Phytochemistry 71 (2010) 14851494

Contents lists available at ScienceDirect

Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem

Differential expression of the mango alcohol dehydrogenase gene family during ripening
Rajesh K. Singh a, Vidhu A. Sane a,*, Aparna Misra a, Sharique A. Ali b, Pravendra Nath a
a b

Plant Gene Expression Lab., National Botanical Research Institute, Lucknow 226 001, India Saia Science College Biotechnology Dept., Bhopal, India

a r t i c l e

i n f o

a b s t r a c t
Alcohol dehydrogenases play an important role during fruit ripening and aroma production. Three fulllength cDNAs (MiAdh1, 2 and 3) encoding alcohol dehydrogenases were obtained from mango fruit pulp using RT-PCR approaches. All three members displayed strong homology in the coding region when compared at the protein and nucleotide levels, however showed variations in untranslated regions. Expression patterns of these ADHs were different during fruit development and ripening. MiADH1 and MiADH2 transcripts accumulated at the onset of ripening in mango fruit whereas MiADH3 accumulated during early development of fruit. Expression analysis also indicated that mango ADHs were responsive to ethylene but regulated differently by ABA. MiADH1 was induced by ABA treatment whereas MiADH2 transcript was negatively regulated by ABA. MiADH3 did not respond to ABA in ripening fruit. Differences in substrate specicity for NADH and NADPH were also observed between the three enzymes. Total ADH enzyme activity correlated positively with increased transcript levels at the initiation of ripening. 2010 Elsevier Ltd. All rights reserved.

Article history: Received 6 March 2010 Received in revised form 18 May 2010 Available online 2 July 2010 Keywords: Mangifera indica Alcohol dehydrogenase Ripening Ethylene ABA Fruit

1. Introduction Plants produce alcohols and aldehydes by the action of alcohol dehydrogenases (EC 1.1.1.1). Alcohol dehydrogenases in plants have been encoded by small gene family comprised generally two or three members (Thompson et al., 2007), with the exception of Arabidopsis (Chang and Meyerowitz, 1986). Most of the alcohol dehydrogenases so far characterized are dimeric enzymes and belong to the medium-size zinc-containing class comprising of $370 residues. ADHs are involved in mediating stress responses in plants, mainly in anaerobiosis and other stresses like dehydration, low temperature, or chemical treatments (Matton et al., 1990; deBruxelles et al., 1996; Dolferus et al., 1994; Peters and Frenkel, 2004). ADH genes are also expressed in plant tissues in a developmentally-regulated manner, particularly during fruit ripening (Van der Straeten et al., 1991; Chen and Chase, 1993; Speirs et al., 1998, 2002; Echeverria et al., 2004) and have been shown to play a major role in avour development in ripe tomato fruit (Speirs et al., 1998) and it is suggested that low activity in the fruit could lead to reduced/altered avour (Speirs et al., 2002). Besides tomato, detailed studies related to role of Adh genes in relation to ripening and aroma synthesis are limited only to grapes and melon (Tesniere and Verries, 2000; Zaldivar et al., 2009; Delippi et al., 2009; Manrquez et al., 2006). However, in apple (Echevarria et al.,

2004) and avocado (Loulakalis et al., 2006) contrary to grape and melon, ADHs have been characterized at the biochemical level only and not at the molecular level. Mango (Mangifera indica L.) is one of the most popular fruit crops of tropical and sub-tropical regions. India accounts for approximately 65% of the total worldwide mango production and boasts of 1000 or more cultivars that differ in fruit size, shape, colour, aroma, taste and ripening patterns (Salvi and Gunjate, 1988). Mono- and/or sesquiterpene hydrocarbons are the major constituents of Indian mango cultivars but other volatiles like alcohols, aldehydes, esters, furanones and lactones which vary in qualitative and quantitative terms in different cultivars (Pandit et al., 2009) are also responsible for the distinct avour and taste of different mango cultivars. Despite the diversity in avour and aroma, mango is poorly worked out at molecular level with respect to aroma related genes. In the present study, we isolated and analyzed three members of ADH gene family from mango fruit and show that inspite of the high sequence homology shared by these genes they are expressed differentially and are regulated by different cues. 2. Results 2.1. Identication, sequencing and phylogenetic analysis of mango alcohol dehydrogenases Three mango alcohol dehydrogenases designated as MiADH1, MiADH2, and MiADH3 were cloned using mango fruit pulp cDNA as template. Nucleotide sequence identity amongst these three

* Corresponding author. Tel.: +91 522 2297959; fax: +91 522 2205839. E-mail address: sanevidhu@rediffmail.com (V.A. Sane). 0031-9422/$ - see front matter 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.phytochem.2010.05.024

1486

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

alcohol dehydrogenases was in the range of 7090%. The 30 UTR of the three genes also shared a lot of sequence identity. MiADH1 (147 nt) had 70% sequence identity with MiADH2 and MiADH3 for 30 UTR (Fig. 1A) while MiADH2 (180 nt) and MiADH3 (129 nt) had a common 30 UTR up to a region of 129 nt. However, MiADH2 had an extension of 51 nt in its 30 UTR that was absent in MiADH3. The encoded putative proteins of MiADH1 (382 aa), MiADH2 (382 aa) and MiADH3 (379 aa) belonged to medium chain zinc ADHs. MiADH3 had a nine-base deletion near the 50 end, which resulted in a three amino acid residue shorter polypeptide (Fig. 2a). Most of the residues in the ORF of these ADHs were identical. All three proteins had a predicted molecular mass of 41 kDa and isoelectric points of 6.3 (MiADH1), 6.1 (MiADH2) and 5.86 (MiADH3), based on bioinformatic analysis (EXPASY). All the three MiADH proteins contained features that were essentially conserved with medium-chain alcohol dehydrogenases. Comparison of these proteins with other medium-chain alcohol dehydrogenases revealed that the positions of cysteines and histidine residues involved in the binding to the two zinc atoms (C-48, -178, H-70 and C-100, 103, 106, 114 for MiADH1, MiADH2 and C-45, -175, H-67 and C97, -100, -103, -111 for MiADH3) were conserved (Eklund and Ramaswamy, 2008; Yokoyama and Harry, 1993). The amino-acid residues implicated in the specicity towards NAD+ as co-factor in the dehydrogenase reaction viz. T-182, V-207, D-227 were also found to be conserved in mango fruit ADHs (Jornvall et al., 1987). A phylogenetic tree was generated from the alignment of the deduced amino acid sequences of three mango ADHs with 31 homologues from other plant species using a short chain ADH (SDR) of Chlamydomonas reinhardtii as outgroup (Fig. 2B). MiADH1, MiADH2 and MiADH3 aligned within the same sub-lineage group. 2.2. Structural organization of MiADH genes Because of the high sequence conservation in the cDNA of these three Adhs, we also studied the genomic sequences. The genomic sequences of the three ADH genes mango varied in length from the initiation codon to termination codon (MiAdh1-3549 bp, MiAdh2-3428 bp and MiAdh3-2539 bp, respectively). Both MiAdh1

and 2 were composed of 10 exons and nine introns as reported for other plant Adhs. MiAdh3, however, was made up of nine exons and eight introns (Fig. 1B). The rst intron (after 37 nucleotides from the initiation codon in MiADH1 and 2) was absent from MiADH3 leading to a larger exon of 165 nt in MiADH3. Except for this, other exons were of identical sizes and conserved in location in all the three MiADHs. The intron sizes varied generally from 79 to 981 bp (Fig. 1B). Intron 1 was the longest in both MiADH1 and 2 (981 bp in MiADH1 and 865 bp in MiADH2). Sequence analyses suggested that intron sequences of MiADH2 and 3 shared greater similarity with each other than with MiADH1. 2.3. Differential transcript accumulation of mango ADHs during ripening Transcript accumulation of different ADHs in mango was studied during the course of ethylene induced ripening of harvested mango for 7 days. A basal level of expression of MiADH transcript was detected in case of all the three ADHs on day 0 in ethylene untreated fruit. The transcript levels of MiADH1 shot up after 24 h in ethylene treated fruit, however, from day 2 onwards levels of MiADH1 transcript decreased from day 1 levels and were then maintained throughout the progression of ripening (Fig. 3A). The expression of the other two ADH genes was low compared to MiADH1 although the pattern of transcript accumulation of MiADH2 and 3 was similar to that of MiADH1. Of the three MiADH3 transcript showed the lowest steady state levels during the course of mango ripening. Since these three ADHs showed very high sequence identity even at nucleotide level, we checked the expression of these transcripts by semi-quantitative PCR at high annealing temperature using gene-specic primers to ensure that the transcript patterns were not due to cross hybridization. MiADH3 transcript levels were low and did not give clear results when 20 cycles of PCR were carried out as in case of MiADH1 and 2. So for all semi-quantitative experiments related to MiADH3, 35 cycles of PCR were carried out. Our results of semi-quantitative PCRs matched with the northern analysis (Fig. 3B) and conrmed that all the three ADHs are expressed at different levels during

Fig. 1A. Nucleotide sequence alignment for 50 and 30 UTR of three MiADHs cDNA.

Fig. 1B. Schematic diagrams of the structure of three MiADH genes. Black boxes represent exons and empty boxes represent introns. ATG and TAG indicate the initiator codon and stop codons, respectively.

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

1487

Fig. 2A. Amino acid sequence comparison among MiADH13. Identical amino acids are shaded in black, and similar amino acids are shaded in gray. Sequences were aligned using Clustal W program and presented using BOX shade program.

mango softening. The expression was also checked in 1-MCP + ethylene treated fruits. All the three MiADHs showed transcript accumulation in 1-MCP treated fruits but the levels were far lower compared to the levels in ethylene treated fruits especially on day 1 post treatment (Fig. 3C and D). Since the patterns were same in northern blots and semi-quantitative PCR experiments, further studies were carried out using semi-quantitative PCR. The expression patterns of MiADH1, 2 and 3 were also analyzed in developing fruit (developmental stages D1D4, as described in Experimental), ower and vegetative tissues like leaf and stem. Basal levels of MiADH1 were observed in developing fruit. The levels were similar to those found in fully mature green mango. The transcript was absent in leaf and ower but expressed in stem. MiADH2 transcript expressed at basal levels in different stages of developing fruit and was also expressed in leaves. Unlike MiADH1 and MiADH2, expression of MiADH3 was high throughout the progression of fruit development and expansion. Moreover, MiADH3 was also specic to fruit as no transcript was found in vegetative tissues (Fig. 4A). Since mango is a climacteric fruit which requires ethylene for initiation of ripening, we checked whether these three ADHs are regulated by ethylene. Exposure of mature green unripe fruits to short interval ethylene treatment (0.5, 1.5, 3 and 5 h ethylene exposure) caused a rapid increase in transcript accumulation of MiADH1 and MiADH2 within 30 min of ethylene exposure. Ethylene induction of MiADH2 expression was also observed in mango leaves. However, ethylene had no effect on the transcript accumulation of MiADH3 even after 5 h exposure (Fig. 4B).

Since ripening is also affected by other hormones like ABA and IAA, we studied the regulation of these genes in fruits by treatment with hormones like ABA (Parikh et al., 1990) and IAA in combination with or without ethylene. The real time qRT-PCR results revealed that MiADH1 was induced by ABA as in case of ethylene (though fold expression was lower in case of ABA) and co-treatment of fruits with ethylene and ABA increased the levels of mRNA over and above those by either of the hormone alone on day 1. In contrast, ABA treatment strongly repressed MiADH2 and even basal expression was lost after 1 day of ABA treatment. However, cotreatment with ethylene was able to overcome the inhibitory effect of ABA although transcript levels did not reach the same levels as in only ethylene treated fruits (Fig. 5). MiADH3 seemed to be insensitive to treatment with ABA/ethylene and continued to be expressed at a basal level. None of the three ADHs were signicantly affected by auxin (IAA), however, ethylene-IAA cotreatment resulted in higher expression as compared to treatment with auxin alone (Fig. 5). 2.4. ADH activity in fruit Considering the ripening related increase in ADH transcripts, we measured ADH activity in Dashehari fruit extracts during the course of ripening with acetaldehyde as a substrate in the presence of NADH or NADPH. The fruit activity was higher in the presence of NADPH than NADH (Fig. 6). The NADPH dependent activity increased almost fourfold on day 1 post ethylene treatment and continued to be maintained at those levels until day 5. Thereafter on

1488

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

in ripening, on day 5 and day 6 a new slow migrating form appeared (Fig. 6C). The activity of all these forms increased with the progression of ripening. Since ADHs can exist in dimeric homo and heteromeric forms, it is difcult to speculate which forms are being expressed during mango ripening. Since in gel assays did not give much information on three MiADHs, we expressed recombinant pET-28a:MiADH1, pET-28a:MiADH2 and pET-28a:MiADH3 in a heterologous system [Escherichia coli BL21 (DE3)]. Recombinant proteins expressed after IPTG induction at 16 C in the soluble fraction were analyzed on SDSPAGE. For all the three pET28a:MiADH constructs the presence of an additional band in soluble extracts was revealed by Coomassie staining when compared to the non-recombinant control pET-28a. Purication of the recombinant proteins by NiNTA columns resulted in single band of approximately 46 kD (ADH and His tag; Fig. 7A). To see if these three puried recombinant MiADHs were active, in gel and in vitro activity assays were performed. In gel assays using NADP+ and ethanol resulted in single activity band of approximately 180 kD in all the three cases (Fig. 7B). In vitro assays carried out with three puried ADH proteins for acetaldehyde and ethanol. MiADH1 and MiADH3 preferred NADPH (acetaldehyde) whereas MiADH2 showed greater afnity towards NADH as substrate (Fig. 8). Our results suggested that though MiADH enzymes function both in forward and reverse directions they prefer reduction of acetaldehyde to ethanol under in vitro conditions (Fig. 8).

3. Discussion At the onset of ripening the vast array of volatile compounds produced by fruits are responsible for their avour and aroma characteristics (Dudareva et al., 2004). Although the pathways for aroma biosynthesis have not yet characterized in detail, alcohol dehydrogenases have been implicated in formation of aroma related alcohols (Speirs et al., 1998). The presence of more than 1000 varieties of mango that differ in aroma makes mango an interesting system for study of aroma and led us to characterize ADHs in mango for their role in ripening. Our results suggest the existence of at least three different ADHs in mango fruit that share high homology at nucleotide and amino acid level in the coding region. Despite this, the promoter regions of these genes were divergent suggesting that the three ADH genes might be under regulation of different signals. The genes are clubbed with medium chain dehydrogenases from dicot plants. As in mango, the existence of multiple ADHs had also been reported from other fruit plants. These include two ADH genes from melon, three in tomato and four in grape (one of which is probably a pseudogene). Of the three tomato genes, LeADH2 was expressed in ripening fruit (Longhurst et al., 1994) while the rest were expressed in anthers (Ingersoll et al., 1994). Two melon ADH genes (Cm-ADH1, Cm-ADH2) expressed during fruit ripening although these belonged to different ADH-subfamilies (Manrquez et al., 2006). Of the three functional grape ADHs, VvADH1 and VvADH3 were prominently expressed during fruit development whereas VvADH2 expressed mostly during ripening. In mango, all three ADHs were expressed in fruit during ethylene induced ripening although their relative transcript levels varied a lot. The expression of all three mango ADHs showed a rapid but transient increase on day 1 post ethylene treatment followed by a decrease in subsequent days particularly in MiADH2 and MiADH3. These results are quite similar to those of melon where both the genes showed a transient but sharp increase on 39 DAP when ethylene production was at maximum and declined thereafter. Although MiADH1 also showed a decrease in subsequent stages, it continued to remain at much higher levels as compared to MiADH2 and MiADH3. The expression was ethylene regulated and ripening related as evident from the decrease in

Fig. 2B. Phylogenetic analysis of mango ADHs amino acid sequences with other Adhs sequences belonging to the medium-chain zinc-binding type. Full-length protein sequences were aligned using CLUSTAL-W and a phylogenetic tree was constructed using PHYLIP with the PROTPARS program. Numbers above the branches indicate bootstrap values (1000 replicates). Chlamydomonas reinhardtii CrSdr was used as out group. Sequences are: Arabidopsis thaliana At-ADH1 (NP_177837.1); Brassica oleracea BoAdh (AAF23532.1); (EDO98712.1); Citrus x paradisi CpAdh (AAY86033.1); Cucumis melo CmAdh1 (ABC02081.1) and CmAdh2 (ABC02082.1); Fragaria x ananassa FaAdh (CAA33613.1) and FaSdh (BAF75466.1); Lotus japonicus LjAdh (CAG30579.1); Malus domestica MdAdh (CAA88271.1); Medicago truncatula MtAdh (ACJ84419); Nicotiana tabacum NtAdh (CAA57446.1); Petunia x hybrida PhAdh2 (AAO74898.1); Pisum sativum PsAdh (P12886.1); Populus trichocarpa PtAdh (XP_002328464.1); Ricinus communis RcAdh (EEF36243.1); Solanum lycopersicum SlAdh2 (CAA54450.1) and SlAdh1 (AAB33481.2); Solanum tuberosum StAdh (CAA37333.1); Vitis vinifera VvAdh1 (AAG01381.1), VvAdh2 (AAG01382.1), VvAdh3 (AAG01383.1) and VvAdh6 (AAF44335.1).

day 6 it increased another two folds in ethylene treated fruit. An increase in activity in 1-MCP treated fruit was also observed on day 1. However, this increase was much less than ethylene treated fruits rising only up to 60% of activity in ethylene treated fruit. Thereafter there was a gradual increase in activity up to day 6 (Fig. 6B). In contrast to the NADPH dependant activity, the NADH dependant activity did not show any major change until day 5. On day 6, however, there was a sudden fourfold increase in activity only in ethylene treated fruit (Fig. 6A). We also checked the ADH isozymes during progression of ripening on native PAGE gel by activity staining. Two major and one minor (between slowest and fastest bands) isoforms appeared from day 1 onwards. Late

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

1489

Fig. 3. mRNA abundance of MiADH1, 2 and 3 during different stages of ripening in mango. (A and B) MiADH1, 2 and 3 accumulation during different stages of ethylene induced ripening of mango by northern blot analysis and semi-quantitative PCR, respectively. E0E6 indicate days after ethylene treatment. (C and D) Transcript abundance of MiADH1, 2 and 3 in 1-MCP treated fruits by northern blot analysis and semi-quantitative PCR, respectively. M1M6, days after treatment. The ethidium bromide stained ribosomal RNA bands in panels A and C are shown to indicate RNA loading. Actin was used as an internal control in panel B and D. All the treatments have been described in Section 5.4. For MIADH1 and 2, 20 PCR cycles and for MiADH3, 35 cycles of PCR were carried out for semi-quantitative PCR.

ADH1 ADH2 ADH3 actin

Fig. 4. Transcript abundance of MiADH1, 2 and 3 in vegetative tissues and ethylene inducibility of genes. (A) mRNA abundance of MiADH1, 2 and 3 in developing stages of mango fruit (D1D4) and other tissues. F, ower; L, leaf; S, stem; E1, day 1 post ethylene treated fruit. Stages and treatment is described in Section 5.1. (B) mRNA abundance of MiADH1, 2 and 3 in mature green fruit after treatment with ethylene for a short period (05 h) and also in ethylene treated leaves. Mature green fruit were exposed to ethylene for the time intervals described in the gure and RNA isolated from the samples. Expression analysis was carried out by semi-quantitative PCR using actin as an internal control.

20

control Eth

12

2.5 2

Fold Expression

16 12 8

ABA ABA+Eth IAA IAA+Eth

8
1.5 1

4
4 0
0.5

D1

D3

D6

D1

D3

D6

D1

D3

D6

Fig. 5. Fold expression of MiADH1, 2 and 3 in Dashehari fruit after different hormonal treatments during 6 day time course post treatments. Auxin and ABA (100 lM) treatments were given for 3 h as described in materials and methods section. Expression analysis was carried out by real time qRT-PCR as described in Section 5. For each gene, the relative abundance of mRNA was normalized against the actin gene in the corresponding samples.

transcript levels in fruit treated with 1-MCP. This is similar to the ripening related expression observed in LeADH2 in tomato (a climacteric fruit) and VvADH2 in grape (a non-climacteric fruit). However, unlike LeADH2, where expression increased after 24 h of ethylene treatment, MiADH1 and MiADH2 showed a rapid and early ethylene response within 30 min. The expression pattern of MiADH3 suggest a possible role in fruit expansion/development. We also studied the effect of ABA and IAA in MiADH expression.

Abscisic acid (ABA) has been shown to induce alcohol dehydrogenase gene (ADH) expression in Arabidopsis roots (deBruxelles et al., 1996) and isolated mature aleurone layers (Macnicol and Jacobsen (2001), as well as during stress (Kato-Noguchi, 2000)). ABA treatment increased ADH expression. The promoters of these ADHs have been shown to have ABA response motifs. However, to the best of our information, there are no reports on effect of ABA or IAA on ripening specic ADHs. Promoter analysis of the

1490

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

ethylene

ethylene

Adh activity molemin-1g-1fw

15 10 5 0

1-MCP

Adh activity molemin -1g-1fw

40 30 20 10 0 1 2 3

1-MCP

3 4 Days

4 5 Days

C
Fig. 6. Total ADH activity during progression of ripening in Dashehari mango. 16 represent days post ethylene treatment. Enzyme activity was measured with 5 mM acetaldehyde as a substrate in the presence of 0.25 mM NADH (A) or NADPH (B). Activity is expressed in lmol min1gfw1 1 as the mean SE of three replications. (C) In gel ADH activity during progression of ripening (post ethylene treatment) in Dashehari mango. Protein extraction and in gel assay on 10% native PAGE was carried out as described in Section 5.5.

Purified MiADH1

Purified MiADH2

Purified MiADH3

Pet28a:MiADH1

Pet28a:MiADH2

Pet28a:MiADH3

Adh Activity mol/min/ g protein

10 8 6 4 2 0

Marker

130 kD 55kD 40kD 35kD 25kD

Pet28a

46kD

NAD

NADH

NADP

NADPH

Fig. 7A. Electrophoresis proles of bacterial proteins with (containing mango ADHs) or without recombinant plasmids as observed on SDSPAGE (10%). Proteins were detected by Coomassie staining. Lane 1, marker; Lane 2, total cell proteins from E. coli pET-28a; Lane 3, total cell proteins from pET-28a:MiADH1, Lane 4, column puried MiADH1; Lane 5, total cell proteins from pET-28a:MiADH2; Lane 6, column puried MiADH2; Lane 7, total cell proteins from pET-28a:MiADH3; Lane 8, column puried MiADH3. The numbers on the left indicate molecular weights in kD of the marker proteins.

Fig. 8. In vitro ADH activity of puried recombinant mango ADH proteins in forward and reverse directions. Enzyme activity was measured with 5 mM acetaldehyde as a substrate in the presence of 0.25 mM NADH or NADPH and also with 5 mM ethanol as a substrate in the presence of 0.25 mM NAD+ or NADP+. Activity is expressed in lmol min1 lg1 protein as the mean SE of three replications.

Marker

1 2 3

243 kD

43 kD 20 kD

Fig. 7B. In gel ADH activity of puried recombinant MiADH proteins. Protein extraction and in gel assay on 10% native PAGE was carried out as described in Section 5.5. First three lanes of the gel show native PAGE protein Markers. 1, 2, 3 indicate puried MiADH1, 2 and 3, respectively.

three mango ADHs (data not shown) suggested the presence of ABA responsive ABRE motif (Gomez-Porras et al., 2007) in the promoter of MiADH1. Real time qRT-PCR analysis of MiADHs in response of ABA suggested that MiADH1 and MiADH2 are regulated in contrast-

ing manner by ABA with MiADH1 being induced and MiADH2 being repressed by ABA. The combined action of ethylene and ABA increased MiADH1 expression over and above either of the hormones indicating that both the hormones activated the gene by mechanisms that are independent of each other. In case of MiADH2 ethylene was able to override the inhibitory effect of ABA when applied in combination with it indicating that ethylene acted downstream of ABA or was in some manner able to repress ABA action. Auxin also plays a role in fruit development and ripening. Trainotti et al. (2007) showed that there was an active crosstalk between auxin and ethylene that was important for the regulation of ripening. Similarly in tomato, thorough characterization of a set of auxin-resistant mutants dgt, led Balbi and Lomax (2003), to propose a cross-talk model of auxin responsiveness and ethylene biosynthesis at very early stages of tomato fruit development. However, in case of mango, auxin did not induce ripening in mature fruit as done by ethylene. All the three MiADHs were expressed at basal level under auxin treatment but did not appear to be signicantly regulated by IAA. In silico promoter analysis of the three genes revealed the presence ethylene responsive GCC like box besides the ABA responsive ABRE motif (Gomez-Porras et al., 2007) in the promoter of MiADH1. ERE motifs have been reported in Arabidopsis AtADH1 (Peng et al., 2001) and LeADH2 (tomato) and VvADH2 (grape) promoters have been shown to be responsive to ethylene treatment (Tesniere et al., 2004; Verries et al., 2004). These elements were not detected in the partial promoters of

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

1491

MiADH2 and MiADH3. A complex interplay of hormones is known to affect fruit development and ripening with auxin and GA being important during fruit expansion and ABA and ethylene for ripening (Srivastava and Handa, 2005). In Dashehari mango, additional complexities are seen due to differential ripening patterns within the fruit. Ripening is initiated from the stone and moves gradually towards the peel and is earlier near the pedicel and later at the bottom. The differential spatial regulation of ripening by hormones may selectively affect the expression of one or the other ADHs. It also needs to be work out whether the contrasting effects of ABA on MiADH1 and MiADH2 help in maintaining the net levels of ADH in fruit during ripening. These results indicate a complex hormonal regulation of the genes during fruit development and ripening. Interestingly, when ADH activity was analyzed in vitro and by in gel assay in mango fruit extracts, it revealed an increase during progression of ripening and softening. The mango fruit activity was higher in the presence of NADPH than NADH as reported for melon and olive ADHs (Manrquez et al., 2006; Salas and Sanchez, 1998). The sudden increase in ADH activity in presence of NADPH on day 1 matches the transcript patterns of MiADH1 and MiADH2. However, the second peak in activity on day 6 (which is observed in NADPH as well as NADH) does not correlate with the transcript patterns of any of the three mango ADHs indicating that other ADH(s) that utilize either NADPH or NADH or both may be activated at late ripening stages. Studies on recombinant proteins also indicate that MiADH1 might be active during initial ripening as it showed preference for NADPH. Previous studies have shown that aroma associated ADHs are mainly NADPH dependent while those associated with stress preferably use NADH. However, presence of two NADPH- and NADH-dependent ADHs in strawberry receptacle with broad substrate specicities has been shown by Mitchell and Jelenkovic (1995). The group observed that NADH-dependent ADH showed higher activity against branched alcohols and nonaromatic aldehydes and an increase in activity during ripening, which was correlated with characteristic aroma of strawberry. The selective increase in NADPH dependent ADH activity (which is correlated with MiADH1 and 2 transcript patterns) indicates that these ADHs might be related to aroma development in fruit. Since fruit pulp deterioration begins on day 6 only in ethylene treated fruit but not as much in control or 1-MCP fruit, the changes associated with this deterioration may be perceived as stress and may activate stress related ADHs (as evident from a sudden increase in NADHdependent ADH). The deterioration of the fruit is also associated with changes in avour and aroma that might explain the increase in NADPH activity. Speirs and co workers tested the relationship of ADH activity and fruit ripeness/softness in six different cultivars of tomato and showed that ADH activity was directly correlated with the rate of softening and suggested that increased ADH activity during softening might be a function of decreasing internal oxygen concentration (Speirs et al., 2002). In gel activity shows the appearance of two forms of ADH on day 1 that may possibly represent MiADH1 and 2 or a combination of both. The levels of these forms increase dramatically on day 6 along with the appearance of an additional band. This may represent the NADH-dependent ADH. 4. Conclusion In this paper, we demonstrated that three mango ADH isogenes, although exhibiting high sequence homology, are expressed differentially during fruit development and ripening. The three isoforms respond differently to other hormones like ABA and IAA in addition to ripening related hormone ethylene suggesting distinct metabolic roles for these genes. Differential ADH expression at transcript and activity levels suggests tight adaptation of the fruit to the developmental events. Further studies related to promoters

of these MiADHs will lead to understanding of regulation of these genes at different time points and under different stress conditions. 5. Experimental 5.1. Material and treatments All the experiments were carried out with Dashehari mango (M. indica). Mature unripe Dashehari mangoes (1215 cm long with a hard stone) were harvested from a local mango orchard at Lucknow. Ripening was initiated by exposing the fruits to exogenous ethylene (100 ll/l) for 24 h in a closed 10 L chamber and then allowed to ripen for 6 days at 23 C in air only (Sane et al., 2005). Pulp tissue was harvested every 24 h, frozen in liquid nitrogen and stored at 70 C until further use. For short duration ethylene treatment, mature unripe mangoes were exposed to ethylene (100 ll/l) and pulp tissue was collected at time intervals of 30, 60, 90 min, 3 h and 5 h. Fruits that were allowed to undergo post-harvest ripening in air for 6 days without any exogenous ethylene treatment were treated as control and pulp tissue harvested as mentioned earlier (Sane et al., 2005; Chourasia et al., 2006). For 1-methylcyclopropene (1-MCP) (an ethylene perception inhibitor) treatment, mature unripe fruits were exposed to 100 ll/l 1-MCP for 12 h followed immediately by 100 ll/l ethylene treatment for 24 h and then kept at 23 C in air as in earlier cases. Four stages of developing fruit D1 (11.5 cm), D2 (3 cm), D3 (6 cm) and D4 (10 cm) were also included in the study along with leaf, ower and stem tissues for expression analysis. For ABA and IAA treatment, fruits were dipped in a solution containing 100 lM ABA or IAA in 0.2% teepol (detergent) and vacuum inltrated for 2 h. Control fruits were inltrated with 0.2% teepol. 5.2. RNA extraction, reverse transcription-PCR and sequencing RNA was extracted from various tissues using cetryl trimethyl ammonium bromide as described by Chourasia et al. (2006, 2008). RNA from day 4 ethylene-treated mango pulp (treated with RNase free DNase) was used for cDNA synthesis. Reverse transcription was carried out using 30 RACE with the adapter primer (30 AP: 50 GGCCACGCGTC GACTAGTACTTTTTTTTTTTTTTTTT-30 ) and MuMLV reverse transcriptase (MBI, Fermentas) according to manufacturers instruction. To amplify the Adh gene fragment from mango, degenerate primers AdhF1 (50 -GAR GCW GSA GGB ATW GTG GAR AGT GT-30 ) and AdhF2 (50 -GGV ACT TCC ACA CCT TCA GYG ART ACA-30 ) and AdhR1 (50 -CTY CKR TCV ACH CCD CCA TYN GTC AT-30 ) AdhR2 (50 GAY YGT KGC WCC TTC HGC ARC MGC AAG-30 ) were designed. PCR-amplied fragments were cloned in pTZ57R/T vector using the InsT/A cloning Kit (MBI, Fermentas). Sequencing was outsourced to MWG DNA sequencing services, Germany. Gene-specic primers were designed for 30 RACE (AdhF3 and AdhF4) based on the sequence of partial clone and these in combination with 30 AP primer were used to obtain the 30 end. To get the upstream sequence of MiAdh1, SMART RACE cDNA amplication kit (Clontech Laboratories, Inc., Palo Alto, CA) was used. cDNA was prepared by reverse transcription using the 30 AP along with the (SMART) primer (50 AAGCAGTGGTAACAACGCAGAGTACGCGG G-30 ). Fragments were amplied using this cDNA and two genespecic primers AdhR3 (50 -CAGTGAACACAGGAAGAACATGGTCTC-30 ) and AdhR4 (50 -AGATCAGTTACACCTTCCCCTACACTCC-30 ). Amplied 50 RACE product was cloned and sequenced. These partial fragments were then joined to get a composite sequence. Two specic primers (F0 and R0) were synthesized out of the composite sequence to amplify the full-length cDNA fragment of 1155 bp fragment designated as MiAdh1 (Ac. No. GU233766). MiAdh2 was obtained using AdhF4 and 30 AP primer. This fragment differed in

1492

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

sequence from the MiAdh1 sequence and specic primers (Adh2R2 and Adh2R3R) were designed for extension towards 50 end. A gene specic primer MiAdh2F0 was then designed based on the sequence of this Partial fragment and along with AdhR0 resulted in full length MiAdh2 ORF (Ac. No. GU233767). In the process of obtaining genomic sequence of MiAdh1 by genome walking in combination with genome walker adapter primers (AP1 and AP2), we obtained MiAdh3 partial sequence. For this a genome walker library was constructed using Universal genome walker kit (Clontech) according to manufacturers protocol. Based on the genomic sequence, gene specic forward Adh3Fo primer (containing rst ATG codon) was designed and used in combination with 30 AP to get the cDNA fragment containing the entire ORF and 30 UTR for MiAdh3 (Ac. No. GU233768). The genome walker library was also used to isolate promoter of MiAdh1, 2 and 3 (GU233769, GU233770, GU233771, respectively) using gene-specic primers and genome walker adapter primer AP1 and AP2. Sequences of all the primers used for amplication of different ADH genes are given in Table 1. 5.3. Sequence analysis Homology searches and signal peptide predictions were performed using the Basic Local Alignment Search Tool (BLAST, NCBI Bethesda, MD) and SIGNALP version 1.1 (Center for Biological Sequence Analysis, Technical University of Denmark) respectively. Multiple alignments were carried out using CLUSTALW program. Phylogenetic analyses of putative mango ADH proteins were carried out using Phylip 3.5c package employing parsimony and bootstrap analysis (100 replicates). Promoter analysis was carried out by PLANT CARE program. 5.4. Northern analysis and semi-quantitative PCR and real time PCR Total RNA was isolated from mango pulp from control (ethylene untreated), different days post ethylene treated fruit and 1-MCP treated fruit. RNA from fruit pulp from different developmental stages and vegetative tissues were also isolated. RNA gel blot analyses were carried out as previously described (Sane et al., 2005). Total RNA (40 lg) from each sample was resolved on a 1.2% formaldehyde agarose gel as described by Sambrook et al. (1989) and modied in the Qiagen Oligotex handbook (2002) protocol for RNA electrophoresis. RNA was transferred to Hybond-N nylon membrane (Amersham-Pharmacia, Biotech, UK). Blots were prehybridized at 42 C for 68 h in hybridization buffer (50% formam-

ide, 6X SSC, 5X Denhardts solution, 0.1% SDS and 100 lg/mL denatured calf thymus DNA). An 1149 bp long MiAdh1 cDNA fragment containing complete ORF was labeled with a 32P-dCTP using random priming method and used as a probe for northern blots (Sambrook et al., 1989). Other probes were prepared using the part of ORF and 30 UTR of each gene. This included a region of 1120 bp for MiAdh2 and 1269 bp for MiAdh3. Hybridization was carried out overnight at 42 C in hybridization buffer containing the radiolabeled probe. The autoradiograms were developed after exposing the blots to X-ray lms (Fuji) at 70 C for 34 days. Hybridization experiments for each gene were replicated at least twice with different RNA samples. Since the nucleotide sequences within the ORF of these three ADHs were highly homologous, transcript analysis was also carried out by semi-quantitative PCR. For this, semi-quantitative PCR was carried out using cDNA prepared from 500 ng DNA free RNA from different fruit and vegetative tissues. PCR was performed using the gene-specic primers for each gene and actin as an internal control. Twenty cycles were carried out for MiADH1 and 2 and 35 cycles for MiADH3. Care was taken in designing primers so that the amplication was gene specic (data not shown). Real-time qRT-PCR was performed in a 20 ll reaction volume using SYBR GREEN PCR Master Mix (PE-Applied Biosystems, Foster City, CA, USA) on an ABI PRISM 7000 sequence-detection system according to manufactures instructions. RT-PCR conditions were as follows: 50 C for 2 min, followed by 95 C for 10 min, then 40 cycles of 95 C for 15 s and 60 C for 1 min. All RT-PCR experiments were run in triplicate. For each sample, a Ct (threshold sample) value was calculated from the amplication curves by selecting the optimal DRn (emission of reporter dye over starting background uorescence) in the exponential portion of the amplication plot. Relative fold differences were calculated based on the comparative Ct method using the actin as an internal standard. To determine relative fold differences for each sample in each experiment, the Ct values for all MiADH genes were normalized to the Ct value for actin and was calculated relative to a calibrator ([Control day 0 unripe fruit (C)] for all the ADHs) using the formula 2DDCt. 5.5. Protein extraction and enzyme activity One gram of frozen pulp tissue from different stages of ripening was used for protein extraction. For each stage, tissue was pooled from three individual fruits. Three independent experiments were carried out with pooled samples. Protein was extracted as described by Kanellis et al. (1991), with slight modications. Tissues were ground to a ne powder in a pestle and mortar with liquid nitrogen and homogenized in 1 ml extraction buffer (100 mM TrisHCl, pH 8.0, 500 mM NaCl, 5 mM EDTA, 5 mM sodium dithionite, 2 mM PMSF and 10% glycerol). The homogenate was centrifuged at 10,000g for 20 min at 4 C in a Sorvall RC5C centrifuge (Sorvall Instruments Co., Inc., Newton, CT). The supernatant thus obtained was desalted through a Sephadex G-50 column (Amersham-Pharmacia, Sweden) and the desalted sample was used for enzyme assays. In vitro Adh activity was determined as described by Manrquez et al. (2006) in a substrate solution containing 5 mM acetaldehyde, 50 mM sodium phosphate buffer, pH 5.8, and 0.25 mM NADH or NADPH. For the assay, 25 ll of enzyme extract (25 lg protein) was added to 1 ml of substrate solution and incubated for 90 min at 37 C. The change in absorbance was measured at 340 nm on a spectrophotometer (Pharmacia Ultrospec 3000; Amersham Biosciences, Piscataway, NJ). Spectrophotometric readings at 0 min and after 90 min of incubation were taken for each sample. Enzyme blank and substrate blank in the reaction mixture were used as negative controls. The results were expressed in enzyme units per gram of fresh weight and one unit of the enzyme activity was dened as the amount of enzyme that

Table 1 List of primers. ADHF1 30 ADHF2 ADHR1 ADHR2 ADHF3 ADHR3 ADHF4 ADHR4 ADHF0bam ADHR0hin ADH2R1 ADH2R2 ADH2F0 ADH3F0 ADH250 F(1) ADH230 R10 ADH230 R2 ADH3Fo modied ADH3F(1) 50 GARGCWGSAGGBATWGTGGARAGTGT 30 50 GGVACTTCCACACCTTCAGYGARTACA 30 50 CTYCKRTCVACHCCDCCATYNGTCAT 30 50 GAYYGTKGCWCCTTCHGCARCMGCAAG 30 50 TGAAGCTAAGAAGTTTGGCTGCACAGA 30 50 CAGTGAACACAGGAAGAACATGGTCTC 30 50 GACAAACCTGTTCAACAGGTTATTGCT 30 50 AGATCAGTTACACCTTCCCCTACACTCC 30 50 GGATCCATGTCTAACAAAGTCGGTCAA 30 50 AAGCTTCTAATCCTCCATGCGAATGATG 30 50 GAATGCATCATCTTTGTTTGGAACACC 30 50 AACTGCAACACCCCAACCATCATGGAC 30 50 TCTTGAGGATCCATGTCTAACACAGCT 30 50 GCTGTGGGATCCATGTCTCATTGGCTG 30 50 TCTTGAAACAAAATGTCTAACAC 30 50 CAGAAGCAAAGTAGACCGGAAA 30 50 AGAAACAAAAGCACACAAAACA 30 50 TGGGATCCATGTCTCATTGGCTGTATT 30 50 TCTTCCTCATATATTGGGATTTGC 30

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494

1493

converts 1 lmol of NADH/NADPH to NAD+/NADP+ per minute under the assay conditions described. Three independent experiments were carried out for each set. For in gel experiments, desalted protein samples were separated on 10% native-PAGE in Trisglycine buffer pH 9.0 (Laemmli, 1970) at 40 mA for 90 min at 4 C. After electrophoresis, gel was stained for ADH activity using stain containing 1 M TrisHCl, pH 9.0, 1.5 mM NAD+ or NADP+, 0.25 mM NBT or MTT, 0.025 mM PMSF and 5% (v/v) ethanol (Duncan et al., 1996). Staining was carried out at 37 C for 30 45 min till the appearance of the bands. Protein was quantied as described by Peterson (1977), with BSA as a standard. 5.6. Hetrologous expression of MiADHs in bacteria The mango ADH cDNAs comprising of start codon and stop codon were amplied by specic forward and reverse primers having BamHI site. Amplied products were cloned rst in pTZ57R/T vector and sequenced. Complete ORF fragments for all the three ADHs were obtained by BamHI digestion, and ligated to pET28a (Novagen) vector to give, respectively, pET28a-MiADH1, pET28aMiADH2 and pET28a-MiADH3. E. coli BL21(DE3) cells were used for isopropyl-bthiogalactopyranoside (IPTG)-induced expression of these constructs. Recombinant bacteria and E. coli BL21 (DE3) cells transformed with pET-28a (as a control), were grown at 37 C in LB medium containing 50 lg/ml ampicillin and 30 lg/ml Chloramphenicol and induced with 0.4 mM IPTG. After an induction period of 3 h at 16 C, the cells were harvested, washed and suspended in buffer A [20 mM TrisHCl extraction buffer, pH 7.2, 0.5 mM DTT, 1 mM PMSF and 20% (v:v) glycerol]. Repetitive freeze and thaw method was applied for protein extraction. Extracts were cleared by centrifugation (12,000g, 15 min at 4 C). The over expressed proteins were puried by using NiNTA column (Banglore Genei, India) as per the manufacturers guide lines. Recombinant proteins were eluted at a concentration of 200 mM imidazole. 5 lg of total soluble protein was electrophoresed on a 12%, SDS PAGE (Laemmli, 1970). Protein (5 lg) was mixed with 2 SDS PAGE sample loading buffer [glycerol 20% (v/v), TrisCl (pH 6.8) 0.1 M, SDS 4% (w/v), DTT 0.2 M, bromophenol blue 0.2% (w/v)] and denatured at 95 C prior to loading. The electrophoresis was carried out in Mini Protean III Dual slab cell system (Bio-Rad) at constant current of 16 mA/gel. Gels were stained with coomassie blue R-250. In gel assays and in vitro assays were also carried out with puried proteins as described in Section 5.5. Acknowledgements We are thankful to Central Institute for Subtropical Horticulture, Lucknow, for the mango samples. Senior Research Fellowship provided to Rajesh K. Singh by CSIR, India is gratefully acknowledged. References
Balbi, V., Lomax, T.L., 2003. Regulation of early tomato fruit development by the diageotropica gene. Plant Physiol. 131, 186197. Chang, C., Meyerowitz, E.M., 1986. Molecular cloning and DNA sequence of the Arabidopsis thaliana alcohol dehydrogenase gene. Proc. Natl. Acad. Sci. USA 83, 14081412. Chen, A.R.S., Chase Jr., T., 1993. Alcohol dehydrogenase 2 and pyruvate decarboxylase induction in ripening and hypoxic tomato fruit. Plant Physiol. Biochem. 31, 875885. Chourasia, A., Sane, V.A., Nath, P., 2006. Differential expression of pectate lyase during ethylene induced post harvest softening of mango (Mangifera indica var. Dashehari). Physiol. Plantarum 128, 546555. Chourasia, A., Sane, V.A., Singh, R.K., Nath, P., 2008. Isolation and characterization of the MiCel1 gene from mango: ripening related expression and enhanced endoglucanase activity during softening. Plant Growth Regul. 56, 117127. deBruxelles, G.L., Peacock, W.J., Dennis, E.S., Dolferus, R., 1996. Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol. 111, 381391.

Delippi, B.G., Manriquez, D., Luengwilai, K., et al., 2009. Aroma volatiles: biosynthesis and mechanisms of modulation during fruit ripening. Adv. Botl Res. 50, 137. Dolferus, R., De Bruxelles, G., Dennis, E.S., Peacock, W.J., 1994. Regulation of the Arabidopsis Adh gene by anaerobic and other environmental stresses. Ann. Bot. 74, 301308. Dudareva, N., Pichersky, E., Gershenzon, J., 2004. Biochemistry of plant volatiles. Plant Physiol. 135, 18931902. Duncan, R., Colin, S., Bolwell, G.P., 1996. Inducible UDP-glucose dehydrogenase from French bean (Phaseolus vulgaris L.) locates to vascular tissue and has alcohol dehydrogenase activity. Biochem. J. 313, 311317. Echeverria, G., Graell, J., Lopez, M.L., Lara, I., 2004. Volatile production, quality, and aroma-related enzyme activities during maturation of Fuji apples. Postharvest Biol. Technol. 31, 217227. Eklund, H., Ramaswamy, S., 2008. Three-dimensional structures of MDR alcohol dehydrogenases. Cell. Mol. Life Sci. 65, 39073917. Gomez-Porras, J.L., Riano-Pachon, D.M., Dreyer, I., Mayer, J.E., Mueller-Roeber, B., 2007. Genome-wide analysis of ABA-responsive elements ABRE and CE3. BMC Genomics 8, 260273. Ingersoll, J.C., Rothenberg, M., Liedl, B.E., Folkerts, K., Garvin, D., Hanson, M.R., Doyle, J.J., Mutschler, M.A., 1994. A novel anther-expressed adh-homologous gene in Lycopersicon esculentum. Plant Mol. Biol. 26, 18751891. Jornvall, H., Persson, B., JeVery, J., 1987. Characteristics of alcohol/polyol dehydrogenases: the zinc-containing long-chain alcohol dehydrogenases. Eur. J. Biochem. 167, 195201. Kanellis, A.K., Solomos, T., Roubelakis-Angelakis, K.A., 1991. Suppression of cellulase and polygalacturonase and induction of alcohol dehydrogenase isoenzymes in avocado fruit mesocarp subjected to low oxygen stress. Plant Physiol. 96, 269 274. Kato-Noguchi, H., 2000. Abscisic acid and hypoxic induction of anoxia tolerance in roots of lettuce seedlings. J. Exp. Bot. 51 (352), 19391944. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277, 680685. Longhurst, T., Lee, E., Hinde, R., Brady, C., Speirs, J., 1994. Structure of the tomato Adh2 gene and Adh2 pseudogenes, and a study of Adh2 gene expression in fruit. Plant Mol. Biol. 26, 10731084. Loulakakis, C.A., Hassan, M., Gerasopoulos, D., Kanellis, A.K., 2006. Effects of low oxygen on in vitro translation products of poly(A)+ RNA, cellulase and alcohol dehydrogenase expression in preclimacteric and ripening-initiated avocado fruit. Postharvest Biol. Technol. 39, 2737. Macnicol, P.K., Jacobsen, J.V., 2001. Regulation of alcohol dehydrogenase gene expression in barley aleurone by gibberellin and abscisic acid. Physiol. Plant 111 (4), 533539. Manrquez, D., El-Sharkawy, I., Flores, F.B., El-Yahyaoui, F., Regad, F., Bouzayen, M., Latche, A., Pech, J.C., 2006. Two highly divergent alcohol dehydrogenases of melon exhibit fruit ripening-specic expression and distinct biochemical characteristics. Plant Mol. Biol. 61, 675685. Matton, D.P., Constable, P., Brisson, N., 1990. Alcohol dehydrogenase gene expression in potato following elicitor and stress treatment. Plant Mol. Biol. 14, 775783. Mitchell, W.C., Jelenkovic, G., 1995. Characterizing NAD- and NADP-dependent alcohol dehydrogenase enzymes of strawberries. J. Am. Soc. Hortic. Sci. 120 (5), 798801. Pandit, S.S., Chidley, H.G., Kulkarni, R.S., Pujari, K.H., Giri, A.P., Gupta, V.S., 2009. Cultivar relationships in mango based on fruit volatile proles. Food Chem. 114, 363372. Parikh, H.R., Nair, G.M., Modi, V.V., 1990. Some structural changes during ripening of mangoes (Mangifera indica var. Alphonso) by abscisic acid treatment. Ann. Bot. 65, 121127. Peng, H.P., Chan, C.S., Shih, M.C., Yang, S.F., 2001. Signalling events in the hypoxic induction of alcohol dehydrogenase gene in Arabidopsis. Plant Physiol. 126, 742749. Peters, J., Frenkel, C., 2004. Relationship between alcohol dehydrogenase activity and low-temperature in two maize genotypes, Silverado F1 and Adh1Adh2 doubly null. Plant Physiol. Biochem. 42, 841846. Peterson, G.L., 1977. A simplication of the protein assay method of Lowry et al. which is more generally applicable. Anal. Biochem. 83, 346356. Salas, J.J., Sanchez, J., 1998. Alcohol dehydrogenases from olive (Olea Europea) fruit. Phytochemistry 48 (1), 3540. Salvi, M.J., Gunjate, R.T., 1988. Mango breeding work in the Konkan region of Maharashtra state. Acta Horticulturae 231, 100102. Sambrook, T., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, A Laboratory Manual. Cold Spring Harbour Laboratory Press, Cold Spring Harbour. Sane, V.A., Chourasia, A., Nath, P., 2005. Softening in mango (Mangifera indica var. Dashehari) is correlated with the expression of the early ethylene responsive, ripening related expansion gene, MiExpA1. Postharvest Biol. Technol. 38, 223 230. Speirs, J., Correll, R., Cain, P., 2002. Relationship between ADH activity, ripeness and softness in six tomato cultivars. Sci. Hortic. 93, 137142. Speirs, J., Lee, E., Holt, K., Kim, Y.D., Scott, N.S., Loveys, B., Schuch, W., 1998. Genetic manipulation of alcohol dehydrogenase levels in ripening tomato fruit affects the balance of some avour aldehydes and alcohols. Plant Physiol. 117, 1047 1058. Srivastava, A., Handa, A.K., 2005. Hormonal regulation of tomato fruit development: a molecular perspective. J. Plant Growth Regul. 24, 6782.

1494

R.K. Singh et al. / Phytochemistry 71 (2010) 14851494 Trainotti, L., Tadiello, A., Casadoro, G., 2007. The involvement of auxin in the ripening of climacteric fruits comes of age: the hormone plays a role of its own and has an intense interplay with ethylene in ripening peaches. J. Exp. Bot. 58 (12), 32993308. Verries, C., Pradal, M., Chatelet, P., Torregrosa, L., Tesniere, C., 2004. Isolation and analysis of the promoter of VvAdh2, a grapevine (Vitis vinifera L.) ripeningrelated gene. Plant Sci. 167, 10671074. Yokoyama, S., Harry, D.E., 1993. Molecular phylogeny and evolutionary rates of alcohol dehydrogenases in vertebrates and plants. Mol. Biol. Evol. 10, 1215 1226. Zaldivar, C., Rivera-Cabrera, F., et al., 2009. Effect of refrigerated storage on aroma and alcohol dehydrogenase activity in tomato fruit. Postharvest Biol. Technol. 54 (2), 93100.

Straeten, D.V.D., Rodrigues, R.A., Gielen, P.J., Montagu, M.V., 1991. Tomato alcohol dehydrogenase expression during fruit ripening and under hypoxic conditions. FEBS 293, 3942. Tesniere, C., Pradal, M., El-Kereamy, A., Torregrosa, L., Chatelet, P., Roustan, J.P., Chervin, C., 2004. Involvement of ethylene signalling in a non-climacteric fruit: new elements regarding the regulation of ADH expression in grapevine. J. Exp. Bot. 55, 22352240. Tesniere, C., Verries, C., 2000. Molecular cloning and expression of cDNAs encoding alcohol dehydrogenases from Vitis vinifera L. during berry development. Plant Sci. 157, 7788. Thompson, C.E., Salzano, F.M., Norberto de Souza, O., Freitas, L.B., 2007. Sequence and structural aspects of the functional diversication of plant alcohol dehydrogenases. Gene 396, 108115.