Vannuchi AI, Castro R S, Pietrocola M, Vianna DM & Arajo RS (2004). Ensino de Cincias: unindo a pesquisa e a prtica. Ed. Thomson. Johnson T & Johnson DW An Overview of Cooperative Learning. http://www.co-operation.org/pages/overviewpaper.html Originalmente publicado em: J. Thousand, A. Villa and NevinEds A Creativity and Collaborative Learning Brookes Press Baltimore Pozo JI, Echeverra MPP & Castill JD (Eds.) A Soluo de Problemas. Artmed, RS, Brasil Stevens R, Johnson DF Soller A Probabilities Predictions: Modeling the and Development of Scientific Problem-Solving Skills. Cell Biology Education, 4, 42 57.

Você também pode gostar