Você está na página 1de 66

Biologia Molecular

RNA

Transcrio & Processamento

RNA: eficiente & eficaz

Dogma Central da Biologia Molecular

TRANSCRIO
Processo pelo qual uma molcula de RNA sintetizada a partir da informao contida na seqncia de nucleotdeos de uma molcula de DNA fita dupla. A transcrio representa a diversidade e a complexidade da expresso dos genes contidos em um determinado genoma. Enquanto a sntese de DNA deve ser precisa e uniforme, a transcrio reflete o estado fisiolgico da clula e, portanto, extremamente varivel para atender s suas necessidades.

TRANSCRIO
Caractersticas Gerais:

Complementaridade Antiparalelismo ( T = U) Sntese 5' 3 RNA Polimerase (RNAP): Funes reconhecem e ligam-se desnaturam DNA mantm estvel a dupla fita aberta mantm estvel DNA:RNA terminam sntese restauram DNA

TRANSCRIO
Apenas uma das fitas do DNA utilizada como
molde, portanto, a molcula de RNA sintetizada complementar fita de DNA que lhe deu origem e idntica outra fita de DNA, sendo as timinas substitudas por uracilas

Em 1960, Hurwitz, Stevens e Weiss descobriram,


independentemente, uma enzima capaz de sintetizar RNA na presena de DNA fita dupla e dos nucleotdeos A, U, C, G. Esta enzima foi denominada RNA polimerase.

RNA POLIMERASE
Reconhece e liga-se a seqncias especficas de DNA; Denatura o DNA expondo nucleotdeos a ser copiada; a seqncia de

Mantm as fitas de DNA separadas na regio de sntese; Renatura o DNA na posterior da sntese; regio imediatamente protenas

Sozinha, ou com o auxlio de especficas, termina a sntese do RNA.

RNA POLIMERASE
Em eucariotos existem vrios subtipos de RNA polimerases envolvidas na sntese de RNAs especficos:
. RNA polimerase I localizada no nuclolo e responsvel pela sntese do RNA ribossmico . RNA polimerase II localizada no nucleoplasma e responsvel pela sntese do RNA mensageiro . RNA polimerase III tambm localizada no nucleoplasma e responsvel pela sntese do RNA transportador

TRANSCRIO
Reao ocorre entre o radical hidroxil da extremidade 3 de um ribonucleotdeo e o grupo fosfato do carbono 5 do ribonucleotdeo a ser incorporado

A reao processa-se no sentido 5 de DNA copiada a de sentido 3 5

3 e a fita

Diferentemente da DNA polimerase, a RNA polimerase no necessita de um iniciador para processar a sntese da nova fita

TRANSCRIO
1.INCIO
Reconhecimento de seqncias especficas no DNA 2. ALONGAMENTO

Incorporao dos ribonucleotdeos


3. TERMINAO

Seqncias no DNA so reconhecidas e a sntese interrompida

INCIO DA TRANSCRIO

O DNA apresenta seqncias especficas, denominadas PROMOTORES, que sinalizam exatamente onde a sntese do RNA deve ser iniciada. Os promotores so, primeiramente, reconhecidos por fatores de transcrio que, ligados ao DNA, interagem com outros fatores, formando um complexo ao qual a RNA polimerase se associa.

INCIO DA TRANSCRIO
As seqncias reguladoras da transcrio podem ser divididas em: . elementos promotores: seqncias de 100 a 200 nucleotdeos prximos ao stio de incio da transcrio que possuem seqncias consenso TATA denominadas TATA box . elementos enhancer ou amplificadores: seqncias pequenas de DNA que podem ocorrer na regio 5 do gene. Ativam a expresso do mesmo.

Amplificam o sinal 100 vezes e os fatores de transcrio que se ligam a eles so chamados ativadores

INCIO DA TRANSCRIO

As fitas do DNA se separam 10 bases upstream ao stio de iniciao, mais especificamente no TATA box.

A fita molde fica exposta e, desta forma, a sntese da cadeia complementar de RNA pode ser iniciada.

ALONGAMENTO DA CADEIA

A polimerase desliza ao longo da fita molde extendendo um cadeia de RNA crescente no sentido 5 3 atravs da adio de ribonucleotdeos.

Este processo ocorre at a RNA polimerase encontrar uma seqncia especfica no DNA que determina o trmino do alongamento.

TRMINO DA TRANSCRIO

Quando a RNA polimerase encontra o stio de terminao na fita molde, ela se desliga do DNA juntamente com a nova cadeia de RNA sintetizada devido uma desestabilizao do complexo de transcrio O desligamento do RNA do sistema provoca a ruptura do complexo de transcrio e as fitas do DNA so renaturadas

O PROCESSAMENTO DO RNA
Os diferentes RNAs sintetizados no processo de transcrio so chamados de transcritos primrios; Na maioria das vezes, esses transcritos no representam a molcula madura, ou seja, aquela cuja seqncia e estrutura correspondem forma final do RNA funcional; Esses transcritos necessitam sofrer modificaes que fazem parte do processamento do RNA.

PROCESSAMENTO DO mRNA

O transcrito primrio da molcula de mRNA tambm conhecido como pr-mRNA

Este RNA precursor sintetizado no ncleo e sofre vrias alteraes transformado-se no que se chama mRNA maduro ou processado. O RNA maduro , ento, transportado ao citoplasma onde ser traduzido

PROCESSAMENTO DO mRNA
Aps o incio da transcrio da molcula de mRNA adicionado um resduo de guanina sua extremidade 5.
Este resduo chamado cap sofre, ento, metilao (adio do radical metil) na posio 7 da guanina resultando na formao do nucleotdeo 7-metilguanilato.

O cap protege a extremidade 5 da ao de exonucleases e, tambm, utilizado para reconhecimento, pelo ribossomo, do stio de incio do processo de sntese protica.

PROCESSAMENTO DO mRNA
A maioria dos mRNAs possui uma seqncia de resduos de adenina na sua extremidade 3 que chamada de cauda poliA e adicionada molcula durante a transcrio.
Quando se reconhece a seqncia AAUAAA, altamente conservada e localizada 10 a 30 nucleotdeos upstream ao stio de poliadenilao, um sinal de que a molcula est terminando e que deve ser adicionada a cauda poliA extremidade da mesma.

PROCESSAMENTO DO mRNA

Aps a adio do cap 5 e da cauda poliA, a molcula de


pr-mRNA sofre o processo de exciso dos introns e juno dos exons, mecanismo conhecido como splicing e migra para o citoplasma da clula. (

Os introns apresentam um grau de conservao maior do


que os exons alm de apresentarem uma caracterstica muito importante:
Os primeiros e os ltimos dois nucleotdeos da extremidade 5 e 3, GU e AG, so altamente conservados.

RNAm liga-se as Ribonucleoprotenas nucleares pequenas (snRNPs)


Splicing mediado por spliceossomo: Utiliza ATP FUNO: ajuda a clivar no stio de splicing remove intron une os xons anteriores e posteriores

PROCESSAMENTO DO mRNA

Splicing: FUNO: ajuda a clivar no stio de splicing remove intron impede afastamento dos xons une os xons

PROCESSAMENTO DO mRNA

Estrutura do mRNA

PROCESSAMENTO DO mRNA

Um transcrito primrio pode ser processado de diferentes maneiras sendo que o que intron para um mRNA pode ser exon para outro mRNA que provm do mesmo RNA precursor Esta diferena de processamento pode ser devida presena de dois ou mais stios de poliadenilao e/ou diferena no processo de splicing do pr-mRNA

MOLCULAS DE RNA

RNA mensageiro carrega a informao copiada do DNA sob a forma de inmeros triplets cada um especificando um aminocido

RNA transportador decifra o cdigo representado pelo mRNA


RNA ribossmico associa-se com uma srie de protenas para formar os ribossomos

TRADUO
Processo que se baseia na seqncia do mRNA para determinar e unir os aminocidos formando, assim, a protena.
Cada aminocido codificado na seqncia de DNA como um cdon contendo uma seqncia de trs nucleotdeos. Molculas de RNA transportador transferem a informao contida no genoma uma seqncia de aminocidos nas protenas.

RNA TRANSPORTADOR

Liga-se quimicamente um aminocido especfico, atravs da enzima aminoacil tRNA sintetase, sendo chamado, desta forma, de aminoacil-tRNA;

Pareia com a seqncia do codon do mRNA adicionando o aminocido que carrega uma cadeia de peptdeos crescente.

RNA TRANSPORTADOR

RIBOSSOMOS

A eficincia da traduo se deve, principalmente, ligao da molcula de mRNA e dos aminoaciltRNAs ao maior complexo RNA-protena da clula o ribossomo que direciona o crescimento da cadeia polipeptdica

Durante a sntese protica, o ribossomo se move ao longo da cadeia de mRNA interagindo com vrios fatores proticos e o tRNA

CDIGO GENTICO
A relao entre a seqncia de bases no DNA e a seqncia correspondente de aminocidos, na protena, chamada de cdigo gentico O cdigo gentico encontra-se na forma de triplets os cdons

TRADUO
O codon AUG, que codifica o aminocido metionina, age como o codon de iniciao na maioria das molculas de mRNA. O tRNAMet reconhece codons AUG internos, no carregando nunca uma metionina formilada.
Quando AUG est colocado no incio este lido como uma formil-metionina; quando est dentro da regio codificadora, lido como metionina.

TRADUO
Durante a sntese de protenas, os ribossomos deslocam-se ao longo do mRNA, possibilitando um pareamento entre esse e os tRNAs que carregam os diferentes aminocidos que iro compor as protenas

Os ribossomos deslocam-se ao longo do mRNA, na direo 5 3, sintetizando a protena no sentido amino-terminal para carboxi-terminal

TRADUO

A terminao da sntese de protenas ocorre pelo aparecimento de cdons de terminao na molcula de mRNA

O reconhecimento desses cdons realizado por protenas e no por molculas de tRNA, diferentemente do que ocorre nos outros cdons

Dogma Central da biologia Molecular

Ncleo RNA polimerase

Gene

Transcrio
hnRNA

Processamento
mRNA

Traduo
Citoplasma

protena

Transcrio:
RNA polimerase

Gene ativo
5 ACGTA TGCAT 3
5

3
3

A T 5

Molcula de RNA nascente

Traduo:
aa livre Ribossomo
Glu Phe Asp

Gly

His

Protena

Met Ala

Cys

tRNA

AU G G CAU G C GAC GAAU U C G GACACAUA Molcula de mRNA Direo do avano do ribossomo

codon

Phe Glu Asp

Gly

His

Met Ala

Cys

5
AU G G CAU G C GAC GAAU U C G GACACAUA

Phe Glu Met Ala Cys

Gly

His

Asp

5
AU G G CAU G C GAC GAAU U C G GACACAUA

His

Gly
Met Ala Cys Asp Phe

Glu

5
AU G G CAU G C GAC GAAU U C G GACACAUA

Ile

Met Ala Cys Asp Glu

His
Gly

Phe

5
AU G G CAU G C GAC GAAU U C G GACACAUA

Lys Met Ala Cys Asp Glu Phe

Ile
His

Gly

5
AU G G CAU G C GAC GAAU U C G GACACAUA

Met Ala Cys Asp Glu Phe Gly

Lys Ile

His

5
AU G G CAU G C GAC GAAU U C G GACACAUA

Met Ala Cys Asp Glu Phe Gly His

Lys

Ile

5
AU G G CAU G C GAC GAAU U C G GACACAUA

Met Ala Cys Asp Glu Phe Gly His Ile

Leu

Lys

5
G CAU G C GAC GAAU U C G GACACAUAAAA

Met Ala Cys Asp Glu Phe Gly His Ile Lys

Met

Leu

5
U G C GAC GAAU U C G GACACAUAAAAU UA

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu

Asn

Met

5
GAC GAAU U C G GACACAUAAAAU UAAU G

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met

Pro

Asn

5
GAAU U C G GACACAUAAAAU UAAU GAAC

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn

Gln

Pro

5
U U C G GACACAUAAAAU UAAU GAAC C CA

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro

Gln

5
G GACACAUAAAAU UAAU GAAC C CACAA

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln

STOP 3

CACAUAAAAU UAAU GAAC C CACAAUAA

Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln

STOP

AUAAAAU UAAU GAAC C CACAAUAAAAA

Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln

STOP

AUAAAAU UAAU GAAC C CACAAUAATAC

Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met

5
AUAAAAU UAAU GAAC C CACAAUAATAC

VARIAO GENTICA =POLIMORFISMO

Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 3

5 AUAAAAU UAAU GAAC C CACAAUAATAC

Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn CYS
5

Muda a forma e funo


3

A U A A A A U U A A U G A A C AA A C A A U A A T A C

REPRESENTAO LINEAR A MOLCULA DO DNA

5ATTCGGCGCTATGCATGCTATGCG3
aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8
- Queratina- cabelo - Albumina- sangue - Hemoglobina-sangue - Estrutura do cabelo - Protena da cor do cabelo (Melanina)

PROTENA

VARIAES GENTICAS

Acontecem no nosso DNA

Clulas germinativas

Clulas somticas

Passa para os filhos Ex. cor dos olhos

No passa para os filhos Ex. cncer

Lembrar...RNApolimerase
essencial na transcrio... (1 etapa da expresso gnica) Sem a RNA polimerase no h vida!!! Sem RNA polimerase no h enzimas!!!! A inibio da RNA polimerase leva morte do organismo...

Correlao Clnica
Antibiticos e Toxinas que tm como alvo a RNA Polimerase:
Toxina do cogumelo Amanita phalloides ou chapu da morte, altamente txico. A toxina mais letal, -amanitina, inibe a subunidade maior da RNA polimerase II, inibindo assim a sntese de mRNA.
Gastrointerites, insuficincia heptica (RNA essenciais so degradados e no so substitudos).

Ao do antibitico Rifampicina, para TB

Correlao Clnica
Sndrome do X frgil: uma doena da Cromatina?
Retardo mental hereditrio Inativao do gene FMR1 Doena resulta da repetio da sequncia CGC
Indivduos normais 30-200 cpias Indivduos com sndrome 200-milhares de cpias

A presena do nmero elevado de CGC induz a uma extensa metilao do DNA da regio promotora do gene FMR1. O DNA metilado se torna inativo, de modo que o mRNA de FMR1 no sintetizado. A ausncia deste gene leva a patologia da doena

Correlao Clnica
Fatores Transcripcionais na Carcinognese
P53 (protena supressora de tumor). Uma cpia mutada desta causa a sndrome de Li-Fraumeni, uma prdisposio ao ca de mama e a sarcoma de crtex adrenal, leucemina, etc. Mutaes representam a perda da funo ou estabilidade ou capacidade de se ligar ao DNA. A p53 inibe a transcrio de genes com sequncia TATA, ligando-se ao complexo formado entre os fatores de transcrio e a sequncia TATA. Paralelamente a p53 ligase a pontos especficos de genes de reparo.

Correlao Clnica
Auto imunidade em doena do tecido conjuntivo: Lpus eritematoso (splicing) Talassemia devido a defeitos na sntese de RNA mensageiro (anemia), mutaes que levam terminao prematura da sntese da beta-globina Sndrome de Cockayne, autossmica recessiva, pacientes apresentam alteraes de desenvolvimento e neurolgicas , deformidade faciel, etc. Morem 20 anos. Mutao afeta a transcrio de alguns genes (atividade da RNA polimeraseII).