Você está na página 1de 12

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

7. CIDOS NUCLEICOS.
7.1. Concepto e importancia biolgica. 7.2. Nucletidos. Enlace fosfodister. Funciones de los nucletidos. 7.3. Tipos de cidos nucleicos. Estructura, localizacin y funciones. 7.1. Concepto e importancia biolgica. El trmino cido nucleico deriva de que son molculas que se comportan como cidos y porque se aislaron por primera vez en el ncleo celular. Estn compuestas por C, H, O, N y P. Nunca contienen S y el P no es ocasional (10%). Son macromolculas fibrilares, no ramificadas, presentes en todos los seres vivos. Son polmeros constituidos por la unin de molculas menores llamadas nucletidos, por tanto, los cidos nucleicos son polinucletidos. Se encuentran asociados a protenas, formando nucleoprotenas que constituyen los cromosomas de las clulas en divisin y la cromatina de las clulas en interfase. Pero no slo se localizan en el ncleo, sino que tambin se encuentran en tres estructuras celulares como mitocondrias, cloroplastos y ribosomas. Contienen la informacin codificada necesaria para que los seres vivos puedan completar sus ciclos biolgicos, as como las instrucciones precisas para la lectura de esta informacin. 7.2. Nucletidos. Los nucletidos son molculas que se pueden presentar libres en la Naturaleza o polimerizadas, formando cidos nucleicos (nucletidos nucleicos). Tambin pueden formar parte de otras molculas que no son cidos nucleicos (nucleotidos no nucleicos), como molculas portadoras de energa o coenzimas. A diferencia de las protenas, en las que las unidades constitutivas (aminocidos) son especies qumicas definidas, los nucletidos son ya molculas complejas, cuya hidrlisis proporciona: - base nitrogenada - aldopentosa - cido fosfrico Bases nitrogenadas. Llamadas as porque en su molcula poseen zonas capaces atraer protones, lo que les confiere carcter bsico. Son sustancias derivadas de dos compuestos qumicos: la purina y la

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

pirimidina. Las que derivan de la purina son las bases pricas. En los nucletidos vamos a encontrar, normalmente, dos base pricas: la adenina (A) y la guanina (G). Las que derivan de la pirimidina se llaman pirimidnicas. Tres son las bases pirimidnicas presentes en los cidos nucleicos: la citosina (C), la timina (T) y el uracilo (U). Las aldopentosas pueden ser Ribosa, que forma nucletidos libres y los nucletidos componentes del ARN, y Desoxirribosa, que forma los nucletidos componentes del ADN. Aparecen en los nucletidos como -furanosas. Conviene destacar que la nica diferencia entre ambas est en que en el carbono 2 de la desoxirribosa hay un hidrgeno (-H) en lugar del grupo alcohol (-OH). Los carbonos que constituyen las pentosas se renumeran, denominndolos con nmeros prima (5' por ejemplo), para no confundirlos en nomenclatura con los carbonos de la base nitrogenada.

www. um.es .es

El azcar y la base nitrogenada se unen entre s como se indica en las figuras formando un nuclesido. El enlace se forma entre el carbono anomrico del azcar y uno de los nitrgenos de la base nitrogenada, en concreto, el N1 si la base es pirimidnica y el N9 si la base es prica.. En la unin se forma una molcula de agua. Este enlace recibe el nombre de enlace -N-glucosdico. Se nombran aadiendo la terminacin osina si la base es prica e idina si la base es pirimidnica al prefijo que indica la base nitrogenada (cit, tim, ur, aden, guan). El prefijo desoxi se utiliza para los desoxirribonuclesidos (por ejemplo, adenosina, citidina, desoxiadenosina, desoxicitidina).

Santillana 2 Bach

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

Los nucletidos son los monmeros que constituyen los cidos nucleicos. Se forman cuando se unen el cido fosfrico y un nuclesido. Es una unin fosfoster entre un OH del cido fosfrico y el OH situado en el carbono 5 del azcar, con formacin de una molcula de agua. Segn el azcar sea la ribosa o la desoxirribosa, tendremos ribonucletidos o desoxirribonucletidos. La timina nunca forma parte de los ribonucletidos y el uracilo no forma parte de los desoxirribonucletidos. Se nombran anteponiendo la palabra cido y la terminacin ilico al prefijo que indica la base nitrogenada (cit, tim, ur, aden, guan). El prefijo desoxi se utiliza para los desoxirribonucletido (por ejemplo cido adenlico o cido desoxiadenlico). Tambin se nombran como el nuclesido del que derivan (quitndose la ultima a) aadindole la palabra fosfato (se suele representar con siglas (por ejemplo AMP, dAMP)). Dos nucletidos van a poder unirse entre s mediante un enlace fosfodister. Este enlace se forma entre un OH del cido fosfrico de un nucletido (C5) y el OH (hidroxilo) del C3 del azcar del otro nucletido con formacin de una molcula de agua. La unin de otros nucletidos dar lugar a un polinucletido (cido nucleico). Segn sea la aldopentosa que contenga, se Web de Jos Luis formar ADN (cido Snchez Guilln desoxirribonucleico) o ARN (cido ribonucleico). Constituidos por un esqueleto pentosafosfato del que irradian lateralmente las bases nitrogenadas. Es de destacar que en toda cadena de polinucletidos el nucletido de uno de los extremos tendr libre el OH del azcar en posicin 3, ste ser el extremo 3' de la cadena. El cido fosfrico del nucletido que se encuentre en el extremo opuesto tambin estar libre, ste ser el extremo 5'. Esto marca un sentido en la cadena de polinucletidos. Pero no todos los nucletidos forman parte de los cidos nucleicos, algunos aislados (nucletidos no nucleicos) realizan funciones como: actan como coenzimas en reacciones de oxido-reduccin (NAD+ (Nicotinamidaadenina-dinucletido), NADP+ (Nicotinamida-adenina-dinucletido-fosfato), FAD (Flavinaadenina-dinucletido)). Estas molculas captan electrones de molculas a las que oxidan y los ceden a otras molculas a las que a su vez reducen. As, el NAD+ puede captar 2etransformndose en su forma reducida, el NADH, y ste puede ceder dos electrones a otras sustancias, reducindolas y volviendo a transformarse en su forma oxidada, el NAD+. As, se transportan electrones de aquellas reacciones en las que se desprende a aquellas en las que se necesitan.

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

Oxford 2 Bach

FAD NAD+

actan como coenzimas energticos (ATP (adenosina-5'-trifosfato)). Se trata de molculas que captan o desprenden energa al transformarse unas en otras. As, el ATP desprende energa cuando se hidroliza, transformndose en ADP (adenosina-5'difosfato) y fosfato inorgnico (Pi). Por el contrario, Oxford 2 Bach el ADP almacena energa cuando reacciona con el fosfato inorgnico y se transforma en ATP y agua. De esta forma se transporta energa (unas 7 kilocaloras por mol de ADP/ATP) de aquellas reacciones en las que se desprende (exergnicas) a aquellas en las que se necesita (endergnicas). forman mensajeros secundarios en el interior de la clula (AMPc (AMP cclico)). Sirven de puente de unin entre las molculas extracelulares, portadoras de informacin, y el interior celular.
Oxford Bach Oxford 22 Bach

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

7.3. cidos nucleicos. 7.3.1. ADN (DNA). Concepto: Qumicamente son polinucletidos constituidos por la polimerizacin de d-AMP, dGMP, d-CMP y d-TMP. Los nucletidos del ADN no tienen ni uracilo, ni ribosa, como ya se ha dicho. Caractersticas: Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons. As, por ejemplo: el genoma humano est formado por 3x109 pares de nucletidos. Esto hace que sean molculas de una gran longitud; por ejemplo: 1,7 m en el caso del virus de la poliomielitis y 2,36 m si sumamos todo el ADN de todos los cromosomas de una clula humana. Localizacin: El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empez a conocer su estructura. Se encuentra en el ncleo de las clulas eucariotas asociado a protenas (histonas y otras) formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la informacin gentica. Tambin hay ADN en ciertos orgnulos celulares (por ejemplo: cloroplastos y mitocondrias). En procariotas se localiza en el protoplasma (nucleoide). ESTRUCTURA DEL ADN En medio acuoso, los largos filamentos de ADN adoptan al igual que las protenas, una estructura tridimensional o configuracin espacial distinguindose varios niveles estructurales de complejidad creciente, cada uno de ellos depende del anterior y a su vez, condiciona al siguiente. Se pueden distinguir 3 niveles estructurales: - Estructura primaria: La secuencia de los nucletidos. - Estructura secundaria: La doble hlice. - Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado. En las clulas eucariotas, a partir de la estructura 3, se dan otros niveles de empaquetamiento de orden superior. ESTRUCTURA PRIMARIA DEL ADN. Es la secuencia de nucletidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucletidos en la hebra o cadena de la molcula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto (individualidad) y los extremos 5' y 3' de la cadena nucleotdica (sentido o direccionalidad), ya que el esqueleto desoxirribosa-fosfato es comn para todos los ADN. As, por ejemplo: 5'ACGTTTAACGACAAGTATTAAGACAAGTATTAA3' La posibilidad de combinar cuatro nucletidos diferentes y la gran longitud que pueden tener las cadenas polinucleotdicas, hacen que pueda haber un elevado nmero de polinucletidos posibles, lo que determina que el ADN pueda contener el mensaje biolgico o informacin gentica y explica la diversidad del mensaje gentico de todos los seres vivos. ESTRUCTURA SECUNDARIA DEL ADN. Datos preliminares: 1. A finales de los aos 40 CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados:

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

a) La concentracin de bases vara de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo. b) La concentracin de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. Las dos primeras establecen dos puentes de hidrgeno entre ellas, y las ltimas tres puentes. Por tanto, la cantidad de purinas es igual a la cantidad de pirimidinas. 2. Por medio de difraccin de rayos X, FRANKLIN y WILKINS (1950-53) observaron una estructura fibrilar de 2 nm o 20 A (nanmetros/angstron) de dimetro con repeticiones cada 034 nm y una mayor cada 34 nm. 3. WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hlice. Este modelo, adems de explicar cmo era el ADN, sugera los mecanismos que explicaban su funcin biolgica y la forma como se replicaba. Segn el modelo de la doble hlice de WATSON y CRICK: 1) El ADN estara constituido por dos cadenas o hebras de polinucletidos enrolladas helicoidalmente en sentido dextrgiro sobre un mismo eje formando una doble hlice. 2) Ambas cadenas seran antiparalelas, una ira en sentido 3'5' y la otra en sentido inverso, 5'3'.

www. um. es

3) Los grupos fosfato estaran hacia el exterior y de este modo sus cargas negativas interaccionaran con los cationes presentes en el nucleoplasma dando ms estabilidad a la molcula. 4) Las bases nitrogenadas estaran hacia el interior de la hlice con sus planos paralelos entre s (a modo de peldaos de una escalera de mano) y las bases de cada una de las hlices estaran apareadas con las de la otra asocindose mediante puentes de hidrgeno. 5) El apareamiento se realizara nicamente
Web de Jos Luis Snchez

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

entre la adenina y la timina, por una parte, y la guanina y la citosina, por la otra. Por lo tanto, la estructura primaria de una cadena estara determinada por la de la otra, ambas cadenas seran complementarias. La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las clulas hijas. Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la sntesis de una nueva cadena complementaria (sntesis semiconservati va).

Santillana 2 Bach

Si una disolucin de ADN se calienta suficientemente ambas cadenas se separan, pues se rompen los enlaces de hidrgeno que unen las bases, y el ADN se desnaturaliza. La temperatura de desnaturalizacin depende de la proporcin de bases. A mayor proporcin de CG, mayor temperatura de desnaturalizacin, pues la citosina y la guanina establecen tres puentes de hidrgeno, mientras que la adenina y la timina slo dos y, por lo tanto, a mayor proporcin de C-G, ms puentes de hidrgeno unirn ambas cadenas. La desnaturalizacin se produce tambin variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo. Esta propiedad se puede utilizar para realizar tcnicas de hibridacin con ADN procedentes de distintas especies, y realizar estudios filogenticos.

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

ESTRUCTURA TERCIARIA DEL ADN EN LAS CLULAS EUCARIOTAS. Las grandes molculas de ADN de las clulas eucariotas estn muy empaquetadas ocupando as menos espacio en el ncleo celular y adems como mecanismo para preservar su transcripcin. Como hemos visto, en las clulas eucariotas el ADN se encuentra en el ncleo asociado a ciertas protenas: nucleoprotenas, formando la cromatina. En la cromatina, la doble hlice de ADN se enrolla alrededor de unas molculas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hlice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no est ms empaquetado an, forma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Segn el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1. NIVELES SUPERIORES DE EMPAQUETAMIENTO Los siguientes niveles de empaquetamiento no estn an aclarados del todo pero, parece ser, que cada fibra se volvera a enrollar formando un bucle (cada bucle tendra 50 millones de pares de bases), seis bucles se empaquetaran asocindose a un "esqueleto nuclear" producindose un rosetn, 30 rosetones formaran una espiral y 20 espirales formaran una cromtida. Todo ello producira un gran acortamiento de las largas cadenas de ADN. En los espermatozoides el ADN se encuentra an mucho ms empaquetado, se dice que tiene "estructura cristalina". Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tan complejas y no estn asociados a histonas, aunque s estn asociados a otras protenas.
Alberts y cols.

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

TIPOS DE ADN Segn su estructura se distinguen los siguientes tipos de ADN: - Monocatenarios o de una cadena; por ejemplo los de algunos virus. - Bicatenarios, con dos hebras o cadenas (el resto de los virus, las bacterias y los eucariotas). A su vez, y en ambos casos, el ADN puede ser: - Lineal, como por ejemplo el del ncleo de las clulas eucariotas y el de algunos virus. - Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus. 7.3.2. ARN (RNA). DIFERENCIAS CON EL ADN. El ARN, cido ribonucleico, es un polirribonucletido que, a diferencia del ADN, no contiene ni desoxirribosa ni timina, pero s ribosa y uracilo. El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los retrovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja. Es ms abundante que el ADN, en eucariotas existe de 5 a 10 veces ms ARN que ADN. Al poseer ribosa lleva en su C2 un grupo hidroxilo libre, lo que lo hace qumicamente menos estable que el ADN. En un tipo de ARN (ARNt), adems de las cuatro bases nitrogenadas tpicas, existen otros compuestos nitrogenados. Hoy sabemos que el ARN tambin puede ser el portador de la informacin gentica como ocurre en algunos virus. CLASES DE ARN Todos los tipos de ARN se obtienen a partir del ADN en un proceso conocido como transcripcin. En eucariotas ocurre en el ncleo. Por su estructura y su funcin se distinguen tres clases de ARN: ARNm (ARN mensajero). Es un polirribonucletido constituido por una nica cadena sin ninguna estructura de orden superior. Su masa molecular suele ser elevada. Constituye entre un 3-5 % del total del ARN. Este ARN se sintetiza en el ncleo celular (eucariotas) y pasa al citoplasma transportando la informacin para la sntesis de protenas. La duracin de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rpidamente por enzimas especficas. En eucariotas se forma a partir de un transcrito primario o pre-ARNm. ste posee una serie de segmentos con informacin llamados exones, alternados con otros sin informacin denominados intrones, que luego son suprimidos y no aparecen en el ARNm. Este proceso se llama maduracin y se produce en el ncleo celular. En el extremo 5 llevan el cap o caperuza que consiste en metilguanosinatrifosfato (mGTP), y en el extremo 3 una cola de 150-200 nucletidos de adenina

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

(poli A) que probablemente les protege contra las exonucleasas y les ayuda en el transporte. En procariotas no hay maduracin y en el extremo 5 llevan un grupo trifosfato. El ARNm procaritico es policistrnico (lleva informacin de varios genes), mientras que el de eucariotas es monocistrnico). ARNt (ARN de transferencia o transferente). Transporta los aminocidos para la sntesis de protenas. Se sintetiza en el ncleo y sale hacia el citoplasma para realizar su funcin: lleva los aminocidos desde el citoplama, donde se hallan disueltos, hasta el ribosoma. Est formado por una sola cadena, aunque en ciertas zonas se encuentra replegada y asociada internamente mediante puentes de hidrgeno entre bases complementarias. Tiene forma de hoja de trbol, con cuatro brazos, de especial significado el brazo anticodn (bucle) y el brazo aceptor de aminocidos (abierto). El brazo anticodn se denomina as porque lleva tres bases complementarias de los codones presentes en el ARNm. En el brazo aceptor se localizan los dos extremos de la molcula; el extremo 5 siempre lleva una G y en el 3CCA (lugar de unin con el aminocido). Su imagen real espacial es la de una L invertida o de boomerang. Adems de A, G, C y U contiene bases modificadas (Pseudouridina, inosina, ribotimidina, metilguanosina) que pueden llegar a suponer hasta un 10% del total de bases. Su peso molecular es del orden de 25.000 da (molculas pequeas). Est formado por entre 70 y 90 nucletidos y constituye el 15 % del total del ARN de la clula.

Santillana 2 Bach

ARNr (ARN ribosmico) Es el ARN de los ribosomas. Son molculas de diferente tamao con zonas de plegamiento en algunas regiones de la molcula. Participan en la formacin de las subunidades ribosmicas al unirse a las protenas ribosmicas. El ARNr contribuye a que los ribosomas presenten la forma adecuada para dar alojamiento al ARNm y a los aminocidos unidos a sus ARNt. El ARNr es el tipo ms abundante, representa del 80-85 % del ARN total de la clula.

10

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

Como criterio de clasificacin se utiliza el peso molecular medio de los ARNr, cuyo valor se deduce de la velocidad con que sedimentan en un campo centrfugo. Existen distintos tipos de ARNr que se diferencian por su coeficiente de sedimentacin. El coeficiente de sedimentacin es directamente proporcional a la velocidad con que sedimenta la partcula. Se expresa en Svedberg (S). Un Svedberg es igual a 10-13 segundos; no obstante, aunque se expresa en segundos, se trata de una velocidad relativa. El coeficiente de sedimentacin depende principalmente del tamao y de la forma de la molcula.
Santillana 2 Bach

ARNn (ARN nucleolar). En el nucleolo se sintetiza un ARN 45S que el precursor de los ARNr mayores (25S, 18S y 58S). El fragmento de ARNr 5S no se obtiene del 45S, sino que se origina en el nucleoplasma, no en el nucleolo.
Santillana 2 Bach

11

Departamento de Biologa y Geologa IES Francisco Pacheco

Jos M Molina Garca

12