Inhalation Toxicology, 21:119132, 2009 Copyright c Informa UK Ltd. ISSN: 0895-8378 print / 1091-7691 online DOI: 10.

1080/08958370802419145

Increase of Matrix Metalloproteinases in Woodsmoke-Induced Lung Emphysema in Guinea Pigs

Carlos Ramos, Jose Cisneros, Georgina Gonzalez-Avila, Carina Becerril, V ctor Ruiz, and Martha Montano
Departamento de Investigaci on en Fibrosis Pulmonar, Instituto Nacional de Enfermedades Respiratorias, Mexico City, Mexico

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

Elastolysis, collagenolysis and gelatinolysis are essential in the pathogenesis of tobacco smokeinduced emphysema; however, these activities have been scantily studied in emphysema secondary to woodsmoke. The aim of this study was to analyze elastolysis, collagenolysis and gelatinolysis, MMP-1, MMP-2, and MMP-9 expression, and apoptosis in guinea pigs exposed to smoke produced by 60 g/day of pine wood, 5 days/week, from 1 to 7 months. Histological analysis after 4 to 7 months in smoke exposed guinea pigs showed alveolar mononuclear phagocyte and lymphocytic peribronchiolar inammation, epithelial and smooth muscle hyperplasia, and pulmonary arterial hypertension. Mild to moderate emphysematous lesions were observed in woodsmoke-exposed animals at 4 to 7 months by increase of mean linear intercepts. A higher percentage of whole blood carboxyhemoglobin (COHb) and elastolytic activity in bronchoalveolar lavage macrophages and lung tissue homogenates was observed at all times. Collagenolysis was increased after 4 to 7 months in woodsmoke-exposed animals, although collagen concentration did not change. Zymography revealed increase in lysis bands of the active MMP-2 and MMP-9 at 4 and 7 months in bronchoalveolar lavage uid and lung tissue homogenate. Positive immunostaining for MMP-1 and MMP-9 was observed in epithelial cells and macrophages in wood exposed animals at 4 to 7 months. Real-time PCR showed MMP-2 and MMP-9 expression at 3 to 7 months in exposed animals. Furthermore, apoptosis was increased at all times in bronchoalveolar lavage macrophages and lung tissue from exposed animals. Results support a role of metalloproteinases and apoptosis in emphysema secondary to woodsmoke exposure.

INTRODUCTION Chronic obstructive pulmonary diseases (COPD) are characterized by irreversible airow limitation and airway inammation, accompanied by decreased health status. The air ow limitation is usually progressive and associated with an abnormal inammatory response of the lungs to several noxious particles, gases, and cigarette smoking. COPD includes chronic bronchitis, emphysema, and small airway disease (Barnes, 2004; Celli

Received 28 March 2008; accepted 19 August 2008. Declaration of interest: The authors report no conicts of interest. The authors alone are responsible for the content and writing of the paper. This work was supported by a grant from the Consejo Nacional de Ciencia y Tecnolog a (CONACYT) M exico, project number III-53083. Address correspondence to Carlos Ramos, PhD, Departamento de Investigaci on en Fibrosis Pulmonar, Instituto Nacional de Enfermedades Respiratorias, Calzada de Tlalpan 4502, Tlalpan DF, Mexico, 14080, Mexico. E-mail: cramosa@prodigy.net.mx

& MacNee, 2004). Several cells participate in emphysema inammation, inammatory mediators, chemotactic factors, extracellular matrix (ECM) molecules, ECM degradative enzymes, and proteinase inhibitors (Barnes et al., 2003; March et al., 2006; Yoshida & Tuder, 2007). Macrophages are the predominant cell population identied in emphysema and play an important role in strengthening the inammatory response with secretion of chemotactic factors, growth factors, and inammatory mediators. Macrophages also participate in ECM turnover and degradation by secreting different matrix metalloproteinases (MMPs), although neutrophils also increase and participate, secreting a serine-elastase (Ofulue et al., 1998; Shapiro et al., 2003). The human MMP family consists of at least 23 enzymes that collectively degrade all ECM components and exert selective proteolysis of cell surface receptors, adhesion molecules, chemokines, cytokines, and growth factors (Pardo & Selman, 2006). MMPs have been classied into six different subgroups of closely related members with rather distinctive but often

119

120

C. RAMOS ET AL.

overlapping substrate specicities: collagenases, gelatinases, stromelysins, matrilysins, membrane-type MMPs, and other MMPs (Pardo & Selman, 2005). ECM metabolism is maintained in a balance between the synthesis and activity of MMPs and that of their inhibitors such as antitrypsin and tissue inhibitors of metalloproteinases (Pardo & Selman, 2006). MMPs have been strongly associated with emphysema in human and animal models, induced by tobacco smoke exposure, oxidants, gene-targeting of enzymes and growth factors, instillation of enzymes, apoptosis induction, and specic chronic inammation (Groneberg & Chung, 2004; Shapiro, 2007). Results of these models have shown that even when COPD is caused by different agents, cigarette smoke exposure remains the main factor, especially producing emphysema and acting by means of airway inammation in combination with increase in expression and activity of MMPs, producing lung parenchyma destruction (Yoshida & Tuder, 2007; Selman et al., 2003; Shapiro, 2007). Conversely, recent epidemiological studies have established another important cause of COPD, especially emphysema, characteristically in developing countries. This cause is domestic exposure to woodsmoke and other biomass solid fuels used as domestic heating and cooking fuels, increasing the prevalence of chronic bronchitis and emphysema (Montano et al., 2004; Ramirez-Venegas et al., 2006). Furthermore, World Health Organization statistics shows that 3 billion people worldwide (45% of the worlds population) use solid fuel biomass such as wood, crop residues, charcoal and dung, but predominantly wood (Desai et al., 2004). Hence, indoor air pollution has been a problem since the Stone Age. In addition, in rural areas of Mexico, biomass, mostly wood, is used as the primary cooking fuel in 69% of households as a result of poverty (Regalado et al., 2006). Nevertheless, the effects of woodsmoke go beyond emphysema and induction of COPD. A recent study from Mexico reported that 38.7% of female patients with lung cancer (non-smokers) who were exposed to continuous woodsmoke for >10 years lived under poverty conditions in rural areas. The ndings suggested a connection between lung cancer and woodsmoke exposure, which may cause similar gene mutations to p53, phospho-p53, and MDM2 protein expression, similar to tobacco use (Delgado et al., 2005). Alternatively, the molecular mechanisms involved in the onset and progress of COPD associated with woodsmoke exposure are only partially known because patients are diagnosed in advanced stages of disease (Desai et al., 2004; Perez-Padilla et al., 1996; Ramirez-Venegas et al., 2006). Using this approach, animal models may contribute to understanding the onset and pathological processes of emphysema and other forms of COPD as occurs with animals exposed to tobacco smoke, mimicking the onset and progression of emphysema. Among the most important woodsmoke components associated with health damage are CO and CO2 , as well as PM10 and PM2.5 particles. PM10 are small particles with a diameter of 10 m or less, and PM2.5 are ne particles with a diameter of 2.5 m or less and can be deposited throughout the respiratory tract (Naeher et al., 2007).

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

Several studies performed on human and animal models exposed to different kinds of woodsmoke have shown that a variety of pathophysiological and cellular effects in lungs and airways can be induced (Diaz et al., 2006; Fehrenbach, 2006; Fujita & Nakanishi, 2007; Groneberg & Chung, 2004; Matthew et al., 2001; Naeher et al., 2007). In this manner, there are no models of COPD and, especially, of emphysema induced by woodsmoke exposure analyzing the participation of MMPs on lung destruction (Montano et al., 2004; Shapiro, 2007). Consequently, the aim of the present study was to develop a sequential model of subchronic exposure to woodsmoke in guinea pigs and analyze histological features, elastolysis, collagenolysis, gelatinolysis, expression of MMP-1, -2, and -9, and apoptosis with the objective of developing lesions and activities that imitate the histological and biochemical characteristics of emphysema observed in human and experimental models induced by tobacco smoke and other agents. METHODS Woodsmoke Exposure and Woodsmoke Analysis Groups of six guinea pigs weighing 330370 g were exposed for 3 h to the whole smoke produced by 60 g of pine wood/day, 5 days/week, for 1, 2, 3, 4, 6 and 7 months. The smoke chamber was similar to the one described elsewhere (Matthew et al., 2001). Briey, the system for smoke exposure was integrated with an electric incinerator for combustion of wood and connected by a rubber tube to a whole-body inhalation chamber. At the same time, the inhalation chamber was coupled through another rubber tube to a vacuum pump. In this manner, woodsmoke ows from the incinerator to the inhalation chamber and then to the outside. Wood was cut into small pieces (30 10 5 mm) and placed between the heating coils in the incinerator. The wood burned gradually without producing a ame. CO concentration in the inhalation chamber was monitored with a CO-detector (MiniCO responder Kit Dosimeter, Mine Safety Appliances Co., Pittsburgh, PA) and maintained at <80 ppm. In addition to CO, we measured CO2 , O2 , PM10 and PM2.5 particle concentrations in the inhalation chamber during exposure to woodsmoke. CO was measured with a CO analyzer (MiniCO responder Kit Dosimeter, Mine Safety Appliances Co.). Oxygen concentration was measured with an oxygen analyzer (Miniox I; MSA) and CO2 was measured with a CO2 analyzer (Model 2825; Bacharach Inc., Pittsburgh, PA). PM10 and PM2.5 particles were measured according to Brauer et al. (1996) using inertial impactors operating at a ow rate of 4 L min1 , which were coupled to a portable integrating nephelometer (M903; Radiance Research, Seattle, WA). Smoke exposure was quantied by measurement of blood carboxyhemoglobin (COHb) by means of co-oximetry as described elsewhere (Sansores et al., 1997). Control guinea pigs were exposed to ambient air instead of woodsmoke into the inhalation chamber for the same period of time as experimental animals. The research protocol was approved by the Scientic and Animal

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA

121

Care Committee of the National Institute of Respiratory Diseases (INER), Mexico City. Experimental and control animals were anesthetized intraperitoneally with sodium pentobarbital (50 mg/kg body weight). Lungs were subjected to bronchoalveolar lavage (BAL). Right lungs were used for morphological analysis, immunostaining, and real-time PCR. Left lungs were used to assay gelatin zymography, collagenolytic activity, elastolysis and collagen concentration. Alveolar macrophages from BAL were used for elastolytic activity, whereas BAL uid was used for gelatin zymography. Total and Differential Cell Count in BAL Lungs were lavaged by ushing twice with 8-mL aliquots of sterile phosphate-buffered saline (PBS) solution at 37 C through a tracheal cannula. BAL was centrifuged at 300 g for 10 min at 4 C. The pellet was resuspended in PBS and used for total cell count with a hemocytometer. One aliquot of 100 L of cells was xed in 50% ethyl alcohol and 2% carbowax (50% polyethylene glycol) and used for differential cell counting in slides stained with hematoxylin and eosin (Selman et al., 1996; Sansores et al., 1997). Remaining cells were frozen and maintained at 80 C until used for elastolytic activity and apoptosis. HISTOLOGICAL ANALYSIS Lungs were xed in situ using a tracheal cannula with 4% phosphate-buffered formaldehyde (pH 7.4) at 25 cm H2 O pressure. Lung tissues were embedded in parafn and processed for conventional light microscopy and immunohistochemistry. Six-m sections were stained with hematoxylin-eosin (Selman et al., 1996), and lungs were analyzed. Enlargement of air spaces was analyzed by mean linear intercept (MLI), which represents the average size of alveoli. MLI were evaluated according to the procedure by Robbesom et al. (2003). To measure the intercepts, a transparent sheet with 10 horizontal and 11 vertical lines was laid over the images. The intercepts of alveolar walls with these lines were counted. Intercepts of bronchiole, blood vessels or septae were counted as one half because they represent part of the structure of surrounding alveolar spaces. Images with bronchi, large bronchioles or blood vessels were excluded from the measurements. Images showing compression of alveolar space observed as meandering walls were also excluded. Elastolytic Activity Elastolytic activity was performed in BAL macrophages and lung tissue homogenates as described elsewhere (Montano et al., 2004). Sixteen g of 3 H-elastin (specic activity = 259,000 cpm/g elastin) per well were applied to cover the bottom of 24well tissue culture plates, and 1 106 macrophages or aliquots of lung homogenates in PBS containing 5 g of total protein were plated on each well. Cells were maintained in RPMI medium

supplemented with 10% fetal bovine serum (FBS) at 37 C, 5% CO2 /95% air for 48 h. Blanks were incubated with RPMI + 10% FBS or PBS alone. Positive controls for 3 H-elastin-coated plates were made by incubating 10 g of bovine pancreatic elastase. Duplicates were assayed with 50 mM EDTA or 100 mM PMSF to inhibit MMPs or serine-elastase, respectively. Results were calculated as follows: cpm macrophage cpm blank/specic activity of 3 H-elastin where cpm is counts per minute. Results were reported as g of elastin degraded/106 macrophages in 48 h or as g of elastin degraded/mg protein in 48 h. Collagenolytic Activity Assay In order to determine the inuence of collagen degradation in this model of woodsmoke exposure, endogenous collagenolytic activity was measured as described previously (Selman et al., 1996). Lungs were homogenized at 4 C in 50 mM Tris [tris(hydroxymethyl-aminomethane)] buffer, pH 7.4, 10 mM CaCl2 , using a homogenizer (Brinkmann Instruments, Westbury, NY), and 1-mL aliquots were incubated at 37 C for 24 h. Collagen degradation was stopped by adding 0.4 M EDTA at the end of the incubation period. As controls, replicate tissue samples were incubated under identical conditions except for the addition of 0.4 M EDTA for the entire incubation period. Homogenates were centrifuged at 4 C and collagen digestion was detected by the release of soluble hydroxyproline-containing material into the supernatants. To control the ratio of enzyme activity to substrate, collagen content was measured in all aliquots. Collagenolytic activity was expressed as g of collagen degraded/mg of collagen incubated in 24 h. Measurement of Collagen Collagen concentration was measured by means of hydroxyproline content as described previously (Cisneros-Lira et al., 2003). 100-mg aliquots of lung tissue were dried and hydrolyzed in 6 N HCl for 24 h at 110 C, and the hydroxyproline content was evaluated colorimetrically. All assays were done in triplicate. Lung Tissue and BALF Gelatin Zymography Gelatinolytic activity was performed in left lung tissue homogenates (LTH) and BALF. Substrate gel electrophoresis was carried out by incorporating 0.1% gelatin (Sigma Chemical Co., St. Louis, MO) into standard 8% SDS-PAGE under nondenaturating conditions as described elsewhere (Pardo et al., 1996). Aliquots of 3 g of total protein from BALF or LTH supernatants from control and experimental animals were added per lane, and gels were run at a constant current of 10 mA. After electrophoresis, gels were rinsed in 2.5% Triton X-100 and then incubated in TNC buffer (50 mM Tris-HCl, 0.15 M NaCl, 20 mM CaCl2 , and 0.02% sodium azide, pH 7.4, with or without 20 mM EDTA) at 37 C overnight. Each gel was stained in 0.05% Coomassie blue R-250 (Bio-Rad, Richmond, CA) and was detained in 10% methanol/10% acetic acid. Gelatinolytic

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

122

C. RAMOS ET AL.

activity was detected as clear bands on a blue background on the stained gel. Serum-free conditioned medium from human lung broblasts was used as a gelatinase A (MMP-2) marker, and serum-free conditioned medium from phorbol myristate acetate (PMA)-stimulated U2-OS cells was used as a marker of gelatinase B (MMP-2). Similar gels were incubated but in the presence of 20 mM EDTA. Immunohistochemistry Immunohistochemical evaluation for MMP-1 and MMP-9 was performed as described elsewhere (Segura-Valdez et al., 2000). Lung tissue sections were deparafnized, rehydrated, and then incubated for 30 min with H2 O2 (3%) in methanol followed by antigen retrieval with citrate buffer (10 mM, pH 6.0) for 5 min in a microwave. Tissue sections were blocked with a universal blocking reagent (BioGenex; San Ramon, CA) 1X solution for 20 min and then incubated with rabbit anti-MMP1 (5 g/mL; Lab Vision, Fremont, CA) or rabbit anti-MMP9 (10 g/mL; Chemicon, Temecula, CA) at 4 C overnight. A secondary biotinylated anti-IgG followed by streptavidin-HRP conjugate (BioGenex) was used according to the manufacturers instructions. 3-Amino-9-ethyl-carbazole (AEC) (BioGenex) in acetate buffer containing 0.05% H2 O2 was used as a substrate. Tissue sections were counterstained with hematoxylin. For negative controls, the primary antibody was replaced by non-immune serum. RT-PCR and Quantitative Real-time PCR Amplication One g of total RNA obtained from lung tissue was reverse transcribed using random primers and Moloney murine leukemia virus reverse transcriptase according to the manufacturers protocol (Advantage RT-for-PCR Kit; Clontech, Palo Alto, CA). Quantitative real-time PCR amplication was performed using iCycler iQ Detection System (Bio-Rad, Hercules, CA). PCR was performed with cDNA working mixture in a 25-l reaction volume containing 2 l of cDNA, 20 mm Tris HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2 , 200 M dNTP, 1 M specic 5 and 3 primers (Table 1), 1.25 units of Taq DNA polymerase (Roche, Branchburg, NJ), and 10 nM uorescein and SYBR green I dye 1:50,000 (Roche, Indianapolis, IN). A dynamic range was built with each PCR product on copy number serial dilutions of 1 108 , 1 107 1 106 , 1 105 1 104 , 1 103 , 1 102 , and 1 101 . All PCRs were performed in

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

FIG. 1. Woodsmoke exposure induces body weight loss and increase of carboxyhemoglobin (COHb) levels. (A) Body weight in controls and woodsmoke-exposed guinea pigs. Bars represent mean SD of 6 guinea pigs; * p < 0.01 compared with controls using Students t-test. (B) COHb% in blood of control and woodsmoke-exposed animals. triplicate. Standard curves were calculated referring to the threshold cycle (the PCR cycle at which a specic uorescence becomes detectable) to the log of each cDNA dilution step. Results were expressed as the number of copies of the target gene normalized to 18S rRNA. Cycling conditions for PCR amplication to MMP-2, MMP-9 and rRNA 18s (Table 1) were performed using the following protocol: initial activation of AmpliTaq Gold DNA polymerase at 95 C for 10 min, 40 cycles of denaturization at 95 C/30 sec, annealing at 58 C/30 sec, and extension at 72 C/30 sec. Specic amplication was conrmed by the presence of one single peak in the melting curve plots. Additionally, PCR products were analyzed in agarose gel electrophoresis. Values are expressed as mean SD of copy number MMP-2 or MMP-9/ 18s RNA (Pardo et al., 2005).

TABLE 1 Primers and probes for real-time PCR GENE rRNA 18s MMP-2 MMP-9 Forward Primer (5 to 3 ) cgttgattaagtccctgccctt agggcgctctgtcct agcactttgggaggccaagg Reverse Primer (5 to 3 ) tcaagttcgaccgtcttctcag ggttcctctcgacgttgga ggtgacgtgaggtcggaccc AT 60 C 56 C 57 C bp 142 159 226

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA

123

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

FIG. 2. Cellular BAL prole. (A) Total cell number in control and woodsmoke-exposed animals (n = 6); * p < 0.01 compared with controls. (B) Cellular prole in control and woodsmoke-exposed animals; * p < 0.01 and ** p < 0.05. Values are expressed as mean SD (n = 6). Signicant differences from air controls are indicated. Detection of Apoptosis Apoptosis was analyzed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) and by measuring caspase-3 in macrophages and lung tissue sections as described elsewhere (Ramos et al., 2006). DNA fragmentation examined by TUNEL was done with the In Situ Cell Death Detection Kit (Roche, Mannheim, Germany). Macrophages from woodsmoke exposed and control animals (1 104 cells/cm2 )

TABLE 2 Time course effect of woodsmoke inhalation in air space enlargement of guinea pig lungs, measured by mean linear intercepts (MLI) Time (months) MLI (m) 0 85.3 24.5 1 86.1 18.6 2 89.3 28.4 3 118.2 39.6 4 167.2 34.8 6 231.7 57.9 7 248 87.7

Values are expressed as mean animals in each group. p < 0.05; p < 0.01; signicantly higher than controls (Time 0).

124

C. RAMOS ET AL.

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

FIG. 3. Representative photomicrographs of hematoxylin/eosin-stained lung sections of control and guinea pigs exposed to woodsmoke. (A) Control lung tissue showing normal thickness of alveolar septa and alveolar duct. Insert, magnication of normal thickness in alveolar septa of only one cell layer is shown. (B) Lung section from a guinea pig exposed to woodsmoke for 4 months showing alveolar mononuclear phagocyte inammation. Insert, magnication of cell wall thickening of more than one cell, as well as mononuclear phagocyte cells. (C) Areas of emphysematous lesions in lung of guinea pig after 7 months exposure to woodsmoke showing air space enlargement. (D) Panoramic view from a control lung tissue. (E) Control lung tissue showing a terminal bronchiole. (F) Lung tissue from guinea pig after 4 months exposure to woodsmoke showing lymphocytic peribronchiolar inammation (closed black arrow), bronchiolar epithelial and smooth muscle hyperplasia (head arrow), as well as thickening of alveolar septae of more than one cell. (G) Lung tissue from guinea pig after 7 months of woodsmoke exposure epithelial and smooth muscle hyperplasia (head arrow), in addition to pulmonary arterial hypertension (open arrow). (H) Panoramic view of lung tissue from guinea pig after 7 months of woodsmoke exposure showing extensive emphysematous areas. Original magnications: A-C, E-G: 20; D and H:4. Inserts in A and B: 63.

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA

125

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

FIG. 6. Active forms of MMP-2 and MMP-9 are detected at 4 and 7 months in lung tissue homogenates and in BALF from woodsmoke-exposed guinea pigs. (A) Representative zymogram from BALF. (B). Representative zymogram from lung tissue homogenate. Zymography bands corresponding to activity of 92, 85, 72, and 62 kDa to pro-MMP9, active MMP9, pro-M MP2, and active MMP-2, respectively. were plated. Some macrophages were incubated with DNase (2 U/mL) for 30 min at 37 C and were used as positive controls. After xation, macrophages were permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate for 2 min on ice. TUNEL reaction mixture was added to the slides and incubated in a humidied chamber at 37 C for 1 h. Apoptotic cells showing brown nuclei were counted with an Olympus microscope at different random elds until at least 500 cells were completed. Results were expressed as a percentage of TUNELpositive macrophages. Immunostaining for caspase-3 was developed with a polyclonal antibody caspase-3 (CPP32, Ab-4) (Neomarkers, Fremont, CA) visualized with diaminobenzidine (DAB) and hematoxylin counterstain.

FIG. 4. Increased elastolytic activity in BAL macrophages and lung tissue homogenates. Elastolysis was increased in BAL macrophages and lung tissue homogenates at all study times in guinea pigs exposed to woodsmoke. (A) Elastolytic activity by 1 106 BAL macrophages. (B) Elastolytic activity in lung tissue homogenates. * p < 0.01 for all comparisons. All values are mean SD (n = 6 per group); mean SD from groups were compared using Students t-test. Signicant differences from air controls are indicated.

FIG. 5. Endogenous collagenolytic activity. Collagenolysis was increased in lung from guinea pigs exposed to woodsmoke for 4 to 7 months; * p <0.01. All values are mean SD (n = 6 per group); mean SDs from groups were compared using Students t-test. Signicant differences from air controls are indicated.

126

C. RAMOS ET AL.

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

FIG. 7. Immunohistochemical detection of MMP-1 and MMP-9. Immunoassay for both MMPs was increased in macrophages and epithelial cells and some interstitial cells in woodsmoke-exposed animals, especially from 3 to 7 months. (A) Control lung section incubated with MMP-1 antibody showing occasional reaction product located in isolated alveolar walls. (B) Section of lung from animal exposed for 7 months to woodsmoke showing positive reaction to MMP-1 in some alveolar and interstitial cells. (C) Section of lung from animal exposed for 7 months to woodsmoke showing positive reaction to MMP-1 in macrophages and alveolar cells. (D) Negative control for MMP-1 showing any labeling. (E) Control lung section incubated with MMP-9 antibody showing occasional positive reaction located in macrophages and alveolar walls. (F) Section of lung from animal exposed for 7 months to woodsmoke showing positive reaction to MMP-9 in numerous alveolar cells. (G) Section of lung from animal exposed for 7 months to woodsmoke showing positive reaction to MMP-9 in some macrophages and epithelial cells. (F) Negative control for MMP-9 showing any labeling (63).

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA

127

STATISTICS Results were expressed as mean SD. Between-group comparisons were made using Students unpaired t-test. Multiple group comparisons were made using ANOVA followed by Dunnetts multiple comparison post-hoc test; p < 0.05 was considered statistically signicant. RESULTS Woodsmoke Composition In order to characterize the composition of the woodsmoke, we measured CO, CO2 , O2 , PM10 and PM2.5 particle concentration in an inhalation chamber during exposure. Wood-burning quantity was adjusted to obtain a continuous exposure of CO <80 ppm in the inhalation chamber. Under this condition, the content of CO2 was 0.35 0.021% and for O2 the content was 20.1 0.06%, whereas concentrations for PM10 and PM2.5 were 502 34 and 363 23 g/m3 , respectively. Body Weight and COHb Analysis Experimental animals with between 4 and 7 months of woodsmoke exposure showed a signicant decrease in body weight compared with controls (Figure 1A). Body weight loss was higher at 7 months, demonstrating 1284.9 65.4 g in controls versus 987 42.6 g in woodsmoke exposed animals ( p < 0.01). As shown in Figure 1B, the concentration of blood COHb was increased in woodsmoke-exposed animals at all times, particularly at 7 months where the exposed animals demonstrated 18.57 5.18 COHb% versus 6.07 1.53 COHb% in controls ( p < 0.01). Cell Prole of BAL In order to evaluate differences in total and differential inammatory cells in BAL in woodsmoke exposed and control guinea pigs, cell count was performed. Total number of recovered cells from BAL was higher in smoke exposed than control animals at all study times, especially at 4 months, with 6.87 1.2 106 cells in controls versus 11.02 1.83 106 cells in wood exposed animals ( p < 0.01; Figure 2A). Results for the differential cell count are shown in Figure 2B. Macrophages were the most prevalent population observed in controls and in woodsmoke-exposed animals. Interestingly, woodsmoke exposure induced a signicant increase of macrophages between 1 and 4 months, whereas neutrophils increased from 4 to 7 months. No changes were shown in eosinophils and lymphocytes. Viability of the recovered cells analyzed by trypan blue exclusion was 91.6 0.8%. Histological Analysis The lungs of guinea pigs exposed to woodsmoke for 3 to 7 months showed heterogeneous phagocyte-mononuclear alveolar inammation. Inammation and wall thickening was prominent at 3 to 4 months of woodsmoke exposure (Figure 3B). Airways also showed changes induced by woodsmoke expo-

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

sure; lymphocytic peribronchiolar inammation and epithelial and smooth muscle hyperplasia were observed (Figures 3F and 3G, closed black arrow and head arrows, respectively). In addition, pulmonary arterial hypertension was noted at 6 and 7 months of woodsmoke exposure (Figure 3G, open arrow). Histological analysis also revealed the presence of mild to moderate emphysematous lesions, especially in lungs of guinea pigs exposed to woodsmoke from 6 to 7 months, accompanied by rupture of the alveolar septa (Figures 3C and 3H). Emphysematous lesions were analyzed by mean linear intercepts (MLI); Comparison showed differences with controls (Table 2), changing from 85.3 24.5 ? m in controls to 167.2 36.6, 231.7 57.9 and 248 87.7 ? m at 4, 6 and 7 months, respectively ( p < 0.05 at 4 months; p < 0.01 at 6 and 7 months). MLI in lungs from control guinea pigs remained constant throughout the study.

Elastolytic Activity With the aim of determining whether elastin degradation participates in this model of emphysema induced by woodsmoke, we measured elastolytic activity in macrophages derived from BAL and lung tissue homogenates incubated in 3 H-elastinprecoated wells. Elastolysis from macrophages was noticeably increased at all time points when guinea pigs exposed to

FIG. 8. MMP-2 and MMP-9 expression analysis by real-time PCR. Expression for both metalloproteinases was increased in lung tissue from animals after 3 to 7 months of woodsmoke exposure. (A) MMP-2/18s RNA. (B) MMP-9/18s RNA; * p <0.01. All values are mean SD (n = 6 per group); mean SD from groups were compared using Students t-tests. Signicant differences from air controls are indicated.

128

C. RAMOS ET AL.

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

FIG. 9. Apoptosis analysis in BAL macrophages and lung tissue. Increase in apoptosis was observed in BAL macrophages and lung tissue sections in woodsmoke-exposed guinea pigs. (A) Analysis of apoptosis by TUNEL in BAL macrophages; * p <0.01. All values are mean SD (n = 6 per group); mean SD from groups were compared using Students t-test. Signicant differences from air controls are indicated. (B) Representative image of lung tissue section by immunostaining for caspase-3 in a control guinea pig showing occasional positive labeling. (C) Representative image of lung tissue section by immunostaining for caspase-3 in a guinea pig exposed for 7 months to woodsmoke, showing positively in epithelial cells (63). woodsmoke were compared with controls (Figure 4A), especially at 4 months where elastolysis changed from 5.67 1.7 g of degraded elastin/106 macrophages in controls to 20.6 4.9 g of degraded elastin/106 macrophages in 48 h; p < 0.01 (Figure 4A). Conversely, BAL macrophage elastolysis was inhibited only by EDTA but not by PMSF (data not shown), showing that their activity was due to a MMP (probably MMP12) and not to a serine-elastase. Lung tissue homogenate elastolysis in guinea pigs exposed to woodsmoke was also higher than controls at all study times (Figure 4B), particularly at 4 months, varying from 11.30 1.87 in controls to 28.65 5.01 g of elastin degraded/mg of lung protein ( p < 0.01). Collagenolytic Activity With the intent of determining the role of collagenolysis in this emphysema model, we studied endogenous collagen degradation in lung tissue homogenates. Results revealed a signicant increase in collagenolysis in guinea pigs exposed to woodsmoke between 4 and 7 months (Figure 5). Higher values for collagenolysis were observed at 7 months of woodsmoke exposure, changing from 0.32 0.07 in controls to 0.97 24 ? g of collagen degraded/mg of collagen incubated/24 h; p < 0.01. Alternatively, collagen concentration did not show any difference (data not shown). Lung Tissue and BALF Zymography With the purpose of evaluating the involvement of gelatinolysis, we assayed gelatinolytic zymography of BALF and lung tissue homogenates. Both samples revealed similar results. Zymography showed activity bands of 92, 85, 72, and 62 kDa, corresponding to proMMP-2, active MMP-9, proMMP2, and active MMP-2, respectively, in samples from both control and woodsmoke-exposed groups (Figure 6). The main change found in zymography was the presence of active forms of

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA

129

MMP-2 and MMP-9 at 4 and 7 months in BALF as in lung tissue homogenate from woodsmoke-exposed guinea pigs (Figure 6). Immunolocalization of MMP-1 and MMP-9 To evaluate whether MMP-1 and MMP-9 were present in woodsmoke-exposed tissues, we developed specic immunolocalizations. The study revealed an increase in the presence of MMP-1 in alveolar macrophages and epithelial cells and in some interstitial cells, especially from 3 to 7 months (Figures 7B and 7C). MMP-9 was also evident in alveolar macrophages and epithelial cells in experimental animals, mainly from 3 to 7 months (Figures 7F and 7G). Real-time PCR for MMP-2 and MMP-9 To evaluate whether activity of gelatinases A and B (MMP-2 and MMP-9, respectively) is accompanied by their expression, we performed real-time PCR for mRNA obtained from lung tissue. We found that MM9-2 transcript was increased signicantly between 3 and 7 months in woodsmoke-exposed animals (Figure 8A). mRNA for MMP-9 also was increased from 4 to 7 months in woodsmoke-exposed animals (Figure 8B). Apoptosis Apoptosis was evaluated in BAL macrophages and in lung tissue sections by both TUNEL staining and caspase-3 immunostaining. BAL macrophage apoptosis showed a progressive increase during the entire study time. Controls showed 11.5 1.23% of cell positivity for apoptosis measure by TUNEL, whereas in woodsmoke-exposed animals apoptosis showed a progressive increase to 27 3% at 3 months and 44 6% at 7 months; p < 0.01 (Figure 9A). Additionally, caspase-3 immunostaining was observed in BAL macrophages (data not shown). Similar results were observed in tissue sections showing positive immunostaining for caspase-3, chiey in macrophages and epithelial cells (Figures 9B and 9C). DISCUSSION AND CONCLUSIONS Elastolytic, collagenolytic and gelatinolytic activities have been assumed to be clues to the pathogenesis of COPD, especially in pulmonary emphysema secondary to tobacco smoke (Barnes et al., 2003). However, these enzymes have not been extensively analyzed in emphysema secondary to woodsmoke exposure (Segura-Valdez et al., 2000; Montano et al., 2004). The use of wood and other solid biomass fuels for cooking and heating is a frequent practice worldwide, especially in developing countries. However, respiratory alterations due to exposure to woodsmoke have been scantily studied. Clinical respiratory alterations associated with long-term woodsmoke exposure are similar to those induced by cigarette smoking. Furthermore, chronic bronchitis and emphysema have been observed in nontobacco smokers exposed to woodsmoke (Ramirez-Venegas et al., 2006; Perez-Padilla et al., 1996). The effects of tobacco smoke on the inammatory process and the molecular mecha-

nisms involved in lung damage have been widely studied. Similarly, the increase in expression and activity of several MMPs has been strongly associated with pathogenesis of tobacco smokinginduced disease (Yoshida & Tuder, 2007). In this context, the MMP family collectively degrades all ECM components and exerts selective proteolysis of cell surface receptors, adhesion molecules, chemokines, cytokines, and growth factors, acting therefore in tissue homeostasis. The action of MMPs is considered crucial in ECM turnover and degradation in emphysema and other forms of COPD (Barnes et al., 2003; Pardo & Selman, 2006). In this regard, elastolysis due to neutrophil elastase and macrophage metalloelastase (MMP-12), MMP-2 (gelatinase A) and MMP-9 (gelatinase B) has been identied in emphysema patients and animal models (Celli & MacNee, 2004). Additionally, MMP-1 and MMP-8 activity has been evidenced (Montano et al., 2004; Segura-Valdez et al., 2000). In this study we focused our analysis on determining whether exposure to woodsmoke induces increases in elastolytic, collagenolytic and gelatinolytic activities and their probable association with the development of emphysema. In addition, we assayed BAL cell prole, immunolocalization of MMP-1 and MMP-9, real-time PCR for MM-2 and MMP-9, and programmed cell death (apoptosis). We used guinea pigs because they have proven to be extremely important in research involving cigarette smoke-induced lung disease and show many advantages and few disadvantages when used in experimental circumstances versus other animals (Wright & Churg, 2002). Consequently, we compared the results from this emphysema model with the one obtained previously in our laboratory exposing guinea pigs to smoke produced by 20 cigarettes/day, which induced emphysema. On the other hand, the time points for this study were chosen on the basis of previous experiments in guinea pigs, which showed the onset of emphysematous lesions at 4 months with woodsmoke exposure. With regard to particle content during exposure in the inhalation chamber, it is important to mention that CO concentration was maintained at <80 ppm. Thus, even when the CO2 level was higher than atmospheric level (0.02%), it did not reach the maximum permissible levels (at least for humans). O2 concentration remained marginally changed in regard to ambient concentration. Concerning PM10 and PM2.5 particles, which are the most signicant for human health risk, levels were similar to those reported by Brauer et al. (1996) for domestic indoor woodsmoke (biomass) exposure in assessment in Mexico where 48% of homes use biomass for cooking but with a proportion much higher than 69% in rural areas versus 0.2% in urban areas. Consequently, this model mimics human exposure to PM10 and PM2.5 during cooking with biomass (woodsmoke) inside the home, which has a signicant impact on chronic bronchitis and chronic airow obstruction, especially for women who are more vulnerable to indoor smoke from solid fuels as wood (Brauer et al., 1996; Perez-Padilla et al., 1996). Our results showed that woodsmoke exposure induced a decrease in weight between 4 and 7 months in guinea pigs,

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

130

C. RAMOS ET AL.

similar to what occurs in patients with end-stage emphysema (and COPD) who have been exposed to domestic woodsmoke (Ramirez-Venegas et al., 2006; Regalado et al., 2006 ). Alternatively, a high percentage of COHb was observed at all times during the study in comparison with controls. COHb is constituted as an indirect measure of woodsmoke exposure, which acts as a sensitive and specic marker of atmospheric carbon monoxide produced from woodsmoke in both indoor and outdoor sources (Townsend & Maynard, 2002). Elevated but variable COHb levels have been seen in different animal models exposed to different types of woodsmoke. COHb levels have been increased up to 50% (Fujita & Nakanishi, 2007; Groneberg & Chung, 2004). In this study, COHb levels were comparable to those found in our emphysema model induced with 20 cigarettes/day in guinea pigs (Selman et al., 1996; Selman et al., 2003). BAL cell analysis showed a signicant increase in total cell recovered in woodsmoke-exposed animals (Figure 2A). Additionally, cell prole showed an increase in macrophages from 1 to 4 months, whereas neutrophils were increased from 4 to 7 months. Similar cellular changes have been described in guinea pig in animal models of emphysema induced by tobacco smoke as well as in emphysema patients (Groneberg & Chung, 2004; Shapiro, 2007; Sethi & Rochester, 2000; Sansores et al., 1997; Cisneros-Lira et al., 2003). This increase of macrophages and neutrophils is crucial in emphysema and other forms of COPD because these cells posses a secretor phenotype of MMPs and other ECM degradative enzymes, leading to turnover and destruction of lung tissue (Barnes et al., 2003; Ofulue et al., 1998). Histological analysis revealed the presence of moderate alveolar and phagocyte-mononuclear alveolar inammation. This inammation was prominent at 3 and 4 months and was associated with an increase in cells obtained from BAL, especially macrophages (Figure 2B), which are from the most abundant cells in COPD. Airways also showed alterations such as lymphocytic peribronchiolar inammation and epithelial and smooth muscle hyperplasia. Pulmonary arterial hyperplasia was noted at 6 and 7 months (Figure 3G). These histological changes have been observed in patients with COPD, especially emphysema secondary to domestic exposure to woodsmoke (Brauer et al., 1996; PerezPadilla et al., 1996; Diaz et al., 2006). Mild to moderate emphysematous lesions were revealed in lungs of woodsmoke-exposed guinea pigs from 4 to 7 months (Figures 3C and 3H), accompanied by rupture of the alveolar septa in the emphysematous lesions (Figure 3C). Emphysematous lesions were analyzed by MLI. Comparison showed MLI increased in lungs from woodsmoke-exposed 4 to 7 months (Table 2). Lesions obtained from woodsmoke exposure were similar to those of guinea pigs and humans exposed to tobacco smoke after 6 to 8 weeks of exposure to 20 cigarettes/day (Selman et al., 1996; Sansores et al., 1997) but were also similar to other emphysema models (Fehrenbach, 2006; Fujita & Nakanishi, 2007; Groneberg & Chung, 2004). Nevertheless, in this model the on-

set of emphysematous lesions occurred at after 4 months as we described previously. Human emphysema shows a similar behavior because tobacco smokers develop emphysema earlier than humans exposed to woodsmoke, although patients (especially women) exposed domestically to woodsmoke develop emphysema and other forms of COPD with clinical characteristics and quality of life similar to those of tobacco smokers (RamirezVenegas et al., 2006; Regalado et al., 2006). Results regarding ECM turnover revealed an increase in activity of several MMPs with woodsmoke exposure. Elastolytic activity was increased signicantly in macrophages obtained from BAL and lung tissue homogenates at all study times (Figure 4) probably due to MMP-12 as shown by EDTA inhibition. This activity was concomitant with an increase in BAL macrophages, and neutrophils in woodsmoke-exposed animals, suggesting the participation of macrophages and neutrophils in this active emphysematous process similar to experimental and human tobacco-induced emphysema (Barnes et al., 2003; Yoshida & Tuder, 2007). The increase in elastolytic activity due to macrophages and neutrophils has been extensively analyzed in interstitial and BAL cells in cigarette smoke-induced emphysema in rats, showing the participation of elastolysis as an essential mechanism for emphysema (Ofulue et al., 1998; Shapiro, 1999). Additionally, an increase of elastolysis in BAL and interstitial macrophages derived from emphysema models induced by tobacco smoke in guinea pigs and patients exposed to woodsmoke has been shown (Montano et al., 2004; Sansores et al., 1997), comparable to our results. Conversely, elastases have the capacity to degrade gelatin, collagen IV, bronectin, laminin, vitronectin, proteoglycan type IV, consequently acting in overall degradation of ECM (Shapiro et al., 2003). Furthermore, this affects basement membranes from endothelia and epithelia, which are predominantly injured in emphysema and COPD. Collagenolysis, another important component of tobaccoinduced emphysema, also was increased at 4 to 7 months (Figure 5), showing the signicant role of this MMP, as occurs in human and animal tobacco-induced emphysema (Selman et al., 1996). Similarly, an increase in gelatinolysis associated with active MMP-2 and MMP-9 was established in both BALF and lung tissue at 4 and 7 months when the primary emphysematous lesions were developed (Figure 6). This is also comparable to cigarette-induced emphysema (Barnes et al., 2003) and human COPD (Segura-Valdez et al., 2000). Additionally, gelatinolysis due to MMP-2 and MMP-9 in BAL from patients exposed to woodsmoke has been demonstrated (Montano et al., 2004). Gelatinolysis due to MMP-9 and MMP-2 is signicantly associated with basement membrane turnover and degradation, determining accordingly the progression of emphysema. MMP9 was increased at 4 to 7 months in exposed animals, when emphysematous lesions were observed (Segura-Valdez et al., 2000). MMP expression analysis by real-time PCR corroborated the presence of MMPs, showing an increased expression

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA

131

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

of MMP-2 and MMP-9 (Figure 8). Similarly, MMP-1 and MMP9 immunostaining were increased in exposed animals (Figure 7). This supports their presence in macrophage, epithelial and interstitial cells, which seem to participate in ECM degradation in this emphysema model. Expression and activities of MMP-2, MMP-9, and MMP-12 have been shown in BAL macrophages from patients exposed to woodsmoke (Montano et al., 2004) and also in parenchyma of COPD patients (Segura-Valdez et al., 2000). Apoptosis, another important pathogenic mechanism recently associated with emphysema, was also increased in both macrophage and epithelial cells from woodsmoke exposed animals (Figure 9), similar to tobacco-induced emphysema (Fehrenbach, 2006). Recently an emphysema model induced by apoptosis induction with caspase-3 instillation was developed, showing that apoptosis alone is enough to induce emphysematous lesions (Demedts et al., 2006). In conclusion, this study demonstrates that subchronic exposure to woodsmoke produces effects similar to tobacco smoke, showing inammatory lesions comparable to emphysema and accompanied by an increase in MMP activity and expression, as well as apoptosis. The presence of these enzymes in the respiratory tract seems to be responsible for degradation of the basement membrane and interstitial ECM. This study also conrms the utilization of the guinea pig in lung pathology models because it induces emphysematous lesions similar to those obtained in humans and guinea pigs exposed to tobacco smoke (Fujita & Nakanishi, 2007; Selman et al., 1996). However, the time for emphysematous lesions to develop with woodsmoke exposure is longer than tobacco smoke. Woodsmoke needs about 4 months to develop similar emphysematous lesions as opposed to those observed after 6 to 8 weeks in a model developed in our laboratory with 20 cigarettes/per day (Selman et al., 1996; Selman et al., 2003). REFERENCES
Barnes, P. J., Shapiro, S. D., and Pauwels, R. A. 2003. Chronic obstructive pulmonary disease: Molecular and cellular mechanisms. Eur. Respir. J. 22:672688. Barnes, P. J. 2004. Mediators of chronic obstructive pulmonary disease. Pharmacol. Rev. 56:515548. Brauer, M., Bartlett, K., Regalado-Pineda, J., and Perez-Padilla, R. 1996. Assessment of particulate concentrations from domestic biomass combustion in rural Mexico. Environ. Sci. Technol. 30:104 109. Celli, B. R., and MacNee, W., with Committee Members: Standards for the Diagnosis and Treatment of Patients with COPD. (2004). A summary of the ATS/ERS position paper. Eur. Respir. J. 23:932946. Cisneros-Lira, J., Gaxiola, M., Ramos, C., Selman, M., Pardo, A. 2003. Cigarette smoke exposure potentiates bleomycin-induced lung brosis in guinea pigs. Am. J. Physiol. Lung Cell Mol. Physiol. 285:L949 56. Delgado, J., Martinez, L. M., Sanchez, T. T., Ramirez, A., Iturria, C., and Gonzalez-Avila, G. 2005. Lung cancer pathogenesis associated with wood smoke exposure. Chest 128:124131.

Demedts, I. K., Demoor, T., Bracke, K. R., Joos, G. F., and Brusselle, G. G. 2006. Role of apoptosis in the pathogenesis of COPD and pulmonary emphysema. Respiratory Research 7:53. Desai, M. A., Mehta, S., and Smith, K. R. 2004. Indoor smoke from solid fuels: Assessing the environmental burden of disease at national and local levels (WHO Environmental Burden of Disease Series, No. 4). Geneva: World Health Organization. Diaz, J. V., Jonathan, K., Gotway, M. B., Nishimura, S., and Balmes, J. R. 2006. Case report: A case of wood-smoke-related pulmonary disease. Environ. Health Perspect. 114:759:762. Fehrenbach, H. Animal models of pulmonary emphysema: A stereologists perspective. 2006. Eur. Respir. Rev. 15:136147. Fujita, M., and Nakanishi, Y. 2007. The pathogenesis of COPD: Lessons learned from in vivo animal models. Med. Sci. Monit. 13(2):RA19 24. Groneberg, D. A., and Chung, K. 2004. Models of chronic obstructive pulmonary disease. Respiratory. Research. 5:18. March, T. H., Wilder, J. A., Esparza, D. C., Cossey, P. Y., Blair, L. F., Herrera, L. K., McDonald, J. D., Campen, M. J., Mauderly, J. L., Seagrave, J. 2006. Modulators of cigarette smoke-induced pulmonary emphysema in A/J mice. Toxicol. Sci. 92:54559. Matthew, E., Warden, G., and Dedman, J. 2001. A murine model of smoke inhalation. Am. J. Physiol. Lung. Cell. Mol. Physiol. 280:L716-L723. Montano, M., Beccerril, C., Ruiz, V., Ramos, C., Sansores, R. H., and Gonzalez-Avila, G. 2004. Matrix metalloproteinases activity in COPD associated with wood smoke. Chest. 125:466472. Naeher, L. P., Brauer, M., Lipsett, M., Zelikoff, J. T., Simpson, C. D., Koenig, J. Q., and Smith, K. R. 2007. Woodsmoke health effects: A review. Inhalat. Toxicol. 9:67106. Ofulue, A. F., Ko, M., and Abboud, R. T. 1998. Time course of neutrophil and macrophage elastinolytic activities in cigarette smokeinduced emphysema. Am. J. Physiol. Lung Cell Mol. Physiol. 275:11341144. Pardo, A., Selman, M., Ridge, K., Barrios, R., and Sznajder, I. J. 1996. Increased expression of gelatinases and collagenase in rat lungs exposed to 100% oxygen. Am. J. Respir. Crit. Care Med. 154:1067 1075. Pardo, A., Gibson, K., Cisneros, J., Richards, T. J., Yang, Y., Becerril, C., Yousem, S., Herrera, I., Ruiz, V., Selman, M., and Kaminski, N. 2005. Up-regulation and probrotic role of osteopontin in human idiopathic pulmonary brosis. PLoS Med. 2(9):e251. Pardo, A., and Selman, M. 2005. MMP-1: The elder of the family. Int. J. Biochem. Cell. Biol. 37:283288. Pardo, A., and Selman, M. 2006. Matrix metalloproteases in aberrant brotic tissue remodeling. Proc. Am. Thorac. Soc. 3:383388. Perez-Padilla, R., Regalado, J., Vedal, S., Pare, P., Chapela, R., Sansores, R., and Selman, M. 1996. Exposure to biomass smoke and chronic airway disease in Mexican women: A case control study. Am. J. Respir. Crit. Care. Med. 154:701706. Ramirez-Venegas, A., Sansores, R. H., Perez-Padilla, R., Regalado, J., Velazquez, A., Sanchez, C., and Mayar, M. E. 2006. Survival of patients with chronic obstructive pulmonary disease due to biomass smoke and tobacco. Am. J. Respir. Crit. Care. Med. 73:393397. Ramos, C., Monta no, M., Becerril, C., Cisneros-Lira, L., Barrera, L., Ru z, V., Pardo, A., and Selman, M. 2006. Acidic broblast growth factor decreases -smooth muscle actin expression and induces apoptosis in human normal lung broblasts. Am. J. Physiol. Lung Cell. Mol. Physiol. 291:L871-L879.

132

C. RAMOS ET AL. smoke-induced lung emphysema in guinea pigs is associated with increased interstitial collagenase. Am. J. Physiol. 271:L734-L743. Selman, M., Cisneros-Lira, J., Gaxiola, M., Ramirez, R., Kudlacz, E. M., Mitchell, P. G., and Pardo, A. 2003. Matrix metalloproteinases inhibition attenuates tobacco smoke-induced emphysema in guinea pigs. Chest 123:16331641. Shapiro, S. D. 1999. The macrophage in chronic obstructive pulmonary disease. Am. J. Respir. Crit. Care. Med. 160:529532. Shapiro, S. D., Goldstein, N. M., Houghton, A. M., Kobayashi, D. K., Kelley, D., and Belaaouaj, A. 2003. Neutrophil elastase contributes to cigarette smoke-induced emphysema in mice. Am. J. Pathol. 163:23292335. Shapiro, S. D. 2007. Transgenic and gene-targeted mice as models for chronic obstructive pulmonary disease. Eur. Respir. J. 29:375378. Townsend, C. L., and Maynard, R. L. 2002. Effects on health of prolonged exposure to low concentrations of carbon monoxide. Occup. Environ. Med. 59:708711. Wright, J. L., and Churg, A. 2002. A model of tobacco smoke-induced airow obstruction in the guinea pig. Chest 121:188S191S. Yoshida, T., and Tuder, R. M. 2007. Pathobiology of cigarette smoke-induced chronic obstructive pulmonary disease. Physiol. Rev. 87:10471082.

Inhalation Toxicology Downloaded from informahealthcare.com by HINARI on 09/21/12 For personal use only.

Regalado, J., P erez-Padilla, R., Sansores, R., P aramo, R. J. I., Brauer, M., Par e, P., and Vedal, S. 2006. The effect of biomass burning on respiratory symptoms and lung function in rural Mexican women. Am. J. Respir. Crit. Care Med. 174:901905. Robbesom, A. A., Versteeg, E. M. M., Veerkamp, J. H., Krieken, J. H. J. M. V., Bulten, H. J., Smits, H. T. J., Willems, L. N. A., Herwaarden, C. L. A. V., Dekhuijzen, P. N. R., and Kuppevelt, T. H. V. 2003. Morphological quantication of emphysema in small human lung specimens: Comparison of methods and relation with clinical data. Mod. Pathol. 16:17. Sansores, R. H., Abboud, R. T., Becerril, C., Montano, M., Ramos, C., Vanda, B., Selman, M. L. 1997. Effect of exposure of guinea pigs to cigarette smoke on elastolytic activity of pulmonary macrophages. Chest 112:214219. Segura-Valdez, L., Pardo, A., Gaxiola, M., Uhal, B. D., Becerril, C., and Selman, M. 2000. Upregulation of gelatinases A and B, collagenases 1 and 2, and increased parenchymal cell death in COPD. Chest. 117:684694. Sethi, J. M., and Rochester, C. L. 2000. Smoking and chronic obstructive pulmonary disease. Clin. Chest Med. 21:6786. Selman, M., Montano, M., Ramos, C., Vanda, B., Becerril, C., Delgado, J., Sansores, R., Barrios, R., and Pardo, A. 1996. Tobacco