B I O L O G Y 1002B

March 17, 2013

Student number

Time: 2 Hours
Room Row

Print Name _____________________________________________________

INSTRUCTIONS - FOLLOW
( ) Print name Signature Instructor Course Student number Exam Code Section Answer Sheet ( ) On your Scantron sheet Print clearly Do your best Haffie Bio 1002B Print clearly/ Bubble neatly 111 Very important Leave it blank Leave it blank

THE CHECK LIST

Fill the bubbles completely Use HB pencil only No stray marks or doodles Make all erasures complete Yes - Calculators are permitted (non-programmable only) No Borrowing is not allowed

On your Test Book Student number Legibly please Name Print your name Test Room The room youre in right now Row number We will tell you this Indicate your answers in the test book. Leave no questions blank. Please place your ID prominently on your desk and sign the attendance sheet when it comes to you. There are 11 pages in this test. Check your paper carefully. There is only one fully correct answer for each question. Part marks may be awarded. Answer all questions. We do not subtract wrong from right. 4) 5) 6)

Scantron answers will be emailed to you. Marks will be posted to OWL after all tests are finished.

1) 2) 3)

Indicate your answers in both the test paper and on the Scantron. It is your responsibility to transfer all answers from the test book to the Scantron sheet within the 2 hour test period. When finished, please stay seated and raise your hand. We will collect both your test book and Scantron sheet.

Warning

The Scantron marking program has a cheating analysis feature that compares answer patterns for all papers. It alerts us to similarities. We then check seating arrangements. Do not sit near your study partners or write the same test codes. Keep your work directly in front of you. Please help us avoid any and all misunderstandings during these tests

Clarifications: Q# 40 Ans D

Please defend your arguments on this page only. Comments will not be accepted after the test.

Clarification If you mean Denis has a dog named Watson, then my answer changes

Alt Ans B

March 2013

Biology 1002B

Page 1 of 11

Circle the best single letter choice for each of the following questions before transferring your answers to your computer sheet. Note: Questions may have 3, 4 or 5 choices. 1. One of the key transitions in the development of life occurred after the rise in O2 concentration in the atmosphere. What was the main source of this O2? A. B. C. D. 2. Respiration in archaea and bacteria. Respiration in early eukaryotes. Photosynthesis in bacteria. Photosynthesis in chloroplasts. Membrane surface area and cell volume are two physical variables that are relevant in explaining the difference in size and complexity between prokaryotic and eukaryotic cells. Which of the following statements about these variables is correct? 1. The ratio of plasma membrane area to total cell volume increased in early eukaryotes which allowed for greater morphological complexity. 2. The total membrane area dedicated to oxidative phosphorylation is greater in eukaryotes. 3. Although physically smaller, prokaryotic cells have more total cell volume than a typical eukaryotic cell. 4. In prokaryotic cells, the membrane location of ATP synthase is the same as that for lactate transport. A. B. C. D. E. 3. 1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct Genomes sizes among related eukaryotes vary much more widely than genome sizes among related bacteria. How is this difference in variability best explained? A. Evolutionary processes (e.g. natural selection) exert less constraint on genome size in eukaryotes than in bacteria. B. Genome size is proportional to energy production - cells that make more ATP have more DNA. C. Eukaryotes have a much wider range of chromosome number than bacteria. D. Organisms with greater morphological complexity have larger genomes. 4. A. B. C. D. Is it true that all known eukaryotes have mitochondria? Yes, but some eukaryotes have mitochondria that do not contain DNA. Yes, but some have only one mitochondrion per cell. No, but all eukaryotes contain mitochondria-derived genes. No, but those that don't contain mitochondria contain chloroplasts instead.

Code 111

Code 111

Code 111

March 2013 5.

Biology 1002B

Page 2 of 11

Once endosymbiosis was first established, it appears that selection favoured organisms with smaller organelle genomes over evolutionary time. As a result, modern organelle genomes are greatly diminished in size relative to those of free-living bacteria. Which of the following is a likely explanation for why diminished genome size would have been favoured? 1. Organelle proteins are smaller, requiring fewer amino acids. Therefore selection has favoured organisms with fewer tRNA genes in organelles. 2. Proteins that are rapidly damaged by reactive oxygen species (ROS) can be replaced more efficiently if their genes are located in the nucleus. Therefore, selection has favoured organisms where these genes have transferred out of the organelles into the nucleus. 3. Organelles have typical prokaryotic gene structure. Therefore, selection has favoured organisms in which organelle genes have lost their introns. 4. Following endosymbiosis, several genes would have been present in both the organelle and nuclear genomes. Therefore, selection has favoured organisms that lost the organelle copy of such redundant genes.

A. B. C. D. E. 6.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct Human mitochondrial genomes code for 37 genes but mitochondria produce only 13 proteins. What would most likely account for mitochondrial genomes having more genes than needed to code for the proteins produced?

A. Several genes code for products that are not translated. B. Several genes have been inactivated over evolutionary time and no longer code for proteins. C. Several genes, and the proteins they code for, are of viral origin. They are not human mitochondrial genes. D. Several genes are coded on both the top and bottom strands of DNA. Therefore they code for the same proteins. 7. A. B. C. D. Which of the following sequences in template DNA would likely code for a hairpin transcription terminator loop? 3 GCCCAAAGCTAGCTATTTGGGC 3 GCGCGCGCGCATATATATATAT 3 ATGCATGCTACGTACGTACGTA 3 AUGCAUGCUAAUGCAUGCUAA

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 3 of 11

8.

The rps10 gene codes for one of several protein components of the chloroplast ribosome. This gene is found in the nuclear genome in some flowering plant species but remains in the chloroplast genome of other species. If the rps10 gene arrived in the nucleus in its DNA form, it contained several associated signals related to its expression. Which of the following signals would have been present on rps10 and likely functional in the nuclear/cytoplasmic environment? 1. 2. 3. 4. enhancer promoter SD box start codon

A. B. C. D. E. 9.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct Using the section of the genetic code below, identify the sequence of DNA template that would code for the polypeptide sequence of Pro-His-Arg.

A. B. C. D.

3CCACAACGG5 3GGTGTGGCT5 3GGUGUGGCU5 3CCTCATCGT5

10. Some viruses that infect E. coli produce an anti-terminator protein that causes RNA polymerase to ignore the termination signal of one virus gene and continue transcribing right into the next gene. What might this anti-terminator protein do? A. Bind to DNA, causing a loop that prevents the RNA polymerase from reaching the termination signal in DNA. B. Bind to mRNA to prevent it from complementary base pairing with itself at the terminator signal. C. Bind to the termination factor, keeping it away from ribosomes that reach the stop codon. D. Bind to the polyadenylation signal, preventing the action of the RNAase clipping enzyme.

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 4 of 11

11. Which of the following features is a characteristic of tRNA anticodons? 1. 2. 3. 4. A. B. C. D. E. Are catalytic, making the tRNA a ribozyme. For the codon of 5UAA, there is a complementary anticodon 3AUU. Bind to specific amino acids. Can be coded in DNA of mitochondrial genomes.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

12. Although most genes have been lost from mitochondria since the original endosymbiosis was established, some remain in the mitochondrial genome. Which of the following genes would you most likely find remaining in modern plant mitochondria? A. B. C. D. E. components of Rubisco cytochrome C snRNA polyA polymerase None, modern plants dont have mitochondria.

13. Ribosomes are ribonucloprotein particles in that they are composed mostly of rRNA with some associated ribosomal proteins. How would the genes coding for ribosomal RNAs be different than the genes coding for ribosomal proteins? A. B. C. D. Only the protein coding genes would have transcription termination signals. Only the RNA coding genes would have anticodons. Only the protein-coding genes would have polyT sequences giving rise to polyA tails. Only the protein-coding genes could suffer a nonsense mutation.

14. Modern Chlamydomonas cells contain one large chloroplast that requires thousands of proteins. Where are these chloroplast proteins translated? 1. 2. 3. 4. A. B. C. D. E. On the rough endoplasmic reticulum. Inside the chloroplast. In the nucleus. In the cytoplasm.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 5 of 11

15. This picture of the structure and expression of the lac operon, showing the coding regions of lacI, Z, Y and A genes, in a different style than youve seen before.

If you were to label the location of the transcription terminator sequence in this image, how many would there be in DNA?

A. B. C. D.

1 2 3 4

16. This Figure shows the activity of the galactosidease enzyme (coded by LacZ gene) in a mutant strain of E. coli relative to a normal strain. Mutant (dotted line); Normal (solid line); Arrow indicates the addition of lactose to the growth medium. Which sequence is likely affected by this mutation?

1. 2. 3. 4. A. B. C. D. E.

SD box of operon mRNA, such that translation efficiency is decreased. lacY, such that lactose is not transported into the cell as well. lacZ gene, such that the enzyme has a lower affinity for substrate. lacI gene, such that the repressor has a lower affinity for DNA.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 6 of 11

17. We discussed three types of boxes that are present as signals in DNA. Which of the following boxes is transcribed? 1. homeobox 2. TATA box 3. SD box A. B. C. D. 1 and 3 2 and 3 3 only All of 1,2 and 3

18. If you imagine a messenger RNA molecule in the cytoplasm of a zebra cell, which of the following will likely affect how much protein is made by translation of this message? A. B. C. D. The presence of appropriate snRNPs. The length of the polyA tail. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.

19. Promoters, promoter-proximal regions and enhancers are important regulatory sequences for many eukaryotic protein-coding genes. Which of the following characteristics do these three different sequences have in common? 1. 2. 3. 4. A. B. C. D. E. Understood by the cell as double-stranded DNA. Mutations in their sequence may result in increased gene expression. Contain binding sites for proteins. Must be upstream of the gene they influence.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

20. There are a variety of mechanisms of genetic regulation that all fall under the broad category of RNA interference (RNAi). When does this category of regulation occur during gene expression? A. before/during transcription B. after transcription; before/during translation C. after translation

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 7 of 11

21. Imagine that a methylation survey reveals that the region of DNA shown in this picture is frequently methylated in the brain cells of biology students who do not attend lectures but is not methylated in brain cells of students who regularly attend lectures. What type of sequence do you see in this DNA? A. B. C. D. promoter-proximal region start codon zinc-finger domain of gene coding a transcription factor intron splice signal

22. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to normal such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). 1. 2. 3. 4. A. B. C. D. E. Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

23. Complementary DNA (cDNA) is frequently created during genetic engineering projects by allowing reverse transcriptase to make double-stranded DNA from mature mRNA. Imagine collecting mature mRNA from the cytoplasm of adult Drosophila wing cells and reverse transcribing it all into a collection of double-stranded cDNAs. Which of the following signals would you likely find (as DNA) among this collection of cDNAs? 1. 2. 3. 4. A. B. C. D. E. promoter Reaper gene start codon intron 3UTR

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 8 of 11

24. The figure below shows four genes in the genome of a goldfish. Shaded areas represent the binding site at each genes enhancer region for 6 different activator proteins.

Assuming that an enhancer is only functional if all activator proteins are bound, which pair of genes can be selectively enhanced in a specific tissue without enhancing the remaining two genes? 1. 2. 3. 4. A. B. C. D. E. Genes Genes Genes Genes L L T T and and and and W P P W

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

25. Which of the following cellular components is created on one side of the nuclear membrane but functions on the other side? 1. 2. 3. 4. A. B. C. D. E. snRNA microRNA peptide tag that targets proteins to mitochondria histone deacetylase

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

26. Which of the following statements is consistent with the claim multi-cellularity is polyphyletic? A. Multicellular plants are closely related to multicellular animals; unicellular plants are closely related to unicellular animals. B. Unicellular organisms have a common ancestor but multicellular organisms do not. C. The common ancestor of all modern multicellular organisms was unicellular. D. All unicellular organisms have the necessary genes to be multi-cellular.

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 9 of 11

27. In what way are identical twins not likely identical with respect to DNA and its expression? 1. One twin might be homozygous for a missense mutation; the other twin might be heterozygous for this mutation. 2. One twin might show higher heritability for disease than the other twin. 3. One twin might inactivate one X chromosome; the other twin might inactivate both X chromosomes. 4. One twin might make different gametes during meiosis than the other twin. A. B. C. D. E. 1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

28. In class we made predictions about what information comparative genomic studies would reveal about the genomes of Chlamydomonas vs. Volvox. Which of the following predictions for a relatively dramatic increase in the Volvox genome was supported by the data? A. B. C. D. number of total base pairs average number of genes in gene families average number of base pairs per gene number of chromosomes

29. This image shows the main gene products involved in programmed cell death in the nematode worm model system, C. elegans.

If you discovered a mutant worm that did not show programmed cell death during development, where might the mutation be?

1. Loss of function of death signal receptor gene (no binding of death signal). 2. Loss of function of CED 4 (no interaction with CED 3) 3. Loss of function of CED 3 (no enzyme activity). 4. Loss of function of CED 9 gene (insensitive to signals from receptor). A. B. C. D. E. 1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 10 of 11

30. Recall that a concentration gradient of BICOID protein in fertilized Drosophila eggs establishes the anterior-posterior axis of developing embryos. Failure of this mechanism is lethal because embryos do not develop a head. If you imagine a male and female fly, both heterozygous for the same severe nonsense mutation in the bicoid gene, what would happen to their homozygous recessive bicoid/bicoid mutant offspring? A. The homozygous recessive offspring would all die as headless embryos. B. The homozygous recessive male and female offspring would all survive to adulthood but all of their offspring would die as headless embryos. C. The homozygous recessive female offspring would survive to adulthood but only their offspring would die as headless embryos. D. The homozygous recessive male offspring would survive to adulthood but only their offspring would die as headless embryos. 31. This figure speculates on the possible arrangement of homeobox-containing genes in a hypothetical common ancestor of Drosophila, Amphioxus (amphibian) and Mouse. (Note that, in mouse, the genes are present on four different chromosomes.) Which pair of genes is orthologous? A. B. C. D. S S S T and and and and T V W (on Amphioxus) V

32. In a chromatography investigation, which of the following data would you need if you wanted to compare the Rf of a particular chlorophyll vs a particular carotenoid? 1. 2. 3. 4. A. B. C. D. E. Distance travelled by the chlorophyll. Distance travelled by the solvent. Distance travelled by the carotenoid. Average distance travelled by all chlorophylls and carotenoids.

1,2 and 3 1 and 3 2 and 4 4 only All of 1,2,3 and 4 are correct

Code 111

Code 111

Code 111

March 2013

Biology 1002B

Page 11 of 11

33. In response to shortened day length and cool temperatures, many trees begin a period of senescence when the breakdown of chlorophyll exceeds chlorophyll production. The leaves of these trees change colour from green to yellow and orange. Based on your knowledge from the photosynthesis lab, which of the following explanations for this change is most likely? A. Total pigment production decreases at this time such that only yellowish to orange wavelengths of light are reflected. B. Chlorophyll breakdown at this time allows additional yellowish to orange pigments to become visible. C. When chlorophyll breaks down during this time, it appears yellowish to orange. D. Chlorophylls that are yellowish to orange are produced during this time. 34. After the fermentation lab, Jamal and Laura decided to make some alcohol at home by mixing table sugar with water and adding yeast. Although the fermentation got off to a good start, it stopped before all of the sugar was consumed. What should Jamal and Laura do differently in their second batch to prevent wasting sugar? A. B. C. D. Add more yeast. Reduce the sugar in the starting mix. Add some sodium dodecyl sulfate. Keep stirring the mix during fermentation to get more oxygen in.

35. The relationship between Elysia and Vaucheria makes an interesting story for educational outreach. Which of the following characteristics is found in this system? A. An animal that makes its own reduced carbon. B. An algae that grows photosynthetically, even after its chloroplasts have been stolen. C. An underwater plant that makes oxygen by photosynthesis and then uses the oxygen as a terminal electron acceptor in respiration. D. A chloroplast that functions without any genes.

Code 111

Code 111

Code 111