Você está na página 1de 64

Biologia Estrutural

Tcnicas de Cristalizao de Macromolculas Biolgicas

Prof. Dr. Walter Filgueira de Azevedo Jr.


wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Diagrama de Fases
Para cristalizarmos uma macromolcula biolgica necessrio traz-la a um estado de supersaturao. Consideremos uma protena dissolvida em um tampo. Nessa situao, para que a protena seja levada a formar cristais, necessrio que as molculas da protena dissolvidas na soluo, sejam trazidas a uma situao onde as molculas estejam prximas umas das outras. Para levar a protena a essa situao podemos aumentar sua concentrao (eixo vertical), ou aumentar a concentrao do sal presente na soluo da protena. O diagrama ao lado ilustra as diferentes regies de solubilidade da protena. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Diagrama de Fases
O processo de cristalizao da protena normalmente deve ser lento, ou seja, considerando-se a protena inicialmente numa regio abaixo da curva de solubilidade, devemos aumentar a concentrao salina, ou da protena, de modo a traz-la na regio de supersaturao, de forma lenta. Na regio de supersaturao teremos as molculas da protena prximas umas das outras, o que, em casos favorveis, promover o aparecimento dos primeiros ncleos cristalinos. Esse microcristais serviro de base para o crescimento de cristais maiores, adequados para experimentos de difrao de raios X. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Diagrama de Fases
Para cristalizarmos protenas normalmente usamos o mtodo de difuso de vapor. Uma gota de protena colocada sobre uma lamnula. Nessa gota adicionamos uma soluo contendo sal, ou outro agente precipitante, como Polietileno glicol (PEG). Colocamos essa lamnula sobre um poo, onde temos a soluo do precipitante. Ao fecharmos esse sistema ocorrer difuso de molculas de gua da gota para o poo, levando a protena, em casos favorveis, a um estado de supersaturao, que pode levar formao dos primeiros ncleos cristalinos.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Salting-in
O aumento da solubilidade de uma macromolcula biolgica a baixa concentrao salina (<0,5M) chamada salting-in. Este fenmeno explicado pelas interaes eletrostticas no especficas entre a macromolcula carregada e as espcies inicas do sal. Segundo a teoria de Debye-Hckel para solues inicas, um aumento na fora inica reduz a atividade dos ons em soluo e aumenta a solubilidade do composto inico. Uma forma alternativa de se tratar este fenmeno considerar o salting-in como o resultado da competio entre grupos carregados na superfcie da macromolcula e os ons em soluo. Na ausncia de ons de solvente a macromolcula precipita devido atrao de eletrosttica entre cargas opostas em diferentes partes da macromolcula. Se os ons so adicionados soluo eles blindam os grupos carregados na macromolcula e aumentam a sua solubilidade.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Salting-in

Fenmeno de salting-in. a) Macromolcula biolgica sem a presena de ons dissolvidos na soluo. A atrao eletrosttica entre os grupos carregados em duas os mais macromolculas causa a aglomerao e precipitao. b) ons blindam a interao eletrosttica entre as macromolculas, aumentando a solubilidade.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Salting-out
Outra forma de precipitar uma macromolcula pela adio de sal (salting-out), este serve para imobilizar as molculas de gua, desta forma aumentando a concentrao efetiva da macromolcula, ou seja, diminuindo a sua solubilidade. No fenmeno de salting-out a solubilidade da macromolcula biolgica governada principalmente por efeitos hidrofbicos.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Montagem de Gotas de Cristalizao

Seqncia de eventos para a montagem de uma gota de cristalizao: a) Colocase 1-2l da soluo da macromolcula biolgica sobre a lamnula de vidro. b) Adiciona-se 1-2l da soluo do reservatrio gota com a soluo da macromolcula biolgica. c) Ao final temos uma gota (2+2) com a soluo de macromolcula biolgica mais a soluo do reservtorio. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Montagem de Gotas de Cristalizao

Na cristalizao de protena podemos variar a forma de acomodar a gota de cristalizao, como na figura acima. Tal variao permite modificaes nas condies de difuso do vapor de gua da gota para o poo, que pode favorecer o aparecimento de cristais de protena. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Mtodo da Matriz Esparsa


Com o aumento do nmero de macromolculas biolgicas cristalizadas com sucesso, tornou-se bvio que muitas das condies de cristalizao se assemelhavam, ou seja, havia uma concentrao de resultados positivos de cristalizao de macromolculas biolgicas usando-se nmero limitado de precipitantes, tampes e aditivos. Isto levou proposio de diversos mtodos de cristalizao (Carter & Carter, 1979), onde um nmero limitado de condies de cristalizao eram tentados, usando-se pequenas quantidades da macromolcula biolgica, geralmente por volta de poucos miligramas. A partir da observao dos resultados preliminares destes experimentos era possvel determinar que tampo, aditivo e agente precipitante seriam os mais favorveis e a partir da proceder-se a sucessivos melhoramentos at se conseguir cristais adequados, ou ainda, em casos favorveis, obter-se cristais adequados j na primeira tentativa com as condies padres. Dentro deste raciocnio a Dra. Jaru Jancarick da UC Berkeleley props o mtodo da matriz esparsa ( Jancarick & Kim, 1991) onde diversas condies diferentes so tentadas para se cristalizar a macromolcula biolgica. Jancarik, J, & Kim, S. -H. (1991) J. Appl. Crystallogr. 24, 409-411.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Mtodo da Matriz Esparsa


Parmetros da matriz de cristalizao (Jancarik & Kim, 1991) No-Volteis MPD PEG 400 PEG 4000 PEG 8000 Agentes precipitantes Sais Volteis Tartarato de Na,K 2-Propanol Fosfato de NH4 Sulfato de NH4 Acetato de Na Sulfato de Li Formiato de Na Fosfato de Na,K Citrato de Na Formiato de Mg Mistura Sulfato de NH4 + PEG 2-Propanol + PEG

Faixa de pH: 4,6; 5,6; 6,5; 7,5 e 8,5 Aditivos: Cloreto de Ca, Citrato de Na, Cloreto de Mg, Acetato de NH4, Sulfato de NH4, Acetato de Mg, Acetato de Zn e Acetato de Ca. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Mtodo da Matriz Esparsa


Por tentativa e erro a matriz multimensional foi simplificada eliminando-se as condies que podem ser parcialmente representadas por resultados de outras condies, a proposta original apresenta 58 condies. Comercialmente a empresa Hampton Research, (USA) simplificou o mtodo original, e disponibiliza um kit com 50 condies de cristalizao. Comercialmente h outros kits usando-se como princpio a variao de pH, fora inica e agentes precipitantes.

Fonte: http://www.hamptonresearch.com/products/ProductDetails.aspx?cid=1&sid=17&pid=1

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Kits da Hampton Research

Fonte: http://www.hamptonresearch.com/products/ProductDetails.aspx?cid=1&sid=17&pid=1

wfdaj.sites.uol.com.br

Crystal Screen I (1-25)

wfdaj.sites.uol.com.br

Crystal Screen I (26-50)

wfdaj.sites.uol.com.br

Crystal Screen II (1-25)

wfdaj.sites.uol.com.br

Crystal Screen II (26-50)

wfdaj.sites.uol.com.br

Placas Linbro

Um dos sistema usados para cristalizao de protenas a placa linbro, mostrada acima. Essa placa apresenta 24 poos, que permite testarmos diversas condies de cristalizao. As lamnulas so colocadas sobre cada um dos poos, e vedadas com graxa de vcuo.
Fonte: http://www.hamptonresearch.com

wfdaj.sites.uol.com.br

Matriz Esparsa (Passo a Passo)


Passo 1) Se a macromolcula biolgica tiver de ser transportada mantenha-a em gelo (sem congel-la) e adicione glicerol at 50% em volume e armazene-a em - 20oC. Use o necessrio para o experimento de cristalizao inicial, geralmente entre 1 e 2 mg o suficiente, e coloque o restante de volta a -20oC. A fim de eliminar o glicerol da soluo estoque, toma-se o volume desejado da macromolcula biolgica em glicerol e adiciona-se um volume igual do tampo, ento dialisa-se contra o tampo. Passo 2) concentre a protena no mesmo tampo e acrescente DTT, ou EDTA se necessrio. Se existe NaCl no tampo melhor elimin-lo, desde que o NaCl no seja necessrio para a solubilidade da macromolcula biolgica. Passo 3) Faa o fatorial 4oC e a temperatura ambiente, se houver material suficiente. Passo 4) Examine a gotas imediatamente aps montado o experimento de cristalizao e anote: a) o nmero das gotas com precipitado. b) h presena de sujeiras. c) h presena de microcristais. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Matriz Esparsa (Passo a Passo)


Passo 5) Confira as gotas diariamente por uma semana, fazendo as mesmas anotaes do passo 4. E verifique tambm o surgimento de algum bom cristal. importante verificar como a macromolcula biolgica se comporta com o tempo em cada gota de cristalizao. Passo 6) Supondo que pequenos cristais se formaram em uma ou mais gotas do experimento inicial de cristalizao, deve-se concentrar esforos nos melhores cristais e tentar a melhoria das condies de cristalizao dos mesmos. Os procedimentos para a melhoria das condies de cristalizao sero mostrados a seguir.

Fonte: http://www.hamptonresearch.com

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Cristais de Protenas

0,5mm

0,5mm

0,5mm

0,5mm

0,5mm

0,5mm

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Montagem de Cristais

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Criocristalografia

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Criocristalografia

Fonte: http://www.hamptonresearch.com

wfdaj.sites.uol.com.br

Sistema Criognico

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Cristalizao de PNP Humana


Equipamentos e reagentes: - Placa Linbro; - PNP (De Azevedo et al., 2003) a 12mg/mL em tampo fosfato de potssio a 10 mM, pH 7,1 (soluo A); - 40 % de sulfato de amnio em tampo citrato de sdio a 0,05 M, pH 5,3 (soluo B); - Microfiltro de 0,22 m; - Graxa de vcuo; - Lamnulas.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Cristalizao de PNP Humana


Mtodo: 1. Prepare a solues estoques de 40 % de sulfato de amnio em tampo citrato de sdio a 0,05 M, pH 5,3 e PNP a 12mg/mL em tampo fosfato de potssio a 10 mM, pH 7,1. Filtre a soluo com um microfiltro de 0,22 m; 2. Prepare uma placa Linbro; 3. Abastea os reservatrios da fileira A da placa Linbro com soluo B variando de 15-40 % em passos de 5 %; 4. Em uma lamnula, misture 1 L da soluo A com 1 L do reservatrio. Rpido e em srie engraxe a borda dos reservatrios e cubra com a lamnula; 5. Abastea os reservatrios da fileira B com soluo B variando de 19-29 % em passos de 2%; 6. Abastea os reservatrios da fileira C com soluo B variando de 15-20 % em passo de 1 %; 7. Use a fileira D para duplicar ou testar parmetros particulares (por exemplo, volume da gota para observar se a influncia nos efeitos cinticos ou no crescimento); 8. Mantenha os experimentos a 18 C; 9. Observe os experimentos no dia seguinte;

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Cristalizao de PNP Humana


Resultados. Os cristais da PNP humana apareceram aps 24 horas e apresentam dimenses aproximadas de 0,5 x 0,5 x 0,6 mm.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Cristalizao da Lisozima


Equipamentos e reagentes: - Placa Linbro; - lisozima 40mg/mL em acetato a 50 mM, pH 4,5; - NaCl 3 M ; - Microfiltro de 0,22 m; - Graxa de vcuo; - Lamnula.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Cristalizao da Lisozima


Mtodo: 1. Prepare as solues estoques de NaCl a 3 M e lisozima a 40 mg/mL (2,74 mM) em acetato a 50 mM, pH 4,5. Filtre todas as solues com um microfiltro de 0,22 m; 2. Prepare uma placa Linbro; 3. Abastea os reservatrios da fileira A com solues de NaCl variando de 0,5-1,5M em passos de 0,2 M; 4. Em uma lamnula, misture 4 L da soluo estoque com 4 L do reservatrio. Rpido e em srie, engraxe a borda dos reservatrios e cubra com a lamnula; 5. Abastea os reservatrios da fileira B com soluo de NaCl variando de 0,8-1,8 M em passos de 0,2 M. Repita o experimento na fileira B depois de diluir a soluo estoque de protena metade para obter uma nova concentrao de 20 mg/mL (1,37 mM); 6. Abastea os reservatrios da fileira C com solues de NaCl variando de 1,5-2,5 M em passo de 0,2 M. Repita o experimento depois de diluir a soluo estoque de protena pela metade; 7. Use a fileira D para duplicar ou testar parmetros particulares (por exemplo, volume da gota para observar se h influncia nos efeitos cinticos ou no crescimento); 8. Mantenha os experimentos a 18 C; 2006 Dr. Walter F. de Azevedo Jr. 9. Observe os experimentos durante 2 dias;

Protocolo de Cristalizao da Lisozima


Resultados: Os cristais de lisozima apareceram aps 24 horas e apresentam dimenses aproximadas de 0,5x0,5x0,5mm.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Otimizao de Cristais A grande maioria dos experimentos de cristalizao de protenas normalmente termina
em insucesso. Os nmeros variam, mas de uma forma geral aceita-se que para uma protena qualquer a taxa de sucesso varia entre 10 e 20 %. Contudo, mas as que conseguimos cristalizar normalmente no na primeira tentativa, assim um processo crucial na cristalizao de uma protena a otimizao. Normalmente ao usarmos os screens temos resultados como precipitado, ou gotas claras, ou ainda microcristais. Em cada uma dessas situaes temos estratgias que podem levar formao de cristais adequados para os experimentos de difrao de raios X. Cristais adequados devem ter ase seguintes caractersticas: 1) Boas dimenses, normalmente maiores que 0,2 mm. 2) Arestas bem definida. 3) Relativa rigidez. 4) Facilidade de manuseio. Mesmo satisfazendo s essas condies o cristal pode no difratar. O teste final quando expomos o cristal ao feixe de raios X e vemos um padro claro e com centenas de pontos de difrao. wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Otimizao de Cristais Consideremos o seguinte cenrio onde temos pequenos cristais obtidos

nos experimentos iniciais, com ou sem precipitado amorfo acompanhando-os. Para a melhoria dos cristais e eliminao do precipitado amorfo seguimos os seguintes passos: Passo 1) Abaixe a concentrao da macromolcula e tente as mesmas condies em que obteve os primeiros cristais. Tente varias concentraes, por exemplo, se os primeiros cristais foram conseguidos com a concentrao de 10mg/ml tente 9, 8, 7, 6 e 5 mg/ml. Espere por uma semana e se no houver melhora nos cristais, Passo 2) Mantenha a concentrao da macromolcula biolgica constante e abaixe a concentrao do agente precipitante.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Protocolo de Otimizao de Espere por uma semana e se no houver melhora nos cristais, Cristais
Passo 3) Adicione 0,2M NaCl ao reservatrio. Se a gota de cristalizao ficar completamente clara (sem precipitado ou cristais) aps uma semana, aumente a concentrao do precipitante em incrementos de 5% a cada 3 dias. Se a gota continuar sem cristais ou precipitado 0,2M de NaCl foi demasiado, tente novamente com 20mM NaCl o mesmo procedimento. A eliminao do precipitado, se presente, importante visto que o mesmo age como stio de nucleao e complica a manipulao futura do cristal. Se no houve melhoria nos cristais pode-se tentar microssemeadura (microseeding) caso tal tentativa no funcione pode-se tentar variar a temperatura, caso o experimento foi realizado a 4oC, deve-se tentar em temperatura ambiente e vice-versa.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Cristalizao

Coleta de dados LNLS Difrao de raios X

Anlise

Resoluo da estrutura cristalogrfica

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Uma etapa inicial importante na elucidao da estrutura tridimensional de protenas, por meio de cristalografia por difrao de raios X determinao do contedo da cela unitria. Uma vez tenhamos determinado os parmetros da cela unitria: a, b, c, alfa, beta e gama, temos que determinar quantas molculas temos na unidade assimtrica. Para isto precisamos alm dos parmetros da cela unitria o peso molecular da protena cristalizada. O mtodo proposto por Matthews (1968) permite calcular o nmero de molculas por unidade assimtrica. Matthews determinou que para cristais de protenas a relao entre volume da cela unitria (Vcell) e o peso molecular da protena cristalizada fica na faixa de 1,7 a 3,5 3/Da, com a maioria dos valores em torno de 2,15 3/Da, este valor chamado volume de Matthews (VM) VM = Vcell Z.MW Onde Z o nmero de molculas na cela unitria, MW o peso molecular da protena cristalizada e Vcell o volume cela unitria, que para uma cela unitria qualquer dada por: Vcell = a.b.c [1 + 2 cos cos cos - cos2 - cos2 - cos2]1/2 wfdaj.sites.uol.com.br
2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
A frao de volume ocupada por protena (Vprotein) dada por: Vprotein = 1,23/VM E a frao de volume de solvente no cristal dada por: Vsolvent = 1 1,23/VM Vprotein pode ser determinado por: Vprotein = (Volume especfico da protena em cm3/g) VM

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao
Principais sees de um artigo de cristalizao de protenas: 3) Clonagem, expresso e purificao da protena 4) Cristalizao 5) Coleta de dados de difrao de raios X 6) Outros (Teste de atividade, sequenciamento, soluo da estrutura e refinamento cristalogrfico parcial.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (cristalizao)


The purifed MtCS was concentrated and dialyzed against 50 mM TrisHCl buffer pH 7.8 (Hampton Research, USA). The final protein concentration was about 10 mg.ml-1. Crystallization was performed by the hangingdrop vapour-diffusion and sparse-matrix methods (Jancarik & Kim, 1991) using tissueculture multiwell plates with covers (Linbro, ICN Biomedicals, Inc, USA) at a temperature of 293 K. Each hanging drop was prepared by mixing 1 ml each of protein solution and reservoir solution and was placed over 700 l reservoir solution. Initial conditions were screened using Crystal Screen I and II kits (Hampton Research, USA).

Hexagonal crystals of MtCS. Approximate dimensions are 0.30 0.25 0.25 mm.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (dados de difrao)


A data set was collected at a wavelength of 1.427 using a synchrotron-radiation source (Station PCr, LNLS, Campinas- Brazil). The data set was collected from a single MtCS crystal using a MAR CCD imageplate system. The crystal was looped out from the drop and flash-cooled. The PEG 400 present in the crystallization conditions served as a cryoprotectant, X-ray diffraction data were collected at a temperature of 100 K under a cold nitrogen stream generated and maintained with an Oxford Cryosystem. The crystal was rotated through a total of 160o, with a 1o oscillation range per frame, a crystal-to-detector distance of 130 mm and an exposure time of 60 s. Data were processed on a Silicon Graphics Octane2 computer using the programs MOSFLM (Leslie, 1990) and SCALA (CCP4, 1994). wfdaj.sites.uol.com.br

A typical diffraction pattern of the MtCS crystal with 1 oscillation range. The crystal diffracts to 2.8 resolution.

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (dados de difrao)


Summary of data-collection statistics for CRL. X-ray wavelength (A ) Space group Unit-cell parameters ( ) Highest resolution shell () Asymmetric unit content Total reflections measured Number of independent reflection Completeness (%) Rmerge (%)
Values in parentheses are for the highest resolution shell (2.942.8 ).

1.427 P6422 or P6222 a = 129.74, b = 129.74, c = 156.77 2.942.8 2 molecules 92610 19341 97.9 (97.9) 5.6 (16.5)

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Aplicaes. 3) Determinao do contedo da unidade assimtrica da corismato sintase de Mycobacterium tuberculosis (Dias et al., 2004). A partir dos dados de difrao de raios X foi determinado que os parmetros da cela unitria. a = 129,74 b = 129,74 c = 156,77 Grupo espacial: P6422 ou P6222 MW = 41.800 kDa Para cela hexagonal: Vcell = a.b.c.sen () Vcell = 129,74. 129,74 . 156,77. sen(120o) = 2.285.290,31 3 wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Para determinarmos o contedo da unidade assimtrica calcularemos o volume de Matthews para diferentes possibilidades de unidade assimtrica e verificaremos qual valor fica mais prximo da faixa de 1,7 a 3,5 , como segue: VM = Vcell Z.MW

Z 2 6 4 18 24 30

VM(3/Da) 54,67 9,11 4,56 3,04 2,28 1,82

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Os valores dentro das caixas esto dentro da faixa prevista por Matthews, contudo sabemos que o grupo espacial hexagonal primitivo, o que significa que temos 6 unidades assimtricas, assim teremos um nmero de molculas mltiplo de 6, ou seja, 12, 18, 24, 30.., sendo o valor mais provvel 24. Assim temos: Vprotein = 1,23/VM = 0,5395 e Vsolvent = 0,4605

Z 2 6 4 18 24 30

VM(3/Da) 54,67 9,11 4,56 3,04 2,28 1,82

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (purificao)


C. roseum seeds were ground to a fine powder in a coffee mill. The powder was stirred with 0.15 M NaCl [1:10(w:v)] at room temperature for 4 h and then centrifuged at 10 000g for 20 min at 278 K. The resultant supernatant was applied onto a Sepharose-4Bmannose column (0.5 10 cm) equilibrated with 0.15 M NaCl containing 5 mMCaCl2 and 5 mMMnCl2. After removing unbound material, the lectin was eluted with 0.1 M glycine, 0.15 M NaCl pH 2.6. Purified CRL was monitored by SDSPAGE as described by Laemmli (1970) and was used to perform further characterization. N-terminal sequence analysis was performed using an Applied Biosystems pulsed-liquid phase 477A protein sequencer with a 120A PTH aminoacid analyzer, following the method described by the manufacturer.

Fonte: Cavada BS, Marinho ES, Souza EP, Benevides RG, Delatorre P, Souza LA, Nascimento KS, Sampaio AH, Moreno FB, Rustiguel JK, Canduri F, de Azevedo WF Jr, Debray H. Acta Crystallogr Sect F Struct Biol Cryst Commun. 1(62), 235-237, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (purificao)

Fonte: Cavada BS, Marinho ES, Souza EP, Benevides RG, Delatorre P, Souza LA, Nascimento KS, Sampaio AH, Moreno FB, Rustiguel JK, Canduri F, de Azevedo WF Jr, Debray H. Acta Crystallogr Sect F Struct Biol Cryst Commun. 1(62), 235-237, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (cristalizao)


The lyophilized purified CRL was dissolved to a concentration of 12 mg ml-1 in 20 mM TrisHCl pH 8.0 containing 0.5 mM CaCl2 and MnCl2 and used for crystallization trials. Crystallization screening by the hanging-drop vapour-diffusion method was performed in Linbro plates at 293 K using Hampton Research Crystal Screens I and II, SaltRx, Index and PEG/Ion Screens (Hampton Research, Aliso Viejo, CA, USA). The drops were composed of equal volumes (2 ml) of protein solution and reservoir solution and were equilibrated against 500 ml reservoir solution. An example of a crystal of CRL is shown in Fig. 1(a).
Fonte: Cavada BS, Marinho ES, Souza EP, Benevides RG, Delatorre P, Souza LA, Nascimento KS, Sampaio AH, Moreno FB, Rustiguel JK, Canduri F, de Azevedo WF Jr, Debray H. Acta Crystallogr Sect F Struct Biol Cryst Commun. 1(62), 235-237, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (dados de difrao)


A crystal was transferred to a cryoprotectant solution consisting of 30% glycerol in the crystallization reservoir solution. Data were collected at 1.42 A wavelength at a synchrotron-radiation source (beamline MX1, CPr station, Laborato rio Nacional de LuzSncrotronLNLS, Campinas, Brazil) using a MAR Research CCD imaging plate at a crystalto-detector distance of 70 mm. A set of 100 1 oscillation images was recorded (an image is shown in Fig. 1b). Diffraction data were indexed, integrated and scaled using MOSFLM and SCALA (Collaborative Computational Project, Number 4, 1994).
Fonte: Cavada BS, Marinho ES, Souza EP, Benevides RG, Delatorre P, Souza LA, Nascimento KS, Sampaio AH, Moreno FB, Rustiguel JK, Canduri F, de Azevedo WF Jr, Debray H. Acta Crystallogr Sect F Struct Biol Cryst Commun. 1(62), 235-237, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (dados de difrao)


Summary of data-collection statistics for CRL. X-ray wavelength (A ) Space group Unit-cell parameters (A ) Resolution limits (A ) Asymmetric unit content Total reflections measured Unique reflections measured Completeness (%) Rmerge (%)
Values in parentheses are for the highest resolution shell (1.871.77 A ).

1.427 P212121 a = 67.82, b = 103.14, c = 122.09 34.921.77 4 molecules 286361 80568 97.00 (97.0) 5.4 (32.5)

Fonte: Cavada BS, Marinho ES, Souza EP, Benevides RG, Delatorre P, Souza LA, Nascimento KS, Sampaio AH, Moreno FB, Rustiguel JK, Canduri F, de Azevedo WF Jr, Debray H. Acta Crystallogr Sect F Struct Biol Cryst Commun. 1(62), 235-237, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Aplicaes. 3) Determinao do contedo da unidade assimtrica da Lectina de Cymbosema roseum seeds (Cavada et al., 2006). A partir dos dados de difrao de raios X foi determinado que os parmetros da cela unitria. a = 67,82 b = 103,14 c = 122,09 Grupo espacial: P212121 MW = 25kDa Vcell = 67,82 . 103,14 . 122,09 = 854.014,03 3
Referncia:Cavada BS, Marinho ES, Souza EP, Benevides RG, Delatorre P, Souza LA, Nascimento KS, Sampaio AH, Moreno FB, Rustiguel JK, Canduri F, de Azevedo WF Jr, Debray H. Acta Crystallogr Sect F Struct Biol Cryst Commun. 1(62), 235-237, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Para determinarmos o contedo da unidade assimtrica calcularemos o volume de Matthews para diferentes possibilidades de unidade assimtrica e verificaremos qual valor fica mais prximo da faixa de 1,7 a 3,5 , como segue: VM = Vcell Z.MW Z 2 3 4 5 6 7 8 9 VM(3/Da) 34,14 17,07 11,38 8,53 6,83 5,69 4,88 4,27 Z 9 10 11 12 13 14 15 16 VM(3/Da) 3,79 3,41 3,10 2,85 2,63 2,44 2,28 2,14 Z 17 18 19 20 21 22 23 24 VM(3/Da) 2,01 1,90 1,80 1,71 1,63 1,55 1,49 1,42
2006 Dr. Walter F. de Azevedo Jr.

wfdaj.sites.uol.com.br

Caracterizao de Cristais
Os valores dentro das caixas esto dentro da faixa prevista por Matthews, contudo sabemos que o grupo espacial ortorrmbico primitivo, o que significa que temos 4 unidades assimtricas, assim teremos um nmero de molculas mltiplo de 4, ou seja, 12, 16 ou 20, sendo o valor mais provvel 16. Assim temos: Vprotein = 1,23/VM = 0,575 Z 2 3 4 5 6 7 8 9 VM(3/Da) 34,14 17,07 11,38 8,53 6,83 5,69 4,88 4,27 Z 9 10 11 12 13 14 15 16 e Vsolvent = 0,425 VM(3/Da) 3,79 3,41 3,10 2,85 2,63 2,44 2,28 2,14 Z 17 18 19 20 21 22 23 24 VM(3/Da) 2,01 1,90 1,80 1,71 1,63 1,55 1,49 1,42
2006 Dr. Walter F. de Azevedo Jr.

wfdaj.sites.uol.com.br

Artigos de cristalizao

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (clonagem, expresso)


The pheA gene (Rv3838c) encoding prephenate dehydratase from M. tuberculosis was amplified by the polymerase chain reaction (PCR) from genomic DNA. The forward (50TGCATATGGTGCGTATCGCTTACCTCGGTCC30) and reverse (50ACAAGCTTTCATGCTTGCGCCCCCTGGTCG- 30) synthetic oligonucleotide primers were based on the amino-terminal coding and carboxyterminal non-coding strands of the pheA gene (Cole et al., 1998) containing 50 NdeI and 30 HindIII restriction sites, respectively. The PCR product was cloned into pET-23a(+) expression vector (Novagen) and the recombinant plasmid was sequenced to confirm the identity of the cloned DNA fragment and to ensure that no mutations had been introduced by the PCR amplification step. ...

Fonte: Vivan AL, Dias MVB, Schneider CZ, de Azevedo Jr. WF, Basso LA, Santos DS. Acta Crystallogr Sect F Struct Biol Cryst Commun. F62, 357-360, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (purificao)


The supernatant was loaded onto a QSepharose Fast Flow (2.6 8.2 cm) anionexchange column (GE Healthcare) and fractionated using a 0.00.5 M NaCl linear gradient. The fractions were pooled and ammonium sulfate was added to a final concentration of 0.6 M; the mixture was then loaded onto a HiLoad 16/10 Phenyl Sepharose HP hydrophobic interaction column (GE Healthcare). The active fractions were loaded onto a Mono Q HR 16/10 anion-exchange column (GE Healthcare) and eluted using a 0.00.5 M NaCl linear gradient.
Fonte: Vivan AL, Dias MVB, Schneider CZ, de Azevedo Jr. WF, Basso LA, Santos DS. Acta Crystallogr Sect F Struct Biol Cryst Commun. F62, 357-360, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (clonagem, expresso)


Crystallization trials were initially performed by the hanging-drop vapour-diffusion method at 292 K. Hampton Crystal Screen and Crystal Screen 2 kits (Hampton Research) were used to determine the initial crystallization conditions. Hanging drops were prepared by mixing 1 ml of a solution containing 10 mg ml1 recombinant protein in 50 mM TrisHCl pH 7.8 and 1 ml reservoir solution. Crystals were obtained with a reservoir solution containing 0.1 M HEPES pH 7.5, 28%(v/v) PEG 400, 0.2 M calcium chloride.
Fonte: Vivan AL, Dias MVB, Schneider CZ, de Azevedo Jr. WF, Basso LA, Santos DS. Acta Crystallogr Sect F Struct Biol Cryst Commun. F62, 357-360, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (dados de difrao)


The data set for recombinant M. tuberculosis prephenate dehydratase was collected at a wavelength of 1.438 using a synchrotronradiation source (Station MX1, LNLS, Campinas) and a MAR CCD detector. The crystal was flash-frozen at 100 K in liquid nitrogen. The oscillation range used was 0.8, the crystal-to-detector distance was 150 mm and the exposure time was 90 s. The crystal diffracted to 3.2 resolution. All data were processed and scaled using the programs MOSFLM and SCALA from the CCP4 program suite (Collaborative Computational Project, Number 4, 1994).
Fonte: Vivan AL, Dias MVB, Schneider CZ, de Azevedo Jr. WF, Basso LA, Santos DS. Acta Crystallogr Sect F Struct Biol Cryst Commun. F62, 357-360, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Artigos de cristalizao (dados de difrao)


Summary of data-collection statistics for M. tuberculosis prephenate dehydratase. X-ray wavelength (A ) Temperature (K) Resolution range (A ) Total/unique reflections Space group Matthews coefficient (3 Da-1) Unit-cell parameters 1.438 100 65.943.20 (3.373.20) 71611/23215 I222 or I212121 2.7 a () 98.26 b ( ) 133.22 c ( ) 225.01 0.43 94.4 (97.2) 5.7 (1.5) 3.1 (3.0) 0.120 (0.434)
2006 Dr. Walter F. de Azevedo Jr.

Mosaicity () Data completeness (%) Average I/(I) Multiplicity Rmerge(%) wfdaj.sites.uol.com.br

Caracterizao de Cristais
Aplicaes. 3) Determinao do contedo da unidade assimtrica da Lectina de Cymbosema roseum seeds (Cavada et al., 2006). A partir dos dados de difrao de raios X foi determinado que os parmetros da cela unitria. a = 98,26 b = 133,22 c = 225,01 Grupo espacial: I222 ou I212121 MW = 33,6 kDa Vcell = 98,26 . 133,22 . 225,01 = 2.945.425,3 3
Fonte: Vivan AL, Dias MVB, Schneider CZ, de Azevedo Jr. WF, Basso LA, Santos DS. Acta Crystallogr Sect F Struct Biol Cryst Commun. F62, 357-360, 2006

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Para determinarmos o contedo da unidade assimtrica calcularemos o volume de Matthews para diferentes possibilidades de unidade assimtrica e verificaremos qual valor fica mais prximo da faixa de 1,7 a 3,5 , como segue: VM = Vcell Z.MW Z 2 8 16 24 32 40 48 VM(3/Da) 87,66 10,96 5,48 3,65 2,74 2,19 1,83

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Caracterizao de Cristais
Os valores dentro das caixas esto dentro da faixa prevista por Matthews, contudo sabemos que o grupo espacial ortorrmbico com centragem I, o que significa que temos 16 unidades assimtricas, assim teremos um nmero de molculas mltiplo de 16, ou seja, 16, 32, 48, sendo o valor mais provvel 32. Assim temos: Vprotein = 1,23/VM = 0,4489 Z 2 8 16 32 48 e Vsolvent = 0,5511 VM(3/Da) 87,66 10,96 5,48 2,74 1,83

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.

Referncias
Drenth, J. (1994). Principles of Protein X-ray Crystallography. New York: Springer-Verlag.

wfdaj.sites.uol.com.br

2006 Dr. Walter F. de Azevedo Jr.