Você está na página 1de 73

SECRETARA DE AGRICULTURA, GANADERA, DESARROLLO RURAL, PESCA Y ALIMENTACIN LIC. FRANCISCO JAVIER MAYORGA CASTAEDA Secretario M.C.

MARIANO RUIZ-FUNES MACEDO Subsecretario de Agricultura ING. IGNACIO RIVERA RODRIGUEZ Subsecretario de Desarrollo Rural ING. ERNESTO FERNNDEZ ARIAS Subsecretario de Fomento a los Agronegocios M.C. JESS ANTONIO BERUMEN PRECIADO Oficial Mayor

INSTITUTO NACIONAL DE INVESTIGACIONES FORESTALES, AGRCOLAS Y PECUARIAS DR. PEDRO BRAJCICH GALLEGOS Director General DR. SALVADOR FERNNDEZ RIVERA Coordinador de Investigacin, Innovacin y Vinculacin M.C. ARTURO CRUZ VZQUEZ Coordinador de Planeacin y Desarrollo LIC. MARCIAL A. GARCA MORTEO Coordinador de Administracin y Sistemas

CENTRO DE INVESTIGACIN REGIONAL DEL NOROESTE DR. ERASMO VALENZUELA CORNEJO Director Regional M.C. JESS ARTURO SAMANIEGO RUSSO Director de Investigacin DR. JESS ARNULFO MARQUEZ CERVANTES Director de Planeacin y Desarrollo CAMPO EXPERIMENTAL VALLE DE CULIACN DR. ENRIQUE ASTENGO LPEZ Director de Coordinacin y Vinculacin en Sinaloa

AVANCES DE INVESTIGACIN 2011 DEL CEVACU

Derechos reservados Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias Progreso 5, Barrio de Santa Catarina, Delegacin Coyoacn C.P. 04010, Mxico D.F. Telfono (0155)38718726

Primera edicin: febrero de 2012 Tiraje: 500 ejemplares Impreso en Los Talleres Grficos de Manjarrez Impresores, S.A. de C.V. Jos Aguilar Barraza 140, poniente Colonia Jorge Almada C.P. 80200, Culiacn, Sin., Mxico

Avances de Investigacin 2011 del CEVACU Campo Experimental Valle de Culiacn Carretera Culiacn-El Dorado km 16.5 Apartado postal 356 C.P. 80000, Culiacn, Sinaloa, Mxico Telfonos: 01(667) 8461013, 8461014 y 8461015 e-mail: astengo.enrique@inifap.gob.mx

CAMPO EXPERIMENTAL VALLE DE CULIACN

AVANCES DE INVESTIGACIN 2011 DEL CEVACU

PUBLICACIN ESPECIAL No. 15

FEBRERO DEL 2012

PRESENTACIN

El objetivo principal del INIFAP es generar y transferir conocimientos e innovaciones tecnolgicas con el fin de contribuir al desarrollo sostenible de los procesos productivos forestales, agrcolas y pecuarios, sin deteriorar los recursos naturales. Para alcanzar este objetivo, el personal cientfico del Campo Experimental Valle de Culiacn desarrolla proyectos con base en las demandas tecnolgicas planteadas en las convocatorias de las instituciones que financian la investigacin agrcola, pecuaria y forestal. La estrategia general del CEVACU es concentrar sus esfuerzos en aquellas demandas para las cuales ha desarrollado mayores y mejores capacidades de investigacin, y colaborar con otras instituciones con un enfoque de complementariedad de capacidades. En particular, en el CEVACU se realiza investigacin para mejorar la competitividad y rentabilidad de los diferentes eslabones de las cadenas agroalimentarias de maz, garbanzo, soya, hortalizas, sorgo, crtamo, arroz, frijol y bovinos leche. Adems; en el CEVACU opera la Unidad Regional de Biotecnologa, que genera conocimientos y tecnologas en al rea agropecuaria, y proporciona a los agricultores diagnsticos altamente especializados de enfermedades de plantas y animales. En esta publicacin, los actores de las cadenas agroalimentarias como productores, agroindustriales, distribuidores, comercializadores, as como los representantes de las instituciones oficiales y de organismos particulares interesados en el desarrollo y competitividad del sector agropecuario y forestal, podrn encontrar los conocimientos y tcnicas generadas por el INIFAP en este Campo Experimental. Con ello esperamos contribuir a mejorar la rentabilidad y competitividad del sector agropecuario y forestal de Sinaloa, respetando los recursos naturales, que son propiedad de la nacin.

Avances de investigacin del CEVACU 2011

NDICE

AGRICULTURA
Crtamo
Validacin de variedades de crtamo y lneas avanzadas en ensayos de rendimiento y fechas de siembra en el centro de Sinalo..... Ctricos Efectividad biolgica de insecticidas novedosos contra Diaphorina citri Kuwayama en el Valle de Culiacn, Sinaloa, Mxico ..... Garbanzo Formacin de variedades de garbanzo blanco para exportacin adaptadas a las zonas productorasdel estado de Sinaloa..

11

Maz
Distribucin geogrfica y caracterizacin molecular de Fusarium spp. en el centro-sur de Sinaloa y respuesta de variedades de maz al ataque de este patgeno .

15

Sorgo Formacin de variedades e hbridos de sorgo para temporal y riego en el estado de Sinaloa..

20

Avances de investigacin del CEVACU 2011

GANADERA

Capacitacin a productores y tcnicos en prcticas de manejo sanitario y ordeo que contribuyan a mejorar la calidad de la leche en ganado bovino . Validacin y transferencia de tecnologa pecuaria para el desarrollo sustentable de grupos de ganaderos organizados en Sinaloa ... Unidad Tcnica Especializada de la Estrategia de Asistencia Tcnica Pecuaria en el estado de Sinaloa 2011... Asistencia tcnica y capacitacin para apoyar el cumplimiento de los compromisos adquiridos por los beneficiarios en el marco del componente PROGAN a tcnicos PSPP en el estado de Sinaloa.....

29 35 43

53

ii

Avances de investigacin del CEVACU 2011

Validacin de variedades de crtamo y lneas avanzadas en ensayos de rendimiento y fechas de siembra en el centro de Sinaloa
M.C. Alberto Borbn Gracia1, M.C. Jess Prez Mrquez1, M.C. Mara G. Garca Camarena1 y M.C. Xochitl M. Ochoa Espinoza2.
Campo Experimental Valle de Culiacn-CIRNO-INIFAP. Campo Experimental Norman E. Borlaug-CIRNO-INIFAP.

INTRODUCCIN El crtamo (Carthamus tinctorius L.), es una de las principales oleaginosas que se siembran en Mxico durante el ciclo de otoo-invierno en condiciones de riego y temporal. Este cultivo destaca por tener bajos costos de produccin y su semilla contiene un aceite de alta calidad, con alto porcentaje de los cidos grasos linoleico y oleico, los cuales son esenciales en la nutricin humana (Montoya, 2010). En la zona centro del estado de Sinaloa existen condiciones de clima y suelo en las cuales el crtamo puede cultivarse eficazmente durante el ciclo otoo-invierno. En la zona de temporal del municipio de Salvador Alvarado, con la humedad residual de las lluvias se pueden obtener rendimientos de 1.5 toneladas por hectrea y en la zona de riego del municipio de Angostura se pueden obtener rendimientos de 3.0 toneladas por hectrea con el riego de presiembra y un auxilio. La demanda comercial de este cultivo, sus bajos costos de produccin, su gran capacidad para extraer la humedad del suelo y su amplia adaptacin en el noroeste de Mxico, hacen del crtamo una buena alternativa de siembra para el estado de Sinaloa, sin embargo, es necesario el uso de nuevas tecnologas que conviertan a este cultivo en una opcin ms segura y rentable. OBJETIVOS Validar variedades de crtamo y lneas avanzadas en ensayos de rendimiento, parcelas de validacin y fechas

de siembra, con el fin de desarrollar la tecnologa de produccin para este cultivo bajo condiciones de riego en Sinaloa. MATERIALES Y MTODOS Los trabajos se llevaron a cabo en el ciclo otoo-invierno 2010-2011 en terrenos del Campo Experimental Valle de Culiacn, y en el lote del agricultor cooperante Jos Hiplito Snchez Snchez, en el municipio de Salvador Alvarado, Sinaloa, bajo condiciones de riego. En el Campo Experimental Valle de Culiacn se establecieron tres trabajos: un ensayo de 15 lneas y variedades linoleicas, un ensayo de 20 materiales oleicos y una evaluacin de dos variedades en ocho fechas de siembra. En el lote del agricultor cooperante se estableci una parcela de validacin compuesta por cuatro variedades altamente tolerantes a falsa cenicilla y el testigo comercial Bacum92. La siembra de los ensayos en el Campo Experimental Valle de Culiacn, se realiz el 9 de diciembre de 2010 en seco y se fertiliz con la frmula 150-50-00. Para los ensayos, se utiliz un diseo experimental de bloques al azar con 4 repeticiones, la parcela experimental fue de 4 surcos de 6 m de longitud separados a 80 cm y la parcela til fue de 6.4 m2. Las variedades que se evaluaron en las ocho fechas de siembra fueron CIANO-LIN y CIANO-OL, las fechas de siembra establecidas fueron: 15 y 30 de noviembre, 15 y 30 de diciembre, 15 y 31 de enero, 15 y 28 de febrero, el tamao de parcela en cada fecha de siembra fue de cuatro surcos de 50 m de longitud con una

1 Agricultura

Avances de investigacin del CEVACU 2011 separacin de 80 cm para cada variedad; en el lote del agricultor cooperante se sembraron las variedades RC-1002, RC1005, RC-1033, CIANO-LIN y el testigo comercial BACUM92, el rea sembrada con cada variedad fue de 5,000 m2, la siembra se realiz el 9 de diciembre de 2010 en hmedo y se fertiliz con la formula 150-5000. En ambos lotes, se tomaron datos agronmicos, calidad y rendimiento de grano, los cuales se analizaron estadsticamente. RESULTADOS En el ensayo con materiales oleicos, obtuvieron diferencias estadsticas En el ensayo con materiales linoleicos, no se encontr diferencia significativa de rendimiento entre los tratasignificativas de rendimiento entre los materiales evaluados, con un coeficiente de variacin de 16.6%. Los materiales ms sobresalientes fueron: S-518, CC1477-2-11-5-3, CC1514-1-3, CC1477-2-1-16-1-0Y, OLEICA ALTA, OLEICA NAVOJOA, CC1444-2-1-0Y-2-2-1, CC1485-3-1-1-2, CIANO-OL, entre otras, con rendimientos que van de 3,000 a 3,578 kg/ha (Cuadro 1). Cabe mencionar que los testigos comerciales presentaron buenos rendimientos, ya que no se present la enfermedad falsa cenicilla.

se

Cuadro 1.- Rendimiento y caractersticas agronmicas de 20 genotipos oleicos evaluados en el Campo Experimental Valle de Culiacn, ciclo O-I 2010/2011. CEVACU-CIRNO-INIFAP
Nmero de das a: Variedad IF S-518 CC1477-2-1-1-5-3 CC1514-1-3 CC1477-2-1-16-1-0Y OLEICA ALTA OLEICA NAVOJOA CC1444-2-1-0Y-2-2-1 CC1485-3-1-1-2 CIANO-OL CIANO-OL-Patronato (Cul.) CC1444-2-1-0Y-1-2-1 CC1469-2-2-1-1-3-1 CC1423-2-3-2-0Y CC1477-2-1-1-5-3 (DESM) CC1469-2-2-1-1-M(DESM) S-334 CC1485-3-1-1-1-0Y (DESM) CC1469-2-2-1-1-1-1 OLEICA BAJA CC1485-3-1-1-1-1 109 110 109 110 108 108 112 110 107 107 109 108 109 109 110 109 108 110 107 108 MF 148 152 148 151 148 148 154 154 148 149 151 147 151 149 151 150 148 150 145 145 127 138 127 145 132 140 135 135 133 138 138 127 130 135 123 132 135 118 130 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3578 a 3438 a 3333 a 3167 ab 3109 ab 3094 ab 3049 ab 3042 ab 3005 ab 2997 ab 2992 ab 2972 ab 2959 ab 2753 ab 2750 ab 2734 ab 2708 ab 2399 b 2344 b 2261 b AP (cm) *CEN (0-10) Rendimiento (kg/ha)

IF = Inicio de floracin, MF = Madurez fisiolgica, AP = Altura de planta, CEN = Cenicilla susceptible.) C.V. = 16.6%; DMS = 931.

(0: = tolerante

10: =

2 Agricultura

Avances de investigacin del CEVACU 2011 mientos evaluados, con un coeficiente de variacin de 17.61%. Los testigos S-719 y Bacum92 presentaron rendimientos superiores a las tres toneladas por hectrea (Cuadro 2), esto debido a que no se present la falsa cenicilla, ya que ante la presencia de esta enfermedad, dichas variedades se ven seriamente afectadas en su rendimiento, mientras que variedades como RC-1002, RC-1005, RC-1033 y CIANO-LIN no son afectadas por esta enfermedad. En la validacin de fechas de siembra, el anlisis estadstico mostr diferencias estadsticas entre variedades y entre fechas de siembra, con un coeficiente de variacin de 10.5%. La variedad CIANO-OL, con un rendimiento de 4,241 kg/ha fue estadsticamente superior a la variedad CIANO-LIN en la primera fecha de siembra, de la segunda a la sexta fecha de siembra fue estadsticamente superior la variedad CIANO-LIN, mientras que en la sptima y octava fecha no se encontr diferencia significativa entre variedades (Cuadro 3). En el Cuadro 4 se presenta el rendimiento obtenido en las diferentes fechas de siembra en promedio de las dos variedades, donde se puede observar que se encontr diferencias significativas entre fechas de siembra y concuerda con lo que mencionan Borbn, et al., 2010. Las fechas de noviembre a diciembre, son las que mejores rendimientos de grano presentaron (3.3 a 3.8 t/ha), sin embargo en el mes de enero se presentan rendimientos superiores a los 2,600 kg/ha y en febrero se obtienen rendimientos de 2,000 kg/ha, que son rendimientos aceptables considerando que en fechas de enero y febrero se puede sembrar crtamo despus de la cosecha de frijol o algunas hortalizas como calabaza.

Cuadro 2. Rendimiento de grano y caractersticas agronmicas de 15 genotipos linoleicos validados en el Campo Experimental Valle de Culiacn, Sin. ciclo O-I 2010-2011 CEVACU-CIRNO-INIFAP.
Variedad RC-1002 0272 A RC-1005 0272-11-1 S-719 P-12-4-3-1-0Y CC1328-5-1-1-1-3-0Y-2-1-0Y BACUM'92 0272-3-2 0272-12-3-5-0Y P-12-1 RC-1033 0272-3-5 0272-20-5 CIANO-LIN Nmero de das a: IF 101 107 106 111 103 105 107 104 106 110 110 107 106 110 105 MF 148 154 152 151 148 152 154 149 151 155 155 151 154 154 151 138 135 127 130 133 127 140 127 138 132 118 130 127 138 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3781 3708 3675 3599 3597 3550 3487 3435 3300 3227 3112 3044 3026 3010 2898 AP (cm) *CEN (0-10) Rendimiento (kg/ha)

IF = Inicio de floracin, MF = Madurez fisiolgica, AP = Altura de planta, CEN = Cenicilla (0: tolerante,10: susceptible.) CV. = 17.61%

3 Agricultura

Avances de investigacin del CEVACU 2011


Cuadro 3. Rendimiento de grano y caractersticas agronmicas de dos variedades de crtamo validadas en ocho fechas de siembra en el Campo Experimental Valle de Culiacn, Sin. Ciclo O-I 2010-2011. CEVACU-CIRNO-INIFAP.
Nmero de das a: Fecha de siembra. Variedad Floracin CIANO-OL 15 de noviembre CIANO-LIN CIANO-OL 30 de noviembre CIANO-LIN CIANO-OL 15 de diciembre CIANO-LIN CIANO-OL 30 de diciembre CIANO-LIN CIANO-OL 15 de enero CIANO-LIN CIANO-OL 31 de enero CIANO-LIN CIANO-OL 15 de febrero CIANO-LIN CIANO-OL 28 de febrero CIANO-LIN 75 120 105 0 1972 a 79 73 128 118 105 105 0 0 2072 a 2059 a 88 77 133 126 105 110 0 0 2897 a 2259 a 93 84 138 130 110 110 0 0 2903 a 2394 b 101 92 145 136 130 115 0 0 3916 a 2363 b 108 98 158 142 135 135 0 0 3769 a 2928 b 110 105 157 155 151 135 0 0 3794 a 3272 b 120 108 166 154 170 157 0 0 3456 b 2825 b 118 Madurez fisiolgica 163 Altura de planta (cm) 170 *Cenicilla (escala 0-10) 0 Rendimiento (kg/ha) 4241 a

F.S. = Fecha de siembra; C.V. = 10.5%; DMS = 146.8.

Cuadro 4. Rendimiento de grano obtenido en ocho fechas de siembra en el Campo Experimental Valle de Culiacn, Sin. Ciclo O-I 2010-2011. CEVACU-CIRNO-INIFAP.

N de orden 1 3 4 2 6 5 7 8
C.V. = 10.5%; DMS = 391.

Fecha de siembra 15 de noviembre 15 de diciembre 30 de diciembre 30 de noviembre 31 de enero 15 de enero 15 de febrero 28 de febrero

Rendimiento medio (kg/ha) 3,849 a 3,521 ab 3,422 b 3,309 b 2,645 2,633 2,166 2,016 c c d d

En la parcela de validacin que se estableci en el municipio de Salvador Alvarado, la variedad RC-1002 present el mejor rendimiento (3 t/ha), el resto de las

variedades presentaron rendimientos de 2.2 a 2.7 t/ha (Cuadro 5), incluyendo el testigo comercial Bacum92 que obtuvo un rendimiento aceptable, esto debido a que no

4 Agricultura

Avances de investigacin del CEVACU 2011 se present la falsa cenicilla, ya que dicha variedad es muy susceptible a esta enfermedad.

Cuadro 5. Rendimiento de grano y caractersticas agronmicas de 5 variedades de crtamo validadas bajo condiciones de riego en el municipio de Salvador Alvarado, Sin. Ciclo O-I 2010-2011. CEVACU-CIRNO-INIFAP.
Nmero de das a: Variedad Floracin RC-1002 BACUM92 RC-1033 CIANO-LIN RC-1005 104 109 112 109 112 Madurez fisiolgica 142 145 148 146 151 Altura de planta (cm) 120 125 125 130 130 *Cenicilla (escala 0-10) 0 0 0 0 0 Rendimiento (kg/ha) 3,004 2,729 2,606 2,535 2,219

C.V. = 16.28%

CONCLUSIONES Los testigos comerciales utilizados en los ensayos de rendimiento, presentaron buen rendimiento de grano debido a que no se present la falsa cenicilla, sin embargo hay lneas avanzadas que presentan rendimientos superiores a los testigos comerciales. La mejor fecha de siembra para el cultivo de crtamo son los meses de noviembre y diciembre, sin embargo las siembras de enero y febrero presentan rendimientos superiores a las dos t/ha y podran ser una buena opcin despus de cosechar el frijol o algunas hortalizas.

LITERATURA CONSULTADA Montoya, C. L. 2008. El cultivo de crtamo (Carthamus tinctorius L) en Mxico. Libro tcnico N 5. INIFAP-CIRNO. Cd. Obregn, Sonora, Mxico p: 16. Borbn G. A., Ochoa E. X. M., Prez M. J., Garca C. M. G., Macas C. J y Montoya C. L. 2010. Gua para producir crtamo en Sinaloa. Folleto para productores N 54. CEVACUCIRNO-INIFAP. Culiacn, Sinaloa, Mxico. p. 9.

5 Agricultura

Avances de investigacin del CEVACU 2011

Efectividad biolgica de insecticidas novedosos contra Diaphorina citri Kuwayama en el Valle de Culiacn, Sinaloa, Mxico
M.C. Jess Prez Mrquez1;Dr. Edgardo Cortez Mondaca2; M.C. Heidi Melania Medina Montenegro1 y M.C. Sixto Velarde Flix.1
Campo Experimental Valle de Culiacn-CIRNO-INIFAP. Campo Experimental Valle del Fuerte-CIRNO-INIFAP.

INTRODUCCIN En Mxico, diversas plagas se encuentran asociadas a los ctricos, dentro de las cuales destaca actualmente el psilido asitico de los ctricos (PAC) Diaphorina citri Kuwayama por su importancia como vector de la bacteria Candidatus liberobacter asiaticus causante de la enfermedad conocida como enverdecimiento de los ctricos Huanglonbing (HLB), enfermedad detectada en el estado de Yucatn en el ao 2009 en muestras del vector (SENASICA, 2009). D. citri se alimenta de especies silvestres y cultivadas de la familia Rutaceae (Aubert, 1987), principalmente limas y limones; el insecto provoca daos directos al alimentarse de los brotes tiernos y en fuertes infestaciones provoca deformacin de los brotes, cada de follaje y flores; las ninfas de cuarto y quinto instar al igual que los adultos son capaces de transmitir la enfermedad (EPPO, 2005). Diversos mtodos y estrategias de control se han empleado para enfrentar, tanto al vector como la enfermedad; se menciona que el manejo de esta enfermedad estar basado en el control del insecto vector al igual que la eliminacin de fuentes de inculo por medio de la erradicacin de los rboles enfermos y el establecimiento de anillos fitosanitarios alrededor de dichos rboles (Chiou, 1998). Sin embargo, hasta el momento no se conoce ningn mtodo de erradicacin efectivo para el vector (McFarland y Hoy, 2001).

OBJETIVO Evaluar insecticidas con diferente modo de accin a los convencionales sintticos de contacto y amplio espectro, para contar con mayores alternativas de control qumico de D. citri en ctricos, en Sinaloa, que permitan realizar otras medidas de control, como el control biolgico por conservacin y el aprovechamiento de numerosos enemigos naturales. MATERIALES Y MTODO El estudio se realiz en la huerta Citripolis con naranja Citrus sinensis (L.) Osbeck, ubicada en el Valle de Culiacn con coordenadas 244850.99 y 1073246.08. Diseo de plantacin con 4 metros entre plantas y seis entre hileras. Se evaluaron seis insecticidas, entre estos algunos relativamente recientes, incluyendo neonicotinoides, spinosynas, derivados de cidos tetrnicos y tetrmicos y piretroides (Cuadro 1) reportados como efectivos para el control del insecto plaga en estudio (Cortez. et al., 2010; Daz-Zorrilla, 2010); el insecticida Bifentrina se incluyo como tratamiento testigo comercial, adems de un testigo absoluto sin insecticida. La aplicacin de los tratamientos se realiz el 4 de marzo de 2011, utilizando una aspersora de motor marca ECHO con una capacidad de 25L; el gasto de agua por

6 Agricultura

Avances de investigacin del CEVACU 2011

Cuadro 1. Ingredientes activos y dosis de producto comercial evaluados contra D. citri en naranja
Insecticida Venom Exalt Confidor Talstar Actara Movento Engeo Clutch Testigo Ingrediente activo 1) Dinotefuran 2) Spinetoram 3) Imidacloprid 4) Bifentrina 5) Thiamethoxam 6) Spirotetramat 7) Thiamethoxam+Cyhalotrina 8) Clotianidina 9) Agua Clase qumica Neonicotinoide Spinosynas Neonicotinoides Piretroide Neonicotinoide Derivados de cidos tetrmicos y tetrmicos Neonicotinoide+Piretoide Neonicotinoide --------Dosis/ha 300 g 500 mL 500 mL 500mL 500 g 300 mL 300 mL 300 g -------Dosis/L de agua 0.85 g 2.80 mL 1.40 mL 2.80 mL 2.80 g 1.20 mL 1.70 mL 1.70 g --------

rbol fue de 0.5 litros. Para todos los tratamientos se le adicion 2 mL por litro de surfactante (Surfacid). La aplicacin se dirigi a la copa del rbol, aplicando entre las 9 y 11 de la maana. Al momento de la aspersin predominaba la etapa de ninfas del pslido asitico de los ctricos. La variable de respuesta medida fue el nmero de ninfas muertas (sin respuesta a estmulo) en brotes tiernos realizando muestreos a los tres y siete despus de la aplicacin. Se colectaron 20 brotes por tratamiento, se cont el total de ninfas en todos sus estadios. El conteo se hizo observando los brotes en un microscopio estereoscpico marca Carl Zeiss para diferenciar con mayor facilidad las ninfas vivas de las muertas. Se utiliz un diseo de bloques al azar con ocho repeticiones por tratamiento, cada rbol se consider una repeticin. El anlisis estadstico se realiz con el programa SAS versin 9.2. (SAS, 2010). En los muestreos donde se observ diferencias entre tratamiento, se realiz comparacin de medias con la prueba de Tukey (=0.05). RESULTADOS Y DISCUSIN En el ANVA de los porcentajes de mortalidad de ninfas chicas a los tres das despus de la aplicacin (DDA; 72h) el Clutch mostr la mayor mortalidad (100%), sin diferenciarse estadsticamente del Venom (97%), Confidor (91%), Talstar (89.3%), Actara (99.6%) y Engeo (95.8). El Clutch mostr diferencia significativa, respecto de Exalt, Movento y el testigo absoluto sin insecticida (Fig. 1). El Clutch

mostr diferencia significativa (p<0.0001), respecto del Exalt, Movento y el testigo absoluto sin insecticida. En el efecto de ninfas grandes el Confidor mostr la mayor mortalidad (90.4%), aunque sin diferenciarse estadsticamente del Venom, Talstar y Engeo; estos cuatro tratamientos reportaron diferencia significativa respecto al resto: Exalt, Actara, Movento, Clutch y el testigo sin insecticida (p<0.0001) (Fig. 1). La efectividad biolgica de los tratamientos insecticidas en algunos casos fue diferente de acuerdo al estado de desarrollo del insecto, por ejemplo el Venom, el Actara y el Clutch, los insecticidas con mayor porcentaje de mortalidad de ninfas chicas, no fueron los ms sobresalientes para matar ninfas grandes. El Exalt present la menor mortalidad de ninfas chicas y grandes (6% y 11%), seguido por el Movento con apenas el 47% y 46%. Siete das despus de la aplicacin de los tratamientos, siete de los ocho insecticidas evaluados mostraron porcentaje de mortalidad de 100 o cercana sobre ninfas chicas, el Talstar, el Actara, el Engeo y el Clutch mataron al 100% de los especmenes, pero no se detect diferencia significativa con Venom, Confidor y Movento; se determin diferencia significativa respecto a Exalt y al testigo absoluto (p<0.0001) (Fig. 2). Para ninfas grandes se observ una respuesta un tanto singular, el porcentaje de ejemplares de D. citri muertas decay notablemente respecto a la lectura de mortalidad de los tres DDA, slo el Movento result sobresaliente

7 Agricultura

Avances de investigacin del CEVACU 2011

(p<0.0001), con una alta efectividad (96.8%), el siguiente tratamiento con mayor porcentaje de mortalidad (Actara), apenas rebas el 30% de mortalidad, el Engeo con elevada mortalidad de ninfas grandes a las 72 h de la aplicacin de los tratamientos y el Clutch registraron cero mortalidad de ninfas grandes del insecto en estudio, igual que el testigo absoluto. Lo anterior significara que el efecto residual de los insecticidas probados excepto el Movento, sobre ninfas grandes es reducido a los siete DDA, aunque el efecto sobre ninfas chicas en el mismo intervalo de tiempo se increment respecto a la lectura de los 3 DDA. Cabe sealar que el estudio an no concluye, se tiene programado realizar al menos una lectura ms a los 13 DDA. El insecticida Exalt definitivamente mostr efectividad reducida sobre el insecto para los dos estados de desarrollo considerados en las dos lecturas de mortalidad. Por su parte el testigo absoluto no registro muerte de ninfas de Diaphorina citri, reflejando cero mortalidad natural.

100 90 80 70

desde los $233.75 hasta $1,514.43 por aspersin de insecticida/ha (Cuadro 2), el testigo comercial Talstar es el de menor costo, mientras el ms costoso es el Actara. Desde este punto de vista el Talstar sera el insecticida a recomendar, ya que mostr una elevada efectividad biolgica sobre ninfas chicas (Fig 1 y 2) a los tres y siete DDA, no obstante es un txico de contacto y de amplio espectro que afecta insectos no blanco de control, entre ellos numerosos enemigos naturales de D. citri (CortezMondaca et al., 2010) y otros que ayudan a regular poblaciones de diferentes insectos plaga, adems, la mortalidad de ninfas grandes mostrada a los siete DDA fue reducida. En contraste el Movento, insecticida sistmico y que tiene que ser ingerido para ejercer su efecto txico, con un porcentaje de mortalidad alto de ninfas chicas y grandes en la lectura de mortalidad a los siete DDA, es probablemente el insecticida que menor efecto nocivo tiene sobre enemigos naturales, aunque su costo/ha es relativamente elevado. Entre los insecticidas con mayor efectividad biolgica como el Movento, Actara, Engeo y Clutch el ms econmico es el tercero, con un costo/ha de $370.50.
100.0 90.0 80.0

Porcentaje de mortalidad

60 50 40 30 20 10 0

Porcentaje de mortalidad

70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0

1 97.3 82.2 a a

2 6.1 c 11.5 c

3 91.3 a 90.4 a

4 89.3 a 82.2 a Tratamientos

5 99.6 a 78.1ab

6 47.4 b 46.5 b

7 95.8a 86.7a

8 100.0 a 68.7 ab

9 0.0c 0.0c

Ninfas Chicas Ninfas Grandes

Figura 1. Porcentaje de mortalidad de ninfas chicas y grandes de D. citri, en brotes tiernos, en evaluacin de insecticidas tres das despus de la aplicacin. (p<0.0001) =0.05. Hileras con letras diferentes no difieren estadsticamente.

1 99.6 a 23.9 bc

2 13.3 b 14.1 bc

3 97.3 a 18.0 bc

4 100.0 a 29.8 bc

5 100.0 a 33.3 b

6 98.9 a 96.8 a

7 100.0a 0.0 c

8 100.0 a 0.0 c

9 0.0 c 0.0 c

Ninfas Chicas Ninfas grandes

Tratamientos

Al realizar un anlisis econmico del costo que representa utilizar los insecticidas evaluados, se observa mucha diferencia,

Figura 2. Porcentaje de mortalidad de ninfas chicas y grandes de D. citri, en brotes tiernos, en evaluacin de insecticidas siete das despus de la aplicacin. (p<0.0001) =0.05. Hileras con letras diferentes no difieren estadsticamente.

8 Agricultura

Avances de investigacin del CEVACU 2011


Cuadro 2. Presentacin, dosis, costo unitario y por hectrea de insecticidas evaluados contra D. citri.
Tratamiento 1 2 3 4 5 6 7 8 Venom Exalt Confidor Talstar Actara Movento Engeo Clutch Presentacin 1000 g 1000 mL 1000 mL 1000 mL 600 g 1000 mL 1000 mL 500 g Costo unitario $ 1,900.00 772.5 1,675.00 467.5 1,817.32 1,850.82 1,235.00 1,650.97 Dosis/ha (300 g) (500 mL) (500 mL) (500 mL) (500 g) (300 mL) (300 g) (300 g) Costo/ha $ 570 386.25 837.5 233.75 1,514.43 555.25 370.5 990.58

De acuerdo a los resultados obtenidos se puede recomendar el empleo de Confidor, Talstar, Actara, Engeo, Venom y Clutch para control de ninfas chicas, mientras que para el control de ninfas chicas y sobre todo ninfas grandes, entre los cuatro y siete DDA, se sugiere el Movento, el cual permitira realizar medidas de control biolgico por conservacin y aprovechamiento de numerosos enemigos naturales y eventualmente mediante la liberacin de agentes de control biolgico (Cortez-Mondaca et al., 2010; CortezMondaca et al., 2010). AGRADECIMIENTOS A la Fundacin Produce Sinaloa A.C. por el financiamiento del proyecto Fluctuacin Poblacional de Diaphorina citri Kuwayama e Insecticidas Biorracionales para su Control en Ctricos en Sinaloa. Al Fondo Sectorial SAGARPA-CONACYT por el financiamiento del proyecto Manejo de la Enfermedad Huanglonbing (HLB) mediante el control de poblaciones del vector Diaphorina citri (Hemiptera:Psyllidae), el psillido asitico de los ctricos. LITERATURA CITADA Aubert B, 1987. Trioza erytreae Del Guercio and Diaphorina citri Kuwayama (Homoptera: Psylloidea), the two vectors of Citrus Greening Disease: biological aspects and 9

possible control strategies. Fruits 42, 149162. Cortez, M. E., J. I. Lpez A, L. M. Hernndez F., A. Fu C. y Jess Loera Gallardo. 2010. Control qumico de Diaphorina citri Kuwayama en ctricos dulces de Mxico: seleccin de insecticidas y pocas de aplicacin. INIFAPCIRNO-Campo Experimental Valle del Fuerte. Folleto Tcnico No. 35. ISBN: 978-607-425-418-5. Editorial: Panorama. Los Mochis, Sinaloa, Mxico. 24p. Cortez-Mondaca, E., N. E. Lugo-Angulo., J. Prez-Mrquez y M. A. ApodacaSnchez. 2010. Primer reporte de enemigos naturales y parasitismos de Diaphorina citri Kuwayama en Sinaloa, Mxico. Southwest. Entomol. 35(1): 113-115. Chiou, N. C. 1998. Ecology of the insect vectors of citrus systemic diseases and their control in Taiwan. FFTC Publication Database. (En lnea). Disponible en www.agnet.org/library/eb/459a/. (Consulta: 20-9-2007). Daz-Zorrilla, U. A. 2010. Estudio de evaluacin de efectividad biolgica de Actara para controlar Diaphorina citri en limn persa (Citrus latifolia Tan). In: Lpez-Arroyo J. I. y V. W. Gonzlez Lauck. Memoria: 1er Simposio Nacional sobre Investigacin para el Manejo del

Agricultura

Avances de investigacin del CEVACU 2011 Psillido Asitico de los Ctricos y el Huanglongbing en Mxico. Monterrey, Nuevo Len, Mxico. INIFAP-CIRNE-Campo Experimental General Tran. 396-407 pp. EPPO. 2005. Diaphorina citri Kuwayama. Bulletin 35: 331-333. McFarland, C. y Hoy, M. (2001): Survival of Diaphorina citri (Homoptera: Psyllidae), and its two parasitoids, Tamarixia radiata (Hymenoptera: Eulophidae) and Diaphorencyrtus aligarhensis (Hymenoptera: Encyrtidae), under different relative humidities and temperature regimes. Fla. Entomol. 84(2): 227-233. SAS Institute. 2010. SAS systems for information delivery for Windows. Release 9.2. Cary, North Caroline. USA. SENASICA-Direccin General de Sanidad Vegetal. Julio de 2009. Notificacin oficial No. 5. Mxico. D.F.

10

Agricultura

Avances de investigacin del CEVACU 2011

Formacin de variedades de garbanzo blanco para exportacin adaptadas a las zonas productorasdel estado de Sinaloa
Dr. Pedro Manjarrez Sandoval1;Biol. Milagros Ramrez Soto1; M.C. Rafael A. Salinas Prez2; Dr. Vctor Valenzuela Herrera1, Ing. Lauro Gmez Gmez1 y M.C.Yeny Valencia Martnez2.
Campo Experimental Valle de Culiacn-CIRNO-INIFAP. Campo Experimental Valle del Fuerte-CIRNO-INIFAP.

INTRODUCCIN El estado de Sinaloa es el principal productor de garbanzo blanco en Mxico. En promedio de los ltimos diez aos, se han sembrado con este cultivo en Sinaloa, un total de 85,668 ha, tanto en riego como en temporal, cosechndose un total de 82,104 ha, con un rendimiento promedio 1,540 kg/ha (SAGARPA, 2010). La produccin de garbanzo en Sinaloa, ha contribuido de una manera importante al posicionamiento del garbanzo mexicano dentro del mercado internacional, dada la alta calidad del grano, de color blanco cremoso y calibre grande, de la variedad Blanco Sinaloa-92, (Gmez et al. 2003a). Esta variedad fue liberada por el Programa de Mejoramiento Gentico de Garbanzo del Campo Experimental Valle de Culiacn del INIFAP. En el ao 2003, el INIFAP liber la nueva variedad Suprema-03 (Gmez et al., 2003b) que conserva la resistencia a la rabia, rendimiento y calibre de grano de Blanco Sinaloa-92, pero mejora el aspecto del grano, pasando del color blanco cremoso de Blanco Sinaloa-92 al grano blanco lechoso de Suprema-03, adems de una rugosidad ms pronunciada. La produccin de nuevas variedades es un requisito indispensable, por un lado, para mantener la alta competitividad del garbanzo mexicano en el mercado internacional y por otro, localmente aumentar el rendimiento, bajar los riesgos y 11

costos de produccin del cultivo al producir variedades ms rendidoras, de tallo erecto y resistencia a enfermedades, tanto del suelo como foliares. Para lograr lo anterior, se fusionaron los programas de mejoramiento gentico de garbanzo del noroeste (Sinaloa, Sonora y Baja California Sur). De esta manera se trabaja coordinadamente en la planeacin de cruzamientos y seleccin de materiales segregantes en Culiacn y Hermosillo, as como evaluacin en localidades del noroeste para la generacin de nuevas variedades. OBJETIVOS Los objetivos del programa de Mejoramiento Gentico de Garbanzo del INIFAP son formar variedades de grano blanco y grande para exportacin, as como incorporar la caracterstica de tallo erecto. Finalmente, stas deben ser resistentes a dos o ms patgenos causantes de la rabia y enfermedades foliares. MATERIALES Y MTODOS Durante el ciclo O-I 2010-2011 se estableci un ensayo regional de rendimiento con 17 lneas experimentales lite del programa de mejoramiento gentico del INIFAP y tres variedades comerciales. Este ensayo se estableci en el Campo Experimental Valle de Culiacn, bajo un diseo experimental de bloques completos al azar, con tres repeticiones. Durante el desarrollo del cultivo se aplic un riego de auxilio.

Agricultura

Avances de investigacin del CEVACU 2011 Para evaluar el rendimiento se utiliz una parcela experimental de cuatro surcos de 6.0 m de largo por genotipo, para cosechar como parcela til los dos surcos centrales con una longitud de 5.0 m. En el lote de rabia se establecieron las lneas y variedades del ensayo regional de rendimiento para corroborar su nivel de resistencia a rabia, as como otras lneas y variedades de garbanzo tanto de Sonora como de Sinaloa. El nmero de surcos vari de acuerdo con el material a evaluar y no se usaron repeticiones. Finalmente, en cuanto a material segregante, desde ciclos anteriores dentro y fuera del lote de rabia se avanz generacionalmente de F4 a F5 un total de ocho poblaciones (Blanco Sinaloa-92 X Progreso-95; Blanco Sinaloa-92 X Jamu-96; Blanco Sinaloa-92 X CuGa234; Suprema-03 X Progreso-95; Suprema-03 X Jamu-96; Suprema-03 X CuGa-234; Progreso-95 X CuGa-234 y Evora-98 X CuGa-234). En madurez se cosech semilla F5 dentro de cada poblacin. Tambin se avanz generacionalmente (de F2 a F3) un total de 18 poblaciones para resistencia a Botritis sp. y otras enfermedades foliares. Tambin se iniciaron cruzamientos entre progenitores de porte erecto recibidos de los bancos de germoplasma del Centro Internacional de Investigaciones para Zonas ridas (ICARDA). RESULTADOS En el Cuadro 1 se presentan los resultados de la evaluacin del ensayo regional de rendimiento. El anlisis estadstico indic diferencias significativas entre genotipos. De acuerdo con la prueba DMS (0.05), siete genotipos produjeron un rendimiento estadsticamente igual o mayor que los testigos Blanco Sinaloa-92 y Progreso-95. De estos genotipos de alto rendimiento sobresale CUGA08-1090, una lnea procedente del Programa de 12 Mejoramiento Gentico del Campo Experimental Valle de Culiacn, que adems del alto rendimiento, tambin present un calibre mucho mayor que Blanco Sinaloa-92 (42.0 contra 44.0). Sin embargo, en evaluaciones realizadas en otras localidades, esta lnea ha mostrado inestabilidad en el rendimiento y ms donde existieron problemas con bajas temperaturas. Para incorporar la caracterstica de tallo erecto se establecieron fuera del lote de rabia un total de 7 poblaciones en generacin F4 derivadas de la cruza de Blanco Sinaloa-92 y Suprema-03, con las variedades de tallo erecto Jamu-96 y Progreso-95, para incorporar esta caracterstica en una planta tipo Blanco Sinaloa-92 o Suprema-03. Al final se cosech la generacin F5. En cuanto a nuevos cruzamientos, se avanz generacionalmente de F2 a F3 un total de 10 poblaciones originadas del cruzamiento de las variedades Blanco Sinaloa-92 y Suprema-03 con las accesiones ICC-1084, ICC-6671 y ICC8173. Estas accesiones han sido reportadas como resistentes a Botritis sp. y en el caso de ICC-6671 tambin resistentes a Fusarium oxysporum f.sp.ciceris y Moho Blanco. En reportes actuales (Gowda et al., 2011), los progenitores como Blanco Sinaloa-92 Mocorito-88 y Surutato-77 se siguen utilizando como recurso gentico para generar variabilidad sobre todo para obtener estabilidad en rendimiento, tamao y color de semilla, que cruzado con el material antes descrito se busca un mejor material con calidad de exportacin. CONCLUSIONES En el Programa de Mejoramiento Gentico de Garbanzo del Campo Experimental Valle de Culiacn del INIFAP se est dando especial nfasis en la incorporacin a las nuevas variedades de la caracterstica tallo erecto, grano grande de color blanco, as como resistencia a rabia. Actualmente se estn incorporando nuevos

Agricultura

Avances de investigacin del CEVACU 2011 progenitores con esta caracterstica procedentes de los bancos de germoplasma de Siria e India y cuyos resultados se esperan obtener a mediano plazo. A ms corto plazo se cuenta con lneas experimentales que aunque no tienen incorporada la caracterstica de tallo erecto, presentan alto rendimiento y excelente calidad de grano, por ejemplo la denominada HOGA-508, que en un plazo de 3 aos pueden liberarse como una nueva variedad.

Cuadro 1. Evaluacin de lneas lite en el Ensayo Regional de Rendimiento establecido en Culiacn, Sin durante el ciclo O-I 2010-2011.

Genotipo CUGA08-1090 CUGA08-751 CUGA08-743 CUGA08-782 Progreso-95 BS-92 HOGA 2002 40-6 HOGA 2002-6-3 CUGA-05 2479 HOGA 2002-20-10 HOGA-12 HOGA 2001-2-2 CUGA 08 871 MOGA 65 HOGA 067 HOGA 021 HOGA 98-6-1 CUGA 05 1056 CUGA 08 583 PROMEDIO CV(%) DMS (0.05) 2437 12.8 371 29274 2811ab

Rend Kg/ha

DM1 117 115 112 117 115 115 114 118 115 115 115 115 117 117 114 111 111 117

% Expor2 94.0 94.0 91.0 94.0 88.7 93.0 90.0 93.7 92.7 93.0 94.7 93.7 94.3 91.3 92.3 93.0 92.7 95.7

Calibre 3 36.6 42.7 44.7 42.8 47.1 43.8 43.7 40.1 43.3 43.8 43.1 40.0 38.2 42.6 43.2 42.9 43.0 35.9

2791abc 2775abcd 2767abcd 2587abcde 2583abcde 2556abcde 2528 bcde 2500 bcde 2476 bcde 2462 bcdef 2430 2418 2364 2348 2243 2099 cdef def ef ef ef f

115

92.8

42.1

1Das a Madurez Fisiolgica 2 Porcentaje de exportacin 3 Calibre de grano (nmero de semillas en 30 gramos de grano) en promedio de las cuatro localidades 4 Valores con la misma letra son iguales estadsticamente de acuerdo con la prueba de DMS (0.05)

13

Agricultura

Avances de investigacin del CEVACU 2011

LITERATURA CONSULTADA: Gmez-Garza, R.M., Gmez-Gmez, L. y Salinas-Prez, R.A. 2003a. Blanco Sinaloa-92, variedad de garbanzo blanco para exportacin. SAGARPA-INIFAPCIRNO-CEVACU. Folleto Tcnico No. 24, 20 p. Gmez-Garza, R.M., Salinas-Prez, R.A y Gmez-Gmez, L. 2003b. Suprema-03, Variedad de Garbanzo para Exportacin. SAGARPA-INIFAP-CIRNOCEVACU. Folleto Tcnico No. 25, 15 p.

Gowda, L.L.L., Upadhyaya, D., Dronavalli, N., and Singh, S. 2011. Identification of largeseeded high-yielding stable kabuli chick pea germplasm lines for use in crop improvement. Crop Science 51:198-209. Manjarrez-Sandoval P., GmezGarza, R.M., Salinas-Prez, R.A, Gmez-Gmez, L. y ArmentaSoto J.L. 2004. Blanco Sinaloa92: Caso exitoso del mejoramiento gentico de garbanzo en Sinaloa. SAGARPA-INIFAP-CIRNOCEVACU. Folleto Tcnico No. 52, 21 p.

14

Agricultura

Avances de investigacin del CEVACU 2011

Distribucin geogrfica y caracterizacin molecular de Fusarium spp. en el centro-sur de Sinaloa y respuesta de variedades de maz al ataque de este patgeno Primera Etapa
Dr. Rubn Daro Garca Prez1; M.C. Sixto Velarde Flix1; Dr. Jos Antonio Garzn Tiznado2; Ing. Joaqun Ureta Tellez1.
Campo Experimental Valle de Culiacn-CIRNO-INIFAP. Facultad de Ciencias Qumicas de la UAS.

INTRODUCCIN El monocultivo del maz ha originado el incremento en la incidencia de plagas y enfermedades en este cultivo en el estado de Sinaloa. Una de las enfermedades ms importantes es la pudricin de la raz, del tallo y de la mazorca causada por el hongo Fusarium. Este patgeno causa que el tejido del tallo se desgarre y se torne de color caf, originando el acame de la planta. En el estado de Sinaloa se ha reportado que la pudricin del tallo puede originar prdidas del rendimiento entre un 10% y 15% (CEVAF, 2003). Por otro lado, la pudricin de la mazorca causada por especies de Fusarium reduce el rendimiento (Munkvold y Desjardins, 1977) y la calidad del grano (Figura 1); adems, algunas especies de este gnero producen diversos tipos de micotoxinas, como las fumonisinas (Gallardo-Reyes, et al., 2006), que son substancias txicas que pueden causar diversas enfermedades, como: edema pulmonar, pancreatitis y dao heptico, en cerdos, y cncer del hgado y del esfago, en humanos. De acuerdo con resultados de la Junta Local de Sanidad Vegetal del Valle del Fuerte, dentro de las 80 mil hectreas de su influencia, la pudricin de tallos de maz en el ciclo O-I 2006-2007, fue causada principalmente por el hongo Fusarium oxysporum, el cual estuvo distribuido en 70-84% de los lotes de maz analizados (Quintero-Bentez, 2007). Adems de ste, no existen reportes adicionales que 15

describan con certeza la distribucin de este patgeno en otras zonas del estado. Tambin se desconoce la variabilidad gentica de Fusarium, el grado de patogenicidad de las posibles variantes existentes en Sinaloa, y la respuesta de los principales hbridos de maz que se siembran en Sinaloa al ataque de este patgeno. Por estas razones y considerando que el conocimiento de la distribucin espacio-temporal de los patgenos en el campo es un requisito indispensable para manejar una enfermedad de manera efectiva, se inici el presente proyecto, que est planeado para realizarse en tres ciclos otoo-invierno (O-I), siendo el 2010-2011 el primero de ellos.

Figura 1. Sntomas del dao causado por Fusarium spp.en la mazorca de maz.

OBJETIVOS Determinar la distribucin geogrfica e identificar las especies de Fusarium que atacan al maz en el centro-sur de Sinaloa. Determinar la respuesta de los principales hbridos de maz cultivados en Sinaloa, al ser inoculados con aislamientos

Agricultura

Avances de investigacin del CEVACU 2011 de Fusarium invernadero. spp. en condiciones de A partir del micelio de un placa de cada cultivo monosprico de Fusarium spp., se obtuvo el ADN genmico, el cual se obtuvo, usando una solucin amortiguadora de extraccin de ADN que contiene: Tris 200 mM (milimoles), EDTA 50 mM y NaCI 50 mM. Enseguida el ADN fue precipitado con isopropanol absoluto e hidratado con 50 L de agua HPLC estril. Finalmente, las muestras de ADN se almacenaron a -20 C para su posterior uso en la identificacin de especies de Fusarium, mediante las tcnicas de PCR y secuenciacin. Para identificar las especies de Fusarium se usaron los siguientes pares de iniciadores: para F. subglutinans (SUB), D: CTGTCGCTAACCTCTTTATCCA y R: CAGTATGGACGTTGGTATTATATCTAA; para F. proliferatum (PRO), D: CTTTCCGCCAAGTTTCTTC y R: TGTCAGTAACTCGACGTTGTTG; para F. verticilloides (VER), D: CTTCCTGCGATGTTTCTCC y R: AATTGGCCATTGGTATTATATATCTA; y para F. oxysporum (FO), D: ACATACCACTTGTTGCCTCG y R: CGCCAATCAATTTGAGGAACG. Para la reaccin de PCR se utiliz un volumen final de las mezclas de reaccin de 25 mL, con 1x de buffer, 2 mM de cloruro de magnesio, 1 mM de cada primer, 0.2 mM de nucletidos trifosfatados (dNTP's), 1.0 unidades de Taq polimerasa (Invitrogen Cat. 18038-018) y 50 g de ADN genmico. Para la amplificacin del ADN se utiliz el siguiente programa: desnaturalizacin inicial a 95 C, por cinco minutos; 30 ciclos de desnaturalizacin a 94 C, durante un minuto; anillamiento a 56 C (SUB, PRO Y VER) o a 54 C (FO), durante un minuto; extensin a 65 C, por un minuto; y extensin final a 65 C, por 10 minutos. Finalmente, los productos amplificados se incubaron a 4 C para enfriamiento y almacenaje. Despus, fueron separados por electroforesis en un gel de agarosa al 1% y teidos con bromuro de etidio; enseguida, fueron expuestos a un transiluminador de 16

MATERIALES Y MTODOS Muestreos Se colectaron de 5 a 10 plntulas, o mazorcas, con sntomas de Fusarium spp. en 54 lotes ubicados en el centro-sur de Sinaloa. Cada muestra se etiquet, indicando el lugar y la fecha de muestreo. Las muestras fueron llevadas al laboratorio de biotecnologa del Campo Experimental Valle de Culiacn CIRNO-INIFAP, donde fueron almacenadas a una temperatura de 4 C, hasta el momento de aislar las cepas de Fusarium spp. Identificacin de especies de Fusarium Se aisl Fusarium spp. a partir de. tallo y de mazorca: para el aislamiento a partir de tallo, se realizaron cortes transversales en la base de ste para obtener 6 fragmentos, que fueron desinfectados con hipoclorito de sodio al 3 %, durante un minuto; para el aislamiento a partir de mazorca, las semillas de la parte apical de sta fueron desprendidas y, a diferencia de los fragmentos de tallo, no fueron desinfectadas, dado que la mayor parte del hongo en las semillas se encontraba en la superficie de stas. Las muestras se transfirieron en condiciones aspticas (en una campana de flujo laminar) a cajas Petri con medio PDA (papa-dextrosa-agar) slido, adicionado con 1.5 mL/L de PCNB (pentacloronitrobenceno) y 600 mg/L de cloranfenicol. Las cajas con los fragmentos de tallo o con las semillas de maz se incubaron a 25 C, durante 7 das. Los cultivos monospricos se obtuvieron mediante diluciones en agua estril de un fragmento del micelio de Fusarium spp., los cuales posteriormente se pusieron a crecer en medio PDA, a 25 C.

Agricultura

Avances de investigacin del CEVACU 2011 luz ultravioleta y su imagen fue capturada con una cmara digital. Inoculacin de hbridos de maz con Fusarium spp. en condiciones de invernadero Los hbridos utilizados para determinar su respuesta al ataque de Fusarium spp. fueron Bisonte, DK2030, DK2036, NB10, P3030W, P2946W, 30P49, H375, TG8535 y P32T83. La semilla se desinfect con alcohol al 70 %, durante un minuto y con hipoclorito de sodio al 1.5 %, durante 20 minutos; posteriormente la semilla se enjuag cinco veces con agua destilada estril. Las semillas fueron sembradas en el invernadero del Campo Experimental Valle de Culiacn CIRNO-INIFAP, a una profundidad de 4 cm, en turba canadiense hmeda y estril contenida en cajones de plstico estriles (de 20 cm de alto, 40 cm de ancho y 80 cm de largo. De cada hbrido se hicieron crecer ocho plantas, en un cajn debidamente etiquetado con el nombre del material. Las plantas fueron regadas peridicamente con agua corriente estril. A 82 das despus de la siembra, cada planta fue inyectada en el segundo entrenudo con una suspensin de 1 mL de conidias patognicas de F. verticillioides, crecidas en medio Kerr, y diluidas con agua destilada estril a una concentracin de cien mil conidias por mililitro (el conteo de las mismas se realiz utilizando un microscopio y una cmara de Neubauer). La evaluacin de la respuesta de los hbridos de maz se realiz dos meses despus de la inoculacin, seccionando longitudinalmente los tallos y midiendo la longitud del rea necrosada en cada uno. RESULTADOS Muestreos En 22 de los 54 lotes muestreados en el centro-sur de Sinaloa fue posible aislar Fusarium spp. a partir de plntulas o mazorcas infectadas (Cuadro 1). En un inicio se plane realizar los muestreos en tres etapas fenolgicas (plntula, floracin y madurez); sin embargo, la onda glida ocurrida en Sinaloa del 3 al 5 de febrero de 2011 afect dicho seguimiento.
Cuadro 1. Lotes de maz muestreados en el centrosur de Sinaloa, en los cuales se detect la presencia de Fusarium spp., en el ciclo O-l 2010-2011.

Ubicacin Pueblo Nuevo, Elota Pueblo Nuevo, Costa Rica Costa Rica (salida) Agua Amarga, La Cruz Potrerillos El Diez CEVACU*

Lote 5,6,9 y 10 2,3,4,5,6,7 y 8 9 y 10 l,23y4 8y 7 Pioneer 1 Y 2 CEVACU

Muestra Plntula Plntula Plntula Plntula Plntula Mazorca Mazorca

Identificacin de especies de Fusarium Del total de lotes muestreados, se obtuvieron 165 cepas monospricas de tallos de plntulas; de estas cepas, 140 fueron identificadas mediante PCR como Fusarium oxysporum (Figura 2), lo cual coincide con lo encontrado por la Junta Local de Sanidad Vegetal del Valle del Fuerte en su rea de influencia, en el ciclo O-l, 2006-2007; adems, en el presente trabajo se obtuvieron 92 cepas monospricas de mazorca, de las cuales 75 fueron identificadas por PCR como Fusarium verticillioides (Figura 3), lo cual indica que al menos dos especies de Fusarium estn asociadas a maz en el centro-sur de Sinaloa.

17

Agricultura

Avances de investigacin del CEVACU 2011 una cepa de Fusarium ms patognica, para determinar con ms precisin cuales son los hbridos ms resistentes a dicha cepa.

Cepas monospricas de tallo obtenidas: 165

Desconocido 15%

60 40 20 0
Hbridos de maz

Longitud de la lesin cm

F. oxysporum 85% Figura 2. Porcentaje de cepas monospricas de Fusarium, provenientes de muestras de tallo de maz colectadas en el centro-sur de Sinaloa, que dieron positivas para la especie F. oxysporum., en el ciclo O-l 2010-2011.

Cepas monospricas de mazorca obtenidas: 92

Figura 4. Longitud de la lesin en el tallo de diez hbridos de maz, inoculados con una cepa monosprica de Fusarium verticillioides, en condiciones de invernadero. Ciclo O-l 2010-2011.

Desconocido 18%

CONCLUSIONES Las especies de Fusarium que se aislaron con mayor frecuencia a partir de muestras de tallo y de mazorca de maz colectadas en el centro-sur de Sinaloa fueron F. oxysporum y F. verticillioides, respectivamente. Los hbridos de maz que que en esta evaluacin preliminar mostraron un menor dao por una cepa de F. verticillioides en condiciones de invernadero fueron H-375 y Bisonte, mientras que el ms afectado fue P32T83.

F. Verticillioides 82%

Figura 3. Porcentaje de cepas monospricas de Fusarium, provenientes de muestras de mazorca de maz colectadas en el centro-sur de Sinaloa, que dieron positivas para la especie F. verticillioides, en el ciclo O-l 2010-2011.

Respuesta de hbridos de maz inoculados con una cepa de Fusarium verticillioides, en condiciones de invernadero Los materiales que en condiciones de invernadero mostraron un menor dao al ataque de una cepa monosprica de Fusarium verticillioides fueron los hbridos de grano blanco H375 y Bisonte, con una longitud de tallo daada de 6.4 cm y 6.8 cm respectivamente, mientras que el ms afectado fue el hbrido de maz amarillo P32T83, con 60.3 cm de tallo afectado (Figura 4). Los resultados obtenidos con estos hbridos son preliminares, por lo cual es necesario evaluarlos nuevamente, con 18

LITERATURA CITADA CEVAF. 2003. Gua para la asistencia tcnica agrcola para el rea de influencia del Campo Experimental Valle del Fuerte. Agenda Tcnica, 6. Edicin. Mxico. pp 110-111. Gallardo-Reyes, E.D, Ibarra-Moreno, G.N., Snchez-Martnez, R.I., CuameaCruz, G., Molina-Gil, D., ParraVergara N.V., Rosas-Burgos E.C. y

Agricultura

Avances de investigacin del CEVACU 2011 Cortez-Roxha, M.O. 2006. Micobiota de maz (Zea mays L.) recin cosechado y produccin de fumonisina B1 por cepas de Fusarium verticillioides (Sacc.) Nirenb. Revista Mexicana de Fitopatologa. 24(1):27-34 Munkvold G.P. y Desjardins, A.E. 1997. Fumonisins in Maize. Can we reduce their occurrence? Plant Dis. 81(6): 556-565. Quintero-Bentez J.A. 2007. Deteccin de daos por Fusarium en maz. Trptico. SAGARPA. Junta Local de Sanidad Vegetal del Valle del Fuerte.

19

Agricultura

Avances de investigacin del CEVACU 2011

Formacin de variedades e hbridos de sorgo para temporal y riego en el estado de Sinaloa


Ing. Toms Moreno Gallegos1; M.C. Luis Alberto Hernndez Espinal1; Ing. Alfredo Loaiza Meza1; Ing. Juan Esteban Reyes Jimnez1. INTRODUCCIN En el estado de Sinaloa, el cultivo de sorgo (Sorghum bicolor L. Moench), se sigue manteniendo en un importante segundo lugar en cuanto a superficie sembrada. De acuerdo a informacin de estadstica agrcola correspondiente al ao agrcola 2009 (SIAP, 2011), la superficie total estatal fue 1172,555 ha dentro de las cuales la mayor parte correspondi al cultivo de maz con 566,503 ha equivalentes a 48 %, siguindole el cultivo de sorgo con 308,057 ha equivalente a un 25 %; por lo que, entre ambos cultivos se cubri un 73 % del total sembrado en dicho ao. La mayor parte de la superficie sembrada con sorgo en Sinaloa (94 %), corresponde al ciclo primavera-verano y dentro de ste, una mayor superficie (75 %) se cultiva bajo condiciones de temporal. El volumen de produccin fue de 516,271 toneladas de grano y su valor super a mil millones de pesos. La problemtica que reviste el cultivo de sorgo en Sinaloa, se refiere en primer trmino, a que se trata del cultivo con mayor importancia para la produccin de forraje. As tambin, dentro del sistema de produccin agrosilvopastoril o agropecuario predominante en reas de temporal, el sorgo representa en el subsistema agrcola, la principal fuente de forraje para el subsistema pecuario; los productos finales del sistema son carne y leche. En reas de temporal, predomina an el uso de semilla de hbridos comerciales para grano que producen con poca biomasa y son susceptibles a enfermedades foliares; as tambin, en buena medida se utiliza semilla de hbridos forrajeros comerciales o sus generaciones avanzadas, por lo general, 20 susceptibles a enfermedades foliares y al acame. Adems, el costo de semilla limita el uso de estos materiales. En riego hacen falta hbridos competitivos de alto rendimiento de grano, de ciclo intermedio a precoz, con sanidad de planta y aceptable calidad de grano. OBJETIVO Formacin de variedades mejoradas de polinizacin libre de sorgo, con alto grado de adaptacin y adecuacin a condiciones de temporal, apropiadas para la produccin y calidad de grano, forraje o doble propsito; as tambin, formacin de hbridos de alto rendimiento para reas de riego, con alta calidad del grano para la industria pecuaria y tolerancia a enfermedades diversas. MATERIALES Y MTODOS En el presente proyecto, durante el ao agrcola 2011, que comprende los ciclos O-I 2010-2011 y P-V 2010-2010, en terrenos del Campo Experimental Valle de Culiacn (CEVACU) se establecieron 11 acciones de investigacin, validacin y transferencia de tecnologa, las cuales se desarrollaron en las zonas centro y sur de Sinaloa. Durante el ciclo otoo-invierno 201011, se cumpli con las metas propuestas, mediante la ejecucin de siete actividades siendo las siguientes: 1) Lote de hibridacin con lneas A, B y R con un total de 93 lneas A, B y R; 2) Lote de seleccin genealgica, con un total de 250 lneas segregantes; 3) Incremento de semillas de lneas e hbridos experimentales avanzados, incluyendo las 93 lneas progenitoras (A, B Y R); 4) Incremento de semilla de 10 variedades experimentales y comerciales (Mazatlan-16,

Agricultura

Avances de investigacin del CEVACU 2011 Dulce, Amarillo Precoz, Variedad-2, Fortuna, RB-Paloma, Perla-101, Costeo201, Sinaloense-202 y Gavatero-203, respectivamente); 5) Lote demostrativo de variedades sobresalientes, con un total de 10 materiales (variedades de polinizacin abierta del CEVACU); 6) Lote de parcelas preliminares de rendimiento integradas por 30 hbridos experimentales formados por el CEVACU y 11 testigos comercial, bajo condiciones de riego en campo; 7) Vivero de observacin compuesto por 41 hbridos experimentales del CEVACU. Las acciones establecidas durante primavera verano 2010-2010 bajo condiciones de temporal en campo, fueron las siguientes: 1) Lote de seleccin genealgica con 200 lneas segregantes; 2) Lote de parcelas preliminares de rendimiento integradas con 32 hbridos experimentales del CEVACU para temporal y tres testigos comerciales; 3) Vivero de observacin compuesto por 24 hbridos experimentales para temporal del CEVACU; 4) Lote demostrativo y multiplicacin de cuatro variedades experimentales y seis comerciales Mazatlan-16, Dulce, Amarillo Precoz, Variedad-2, Fortuna, RB-Paloma, Perla-101, Costeo-201, Sinaloense-202 y Gavatero-203, respectivamente. de planta, por lo que se consideran como nuevas variedades experimentales que pasarn a la fase siguiente del proceso de mejoramiento, la fase de evaluacin en ensayos de rendimiento. Por otra parte, con la aplicacin de la metodologa de hibridacin, para la obtencin de hbridos experimentales para riego y temporal con caractersticas agronmicas superiores, se manejaron 93 lneas A, B y R, en el ciclo otoo-invierno 2010-2011. De acuerdo al resultado obtenido al trmino del perodo 2010-2011, se obtuvieron ms de 100 nuevos hbridos experimentales, los cuales pasarn a la siguiente fase del proceso que es el establecimiento de un vivero de observacin y ensayo de rendimiento. Con base a las evaluaciones tanto de variedades como hbridos bajo condiciones de riego, se obtuvieron resultados que indican que las mejores variedades comerciales en cuanto a produccin de forraje y grano, fueron RBPaloma y Sinaloense-202, con rendimientos de forraje verde de 50.31 y de grano 5.38 ton/ha para el primer material y de 64.68 y 4.29 ton/ha, para el segundo. En cuanto a hbridos evaluados en riego el mejor comportamiento correspondi a los hbridos 7AX35R y 7AX47R con rendimientos de grano de 7.73 y 7.10 ton/ha, respectivamente, compitiendo contra los hbridos comerciales (ver Cuadro 1). En cuanto a la evaluacin de lneas experimentales de polinizacin abierta seleccionadas para condiciones de riego, el mejor comportamiento en rendimiento correspondi a las variedades experimentales Mazatlan-16 y Variedad-2, con rendimientos de forraje verde de 54.68 y de grano 5.73 ton/ha para el primer material y de 56.56 y 5.35 ton/ha, para el segundo. Los avances obtenidos del proyecto, han permitido el logro de productos como es la propuesta de liberacin comercial de una nueva variedad experimental para reas de temporal del estado de Sinaloa, las cual es la variedad con denominacin de Amarillo Precoz, correspondiente a la lnea experi21

RESULTADOS
De acuerdo al objetivo y metas del proyecto; as como al esquema de mejoramiento aplicado hasta 2011, se han obtenido avances importantes en la formacin y evaluacin de variedades e hbridos experimentales de sorgo. El proceso de seleccin genealgica ha permitido que al final del perodo 20102011, se lograra la obtencin de un grupo numeroso de nuevas progenies con las que se estar en condiciones de iniciar el siguiente ciclo de seleccin genealgica. Adems dentro del grupo de progenies, se identificaron dos de stas con caractersticas de uniformidad en altura de planta y precocidad, as como, con buena sanidad

Agricultura

Avances de investigacin del CEVACU 2011 mental AP, cuyos trmites de registro estn en proceso ante SNICS. Durante la evaluacin por varios aos, en ensayos de rendimiento y parcelas demostrativas en diferentes localidades de los municipios del estado de Sinaloa, ha destacado por las principales caractersticas de planta, siendo de ciclo vegetativo precoz de 90 a 95 das a la cosecha, altura de planta de 196 cm, tamao de panoja de 27.5 cm, tipo de panoja abierta y grano de color amarillo, tolerante a las principales enfermedades y sequia, con rendimientos promedio de 44 ton/ha de forraje verde y 5.34 ton/ha de grano bajo condiciones de riego. En temporal los rendimientos promedio de 28 ton/ha de forraje verde y 3.0 ton/ha de grano. condiciones de iniciar el siguiente ciclo de seleccin genealgica. As tambin, durante el ciclo productivo 2010-2011, se estableci un vivero de observacin, el cual es la primera etapa para identificar aquellos nuevos hbridos seleccionados en el CEVACU y con posibilidades de constituir futuros cultivares para ser evaluados en parcelas preliminares de rendimiento y determinar si son viables de integrar en ensayos de rendimiento para determinar con mayor precisin su potencial como futuras variedades. Este vivero estuvo constituido por 41 hbridos experimentales con caractersticas de doble propsito (forraje y grano). Fueron identificados cinco hbridos (2x29; 7x37; 11x50; 22x19 y 22x51) por su excelente fenotipo y sanidad, as como por su alto potencial de produccin de grano. En este caso se cort un mnimo de 10 panojas por cada hibrido seleccionado que sern sembradas individualmente en el prximo ciclo primavera verano 2011-11, bajo condiciones de temporal, con la finalidad de seleccionar y obtener nuevas lneas con alto potencial productivo. Los resultados se presentan en el Cuadro 2. As mismo, durante el ciclo O-I 2010 2011, se estableci un lote de incremento de semilla original de las principales variedades sobresalientes con que cuenta el programa de mejoramiento de sorgo del CEVACU. Se establecieron seis variedades comerciales y cuatro variedades experimentales sobresalientes, siendo: Fortuna, Costeo-201, Perla-101, Mazatlan16, Gavatero-203, Sinaloense-202, Dulce, RB-Paloma, Variedad-2 y Amarillo Precoz (Figura 2). En todas estas, mediante autofecundaciones de plantas seleccionadas se realiz el incremento de semilla, cuyas cantidades cosechadas variaron entre 10 y 15 kg de cada variedad. Con lo que respecta, al ciclo de primavera verano 2010-10, bajo condiciones de temporal en campo, se estableci un lote con 200 lneas segregantes, para dar conti-

Figura 1. Hbridos de sorgo del CEVACU-INIFAP, establecidos durante el ciclo otoo-invierno 20102011, bajo condiciones de riego.

En otra accin ms del ciclo O-I 2010-11, se estableci y condujo un lote de seleccin genealgica para dar continuidad al proceso de mejoramiento de variedades y obtencin de variedades experimentales que luego pasarn al proceso de evaluacin. En total se manejaron 250 progenies, dentro de las cuales se seleccionaron plantas y/o panojas con base a criterios de seleccin como tipo de planta, sanidad, tipo de panoja y precocidad. Este proceso permiti que al final del perodo, se lograra la obtencin de 300 nuevas progenies con las que se estar en 22

Agricultura

Avances de investigacin del CEVACU 2011


Cuadro 1. Rendimiento de grano y forraje y sus principales caractersticas agronmicas del ensayo de rendimiento de hbridos de sorgo del CEVACU, durante otoo-invierno 2010-2011, bajo condiciones de riego. INIFAP- CIRNO- CEVACU. 2011. Hbrido Das a Altura Longitud ExcerColor de Tipo Rend. Rend. floracin de de sin grano de forraje grano planta panoja (cm) panoja verde (t/ha) (m) (cm) (t/ha) 3x41 96 1.68 33 30 ROJO SC 40.312 5.542 3x58 91 1.55 30 10 CREMA SC 55.156 5.400 5x15 103 1.35 30 1 ROJO SC 49.531 6.320 6x18 90 1.38 27 10 ROJO SC 50.468 3.556 7x7 91 1.53 31 20 ROJO SC 55.521 6.681 7x28 91 1.52 31 21 CREMA SC 55.937 4.469 7x30 104 1.50 28 13 CREMA C 73.229 5.222 7x33 107 1.59 33 5 CREMA C 65.156 4.600 7x34 96 1.70 30 25 ROJO SC 43.437 4.227 7x35 106 1.60 34 9 CREMA C 67.187 7.736 7x47 101 2.09 30 13 ROJO C 73.593 7.104 7x51 92 1.55 35 10 ROJO SC 61.562 3.960 7x50 92 1.48 30 20 ROJO SC 49.218 5.166 11x31 98 1.65 30 16 CREMA C 64.218 5.759 12x39 91 1.77 20 25 ROJO C 41.250 3.909 11x44 88 1.70 20 30 ROJO C 66.874 5.923 11x37 87 1.50 20 25 ROJO SC 34.218 5.753 11x35 98 1.60 30 20 CREMA C 77.187 3.968 12x34 94 1.70 30 30 ROJO SC 55.917 3.704 12x44 90 1.60 30 23 ROJO SA 37.812 4.434 14x41 98 1.58 35 20 ROJO SC 67.031 6.731 14x26 92 1.40 34 24 ROJO SC 42.500 3.650 15x58 91 1.62 25 36 ROJO SA 32.656 4.677 16x58 91 1.45 28 26 CREMA C 50.937 4.998 17x24 88 1.39 24 12 ROJO C 39.218 5.363 16x40 98 1.45 28 25 ROJO C 44.531 4.139 16x41 98 1.46 26 25 ROJO C 34.062 5.427 16x50 98 126 26 18 ROJO C 32.187 4.984 24x24 92 1.50 25 25 ROJO C 30.468 6.748 24x7 96 1.45 30 18 ROJO C 54.687 5.534 G STAR 7205* 98 1.40 22 15 ROJO C 46.562 5.938 G STAR 7601* 101 1.25 26 16 ROJO SC 57.031 4.069 G STAR 7402* 106 1.44 28 13 ROJO C 47.812 6.179 G STAR 7304* 91 1.40 24 27 ROJO SA 30.781 6.813 KILATE* 98 1.53 24 13 ROJO SC 53.906 4.427 AVANTE CIPRES* 98 1.26 27 14 ROJO SC 51.093 5.088 AVANTE PINO* 98 1.32 24 12 ROJO C 49.531 6.272 SYNGENTA 5515* 98 1.12 30 9 ROJO SA 47.499 5.527 AVANTE 96 1.37 25 24 ROJO SC 21.093 5.447 MEZQUITE* AVANTE NOGAL* 110 1.35 23 25 ROJO C 59.218 5.582 SYNGENTA 5265* 102 1.37 23 14 ROJO C 45.624 5.760 * Testigo comercial

23

Agricultura

Avances de investigacin del CEVACU 2011

Cuadro 2. Rendimiento de grano y sus principales caractersticas agronmicas de los materiales sobresalientes de hbridos de sorgo del vivero de observacin, durante el ciclo otoo-invierno 2010-2011, bajo condiciones de riego. INIFAP- CIRNO- CEVACU. 2011. Hbrido Das a floracin 93 101 93 87 104 111 104 102 104 104 111 90 97 104 91 87 92 87 90 96 93 93 93 87 96 93 87 93 87 90 109 93 93 93 89 92 98 86 89 89 97 Altura de planta (m) 1.45 2.35 1.75 1.55 1.45 1.45 1.48 1.40 1.45 1.45 1.73 1.38 1.60 1.42 2.00 1.70 1.56 1.60 1.75 1.80 1.52 1.85 1.70 1.90 1.67 1.92 1.70 1.54 1.60 1.58 1.78 1.58 1.44 1.51 1.38 1.57 1.15 1.82 1.55 1.55 1.60 Longitud de panoja (cm) 30 35 29 29 30 29 32 30 28 31 40 30 27 31 28 34 30 31 24 26 32 37 29 22 27 35 25 33 36 27 25 37 28 25 30 30 28 30 33 34 30 Excersin (cm) 16 15 23 24 16 21 8 15 5 6 2 26 23 5 25 36 17 26 30 23 23 27 30 48 27 19 27 19 28 28 5 27 19 23 14 23 9 26 24 16 12 Color de grano ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO CREMA ROJO ROJO CREMA ROJO ROJO CREMA ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO ROJO CREMA ROJO ROJO ROJO CR ROJO ROJO ROJO ROJO ROJO ROJO Tipo de planta CANELA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA CANELA ROJA ROJA CANELA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA CANELA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA Tipo de panoja SC SC SC SC C C C C C C SC SC SC SC C SC C C C C C SC SC SC SC SC SC SC SC SC C SC C SC SC SC SC SA SA SC C Rend. grano (t/ha) 2.61 0.0 5.79 5.45 5.51 4.57 8.31 4.05 5.82 4.58 0.0 2.33 6.78 4.31 0.0 3.22 6.83 5.55 5.37 3.76 3.01 6.48 5.30 0.0 3.55 0.0 0.0 4.11 6.13 5.63 0.0 5.94 2.99 4.69 6.67 4.15 0.0 0.0 6.95 5.46 6.11

1X50 1X47 1X34 1X37 2X35 2X36 2X29 2X53 3X52 3X53 5X14 6X17 7X37 8X58 10X7 11X38 11X50 12X28 12X38 12X41 14X28 14X44 14X3 15X43 15X41 15X44 15X39 16X51 16X43 16X45 17X27 19X28 19X10 21X60 22X19 22X39 22X42 22X44 22X51 22X58 24X41

24

Agricultura

Avances de investigacin del CEVACU 2011 nuidad al trabajo de seleccin genealgica. El trabajo realizado permiti la obtencin de 250 selecciones individuales por panoja de las plantas con alto potencial de formar variedades experimentales de sorgo de polinizacin abierta, con caractersticas fenotpicas y agronmicas de inters. presentan en el Cuadro 4. Finalmente, durante el ciclo O-I 2010-2011 y PV 2010-2010, en el Campo Experimental Valle de Culiacn fueron establecidos lotes demostrativos con materiales mejorados de sorgo y de incremento de semilla original con seis variedades comerciales de INIFAP y cuatro variedades experimentales sobresalientes formadas por el CEVACU, con el objeto de contar con semilla con viabilidad adecuada para las necesidades de multiplicacin de semilla bsica, evaluacin y demostracin de variedades de polinizacin abierta. Se realizaron eventos demostrativos en dos fechas: durante el mes de noviembre de 2010 bajo condiciones de temporal y en junio de 2011 bajo condiciones de riego, dndose a conocer las bondades de los materiales a un buen nmero de productores, tcnicos, estudiantes y autoridades. En el Cuadro 5 se presentan los rendimientos y sus principales caractersticas, bajo condiciones de temporal. CONCLUSIONES Con base en los avances y logros del presente proyecto durante el ejercicio 2010 2011 (O-I 2010-2011 y P-V 20102010), se tuvo continuidad en el proceso de mejoramiento y se lograron las metas programadas para dicho ao de trabajo. Se identificaron materiales sobresalientes: hbridos para condiciones de riego y variedades de polinizacin libre para condiciones de temporal y riego. Los avances obtenidos del proyecto, han permitido el logro de productos como la propuesta de liberacin comercial de una nueva variedad para reas de temporal del estado de Sinaloa, con denominacin de Amarillo Precoz, correspondiente a la variedad experimental AP, cuyos trmites de registro se encuentran actualmente en curso con las instancias oficiales correspondientes. 25

Figura 2. Variedad de polinizacin libre Sinaloense202, del CEVACU de INIFAP, durante otoo-invierno 2010-2011, bajo condiciones de riego.

As mismo durante el ciclo primavera verano 2010-10, se evalu en un lote de parcelas preliminares de rendimiento integradas por 32 hbridos experimentales formados en el CEVACU para temporal, utilizando como progenitores lneas androestriles como hembras y variedades comerciales y experimentales de polinizacin libre como machos y tres hbridos comerciales, en el anlisis estadstico result diferencias altamente significativas, sobresaliendo de la evaluacin dos hbridos experimentales 12AXFortuna y 14AXDulce con rendimientos promedio de 54.68 y 44.68 ton/ha de forraje verde, como se observa en el Cuadro 3. As tambin, durante primavera verano 2010-2010, se estableci un vivero de observacin, constituido por 24 hbridos experimentales con caractersticas de doble propsito. Destacando los hbridos experimentales 15AXIndu y 7AXIndu, con rendimientos promedio de 43.75 y 42.81 ton/ha, respectivamente. Los resultados se

Agricultura

Avances de investigacin del CEVACU 2011


Cuadro 3. Rendimiento de forraje y sus principales caractersticas agronmicas del ensayo de rendimiento de hbridos experimentales de sorgo del CEVACU, durante primavera verano 2010-2010, bajo condiciones de temporal. INIFAP- CIRNO- CEVACU. 2011. Hbrido Das a floracin Altura de planta (m) 2.40 2.30 2.42 2.50 2.58 2.40 2.15 2.22 2.80 2.85 2.85 3.13 3 2.20 2.40 2.45 2.40 2.40 2.44 2.67 2.18 2.28 2.40 3.16 2.90 2.80 2.40 2.55 2.23 2.75 2.65 2.52 1.50 1.75 1.75 Longitud de panoja (cm) 32 31 28 32 30 30 28 30 21 23 25 27 25 21 31 31 30 31 31 29 29 27 33 22 25 27 28 30 24 23 22 22 27 23 29 Excersin (cm) 10 12 17 18 19 18 10 17 13 12 15 10 12 23 17 11 13 15 7 22 9 25 18 21 5 6 16 26 26 7 11 8 16 23 10 Color de grano ROJO ROJO ROJO ROJO ROJO CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA ROJO CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA ROJO ROJO ROJO Tipo de planta Tipo de panoja Rend. forraje verde -1 (t ha ) 42.81 25.00 30.93 30.62 22.50 34.37 25.62 38.43 24.37 23.75 27.18 36.56 25.00 20.31 33.43 26.87 28.12 54.68 35.62 22.81 27.18 24.37 35.31 44.68 40.62 26.56 26.56 17.81 22.50 25.00 28.43 36.25 19.06 16.56 23.75

4AXG-203 6AXG-203 7AXG-203 14AXG-203 16AXG-203 4AXC-201 7AXC-201 16AXC-201 3AXSUREO 4AXSUREO 12XSUREO 14XSUREO 16XSUREO 24XSUREO 7AXL-9 16AXL-9 11AXF 12AXF 16AXF 22AXF 7AXP-101 12AXP-101 16AXP-101 14AXDULCE 3AXTHEIS 7AXTHEIS 14AXS-202 16AXS-202 3AXAP 3AXTOPPER 4AXTOPPER 7AXTOPPER 86P42* 85P47* P-8641* *Testigo comercial

65 62 65 65 65 64 64 63 71 68 67 64 72 69 61 64 68 75 76 62 61 60 64 62 69 73 64 64 57 72 76 76 61 62 64

ROJA ROJA CANELA ROJA ROJA ROJA ROJA ROJA ROJA ROJA CANELA ROJA ROJA ROJA CANELA ROJA CANELA CANELA ROJA ROJA CANELA CANELA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA

SEMICOMPACTA SEMIABIERTA SEMIABIERTA SEMICOMPACTA SEMICOMPACTA COMPACTA COMPACTA COMPACTA COMPACTA SEMICOMPACTA COMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA COMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA COMPACTA SEMICOMPACTA SEMIABIERTA SEMIABIERTA SEMIABIERTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA

26

Agricultura

Avances de investigacin del CEVACU 2011


Cuadro 4. Rendimiento de biomasa y sus caractersticas agronmicas ms importantes de materiales sobresalientes de hbridos de sorgo del vivero de observacin, durante el ciclo primavera verano: 2010-10, bajo condiciones de temporal. INIFAP-CIRNO-CEVACU. 2011. Hbrido Das a floracin Altura de planta (m) 2.12 2.40 2.20 2.33 2.80 2.50 2.90 2.70 3.08 2.73 2.75 2.60 2.52 2.47 2.37 2.75 2.20 2.40 2.40 2.25 2.90 3.07 2.20 3.0 Long. de panoja (cm) 27 31 28 31 29 26 30 23 30 21 21 30 32 31 27 23 26 31 30 30 25 26 25 24 Excersin (cm) 25 29 16 19 19 20 19 7 20 30 16 19 27 15 25 16 27 24 14 7 21 24 18 18 Color de grano ROJO ROJO ROJO ROJO CREMA ROJO CREMA CREMA CREMA CREMA ROJO ROJO ROJO CREMA CREMA ROJO CREMA CREMA CREMA CREMA CREMA CREMA CREMA CREMA Tipo de planta Tipo de panoja Rend. forraje verde -1 (t ha ) 31.56 28.12 21.87 29.06 31.25 21.25 26.87 26.56 38.12 19.31 43.75 31.25 32.18 26.56 23.43 37.18 29.06 24.37 32.18 40.0 30.0 40.0 11.56 42.81

2AXG-203 22AXG-203 19AXC-201 15AXL-9 3AXDULCE 6AXDULCE 16AXDULCE 4AXTHEIS 3AXINDU 12AXINDU 15AXINDU 3AXG-203 15AXG-203 3AXC-201 12AXC-201 15XSUREO 11AXL-9 14AXL-9 4AXF 17AXF 4AXDULCE 16AXDULCE 10AXM-16 7AXINDU

72 62 76 64 68 62 68 75 68 68 60 69 62 68 67 68 64 62 71 68 63 62 68 62

ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA ROJA CANELA ROJA CANELA ROJA ROJA ROJA ROJA ROJA CANELA ROJA

SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMIABIERTA SEMIABIERTA SEMIABIERTA SEMIABIERTA SEMICOMPACTA SEMIABIERTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA COMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMICOMPACTA SEMIABIERTA SEMICOMPACTA COMPACTA SEMIABIERTA

Cuadro 5. Rendimiento de grano y forraje y sus principales caractersticas agronmicas por variedad comercial o experimental de sorgo en el CEVACU, durante primavera verano 2010-2010, bajo condiciones de temporal. INIFAPCIRNO- CEVACU. 2011. Variedades Das a Altura Long. ExcerColor Tipo Tipo* Rend. Rend. floracin de de sin de de de forraje grano -1 planta panoja (cm) grano planta panoja verde (t ha ) -1 (m) (cm) (t ha ) Fortuna 86 2.40 29 5 mbar Canela SC 47.50 1.97 Variedad-2 73 2.05 27 17 mbar Canela SC 51.56 2.75 Dulce RB-Paloma Mazatlan-16 Amarillo precoz Gavatero-203 Sinaloense-202 Costeo-201 Perla-101 67 72 62 58 62 75 70 62 2.85 1.96 2.03 2.05 2.37 2.55 2.03 1.81 27 33 24 32 25 26 27 23 24 9 20 16 21 19 9 5 mbar mbar mbar mbar Rojo mbar mbar mbar Canela Canela Canela Canela Canela Canela Canela Canela A SC C A SA SA SC SC 40.31 40.22 35.00 33.25 39.35 40.00 36.87 34.68 2.06 1.94 3.32 2.53 2.77 2.88 3.61 2.62

*SC: semicompacta; A: abierta.

27

Agricultura

Avances de investigacin del CEVACU 2011 Con el establecimiento de un lote de lneas progenitoras A, B y R, durante el ciclo O-I 2010-2011, para la formacin de hbridos sobresalientes y de nueva formacin, as como incremento de semilla de lneas sobresalientes, se asegura la continuidad del esquema de mejoramiento planeado en cuanto a la obtencin de hbridos de alto rendimiento para riego y temporal. Se establecieron dos lotes de incremento de semilla original de diversas variedades comerciales y experimentales sobresalientes, uno durante el ciclo O-I y otro durante el ciclo P-V. En total se manejaron seis variedades comerciales de INIFAP y cuatro variedades experimentales formadas por el CEVACU, de las cuales se cuentan con 90 kg de semilla original. Se realiz seleccin genealgica en dos ciclos agrcolas O-I 2010-2011 y P-V 2010-2010, para dar continuidad al proceso de mejoramiento de variedades y obtencin de variedades experimentales que luego pasarn al proceso de evaluacin. En total se manejaron 450 progenies, dentro de las cuales se seleccionaron plantas y/o panojas con base a criterios de seleccin como tipo de planta, sanidad, precocidad, tipo de panoja y precocidad. Este proceso permiti que al final del ciclo otoo invierno 20102011, se lograra la obtencin de 300 nuevas progenies con las que se estar en condiciones de iniciar el siguiente ciclo primavera verano 2011-2011, la seleccin genealgica. LITERATURA CONSULTADA Compton L. Paul. 1990. Agronoma del sorgo. ICRISAT.-Centro de Tecnologa Agrcola. El Salvador, C.A. 225 p. Compton L. P. and De Walt B. R. 1985. Sistemas de produccin de sorgo en Amrica Latina. INTSORMIL. ICRISAT. CIMMYT. Mxico. 344 p. Leland R. House. 1982. El Sorgo. Gua para su Mejoramiento Gentico. 425 p Palacios V., O. 1998. Variedades de sorgo para sistemas agrosilvopastoriles en el sur de Sinaloa. In: Memorias del XVIII Congreso de la SOMEFI. Acapulco, Gro. Octubre de 1998. p. 317. Palacios, V.O. Avances en la formacin de variedades de sorgo para reas de temporal del estado de Sinaloa. Memorias de XLI Reunin Nacional de Investigacin Pecuaria. Cuernavaca, Mor. 14-18 de noviembre de 2005. p. 163. Servicio de Informacin y Estadstica Agroalimentaria y Pesquera (SIAP). 2011. Anuario Estadstico de la Produccin Agrcola 2009 en Mxico. El cultivo de sorgo. Secretara de Agricultura, Ganadera, Desarrollo Rural, Pesca y Alimentacin (SAGARPA). URL: http://www.siap.gob.mx.

28

Agricultura

Avances de investigacin del CEVACU 2011

Capacitacin a productores y tcnicos en prcticas de manejo sanitario y ordeo que contribuyan a mejorar la calidad de la leche en ganado bovino
Juan Esteban Reyes Jimnez, Luis Alberto Hernndez Espinal, Mara Guadalupe Garca Camarena, Alfredo Loaiza Meza y Toms Moreno Gallegos INTRODUCCIN El estado de Sinaloa se caracteriza por tener un gran desarrollo agrcola, en cambio, respecto a la actividad pecuaria muestra desequilibrio y atraso en bovinos de carne y ms notoriamente en bovinos de leche. En el sur de Sinaloa, los sistemas de produccin de ganado bovino son: 1) El sistema vaca-cra que es el ms prevaleciente y extensivo y 2) el sistema becerro-leche conocido tambin como produccin semi-intensiva de leche, el cual juega un papel muy importante al aportar una produccin de leche de alrededor de 100 mil litros/da, que producen ms de 500 ganaderos con hatos de 50 a 100 animales con diferente grado de encastamiento de la raza Holstein. Uno de los problemas sanitarios ms importantes lo constituye la mastitis, la cual causa una inflamacin de la ubre que afecta a una alta proporcin de vacas lecheras provocando una significativa disminucin en la produccin de leche alterando tambin su composicin. Las prdidas por mastitis son: no solo por la presencia de la enfermedad y el costo del tratamiento, sino tambin por la leche desechada, y por los reemplazos prematuros. La mastitis durante la lactacin temprana sea clnica o sub-clnica, produce efectos perjudiciales en la reproduccin del animal ya que puede alterar los perfiles endcrinos y el desarrollo del folculo. Esta enfermedad es causada principalmente por grupos de organismos bien identificados tales como: Staphylococcus spp., Streptococcus spp., Pastereulla spp., Colifornes, -Escherichia colli, Enterobacter spp., y Klebsiella spp. El conteo de clulas somticas es un indicador de la intensidad del esfuerzo de defensa del sistema inmune del animal, este conteo aumenta en respuesta a la infeccin intra-mamaria. Por lo anterior, es que la industria moderna busca el conteo ms bajo posible de clulas somticas en leche, desde el punto de vista econmico la reduccin significa para el productor, aumento en la produccin de leche, disminucin en el costo de vaquillas de reemplazo, menos leche de descarte, reduccin en el costo de medicamentos y del veterinario, menos trabajo y aumento en el rendimiento del producto final. En la actualidad, el conteo de clulas somticas es el indicador ms utilizado para evaluar la calidad de la leche y su determinacin ms precisa se hace con el contador de clulas somticas (DCC) cuyo principio son: los rayos infrarojos que pasan por un sistema de filtros, el ncleo de las clulas se tien con Propidium lodide. Se usa un casete por muestra, el cual contiene la tincin y permite hacer la prueba en menos de un minuto. En Mxico, Hernndez (2002) realiz una validacin para el diagnstico y control de mastitis sub-clnica y utiliz la prueba modificada de Wisconsin la cual tiene un costo por animal de alrededor de seis pesos y es ligeramente inferior al costo de la prueba California, la evaluacin se realiz en un hato de 360 vacas Holstein. Despus de un ao de la prueba el porcentaje de vacas sanas sin mastitis pas de 27% a 57%, lo que a su vez se traduce en la obtencin de una leche de mejor calidad. En contraste, el no efectuar las pruebas de diagnstico oportuno de mastitis puede producir mastitis clnica. Son varios los problemas que limitan el desarrollo de la 29

Ganadera

Avances de investigacin del CEVACU 2011 ganadera regional; pero sobresale la falta de tecnologa adecuada a las caractersticas socioeconmicas y culturales de los productores, adems de que esta tecnologa sea conocida por ellos y realmente la utilicen. Para alcanzar dicho objetivo se requiere un proceso de transferencia de tecnologa pecuaria de prcticas de manejo que sean ms eficientes y eficaces, para que logren una mejor productividad de las explotaciones agropecuarias. El proyecto tiene como eje principal, transferir tecnologa para el diagnstico y control de mastitis a travs de prcticas de manejo y ordeo en ganado bovino en explotaciones agropecuarias cuyo propsito principal es la produccin de leche y carne. La estrategia inicial es capacitar a productores y tcnicos en tecnologas pecuarias disponibles para el diagnstico y control de mastitis y prcticas de ordeo para mejorar la calidad de la leche de ganado bovino; con un enfoque adaptativo para incrementar la productividad de las unidades de produccin de ganado bovino de doble propsito en el sur de Sinaloa. OBJETIVOS Establecer un mdulo de transferencia de tecnologa para capacitar a los productores y tcnicos en buenas prcticas de ordeo y manejo sanitario de la mastitis en los sistemas de produccin de leche de ganado bovino. Difundir las prcticas de ordea y el control sanitario de mastitis para reducir la presencia de la enfermedad en el ganado bovino. Demostrar las bondades del seguimiento del conteo de clulas somticas como indicador de la calidad de la leche como una estrategia de control de mastitis. MATERIALES Y MTODOS El mdulo de tecnologa pecuaria de ganado bovino, se estableci en el Rancho San Jos comunidad de El Quemado, municipio de Mazatln, Sinaloa., cuyas coordenadas geogrficas son: 10621' longitud oeste y 2312' latitud norte, a 38 km al norte de la Ciudad de Mazatln por la carretera internacional Mazatln-Culiacn. La unidad de produccin cuenta con 160 cabezas de ganado bovino de la raza Suizo Americano, Holstein x Jersey. El sistema empleado consisti en una sala de ordea y una ordeadora de tipo mecnico de seis pezoneras (alfa laval), bomba de vaco VT-76, bomba elctrica de descarga de leche, tanque de balance de vaco, bomba de lavado automtico 6 pesadores de leche individual (WAIKATOS); la sala de ordea est diseada en forma de media espina de pescado con una capacidad de ordeo de 42 a 50 vacas por hora; tanque fro de leche con capacidad de 1,600 litros. Para el lavado del equipo de ordeo se utiliz una solucin alcalina en dosis de 10 mililitros por litro de agua, adems de una solucin cida en dosis de 15 ml por litro de agua. Para el presello de ubres se emple Sellalac. Al final del lavado del equipo de ordea se aplic una solucin sanitizante en dosis de un mililitro de yodo por litro de agua a una temperatura de 60C. Para el lavado del tanque fro se emple shampoo acidfico, y para el control de mosca del establo se aplica Biothrine C.E. 15 (deltametrina) en dosis de dos mililitros por litro de agua con una aspersora de motor. Para la prueba de California se emple una solucin de Diagmastin en dosis de tres mililitros de reactivo por tres mililitros de leche, los cuales se depositaron en una paleta de plstico con cuatro cuadrantes. Para el secado de las vacas al

30

Ganadera

Avances de investigacin del CEVACU 2011 final de la lactancia se aplica SECAM y/o Orbenin-edc (cloxacilina benzatnica) en dosis de 10 mililitros por cuarto de ubre. Para la realizacin del antibiograma se emplearon cajas petri y una incubadora de laboratorio (de 50 a 100C), sensi-discos, medios de cultivo (agar, sangre de bovino al 5%), rejillas para tubos de ensayo, varillas de vidrio y asa de 6 milmetros de dimetro. Para cuantificar las clulas somticas en la leche como indicador de calidad, se emple un contador de clulas somticas (DCC) de infrarrojo DeLaval y cassett en muestras de leche. . Para la capacitacin de productores y tcnicos en prcticas de manejo sanitario y ordea se emple el mtodo de capacitacin para adultos (aprender haciendo). Los cursos se desarrollaron de manera terica y prctica en grupos no mayores a 30 personas por evento. En la primera parte de cada curso se desarroll la parte terica en un tiempo de 2 a 3 horas en donde se describieron los conceptos y antecedentes de la temtica motivo de la capacitacin y en la segunda parte se hizo nfasis en la prctica de las actividades tocadas, las cuales se desarrollaron en el mdulo de transferencia de tecnologa. Las temticas en los cursos terico prcticos fueron: 1). Buenas prcticas de ordeo para mejorar la calidad de la leche (rutina de ordea, intervalo entre ordeas, manejo de productos y dosis de limpieza de equipo de ordea, lavado de ubre, despunte de ubre, manejo del vaco del equipo de ordea, desinfeccin de pezoneras, funcionamiento de la eficiencia de la mquina de ordea, etc.); 2). Calidad de la leche, conceptos y principios de la calidad de la leche, indicadores de calidad, conteo de clulas somticas, cuenta total bacteriana (UFC) % de grasa, coliformes y determinacin de indicadores de la calidad de la leche; 3). Influencia de pezoneras (funcionamiento, reposicin, limpieza y manejo al momento de la ordea); y 4) Conteo celular somtico, (importancia como 31 estrategia de control de mastitis, determinacin en leche fra y caliente, mtodos de medicin y equipo). 5. Manejo de vacas secas (secado de vacas al final de la lactancia, mtodos de secado, tratamientos, productos y dosis, alimentacin de vacas secas, etc.). 6. Tratamiento de mastitis (prueba de diagnstico de mastitis, descripcin de prueba California, Wisconsin, conteo de clulas somticas, antibiograma, mtodos de control, antibiticos, dosis de productos farmacuticos y manejo integral de la enfermedad. Para monitorear la calidad de la leche fra en tanque y de la leche caliente destinada a queso, se determin, una vez al mes, el contenido de clulas somticas por mililitro de leche. RESULTADOS Se mantuvo una unidad productiva de transferencia de tecnologa con un manejo integral de la mastitis (prcticas de ordeo y control sanitario). En el Cuadro 1 se describen los cursos dirigidos a productores y tcnicos sobre higiene y control de mastitis en el ganado bovino. Se capacitaron 222 productores y 18 tcnicos del Programa Prestadores de Servicios Profesionales Pecuarios (PSPP) en el manejo sanitario y prcticas de ordeo para mejorar la calidad de la leche de ganado bovino. Se realizaron nueve cursos tericosprcticos para productores y tcnicos, sobre prcticas de ordeo y manejo sanitario para mejorar la calidad de la leche de ganado bovino. Adems, se impartieron cursos sobre: a) Bioseguridad alimentaria, caso produccin de leche en ganado bovino., b) Calibracin y ajuste de equipo de ordeo c) Indicadores de calidad del agua y dosificacin de solucin alcalina y cida para el lavado de equipo de ordea.

Ganadera

Avances de investigacin del CEVACU 2011 Se han elaborado a la fecha tres manuales tcnicos como memoria de resultado de proyecto y cuyos ttulos son: 1.- Buenas prcticas de manejo e higiene para obtener leche de calidad; 2.- Control de Mastitis en Gando bovino; y 3.Aplicacin de los conceptos de Inocuidad en la produccin de leche en Sinaloa.
Cuadro 1. Cursos efectuados sobre prcticas de higiene de ordeo y control de Mastitis para mejorar la calidad de la leche en ganado bovino 2010-2011.
Municipio Fecha 31/07/10 16/10/10 Mazatln 21/07/11 18/08/11 10/11/11 30/04/10 27/11/10 San Ignacio Elota 24/02/10 17/11/10 No. Productores No. Tcnicos 22 12 21 23 25 24 17 26 52 2 1 3 2 3 2 1 1 1

sensibilidad se observ que el mejor antibitico fue Enrofloxacim baytril. Se realizaron 9 cursos tericoprcticos sobre prcticas de higiene y manejo de ordea para mejorar la calidad de la leche de ganado bovino. Se efectuaron adems dos das demostrativos de campo para determinar el contenido de clulas somticas en leche como indicador indirecto de la sanidad de la ubre. Las demostraciones se efectuaron en las localidades de El Potrero de Sataya, municipio de Navolato, y Chinobampo municipio de Ahome. Los participantes fueron 178 productores y 30 tcnicos del programa PSPP. Se elaboraron los escritos 1) Control de Mastitis en ganado bovino y 2) Aplicacin de los conceptos de inocuidad en la produccin de leche en Sinaloa, publicados en. la Memoria de Resultados de. Fundacin Produce Sinaloa, A.C. 2011. Adems se elaboraron los siguientes resmenes: 1) Manejo para mejorar la calidad de leche en bovinos, publicado en la Memoria Anual de la Fundacin Produce Sinaloa, A.C. Ejercicio Operativo 2010-2011 en diciembre del 2011; 2) Modelo de transferencia de Tecnologa Pecuaria en Sinaloa: Calidad de la leche en ganado bovino; 3) Aislamiento y susceptibilidad antimicrobiana de cepas Staphilococcus aureus de mastitis bovina en Sinaloa, Mxico, publicado en la. Memoria del Segundo Congreso Internacional de Innocuidad Pecuaria en Morelia, Michoacn. Septiembre 2011; 4) Capacitacin a productores y tcnicos del sur de Sinaloa en prcticas de manejo sanitario y ordeo para obtener leche de calidad de ganado bovino, publicado en la Memoria del. Segundo Congreso Internacional de Manejo de Pastizales y Produccin animal. Chihuahua, Chih. Septiembre 2011; 5) Resistencia bacteriana en cepas patgenas aisladas de mastitis bovina en Sinaloa, Mxico, publicado en la Memoria de Segundo Congreso Internacional de Manejo de 32

Culiacn

T o t a l =>

222

18

Se determin la calidad de agua utilizada para el lavado de equipo de ordeo de 30 establos proveedores de leche fra de la Planta Pasteurizadora Lala Mazatln, y se lleg a la conclusin que la mayora de las explotaciones (25 de 32) el agua se caracteriza por ser dura en extremo y muy dura, en base a esos resultados se determino la dosificacin para las soluciones alcalino y cido para el lavado de equipo de ordea. Se efectuaron pruebas de sensibilidad a antibiticos a catorce vacas con problema de mastitis subclnica en el Rancho Pericos en el municipio de Mazatln, despus de 48 horas de incubacin se determin que en 8 vacas el agente patgeno principal fue Staphilococcus aureus y en 5 vacas el agente principal fue Micrococcus y en una Streptococcus spp. En la prueba de

Ganadera

Avances de investigacin del CEVACU 2011 Pastizales y Produccin animal. Chihuahua, Chih. Septiembre 2011, y 6) Transferencia de Tecnologa para mejorar la calidad de la leche fra de ganado bovino en el sur de Sinaloa, publicado en la memoria de la XLVII Reunin Nacional de Investigacin Pecuaria. Len, Guanajuato 2011. CONCLUSIONES Se capacitaron 222 productores y 18 tcnicos PSPP en el manejo integral de mastitis para mejorar la calidad de leche de ganado bovino. El indicador de clulas somticas (CS/mL) de leche se redujo en el mes de mayo de 2011 a un rango de 90,000/mL a 420,000/mL de leche, contra 300,000/mL a 1,750,000/mL de leche en julio del 2008, como producto de la implementacin de buenas prcticas de higiene y control de mastitis. Se cuenta con la capacitacin personalizada de 42 ordeadores del sistema de produccin de leche semiintensivo, lo que ha permitido mejorar los indicadores de calidad de leche fra que se entrega a las plantas pasteurizadoras. El muestreo de leche en tanque realizado de manera individual con el Contador de Clulas Somticas (DDC) es determinante para tomar medidas de control oportuno contra la mastitis. Como resultado de la capacitacin se han mejorado las prcticas de manejo en: la higiene del equipo de ordeo, la Prueba California, el tratamiento de mastitis con antibiticos, el secado de vacas, la limpieza de sala de ordea, la desinfeccin de sala y equipo de ordea, as como el manejo de vacas con problemas de mastitis. LITERATURA CONSULTADA Barretero, H.R. et al 2002. Uso de sales aninicas en la alimentacin de 33 vacas secas. Fichas tecnolgicas Sistema Producto Bovinos Leche. Tecnologas disponibles 1997-2003. Divisin General de Investigacin Pecuaria. Primera edicin INIFAP Mxico 115-120 Mxico. D. F. Garca, A.D. 2004. Clulas somticas y alto recuento bacteriano. C. Primera edicin. College of Agriculture y Biologic al Sciences/ South Dakota State Univ./USDA. pg 403. 1-S EEU. Guerra, L.J. E. et al. 2007. Efecto del Selenio y Vitamina E en la produccin de leche y condicin corporal de vaca Ayshire. Memoria de la XLII Reunin Nacional de Investigacin Pecuaria. Culiacn, Sin. Primera edicin. UAS Mxico Culiacn, Sin. Koppel R. E. 2002 El doble ordeo en sistemas de explotacin de Bovinos doble propsito Tecnologa transferida a agentes de cambio. SAGARPA. INIFAP. Primera edicin. INIFAP 1 y 2 Mxico. Hernndez, A.L. 2002. Control de mastitis. Fichas tecnolgicas de Tecnologa validada Bovinos SAGARPA.INIFAP. Primera edicin. INIFAP Mxico. 18 y 19 Mxico, D.F. Hernndez, A.L. 200. Diagnstico y control de la mastitis. Fichas tecnolgicas Bovinos leche. Tecnologas validadas. Direccin General de Investigacin Pecuaria. SAGARPA INIFAP-2002. Primera edicin. INIFAP. Mxico. 20. Mxico, D. F. Luna. L.M. et al. 2002. La prueba de reductasa para el monitoreo de l calidad de la leche en Jalisco. Primera edicin. INIFAP. Mxico 15 y 16. Mxico, D.F. INIFAP. 1997. Prevencin de mastitis subclnica en ganado de doble propsito. Tecnologa llave en mano. INIFAP. Mxico 27-29 Mxico, D. F. Pedraza, G.C. et al. 2000. Cambios en la produccin y composicin lctea por efecto del incremento de clulas somticas en leche de vaca.

Ganadera

Avances de investigacin del CEVACU 2011 Agricultura Tcnica C.P. Colegio de Postgraduados. Primera edicin Mxico 251-258. Salty, J. A. y Crdova, I.A. 2008. Pruebas de campo para diagnstico de calidad de leche y mastitis en Memoria de Seminario Internacional de Avances en Produccin Animal Sinaloa 2008. Primera edicin. UAS Mxico. 107-111. Reyes, J.J.E. 2001. Validacin de la pradera y ensilaje en el sistema de produccin becerro-leche en el sur de Sinaloa en Memoria de Reunin Nacional de Investigacin Pecuaria. Quertaro, Qro. Primera edicin. INIFAP. Mxico. 165. SAGARPA 2003. Servicio de Informacin y Estadstica Agroalimentaria y Pesquera. Secretara de Agricultura, Ganadera y Desarrollo Rural. Boletn Leche. mayo-junio. Primera edicin. Mxico. D.F. 7-75. Eilfried W. 2004. Mastitis Bovina. Prevencin y Tratamiento. Primera edicin. Universitaria. Universidad de Guadalajara, Jal. Mxico. 143.

34

Ganadera

Avances de investigacin del CEVACU 2011

Validacin y transferencia de tecnologa pecuaria para el desarrollo sustentable de grupos de ganaderos organizados en Sinaloa
Ing. Alfredo Loaiza Meza, Ing. Juan E. Reyes Jimnez, Ing. Toms Moreno Gallegos, Ing. Daniel Gonzlez Gonzlez, Lic. Jaime Valdez Amaya e Ing. Hrlyn Astengo Czares.

INTRODUCCIN Segn datos del Programa Nacional Pecuario 20072012, en el pas existen ms de 3.1 millones de Unidades de Produccin Ganadera, las cuales se localizan a lo largo y ancho del territorio nacional, ocupando una superficie de poco ms de 110 millones de hectreas, en las que en muchos casos no se tiene otra opcin ms que la cra y explotacin de ganado; coexisten sistemas productivos muy contrastantes, desde muy tecnificados hasta los ms rudimentarios con alto uso de tecnologa tradicional; se afirma que el sector pecuario genera ms de un milln de empleos remunerados en forma permanente; aunque se ha presentado un crecimiento sostenido en los niveles de produccin, no ha sido suficiente para cubrir la demanda nacional, teniendo que recurrirse a exportaciones crecientes en casi todos los productos pecuarios (Programa Nacional Pecuario 20072012, SAGARPA). Ante las expectativas de crecimiento poblacional del pas, se prev que para el 2012, existan ms de 110 millones de mexicanos, que provocar un aumento en la demanda de alimentos; el subsector pecuario enfrenta el reto de producir cada vez ms y de manera ms eficiente, poniendo especial nfasis en el cuidado al medio ambiente, en otorgar valor agregado a los productos, en la sanidad e inocuidad de los mismos y, sobre todo, a precios accesibles a la poblacin mexicana. Un factor que se considera importante para mejorar las expectativas de desempeo del subsector pecuario del pas, es la tecnologa; no obstante, segn informacin disponible en el INIFAP solo el 15% de las Unidades de Produccin Pecuaria (UPP), 35

presentan niveles altos de uso de tecnologa (PRONAVATT 2000- 2006. INIFAP). Ello a pesar de que para muchos de los problemas de produccin y productividad de las UPP, ya existe el conocimiento y la tecnologa necesaria. Lo anterior, significa que es necesario redoblar esfuerzos encaminados a la capacitacin y transferencia de tecnologa para los productores pecuarios del pas. No obstante, debido a los aspectos sealados anteriormente: ms de 3.5 millones de UPP, dispersin y diversidad de sistemas productivos, diversidad social, econmica y ecolgica del pas; se considera una tarea complicada el lograr atender de manera directa a todos los productores pecuarios del pas. Una alternativa viable para contribuir a la solucin de la problemtica planteada es a travs de la capacitacin y soporte tecnolgico a los Prestadores de Servicios Profesionales que proporcionan asistencia tcnica a los productores pecuarios del pas. En Mxico, la ganadera tropical aporta el 19.5% de la leche y el 40% de la carne consumida en el pas (Romn, 1995; SAGARPA, 2002); de esta cantidad, la mayor parte de leche y aproximadamente el 50% de la carne se producen en la cadena bovinos de doble propsito. Para el 2002, Sinaloa present una existencia ganadera de 1 601 409 cabezas de ganado bovino. En las reas de temporal del estado se encuentra aproximadamente el 80% del inventario ganadero estatal. Este ganado est constituido por animales criollos encastados por ceb y registran un bajo porcentaje de fertilidad entre el 40 y 50%. La productividad de los bovinos es baja, becerros al destete de 150 kg., produccin de leche por lactancia de 700 lt. y edad al

Ganadera

Avances de investigacin del CEVACU 2011 primer parto de 40 meses, desventaja que es compensada por su adaptabilidad y resistencia a las condiciones de la regin del trpico seco de Sinaloa. La produccin de leche en Sinaloa es baja y esta se ha mantenido sin variantes importantes a lo largo de los ltimos 15 aos. Para el 2003, Sinaloa aport slo el 0.8 por ciento de la leche nacional al producir 82 194 miles de litros. En cuanto a produccin de carne, Sinaloa se ubica entre los siete estados que ms aportan al total nacional, para el 2003 produjo 72 809 toneladas de carne (lo que representa el 4.86 por ciento del total producido a nivel nacional. La baja productividad (sobre todo de leche) y fertilidad que presenta la ganadera en Sinaloa se debe principalmente a las limitantes tecnolgicas que presentan la mayora de las unidades de produccin. En el INIFAP se cuenta con tecnologa y conocimientos que pueden contribuir a la solucin de los problemas de produccin y productividad que afectan al campo mexicano. Sin embargo, es necesario establecer acciones permanentes para que esos conocimientos y tecnologas lleguen a los productores rurales del pas. Al respecto, de 1997 al 2007 oper en el Instituto el Programa Nacional de Validacin y Transferencia de Tecnologa Pecuaria (PRONAVATT), el cual tena entre sus estrategias principales la de dar soporte tecnolgico y capacitacin a los Agentes de Cambio que trabajaban con grupos de productores ganaderos. Conscientes de que el trabajo directo con los productores es una tarea imposible de realizar, en el INIFAP, se estableci una estrategia de capacitacin a capacitadores, a travs de los tcnicos contratados por el Programa DEPAI, esta estrategia permiti validar y transferir una gran cantidad de conocimientos y tecnologas a los productores pecuarios del pas. Actualmente, el INIFAP cuenta con investigadores que cubren la mayora de las disciplinas pecuarias, los cuales tienen experiencia en procesos de capacitacin; 36 adems en el Instituto se tienen diseados una gran diversidad de cursos y talleres que cubren los diferentes sistemas productos pecuarios. El INIFAP mantiene alianzas con las principales instituciones de investigacin y docencia del pas, para atencin de aquellas reas y disciplinas para las que no se cuenta con los recursos humanos suficientes. Un gran nmero de Proyectos Estatales de Transferencia de Tecnologa Pecuaria contina en operacin como es el caso de Sinaloa y se ha mantenido en los ltimo diez aos porque se han buscado estrategias interinstitucionales y en la parte operativa se constituyen GAC en la zona norte, centro y sur del estado, para dar una mejor evaluacin y seguimiento del programa. Resulta necesario agregar al Centro de Investigaciones Regionales del Noroeste (CIRNO), a lo anterior, como el responsable directo en el noroeste del pas de las innovaciones tecnolgicas, dirige sus esfuerzos para dar respuesta a las demandas de la gran diversidad de sistemas producto establecidos en la regin en apoyo a la difusin del conocimiento cientfico; en su gran mayora han sido diseadas y ejecutadas para impactar productores del sector primario, sin embargo se requiere que estas actividades tengan un nuevo enfoque en que la poblacin objetivo de este Programa de Validacin y Transferencia de Tecnologa abarque a todos los usuarios que demanden la tecnologa, desde el productor primario hasta llegar a la Industria de transformacin y comercializacin. Desde 1996 se inici un proyecto de Validacin y Transferencia de Tecnologa Pecuaria en el noroeste del pas, los estados avanzan en diferente forma, sin embargo es en Sinaloa, en donde los impactos son sobresalientes y a diez aos de su establecimiento en la cadena prioritaria de bovinos doble propsito, en donde se aplica la metodologa del modelo GGAVATT, se han alcanzado impactos productivos, econmicos y sociales a nivel

Ganadera

Avances de investigacin del CEVACU 2011 estatal, regional y nacional, que permiten definir a este mtodo de trabajo como de las pocas estrategias para validar y transferir tecnologa. OBJETIVO GENERAL El propsito general es establecer una estrategia de transferencia de tecnologa mediante el modelo GGAVATT que permita apoyar el desarrollo de capacidades, conocimientos y habilidades de los PSPP, en la adopcin de tecnologas por los productores. OBJETIVOS ESPECFICOS Incorporar a los productores al modelo GGAVATT para el cambio tecnolgico en la alimentacin, sanidad, reproduccin, gentica, industrializacin, manejo y comercializacin. Promover el modelo GGAVATT con instituciones y ganaderos para la formacin de nuevos grupos interesados en transferir tecnologa. Establecer el programa de mejoramiento gentico del ganado a partir de sementales bovinos de doble propsito cruzados de INIFAP con adaptacin a las condiciones del trpico de Sinaloa. Capacitar a los productores y agentes de cambio, con tecnologas que mejoren la productividad de los ranchos y lograr la adopcin de la tecnologa propuesta. Capacitar y asesorar a los ganaderos y a los agentes de cambio en tcnicas de establecimiento, manejo y utilizacin de especies forrajeras, con el mtodo de mapeo de rancho. Evaluar y supervisar los efectos de la participacin de los tcnicos PSPP, en la adopcin de tecnologa de los GGAVATT con la participacin directa de los productores e instituciones involucradas en el desarrollo pecuario. Establecer un programa estatal UTEP que permita vincular las acciones de validacin y apoyos para transferir la tecnologa y evaluar sus efectos en el sistema de produccin pecuario. MATERIALES Y MTODO El modelo GGAVATT fue desarrollado por el INIFAP y actualmente se aplica en todos los estados del pas, con resultados exitosos. Parte del mtodo consiste en intensificar el uso y adopcin de tecnologa pecuaria a travs del proceso de validacin y transferencia de tecnologa en grupos organizados, con la finalidad de incrementar la produccin y productividad de los ranchos, as como mejorar el nivel de vida de los productores y sus familias; fomentando adems la conservacin y mejoramiento de los recursos naturales. Por medio de este mtodo, se organizan de 10 a 15 productores cuyos ranchos tengan caractersticas y propsitos de produccin similares, es importante, que la ganadera sea la actividad principal del productor. La institucin de investigacin validar las tecnologas desarrollada en Campos Experimentales y se retroalimentar con la problemtica detectada por el asesor, con el fin de generar nuevas tecnologas que den soluciones a la nueva problemtica detectada. Las principales instituciones participantes del proyecto son : SAGARPA, INIFAP-UTEP, Programa PSPP, Centro de Evaluacin Regional, Centro de Evaluacin Estatal, Institucin Portadora (Chapingo), Fundacin Produce Sinaloa, Subsecretara de Ganadera del Gobierno del estado de Sinaloa, UGRS, Asociaciones locales ganaderas, Alianza para el Campo y Universidad Autnoma de Sinaloa. Bajo este mtodo de trabajo se han alcanzado los resultados siguientes.

37

Ganadera

Avances de investigacin del CEVACU 2011 RESULTADOS Del diagnstico inicial se determin que el sistema de produccin identificado fue el de bovinos doble propsito donde las salidas principales son leche y carne, aunque algunos productores obtienen ingresos por la venta de semilla de variedades de sorgo de doble propsito y leguminosas forrajeras. Los productores son asesorados y capacitados permanentemente por 52 asesores tcnicos del Programa Prestadores de Servicios Profesionales Pecuarios (PSPP) y estn involucrados en la capacitacin y el soporte tecnolgico permanente, de un total de 1,525 ganaderos que cuentan con 60 mil ha. y 50 mil cabezas de ganado. Los tcnicos encargados de la capacitacin a los productores por lo general atendieron dos grupos organizados, adems, el tcnico tiene la responsabilidad de llevar a cabo la evaluacin y seguimiento de los grupos. La tipologa de los productores que conforman los GGAVATT se ubican en el estrato denominado productores en transicin, los cuales se caracterizan por tener hatos de 20-50 cabezas de ganado bovino de doble propsito de la raza CriollaXCeb y otras cruzas europeas y una superficie promedio cultivable de 20 hectreas. Para mayo del 2011, al momento de concluir el proyecto, los 52 tcnicos PSPP fueron capacitados en metodologas de evaluacin, diagnostico e informtica, del modelo GGAVATT, lo cual permiti una mejor capacidad de los tcnicos y productores en la administracin de los ranchos ganaderos y facilit el proceso para transferir tecnologas en el establecimiento y manejo de praderas, leguminosas y forrajes de corte con el mtodo de mapeo de rancho; conservacin de forrajes por el mtodo de ensilaje; tratamiento de pasturas a partir de urea; produccin de semilla de especies forrajeras; uso de sales minerales; mejoramiento gentico y reproduccin en bovinos de doble propsito; con la transferencia de tecnologa de estos conocimientos se alcanz el equilibrio de la alimentacin animal anual, en sanidad animal mas de 20 mil bovinos limpios de brucella, tuberculosis y parsitos; se mejor genticamente a 5 mil vientres mediante inseminacin o monta con toros cruzados de INIFAP y se alcanzaron producciones de leche de 30 millones de litro al ao; 200 toneladas de queso y 80 mil t de peso vivo por venta de becerros y vacas de desecho. En Sinaloa se ha consolidado una etapa importante de desarrollo del modelo GGAVATT, ya que autoridades, ganaderos, tcnicos e instituciones, en forma coordinada uniendo esfuerzos, talentos y recursos, se ha implementado el modelo GGAVATT como una verdadera estrategia de validacin y transferencia de tecnologa pecuaria en Sinaloa. Los principales componentes de capacitacin en el GAC que a su vez fueron recibidas por los ganaderos y adoptadas como actividades de validacin y transferencia de tecnologa por los grupos fueron: Mapeo de Ranchos Es un mtodo de trabajo para ordenar la distribucin de las especies forrajeras en el rancho de acuerdo a la condicin de suelo y humedad, este mtodo se puede transferir a los productores mediante, capacitaciones, asesoras, talleres, plticas, demostraciones, recorridos de campo y publicaciones. Bajo este contexto en el ciclo 2010-2011 se capacitaron en establecimiento y manejo de especies forrajeras a 52 tcnicos PSPP, los cuales capacitaron a 275 ganaderos de 30 GGAVATT del estado, en tecnologas para la siembra y manejo de especies de pastos, as mismo, con las demostraciones y recorridos de campo con intercambio de experiencias entre productores, instituciones y tcnicos fue posible hacer transferencia de este componente en 250 ha de temporal y 150 de riego.

38

Ganadera

Avances de investigacin del CEVACU 2011 Tecnologas para el establecimiento y manejo de forrajes de corte El sorgo forrajero de doble propsito es el principal cultivo de los ggavateros de Sinaloa, por lo que se capacitaron en el establecimiento y manejo de variedades de polinizacin libre de sorgo Costeo 201, Sinaloense, Gavatero y Fortuna a 51 tcnicos PSPP, los cuales actualizaron en los temas a 275 ganaderos de 32 GGAVATT del estado, en tecnologas para la siembra y manejo de variedades de sorgos de doble propsito, as mismo, con las demostraciones, recorridos trimestrales de campo con intercambio de experiencias entre productores, con publicaciones, fue posible hacer transferencia de este componente en 2,100 ha de los GGAVATT e impactar en el resto de los ganaderos del estado en 32 mil hectreas. Tcnicas para el ensilaje La disponibilidad de forraje disminuye drsticamente a partir de diciembre hasta junio, una estrategia para utilizar los excesos de forrajes producidos en el periodo lluvioso es la de proceder a conservarlos para su utilizacin en este periodo de secas, por tal motivo, con procesos de capacitacin, demostraciones, publicaciones y recorridos de campo, en el ciclo 2011-2012 se capacitaron a 450 productores de 65 GGAVATT en tcnicas para conservacin de pasturas por el mtodo de ensilaje, producto de la capacitacin se ensilaron 30,550 toneladas cosechadas de 1,500 ha en los cultivos de sorgo y maz. Tcnicas para el Manejo de praderas En un manejo de praderas la estimacin de la capacidad de carga animal de un pastizal tiene como base la produccin anual de materia seca, con la finalidad de establecer un manejo anual de acuerdo a la disponibilidad de materia seca durante el ao. La capacitacin a 50 tcnicos PSPP sobre el tema, con 39 demostraciones y recorridos de campo, permiti establecer un sistema de pastoreo rotacional mnimo de dos potreros en 475 ha de praderas. Establecimiento y manejo del cultivo de la alfalfa La alfalfa es una de las mejores especias forrajeras para el ganado bovino, ovino, caprino y equino, ya que su forraje contiene nutrimentos que son importantes en la alimentacin de esos animales domsticos. El cultivo de alfalfa en general tiene un ciclo anual o bianual con productividad econmica. La capacitacin a los tcnicos PSPP y a productores, con demostraciones, recorridos trimestrales y publicaciones, permiti la siembra y manejo de 350 ha. Tcnicas para el establecimiento y manejo agronmico de leguminosas tropicales Existe la posibilidad tener una produccin continua de forraje a travs del ao mediante el establecimiento de leguminosa forrajeras de usos mltiples como el chncharo de rbol Cajanus cajanus, frjol cuchillo Canavalia ensiformis y frijol terciopelo Mucuna deeringianum, las cuales adems de producir forraje de abundante cantidad y calidad son excelentes mejoradores del suelo. La capacitacin a los tcnicos PSPP y a productores, con demostraciones, recorridos trimestrales y publicaciones, permiti la siembra y manejo de 50 ha. Tcnicas para el tratamiento de pasturas y esquilmos agrcolas Los esquilmos agrcolas o residuos de cosecha, es de los pocos recursos forrajeros disponibles por los productores para poder alimentar el ganado durante la poca de sequa, estas pasturas son de baja calidad en cuanto a digestibilidad y contenido de nutrientes, por esta razn, para ser incluidos en dietas para el ganado

Ganadera

Avances de investigacin del CEVACU 2011 deben ser sometidos a tratamientos fsicos, qumicos o biolgicos con el propsito de incrementar su calidad y el consumo voluntario por parte del animal. Tcnicas para la elaboracin de bloques nutricionales Bloques multinutricionales (BM) constituyen una tecnologa para la fabricacin de alimentos slidos y que contienen una alta concentracin de energa, protena y minerales. Son preparados utilizando urea, melaza y un agente solidificante. Adicionalmente puede incluirse, minerales, sal y una harina que proporcione energa. Generalmente, el uso de los BM ha sido como alimentacin estratgica durante la poca seca, son resistentes a la intemperie y es consumido lentamente por lo que garantiza el consumo dosificado de la urea. Este mtodo se puede transferir a los productores mediante, capacitaciones, asesoras, talleres, plticas, demostraciones, recorridos de campo y publicaciones. Con la capacitacin en la elaboracin de bloques nutricionales a los 52 tcnicos PSPP, 90 ganaderos de 25 GGAVATT, realizaron transferencia de estos componentes en 80 toneladas de bloques nutricionales. Tcnicas en inseminacin artificial para ganado bovino Con la capacitacin a 110 nuevos ganaderos en inseminacin artificial se cuenta con 850 ggavateros preparados en este tema en el estado, los cuales alcanzaron a inseminar 1,250 bovinos en el presente ciclo. Mejoramiento gentico Despus de contar con una buena alimentacin y manejo el siguiente paso fue mejorar genticamente el ganado bovino, para lo cual se asoci al proyecto nacional de bovinos de doble propsito del INIFAP a los GGAVATT de Sinaloa, el primer paso fue darle un reordenamiento a la gentica 40 en el estado, se procedi a capacitar a los productores en inseminacin artificial, los resultados son relevantes, en ocho aos se han realizado 40 cursos, con lo cual se han preparado a 850 ganaderos en esta prctica es decir el 70% de los gavateros sinaloenses ya saben inseminar, cuando se inicia el programa en el estado solamente se contaba con 6 termos para la inseminacin, actualmente se cuenta con 105 termos, lo cual ha permitido en estos ltimos cuatro aos, inseminar 6,500 vacas con ganado bovino de doble propsito. Producto de este programa de mejoramiento gentico con toros cruzados del INIFAP, podemos afirmar que contamos con excelente gentica para las condiciones del trpico sinaloense, al comenzar a probar las hijas de estos toros que en varios ranchos de los GGAVATT estn produciendo 15L de leche diario con vaquillas del primer parto, las condiciones se estn dando y necesitamos el respaldo absoluto de las autoridades para seguir avanzando. De esta manera evitaremos las importaciones de ganado australiano de altos costos y bajo nivel de adaptacin a las condiciones tropicales de la entidad. Los componentes adoptados por los ganaderos fueron producto de capacitaciones impartidas por los investigadores de INIFAP a tcnicos PSPP, las cuales fueron sujeto de demostraciones, recorridos de campo trimestrales en cada una de las zonas el avance determinado por los GGAVATT de acuerdo a los ndice de transferencia de tecnologa oscila entre 60 y 80%, dependiendo del componente tecnolgico por adoptar y la condicin socioeconmica del grupo. Con los avances que se han alcanzado en estos ltimos diez aos en validacin y transferencia de tecnologa pecuaria, se est en condiciones de mejorar la cantidad y calidad de los forrajes empleados en la alimentacin animal bovina con el uso de praderas, leguminosas y forrajes de corte destinados a conservacin de forrajes, con lo cual se logr un equilibrio de la alimentacin animal anual, al mismo tiempo con el programa de

Ganadera

Avances de investigacin del CEVACU 2011 mejoramiento gentico, reproduccin, manejo y sanidad se podr impactar en el trpico seco de Sinaloa alrededor de 400 mil ha de temporal, susceptibles de adoptar los componentes tecnolgicos validados y se podr mejorar las condiciones de 1 600, 000 bovinos, en beneficio de 50 mil ganaderos. Con los resultados obtenidos en los mdulos de validacin y transferencia de tecnologa de los GGAVATT se est en condiciones de impactar cuando menos en: cien mil becerros que pasaran de 140 a 180 kg promedio de peso vivo, lo que equivale a producir adicionalmente cuatro mil toneladas de carne/ao, la produccin de leche se incrementara de 800 kg a 1,400 kg, que representan adicionalmente 20 millones de litros de leche por ao. Con el uso de pradera y ensilaje se bajan los costos de produccin en un 40% y con el uso de bloques nutricionales en la suplementacin animal se bajan los costos de produccin en un 80%. En produccin de semillas de especies forrajeras ms del 90% son importadas, se han alcanzado avances importantes en la autosuficiencia de sorgos forrajeros de doble propsito variedad Gavatero, Sinaloense, Fortuna y Costeo 201; sin embargo, es necesario establecer un programa de produccin de semillas de pastos y leguminosas forrajeras que permitan bajar los costos de produccin hasta en un 50% por este concepto. Talleres y GGAVATT seguimiento del modelo aproximadamente asistentes. CONCLUSIONES Se estableci un programa estatal que permiti vincular las acciones de validacin y transferencia de tecnologa con los ganaderos, los agentes de cambio y las instituciones del sector, con la participacin de los tcnicos promotores PSPP, que funcionan en perfecta congruencia con la metodologa GGAVATT. El grado de adopcin de tecnologa de los GGAVATT en el estado es del orden del 70%, producto de los componentes y actividades que desarrollan en sus ranchos. El modelo GGAVATT aplicado a la ganadera bovina de doble propsito de Sinaloa ha mejorado sustancialmente la situacin de los ranchos en cuanto a alimentacin, mejoramiento gentico, sanidad, manejo y comercializacin. Se constituyeron seis nuevos GGAVATT cuatro de ellos en los sistemas apcolas y de ovinos. Se promocion ante las instituciones del sector pecuario y agrcola el modelo GGAVATT como una estrategia para transferir tecnologa en esta rea. LITERATURA CONSULTADA INIFAP. 1999. Manejo del Ganado Bovino de Doble Propsito en el Trpico. Centro de Investigacin Regional Golfo Centro. Mxico. Rivas, L. 1992. El sistema ganadero de doble propsito en Amrica Latina Tropical: evolucin, perspectivas y oportunidades. In Memorias Symposium Internacional sobre alternativas y estrategias en produccin Animal. Universidad Autnoma de Chapingo, Mxico. pp 5-9. Romn P., H. 1995. Situacin actual y retos de la ganadera bovina en el trpico 41 a 900 productores

Se realizaron dos talleres sobre metodologa del modelo a los tcnicos PSPP. En los GGAVATT de las tres zonas del estado se realizaron seis encuentros trimestrales entre productores con la participacin de ms de 1,100 asistentes. Mensualmente se realizaron en promedio 90 reuniones de evaluacin, seguimiento y capacitacin en los GGAVATT del estado

Ganadera

Avances de investigacin del CEVACU 2011 In Memoria del XX Simposium de Ganadera Tropical: Alternativas de alimentacin del ganado bovino en el trpico. INIFAP. Mxico. pp 1-10. Romn P., H. 1995. Situacin actual y retos de la ganadera bovina en el trpico pp 1-10. In Memoria del XX Simposium de Ganadera Tropical: Alternativas de alimentacin del ganado bovino en el trpico. INIFAP. Mxico. 10. Roman P.H y Roman P.C. 1981. Produccin de leche en sistemas extensivos tradicionales en clima tropical. Tec Pec Mex. 1981; 40: 715 Rivas, L,. y Holmann F. 2002. Simposio Internacional sobre la actualizacin en el manejo de ganado bovino de doble propsito. FMVZ-UNAM; CEIEGT. Veracruz, Mxico. Vera, R.R., Garca, O., Botero, R., y Ullrich, C. 1994. Produccin de leche y reproduccin en sistemas de doble propsito. Algunas implicaciones para el enfoque experimental. Pasturas Tropicales, 18: 25-30. Villamar A.L. y Olivera C.E. 2005. Situacin actual y perspectiva de la produccin de leche de bovino en Mxico. 2005. CGG-SAGARPA. Mxico 2005, Pg. SIAP-SAGARPA. 2003. Servicio de Informacin y Estadstica Agroalimentaria y Pesquera-Secretara de Agricultura, Ganadera y Desarrollo Rural. Boletn de Leche. Mayo-Junio.

42

Ganadera

Avances de investigacin del CEVACU 2011

Unidad Tcnica Especializada de la Estrategia de Asistencia Tcnica Pecuaria en el estado de Sinaloa 2011.
Ing. Alfredo Loaiza Meza, Ing. Juan E. Reyes Jimnez, Ing. Toms Moreno Gallegos, Ing. Daniel Gonzlez Gonzlez, Lic. Jaime Valdez Amaya e Ing. Herlyn Astengo Cazares

INTRODUCCIN El estado de Sinaloa tiene una superficie de 5,609,200 has, que representa el 2.9 % de la superficie del pas (INEGI, 1991). Cuenta con una poblacin de 2,608,442 habitantes, el quinceavo lugar a nivel nacional (INEGI, 2003). La mayor parte del territorio sinaloense est constituido por terrenos planos, el resto lo forma una pequea porcin montaosa. Aproximadamente el 80% de los terrenos de la entidad se localizan por abajo de los 600 metros sobre el nivel del mar. En 2002, Sinaloa present una existencia ganadera de 1,001,409 cabezas de ganado bovino. En las reas de temporal del estado se encuentra aproximadamente el 80% del inventario ganadero estatal. Este ganado est constituido por animales criollos encastados por ceb y registran un bajo porcentaje de fertilidad, entre el 40 y 50%. La productividad de los bovinos es baja, becerros al destete de 150 kg., produccin de leche por lactancia de 700 lt. y edad al primer parto de 40 meses, desventaja que es compensada por su adaptabilidad y resistencia a las condiciones de la regin del trpico seco de Sinaloa. La produccin de leche en Sinaloa es baja y esta se ha mantenido sin variantes importantes a lo largo de los ltimos 15 aos. Para el 2008, Sinaloa aport de la leche nacional al producir 108,076 miles de litros. En cuanto a produccin de carne, Sinaloa se ubica entre los siete estados que ms aportan al total nacional, para el 2008 produjo 144,473 toneladas de carne, con un valor de la produccin de $ 2, 448, 420,000.00. La baja productividad (principalmente de leche) y fertilidad que presenta la ganadera en Sinaloa se debe 43

principalmente a las limitantes tecnolgicas que presentan la mayora de las unidades de produccin. Estas limitantes tecnolgicas son que los ganaderos alimentan su ganado a partir del agostadero y esquilmos agrcolas de baja cantidad y calidad, una gentica animal sin lnea definida, con cruzamientos sin orden con razas no apropiadas a la regin, el no uso de suplementacin mineral y el rgimen de alimentacin a que est sometido el ganado presenta un desorden en la fertilidad animal, la cual no es mayor al 50%. La alianza estratgica que el INIFAP ha mantenido por ms de 10 aos con los agentes de cambio, con las instituciones y organizaciones en los diferentes estados y la experiencia de casi 30 aos a travs de los GGAVATT; son la base para la presentacin del presente: Proyecto Nacional de Capacitacin y Soporte Tecnolgico a los Prestadores de Servicios Profesionales Pecuarios 2008 2012. OBJETIVOS Contribuir al desarrollo econmico y social del sector rural, para mejorar el ingreso y calidad de vida de la poblacin, a travs de la formacin de capital humano que fortalezca el desarrollo sustentable del subsector pecuario. Desarrollar y fortalecer las capacidades en conocimientos, metodologas de transferencia de tecnologa, organizacin y actualizacin tcnica a los Prestadores de servicios Profesionales Pecuarios (PSPP) que dan asistencia tcnica a los productores de Sinaloa. Establecer un sistema estatal de soporte tecnolgico continuo, como apoyo

Ganadera

Avances de investigacin del CEVACU 2011 al desarrollo de capacidades, conocimientos y habilidades de los Prestadores de Servicios Profesionales Pecuarios, con el fin de impulsar la innovacin en los sistemas producto pecuarios en Sinaloa. Supervisar y evaluar los servicios de asistencia tcnica y capacitacin pecuaria en apoyo al Centro Estatal de Evaluacin del programa soporte de la SAGARPA, a travs de la estrategia de la Unidad Tcnica Especializada Pecuaria. Capacitar y dar soporte tecnolgico a los prestadores de servicios profesionales pecuarios del programa soporte de la SAGARPA, para que cuenten con herramientas metodolgicas y de conocimiento por sistema producto para el mejorar su servicio a los productores. Mejorar los ndices productivos, reproductivos, tecnolgicos y econmicos de las unidades de produccin pecuaria de los grupos ganaderos, a travs de la implementacin y adopcin de innovaciones tecnolgicas. MATERIALES Y MTODO Funciones de la Unidad Especializada Pecuaria Tcnica servicios y estrategia. Realizar actividades de supervisin: Presentacin de la estrategia de supervisin y evaluacin a nivel nacional y por entidad Capacitacin a PSPP Las actividades generales consideradas en esta lnea estn orientadas a fortalecer las capacidades, habilidades y actitudes de los PSPP, para mejorar sus estrategias de intervencin con los grupos de productores; se pretende desarrollar materiales e impartir cursos y talleres. En el soporte tcnico las actividades generales consideradas son establecer un sistema nacional y estatal de soporte tecnolgico continuo y permanente, como apoyo al desarrollo de las capacidades, conocimientos y habilidades, para atender a las demandas y necesidades de los PSPP. Por esta razn en todas las reuniones mensuales del GAC (Grupo de Agentes de Cambio), se capacit a los tcnicos con tecnologas que los productores incorporaran en sus ranchos para mejorar su productividad. En estas reuniones tambin se presentan a las dependencias del sector, los avances y logros de cada uno de los 107 servicios en operacin, se programan actividades, se analizan los casos crticos de las actividades desarrolladas y se proponen estrategias de mejora; as como los acuerdos para solventar los casos muy crticos. En Sinaloa, dado que son 52 tcnicos PSPP y el seguimiento total es cada vez ms difcil se utiliz la estrategia de constituir un GAC en cada una de las zonas norte, centro y sur, con 15, 22 y 15 tcnicos, respectivamente, los cuales se renen en la segunda semana del mes, dejando la reunin estatal para el tercer jueves del mes. 1). Mapeo de rancho Es un mtodo de trabajo que sirve para reordenar las especies forrajeras de acuerdo a las condiciones del clima y suelo 44

El proyecto entre sus funciones principales contempla acciones de capacitacin y soporte tcnico para los PSP que brinden servicios de asistencia tcnica y capacitacin pecuaria, desarrollando: programa de formacin, material de apoyo, imparticin de cursos de capacitacin y animacin de la red de prestadores de servicios especializados, a travs de boletines electrnicos o pginas Web, apoyndose en los desarrollados por la DGSPDR/SAGARPA y en la pgina Web del INIFAP. Otra de las funciones como evaluador de servicios de asistencia tcnica de la estrategia es firmar contrato o convenio con la Institucin Portadora o Centro de Evaluacin Estatal Acreditado, para participar como evaluador de los

Ganadera

Avances de investigacin del CEVACU 2011 (textura, P.H. topografa del terreno), al ordenar las especies forrajeras en el rancho se evita la erosin del suelo al destinar al pasto bermuda en las partes con problemas de zanjones y crcavas; Pretoria presenta una excelente respuesta a los suelos arcillosos, pedregosos, con topografa accidentada en donde otros forrajes no prosperan. Los mejores suelos deben destinarse a los forrajes de corte y en las partes altas ligeramente planas del rancho los Panicum juegan un papel importante. El mapeo de rancho sirve para planear la disponibilidad de forraje durante el ao en cantidad y calidad, detiene la erosin y se reordenan el uso de las especies de acuerdo a las condiciones de suelo y clima. Antes de aplicar esta tecnologa, el productor siembra monocultivo de pastos cultivos agrcolas con baja cantidad y calidad forrajera; al aplicar la tecnologa de mapeo de rancho los productores usan diferentes especies forrajeras de pastos forrajes de corte y leguminosas forrajeras en la misma unidad de produccin, de acuerdo a las condicionad de textura, topografa, P.H. y humedad del suelo, permite mejorar la cantidad y calidad del alimento en trminos de produccin de materia seca y protena en un 30%. 2). Variedades de sorgo forrajero del INIFAP La capacitacin sobre el uso de sorgos forrajeros de doble propsito liberados por INIFAP, consiste en actualizar a los tcnicos PSPP, en un paquete tecnolgico para el establecimiento y manejo de variedades de sorgo liberados por INIFAP, variedades seleccionadas por sus excelentes caractersticas agronmicas forrajeras, alto contenido de azucares, libre de taninos, que le permiten seleccionarla hasta para el consumo humano, tolerancia a enfermedades y acame, muy apetecible por el ganado, de mejor digestibilidad y abundante produccin de forraje verde. 45 Las variedades de sorgo liberadas por INIFAP sirven para alimentar mejor los animales por unidad de superficie, debido a su produccin y calidad forrajera; por el bajo costo de su semilla, comparado con el de los hbridos comerciales, por la frescura de su forraje (el cual permanece suculento an cuando el grano est maduro) lo que permite cosechar ms eficientemente el forraje, as mismo, su tolerancia al acame, que permite una cosecha mecnica sin prdidas de biomasa. Antes de la capacitacin se tena poco uso de prcticas agronmicas que no permiten a materiales de sorgo demostrar su potencial de rendimiento y este de baja calidad del forraje, despus de la capacitacin a tcnicos y estos a los productores se mejoraron las prcticas agronmica utilizadas en las variedades de sorgo Costeo 201, Sinaloense, Gavatero, Fortuna y VC-462 , sobre todo en el uso de mejores variedades, tratamiento de semilla, uso de herbicidas preemergentes y fertilizacin, lo cual permiten obtener rendimientos promedios de 35.0 t/ha de forraje verde, con un contenido de protena del 8-al 10%, una digestibilidad del 65% superior a los hbridos comerciales en un 20% que producen de 25 t/ Ha de forraje verde. 3). Conservacin de pastura por ensilaje. El ensilaje es una prctica de conservacin de forrajes frescos sin deteriorar el valor nutritivo original de la planta, permite asegurar el sustento alimenticio durante el ao, al utilizar este cuando el alimento escasea: Se aprovecha al mximo la produccin de forrajes de alto rendimiento y calidad, sin el deterioro de su valor nutritivo, se dispone de material suculento, cuando en el periodo de sequa escasean las pasturas, se destina al ensilaje especies forrajeras de altos rendimiento, lo que permite alimentar un mayor numero de animales, los forrajes duros con el proceso de fermentacin aumentan su digestibilidad, la leche producida con alimentos ensilados es ms

Ganadera

Avances de investigacin del CEVACU 2011 rica en vitamina A y caroteno, el ensilaje se digiere mejor, debido a su alto contenido de humedad, lo que favorece la masticacin y la rumia. Antes de capacitar a los tcnicos en esta tecnologa, los productores utilizaban solamente los forrajes disponibles de esquilmos y sorgos de pastoreo, que usados en la alimentacin animal originan perdidas del 50% por pisoteo y defecacin, lo cual incide en una reduccin de la carga animal hasta en un 60% ( 4 vacas/ha en 90 das de pastoreo). Al capacitarse en este mtodo de conservacin de forraje, los productores con el ensilados se aprovechan al 100% su forraje, adems de que conservan su calidad de nutrientes mnimo un 90%, una produccin de 30 t/ha de forraje verde equivale a la alimentacin de 8 vacas durante 90 das. 4). Leguminosas forrajeras de temporal Los tcnicos PSPP fueron capacitados en el establecimiento y manejo de leguminosa forrajera tropicales; Mucuna, Canavalia y Cajanus que representan una alternativa oportuna para dar respuesta a los graves problemas de produccin de forraje en cantidad y calidad en las zonas de temporal de Sinaloa. La metodologa impartida a los PSPP en estos cultivo, les da el conocimiento para trasmitirlo a los productores sobre los beneficios, que adems de proveer de forraje de alta calidad con protena superior al 18%, son especies que por su cobertura vegetal conservan el suelo, la erosin es mnima, as como, sirven para fijar nitrgeno atmosfrico de 40 a 60Kg/ha, se bajan los costos de produccin por alimentacin y juegan un papel importante en la sostenibilidad del sistema. El sistema de alimentacin de los animales en la zona de temporal que es a partir de forrajes de bajos rendimientos, menores a las 3.0 t/ha de forraje seco, adems de que se suministran hasta 4.0 Kg./animal/da de concentrados a altos costos. Se espera que con el conocimiento sobre el 46 establecimiento y manejo de leguminosas forrajeras, los productores puedan disponer de un forraje con rendimientos superiores a las 6.0 t/ha de materia seca y 24.0 t/ha de forraje verde, suficientes para mantener bien alimentados a los animales y eliminar el uso de concentrados. 5). Manejo de Praderas Se capacit a los tcnicos PSPP a comprender que un buen manejo de praderas siempre est asociado con un sistema de pastoreo rotacional y esta define como la manipulacin del pastoreo para obtener un resultado determinado, su objetivo es mejorar o mantener la condicin de una pastura y hacer una utilizacin eficiente del forraje para obtener una produccin animal mxima y sostenida. Sin embargo es importante aclarar que no existe ningn sistema capaz de lograr el objetivo anterior si la carga animal excede de la capacidad de carga de la pradera; el conocimiento de la relacin entre la carga animal y la productividad por animal y por hectrea, para cualquier tipo de pradera, es esencial para un buen manejo. En un manejo de praderas, la capacidad de carga de un pastizal tiene como base la estimacin de la produccin anual de materia seca, sin embargo es importante considerar que la produccin de forraje en regiones tropicales y subtropicales ocurre en su mayor parte durante la temporada lluviosa, por lo tanto, la carga animal debe ser ajustada a la cantidad de forraje disponible, tomando en cuenta el grado de utilizacin permitido. Este sistema consiste en dividir a la pradera en ms de dos potreros de igual rea, rotndose de 21 a 28 das para volver ser pastoreada, mientras uno permanece ocupado los dems se encuentran en recuperacin para un nuevo pastoreo. La divisin de potreros puede ser desde 2 hasta 14 metros cuando se usan cercos elctricos; de esta manera mejora el uso del forraje cuando alcanza el equilibrio

Ganadera

Avances de investigacin del CEVACU 2011 entre rendimiento y calidad, mantiene mejor equilibrio entre las especies de la pradera y mejor control de malezas, propicia mejor distribucin de heces de orina, se rompen los ciclos de parsitos y de enfermedades, propiciando mejor control sanitario, no requiere de la apertura de nuevas reas (desmonte) destinadas al pastoreo y se logra un mayor aprovechamiento por unidad de superficie. Se parte de un sistema de pastoreo continuo tradicional con alimentacin a partir de praderas, agostaderos y esquilmos agrcolas, la produccin de leche de 700 Kg. / lactancia y la carga animal de dos hectreas por animal, los becerros al destete pesan un promedio de 150 Kg. Con el manejo intensivo de las praderas se soluciona el problema de forraje en la poca de lluvias, se sostienen bajo este rgimen de pastoreo de 2 a 4 vacas /ha durante el periodo de lluvias, la produccin lctea es de 1400 L/ lactancia y en riego de 6 a 8 vacas/ha con una produccin de 2500 L/lactancia, adems de que en produccin de carne con seis becerros/ha se producen entre 400 y 500 Kg. /ha de peso vivo en 180 das de pastoreo. Se obtienen becerros al destete de 180 kg. 6). Elaboracin de Bloques Multinutricionales. Los tcnicos PSPP fueron capacitados en la elaboracin de bloques multinutricionales partiendo de la hiptesis de que los bloques nutricionales es un complemento alimenticio que sirve para el mejor aprovechamiento de los forrajes toscos disponibles en la poca de sequa, como los esquilmos de sorgo y maz, principalmente. Los tcnicos capacitaron a los productores considerando que el uso de esta tecnologa constituye un mtodo para la fabricacin de alimentos slidos con una alta concentracin de energa, protena y minerales. Son preparados utilizando urea, melaza, y un agente solidificante. Adicionalmente puede incluirse, minerales, 47 sal, y una harina que proporcione la protena y energa (Cuadro 1). Generalmente los bloques multinutricionales se han usado como alimentacin estratgica durante la poca seca, ya que son resistentes a la intemperie. Los concentrados comerciales contienen del 10 al 16% de protena a precios promedios de $5.00 kg. Un bloque multinutricional elaborado con la frmula propuesta por INIFAP contiene alrededor del 50 % de protena por efecto del uso de la urea principalmente, por lo que se mejora la calidad del forraje, se incrementa la digestibilidad de los esquilmos de 40% hasta en un 60% y el contenido de protena cruda en ms del doble (del 4 al 8%); adems, como resultado de la adicin de minerales y energa al bloque multinutricional, se incrementa la fertilidad de las vacas de un 50% a un 65%.
Cuadro 1. Ingredientes para la elaboracin de bloques multinutricionales.

Ingrediente Granos de cereal Melaza Urea Sal comn Minerales traza Cal hidra o cemento Protena (soya o harina de pescado)

% 10-15 40-50 5-10 3 2 10 15

7) Mejoramiento gentico y reproduccin A los tcnicos PSPP se les capacit en el tema de inseminacin artificial como un mtodo de reproduccin que se utiliza en los programas de mejoramiento gentico para obtener ganado genticamente superior, con la finalidad de contar con una ganadera ms productiva al usar un cruzamiento ordenado. De acuerdo con los resultados obtenidos en los hatos de los Campos Experimentales del INIFAP y en hatos comerciales, con el cruzamiento de

Ganadera

Avances de investigacin del CEVACU 2011 toros hbridos de INIFAP, con el uso del semen de los sementales cruzados a travs de inseminacin artificial, se permite mantener el vigor hbrido o heterosis, con lo cual, se podrn mejorar los parmetros productivo y reproductivos al incrementar los rendimientos de leche de 700 a 1500 L/vaca/lactancia. A largo plazo se espera que realizando este tipo de mejoramiento gentico dentro de los hatos de doble propsito, se estar en condiciones de producir un promedio de 2000 kg de leche con lactancia de 260 das, becerros al destete de 210 kg a los nueve meses de edad, y vacas al primer parto a los 30 meses, con un peso entre 320 a 400 kg y fertilidad del 75 %. Se parte de la base de que actualmente sin el programa de inseminacin artificial la ganadera se sigue manteniendo extensiva, con desorden gentico por el uso indiscriminado de diferentes razas y bajos ndices productivos y reproductivos. Por tal motivo, el enfoque es que los productores sean capacitados en inseminacin artificial, que cuenten con una ganadera semi-intensiva, que se ordene genticamente al ganado con razas especializadas en el doble propsito de Suizo, Holstein y Simbrah, y se mejore la productividad de los hatos ganaderos. 8). Prevencin y control de la Mastitis Los tcnicos PSPP fueron capacitados en la prevencin y control de la mastitis clnica y subclnica. Se parte de la base que en el manejo tradicional de mastitis del ganado bovino en general se caracteriza por: producir leche de baja calidad, alta presencia de bacterias, alto conteo de clulas somticas (CCS), alta presencia de coliformes, cuenta total bacteriana alta, baja vida de anaquel de leche fresca, productos lcteos perecederos. Al capacitar a los tcnicos en el tema y estos a su vez a los productores se esta en condiciones de emplear prcticas de higiene y manejo de la ordea que mejoran la calidad de la leche. La 48 mastitis es una enfermedad bacteriana que provoca una inflamacin de la ubre que casi siempre es causada por una infeccin. El manejo integral consiste en implementar una serie de prcticas de higiene en el ordeo y manejo que conduzcan a producir leche de calidad. El indicador ms utilizado para evaluar la presencia de mastitis es la cantidad de Clulas Somticas (CCS) y su alta presencia disminuye la calidad de la leche. El manejo integral permite la deteccin temprana de mastitis subclnica y un tratamiento temprano, lo cual aumenta la tasa de curacin. Tambin ayuda a mejorar la prevencin general antes que se vuelva muy serio el problema del hato. El primer paso es la revisin de los cuartos enrojecidos, hinchados o duros; despus examinar los primero chorros de leche para detectar cogulos y trazas de sangre. El despuntado puede mostrar mastitis antes de que se pueda ver cualquier inflamacin. Despus de la capacitacin los productores efectan pruebas de diagnostico de mastitis subclnica (prueba california), se realiza el monitoreo de leche fra en tanque (conteo de clulas somticas), se monitorean residuos de antibiticos en leche; se secan las vacas al final de la lactancia para la prevencin de mastitis. 9) Soporte tcnico por internet y correo electrnico. El soporte tcnico va internet se dio mediante la pgina web de la UTEP: http://www.utep.inifap.gob.mx/. Los PSPP desde el inicio y como requisito de elegibilidad tenan un correo por medio del cual se les notificaba toda la informacin relativa a la operacin de su trabajo y la interrelacin con la UTEP, as como el soporte tcnico que solicitaron. Mencin especial tiene el sistema de informacin de la UTEP (SIUTEP) en la cual los PSPs capturaron la informacin tcnica, productiva y econmica de sus grupos, tambin se tuvo una atencin especial y

Ganadera

Avances de investigacin del CEVACU 2011 soporte tcnico especfico actividad y pgina. para esta integrantes del grupo en las acciones de capacitacin impartidas por los propios PSPP o por especialistas invitados. Tambin se apoy con la imparticin de plticas tcnicas sobre innovaciones para mejorar la productividad y competitividad de las unidades de produccin de los diferentes sistemas producto pecuarios. Las principales actividades de los evaluadores fueron: reuniones mensuales de trabajo con PSPP, apoyo en plticas tcnicas al grupo de productores, supervisar informes mensuales de PSPP, participacin y supervisin en reuniones mensuales de los grupos de productores, visitas de supervisin en campo de la UPP, tutoras y soporte tcnico en programa de trabajo de PSPP, apoyo a PSPP y productores en levantamiento de registros en las UPP, asistencia a la reunin final de evaluacin del PSPP y grupo de productores, levantar el acta de satisfaccin del cliente y emitir el dictamen del servicio, todos estas actividades fueron complementadas con la evaluacin de recorridos trimestrales y encuentros estatales por zona. Cobertura de atencin Para el ejercicio 2010-2011 en Sinaloa, se autorizaron 107 servicios de asistencia tcnica y capacitacin del programa soporte, atendidos por 52 tcnicos prestadores de servicios profesionales pecuarios; se consider cada servicio de 15 productores como un grupo ganadero y cada tcnico atendi dos servicios. En Sinaloa se atienden a los 18 municipios que comprende el estado, con un mnimo de 2 tcnicos por municipio: en el norte del estado, El Fuerte y Ahome, con cuatro tcnicos, Choix, con tres, Culiacn con 8, Mocorito con 5, Navolato y el resto con al menos 2 grupos. El perfil de los PSPP que atienden los grupos es de profesionistas mdicos veterinarios titulados, solo nueve son ingenieros agrnomos zootecnistas; el 90 % de ellos tienen ms de cinco aos de experiencia en 49

10) Tutoras personalizadas a PSPP: Por parte de los evaluadores, se tuvo disponibilidad ilimitada de tiempo para los PSPP que acudieron en visitas a los Campo Experimentales de Sinaloa, CEVACU, SUR DE Sinaloa y CEVAF. En las reuniones de zona y con la comunicacin oficial acordada por las instituciones participantes y los PSPP, fue el correo electrnico, va por la cual, adems del telfono y chat, se dio salida a todas la inquietudes tecnolgicas planteadas por los PSPP, principalmente en la captura de la informacin en el SI-UTEP, tambin sobre la implementacin de diferentes innovaciones tecnolgicas y dudas sobre los formatos y fechas para entrega de los informes. Seleccin y evaluadores actividades de los

Los tres evaluadores de la UTEP en Sinaloa, fueron seleccionados de acuerdo al perfil requerido para dicha actividad; son investigadores de INIFAP cuya formacin profesional es de Ingenieros agrnomos, los cuales son apoyados en la supervisin, evaluacin y seguimiento de campo por tres mdicos veterinarios zootecnista contratados del Centro de Evaluacin Regional. Los tres evaluadores de INIFAP cuentan con ms de 30 aos de experiencia profesional en investigacin pecuaria, fueron capacitados en la estrategia UTEP durante el 2009 y tienen experiencia de 15 aos en el manejo de grupo de productores con la metodologa GGAVATT, en asesora y capacitacin a PSPP. A cada evaluador se le asignaron 15, 20 Y 16 prestadores de servicios profesionales en la zona norte, centro y sur de Sinaloa, respectivamente Los evaluadores asistieron y participaron en al menos una reunin mensual del grupo para supervisar y verificar la asistencia y participacin de los

Ganadera

Avances de investigacin del CEVACU 2011 la organizacin y asesora de grupos ganaderos con la metodologa GGAVATT, solo dos tienen menos de un ao de experiencia. Son especialistas en el sistema producto que atienden, con un promedio de ms de 10 aos de egresados de los estudios de licenciatura en universidades locales. Todos manejan los programas bsicos de computacin, radican en la entidad y los ms cerca de las unidades de produccin, adems cuentan con vehculo propio para la realizacin de sus actividades. RESULTADOS Capacitacin a PSPP Se impartieron tres talleres de capacitacin a los 51 PSPP de la estrategia pecuaria de Sinaloa. El primero fue: taller sobre manejo del sistema de informacin SIUTEP, el cual fue terico-prctico para conocer la operacin del sistema y practicar la captura; que tuvo una duracin de.8 horas; el segundo curso, denominado: administracin de ranchos pecuarios en base al uso de registros tcnicos y econmicos, con duracin de 16 horas, para conocer y ejercitar las estrategias para la implementacin de agronegocios y levantar registros tcnico productivos y econmicos en las unidades de produccin; y el tercero fue sobre el modelo GGAVATT. Se realizaron 8 reuniones durante el periodo 2010-2011 en cada una de las zonas y del GAC estatal, por lo que representaron 32 eventos de capacitacin, cubriendo los temas de alimentacin, gentica, reproduccin, sanidad y manejo (Figura 1). Capacitacin a productores Los 107 servicios de asistencia tcnica y capacitacin autorizados para el ejercicio 2010-2011agrupan un total de 1511 productores ganaderos registrados en el SI-UTEP de los sistemas producto bovinos de doble propsito, ovino y abejas, de los cuales, 1386 son hombres y 125 son 50 mujeres responsables de la UPP, con un impacto directo en 114545 ha, de las cuales 56115 ha. son principalmente de agostaderos, 35680 siembra de forrajes de corte, 7912 ha de praderas de temporal, 11728 ha de praderas de riego.

ALIMENTACION 80%
ENSILAJE SORGOS PRADERAS LEGUMINOSAS BLOQUES T.PASTURAS INSEMINACION MASTITIS PROD. LACTEOS

Figura 1. Principales componentes tecnolgicos de capacitacin en las reuniones GAC y su adopcin por los productores de Sinaloa en el ciclo 2010-2011.

En 98 servicios se incorporaron al menos dos innovaciones tecnolgicas en el 50 % de los productores del grupo, nueve servicios no reportan tecnologas incorporadas, ni presentaron evidencias en el formato acordado. De acuerdo a lo anterior, al menos 760 productores en los sistemas bovinos de doble propsito, apcola y ovinos adoptaron tecnologas como: praderas, leguminosas, sorgos variedades INIFAP, suplementacin con minerales, elaboracin de dietas integrales, elaboracin de bloques multinitricionales, tratamiento de pasturas con urea, prevencin y control de mastitis, elaboracin de productos lcteos, siembra de forrajes de corte, ensilaje de forrajes, inseminacin, diagnsticos de gestacin entre otras. En abejas, un servicio indica que los productores adoptaron las innovaciones de acaricidas orgnicos, diagnstico y control de Varroa. Al inicio de la intervencin, el nivel tecnolgico promedio de los 107 grupos GGAVATT de bovinos de doble propsito de Sinaloa, fue del 45.0 %; con los servicios de asesora tcnica y capacitacin a travs de la implementacin de innovaciones tecnolgicas, el nivel se increment al

Ganadera

Avances de investigacin del CEVACU 2011 75.8 %, lo cual indica que durante este periodo, el salto tecnolgico fue del 30.8 %. Las tecnologas con mayor contribucin, fueron la implementacin de ensilaje, siembra de variedades de INIFAP, praderas, alfalfa, lombricultura, fertilizantes orgnicos, tratamiento de pasturas, elaboracin de bloques, suplementacin mineral e inseminacin artificial. Otras innovaciones tecnolgicas que contribuyeron en menor medida, porque fueron implementadas en menor porcentaje por los productores, fueron: Prueba California, pastoreo intensivo tecnificado, uso de melaza, urea y bloques, sincronizacin de estros, buenas prcticas de ordeo y elaboracin de productos lcteos. Al inicio de la intervencin, el nivel de aplicacin de prcticas de manejo de los 107 servicios de los grupos ganaderos de bovinos de doble propsito de Sinaloa, fue del 45.0 %; con los servicios de asesora tcnica y capacitacin a travs de la implementacin de prcticas de manejo, el nivel de uso se increment al 75.0 %, lo cual indica que durante este periodo, se logr un aumento del 30.0 %, las prcticas de manejo que se realizaron por un mayor nmero de productores, fueron la identificacin del ganado con arete (SIINIGA), levantamiento de registros tcnicos y econmicos, desparasitacin, vacunacin del ganado y manejo de praderas. Indicadores productivos El 90 % de los productores de bovinos de doble propsito ordean sus vacas, el resto las maneja como de carne o vaca-cra, lo cual indica que este sistema se encuentra establecido en Sinaloa, debido a las condiciones econmicas por las que atraviesa el pas en lo general y la ganadera en lo particular. El promedio de vacas en ordeo por grupo, esta en los rangos de 30 a 40 vacas en un 80%. El promedio de produccin diaria de leche por vaca, es en los ranchos muestreados de 6.0 L de 3,5 L iniciales., los cual representa incrementos de 2.5 L respecto a UPP que 51 no implementan innovaciones tecnolgicas y superior tambin a los promedios de la ganadera antes de implementar la metodologa GGAVATT en Sinaloa. Resultados de la acreditacin desempeo de los PSPP por

Cinco PSPP de 52 quedaron rechazados: dos por falta de la reunin final de evaluacin y acta de satisfaccin del cliente; dos por no acreditar el programa de capacitacin; y uno por incumplimiento en los productos a entregar. Nivel de participacin de los productores Con relacin a las reuniones mensuales de los grupos, los recorridos trimestrales y los encuentros trimestrales por zona durante el presente ejercicio, se tuvo una participacin promedio del 80 % de los productores, lo cual confirma que los ganaderos de Sinaloa han establecido este mtodo de trabajo como una estrategia para transferir el conocimiento en sus ranchos ganaderos. CONCLUSIONES La estrategia de Asistencia Tcnica del Programa Soporte, es una muy buena opcin de apoyo para el desarrollo de la ganadera en el estado de Sinaloa. Se consolid el GOE y el trabajo del equipo de la UTEP en el estado de Sinaloa. Los resultados e impactos de la estrategia fueron positivos en la adopcin de tecnologas por al menos el 50 % de los productores de cada grupo. Se incrementaron los indicadores productivos, pero los econmicos muestran valores negativos en la mayora de los grupos. Hubo baja participacin de los productores en las reuniones mensuales, con un 80 % de asistencia, as como

Ganadera

Avances de investigacin del CEVACU 2011 reducidas visitas de los PSPP a las unidades de produccin, con un 60 %. LITERATURA CONSULTADA Caetano A. de O. 2006. Propuesta de vinculacin entre el sector institucional y el sector productivo para la transferencia de tecnologa. una visin desde la perspectiva de los productores rurales. CNPAMM. Espinosa G., JA., AT Gonzlez O., U. Aguilar B y SA Ros R. 2005. Planeacin,seguimiento y evaluacin econmica y metodologa para empresas familiares bovinas. Celaya, Gto., Mxico. INIFAP, Campo experimental Bajo. 32 p (Folleto tcnico Nm. 2). Herrera F., C., Velasco H. , Denen y R. Radulovich, 1994. Fundamentos de anlisis econmico, pp. 9-22; gua para investigacin y extensin rural. Serie Tcnica, Informe Tcnico Nm. 232. CATIE, Turrialba, Costa Rica. Hugh H. B., Trevino, R. 2006. Servicio de Conservacin de los Recursos Naturales. NRCS. Productive lanas healthy Environment. strategy plan 2005-2010 INIFAP. 2005. Contribuciones del modelo GGAVATT al desarrollo de la ganadera: Testimonio de productores y tcnicos de los GGAVATT El sacrificio; sol, tierra y leche de Sinaloa. pp 75-102 . INEGI 2000: XI censo general de poblacin y vivienda 1990; Conteo de poblacin y vivienda 1995; y XII Censo general de poblacin y vivienda 2000 INIFAP 2006: Interpretacin del mandato institucional sobre promocin y apoyo a la transferencia de tecnologa, pp.15-20. Documento interno de trabajo. Loaiza M.A. 2007. Innovaciones tecnolgicas aplicadas al Sistema Bovinos de Doble Propsito por los GGAVATT de Sinaloa, XLIIIMemoria, Cientfica y XI Encuentro Nacional de Validacin y Transferencia de Tecnologa Pecuaria. Culiacn, Sinaloa, Mxico. Rivas, L. 1992. El sistema ganadero de doble propsito en Amrica Latina Tropical: evolucin, perspectivas y oportunidades. pp. 5-9 Memorias Symposium Internacional sobre alternativas y estrategias en produccin animal.

52

Ganadera

Avances de investigacin del CEVACU 2011

Asistencia tcnica y capacitacin para apoyar el cumplimiento de los compromisos adquiridos por los beneficiarios en el marco del componente PROGAN a tcnicos PSPP en el estado de Sinaloa
Ing. Alfredo Loaiza Meza, Ing. Juan E. Reyes Jimnez, Ing. Toms Moreno Gallegos, Ing. Daniel Gonzlez Gonzlez, Lic. Jaime Valdez Amaya e Ing. Herlyn Astengo Cazares. INTRODUCCIN Las unidades de produccin pecuaria son diversas en el pas, por la situacin climtica edfica, social, econmica y cultural que se presenta en cada una de las regiones, que van desde unidades productoras tecnificadas, hasta de subsistencia. Se distinguen, en forma general, cuatro sistemas de produccin: a) especializado, b) semiespecializado, c) doble propsito y d) familiar. El mayor volumen de produccin de leche se obtiene en el sistema especializado, que aporta el 50.6% del total nacional, el semiespecializado produce el 21.3%, el de doble propsito el 18.3% y el sistema familiar aporta el 9.8%. La produccin de leche en Mxico en los ltimos diez aos, ha presentado una tasa media de crecimiento anual del 2.9%. Sin embargo, la produccin de leche no ha sido autosuficiente, tenindose que importar anualmente el 20.1%, para satisfacer las necesidades de 118 litros por habitante al ao. Considerando que el desarrollo de la actividad lechera en los estados del pas no es homognea, ya que en el 22.8% de los estados del pas, se produce el 65% del total de la produccin de leche en Mxico. De las siete entidades federativas, destacan los estados de Jalisco que produce el 17.4% del volumen total, Durango participa con el 10.7%, Coahuila con el 9.7%, Chihuahua con el 8.1%, Veracruz con el 7.3%, Guanajuato con el 6.6% y el Estado de Mxico con el 4.9%. Sin embargo, el crecimiento de la produccin en las principales zonas lecheras, se debe esencialmente al incremento en el nmero de vacas en produccin y en menor medida 53 al aumento en la produccin por unidad animal. Los sistemas de produccin de leche especializado y semiespecializado se benefician con la liberacin de los precios de leche pasteurizada y ultrapasteurizada. Sin embargo, los sistemas de produccin familiar y doble propsito se ven afectados por las importaciones de leche en polvo, as como por los elevados costos de insumos y venta de un producto final que no cuenta con valor agregado. Debido a esto, se le ha dado poca importancia a los sistemas productivos doble propsito y familiar, sin embargo, se necesita dar atencin a este sistema, ya que dentro de las unidades de produccin existentes en el pas son el tipo que predomina. La mayor parte de estos sistemas de produccin son atendidos por el Programa de Asistencia Tcnica y Capacitacin para Apoyar el Cumplimiento de los Compromisos Adquiridos por los Beneficiarios en el Marco del Componente PROGAN por lo que se estima que con la aplicacin del programa de capacitacin a los PSPP en tecnologas que se comprometieron a transferir en sus Unidades de Produccin(U.P.) podrn contribuir a amortiguar los volmenes faltantes que se complementan con importaciones, que van en aumento con el paso del tiempo. Es necesario incorporar tecnologas a las U.P. para que se transformen en empresas ganaderas de xito, lo cual depender en gran medida de la capacitacin y asesoramiento intensivos en los principales temas que estn afectando a los ranchos, principalmente: a) crianza del becerro desde el nacimiento hasta el

Ganadera

Avances de investigacin del CEVACU 2011 destete, b) seleccin de hembras en el manejo reproductivo, c) ajuste de carga animal de los animales en pastoreo acorde a la produccin de forraje por unidad de superficie y al impacto de la introduccin de especies forrajeras en reas abiertas al cultivo, as como d) mantenimiento de los hatos limpios de brucelosis; por tal motivo en esta primera fase se elaborarn para el estado de Sinaloa los temas anteriores con capacitaciones documentadas con manuales dirigidos a tcnicos Prestadores de Servicios Profesionales Pecuarios (PSPP) y en forma simultanea la elaboracin de guas con conceptos prcticos entendibles por los productores ganaderos que puedan sistematizar y capacitar con este documento en tecnologas que le permitan mejorar las condiciones de un sistema tradicional y extensivo a un sistema innovador. El conocimiento de estos temas ubicara al tcnico y a su vez a los productores el porqu estas tecnologas mejorarn desde la alimentacin, manejo, sanidad y reproduccin sus hatos ganaderos haciendo de sus ranchos una empresa en desarrollo. La propuesta de documentar la capacitacin tcnica que hoy se comparte con Instituciones, los tcnicos PSPP y los productores del pas, representa el esfuerzo conjunto de un equipo de investigadores expertos en la materia del Instituto Nacional de Investigaciones Forestales Agrcolas y Pecuarias (INIFAP) que durante los ltimos 25 aos han dedicado su tiempo a la investigacin pecuaria de Mxico en el tema que hoy nos ocupa. Por lo anterior la capacitacin en los temas propuestos documentadas con la elaboracin de guas tcnicas y manuales tienen la finalidad de ofrecer conocimientos tecnolgicos y material de respaldo a los Prestadores de Servicios Profesionales Pecuarios (PSPP), en materia de ajuste de carga, seleccin y manejo reproductivo de hembras bovinas y brucelosis, con el fin de que sirva de apoyo para la capacitacin de 54 productores. Los frutos que se logren por la capacitacin a los tcnicos PSPP sern para beneficio de los productores que apliquen estos conocimientos en sus unidades de produccin, lo cual es producto de la coordinacin institucional que involucra a SAGARPA, CGG PROGAN, INIFAP, y las Uniones Ganaderas del pas. Tenemos la firme conviccin de que avanzaremos en el corto plazo, y estaremos preparados para mejorarlo, el INIFAP es cuna de Investigadores ilustres y de trabajo tesonero, aportaremos un grano de arena a la educacin de nuestros ganaderos y la capacitacin continua de calidad, traer mas y mejor desarrollo para el pas.

OBJETIVOS
Conjuntar acciones y recursos para la asistencia tcnica y capacitacin, as como para otorgar apoyo para el cumplimiento de los compromisos adquiridos por los beneficiarios del componente PROGAN del programa de uso sustentable de recursos naturales para la produccin primaria de la SAGARPA. Elaborar 5 manuales impresos como material didctico bsico para impartir cursos para Prestadores de Servicios Profesionales (PSP): Manejar el proceso reproductivo de la hembra bovina de carne y doble propsito en condiciones sustentables; ajuste de la carga animal en agostaderos y praderas; y mejoramiento de la calidad sanitaria de la leche. Prevenir enfermedades en abejas (varroasis) y en rumiantes (brucelosis.). Capacitar a los PSPP y a los productores en tcnicas de: manejo reproductivo de la hembra, ajuste de la carga animal, control de varroasis, y brucelosis, y calidad sanitaria de la leche, que les permita cumplir con los compromisos del PROGAN.

Ganadera

Avances de investigacin del CEVACU 2011 Elaborar 4 guas tcnicas para los beneficiarios del PROGAN, en: diagnstico de gestacin en bovinos, programa de ajuste de carga animal, prevencin de enfermedades en rumiantes y prevencin de enfermedades en abejas. MATERIALES Y MTODO Una vez analizado en una reunin de trabajo del Grupo Operativo del PROGAN Sinaloa encabezado por el Director de Ganadera de la SAGARPA, COTECOCA, INIFAP y el Colegio de Mdicos Veterinarios, se procedi a dar cumplimiento a los principales acuerdos para llevar a cabo la capacitacin a tcnicos y productores con base en los siguientes puntos: Proceso de programacin de los cursos a PSPP. Se realiz con la finalidad de contar con una cobertura de todos los tcnicos PSPP que estn apoyando el PROGAN ya sea como evaluadores o bien como tcnicos GGAVATT con seguimiento en la UTEP-INIFAP. Los cursos se programaron en las tres zonas del estado para dar la oportunidad a todos los tcnicos involucrados en el PROGAN. En la zona norte del estado por sus caractersticas se decidi impartir el taller de capacitacin Seleccin y manejo reproductivo de la hembra bovina productora de carne y de doble propsito en pastoreo; en la Zona centro, en el Valle de Culiacn por la importancia en alimentacin animal se selecciona el taller de capacitacin Ajuste de carga animal en tierras de pastoreo y en el sur del estado en Mazatln, por la importancia en las campaas zoosanitarias se decide impartir el taller de capacitacin Prevencin de brucelosis en rumiantes. De esta manera 50 tcnicos PSPP se involucraron en los talleres de capacitacin que estn prestando servicio a los ganaderos de Sinaloa en el PROGAN lo que permitir un mejor abanico para la seleccin de 25 tcnicos capacitadores que 55 se seleccionaran finalmente de acuerdo a los parmetros incorporados en el aprendizaje de los diferentes talleres. Proceso mediante el cual se seleccion a los PSPP. En Reunin celebrada con el Grupo Operativo del PROGAN en la Direccin de Ganadera de SAGARPA en Sinaloa, para la seleccin de los tcnicos PSPP capacitadores se determin utilizar los siguientes criterios: Un primer grupo de tcnicos PSPP sern seleccionados por haber participado en los tres talleres y su clasificacin ser de acuerdo a los puntos obtenidos en las calificaciones del examen final en cada uno de los talleres. Un segundo grupo sern aquellos tcnicos PSPP que tomaron dos talleres y su clasificacin ser de acuerdo a los puntos obtenidos en las calificaciones del examen final en cada uno de los dos talleres, despus del primer grupo. El tercer grupo de tcnicos PSPP seleccionados sern aquellos que por razones justificadas tomaron un solo taller de capacitacin y obtuvieron la ms alta calificacin en el examen final. Un cuarto grupo seleccionado sern aquellos tcnicos PSPP que adems de salir satisfactorios en los talleres de capacitacin tienen experiencia como capacitadores en los GGAVATT. Con estas caractersticas se seleccionaron 25 tcnicos de los 46 que tomaron talleres de capacitacin, los cuales se les notifico por medio de correo electrnico por parte de la Direccin de ganadera de SAGARPA, asimismo en las reuniones del GAC en cada una de las zonas se le notifico al personal capacitador que quedo seleccionado, sin embargo se presentaron dos casos que an cuando

Ganadera

Avances de investigacin del CEVACU 2011 salieron excelentes por razones personales no pudieron participar como capacitadores. Programacin de los Cursos y Asesoras a productores. Despus de la seleccin, se procedi a ubicar a los tcnicos de acuerdo a la zona de trabajo que estn atendiendo como evaluadores del PROGAN y/o Asistencia Tcnica en los GGAVATT, quedando distribuidos en los 18 municipios del estado de Sinaloa. Se atendi la asignacin que realiz el programa nacional del PROGAN que fue de 323 asesoras y 41 capacitaciones en Sinaloa. Distribucin de cargas de trabajo a los PSSP De manera uniforme se distribuy la carga de trabajo de los 25 Tcnicos PSPP seleccionados, correspondiendo en la mayora de los casos 13 asesoras y dos capacitaciones (Cuadro 1). RESULTADOS Capacitacin a PSPP En el estado de Sinaloa se realizaron tres talleres de capacitacin distribuidos en tres zonas del estado de acuerdo a los criterios utilizados en la programacin descrita anteriormente de la forma siguiente: Capacitacin sobre ajuste de carga animal en tierras de pastoreo. ste evento fue dirigido a un total 29 tcnicos de las diferentes instituciones involucradas en la actividad pecuaria de Sinaloa como sigue: PSPP-PROGAN 1, PSPP-GGAVATT 27, SAGARPA 1; de esta forma tanto autoridades de las diferentes instituciones, investigadores, Tcnicos PSPP con participacin en la actividad Pecuaria de Sinaloa fueron participes de la temtica desarrollada en estos eventos en beneficio 56 de los ganaderos de la entidad. El taller se llevo acabo en Culiacn, Sinaloa, en las instalaciones del Campo Experimental Valle de Culiacn los das jueves 24 y viernes 25 de marzo de 2011.
Cuadro 1. Distribucin de la carga de trabajo de acuerdo a los municipios y zona geogrfica del estado de Sinaloa. 1 1 1 AS CA ZO NOMBRE Sebastin Velarde Figueroa 13 2 Mario Hctor Pompa Quintero 13 2 Roberto Urzua de la Vega 13 1 Luis Fernando Meza Osuna 12 1 Miguel E. Vega Sotomayor 13 2 Tirzo Robles Camargo 13 2 Amelia Mendoza Moroyoqui 13 1 Sergio Ignacio Castil Vzquez 13 2 Octavio Ignacio Castil Reyes 13 2 Mirna Mireya Milln Varela 13 2 Emilio Bon Rojo 13 1 Artemio Joaqun Bandn Gaxiola 13 2 Marcos Joel Montoya Camacho 13 1 Juan Ramn Garrido Rojo 13 1 Hugo Lpez Lpez 13 2 Felipe de Jess Tirado Valdez 13 2 Rafael Gaxiola Gaeta 12 1 Oscar Amhed Aguilar Huerta 13 2 Edgar Benjamn Lpez Pompa 13 2 Ernesto Gastn Soto Cruz 13 1 Fco. Rodrguez Domnguez. 13 2 Francisco R. Pea Hernndez 13 2 Guillermo Francsco Mrquez G. 13 2 Andrs Eladio Villaseor Castro 13 2 Ernesto Salazar Pineda 13 1 TOTAL 323 41 1 : AS, asesoras; CA, capacitaciones; ZO, zona 2 : A, alta; M, media; V, valle. A M A M A M A V V M V A V A A M V A A A A A V A V
2

Seleccin y manejo reproductivo de la hembra bovina productora de carne y de doble propsito en pastoreo. ste evento fue dirigido a un total 24 tcnicos de las diferentes instituciones involucradas en la actividad pecuaria de Sinaloa como sigue: PSPP-PROGAN 1, PSPP-GGAVATT 22, SAGARPA 1; de esta forma tanto autoridades de las diferentes instituciones, investigadores, Tcnicos PSPP con participacin en la actividad Pecuaria de Sinaloa fueron partcipes de la temtica desarrollada en estos eventos en beneficio

Ganadera

Avances de investigacin del CEVACU 2011 de los ganaderos de la entidad; El taller se llevo acabo en Los Mochis, Sinaloa, en las instalaciones del Campo Experimental Valle del Fuerte los das jueves 31 de marzo y viernes 1 de abril de 2011. Taller de Capacitacin sobre Prevencin de la brucelosis en rumiantes. ste evento fue dirigido a un total 16 tcnicos de la instituciones involucradas en la actividad de los GGAVATT de Sinaloa (Cuadro 2). Los 16 tcnicos que asistieron al taller son PSPP que conducen GGAVATTs en el centro y sur del estado de Sinaloa, fue una seleccin dirigida sobre aquellos tcnicos con experiencia en capacitacin del modelo GGAVATT, que nos permita establecer los criterios de acuerdo a las necesidades de las demandas de los productores para cumplir con los compromisos del PROGAN. El taller se llev acabo en Mazatln, Sinaloa, en las instalaciones del Campo Experimental sur de Sinaloa los das jueves 28 de abril y viernes 29 de abril de 2011.
Cuadro 2. Nmero de asistentes a 3 talleres de capacitacin de produccin animal en Sinaloa.

Perfil de los PSPP capacitados en los talleres Taller de capacitacin sobre ajuste de carga animal en tierras de pastoreo. Los 29 tcnicos asistentes fueron PSPP, con una edad promedio de 42.8 aos, de los cuales el 89.7 % son hombres y 10.34% mujeres; el 96.55% tienen el grado acadmico de licenciatura y el 3.45% es Tcnico pecuario, en donde el 72.4 % son MVZ, el 27.6% IAZ y el 3.45% tcnicos pecuarios. En el Cuadro 3 se presenta el perfil general de los PSPP a partir de la captura de la ficha de registro de cada uno de ellos y los resultados en trminos de promedios y porcentajes son de acuerdo con los formatos establecidos en la Unidad Tcnica Especializada Pecuaria (UTEP). El perfil de los asistentes fue satisfactorio y cumpli con las demandas establecidas para dar cumplimiento al los productores del PROGAN. Taller de seleccin y manejo reproductivo de la hembra bovina productora de carne y de doble propsito en pastoreo. Los 24 tcnicos asistentes son PSPP, con una edad promedio de 42.1 aos, de los cuales el 87.5 % son hombres y 12.50% mujeres; el 100.0% tienen el grado acadmico de licenciatura y en donde el 87.5 % son MVZ y el 12.5% IAZ. En el Cuadro 3 se presenta el perfil general de los PSPP a partir de la captura de la ficha de registro de cada uno de ellos y los resultados en trminos de promedios y porcentajes son de acuerdo con los formatos establecidos en la Unidad Tcnica Especializada Pecuaria (UTEP). El perfil de los asistentes fue satisfactorio y cumpli con las demandas establecidas para dar cumplimiento a los productores del PROGAN. Taller de capacitacin sobre prevencin de la brucelosis en rumiantes. Los 16 tcnicos asistentes son PSPP, con una edad promedio de 42.0 aos, de los cuales el 87.5 % son hombres y 12.5% 57

Taller de Fecha capacitacin

Lugar

Asistentes

Ajuste de 24 y 25 carga animal Culiacn, marzo en tierras de Sinaloa 2011 pastoreo Seleccin y 31 manejo marzo reproductivo y1 de la hembra abril de bovina 2011 Los Mochis, Sinaloa

29

24

Prevencin 28 y 29 de la de abril Mazatln, brucelosis en de Sinaloa rumiantes 2011 TOTALES 3 3

16

69

Ganadera

Avances de investigacin del CEVACU 2011 mujeres; el 100.0% tienen el grado acadmico de licenciatura, donde el 62.5 % son MVZ y el 37.50% IAZ (Cuadro 3). El perfil de los asistentes fue satisfactorio y cumpli con las demandas establecidas para dar cumplimiento a los productores del PROGAN.
Cuadro 3. Caractersticas de los PSPP asistentes a los tres talleres realizado en el estado de Sinaloa en el Marco del Componente PROGAN del 2011 Conceptos Ajuste Sel. y Preven. carga manejo brucelosis animal reprod. rumiantes No. de PSPP 29.0 24.0 16.0 42.8 42.1 42.0 Edad media 89.7 87.5 87.5 % de H 10.3 12.5 12.5 % de M 97.0 100.0 100.0 % G. A. Lic. 72.4 87.5 62.5 % de MVZ 27.6 12.5 37.5 % de IAZ

Un primer grupo de tcnicos PSPP fueron seleccionados por haber participado en los tres talleres y su clasificacin fue de acuerdo a los puntos obtenidos en las calificaciones del examen final en cada uno de los talleres.
Cuadro 4. Evaluacin del aprendizaje de los tcnicos PSPP asistentes a los tres talleres realizado en el estado de Sinaloa en el Marco del Componente PROGAN del 2011

Capacitacin Ajuste de carga animal en tierras de pastoreo Seleccin y manejo reproductiv o de la hembra bovina Prevencin de la brucelosis en rumiantes TOTALES

No. de PSP

Calificacin Inicial Final

Grado de aprendizaje

29

7.2

9.0

1.8

Evaluacin a PSPP Se realiz una evaluacin inicial de conocimientos, donde cada una de los veinticinco preguntas fueron expuestas una a una al grupo en general, y el o los participantes tuvieron la oportunidad de participar en las respuestas de acuerdo a sus conocimientos iniciales, lo cual se hizo en forma escrita. Al final se les hizo una evaluacin con las mismas 25 preguntas cerradas, esta evaluacin se contabiliz y el promedio general del taller fue de 8.8 de calificacin, contra 5.6 del promedio inicial (Cuadro 4). Lo anterior refleja un incremento del 36.4%, lo cual demuestra que los talleres de capacitacin fueron altamente provechosos por los conocimientos adquiridos por los tcnicos PSPP. De acuerdo con estos resultados se analiz la participacin de cada uno de los tcnicos y en reunin celebrada con el Grupo Operativo del PROGAN en la Direccin de Ganadera de SAGARPA, se efectu la seleccin de los tcnicos PSPP capacitadores mediante los criterios que se indican a continuacin. 58

24

5.8

8.9

3.1

16

3.9

8.4

4.5

69

5.6

8.8

3.2

Un segundo grupo fueron aquellos tcnicos PSPP que tomaron dos talleres y su clasificacin fue de acuerdo a los puntos obtenidos en las calificaciones del examen final en cada uno de los dos talleres, despus del primer grupo. El tercer grupo de tcnicos PSPP seleccionados fueron aquellos que por razones justificadas tomaron un solo taller de capacitacin y obtuvieron la ms alta calificacin en el examen final. Un cuarto grupo seleccionado fueron aquellos tcnicos PSPP que adems de salir satisfactorios en los talleres de capacitacin tienen experiencia como capacitadores en los GGAVATT.

Ganadera

Avances de investigacin del CEVACU 2011 Con estas caractersticas se seleccionaron 25 tcnicos de los 69 que tomaron talleres de capacitacin, como se presenta en el Cuadro 5.
Cuadro 5. Tcnicos autorizados por la Direccin General de Ganadera de SAGARPA de acuerdo a los criterios de evaluacin utilizados en la seleccin de los tcnicos PSPP capacitadores del PROGAN en Sinaloa. 2011.
Nombres Carga animal Crianz a Brucelosis Prom e-dio

Evaluacin de capacitacin.

los

cursos

de

Sebastin Velarde F. Mario H. Pompa Q Roberto Urzua V. Luis F. Meza Osuna Miguel E. Vega Sotom Tirzo Robles Camarg Amelia Mendoza M. Sergio Ignacio Castil Octavio Ignacio Castil Mirna Mireya Milln V. Emilio Bon Rojo Artemio J. Bandn G. Marcos J. Montoya C. Juan R. Garrido Rojo Hugo Lpez Lpez Felipe de J. Tirado V. Rafael Gaxiola Gaeta Oscar A. Aguilar H. Edgar B. Lpez P. Ernesto Gastn Soto Francisco Rodrguez Francisco R. Pea H. Guillermo F Mrquez Andrs E Villaseor C. Ernesto Salazar P. PROMEDIOS

9.4 9.2 9.2 9.2 9.6 9.4 9.2 9.2 9.2 9.2 8.8 8.8

9.0 9.6 9.6 8.7 9.6 9.3 9.3 9.3 9.3 9.3 9.0 9.0 9.6 9.0

9.3 8.1 8.1 8.7

9.2 9.0 9.0 8.9 9.6 9.4 9.3 9.3 9.3 9.3 8.9 8.9 9.6

La evaluacin de los tres cursos de capacitacin de acuerdo a los formatos utilizados por la UTEP, indican que al aplicar los conceptos utilizados para la evaluacin de dichos cursos de capacitacin fue calificado como excelente (Cuadro 6). Los talleres fueron dinmicos, participativos, intensivos y de una calidad cientfica excelente por la exposicin de los conocimientos por personal del INIFAP. Los conocimientos y experiencias de los expositores fue altamente valorado; las expectativas de los talleres fueron alcanzadas, sin embargo la audiencia manifest que se utilizaran mas ejercicios de campo, que se presentaran resultados locales, ajustados a las condiciones del trpico seco. Que este tipo de capacitaciones puedan ser dirigidas directamente a los productores, que se seleccione un grupo que reciba el taller y ellos trasmitirlo al resto de los productores en un intercambio de experiencias.
Cuadro 6. Evaluacin del evento de capacitacin de los tcnicos PSPP asistentes en los tres talleres realizado en el estado de Sinaloa en el Marco del Componente PROGAN del 2011. EVALUACONCEPTOS CIN Los objetivos del evento (instituciones y logros) Estructura del curso de acuerdo a sus necesidades de conocimientos Habilidades de interaccin Estrategias empleadas Aplicabilidad (utilidad) de lo aprendido en su trabajo Coordinacin del evento Duracin en relacin a objetivos y contenido Actividades que influyeron en su satisfaccin Promedio 94.3 97.6 94.8 91.1 95.1 95.6 92.6 93.8 94.5

6.8 10.0 10.0

7.9 10.0 10.0 9.3

9.3 9.3 9.3 9.2 9.0 8.7 8.7 8.4 8.8 9.1 8.7 9.0 9.2 8.8

9.3 9.3 9.2 9.0 8.7 8.7 8.6 8.9 9.1

59

Ganadera

Avances de investigacin del CEVACU 2011 Evaluacin de los instructores La evaluacin de los tres cursos de capacitacin de acuerdo a los formatos utilizados por la UTEP, indican que al aplicar los conceptos utilizados para la evaluacin de dichos cursos de capacitacin fue calificado como excelente (Cuadro 7). Estas calificaciones fueron producto de un promedio de 69 observaciones por instructor, donde se aplic el formato de la UTEP, que considera los siguientes conceptos: 1).Organizacin y claridad, variable que involucra 9 elementos; 2) Dominio del tema, que contiene 6 elementos; 3) Habilidades de interaccin, que involucra 10 elementos; y 4) Direccin de ejercicios, que contiene 8 elementos. En el caso del instructor 3 es un investigador de reciente ingreso que presenta dominio sobre la metodologa, sin embargo su calificacin fue regular por falta de experiencia como capacitador; el caso del capacitador 4 es un tcnico de COTECOCA con una experiencia de 30 aos altamente calificado en los ejercicios de campo, sin embargo la explicacin de aula fue aceptable por falta de dominio de la metodologa. Los talleres fueron dinmicos, participativos, intensivos y de una calidad cientfica excelente por la exposicin de los conocimientos por personal del INIFAP. Los conocimientos y experiencias de los expositores fue altamente valorado; las expectativas de los talleres fueron alcanzadas, sin embargo la audiencia manifest que se utilizaran ms ejercicios de campo, que se presentaran resultados locales, ajustados a las condiciones del trpico seco. Que este tipo de capacitaciones puedan ser dirigidas directamente a los productores, que se seleccione un grupo exitoso que reciban el taller y ellos trasmitirlo al resto de los productores en un intercambio de experiencias. Evaluacin de los cursos a productores De acuerdo al cuestionario aplicado a los productores y con el propsito de conocer si los cursos que recibi por medio del Programa de Asistencia Tcnica y Capacitacin para Apoyar el Cumplimiento de los Compromisos Adquiridos por los Beneficiarios en el Marco del Componente PROGAN le fueron provechosos se recibi la informacin siguiente:

Cuadro 7. Calificacin obtenida por los instructores que impartieron los tres talleres realizados en el estado de Sinaloa en el Marco del Componente PROGAN del 2011 Instructor por taller Concepto Carga animal Brucelosis Crianza 1 2 3 4 5 6 7 8 9 Organizacin y claridad Dominio del tema Habilidades interaccin Direccin del ejercicio Promedio 97.1 94.2 95.5 96.3 95.8 96.0 94.9 97.5 94.8 95.8 85.7 80. 7 80.8 78.3 81.4 81.9 77.1 80.0 79.0 79.5 95.2 94.1 96.4 95.0 95.2 92.4 91.1 93.3 92.8 92.4 95.8 93.3 93.2 86.6 92.2 94.3 94.2 94.7 90.8 93.5 96.4 96.8 97.2 95.1 96.4

60

Ganadera

Avances de investigacin del CEVACU 2011 Evaluacin de las asesoras a productores Las asesoras cumplen con un compromiso informativo, pero la demanda de los productores es la capacitacin completa de los temas, por lo que opinan que en lo sucesivo es preferible tener talleres de capacitacin ms completos con duracin por tema de ocho horas con un enfoque a prcticas de campo. Distribucin de guas tcnicas En la Delegacin SAGARPA ubicada en Culiacn, Sinaloa, fue el centro de concentracin de 62,600 guas que fueron enviadas de oficinas centrales del DF., las guas recibidas en la delegacin SAGARPA, Culiacn, fueron 21,500 ejemplares de Seleccin y manejo reproductivo de la hembra bovina productora de carne y de doble propsito en pastoreo, 12,100 guas de Ajuste de carga animal en tierras de pastoreo y 11,000 ejemplares de Prevencin de brucelosis en rumiantes. La distribucin fue la siguiente: estos 44,600 ejemplares fueron entregados a la Unin Ganadera Regional de Sinaloa para que a su vez las entregaran a las 18 asociaciones Locales Ganaderas de los municipios; Los 18,000 ejemplares restantes se distribuyeron en los Distritos de Desarrollo y Centros de Apoyo de SAGARPA en Sinaloa. Evaluacin de puntos crticos La seleccin de los tcnicos PSPP para impartir los cursos de capacitacin deber de elegirse con tiempo con un perfil previo. Las asesoras cumplieron con un compromiso informativo, pero no con las expectativas de adquirir conocimientos para los productores y la participacin fue ms por compromiso que por aprendizaje. La distribucin de las guas no est llegando en tiempo y forma con los 61 productores, ya que es necesario contar con este material de documentacin antes de que se inicie el proceso de capacitacin. CONCLUSIONES Es necesario realizar recomendaciones para mejorar las capacitaciones a PSPP, los cursos y las asesoras a productores. Tambin es importante describir las limitantes encontradas y las fortalezas detectadas, que se considere importante incorporar, o que incidan en toda la estrategia. Los tcnicos PSPP que participaron en los tres talleres ajuste de carga animal en tierras de pastoreo, crianza y desarrollo, prevencin de Brucelosis realizado en el estado de Sinaloa fueron acreditados despus de pasar satisfactoriamente todas las secuencias de aprendizaje. La seleccin de los tcnicos PSPP para impartir los cursos de capacitacin deber hacerse con tiempo para que estos puedan tomar todos los talleres de capacitacin para fortalecer el conocimiento que llevarn a los productores. Los talleres se caracterizaron por ser participativos (discusin en plenarias y trabajo en grupos pequeos), evaluativos (capacitadores, material didctico, instalaciones, servicios), intensivos (dos das completos) y terico prcticos (exposiciones y ejercicios). Sin embargo, es recomendable adems de estos puntos, dirigirlo el mayor tiempo a ejercicios de campo con experiencias locales. El perfil de los participantes fue amplio: mdicos, veterinarios, zootecnistas e Ing. agrnomos zootecnistas; as se cumpli con la formacin acadmica de los tcnicos PSPP como capacitadores del PROGAN. El perfil de los capacitadores es producto de la coordinacin institucional de SAGARPA, CGG, PROGAN, INIFAP y las

Ganadera

Avances de investigacin del CEVACU 2011 Asociaciones Locales Ganaderas, y son seleccionados por su experiencia profesional en cada uno de los temas abordados en el taller. Lo anterior facilitar el proceso para la seleccin previa de los PSPP como capacitadores y que se actualicen en todos los temas impartidos y no parcialmente. Las asesoras cumplen con un compromiso informativo, pero no cumplieron con las expectativas de adquirir conocimientos para los productores, la participacin fue ms por compromiso que por aprendizaje, por lo que en lo sucesivo es preferible contar con talleres de capacitacin para los productores ms completos, con duracin por tema de ocho horas, con un enfoque a prcticas de campo. RECOMENDACIONES Continuar con los talleres de capacitacin del PROGAN, con actualizacin de acuerdo a la zona ecolgica del pas y enfocarlos a la capacitacin de PSPPs. Establecer los criterios de seleccin del tcnico PSPP con un perfil acorde a las necesidades de capacitacin de los productores, y contar con el personal seleccionado previo a los talleres de capacitacin. Impulsar el mejoramiento gentico de ganado bovino de doble propsito en el trpico seco a partir de la gentica INIFAP, por lo que se deber ajustar un manual de acuerdo a las necesidades del PROGAN.

62

Ganadera

CAMPO EXPERIMENTAL VALLE DE CULIACN

Jefe de Campo DR. ENRIQUE ASTENGO LPEZ Biotecnologa DR. RUBN DARO GARCA PREZ M.C. SIXTO VELARDE FLIX ING. JOAQUN URETA TLLEZ Crtamo y Entomologa M.C. JESS PREZ MRQUEZ Frutales Tropicales M.C. HEIDI MEDINA MONTENEGRO Garbanzo DR. PEDRO MANJARREZ SANDOVAL DR. VCTOR VALENZUELA HERRERA BIOL. MILAGROS RAMREZ SOTO Inocuidad y Tecnologa de Alimentos M.C. MA. GUADALUPE GARCA CAMARENA Maz ING. DANIEL GONZLEZ GONZLEZ Modelos de Prediccin ING. HERLYN ASTENGO CZARES Socioeconoma ING. JAIME VALDEZ AMAYA Sorgo ING. TOMS MORENO GALLEGOS M.C. LUIS ALBERTO HERNNDEZ ESPINAL Transferencia de Tecnologa Pecuaria y Forrajes ING. ALFREDO LOAIZA MEZA ING. JUAN ESTEBAN REYES JIMNEZ ING. DANIEL GONZLEZ GONZLEZ

La serie de Publicaciones Especiales tiene como objetivo presentar a pblicos diversos, informacin derivada o motivada por un acontecimiento especial, bien sea del Instituto, de un Centro de Investigaciones o de un Campo Experimental. Tambin, en algunas ocasiones, presenta informacin de carcter tcnico, dirigida a los agentes de cambio y/o investigadores forestales, agrcolas y pecuarios. Su distribucin se realiza a instituciones de enseanza e investigacin en ciencias agrcolas, pecuarias y forestales del pas y del extranjero y a las bibliotecas de los Campos Experimentales del INIFAP. Tambin se distribuye a productores regionales, a agentes de cambio y a funcionarios del sector agrcola, pecuario y forestal. El contenido de esta publicacin podr ser reproducido total o parcialmente con fines de difusin, siempre y cuando se de el crdito correspondiente a los autores; al Campo Experimental Valle de Culiacn, al CIRNOROESTE, al Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) y a la Secretaria de Agricultura, Ganadera, Desarrollo Rural, Pesca y Alimentacin- (SAGARPA). Agradecimientos Agradecemos el financiamiento otorgado por la Fundacin Produce Sinaloa A.C. a los proyectos de investigacin cuyos resultados relevantes se presentan en esta publicacin.

COMIT EDITORIAL DEL CEVACU Presidente Dr. Enrique Astengo Lpez Secretario Ing. Toms Moreno Gallegos Vocales Dr. Rubn Daro Garca Prez Dr. Vctor Valenzuela Herrera Ing. Herlyn Astengo Czares Lic. Jaime Valdez Amaya

Compilacin Dr. Rubn Daro Garca Prez Edicin y Portada Dr. Rubn Daro Garca Prez

Esta publicacin se imprimi en febrero de 2012, en los talleres grficos de Manjarrez Impresores, S.A. de C.V., en Culiacn, Sin., Mxico, con un tiraje de 500 ejemplares.