Você está na página 1de 3

22 Azevedo FM, Mitne M, Magalhães VD

ARTIGO ORIGINAL

O uso de uma nova ferramenta de amplificação para o


diagnóstico molecular de amostras difíceis
The use of a novel amplification tool for molecular diagnosis of challenging samples*
Fátima de Melo Azevedo1, Melissa Mitne2, Vanda Dolabela de Magalhães3

ABSTRACT INTRODUÇÃO
Objective: To obtain adequate amounts of starting material to be Uma questão fundamental no diagnóstico molecular
used in molecular diagnosis. Methods: Isothermal ramification é a detecção de seqüências específicas de DNA. A
amplification. Results: Water samples where Legionella spp was reação em cadeia de polimerase (PCR) tem sido
diluted and small amount of human DNA from HIV infected patients
extensamente usada para amplificar seqüências
were submitted to a new amplification technology (GenomiPhi®
kit). Those samples that were previously negative upon PCR
definidas, em laboratórios clínicos e de pesquisas(1). Na
became positive after the treatment. Conclusion: The new PCR convencional, primers específicos hibridizam-se
technology allows for molecular assays to be performed in samples com bases complementares na molécula-alvo,
of reduced volumes or low concentration. permitindo que as polimerases de DNA repliquem
exponencialmente o fragmento. Contudo, às vezes, o
Keywords: Legionella/isolation & purification; Legionella/growth material genético presente em amostras clínicas não
& development; Molecular diagnostic techniques/methods; HIV está disponível em quantidade e/ou qualidade
suficiente, impedindo a amplificação. As propriedades
da DNA polimerase isolada de um bacteriófago (Phi29)
RESUMO
foram exploradas visando superar essas limitações. Essa
Objetivo: Obter quantidades adequadas de material inicial para enzima é capaz de usar primers hexâmeros e suporta a
ser utilizado em diagnóstico molecular. Métodos: Amplificação
síntese por deslocamento de fita. A atividade
isotérmica e ramificada. Resultados: Amostras de água onde
Legionella spp se encontrava diluída e pequena quantidade de proofreading (correção de erros) da exonuclease 3’-5’
DNA humano extraído de paciente com infecção por HIV foram resulta em DNA amplificado com maior fidelidade
submetidas a uma nova tecnologia de amplificação (kit quando comparado à Taq DNA polimerase, a enzima
GenomiPhi®)). Essas amostras, que haviam apresentado resultado padrão usada na maioria das reações de PCR(2). Essa
negativo na PCR realizada anteriormente, tornaram-se positivas polimerase altamente processiva faz parte de um kit
após o tratamento. Conclusão: A nova tecnologia permite a comercial (GenomiPhi®, Amersham Biosciences) que
realização de ensaios moleculares em amostras de volume reduzido permite amplificação representativa de todo o genoma.
ou baixa concentração.
Nesse processo de amplificação, os primers
Descritores: Legionella/isolamento & purificação; Legionella/ hexâmeros hibridizam com o molde (template) em
crescimento & desenvolvimento; Técnicas de diagnóstico múltiplos pontos e a polimerização isotérmica tem
molecular/métodos; HIV início. À medida que a reação prossegue, uma nova
fita complementar é deslocada e gera um novo DNA
de fita simples. Essa fita fica então disponível para

* Trabalho apoiado pela FAPESP e pelo IEP - Instituto de Ensino e Pesquisa Albert Einstein.
* Trabalho financiado pelo CNPq Nº 522552/95-1 e pela FAPESP Nº 02/08460-6.
1
PhD, Centro de Pesquisa Experimental, Instituto de Ensino e Pesquisa Albert Einstein.
2
Centro de Pesquisa Experimental, Instituto de Ensino e Pesquisa Albert Einstein.
3
PhD, Centro de Pesquisa Experimental, Instituto de Ensino e Pesquisa Albert Einstein.
Endereço para correspondência: Vanda Dolabela de Magalhães - Instituto de Ensino e Pesquisa - HIAE - Av. Albert Einstein, 627/701 - Morumbi - CEP 05651-901 - São Paulo (SP), Brasil.
Tel.: (55 11) 3747-1343- Fax: (55 11) 3747-0208 - e-mail: vanda@einstein.br
Recebido em 11 de janeiro de 2004 - Aceito em 14 de fevereiro de 2004

einstein. 2004; 2(1):20-2


O uso de uma nova ferramenta de amplificação 23

ligação pelos novos primers. Esse tipo de reação produz X PCR (Amersham Biosciences), 0,5 µM de cada primer
uma estrutura ramificada. As repetições de priming e (K1–5’CAGAGCCAACAGCCCCACCA e K2–5’
deslocamento resultam em DNA amplificado de dupla- TTTCCCCACTAACTTCTGTATGTCATTGACA), 0,2
fita de alto peso molecular (figura 1). mM de cada dNTP e 2,5 U de Taq polimerase
Descrevemos, a seguir, a utilização do kit (Amersham Biosciences). O molde do DNA foi
GenomiPhi ® para amplificação de amostras de desnaturado a 94°C por 10 minutos e um total de 35
Legionella spp diluídas em água e HIV de amostras de ciclos foi realizado, consistindo de 94°C por 45
tamanho limitado. A primeira tentativa de amplificar segundos, 55°C por 45 segundos para hibridização dos
esses patógenos por PCR diretamente a partir das primers e 72°C para extensão durante 2 minutos. Após
amostras disponíveis falhou. Depois do material inicial o último ciclo, foi realizada uma extensão de 10 minutos
ser submetido ao GenomiPhi®, a PCR convencional a 72°C. Um ou 2 µl da primeira PCR foram usados
conseguiu amplificar os fragmentos esperados e para o ensaio aninhado (nested). Os primers DP16
identificar ou caracterizar os patógenos. (5’ CCTCAAATCACTCTTTGGCAAC) e G2
(5’GCATCHCCCACATCYAGTACTG) foram usados
para amplificar a região da protease e os primers F1
1. Primers hexâmeros aleatórios hibridizam no molde ( 5 ’ GT T G A C T C A G AT T G GT T G C A C ) e F 2
do DNA em vários sítios.
(5’ GTATGTCATTGACAGTCCAGC) para a região da
2. A polimerase Phi29 inicia a replicação em múltiplos transcriptase reversa. O segundo ciclo de PCR para
sítios do DNA linear desnaturado
simultaneamente. ambos os pares de primers não diferiu signi-
ficativamente do primeiro. Todas as amostras foram
3. À medida que a polimerização prossegue, o
deslocamento da fita do DNA de fita simples. analisadas em duplicata.
Eletroforese em gel de agarose: os produtos da
4. Primers adicionais ligam-se ao DNA de fita simples amplificação foram visualizados por transiluminação
recém-sintetizado.
UV de gel de agarose embebido em brometo de etídio
após eletroforese. A concentração do gel foi 2,5%, TAE
5. A hibridação subseqüente e o deslocamento da fita
produzem grandes quantidades de DNA de fita
1X (40 mM Tris-acetato, pH 8,0, 1 mM EDTA) foi
dupla de alto peso molecular. usado como tampão e o estudo foi realizado a 6 V/cm.
Os resultados foram fotografados com um sistema
Figura 1. Amplificação isotérmica por DNA polimerase Phi29. Polaroid.
Seqüenciamento: os amplicons foram purificados
MÉTODOS com o kit de purificação GFX PCR DNA (Amersham
Amplificação com GenomiPhi®: 1 µl de material inicial Biosciences) e quantificados após eletroforese em
foi acrescentado a 9 µl de solução-tampão para amostra agarose usando um padrão de massa. O
(fornecida com o kit) em um microtubo Eppendorf. A seqüenciamento foi realizado em um sistema capilar
amostra foi desnaturada a 95°C por 3 minutos e MegaBace 1000 com o kit DYEnamic ET Terminator
resfriada com gelo. Nove microlitros de solução-tampão Cycle Sequencing (Amersham Biosciences), seguindo
de reação (fornecida) e 1 µl de Phi29 DNA polimerase as recomendações do fabricante. A análise com o
são acrescentados, mantendo-se o tubo no gelo. Após BLAST foi realizada no site da NCBI (http://
a mistura, o tubo é incubado a 30°C por 16 a 18 horas. www.ncbi.nlm.nih.gov).
A enzima é inativada por calor a 65°C por 10 min e o
DNA está pronto para outros ensaios.
PCR para Legionella spp: a amplificação de RESULTADOS
Legionella spp foi obtida pelo método descrito(3). O Pneumonia foi diagnosticada em um paciente
produto da amplificação, um fragmento de 386 bp da transplantado e o agente etiológico suspeito foi L.
subunidade 16S rRNA, foi digerido de modo pneumophila. O lavado broncoalveolar foi enviado para
independente com duas enzimas de restrição, Xho I e análise e diagnóstico por biologia molecular. A PCR
Hae III, resultando em padrões estriados específicos foi positiva e a digestão do amplicon com enzimas de
que puderam ser atribuídos à L. pneumophila ou outras restrição apropriadas identificou a L. pneumophila.
espécies. Como Legionella spp encontradas no abastecimento
PCR para HIV: as regiões de transcriptase e protease de água foram relacionadas a casos de pneumonia em
foram amplificadas em duas PCR consecutivas com dois pacientes imunocomprometidos (3), as investigações
primers (nested-PCR). Vinte e cinco µl da mistura para epidemiológicas incluíram coleta de amostras de água
reação de amplificação continham solução-tampão 1 de chuveiros e pias de diferentes quartos. Também

einstein. 2004; 2(1):20-2


24 Azevedo FM, Mitne M, Magalhães VD

foram coletadas amostras dos reservatórios. A PCR foi DISCUSSÃO


positiva apenas para a água do chuveiro do quarto do Muitas análises genéticas usam PCR e é comum que
paciente. Contudo, a quantidade de produto de não haja amostras clínicas em quantidade adequada
amplificação não era suficiente para novas análises. A para permitir múltiplos testes. Enquanto a PCR
amostra original do chuveiro foi usada no kit aleatória em geral produz DNA de peso molecular
GenomiPhi ® e gerou uma grande quantidade de relativamente baixo, a ação da DNA polimerase Phi29
amplicons, permitindo a análise de restrição e o produz fragmentos cujo comprimento varia entre 5 e
seqüenciamento. Além disso, amostras de água 50 kb. O material amplificado é representativo de todo
coletadas em outros pontos (pias e reservatório) o genoma e a informação é preservada, pois pouca ou
também foram submetidas ao sistema GenomiPhi® e nenhuma mutação é permitida pela atividade de
resultaram em amplificação positiva de uma amostra proofreading da enzima.
referente ao reservatório (figura 2). O seqüenciamento Além do uso aqui descrito, a amplificação por
dos produtos por PCR confirmou a presença de L. ramificação isotérmica foi usada para fornecer
pneumophila no lavado broncoalveolar e na água do densidade adequada de DNA isolado de algumas
chuveiro do quarto do paciente. Na amostra do centenas de células em matrizes para hibridização
reservatório, o seqüenciamento revelou a presença de genômica comparativa(4). A análise dos polimorfismos
L. rubrilucens. de um único nucleotídeo (Single Nucleotide
Como parte da Rede de Diversidade Genética Viral Polymorphism ou SNP) também consome grande
(Viral Genetic Diversity Network), nosso laboratório quantidade de DNA devido ao número de SNPs no
recebe DNA extraído de pacientes com HIV. É genoma humano. Nessas duas abordagens, menor
esperado que amplifiquemos as regiões da transcriptase exatidão é observada quando o aporte de DNA não é
reversa e da protease dos pró-vírus presentes nessas adequado.
amostras. O seqüenciamento dessas regiões identifica
possíveis genótipos resistentes. Algumas amostras
falharam sistematicamente na reação de PCR, muito CONCLUSÃO
provavelmente devido à presença de substâncias GenomiPhi® é uma ferramenta potente para fornecer
inibidoras ou a baixa carga viral. Nesses casos, a DNA suficiente para a realização de diferentes estudos
quantidade de amostra que restou após muitas de interesse clínico e para pesquisas quando os
tentativas de superar os problemas era muito pequena. materiais iniciais têm quantidade reduzida.
O uso do GenomiPhi ® resultou em amplificação
positiva e seqüenciamento bem-sucedido das regiões
escolhidas de amostras que haviam falhado AGRADECIMENTOS
anteriormente. Gostaríamos de agradecer à Amersham Biosciences por
fornecer o kit GenomiPhi® mesmo antes de ele ser
comercializado.

REFERÊNCIAS
1. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. Primer-
1 2 3 4 directed enzymatic amplification of DNA with a thermostable DNA polymerase.
Science. 1988; 239(4839):487-91.
1. PCR de Legionella spp de amostra de água do reservatório. 2. Blanco L, Bernad A, Lazaro JM, Martin G, Garmendia C, Salas M. Highly
efficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetrical
2. PCR de Legionella spp da mesma amostra de água do reservatório de
mode of DNA replication. J Biol Chem. 1989; 264(15):8935-40.
1, após uso do kit GenomiPhi®.
3. PCR de Legionella spp de amostra da água do chuveiro do paciente. 3. Jonas D, Rosenbaum A, Weyrich S, Bhakdi S. Enzyme-linked immunoassay
for detection of PCR-amplified DNA of legionellae in bronchoalveolar fluid. J
4. PCR de Legionella spp da mesma amostra do chuveiro do paciente após Clin Microbiol. 1995; 33(5):1247-52.
uso do kit GenomiPhi®.
4. Lage JM, Leamon JH, Pejovic T, Hamann S, Lacey M, Dillon D, et al. Whole
genome analysis of genetic alterations in small DNA samples using
Figura 2. Eletroforese em gel de agarose de Legionella de amostras de hyperbranched strand displacement amplification and array-CGH. Genome
água antes e depois do uso do kit GenomiPhi ®. Res. 2003;13(2):294-307.

einstein. 2004; 2(1):20-2