Você está na página 1de 8

Escola Secundria c/ 3 Ciclo Joo Gonalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2)

Ficha de preparao para o Teste Intermdio - 1

_______________________________________________________________________________________
I
1. Corresponde a cada alnea das frases os termos adequados. 1.1- A molcula de DNA tem mensagens codificadas em sequncias de _____a)_____ que contm as seguintes bases azotadas: ___b)______, _______c)______, ______d)________ e _____e)______. 1.2- No mRNA, cada grupo de trs ____f)______ que codifica um _______g)______ recebe o nome de ____h)____ . 1.3- Os _____i)_______so constitudos por subunidades de tamanhos diferentes que participam na _____j)______ do ____l)_____. 1.4- Entre as duas cadeias _____m)_______ da molcula de DNA estabelecem-se ligaes _____n)_____ segundo a regra de complementaridade das ______o)______. 2. Estabelece a correspondncia entre as afirmaes da coluna I com uma letra da chave da coluna II. AFIRMAES 1- Cadeias de nucletidos. 2- Composto por uma sequncia especfica de aminocidos. 3- Contm uracilo. 4- Encontra-se no ncleo. 5- Contm citosina. 6- Encontra-se, pelo menos, em trs formas diferentes. 7- Contm ribose. 8- Estrutura de dupla hlice. 9- Capaz de autoreplicao em plantas e animais. 3. Observa a figura 1. CHAVE A- Molcula de DNA B- Molcula de RNA C- Ambas as molculas D- Nenhuma das molculas

Fig. 1

3.1- Indica o fenmeno evidenciado na figura 1. 3.2- Descreve esse fenmeno. 3.3- Indica em que organelo celular se efectua o processo referido, nas clulas eucariticas. 3.4- Explica a importncia biolgica deste processo. 4. Um gene da molcula de DNA apresenta a seguinte sequncia de bases azotadas: 5 T A C A C AT T T C G C C G G AG A A G G AT T 3 4.1- Indica a sequncia de bases azotadas da cadeia complementar da mesma molcula de DNA. 4.2- Replica a molcula de DNA referida.

Natrcia Vieira Charruadas

Pgina 1 de 8

4.3- Indica a sequncia de bases do mRNA que o gene indicado origina. 4.4- Refere o nmero de codes que o mRNA apresenta. 4.5- Apresenta a sequncia correcta dos anticodes. 4.6- Considera que no DNA de um organismo existem 30% da base azotada adenina. Refere as percentagens das restantes bases. 5. Observa atentamente a seguinte figura 2.

Fig. 2

5.1- Atribui um ttulo ao processo esquematizado na figura. 5.2- Designa as fases assinaladas por 1 e 2. 5.3- Legenda a figura esquematizada para os nmeros 1, 3, 4, 5, 6 e 7. 5.4- A molcula 6, antes de migrar para o citoplasma, sofre uma maturao que o torna funcional. Em que consiste essa maturao? 5.5- Descreve os acontecimentos que caracterizam a etapa de iniciao da fase 2. 5.6- Justifica a seguinte afirmao: A molcula 1 formada por duas cadeias de nucletidos anti-paralelas. II 1. A figura 3 representa o conjunto de etapas na clonagem de um sapo.

Figura 3
Natrcia Vieira Charruadas Pgina 2 de 8

1.1- Refere o procedimento para obter a clula que originou o sapo albino? 1.2- A informao gentica que permitiu a formao de um sapo albino teve origem: A- no vulo do sapo verde. B- no ncleo do vulo e no ncleo do girino albino. C- no ncleo da clula proveniente do girino albino. D- no ncleo do vulo do sapo verde. Selecciona a opo correcta 1.3- O sapo albino obtido constitui um clone do girino albino. Fundamenta esta afirmao. 1.4- Distingue clulas totipotentes de clulas indiferenciadas 2. Observa as figuras seguintes, relativas a processos de reproduo assexuada. 2.1. Qual das figuras, A ou B, representa um processo de: Bipartio? Gemulaao?

2.1.12.1.2-

2.2. Relativamente aos processos representados nas figuras, assinala as afirmaes verdadeiras (V) e as falsas (F). Ambos os processos contribuem para a variabilidade gentica das espcies. O processo A tambm pode ser chamado de esquizogonia. Ambos os processos contribuem para um aumento rpido das populaes. O processo B tambm pode ser chamado de gemiparidade. O processo A contribui para um aumento rpido da populao e o processo B contribui para a variabilidade gentica da espcie. O processo A tambm pode ser chamado de diviso binria. O processo B contribui para um aumento rpido da populao e o processo A contribui para a variabilidade gentica da espcie. O processo B tambm pode ser chamado de diviso simples. 3. Observa a figura 5 que representa um processo reproduo assexuada. 3.1- Identifica o tipo de reproduo assexuada representada. 3.2- Qual dos ramos, A ou B, produzir frutos: 3.2.1- da espcie 1? 3.2.2- da espcie 2? 3.3- Discute sobre as vantagens deste tipo de reproduo no ponto de vista da produo vegetal.

Figura 5

4. A diviso nuclear est na base da reproduo que conduz a propagao das espcies. Na figura 6 esto representadas algumas fases de um tipo de diviso nuclear.

Figura 6

Natrcia Vieira Charruadas

Pgina 3 de 8

4.1- Faz corresponder uma das etapas, de A a F, representadas na figura, s frases seguintes: A. Troca de pores gnicas entre cromatdeos no irmos. B. Ascenso de cromossomas homlogos para plos opostos. C Formao de clulas haplides cuja quantidade de DNA 1/4 da existente na clula-me no incio da diviso. D. Disposio dos cromossomas homlogos, na zona equatorial, com os centrmeros voltados para os plos. 4.2- Estabelece a sequncia das letras (A a F) correspondentes as fases da diviso nuclear, de modo que retratem o seu normal processamento. 4.3- Apresenta trs dados patentes na figura que justifiquem tratar-se de uma meiose. 5. A reproduo sexuada caracteriza-se pela interveno de clulas reprodutoras sexuadas, os gmetas que, por fecundao, originam o ovo. A figura 7 representa esquematicamente duas fases da meiose - A e B.

Figura 7 5. 1. Considera o esquema A da figura 6 e refere: 5.1.1- o fenmeno evidenciado. 5.1.2- a designao de cada um dos conjuntos cromossmicos formados 5.1.3- o nmero de cromatdeos de cada conjunto de cromossomas. 5.2- Legenda convenientemente o esquema B da figura 7. 5.2.1- Discute a importncia do fenmeno esquematizado em B. 5.2.2- Estabelece a correspondncia entre cada uma das afirmaes e os termos da chave: AFIRMAES O nmero de cromossomas reduzido para metade. Ocorre a formao do fuso acromtico. Ocorre a replicao dos cromossomas. A clula passa de diplide a haplide. Mantm-se o nmero de cromossomas neste tipo de diviso. Observam-se pontos de quiasma. Ocorre intensa sntese proteica. CHAVE

A - Interfase B- Diviso I da meiose C- Diviso II da meiose D- Diviso I e II da meiose.

6. A figura representa trs ciclos biolgicos - A, B e C -, evidenciando a alternncia de fases nucleares. Observa-o criteriosamente.

Natrcia Vieira Charruadas

Pgina 4 de 8

6.1- Identifica a clula representada nos trs ciclos pela letra X. 6.2- Atendendo ao nmero cromossmico de todas as clulas do ser vivo com um ciclo biolgico igual ao esquematizado em A, classifica esse organismo. 6.3- Caracteriza o ciclo biolgico esquematizado em B. 6.4 Refere um exemplo de um ser vivo com um ciclo biolgico igual ao esquematizado em C. 7. O esquema seguinte representa o ciclo de vida do polipdio. 7.1- Completa a legenda da figura para as letras A, B e C. 7.2- Assinala as afirmaes verdadeiras (V) e as falsas (F). A produz gmetas, B uma entidade multicelular diplide. C nada at oosfera. A pertence fase diplide. B uma entidade independente da planta adulta. C produz espermatozides.

III 1. Preenche os espaos das frases seguintes com o termo adequado. 1.1 Os primeiros organismos vivos que povoaram a Terra eram seres ______________. Estes seres no apresentavam ______________ membranares e o ______________ uma molcula circular simples localizada no ______________. 1.2 So dois os modelos que pretendem explicar a origem das clulas eucariticas a partir dos ______________: o modelo ______________ e o modelo ______________. 1.3 Segundo o modelo ______________, as clulas ______________ tero surgido por associao entre clulas ______________. Os ______________, por exemplo, ter-se-iam originado a partir de ______________ que possuam pigmentos fotossintticos. Estas associaes tornaram-se benficas tanto para as clulas ______________ como para as clulas - hspedes. 1.4 A progressiva ______________ morfolgica e fisiolgica dos seres ______________ conduziu ao aparecimento dos seres ______________.

2. Observa a figura que traduz uma das hipteses relativas ao aparecimento dos seres multicelulares.

2.1 Refere a designao da hiptese ilustrada. 2.1.1 Justifica a resposta anterior.

Natrcia Vieira Charruadas

Pgina 5 de 8

3. Aponta duas vantagens para os seres vivos resultantes da multicelularidade.

4. Completa o quadro seguinte, indicando para cada tipo de clula se a estrutura celular referida est presente ou no. Procarionte Estrutura Celular Parede Celular Membrana Celular Membrana Nuclear Citoplasma Ex. Bactrias Animal Eucarionte Vegetal

5. Considera o seguinte texto: Os fsseis de espcies que no existem na actualidade mostram que houve seres vivos no passado que se extinguiram. Estas formas nada tm a ver com a origem das espcies actuais. 5.1 Selecciona a opo correcta. O texto reflecte ideias: A Transformistas; B Evolucionistas; C Fixistas; D Lamarckistas.

6. Das afirmaes seguintes selecciona as que correspondem a explicaes lamarckistas: A Nos patos, os indivduos que apresentam membrana interdigital tm vantagem no meio aqutico, relativamente aos que a no tm, e por isso sobrevivem muito melhor nesse meio. B Muitos peixes desenvolveram bexiga natatria para poderem nadar melhor. C Alguns indivduos apresentam caractersticas que lhes permitem viver mais tempo e deixar mais descendncia. D Muitos mamferos desenvolveram msculos que lhes permitiram movimentar as orelhas na direco do Sol e passaram essa caracterstica aos descendentes. O Homem, como no precisa de executar esses movimentos, tem esses msculos atrofiados. E Os morcegos desenvolveram um sentido de orientao especial para se movimentarem durante a noite. F As girafas apresentam um longo pescoo porque as que de pescoo mais longo tinham vantagem na luta pelo alimento.

Natrcia Vieira Charruadas

Pgina 6 de 8

SUGESTO DE CORRECO questo


1.

Correco
1.1. a) nucletidos; b) timina; c) adenina; d) citosina; e) guanina 1.2. f) nucletidos; g) aminocido; h) codo 1.3. i) ribossomas; j) transcrio; l) mRNA 1.4. m) polinucleotdicas; n) de hidrognio; o) bases 1- C; 2 D; 3 B; 4 C; 5 C; 6 B; 7 B; 8 A; 9 A Replicao semiconservativa do DNA O processo inicia-se quando a DNA polimerase abre as duas cadeias de DNA quebrando as pontes de hidrognio que ligam as bases complementares. A molcula de DNA abre e fica assim, pronta para que se liguem nucletidos livres de DNA que se encontram no nucleoplasma. Estes ao ligarem-se por complementaridade aos nucletidos da cadeia j existente de DNA vo formar progressivamente uma nova cadeia complementar e anti-paralela. O mesmo acontece na outra cadeia da molcula-me. Quando o processo termina temos duas molculas-filhas semelhantes molcula-me e semelhantes entre si. Ncleo Permite que, antes da ocorrncia da diviso celular, o material gentico se duplique para que a quantidade de DNA seja igual nas clulas filhas. 3 ATGTGTAAAGCGGCCTCTTCCTAA 5 5 T A C A C A T T T C G C C G G AG A A G G AT T 3 3 ATA T G T A A A G C G G C C T C T T C C T A A 5

2. 3.1 3.2

3.3 3.4 4.1 4.2

Grupo I

5 T A C A C A T T T C G C C G G AG A A G G AT T 3 3 ATA T G T A A A G C G G C C T C T T C C T A A 5 4.3 4.4 4.5 4.6 5.1 5.2 5.3 5.4 5.5 5 UACACAUUUCGCCGGAGAAGGAUU 3 8 AUG UGU AAA GCG GCC UCU UCC UAA 30% Timina; 20% guanina; 20% citosina Sntese proteica 1 Transcrio; 2 Traduo 1 DNA; 3 tRNA; 4 aminocidos; 5 ribossoma; 6 mRNA; 7 polipptido/protena Consiste na remoo de sequncias de genes que no codificam informao (intres) A subunidade menor do ribossoma liga-se extremidade do mRNA; a subunidade menor do ribossoma desliza ao longo da molcula de mRNA at encontrar o codo de iniciao (AUG); o tRNA que transporta o aminocido metionina liga-se por complementaridade ao codo de iniciao; As subunidades menor e maior ligam-se. A molcula de DNA formada por duas cadeias de nucletidos que se encontram ligadas lado-a-lado, mas que crescem em sentidos opostos, pelo que se designam anti-paralelas. Clonagem C Porque no houve mistura de informao gentica. O nico dador de informao foi o girino do sapo albino, logo reproduo assexuada clonagem. Uma clula totipotente tem as potencialidades para originar todas as outras clulas. Clulas indiferenciadas so semelhantes entre si e semelhantes clula totipotente inicial que lhes deu origem. A B 1 F; 2 F; 3 V; 4 V; 5 F; 6 V; 7 F; 8 - F Propagao vegetativa artificial enxertia por encosto A B Permite conciliar vantagens de ambas as espcies envolvidas, seleccionando as

5.6

1.1 1.2 1.3 1.4 Grupo II

2.1.1 2.1.2 2.2 3.1 3.2.1 3.2.2 3.3

Natrcia Vieira Charruadas

Pgina 7 de 8

4.1 4.2 4.3 5.1.1 5.1.2 5.1.3 5.2.1 5.2.2 6.1 6.2 6.3 6.4 7.1 7.2 1.1 1.2 1.3 1.4 2.1 2.1.1 3. Grupo III

melhores caractersticas. A F; B D; C E; D A C, F, A, D, B, E 1) A ocorrncia de crossing-over (F) 2) A formao de 4 clulas filhas haplides 3) A separao de cromossomas homlogos Sinapse (emparelhamento de homlogos) Ttrada cromatdica 4 Permite maior variabilidade gentica 1 B; 2 D; 3 A; 4 - B; 5 C; 6 B; 7 A Ovo ou zigoto Diplonte Apresenta alternncia de geraes (esporfita e gametfita) e ocorre produo de esporos e gmetas. Espirogira A esporngio; B protalo; C anterdio 1 F; 2 F; 3 F; 4 V; 5 V; 6 - F Procariticos; organelos; DNA; citoplasma Procariontes; autognico; endossimbitico Endossimbitico; eucariticas; procariticas; cloroplastos; clulas; hospedeiras Diferenciao; unicelulares; pluricelulares Hiptese autognica Porque se verifica que os organismos se originam a partir de invaginaes da membrana plasmtica. Por exemplo, permite que o ser tenha maiores dimenses, mantendo-se a relao rea/volume ideal para a relizao de trocas com o meio e permite uma maior biodiversidade, proporcionando melhor adaptao a diferentes ambientes. Procarionte Estrutura Celular Parede Celular Membrana Celular Membrana Nuclear Citoplasma Ex. Bactrias Sim Sim No Sim Eucarionte Animal No Sim Sim Sim Vegetal Sim Sim Sim Sim

4.

5.1 6.

C B, D e E

Fonte: www.acessus.net

Natrcia Vieira Charruadas

Pgina 8 de 8