Você está na página 1de 13

Universidade Federal do Rio de Janeiro Centro de Cincias da Sade Instituto de Bioqumica Mdica Disciplina: Bioqumica Ff I Docente: Francisco Prosdocimi

Discentes: Carine Alves Jourdan Eliane Paiva dos Santos Letcia Godinho de Menezes Louise Paloma Luz Alves Vinicius Alves Moura

Contedo: ED2 Estudo dirigido

Rio de Janeiro 2.2012

ED2 Estudo Dirigido 1As clulas vivas possuem biomolculas altamente especializadas em determinadas funes celulares especficas. a) Quais as funes celulares principais do DNA, do RNA e das protenas?

DNA: o material gentico de todos os organismos celulares. Este material gentico responsvel pela transmisso de caractersticas hereditrias entre os seres vivos e pelo transporte da informao necessria para dirigir a sntese de protenas e sua replicao. RNA: A funo do RNA produzir protenas para exercer determinadas funes no organismo, basicamente o RNA o mensageiro da informao gentica presente no DNA. Ou seja, a informao gentica contida no DNA codifica certa protena, mas o RNA que a partir do DNA vai fazer com que seja possvel a realizao desse processo. Alm das funes de mensageiro entre DNA e os ribossomos, formador dos ribossomos, e transportador de aminocidos, os RNAs podem ainda desempenhar a funo de catlise e de regulao gnica. Protenas: So macromolculas compostas por polmeros de aminocidos extremamente importantes para o funcionamento de um organismo. Elas atuam na construo de novos tecidos; atuam no transporte de substncias, como o oxignio; atuam no sistema de defesa do organismo, neutralizando vrus e bactrias e outros corpos estranhos (Anticorpos so compostos por protenas); atuam na catalisao de reaes qumicas, como as enzimas; atuam na regulao de hormnios. As protenas encontradas na membrana plasmtica atuam como receptoras, emitindo sinais para que a clula possa desempenhar suas funes vitais. b) Por que o DNA no faz tudo sozinho, j que ele contm as informaes e comanda todo o metabolismo celular? Ou seja, por que ele precisa transformar suas informaes em molculas de protenas?

Embora o DNA seja responsvel pela existncia da vida, isoladamente ele inanimado, ou seja, no reativo e quimicamente inerte. O seu funcionamento depende de enzimas especiais que copiam suas mensagens biolgicas e as transferem para molculas muito mais geis conhecidas por RNA mensageiros. 2O DNA um polmero extremamente comprido que deve ser compactado para caber dentro do ncleo celular. a) b) c) Como acontece a compactao do DNA no ncleo? O que um nucleossomo? Quais so os diferentes graus de compactao do DNA dentro do ncleo? Existem quatro nveis de compactao da cromatina: 1) Estrutura primria Associao da dupla hlice do DNA com um grupo especfico de histonas. Duas cpias de cada uma das quatro histonas (H2A, H2B, H3, H4) constituem um octmero, em torno do qual um segmento de dupla hlice de DNA se enrola, como uma linha em torno de um carretel. O octmero circundado por duas voltas de DNA constitui um nucleossomo. Cerca de 140 bases de DNA esto associadas a cada centro de histonas. Aps um segmento de DNA curto (20 a 60 bases), forma-se o centro seguinte de complexo de DNA, e assim por diante, conferindo cromatina a aparncia de contas num cordo. Este primeiro nvel de compactao reduz o tamanho da molcula de DNA em 6 a 7 vezes. 2) Solenides A histona H1 tem papel na organizao da cromatina ocupando lugar na regio entre os nucleossomos, forando o material a outro tipo de compactao, em estruturas secundrias

helicides, denominadas solenides. O solenide corresponde compactao de 6 a 7 nucleossomos. Essa nova fibra a unidade fundamental da organizao da cromatina. O solenide capaz de condensar aproximadamente 1200 bases de DNA. 3) Alas Com a formao do solenide, tem lugar a ao de protenas no-histnicas, que formam estruturas em alas ou domnios. As alas podem ser o incio de espessamentos parecidos com ns, denominados crommeros. medida que os cromossomos se condensam mais, os crommeros adjacentes fundem-se em estruturas maiores, que depois se tornam as bandas cromossmicas. 4) Cromossomos Encontramos essas formas na metfase, quando h a maior condensao da cromatina. o enrolamento final, do qual participa a topoisomerase II. Os diferentes graus de compactao do DNA dentro do ncleo so Cadeia dupla de DNA, Filamento de cromatina e cromossomo. 3O ciclo celular consiste em um processo altamente coordenado atravs do qual uma clula entra em diviso. a) Quais so as etapas do ciclo celular?

Intrfase A interfase corresponde ao perodo entre o final de uma diviso celular e o incio da outra. Geralmente a clula encontra-se nesta fase durante a maior parte da sua vida. A interfase divide-se em trs fases: Fase G1 Nesta fase sintetizam-se muitas protenas, enzimas e RNA, verifica-se tambm a formao de organelas celulares e, consequentemente, a clula cresce. Fase S nesta fase que ocorre a auto-replicao das molculas de DNA (diz-se no plural porque para cada cromossomo existe uma molcula de DNA). A partir deste momento os cromossomos passam a possuir dois cromatdeos ligados por um centrmero. Fase G2 Neste perodo d-se a sintese de molculas necessrias diviso celular (como os centrolos). As fases G e S possuem estas denominaes em decorrncia de abreviaes do ingls G para gap (intervalo) e S para synthesis (sntese).

b)

Em qual etapa do ciclo celular o DNA deve se replicar? Na fase S da Interfase.

c)

Explique o que so as ciclinas e o que so os oncogenes e como eles devem funcionar regulados para que a clula se divida de forma organizada.

Ciclinas so protenas reguladoras, elas atuam no ciclo celular, fazendo com que o fator promotor de maturao se ative. Elas formam o complexo de protenas com a p34cdc2, a subunidade cataltica do fator promotor e molda as funes da protena quinase. As ciclinas ocorrem durante o ciclo celular, elas so sintetizadas e se ligam a p34, dessa forma ativando esta quinase. A sntese da ciclina oscila durante o ciclo celular, chegando em nveis altos durante a transio de G1, S, G2 e M. Oncogene a denominao dada aos genes relacionados com o surgimento de tumores, sejam malignos ou benignos, bem como genes que quando deixam de funcionar normalmente, transformam uma clula normal numa clula cancerosa. As verses de funo normal de oncogenes, os proto-oncogenes, so genes responsveis pelo controle da diviso celular (mitose), da diferenciao celular e da traduo proteica. Aps sofrer uma mutao gnica somtica, por exemplo, uma translocao, amplificao ou mutao pontual um proto-oncogene torna-se eventualmente um oncogene. Durante a diviso celular, usual ocorrer erros genticos durante a replicao do DNA. Erros esses que so normalmente corrigidos pela maquinaria de reparo de DNA. Quando a maquinaria de reparo de DNA falha em consertar um erro na sequncia de DNA que corresponde ao proto-oncogene, esse erro mantido, ou seja, ocorre uma mutao. Duas situaes poderiam ocorrer, considerando tal mutao: O produto proteico de um proto-oncogene continua ativo e funcional - como em uma mutao silenciosa, onde a troca da base azotada permite manter o mesmo aminocido. A mutao confere caractersticas oncognicas s protenas que antes controlavam a diviso celular. O produto proteico do que era um proto-oncogene passa a apresentar ao deficiente ou fica inativado por exemplo, por mutao que insere cdon de parada ou altera a fase de leitura do mRNA deixando de existir qualquer controle da diviso celular. Quando isto ocorre diz-se que o oncogene foi ativado.

4a)

A replicao do DNA um processo bastante complexo onde esto envolvidas diversas enzimas. Cite todas as enzimas conhecidas que esto envolvidas no processo e a funo de cada uma. DNA Polimerase, Endonuclease, Helicase, Topoisomerase, Primase, Telomerase. DNA Polimerase responsvel pela adio de nucleotdeos e reparo. Endonuclease degrada o DNA, clivando-o em pedaos menores. Helicase Separao da dupla fita.

Topoisomerase Ela catalisa uma quebra nas molculas de DNA, mas usa ligaes covalentes para segurar as molculas de DNA que foram quebradas. Primases A primase do DNA atua no incio da replicao, sintetizando o primer necessrio para comear a sntese da cadeia leading, e tambm, durante todo o processo, sintetizando os primers necessrios para o incio da sntese de cada fragmento de Okazaki. Ligases Conectam fragmentos de fitas menores.

5a)

A replicao do DNA nas chamadas forquilhas de replicao. Explique como se d essa replicao e por que este procedimento ocorre de forma diferenciada nas fitas lder e retardada.

A replicao de DNA sempre tem incio num ponto nico na molcula, caracterizado por uma sequencia de bases especficas denominado origem da replicao, a partir de onde a dupla fita se abre. As terminaes destes so pontos dinmicos, chamados de forquilhas de replicao, onde as fitas de DNA so separadas e replicadas. A replicao tem incio na origem de replicao e a partir dela continua bidirecionalmente. A replicao do DNA dita semi-consertiva, pois as 2 fitas so antiparalelas. Como a abertura da dupla fita gradual a partir da forquilha de replicao e o sentido de leitura obrigatoriamente na direo 5-----3, a sntese das duas fitas ocorre em sentidos opostos, no sendo possvel que elas fossem sintetizadas continuamente. Desta forma, uma das fitas sintetizada continuamente, sendo denominada de fita lder, enquanto a outra se faz em pequenos fragmentos, sendo chamada de fita retardada. b) O que significa dizer que a DNA polimerase apresenta atividade exonuclesica 3->5?

Significa dizer que essa atividade exonuclesica da DNA Polimerase permite que logo aps serem adicionados, os nucleotdeos sejam retirados e conferido se o seu pareamento est correto (A com T e C com G). Esta atividade chamada atividade Editorial. Ou seja, essa atividade exonuclesica tem funo no mecanismo de reparao do DNA, evitando possveis mutaes. 6a) b) . Como formada a estrutura de um gene no DNA? Alm da regio codificadora que conter o cdigo para a produo da protena, o gene tem vrias outras regies importantes para que ele seja corretamente transcrito e traduzido. Quais so essas regies? (Fale sobre promotores, acentuadores, stios de ligao ao ribossomo, etc.)

Inicialmente convm estabelecer o que entendemos por gene. Numa concepo simplista podemos admitir que um gene o segmento de DNA que codifica uma certa protena. Embora esta definiao possa ser til e vlida, ela encontra dificuldades de aplicao quando o segmento de DNA contm introns. Por outro lado, convm em muitos casos considerar as regies controladoras da expresso do gene como partes integrantes dele. Assim, a definio molecular de gene deve compreender um segmento de DNA bem maior do que o mnimo necessrio para codificar os aminocidos que fazem parte da sequncia polipeptdica. Vamos comear o caminho na direo da definio molecular de um gene pela anlise da estrutura tpica de um gene procarioto. Embora em muitos casos vrios genes estejam sob o controle de um nico sistema, formando o chamado operon, vamos aqui considerar que um nico gene est em jogo. A figura abaixo mostra um gene tpico de um procarioto.

Figura: Estrutura tpica de um gene procarioto. RBS = stio ligador de ribossomo; ATG = cdon de iniciao da sntese protica; Cds ou ORF = quadro aberto de leitura; stop = qualquer um dos trs cdons de finalizao da sntese protica; terminador = regio terminadora da transcrio

O trecho compreendido entre o cdon de iniciao da sntese proteca (usualmente ATG ou TTG) e um dos trs cdons para terminao da sntese protica (designados aqui por stop) determina a sequncia

de aminocidos do polipeptdeo final, produto do gene. Este trecho frequentemente designado como quadro aberto de leitura (ORF = open reading frame) ou sequncia codificadora (Cds = coding sequence). Antes dele (diz-se 5' dele) esto o promotor (onde vai se ligar a RNA polimerase) e o stio ligador de ribossomo (RBS = ribosome binding site ou rrs = ribosome recognition site), uma sequncia que, quando transcrita para o mRNA, ir permitir o pareamento deste com um trecho complementar do RNA 16 S da subunidade menor do ribossoma. Aps a ORF (3' dela, como se diz no jargo de biologia molecular), h o sinal de parada da transcrio, que formado por uma sequncia didica acompanhada de um poliT (na fita 5'3', que sempre a de cima, salvo quando especificado na figura). A transcrio da regio do terminador provoca a formao de um grampo no RNA mensageiro nascente, seguido de um poli-U, que interrompe a sntese de RNA. 7Como acontece o mecanismo de transcrio do DNA em RNA? (Fale sobre os fatores de transcrio e sobre o fator sigma.) Transcrio o processo de formao de uma molcula de RNA a partir de uma molcula molde de DNA. Neste processo, as fitas do DNA se separam e uma serve de molde para o RNA, enquanto a outra fica inativa. Ao fim da transcrio, as fitas que foram separadas voltam a se unir. A transcrio um processo altamente seletivo, pois apenas pequenas pores da fita de DNA molde copiada. Isso muito importante, pois o primeiro passo da regulao de um gene. O processo iniciado quando a polimerase do DNA se liga a uma das extremidades do DNA. Essa extremidade muito especfica, possuindo uma seqncia especial de bases, e chamada de promotor. Neste local, existe um stio de iniciao, com a primeira base a ter transcrita. A polimerase do RNA segue pela extenso da cadeia, transcrevendo o DNA em RNA at encontrar a seqncia de terminalizao, que contm bases especficas que determinam o fim da transcrio. Etapas da transcrio 1 Reconhecimento da fita molde de DNA O DNA e as polimerases do RNA (enzimas catalizadoras da reao) esto livres na clula e podem se encontrar ao acaso, porm a transcrio s tem incio quando a enzima encontra e liga-se fortemente ao stio promotor. Quando isso acontece, a dupla-hlice desenrolada e as fitas so separadas. 2 Incio da transcrio A polimerase ligada regio promotora inicia o processo de transcrio, adicionando os primeiro nove nucleotdeos da seqncia de RNA. Essa fase chamada de fase de iniciao. 3 Elongao Aps a produo de aproximadamente nove nucleotdeos, a polimerase do RNA passa a se deslocar pela molcula de DNA, desenrolando sua hlice e produzindo uma molcula de RNA, cada vez mais alongada. O DNA j transcrito volta a ser enrolado, quase que imediatamente, recompondo a sua duplahlice. Esse processo chamado de fase de elongao. A fita de RNA produzida simples e livre. Cerca de 40 nucleotdeos podem ser produzidos por segundo, a uma temperatura de 37C em bactrias. 4 Trmino Quando a polimerase do RNA encontra a seqncia de terminalizao, o RNA para de ser transcrito. A partir desse momento, nenhuma outra base nitrogenada incorporada ao RNA. Neste momento, a bolha de transcrio se desprende, liberando uma molcula de RNA e imediatamente a molcula de DNA se enrola completamente. A seqncia de DNA que contm os genes sinalizadores do trmino chamada de regio terminalizadora.

O fator sigma da RNA-polimerase responsvel pelo reconhecimento da regio do promotor, local onde se inicia a sntese. Foram convencionados nmeros para a identificao deste local. 8Nos organismos eucariticos, o RNA mensageiro produzido no ncleo, processado e ento enviado ao citoplasma para ser traduzido em molculas de protenas. a) b) Quais so as modificaes que um transcrito primrio de mRNA deve sofrer at que forme o chamado MRNA maduro, que ir ao citoplasma servir de molde para a sntese de protenas? Por que elas acontecem?

No genoma humano os introns iniciam sempre com GU e terminam em AG. H um nmero maior de bases relativamente conservadas nas duas extremidades e elas participam no reconhecimento do intron pelo spliceossomo ou encadeassomo, complexo enzimtico responsvel pela retirada dos introns e emenda dos exons adjacentes. A figura abaixo mostra esquematicamente a retirada os introns, assim como duas outras modificaes importantes do transcrito primrio de RNA: o capeamento e o caudeamento. No capeamento, uma base diferente das demais que compem o RNA, a 7-metil-guanosina, adicionada na extremidade 5' do mRNA, com sua hidroxila da posio 3' voltada para fora do RNA. Na outra extremidade, a partir de um sinal de poli-adenilao (uma sequncia no mRNA), uma enzima especfica cliva o RNA, descarta a poro final e adiciona extremidade 3' um nmero varivel de adeninas (de 15 a 300). Com isto, o trecho que vai deste sinal at o fim do mRNA fica perdido. este fenmeno dificulta imensamente o estudo do mecanismo de terminao da transcrio em eucariotos, que ainda no bem compreendido.

Figura: Diagrama do processamento do transcrito primrio at o mRNA maduro. Os introns formam laos (denominados lariats) na presena do splicesossomo (1), sendo retirados. Ao mesmo tempo, a parte final (3') do RNA clivada (2) e uma cauda poli-A adicionada. Por fim, uma resduo de 7-metil-guanosina adicionado extremidade 5' do RNA, criando o bon, ou cap (3).

O mRNA pronto passa pelo poro nuclear para o citoplasma, onde ser traduzido. Por este poro passam tambm as duas sub-unidades do ribossomo (separadamente). Dependendo dos sinais que o mRNA tiver nas regies 5'-UTR e 3'-UTR, ele poder ser exportado para uma organela (mitocndria ou cloroplasto), transportado para determinadas regies da clula (botes sinpticos, por exemplo) ou ainda formar parte do pool de mRNAs no traduzidos. As duas regies UTR tm, na verdade, um importante papel na regulao ps-transcricional da expresso gnica que muitos eucariotos empregam este mecanismo com frequncia e, em alguns casos, quase exclusivamente (como o caso da Leishmania e do Trypanosoma). 9Os mecanismos de transcrio so regulados atravs da presena de determinados metablitos na clula, que indicam a ela se determinado conjunto de genes deve ou no ser transcrito em determinado momento. As bactrias realizam a regulao da transcrio em conjuntos de genes chamados de operons, que podem ser indutveis ou repressveis.

a)

Explique o mecanismo de funcionamento do operon LAC ou do operon do triptofano em bactrias. Operon LAC um operon requerido para o transporte e metabolismo da lactose.

O operon LAC utiliza um mecanismo de controle duplo para assegurar que a clula produza enzimas somente quando haja lactose no meio. Isso conseguido com o repressor LAC que paralisa a produo de enzimas na ausncia de lactose, e com a protena ativadora catablica (CAP), que auxilia na produo, no caso de ausncia de glicose. Esse controle duplo faz com que a glicose seja metabolizada pelas bactrias antes que a lactose, o que se conhece pelo nome de diauxia. 10a) . Como se d o mecanismo de traduo da informao do DNA em protenas?

Aps a transcrio da informao gentica contida no DNA em RNA, ocorre a traduo, processo ao qual processo de leitura do mRNA que ocorre no citoplasma pelos ribossomos para formar uma protena. Aps a formao do mRNA maduro, no processo de transcrio, ele sai do ncleo da clula e vai em direo ao ribossomos no citoplasma para ser traduzido. A ao dos ribossomos dividida em trs etapas: iniciao, alongamento e finalizao: Iniciao: O mRNA migra para o citoplasma e fixa-se na subunidade pequena do ribossoma, nomeadamente na regio de AUG, o codo de iniciao. O tRNA funciona como intrprete dessa mensagem, transportando o aminocido metionina ligando-se ao cdon de iniciao. A subunidade grande do ribossoma liga-se pequena subunidade. O ribossoma est ento funcional. Alongamento: O anticdon de um novo tRNA transporta um segundo aminocido na extremidade 3' e liga-se ao segundo cdon por complementaridade. Estabelece-se ento uma ligao peptdica entre o aminocido que ele transporta e a metionina. Estas ligaes implicam transferncias de energia sendo catalisadas por enzimas. Como o cdigo degenerado, pode existir mais de um tRNA para o mesmo aminocido. O ribossoma avana trs bases e o processo repete-se ao longo do mRNA. Finalizao: Assim que ao ribossoma chega um cdon de finalizao, termina a sntese. A cadeia polipeptdica destaca-se. Os componentes do complexo de traduo separam-se, mas as subunidades ribossomais podem ser novamente utilizadas. No final da traduo resulta uma sequncia de aminocidos que, depois de sofrer transformaes em diferentes organelas celulares (RER e complexo de Golgi), se torna numa protena funcional capaz de desempenhar as suas funes, conferindo clula que a produziu uma determinada caracterstica. b) O que so e pra que servem as enzimas tRNA aminoacil sintetases?

tRNA aminoacil sintetase uma enzima que catalisa a esterificao (reao qumica reversvel na qual um cido carboxlico reage com um lcool produzindo ster e gua) de um especfico aminocido em um dos possveis tRNA correspondentes, com vista a formar um aminoacil-tRNA. 11Depois que as protenas so produzidas, elas podem sofrer as chamadas modificaes pstraducionais. a) Para que servem estas modificaes? Para adquirir sua conformao final biologicamente ativa. b) Cite pelo menos dois tipos de modificaes ps-traducionais conhecidas em protenas e a funo dessas modificaes na regulao da atividade protica.

Adio de grupos prostticos: muitas protenas requerem, para sua atividade, grupos prostticos ligados covalentemente. Formao de pontes de dissulfeto: Aps se dobrarem nas suas conformaes reativas, algumas protenas formam pontes de dissulfeto entre resduos de CYS presentes em uma mesma cadeia ou em cadeia diferentes.

Para as questes de 12 e 13 utilize a sequncia abaixo, obtida de um DNA bacteriano:

> Sequncia 1
GCCTTCAATGGCAAGCGGTCTGGAATCCTACTTCTTGAATCGGCACGGTGTCATTACGGGCGGGGGCCAG AACAACGTCCCTGGACATCACACCTAGCCCGTGCGACGGCGGAAACCTTCGCCGGCGCAGGCTTCGACGT GACCCTCATCGCGGAACCCTCCCCCACCCCAGTGTTGGCGTGGCTGGTGCGCTCACGGCGAATGGACGTG Enzima de restrio EcoRI GGCGTGCAGATCACCGCCTCGCACAATCGAATTCAGGACAACGGCTACAAGCTGTACCTGGACGGCGGCT CTCAGCTGGTCTCCCCCGCCGACCGGCAGATCGAGGAGCACATTGCCGCCCAGCCAACTGACGCGGCGAA Enzima de restrio inventada GATCCCCCGCTCCGAGGCGAAGTCTGTAGACCTGTCCGTAGTCTCCGGCTATGTCACCGAGCTAAGTACC CTGGTGGCCACCGGCCGCCAATCCGAGCTGGCGCCGCGGCGGAACCTGAAGATCCTCTACACCCCCATGC 12Suponha que a sequncia acima tenha sido amplificada por PCR de um extrato bacteriano. ACGGCGTGGGCGGCAATGCCCTGGAGTGGGCCTTACGTGAATTCGGCTTCGGCAACGTGCACGCGGTGGC a)CTCGCAGCGCTGGCCGGACCCGACCTTCCCGACTGTGGACTTCCCCAACCCTGAGGAGCCGGGTGCCACC Quais so os reagentes que o pesquisador colocou no tubo para fazer a reao, alm do DNA GACGCGCTGCTGGAAGAAGCCCGCGCCATCGATGCGGACCTGCTGATCGCCCTGGATCCGGATGCGGACC

extrado, em soluo?

Coloca-se no tubo de PCR, o extrato de DNA coletado, o primeiro primer, o segundo primer, Soluo de desoxinucleotdeos, cofator Mg2+, e a enzima DNA Polimerase termo-estvel em soluo tampo. b) A PCR uma reao de amplificao que acontece em ciclos. Descreva sucintamente as trs etapas do ciclo da PCR e diga o que acontece em cada um deles.

Etapa 1: _Desnaturao do DNA______________________________ Temp: _95_C Desnaturao do DNA alvo pelo calor (tipicamente 1 minuto a 94-96C), de modo a separar as duas cadeias. Etapa 2: _Anelamento dos primers____________________________ Temp: _50_C Associao dos iniciadores por ligaes de hidrognio ao DNA alvo em cadeia simples. Para permitir essa associao, a mistura de reaco arrefecida (tipicamente a temperaturas entre 50 e 65C, durante 1 minuto; a temperatura a usar depende da % GC da sequncia a amplificar). Etapa 3: _Extenso dos iniciadores____________________________ Temp: _72_C Extenso dos iniciadores atravs da sntese da cadeia complementar de cada cadeia molde, catalisada pela DNA polimerase (tipicamente 1 minuto a 72C). c) Por que a utilizao da polimerase de uma bactria hipertermoflica (Thermus aquaticus) permitiu a automao da tcnica? Qual a funo da mquina conhecida como termociclador?

Um grande nmero de DNA polimerases de seres termfilos e hipertermfilos tm sido isoladas e caracterizadas de archaea e eubacterias termfilas. Estas enzimas tm atividade a uma temperatura tima elevada e tm uma estabilidade trmica que corresponde aos ambientes trmicos extremos onde os organimos vivem. Apesar do fato de a estabilidade trmica das protenas nativas variar entre as diversas enzimas, existe uma temperatura tima de polimerizao comum entre os 70 e os 80C. Isto sugere que a estabilidade do template, contrastando com a estabilidade intrnseca das enzimas, determina a temperatura da polimerizao. Devido termoestabilidade destas enzimas, as relaes entre a estrutura e funo, e as potenciais aplicaes biotecnolgicas de muitas destas enzimas termoestveis, tal como as DNA polimerases, so de grande interesse para a investigao cientfica.

A Taq DNA polimerase proveniente da bactria termfila Thermus aquaticus, sendo a enzima de eleio para a maioria das aplicaes de PCR (Polymerase Chain Reaction). A Taq DNA polimerase consiste numa cadeia polipeptdica simples, com um peso molecular de aproximadamente 95 kD e com uma temperatura ptima de atividade de 75C. Esta DNA polimerase catalisa a sntese do DNA de 5'-3'. Por outro lado, de 3'-5' no tem atividade exonuclesica e de 5'-3' esta baixa. A enzima obtida a partir de clulas de Escherichia coli nas quais est clonado o gene poI de Thermus aquaticus. Atravs da tcnica de PCR, a Taq polimerase usada para amplificar fragmentos de DNA to grandes como 5 Kb e apresenta uma taxa de erro de 2,2x10-5 nucletidos por ciclo. O Termociclador funciona a partir de ciclos alternantes de aquecimento e resfriamento da mistura juntamente com a DNA polimerase, com a funo de copiar um fragmento de DNA. Esses fragmentos, ou primers, indicam qual parte do DNA est sendo copiado. Esse mtodo torna possvel produzir inmeras cpias de determinada parte do DNA. Ele auxilia na ampliao do DNA de inmeras fontes. Ele prprogramado com protocolos de PCR que podem ser facilmente selecionados atravs do display. As amostras recolhidas pelo termociclador podem ser visualidasas atravs de eletroforese. 13Uma vez amplificada a sequncia deste gene, queremos agora clon-lo em um vetor de clonagem. Para isso precisamos primeiro cort-la com enzimas de restrio. Sabe-se que a enzima de restrio EcoRI corta um DNA fita dula do seguinte modo e no seguinte stio (veja figura). Responda:

Figura: Corte com a enzima EcoRI a) Quantos stios de restrio existem na nossa sequncia? Sublinhe-os Existem 2 stios de restrio para a enzima EcoRI conforme sequencia abaixo.
> Sequncia 1 GCCTTCAATGGCAAGCGGTCTGGAATCCTACTTCTTGAATCGGCACGGTGTCATTACGGGCGGGGGCCAG AACAACGTCCCTGGACATCACACCTAGCCCGTGCGACGGCGGAAACCTTCGCCGGCGCAGGCTTCGACGT GACCCTCATCGCGGAACCCTCCCCCACCCCAGTGTTGGCGTGGCTGGTGCGCTCACGGCGAATGGACGTG b)GGCGTGCAGATCACCGCCTCGCACAATC O gel abaixo apresenta, na canaleta 1, um padro de peso molecular onde as bandas GAATTC AGGACAACGGCTACAAGCTGTACCTGGACGGCGGCT CTCAGCTGGTCTCCCCCGCCGACCGGCAGATCGAGGAGCACATTGCCGCCCAGCCAACTGACGCGGCGAA representam sequncias com 10bp, 50bp, 80bp, 200bp e 1kb. Suponha que seu DNA acima tenha GATCCCCCGCTCCGAGGCGAAGTCTGTAGACCTGTCCGTAGTCTCCGGCTATGTCACCGAGCTAAGTACC sido digerido pela enzima EcoRI e represente, na canaleta 2, os fragmentos resultantes do corte CTGGTGGCCACCGGCCGCCAATCCGAGCTGGCGCCGCGGCGGAACCTGAAGATCCTCTACACCCCCATGC ACGGCGTGGGCGGCAATGCCCTGGAGTGGGCCTTACGT GAATTCGGCTTCGGCAACGTGCACGCGGTGGC (dica: cada linha da sequncia apresenta 70 nucleotdeos). CTCGCAGCGCTGGCCGGACCCGACCTTCCCGACTGTGGACTTCCCCAACCCTGAGGAGCCGGGTGCCACC GACGCGCTGCTGGAAGAAGCCCGCGCCATCGATGCGGACCTGCTGATCGCCCTGGATCCGGATGCGGACC

1 fragmento: 239bp 2 fragmento: 290bp 3 fragmento: 171bp

c)

Utilizaremos aqui um plasmdeo chamado pLADA contendo 900bp que apresenta um stio para a enzima EcoRI dentro de seu stio mltiplo de clonagem. O plasmdeo foi digerido com esta enzima de restrio e, assim, linearizado. Suponha que voc tenha purificado do gel seu maior fragmento obtido na canaleta 2 e incubado este fragmento com o plasmdeo digerido, na presena de DNA ligase. Na canaleta 3, apresente as bandas resultantes deste experimento de ligao. Lembre-se que o plasmdeo pode ligar-se com ou sem o inserto. Explique porque as bandas tm o tamanho observado no gel

Plasmdeos so capazes de amplificar o segmento de DNA neles inserido, por isso so utilizados como vetores de clonagem. Para isso, tm que possuir certas propriedades: ter uma origem de replicao, que consiste numa sequncia de DNA que permite a replicao do vetor na clula hospedeira; possuir Mltiplos Stios de Clonagem (MSC), ou seja, vrios locais nicos de clivagem para endonucleases de restrio, os quais constituem o stio de insero no vetor de clonagem; conter um gene que codifique uma substncia que possa distinguir uma clula transformada de uma no transformada. Muitas vezes, so utilizados genes que conferem resistncia a um antibitico. Assim, as clulas que possuem este gene so capazes de crescer em meios com antibitico, enquanto que as restantes no sobrevivem.

Estes vetores constituem parte essencial no processo de clonagem, sendo necessria a atuao das enzimas de restrio para ligar o DNA a ser clonado ao DNA do vetor, atravs da produo de extremidades coesivas complementares (ou extremidades abruptas). Seguidamente, a molcula hbrida resultante inserida numa clula hospedeira, muitas vezes bactrias, por um processo denominado transformao. O vetor pode assim sofrer replicaes e proceder consequente amplificao do nmero de cpias. Como foi referido anteriormente, estas clulas so identificadas devido a novas caractersticas concedidas pelo plasmdeo (por exemplo, sobreviver num meio contendo um dado antibitico para o qual o plasmdeo confere resistncia).

d)

Invente uma enzima de restrio que corte num stio diferente da EcoRI. Lembre-se que as enzimas de restrio cortam em stios palindrmicos (idnticos nas duas fitas; GAATTC GAATTC tambm na fita complementar-reversa). Apresente o stio de corte de sua enzima, d um nome para ela, corte o DNA da sequncia 1 com esta enzima em pelo menos um stio e apresente, na canaleta 4, os fragmentos gerados por este ensaio de digesto, com seus respectivos tamanhos.

Enzima: _BqmFII__________________ Stio de corte: _5GCGC-___________

Nmero e tamanho dos fragmentos de restrio gerados: 7 fragmentos resultantes: 1 fragmento: 125bp 2 fragmento: 64bp 3 fragmento: 262bp 4 fragmento: 116bp 5 fragmento: 67bp 6 fragmento: 19bp 7 fragmento: 47bp

14que?

O que um organismo transgnico? Voc se considera contra ou a favor dos transgnicos? Por

Transgnicos ou organismos geneticamente modificados (OGM) so organismos que mediante licenas de engenharia gentica sofreram alteraes no seu material gentico. No sou contra e nem a favor. Uma vez que os organismos transgnicos possuem seus prs e contra. Prs: Pode ter a funo prevenir, reduzir ou evitar riscos de doena, reduzir o numero de agrotxicos; dar resistncia s plantas; aumento de produo de alimentos; entre outros. Contra: Podem causar resultados inesperados ao organismos que se inserem; aumento do nmeros de casos de pessoas alrgicas determinados alimentos; riscos sade; riscos ambientais; aumento de resistncia de pragas e doenas, entre outros. 15Faa um crtica responsvel nossa disciplina. Quais os pontos fortes? Quais os pontos fracos? Voc acha que conseguiu aprender? Voc conseguiu se dedicar ao estudo? Como voc sugere que o professor possa tornar esta disciplina melhor no prximo semestre? O curso de Bioqumica se fez imensamente satisfatrio e esclarecedor, apresentando como pontos fortes os slides bem preparados e resumidos que auxiliam nos estudos e poupam o tempo que seria gasto lendo captulos inteiros (70-80 pginas) para identificar os tpicos mais importantes. Alm disso, os vdeos mostrados em sala promoveu um maior enendimento acerca do contedo. No h pontos fracos a serem destacados nessa crtica. Foi possvel me dedicar disciplina, embora no tenha sido possvel, talvez, dar conta de reter todas as informaes que nos foram dadas uma vez que o contedo bastante extenso. Sugiro que haja uma reduo do contedo ou aumento na quantidade de aulas para que essas sejam melhor aproveitadas.