Você está na página 1de 6

BC.

06: cidos nuclicos e ao gnica

BIOLOGIA

ATIVIDADES
1.

DNA e RNA so encontrados em quantidades apreciveis, respectivamente:


a) b) c) d) e)

substncias radioativas. Essas bactrias sofreram trs divises no novo meio, produzindo 800 bactrias. A anlise dos cidos nuclicos mostrou que, dessas 800 bactrias:
a) b) c) d)

no ncleo; no citoplasma. no ncleo; no ncleo e no citoplasma. no ncleo; no ncleo. no ncleo e no citoplasma; no ncleo. no citoplasma; no ncleo e no citoplasma.

100 apresentavam o DNA marcado, mas RNA. 200 apresentavam o DNA marcado, mas RNA. 400 apresentavam o DNA marcado, mas RNA. 50 apresentavam o DNA marcado, mas RNA.

no o no o no o no o

2.

cido fosfrico, acar e uma base se ligam com perda de molculas de gua, formando um:
a) b) c) d) e)

cido nuclico. nucleosdio. nucleotdeo. ribonucleotdio. desoxirribonucleotdio.

6.

(UEL) Considere as seguintes afirmaes referentes a molcula de cidos nuclicos: I. Sua duplicao ocorre durante a interfase. II. Uma cadeia simples da molcula original conserva-se ntegra em cada uma das molculas-filhas. III. As duas molculas-filhas tm exatamente a mesma seqncia de bases nitrogenadas e so idnticas molcula original. IV. Aps associarem-se a protenas, as molculasfilhas vo para o citoplasma participar da sntese de novas protenas. Relacionam-se ao cido desoxirribonuclico (DNA) as afirmaes: a) b) c) I e II, apenas. I e III, apenas. I, II e III, apenas. d) e) II, III e IV, apenas. I, II, III e IV.

3.

(UEL) Com relao composio qumica, as molculas de DNA e RNA diferem entre si quanto ao tipo de:
a) b) c) d) e)

acar, apenas. base nitrogenada, apenas. base nitrogenada e de acar, apenas. base nitrogenada e de fosfato, apenas. base nitrogenada, de acar e de fosfato.

4.

Genes atualmente podem ser definidos como:


a) b) c) d) e)

seqncias especficas de aminocidos. segmentos de informaes genticas que no mais se modificam. equivalentes sempre a uma molcula de DNA. unidades encontradas somente em clulas especializadas. segmentos de DNA que codificam polipeptdeos especficos.

7.

(FUVEST) A tabela mostra a composio das bases nitrogenadas pricas, adenina e guanina, nos DNAs do homem e do boi. Adenina Homem 30,4% Guanina ?

5.

(FUVEST) Bactrias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de geraes. Dessa cultura, foram isoladas 100 bactrias e transferidas para um meio sem 55

APOSTILA 2

SISTEMA LOSANGO DE ENSINO

BC.06: cidos nuclicos e ao gnica

BIOLOGIA

Boi

21,0%

d) e)

As porcentagens que esto faltando para o homem e para o boi so, respectivamente: a) b) c) 19,6 e 29,0 21,0 e 30,4 29,0 e 30,4 d) e) 19,6 e 21,0 30,4 e 21,0

respectivamente no ncleo, citoplasma e citoplasma. respectivamente no citoplasma, ncleo e ncleo.

10. (VUNESP) Na clula eucarionte, estabelecem-se,

8.

(UFPel) A sntese de protenas, na clula, inicia-se quando uma determinada regio da molcula de DNA aberta e o RNA produzido ao longo de uma das fitas, atravs da ao da enzima RNA polimerase. Cada base do RNA complementar a uma determinada base do DNA. Esse RNA chamado RNA mensageiro, pois carrega a mensagem gentica do DNA para a sntese da protena. Considerando que ... AATGACGCCTAGCTAC... a seqncia de bases em uma certa regio do DNA que est sendo transcrita, assinale a alternativa que apresenta o trecho do RNA mensageiro correspondente. a) b) c) d) e) ...AATGACGCCTAGCTAC... ...UUACUGCGGAUCGAUG... ...TTACTGCGGATCGATG... ...TTUCTGCGGUTGCUTG... ...AAUGACGCCUAGCUAC...

entre ncleo e citoplasma, trocas de substncias que, sintetizadas em um desses compartimentos, migram para o outro a fim de atender suas necessidades. O esquema apresenta algumas dessas substncias.

Assinale a resposta que d a direo correta de migrao das mesmas. a) b) c) A, D, F, G. B, D, F, G. B, D, F, H. d) e) A, D, E, G. A, D, F, H.

11. (UEL) Para sntese de uma determinada protena,

9.

(UniABC) O seguinte esquema resume, parcialmente, as inter-relaes funcionais dos cidos nuclicos ocorrentes em grande parte das clulas vivas.

so necessrios RNA mensageiro, RNA ribossmico, RNA transportador e aminocidos. Sobre o assunto, considere as seguintes afirmativas: I. II. A traduo ocorre no citoplasma da clula. O RNA transportador carrega a mensagem para a produo da protena. III. Cada 3 nucleotdeos do RNA mensageiro determinam a colocao de um aminocido especfico na protena. IV. Molculas de RNA transportador, ligadas a aminocidos, unem-se ao RNA ribossmico por uma seqncia de 3 bases. V. Enquanto o ribossomo se desloca sobre a fita de RNA mensageiro, outros RNA transportadores se encaixam, trazendo novos aminocidos. Assinale a alternativa correta. a) b) c) d) e) Apenas as afirmativas I e II so corretas. Apenas as afirmativas I, III e V so corretas. Apenas as afirmativas II e V so corretas. Apenas as afirmativas I, II, IV e V so corretas. Apenas as afirmativas III e IV so corretas.

Considerando-se apenas clulas eucariticas, as 3 etapas I, II e III, assinaladas no esquema, ocorrem:


a) b) c)

12. (PUC-CAMP)

todas no ncleo. todas no citoplasma. respectivamente no ncleo, ncleo e citoplasma. 56

O quadro a seguir contm um segmento de DNA, os cdons e os anticdons correspondentes. DNA ATT GAC TCA
APOSTILA 2

SISTEMA LOSANGO DE ENSINO

BC.06: cidos nuclicos e ao gnica

BIOLOGIA

RNAm RNAt

TAA ...II... UAA

...I... GAC ...IV...

...III... AGU

3.

(UFJF)

Para preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos, respectivamente, por:
a) b) c) d) e)

GAC, TAA, AGT e CTG. GTC, AUU, UCA e GUC. GTC, ATT, TCA e GUC. CTG, ATT, UCA e CUG. CTG, AUU, UCA e CUG

EXERCCIOS COMPLEMENTARES
1.

(UNICAMP) A anlise da composio de nucleotdeos do cido nuclico, que constitui o material gentico de quatro diferentes organismos, mostrou o seguinte resultado: % de nucleotdeos

A: adenina B: citosina C: guanina T: timina U: urucila Identifique as estruturas numeradas: a) b) c) d) e) 1 molcula de DNA e 2 molcula de RNA 1 cdigo gentico e 2 DNA replicado 2 sntese de DNA e 1 RNA 1 sntese de DNA e sntese de RNA 1 e 2 separao e duplicao da molcula, originando duas rplicas do original

Organismos A A B C D 23,3 17,3 27,5 18,5 G 26,7 40,5 14,3 31,5 T 23,5 28,2 0 18,3 C 26,5 14,0 35,5 31,7 U 0 0 22,7 0
4.

Com base nesses resultados responda o que se pede e justifique as respostas: a) Qual o cido nuclico de cada um desses organismos? Quantas cadeias poli-nucleotdicas possui o cido nuclico de cada um desses organismos?

(UFV 2005) A seqncia dos cinco primeiros aminocidos (aa), de um peptdeo em incio de sntese, est representada a seguir. Na tabela, aparecem tambm representados alguns RNAs transportadores (tRNA) e seus respectivos aminocidos.

b)

2.

(UFV 2004) Este ano comemorou-se 50 anos da publicao do trabalho de Francis Crick e James Watson, que estabeleceu o modelo da estrutura da molcula de cido desoxirribonuclico (DNA). Dentre as afirmativas a seguir, assinale a alternativa CORRETA:
a)

5.

Uma cadeia simples de DNA constituda de nucleotdeos, compostos por uma desoxirribose ligada a um fosfato e a um aminocido. A polimerizao de uma fita simples de DNA dita semiconservativa, pois independe da existncia de uma fita molde. b) As duas cadeias de uma dupla-hlice possuem a mesma orientao, e suas seqncias de bases so complementares. (UFV 2004) A tabela a seguir representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o 57
SISTEMA LOSANGO DE ENSINO

a) b) c) d) e)

5 -AUG-CUC-CCC-CAA-GCA- 3 5 -CCC-CAA-GCA-CUC-AUG- 3 5 -CAA-GCA-GAG-UAC-CCC- 3 5 -GCA-CUC-GUU-AUG-CAA- 3 5 -UAC-GAG-GGG-GUU-CGU-3

APOSTILA 2

BC.06: cidos nuclicos e ao gnica

BIOLOGIA

padro do cdigo gentico universal, no qual trs bases codificam um aminocido. Trinca de bases AAC AAU AGG AUA AUC AUG CAU CCU CGA CGC Aminocido N O C O S iniciao O S W I Trinca de bases CUA GAA GCA GCC GCU GGC GGG UAA UAC UAU UCG Aminocido R K T N T W S terminao A E A

Analise a tabela e faa o que se pede: a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b) Cite a seqncia do anticdon correspondente ao cdon de iniciao. c) Qual a seqncia de aminocidos que resultar da traduo da seguinte molcula de RNA mensageiro? 5 3

AUAUGCGAUCGGCUAUCCAUGCCUAUAGGCUACGCAGGGAAUAACUAA d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA, aps uma deleo do terceiro nucleotdeo?

6.

(UFAL) Um segmento de uma fita de DNA possui a trinca TAC. Assinale, no quadro a seguir, a alternativa que identifica corretamente o cdon e o anticdon correspondentes. RNAm a) ATG b) AUG c) UTC d) UAC e) UGA RNAt TAC UAC AUG TAG TUG
8.

b) c) d) e)

RNAm, RNAT, Ribossomo. RNAt, DNA, RNAm. RNAm, RNAt, DNA. Ribossomo, RNAm, RNAt.

(UFV) A composio qumica das clulas formada por substncias inorgnicas e orgnicas. Entre estas ltimas detacam-se as protenas, os cidos nuclicos os carboidratos e os lipdios. Com relao a estas substncias orgnicas, assinale a alternativa INCORRETA. a) Os lipdios caracterizam-se por serem pouco solveis em gua e so os principais componentes das membranas celulares. b) As protenas so formadas por aminocidos ligados covalentemente entre si e muitas tm funo enzimtica. c) Entre os tipos de RNA tm-se o RNA de transferncia, o RNA ribossmico o RNA mensageiro, sendo este ltimo o nico envolvido na sntese de protenas. d) Os carboidratos podem desempenhar funo estrutural, como a celulose ou de reserva, como o amido. e) O DNA o cido nuclico responsvel pela transmisso da informao gentica e encontrase quase todo no ncleo. (FUVEST)

7.

(PUC-MG) O desenho a seguir representa o processo de sntese protica.

Os nmeros 1, 2, e 3, so, respectivamente: a) DNA, RNAm, RNAt.


APOSTILA 2

9.

133

SISTEMA LOSANGO DE ENSINO

BC.06: cidos nuclicos e ao gnica

BIOLOGIA

25 aminocidos de uma enzima mitocondrial (NAD desidrogenase) do homem (a), do gorila (b) e do orangotango (c). Examine essas seqncias e responda: Que macacos ocupam os espaos I e II do diagrama a seguir, em funo do grau de proximidade de parentesco com o homem? Justifique sua escolha. Obs.: Cada aminocido abaixo est representado por uma letra, de acordo com o novo cdigo internacional. a) I T M H S T I T T L T L T S L I P P I L T T L V N b) I T M Y A T I T T L A L T S L I P P I L T T F I N c) T A M F T T I T A L T L T S L I P P I T A T L I N

O esquema apresenta a sntese de um polipeptdeo a partir de uma molcula de DNA. licito dizer que o diagrama mostra:
a) b) c) d) e)

a traduo do cdigo gentico a transcrio do cdigo gentico a transcrio e a traduo do cdigo gentico a replicao do DNA a replicao do DNA, a transcrio e a traduo do cdigo gentico.

10. (UFRJ) Temos a seguir a seqncia dos primeiros

CDIGO GENTICO
2 LETRA 1 LETRA
a a

U UUU (Fenilalanina)

C UCU (Serina) UCC (Serina) UCA (Serina) UCG (Serina CCU (Prolina) CCC (Prolina) CCA (Prolina) CCG (Prolina) ACU (Treonina) ACC (Treonina) ACA (Treonina) ACG (Treonina) GCU (Alanina) GCC (Alanina GCA (Alanina) GCG (Alanina)

A UAU (Tirosina) UAC (Tirosina) UAA (Parada) UAG (Parada) CAU (Histidina) CAC (Histidina) CAA (Glutamina) CAG (Glutamina) AAU (Asparagina) AAC (Asparagina) AAA (Lisina) AAG (Lisina) GAU (c. Asprtico) GAC (c. Asprtico) GAA (c. Glutmico) GAG (c. Glutmico 59

G UGU (Cistena) UGC (Cistena) UGA (Parada) UGG (Triptofano) CGU (Arginina) CGC (Arginina) CGA (Arginina) CGG (Arginina) AGU (Serina) AGC (Serina) AGA (Arginina) AGG (Argina) GGU (Glicina GGC (Glicina) GGA (Glicina) GGG (Glicina

3 LETRA U C A G U C A G U C A G U C A G

UUC (Fenilalanina) UUA (Leucina) UUG (Leucina) CUU (Leucina

CUC (Leucina) CUA (Leucina) CUG (Leucina AUU (Isoleucina)

AUC (Isoleucina) AUA (Isoleucina) AUG (Metionina) GUU (Valina)

GUC (Valina GUA (Valina) GUG (Valina)

APOSTILA 2

SISTEMA LOSANGO DE ENSINO

BC.06: cidos nuclicos e ao gnica

BIOLOGIA

11. (UFJF) Considere que, em uma planta de milho

13. (LOSANGO) Ao se isolar uma molcula pura e

transgnica, foi inserida uma cpia de um gene relacionado produo de um hormnio de crescimento em seres humanos. Dessa forma, as sementes de milho contendo a protena de interesse poderiam ser utilizadas pela indstria para a produo de remdios a um custo inferior, beneficiando milhares de crianas com problemas de crescimento. (Adaptado de O Globo, 17/10/99). Uma das fitas do segmento de DNA humano inserido apresentava a seqncia:

completa de RNAm, contou-se nela 1600 nucleotdeos. Destes, 300 eram uracilas e no havia adenina. Assim sendo, pede-se o nmero de citosinas presentes no gene (ou a molcula de DNA) que organzou tal RNAm. a) 600 b) 800 c) 900 d) e) 1200 1300

14. (LOSANGO) Com relao sntese de protenas

TACGAGCCTAACATC De posse dessas informaes, responda: a) Em que compartimento celular da planta, o gene humano deve ser inserido para que a protena funcional seja produzida? Que tipos de RNA esto envolvidos na produo dessa protena na planta? Qual a seqncia de base do RNA mensageiro transcrito a partir do segmento de DNA inserido na planta? Utilizando a tabela do cdigo gentico apresentado, informe quais aminocidos faro parte da protena sintetizada a partir da seqncia de DNA inserida na planta. Imagine agora, que aps a insero do fragmento de DNA, um evento imprevisvel a levou substituio da 5 base, da esquerda para a direita, por uma timina (T). Este fato causar alguma alterao na seqncia de aminocidos da protena a ser formada? Em caso positivo, qual ser essa alterao?

em uma clula, afirmativas:


I.

foram

feitas

as

seguintes

b) c)

d)

e)

Todas as clulas sintetizam sempre os mesmos tipos de protenas, nas mesmas propores. II. A seqncia de bases nitrogenadas ao longo da molcula de RNAm determina a seqncia dos aminocidos incorporados na cadeia polipeptdica. III. Durante a sintese proteica, o RNAt tem por funo levar os aminocidos s mitocndrias. IV. As mitocndrias no tm relao direta com a sntese de proteina, j que esta ocorre nos ribossomos. V. Um RNAm sinttico, que contenha apenas um determinado tipo de cdon em seqncia, condicionar a sntese de uma cadeia polipeptdica com um nico tipo de aminocido. As afirmativas corretas so: a) I, II b) I, IV c) III, V d) e) II, V II, III

12. (CESGRANRIO)

A anlise de esquema anterior nos permite afirmar que: I. os ribossomas nessa molcula de RNA traduziro os mesmos cdons II. durante o processo a protena depende, em ltima anlise, de uma molcula de DNA III. qualquer protena formada ser conseqncia direta de uma transcrio do RNA. A(s) afirmativa(s) correta(s) (so): a) I apenas b) I e II apenas c) I e III apenas
SISTEMA LOSANGO DE ENSINO

d) e)

I, II e III II e III apenas 60

APOSTILA 2