Você está na página 1de 44

Licenciatura

em Bioqumica

2012/2013

Biologia Molecular
RELATRIOS

Turma 2 | Grupo 1 Professores responsveis: Dr. Cladio Sunkel e Dr. Carlos Conde Realizador por: Filipa Barros, Henrique Fernandes, Joo Rodrigues, Lisete Moutinho e Sara Moniz

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

P R E F C I O
O presente documento compila os relatrios de todos os trabalhos prticos e terico- prticos realizados ao longo do segundo semestre do ano lectivo 2012/2013 da licenciatura em Bioqumica (Faculdade de Cincias da Universidade do Porto e Instituto de Cincias Biomdicas Abel Salazar da Universidade do Porto). Os trabalhos foram realizados no mbito da unidade curricular de Biologia Molecular. Toda a informao que no est contemplada no manual dos trabalhos prticos da unidade curricular que foi disponibilizado pelo professor e/ou material utilizado nas aulas tericas tem a sua fonte citada na bibliografia.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

N D I C E
EXTRAO DE DNA GENMICO DE DROSOPHILA MELANOGASTER .................................... 4 OBJECTIVOS .............................................................................................................................. 4 INTRODUO TERICA ......................................................................................................... 4 METODOLOGIA ..................................................................................................................... 5 REAGENTES ....................................................................................................................... 5 EQUIPAMENTOS ................................................................................................................ 5 procedimento experimental .............................................................................................. 5 RESULTADOS EXPERIMENTAIS ...................................................................................................... 6 CONCLUSES ......................................................................................................................... 8 EXTRACO DE DNA PLASMDICO DE ESCHERICHEA COLI ................................................... 9 OBJECTIVOS .............................................................................................................................. 9 INTRODUO TERICA ......................................................................................................... 9 METODOLOGIA ................................................................................................................... 10 REAGENTES ..................................................................................................................... 10 EQUIPAMENTOS .............................................................................................................. 10 procedimento experimental ............................................................................................ 10 RESULTADOS EXPERIMENTAIS .................................................................................................... 10 CONCLUSES ....................................................................................................................... 10 ANLISE ELETROFORTICA DE DNA DIGERIDO COM ENZIMAS DE RESTRIO .................. 12 OBJECTIVOS ............................................................................................................................ 12 INTRODUO TERICA ....................................................................................................... 12 METODOLOGIA ................................................................................................................... 14 REAGENTES ..................................................................................................................... 14 EQUIPAMENTOS .............................................................................................................. 14 procedimento experimental ............................................................................................ 14 RESULTADOS EXPERIMENTAIS .................................................................................................... 15 CONCLUSES ....................................................................................................................... 16 ELABORAO DO MAPA DE RESTRIO DE UM PLASMIDEO RECOMBINANTE ................. 17 OBJECTIVOS ............................................................................................................................ 17 INTRODUO TERICA ....................................................................................................... 17 METODOLOGIA ................................................................................................................... 18 procedimento experimental ............................................................................................ 18 RESULTADOS EXPERIMENTAIS .................................................................................................... 18 CONCLUSES ....................................................................................................................... 19 DISCUSSO ............................................................................................................................. 22 PCR POLIMERASE CHAIN REACTION .......................................................................... 23 OBJECTIVOS ............................................................................................................................ 23 INTRODUO TERICA ....................................................................................................... 23 2

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

METODOLOGIA ................................................................................................................... 24 REAGENTES ..................................................................................................................... 24 EQUIPAMENTOS .............................................................................................................. 24 procedimento experimental ............................................................................................ 24 RESULTADOS EXPERIMENTAIS .................................................................................................... 25 CONCLUSES ....................................................................................................................... 27 TRANSFORMAO DE ESCHERICHIA COLI COM DNA PLASMDICO .................................... 28 OBJECTIVOS ............................................................................................................................ 28 INTRODUO TERICA ............................................................................................................. 28 METODOLOGIA ................................................................................................................... 29 Reagentes ........................................................................................................................ 29 Procedimento Experimental ............................................................................................ 29 RESULTADOS EXPERIMENTAIS .................................................................................................... 30 CONCLUSES .......................................................................................................................... 33 SEQUENCIAO DE DNA .................................................................................................. 35 OBJECTIVOS ............................................................................................................................ 35 INTRODUO TERICA ............................................................................................................. 35 RESULTADOS EXPERIMENTAIS .................................................................................................... 36 CONCLUSES .......................................................................................................................... 38 CLONAGEM DE CDNA Y-TUB ............................................................................................. 39 OBJECTIVOS ............................................................................................................................ 39 INTRODUO TERICA ............................................................................................................. 39 METODOLOGIA ................................................................................................................... 39 Reagentes ........................................................................................................................ 39 Equipamento ................................................................................................................... 39 Procedimento Experimental ............................................................................................ 39 RESULTADOS EXPERIMENTAIS .................................................................................................... 40 CONCLUSES .......................................................................................................................... 41 BIBLIOGRAFIA .................................................................................................................. 42 ANEXOS ........................................................................................................................... 43

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

EXTRAO DE DNA GENMICO DE DROSOPHILA MELANOGASTER


OBJECTIVOS Isolamento e quantificao por espectrofotometria do DNA genmico da Drosophila melanogaster. Avaliao do grau de pureza do DNA isolado e estudo dos efeitos de diversos tratamentos, na integridade do DNA genmico. INTRODUO TERICA A Drosophila Melanogaster um insecto usado em muitos estudos na rea da gentica, por apresentar 4 pares de cromossomas de grandes dimenses que so formados por vrias multiplicaes de filamentos de eucromatina (cromatina descondensada), facilitando a visualizao microscpica dos mesmos. Para alm disso, a cromatina possui prolongamentos que permitem um maior contacto com o hialoplasma estruturas denominadas de pufes. Este contacto vai permitir uma ativao de uma maior rea de DNA. Finalmente estes seres, apresentam a vantagem da sua criao ser fcil e barata, tm uma longevidade pequena, uma taxa de reproduo elevada e o seu genoma est bem estudado e sequenciado na totalidade. Para se efetuar um isolamento de DNA necessrio recorrer a processos que provoquem a lise das clulas e permitam a purificao do mesmo.
4

Com a lise celular todos os compostos que intercelulares so libertados para a soluo e geralmente provocada por rompimento mecnico ou se necessrio, utilizando enzimas que degradem a parede celular. frequente utilizarem-se tambm detergentes e assim, a purificao do DNA dar-se- com a libertao de todos os compostos intercelulares por precipitaes diferenciais e ao de enzimas como protases e RNAases. O DNA genmico obtido pelos processos referidos anteriormente, pode ser utilizado em variados processos moleculares (Southern blotting, bancos genmicos, etc). Deve ser guardado solubilizado a 70C (ou 20C). Porm, congelao e descongelao sucessivas provocam quebras nas cadeias de DNA. Ento, para armazenamentos a longo prazo convm ser guardado em alquotas enquanto que a curto prazo, aconselha-se a preservao a 4C. Para o armazenamento, solubilizado em tampo TE, onde o EDTA previne a degradao do DNA por ao quelante de metais pesados e caties que promovem a quebra das ligaes fosfodister por ao das DNAases.
A electroforese em gel acionada por um campo elctrico frequentemente utilizada para separar e estimar o tamanho de fragmentos de DNA. Sujeitos a um campo elctrico, os cidos nucleicos migram em direo ao plo positivo, uma vez que apresentam carga negativa a pH

neutro. A agarose funciona como uma rede cujos poros deixam passar mais facilmente as molculas mais pequenas, que vo portanto migrar mais do que as de maiores dimenses. A migrao de um fragmento de DNA depende da sua conformao. De um modo generalista, o cccDNA migra mais rapidamente do que os fragmentos do mesmo tamanho de dsDNA porque a conformao circular tem menor raio hidrodinmico (devido aos super- enrolamentos). No DNA circular, com uma quebra numa ligao fosfodister, os enrolamentos desaparecem pois h uma quebra de uma ligao fosfodister; este facto torna-a a forma mais lenta de migrao. A distncia de migrao dos vrios fragmentos depende tambm da voltagem aplicada e da concentrao de agarose empregue. Pelas mesmas razes da influncia do peso molecular na mobilidade, o aumento da concentrao da agarose leva a um retardamento da migrao electrofortica. A concentrao de agarose a usar deve ser adaptada gama de tamanhos de fragmentos que se pretende resolver. Assim, em suma a distncia que o fragmento percorreu a partir do ponto de aplicao, comparada com a distncia que outros fragmentos de tamanhos conhecidos percorreram no mesmo gel. Esses fragmentos so os ladders (marcadores de peso molecular), misturas de segmentos de DNA de tamanhos variveis, e que so aplicados em um poo no gel no incio do processo. Os gis de agarose so, geralmente, corados com solues de brometo de etdio (EtBr), uma substncia intercalante que revela os cidos nucleicos ao fluorescer sob luz ultravioleta. 5

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Concentraes de at 1ng de DNA podem ser visualizadas por exame direto do gel na luz ultravioleta.

METODOLOGIA REAGENTES
Usou-se tampo de lise e Brometo de etdeo (mutagnico muito forte).

EQUIPAMENTOS
Recorreu-se a um espectrofotmetro. Suporte para o gel de agarose e fonte de alimentao para a electroforese.

PROCEDIMENTO EXPERIMENTAL
A. Extrao de DNA genmico de Drosophila Melanogaster Recolha de cerca de 200 moscas adultas, procendendo homogeneizalo em 5 ml de tampo de lise previamente arrefecido em gelo. Centrifugao a 1000 rpm , durante um minuto. Transferncia do sobrenadante (correspondente suspenso de ncleos) para um tubo de Falcon. Adio de 50 l de soluo de proteinase K ( a 10 mg/ml) suspenso de ncleos e incubao a 37C durante 2 horas. Isolamento de uma fraco de ncleos isolados e ressuspendidos em 500 l. Adio de 500 l de soluo de fenol equilibrado em tampo TE ( 10mM Tris- HCL pH 8; 1mM EDTA pH 8 ) suspenso de ncleos. Agitao por inverso do tubo e centrifugao a 5000 rpm durante 2 minutos. Transferncia da fase aquosa para um novo tubo. Adio de 500 l da mistura fenol/clorofrmio/lcool isoamilico e agitar cuidadosamente por inverso do tubo. Nova centrifugao a

5000 rpm durante 2 minutos. Transferir novamente a fase aquosa para novo tubo. Adicionar de 500 l da soluo de clorofrmio , repetindo-se a mistura da preparao por inverso do tubo seguida de nova centrifugao mesma rotao e intervalo de tempo que a anterior e transferncia da fase aquosa para novo tubo. Adio de 100 l da soluo de NaCl e 900 l de etanol absoluto frio fase aquosa e misturar bem, seguindo-se nova centrifugao a 12000 rpm durante dez minutos a 4C. Remoo do sobrenadante com uma micropipeta e adio de 500 l de uma soluo de lavagem de etanol 70% ao DNA precipitado. Centrifugao a 12000rpm durante 2 minutos, igualmente a 4C. Remoo do novo sobrenadante e secagem do sedimento na estufa a 37C durante 5 minutos. Dissoluo do sedimento em 50 l de tampo TE. B. Verificao da ao de tratamentos fsicos sobre a integridade do DNA genmico Retirar 10 l da amostra de DNA genmico para um tubo Eppendorf. Um dos DNAs vortexado vigorosamente durante dois minutos e colocado em gelo; outro aquecido em gua at a ebulio, e finalmente, arrefecido em gelo. C. Determinao da concentrao e grau de pureza do DNA Fazer o zero da absorvncia, com o espectrofotmetro ajustado a 260 nm, com gua pura numa cuvete de quartzo. Adicionar 695 l de gua ultra-pura e 5 l da amostra de DNA (diluio de 140). Tapar a cuvette com parafilme e inverter vrias vezes. Ler a absorvncia a 6

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

260nm. Repetir o procedimento e fazer a leitura a 280nm. Calcular a concentrao de DNA e o grau de pureza da amostra D. Electroforese de DNA e preparao do gel de agarose Pesar a agarose para um frasco e adicionar 40 ml de tampo TAE 1. Aquecer o tampo e a agarose at esta se dissolver totalmente. Uma vez arrefecida a soluo de agarose, adicionar 1 l de soluo de brometo de etdeo (a 10 mg/ml). Verter a soluo sobre um molde, utilizando-se um pente para a formao dos poos, onde sero colocadas as amostras de DNA. O gel deixado arrefecer para que solidifique. Remover o pente e colocar o gel na tina de electroforese submergido em tampo TAE 1. Aps colocao do tabuleiro na tina de electroforese, cobrir o gel com tampo de electroforese, 1 a 2 mm acima da superfcie do gel.

RESULTADOS EXPERIMENTAIS
Determinao da concentrao e do grau de pureza do DNA Foi determinada a absorvncia no comprimento de onda de 260nm uma vez que esta proporcional quantidade de cidos nucleicos. Registou-se tambm a um comprimento de onda a 280nm, porque proporcional quantidade de protenas com resduos aromticos. Assim podemos avaliar a contaminao da amostra de DNA por protena. Grau pureza DNA = A260=0,452 A280=0,222 A(260nm) = 2,04 A(280nm)

Atravs da Lei de Lambert-Beer calculada a concentrao de DNA na amostra:

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Tabela 1 Distncias migradas pelas bandas, respectivos pesos moleculares e logaritmos. dmigrada/mm PM/pb log(PM) 46,07 10000 4,000 49,88 8000 3,903 60,15 6000 3,778 65,65 5000 3,699 72,16 4000 3,602 77,91 3000 3,477 87,64 2500 3,398 95,54 2000 3,301 105,57 1500 3,176 119,51 1000 3,000 129,45 800 2,903 137,91 600 2,778 149,71 400 2,602 166,04 200 2,301
4,500 4,000 Log(PM) 3,500 3,000 2,500 log(PM) = -0,0133 dmigrada + 4,5749 R = 0,9958

A=lc
Assim:

(1)

!"# = 2,26 g mL!! Uma vez que a diluio foi de 5L para 700L: !"# = 316,4 g mL!! Clculo dos pesos moleculares das amostras

Figura 1 Electroforese em gel de agarose. gDNA (DNA genmico) (1), gDNA vortexado intensamente (2); gDNA fervido (3); gDNA pipetada mltiplas vezes (4). DNA plasmdico (5) (referente ao trabalho seguinte Extrao do DNA plasmdico da E.coli); marcadores de pares de bases (6). 7

2,000 0 50 100 dmigrada/mm 150 200

Figura 2 Logaritmo do peso molecular em funo da distncia migrada

Tabela 2 Distncias migradas por cada banda nos poos de 1 a 5. Respectivo clculo do nmero de pares de bases com base na equao da reta obtida pela regresso representada na figura 2. Os valores relativos ao poo 5 sero usados na anlise dos dados do prximo trabalho. Poo 1 dmigrada/mm 32,12 120,56 171,18 33,45 120,10 169,88 154,32 33,90 121,82 166,87 141,00-174,13 PM/pb 14 051 936 199 13 490 950 207 333 13 305 901 227 501-182

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

sendo por isso possvel a estimativa quantitativa do DNA da amostra relativamente a do padro (clivado com Hind III). Os poos 1, 2 e 4 apresentam uma banda correspondente a aproximadamente 13500 pb que corresponde, ento, ao gDNA. Contudo o aparecimento de outras bandas nesses poos indicam a contaminao da amostra. A banda mais intensa, provavelmente no ser uma contaminao, dado que a determinao do grau de pureza do gDNA resultou num valor aprecivel para a pureza da amostra obtida. Assim poder tratar-se de gDNA que sofre supercoiling e que, portanto, apresenta uma maior distncia percorrida no gele de agarose. A banda que mais migrou corresponder, provavelmente a contaminaes por RNA. Uma forma de eliminar estas contaminaes, era recorrer a RNAses que degradasses o RNA e purificassem assim a amostra de gDNA. Em relao aos tratamentos a que o gDNA foi sujeito, verifica-se que apenas a fervura foi capaz de destruir o DNA. Uma vez que tanto os poos 2, como 4 apresentam um perfil idntico ao 1 (controlo). O facto do poo 3 apresentar uma banda muito intensa que migrou muito no gel, isto indica que o DNA foi desnaturado e cortado em vrias pores fazendo com que se formassem vrias pores de DNA com poucos pares de bases (cerca de 300 pb). Conclui-se ento que o vortexar ou pipetar repetidamente o DNA no afeta, de forma alguma, a sua integridade. Salvaguarda-se que a resoluo do gel no permite obter valores, relativos ao nmero de pares de bases de cada fragmento, que possam ser tomados em considerao de forma absoluta. Temos apenas dados comparativos e valores aproximado 8

2 3 4 5

CONCLUSES
A absoro de radiao ultravioleta por parte dos cidos nucleicos a base da metodologia utilizada para determinar o grau de pureza do DNA e que se designa por mtodo espectrofotomtrico. Assim, a quantidade que radiao ultravioleta que absorvida relaciona-se proporcionalmente com a quantidade de DNA da amostra. A amostra de DNA genmico extrada de Drosophila melanogaster , obtida com um elevado grau de pureza com uma concentrao de 316,4 g/mL e possu cerca de Um mtodo alternativo seria um teste utilizando fluorescncia induzida pelo brometo de etdeo com posterior comparao com a fluorescncia de uma srie de padres que apresentam uma gama de fragmentos com vrias dimenses. Cada barra corresponde a uma concentrao de DNA bem definida,

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

EXTRACO DE DNA PLASMDICO DE ESCHERICHEA COLI


OBJECTIVOS
Com este trabalho prtico pretende-se preparar, em pequena escala, e para uso de rotina, o plasmdeo pSK-polo de Escherichia coli. Deste modo, e tendo em conta a grande quantidade de DNA cromossmico, necessrio separar e isolar o DNA plasmdico da bactria, para a sua futura preparao. aminocidos raros, bem como produo de enzimas de restrio. Para alm disso, de referir a capacidade de transmisso de plasmdeos para outros hospedeiros da mesma estirpe ou estirpes diferentes, pelo processo de conjugao bacteriana, na qual o gene mob tem especial importncia. Para usufruir das suas caractersticas especiais, os plasmdeos originais das bactrias foram alterados de modo a aumentar a sua eficincia na clonagem e expresso gnica. Assim, surgiram novos plasmdeos com caractersticas diferentes das originais: menor tamanho, maior nmero de locais de clonagem e cpias, e marcas seletivas convenientes, muito teis em Biologia Molecular. So estes novos vectores plasmdicos de clonagem ou de expresso que se pretendem isolar atravs da tcnica a que o relatrio diz respeito. Para ser separado o DNA plasmdico do DNA cromossmico, necessrio induzir a lise celular e, aps centrifugao dos resduos resultantes, separar os dois componentes. necessria, tambm, uma desproteinizao da soluo anteriormente referida, para remoo de protenas associadas molcula, bem como passos adicionais de purificao da mesma.

INTRODUO TERICA
Muitas bactrias, para alm do DNA genmico cm cerca de 4 milhes de pares de bases, possuem DNA plasmdico em grandes quantidades, chegando a alguns milhares de pares de bases. Estas molculas, pequenas, so constitudas por uma cadeia dupla de cidos nucleicos, devidamente associados entre si, de forma circular fechada (cccDNA) e possuem replicao autnoma. Estas caractersticas morfolgicas facilitam a sua separao do DNA cromossmico. Para alm disso, verificou-se que os plasmdeos contm genes especficos que, na bactria que os possui, codificam todo um conjunto de informaes de elevada importncia a nvel evolutivo. Assim, estas molculas de DNA, hoje em dia extremamente manipuladas pelo homem, revelaram-se bastante teis em Engenharia Gentica pela sua capacidade de conferir fentipos vantajosos e variados, tais como resistncia a metais pesados, enzimas e antibiticos, produo e catabolismo de molculas orgnicas complexas e 9

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

METODOLOGIA REAGENTES
Utilizou-se meio de cultura LB; Tampo STET; Lisozima; Isopropanol e agarose 1%.

RESULTADOS EXPERIMENTAIS

EQUIPAMENTOS
Incubadora; Vortex; microcentrfuga.

PROCEDIMENTO EXPERIMENTAL
Inoculou-se, durante a noite, a estirpe E. coli com o plasmdeo a purificar. Introduziu-se 1,5 ml da cultura num tubo Eppendorf e centrifugaram-se as clulas durante 3 minutos velocidade mxima. Aspirou-se, ento, o contedo sobrenadante com ajuda de uma micropipeta. Adicionou-se 1,5 ml da cultura bacteriana ao sedimento obtido no processo e 200 l do tampo STET, ressuspendendo-se o sedimento em vortex ou com a micropipeta. Adicioinou- se 4 l de lisozima (50 mg/ml) e incubou- se durante 5 minutos temperatura ambiente. Posteriormente procede-se incubao a 95C durante 1 minuto, centrifugao do lisado celular durante 10 minutos velocidade mxima. Descarta-se o sedimento e adicionam-se 200 l de isopropanol ao sobrenadante e vortexa- se. Segue-se uma centrifugao velocidade mxima, durante 10 minutos. Recolhe-se o sobrenadante com uma micropipeta e seca-se o sedimento a 37C na estufa durante 10 minutos. Ressuspende-se o DNA em 10 l de gua pura. Procede-se realizao de uma electroforese em gel de agarose (1%). Aplicao de 5 l da amostra misturados com 5l de tampo de aplicao. 10

Figura 3 Electroforese em gel de agarose. gDNA (DNA genmico) (1), gDNA vortexado intensamente (2); gDNA fervido (3); gDNA pipetada mltiplas vezes (4). Isto referente ao trabalho prtico Extraco do DNA genmico de Drosophila melanogaster. DNA plasmdico (5); marcadores de pares de bases (6).

CONCLUSES
De acordo com a imagem apresentada, (Figura 3) podemos concluir que o plasmdeo uma poro de DNA de menor peso molecular que o DNA cromossmico, tendo em conta que foi o material que apresentou maior migrao no gel, o que est de acordo com o esperado tendo em conta que estas pores de material gentico so pequenos fragmentos de DNA bacteriano de forma circular. Por anlise do resultado da electroforese (Figura 3 Poo 5), verifica-se que o DNA plasmdico foi separado do demais material gentico da bactria, DNA cromossmico, com sucesso. Isto porque no se verifica o aparecimento de outras

bandas no gel que pudessem indiciar a presena de outro DNA ou RNA que esteja a contaminar a amostra. Contudo no podemos inferir, com total certeza, acerca da contaminao por RNA, uma vez que o RNA migraria para valores prximos dos migrados pelo DNA plasmdico e a banda detectada muito grande. A banda em causa engloba fragmentos de cerca de

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

500 a 200 pb, podendo portanto englobar RNA. Uma forma de certificar a ausncia de RNA na amostra era proceder ao tratamento da amostra com RNAses que degradassem o DNA e repetir a electroforese. Daqui, podemos ainda concluir, que o DNA plasmdico apresenta aproximadamente entre 500 a 200 pb.

11

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

ANLISE ELETROFORTICA DE DNA DIGERIDO COM ENZIMAS DE RESTRIO


OBJECTIVOS
Estudar a aco enzimtica de duas enzimas de restrio (ER) EcoRI e HindIII na digesto de uma amostra de DNA plasmdico e avaliar o resultado dos cortes efectuados pelas endonucleases atravs de uma electroforese em gel de agarose.
Acresce que as enzimas do tipo III apenas efetuam metilao numa das cadeias. Por estas razes, as enzimas do tipo I e III no so frequentemente usadas em investigao de rotina em Biologia Molecular. As endonucleases de restrio de tipo II so sistemas binrios em que uma das subunidades tem ao nuclesica e a outra de metilao. Ambas as aes so efectuadas em locais especficos dentro da sequncia reconhecida. A maior parte das enzimas de restrio do tipo II, reconhecem sequncias com 4 8 pares de bases com simetria palindrmica. A enzima EcoRI (produzida por Escherichia coli) reconhece a sequncia GAATTC, enquanto AluI (produzida por Arthrobacter luteus) corta em AGCT. Como h especificidade para o local de corte, estas enzimas podem ser usadas para a degradao de molculas de DNA com obteno de fragmentos de menor tamanho, cujas extremidades so conhecidas em termos de sequncia nucleotdica. As sequncias das extremidades e o tamanho dos fragmentos obtidos variam de acordo com a enzima de restrio usada. Dada a possibilidade de manipulao em locais especficos do DNA, as enzimas de restrio constituem nos dias de hoje, ferramentas bsicas em Biologia Molecular. Duma maneira geral, so usadas para o estabelecimento de mapas de restrio de fragmentos de DNA cuja sequncia desconhecida, fragmentao de DNA genmico para separao electrofortica e posterior anlise, criao de fragmentos de DNA para subclonagem num vector apropriado e a criao de 12

INTRODUO TERICA
Os rpidos avanos da investigao cientfica, em particular da Biologia Molecular, que tiveram lugar nas duas ultimas dcadas foram possveis em grande parte, devido capacidade de isolar determinados segmentos de interesse de DNA procaritico e eucaritico. A clonagem de genes requer que as molculas de DNA sejam cortadas de um modo muito preciso e reprodutvel. Atravs da utilizao das enzimas de restrio esse objectivo facilmente conseguido, pois possuem a capacidade de ligao especfica a determinados locais de DNA de cadeia dupla (sequncia de reconhecimento) e sua posterior clivagem, no interior dessa sequncia ou adjacente a ela. De acordo com as caractersticas de corte, as endonucleases de restrio so classificadas em trs tipos. As enzimas do tipo I e III, para alm da aco nuclesica, tm aco modificadora (metilao) no mesmo domnio de reconhecimento da protena. Apesar destas enzimas reconhecerem sequencias especificas de DNA, a actividade nuclesica ocorre de modo aleatrio na proximidade da sequencia de reconhecimento e dependente de ATP.

sondas marcadas para anlises por southern e northern. Existem trs tipos de extremidade resultantes do corte consoante o modo de corte da cadeia dupla. Enzimas de restrio que cortam exatamente no meio da sequncia do palindroma (SmaI) originam extremidades sem nenhuma das duas cadeias protuberante (blunt ends). Outras enzimas cortam na extremidade 5do palindroma reconhecido originando extremidades protuberantes 5de 2-4 bases na forma de cadeia simples (EcoRI) denominadas por extremidades 5coesivas (5 sticky-ends). Outras enzimas cortam na extremidade 3do palindroma originando extremidades protuberantes 3de 2-4 bases na forma de cadeia simples (KpnI) denominadas por extremidades 3coesivas (3 sticky- ends). Como estas enzimas de restrio so, na sua maioria, especficas em relao sequncia de reconhecimento e corte, duas molculas de DNA diferentes que foram digeridas com a mesma enzima, por exemplo BamHI, possuiro extremidades 5 iguais que podem assim emparelhar utilizando as bases que ficaram em cadeia simples, numa reao catalisada por uma DNA Ligase. O resultado da ligao destas duas cadeias ser uma molcula recombinante. Dois factores so essenciais para a eficincia de corte das endonucleases de restrio: pureza do DNA e o tampo de digesto. As impurezas habituais presentes em amostras de DNA (protenas, fenol, clorofrmio, EDTA, SDS e a elevada concentrao de sais) podem inibir por completo determinadas enzimas 13

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

de restrio. A influncia de todos estes factores varia de enzima para enzima, pelo que se devem ter em conta quando se verifica ausncia de atividade, assegurando-se que as condies de reao foram as ideais. Os componentes essenciais dos tampes de digesto so: tampo Tris (pH 7.58.0), ies de magnsio, cloro, sdio, e potssio; um agente redutor como ditioeritriol, ditiotreitol ou 2-mercaptoetanol. Embora haja especificidade da atividade em relao a todos estes factores, o mais importante a concentrao de ies (fora inica). Assim, dividem-se as enzimas em trs grupos: as que requerem elevada fora inica, mdia fora inica e baixa fora inica. Esta propriedade particularmente importante para digestes com vrias enzimas de restrio em que impossvel a digesto simultnea com enzimas que requerem foras inicas diferentes. Nestes casos, as digestes devem ser feitas em separado, comeando pela enzima de menor fora inica, desnaturar a enzima por calor, ajustar a concentrao de sais e proceder segunda digesto. As consequncias do uso de condies no ideais em digestes com enzimas de restrio so a ausncia de atividade ou o fenmeno de star activity em que a enzima perde a especificidade para a sequncia de reconhecimento, passando a fazer cortes no s nos locais especficos mas tambm noutros locais. Um factor que pode ser importante em alguns casos o grau de metilao do DNA. A produo de enzimas de restrio um mecanismo de defesa das bactrias contra a infeco por DNA exgeno. Para

precaver a ao contra o prprio DNA, estas enzimas de restrio promovem a metilao de nucletidos, ficando ento a sequncia de reconhecimento imune sua ao. Assim, quando se trabalha com DNA plasmdico proveniente de estirpes bacterianas com uma elevada capacidade de metilao, deve-se ter em ateno, tambm, a sensibilidade da enzima a usar para a metilao dos nucletidos da sequncia de reconhecimento. A estratgia mais usada o uso de estirpes bacterianas manipuladas geneticamente para a perda dessa capacidade.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

PROCEDIMENTO EXPERIMENTAL
Pipetar para dois tubos Eppendorf, usando pontas de pipeta diferentes e limpas, 15l de gua destilada e esterilizada, 2l de tampo de enzima de restrio 5, 2l de DNA plasmdico e 1l de enzima de restrio, por esta ordem, em que no tubo 1 adiciona-se apenas EcoRI, e no tubo 2 adiciona-se apenas HindIII. Preparar uma terceira soluo, pipetando 14l de gua destilada e esterilizada, 2l de tampo de enzima de restrio 5, 2l de DNA plasmdico e 1l de cada enzima de restrio Misturar cuidadosamente batendo levemente com o dedo no fundo do tubo. Incubar a 37 C durante 1 hora. Preparao do gel 1% de agarose: Pesar 0,4 g de agarose e adicionar 40 mL de tampo TAE 1x. Aquecer at ebulio de forma a dissolver completamente a agarose. Adicionar 1 L de brometo de etdeo, agitar levemente e verter a soluo sobre um molde, utilizando-se um pente para a formao dos poos, onde sero colocadas as amostras de DNA. O gel deixado arrefecer para que solidifique. Remover o pente e colocar o gel na tina de electroforese submergido em tampo TAE 1. Preparao das amostras em tubos Eppendorf para carregar o gel: No primeiro adicionar 5 l de DNA no digerido e 5 l de tampo de aplicao; no segundo adicionar 20 l de DNA digerido com HindIII e 5 l de tampo de aplicao; no terceiro adicionar 20 l de DNA digerido com EcoRI e 5 l de tampo de aplicao; No quarto adicionar 20 l de 14

METODOLOGIA REAGENTES
Utilizou-se 3 L de soluo enzimas de restrio EcoRI e HinIII estas devem ser mantidas em gelo durante a actividade prtica, sendo depois armazenadas a - 20C; 11 L de plasmdico pSK-polo; 6 L de tampo de enzima de restrio 5x; 0,4 g de agarose; tampo TAE 1x; 1 L de brometo de etdio; 5 L marcador de peso molecular Bioline; 20 L de tampo de aplicao; 44 L de gua destilada e esterilizada.

EQUIPAMENTOS
Utilizou-se uma estufa, um suporte para gel de agarose, uma fonte de alimentao para a electroforese e um transiluminador de UV.

DNA digerido com HindIII e EcoRI e 5 l de tampo de aplicao. Carregar o gel com as quatro amostras, carregando um quinto poo com 5 l de marcador de peso molecular. Correr o gel a 100V at a frente do gel chegar a cerca de dois teros do gel. Visualizar o DNA num transiluminador de UV.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

cada banda, em cm, e ao logaritmo dos pesos moleculares. PM /pb 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 600 400 200 A partir da aplicao da regresso linear da distncia migrada (d) em funo do logaritmo dos pesos moleculares (log PM) obtm-se a seguinte equao: dmigrada = - 3,811 log(PM) + 17,27 (1) Aplicando a equao (1) s bandas correspondentes s amostras obtm-se os pesos moleculares apresentados na tabela 3. dmigrada / cm 2,40 2,65 2,85 3,09 3,30 3,79 4,10 4,48 5,05 5,95 6,40 6,92 7,12 8,68 Log(PM) 4,00 3,90 3,78 3,70 3,60 3,48 3,40 3,30 3,18 3,00 2,90 2,78 2,60 2,30

RESULTADOS EXPERIMENTAIS
Aps a electroforese obteve-se os resultados apresentados na figura 3.

Figura 4 Gel de agarose 1% corrido a 100V. Da direita para a esquerda: marcador de pesos moleculares; DNA plasmdico por digerir; DNA plasmdico digerido com HindIII; DNA plasmdico digerido com HindIII e EcoRI; DNA plasmdico digerido com EcoRI. Tabela 2 Valores referentes aos pesos moleculares do marcador Bioline em pares de bases, distncia migrada de 15

Tabela 3 Valores referentes s distncias de migrao das bandas das amostras e aos respectivos pesos moleculares. dmigrada / cm 2,50 3,85 2,92 3,13 3,50 5,50 3,51 5,40 PM / pb 7510 3322 5827 5132 4104 1226 4079 1302

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Controlo HindIII HindIII + EcoRI EcoRI

No que diz respeito ao estudo do DNA digerido com diferentes enzimas de restrio, pode-se concluir que a EcoRI possui duas zonas de corte no plasmdeo recombinante, o que origina duas bandas no gel, com pesos moleculares de 4079 pb e de 1302 pb. Em relao enzima HindIII conclui-se que esta corta o plasmdeo apenas uma vez, fazendo com que este perca a sua conformao circular e adquira uma conformao linear, levando ao aparecimento de apenas uma banda.
No caso da digesto do DNA plasmdico com as duas enzimas, observa-se trs bandas, o que concordante com o esperado, dado que a insero do gene polo foi feita entre um corte da EcoRI e o corte da HindIII. Assim, pode-se concluir que o fragmento inserido correspondente ao gene polo possui um peso molecular de aproximadamente 1302 pb.

CONCLUSES
Analisando o gel, pode-se verificar a presena de duas bandas no poo do DNA plasmdico controlo e ainda uma terceira, pouco visvel. O que seria de esperar era obter-se 3 bandas distintas, referentes s 3 formas de DNA plasmdico: DNA circular, DNA linear de cadeia dupla e DNA superenrolado.

16

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

ELABORAO DO MAPA DE RESTRIO DE UM PLASMIDEO RECOMBINANTE


OBJECTIVOS
Nesta aula laboratorial pretende-se realizar o mapa de restrio de um plasmdeo recombinante que contm um gene que codifica para uma subunidade da enzima NADH (desidrogenase presente na cadeia respiratria). Para tal, sero utilizados dois fragmentos de DNA distintos, L e R, inseridos no plasmdeo pGEM-3. Aps a elaborao das molculas recombinantes, deve proceder-se anlise do peso molecular dos fragmentos obtidos aps digesto desses mesmos plasmdeos recombinantes com as enzimas de restrio SalI, HindIII, PstI, XhoI, PvuII, SacI e BamHI. restrio, os quais constituem o stio de insero no vetor de clonagem. Estes vetores constituem parte essencial no processo de clonagem, sendo necessria a atuao de enzimas de restrio, que cortam a molcula de DNA em sequncias especficas, para ligar o DNA a ser clonado ao DNA do vetor (plasmdeo recombinante), atravs da produo de extremidades coesivas complementares permitindo a construo de mapas fsicos ao longo da mesma

INTRODUO TERICA
Para a manipulao de fragmentos de DNA genmico de maior interesse a obteno de pores gnicas de menores dimenses, pois estas molculas so quase sempre demasiado grandes para poderem ser manipulados diretamente. Os plasmdeos so molculas circulares duplas de DNA extra cromossomais capazes de se reproduzir independentemente do DNA cromossmico. Podem estar presentes em duas ou mais cpias na clula e podem variar entre 5 e 400 kb (kilobases). Este plasmdeos, sendo capazes de amplificar o segmento de DNA neles inserido, so utilizados como vetores de clonagem. Para isso, tm que possuir certas propriedades como ter uma origem de replicao e possuir Mltiplos Stios de Clonagem (MSC), ou seja, vrios locais nicos de clivagem para endonucleases de 17

Figura 5 Esquema de preparao de um plasmdeo recombinante. Como consequncia, so obtidas inmeras pores de dimenses mais reduzidas, cujo peso molecular determinado em gel de agarose, mapas de restrio. importante referir que as extremidades referidas dessas mesmas pores so sequncias nucleotdicas conhecidas, que correspondem sequncia de reconhecimento da(s) enzima(s) de restrio utilizada(s) durante a reao. A relao entre o nmero de pares de bases correspondente a cada uma das bandas do DNA padro (marcador) e a distncia percorrida por essas mesmas bandas num gel de agarose permite determinar qual a equao da reta que

relaciona estas duas variveis, tendo em conta que as bandas correspondentes ao marcadores tm pesos moleculares conhecidos. Assim, a elaborao de mapas de restrio rigorosos permite a seleo de sequncias genmicas de dimenses mais reduzidas que podem ser clonados posteriormente facilitando o seu estudo. Estes mapas podem, portanto, ter aplicaes de grande importncia em gentica molecular, tais como localizao fsica dos locais de corte de enzimas de restrio ao longo da molcula de DNA, bem como identificar segmentos de DNA homlogos.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Tabela 4 Lista dos pesos moleculares (pb) de cada banda do marcador e respectivos valores da distncia migrada no gel (cm). Marcadores de PM/pb 23130 9416 6557 4361 2322 2027 564 Com estes valores, traou-se o grfico da distncia migrada pelas bandas do marcador em funo do logaritmo dos respectivos pesos moleculares. Assim, obtm-se uma reta que permitir calcular os pesos moleculares das bandas do DNA digerido.
5,60 4,60 d/cm 3,60 2,60 1,60 0,60 2,700 3,000 3,300 3,600 3,900 4,200 log(PM) dmigrada = -2,7475log(PM) + 12,705 R = 0,9575

dmigrada /cm 1,20 1,66 1,98 2,40 3,32 3,59 5,50

Log(PM) 4,364 3,974 3,817 3,640 3,366 3,307 2,751

METODOLOGIA PROCEDIMENTO EXPERIMENTAL


Medio das distncias percorridas por cada uma das bandas evidenciadas no gel de agarose. Traar o grfico dos pesos moleculares (pb) do DNA padro em funo da mobilidade dos fragmentos (mm) no gel dos fragmentos. Tendo em conta a distncia percorrida pelos fragmentos de DNA da amostra e substituindo esses valores na equao do grfico determinam-se as dimenses dos fragmentos do DNA digerido do plasmdeo recombinante utilizado.

RESULTADOS EXPERIMENTAIS
Relativamente ao marcador (DNA padro) conhecem-se os pesos moleculares e mediram-se as distncias migradas de cada banda obtendo-se os seguintes resultados: 18

Figura 6 Representao grfica de dmigrada em funo do log(PM). Seguidamente, procedeu-se medio das distncias migradas pelas bandas do DNA digerido da amostra de plasmdeo utilizada.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Tabela 5 Enzimas de restrio utilizadas, distncias migradas e respectivos pesos moleculares das bandas dos fragmentos R e L.
Fragmento L d/cm Peso/pb 3,8 3,6 3,7 3,4 4,2 3,3 4,3 3,1 5,0 3,0 5,9 2,9 3,5 4,3 5,0 1742 2060 1895 2436 1246 2649 1146 3133 637 3406 300 3704 2240 1146 637 Fragmento R d/cm Peso/pb 3,2 3,5 3,6 3,1 5,1 3,1 4,7 3,0 4,8 3,4 3,7 2,8 3,0 4,8 7,0 2881 2240 2060 3133 586 3133 820 3406 754 2436 1895 4028 3406 754 119

Enzima pGEM 3x BamHI SalI1 SalI2 HindIII1 HindIII2 PstI1 PstI2 XhoI1 XhoI2 PvuII1 PvuII2 SacI Xho/SacI1 Xho/SacI2 Xho/SacI3

Figura 7 Eletroforese onde se inseriu o fragmento R.

CONCLUSES
Construo do mapa de restrio do fragmento L O plasmdeo pGEM-3 sem o fragmento inserido tem 1742 pb. O seu peso molecular foi determinado atravs do peso molecular do fragmento obtido pelo corte com a enzima de restrio BamHI. O plasmdio com o fragmento L possu 3704 pb. Os valores das determinaes so aproximados porque as medidas esto carregadas com erros significativos e isso propaga-se em todas as operaes, ocorrendo desvios at dezena de pb. Sabendo que tanto o fragmento L como o R foram inseridos com a enzima de restrio Sal I possvel construir o mapa de restrio do plasmdeo. 19

Figura 8 Eletroforese onde se inseriu o fragmento L. Com os valores das distncias migradas pelas bandas de cada amostra no gel (cm) e substituindo esses resultados na equao da reta do grfico da figura 6 traado com os dados do marcador, obtm-se os pesos moleculares das bandas no gel.

Relativamente enzima HindIII pode-se concluir que esta corta duas vezes obtendo-se dois fragmento, um com 2436 pb e o outro com 1246 pb. Esta enzima corta o pGEM-3 na posio 7 e uma outra, originado duas bandas, ento ter de possuir um outro local de corte no fragmento inserido. Assim, o segundo local de corte da HindIII ser a 1228 pb (1246 pb + 7 pb) do primeiro local de corte. Quanto Pst I , verifica-se que tambm corta duas vezes o fragmento, tendo um dos fragmentos 2649 pb e o outro 1146 pb. Sabe-se que este enzima corta o pGEM-3 na posio 23 pb, ento, o outro local de corte da Pst I ser a 1146 pb do primeiro corte e ter de ser no fragmento, pelo que ocorrer na posio 1169 pb. Com a enzima PvuII tambm se obtm duas bandas, o que significa que corta duas vezes o fragmento, sendo que um dos fragmentos tem 3406 pb e outro 300 pb. Sabe-se que tem um local de corte na posio 104 pb do vetor, pelo que com o fragmento inserido, este local ocorre na posio 2164 pb do vetor com o fragmento L. O outro local de corte ter de ocorrer, obrigatoriamente, no fragmento L, assim ir ocorrer na posio 1864 pb (2164 pb 300 pb). Relativamente enzima Sal I (utilizada para inserir o fragmento no plasmdeo), verifica-se o aparecimento de duas bandas muito prximas uma da outra no gel de electroforese, o que nos indica que o fragmento e o vetor devero ter um tamanho muito aproximado e pesos moleculares de 2060 pb e 1895 pb. A enzima Sac I origina apenas uma banda no gel de agarose e sabe-se que corta o vetor na posio 56 pb pelo que cortar o plasmdeo na posio 2085 pb. Assim, no 20

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

ter nenhum corte no fragmento inserido. O peso molecular relativo a esta banda (3704 pb) o tamanho do plasmdeo recombinante (vetor + fragmento). Sabe-se que a enzima XhoI no corta o vetor, o que significa que as duas bandas que aparecem no gel correspondem a dois locais de corte no fragmento. Dos dados obtidos conclui-se que corta em dois locais originando fragmentos com 3133 pb e 637 pb. Para se localizar os dois locais anteriormente referidos recorresse anlise dos resultados obtidos para as bandas respetivas digesto dupla com as enzimas de restrio XhoI e SacI, partindo j da informao de que esta ltima apenas corta o pGEM-3. Sabe-se que estas duas enzimas juntas cortam o plasmdeo em trs locais, a 2240 pb, 1146 pb e 637 pb. Tendo em conta que a Sac I corta o plasmdeo na posio 2116 pb, um dos locais de corte da Xho I ser a 970 pb (2116 pb - 1146 pb). O outro local de corte pela XohI acontece na posio 337 pb (970 pb 637 pb). O mapa de restrio obtido encontra-se apresentado na figura 9. Construo do mapa de restrio do fragmento R Relativamente ao fragmento R procedeu- se do mesmo modo para a construo do mapa de restrio. Dado que as enzimas de restrio usadas foram as mesmas e o vetor o mesmo. Assim o mapa de restrio obtido encontra-se apresentado na figura 10.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Figura 9 Mapa de restrio do plasmdeo construdo a partir do vetor pGEM3 e do fragmento L.

Figura 10 Mapa de restrio do plasmdeo construdo a partir do vetor pGEM3 e do fragmento R. 21

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

DISCUSSO
Com a realizao desta atividade conseguiu-se analisar segmentos de DNA distintos cortados com vrias enzimas de restrio, bem como compreender qual a dimenso dos mesmos por comparao, relativamente a um padro conhecido. Para isso, teve-se em ateno o grfico, que relaciona o comprimento (cm) com o nmero de pares de bases correspondentes. Assim, por existir uma dependncia/necessidade de determinar com a maior exatido possvel o nmero de pares de bases num segmento de DNA, a correta elaborao do grfico tambm fundamental. Assim, o rigor do modelo

ser proporcional ao nmero de fragmentos considerados, cuja migrao no gel de agarose foi analisada anteriormente. Portanto, para determinar o nmero de pares de bases que compem os fragmentos contidos nos diversos poos, utiliza-se uma ladder que permite estabelecer a comparao com base numa proporcionalidade direta. Atravs da elaborao do mapa de restrio de ambos os fragmentos foi possvel visualizar de forma esquemtica o processo de corte de cada uma das enzimas.

22

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

PCR POLIMERASE CHAIN REACTION


OBJECTIVOS
Amplificar uma sequncia de DNA genmito (gDNA) e de uma sequncia de cDNA, amabas sequncias do gene polo, por PCR. Anlise da eficincia e caractersticas do gDNA e do cDNA por electroforese. adicionados s extremidades 3 dos primers seguindo a complementaridade das bases do DNA inicial que serve de molde. Assim a nova sequncia formada pode agora servir de molde para futuros ciclos, dando azos para um aumento exponencial da quantidade do material gentico. O tamanho das cadeias de DNA que se formam sero sempre de tamanho bem definidos dado que terminam todos nas extremidades 5 dos primers utilizados. Apesar de se tratar de uma tcnica com elevada aplicabilidade e rendimento, existem vrios parmetros que tm de ser optimizados de modo a que a reao ocorra de forma correta. Porm, o parmetro que considerado mais complexo do ponto de vista da optimizao da tcnica, trata-se do desenho dos primers adequados. Assim, um bom desenho dos primers fundamental para gerir da melhor forma o oramento e poupar tempo, dado que o uso de primers adequados aumentaro significativamente o rendimento da reao. Para um bom desenho dos primers existem algumas regras, que embora algumas sejam empricas, apresentam resultados bastante satisfatrios. Um dos fatores mais importantes que o primer tenha uma sequncia nucleotdica que seja nica na regio alvo, de modo a evitar a ligao em mltiplos locais da zona a amplificar. Comummente, a sequncia do primer deve ser perfeitamente complementar sequncia de bases da cadeia de DNA molde. Outro fator importante a colocao de um resduo de guanina ou citosina na terminao 3 do primer, isto porque a ligao que se forma ajuda na correta hibridao, pois tratam-se de resduos que estabelecem trs pontes de Hidrognio e portanto fortalecem a ligao estabelecida.

INTRODUO TERICA
A tcnica de PCR (reao de polimerase em cadeia) o mtodo mais usado e rpido para a amplificao de certos fragmentos de DNA ou RNA em sistemas in vitro. Esta tcnica, como a de clonagem molecular, permitiu o desenvolvimento da Biologia Molecular. A PCR uma tcnica com uma vasta gama de aplicaes, que vo desde a clonagem de DNA ou de cDNA (DNA complementar), ensaios de mutaes in vitro, engenharia gentica, anlise de amostras forenses, determinao de agentes infecciosos, diagnstico de doenas genticas at sequenciao direta do DNA genmico e do cDNA. A tcnica de PCR baseia-se na atividade cataltica de uma DNA polimerase e requer a existncia de dois iniciados oligonucleotdicos (primers) que se encontram nas extremidades do fragmento de DNA a ser amplificado, a designada sequncia alvo. Para alm disso, a soluo onde se encontram as DNA polimerases, DNA e primers submetida a vrios ciclos de aumento e abaixamento da temperatura. Assim, em cada ciclo promove-se a desnaturao do DNA de cadeia dupla pelo aquecimento, hibridam-se os primers s sequncias complementares e por fim ocorre a extenso dos primers por incorporao de nucletidos por ao das DNA Polimerases. Os nucletidos so

23

Contudo sequncias que possuam trs ou mais guanina (G) ou citosinas (C) deve ser evitado, pois em caso de emparelhamento errneo, torna-se mais difcil a sua remoo para uma nova tentativa, dada a fora da interao formada. No desenho dos primers deve ter-se em ateno possibilidade de emparelhamento entre os prprios primers, assim dever-se- ter em linha de conta possveis sequncias complementares entre diferentes primers. Se houver uma grande probabilidade de emparelhamento entre o par de primers utilizado, a ocorrncia deste fenmeno ser superior das reao de PCR, dada a preferncias com que ocorrem. Ainda dentro dos estudos de complementaride dos primers, estes so devem ter sequncias com mais de 4 bases que possam ser complementares dentro do mesmo primer, pois impulsionaria a formao de estruturas por auto- complementaridade, estruturas secundrias (hairpins). Como j foi referido a composio de bases dos primers muito importante, da que um primer no dever ter menos de 17, nem mais do que 25 nucletidos e o contedo em guanina e citosinas deve estar entre 45 a 55%. Outro aspecto importante a temperatura que os diferentes primers dentro de um mesmo par hibridam, dado que essa temperatura deve ser muito semelhante (Tm). Esta temperatura pode ser calculado com base na equao 1 e no deve diferir em mais do que 5C entre cada primer dentro de um par a utilizar.
! = ! + ! 4 + ! + ! 2

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

negativamente). Neste tipo de tcnica necessrio recorrer a DNA polimerases que sejam resistentes s variao de temperatura que ocorrero durante os ciclos, da usar-se frequentemente a Taq DNA Polimerase (DNA polimerase termoestvel) que extrada da bastria Thermus aquaticus pois trata-se de uma bactria extremfila encontrada em ambientes aquticos a elevadas temperaturas.

METODOLOGIA REAGENTES
Utilizou-se 1ng de cDNA; 5ng de gDNA; solues de 0,1 mol dm-3 dos primers 9R1 (sense primer) e 9R2IC (antisense primer); soluo de dNTPs com a concentrao de 200 mol dm-3; tampo de reao 1x; soluo aquosa de MgCl2; Taq DNA polimerase: 0,25U; gua estril ultrapura. Para a electroforese utilizou-se agarose; Brometo de etdeo (potencialmente cancergeno; manusear com luvas e evitar o contacto com as vias respiratrias).

EQUIPAMENTOS
Recorreu-se a um amplificador termocclico para efetuar o programa de ciclos para as reaes de PCR e centrfuga. Suporte para o gel de agarose e fonte de alimentao para a electroforese.

(1)

PROCEDIMENTO EXPERIMENTAL

No que diz respeito execuo Preparao do meio reacional para PCR de experimental propriamente dita, existem gDNA alguns cuidados a ter em conta como a utilizao duma concentrao adequada de Para um tubo de PCR pipetar 1L da soluo Cloreto de Magnsio (MgCl2), dado que o de gDNA; 5L de tampo de reao; 1L de Mg2+ um co-fator importante na ativao cada uma das solues de primers; 4L da da polimerase e ainda importante na soluo de dNTPs; e 6L da soluo de estabilidade das cadeias de DNA (carregadas MgCl2. Adicionar gua para perfazer um 24

volume total de 50L (tendo em conta que se ir adicionar, posteriormente, 0,25L de Taq DNA Polimerase), assim deve ser adicionado um volume de gua estril de 31,75 L. Misturar suavemente a mistura e centrifugar. Adicionar 0,25L da soluo de Taq DNA polimerase e misturar muito suavemente com a ponta da pipeta. Preparao do meio reacional para PCR de cDNA Repetir o procedimento anterior, com a exceo da adio de 1L de gDNA, que em vez disso, dever ser adicionado 1L da soluo de cDNA. Colocar os tubos de PCR em banho a 95C durante 5 minutos. Segue-se o acondicionamento dos tubos de PCR no suporte do aplificador termocclico e programar 15 ciclos. Cada ciclo dever compreender um perodo de 15 segundos a 94C (promove a desnaturao), seguido de 30 segundos a 50C (hibridao) e 1 minuto

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

a 72C (extenso). Aps o ltimo ciclo, as amostras devero ficar 10 minutos a 72C. Retirar os tubos do amplificador termocclico e acondicion-los a 4C. Aplicar as amostras em gel de agarose a 1%.

RESULTADOS EXPERIMENTAIS
DESENHO DOS PRIMERS O primer 9RI (sense primer) foi obtido com base nas regras definidas na introduo e obtido diretamente a partir da sequncia 53. J o primer 9R2IC (antisense primer) obtido a partir da sequncia da extremidade oposta e como ter de polimerizar na cadeia oposta, o primer, ter de ser complementar s bases que compe a sequncia escolhida.

Extremidade 5 da sequncia sense da poro a amplificar 5 AGCTATGCTATGCTATGCTAGCCAGTCAGCTGAACGTG 3 5 TATGCTAGCCAGTCAGC 3 Primer sense Sequncia sense

Extremidade 3 da sequncia sense da poro a amplificar 5 TCTAATTCCAAGCCAATTGCCAAAAAGGAACCG 3 3 AGATTAAGGTTCGGTTAACGGTTTTTCCTTGGC 5 3 CGGTTAACGGTTTTTCC 5 O primer sense constitudo por 17 apresenta uma Tm=50C. Assim o par de nucletidos, dos quais 9 so guanina ou primers escolhido por ser usado para PCR, citosinas (53% de G/C) e apresenta uma dado que possuem um nmero de Tm=52C (calculado com base na equao 1. nucletidos aceitvel, a percentagem de G/C Para o primer antisense, o nmero de est dentro dos parmetros estipulados, e a nucletidos o mesmo (17), possu 8 Tm difere apenas em 2C entre cada um dos guaninas ou citosinas (47% de G/C) e primers. 25 Sequncia sense Sequncia antisense

Primer antisense

ELECTROFORESE Como forma de avaliar a qualidade do produto da PCR, procedeu-se a uma electroforese em gel de agarose a 1%, cujo resultado (Figura 1) evidncia uma maior migrao do cDNA do que do gDNA. Para alm disso verificam-se mais trs bandas de migrao para o poo 2, correspondente ao gDNA. No que diz respeito ao cDNA, verifica- se a migrao de mais uma banda no gel. Procedeu-se a medio das distncias de migrao dos marcadores de pesos moleculares (valores sumariados na Tabela 1) e procedeu-se ao traado grfico do logaritmo dos pesos moleculares em funo da distncia migrada no gel (Figura 2). Os pontos ajustam-se a uma reta cuja regresso linear (R2=0,99434) utilizada para determinar o nmero de pares de bases de cada um dos fragmentos de cDNA e gDNA.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Tabela 6 Valores referentes migrao dos marcadores de pesos moleculares, nmero de pares de bases referentes a cada banda e respectivo logaritmo.

dmigrada /mm 5,4 6,1 6,8 7,3 7,9 8,8 9,5 10,4 11,7 13,4 14,2 15,1 17,0 18,8

log(PM)
3,900 3,700 3,500 3,300 3,100 2,900

Marcadores PM/pb 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 600 400 200

log (PM) 4,000 3,903 3,778 3,699 3,602 3,477 3,398 3,301 3,176 3,000 2,903 2,778 2,602 2,301

log(PM) = -0,1201 dmigrada + 4,5869 R = 0,99434

Figura 11 Resultado da electroforese em gel de agarose 1% para o produto da amplificao por PCR de cDNA (1) e gDNA (2). O poo (3) corresponde aos marcadores de pesos moleculares.

2,700 2,500 2,300 5,0 7,0 9,0 11,0 13,0 15,0 17,0 19,0

dmigrada /mm

Figura 12 Representao grfica dos pontos referentes ao logaritmo do nmero de pares de bases em funo da distncia migrada pelas bandas. Respectiva regresso linear e equao da reta.

26

Com base na equao da reta determinada e nas distncias migradas pelas bandas do cDNA (dmigrada=16,0 mm) e do gDNA (dmigrada=15,4 mm) possvel determinar o nmero de pares de bases de cada um dos fragmentos, Tabela 2. Tabela 7 Valores referentes migrao do cDNA e do gDNA em gel de agarose a 1% e respectivo nmero de pares de bases. cDNA gDNA Como seria de esperar, o cDNA apresenta um menor nmero de pares de bases (menos 83pb) do que o corresponde gDNA. Isto porque o cDNA obtido atravs de uma transcriptase reversa a partir do mRNA correspondente. Ora, o mRNA sofre um processo de splicing ps transcrio de modo que os intres so removidos e portanto, leva ao encurtamento da sequncias de mRNA e consequente encurtamento da sequncia de cDNA. Assim podemos inferir que cerca de 80pb do gene polo correspondem a intres e que no codificam para a protena. dmirada /mm 16,0 15,4 pb 463 546

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

O DNA genmico (gDNA) composto por intres, exes e fragmentos que regulam a expresso gnica. Porm, apenas os exes contm informao para a sntese proteca, dado que os intres so transcritos para mRNA mas so eliminados durante o processo de splicing do mRNA. Assim de esperar que o mRNA tenha menos bases que o o gDNA que lhe deu origem. Como o DNA complementar (cDNA) obtido a partir do mRNA por ao enzimtica de uma transcriptase reversa, esta poro de DNA ter um nmero de bases inferior ao gDNA inicial, da o cDNA migrar mais do que o gDNA em gel de agarose. Detectou-se ainda a migrao de mais trs fragmentos diferentes no poo carregado com gDNA, isto deve-se a estruturas de DNA com elevado efeito de supercoilling que apresentam uma menor distncias migrada no gel. Contudo, estas e a outra banda detectvel no poo carregado com cDNA podem dever-se a contaminaes do material gentico utilizado. No que diz respeito intensidade das bandas, esta uma boa forma de avaliar a eficincia da PCR qualitativamente. Verifica-se que a banda correspondente ao gDNA deveras mais intensa do que a de cDNA, isto pode estar relacionado com temperaturas que no se ajustavam to bem amplificao do cDNA como o que aconteceu com o gDNA. Pode ainda pensar-se que a quantidade de Mg2+ adicionada foi demasiado elevada e que levou a uma sobreatividade da Taq DNA polimerase e que aumenta a inespecificidade da tcnica, diminuindo a eficincia e aumentanto o nmero de bandas correspondentes a bandas no desejveis.

CONCLUSES
No que diz respeito ao desenhos dos primers, estes seguem todas as condies para optimizarem a reao de PCR, para alm dos requisitos que satisfazem e que j fora supracitados, apresentam ainda pouca probabilidade de emparelharem um com o outro, para alm de que no existem mais do que 3 guaninas ou citosinas consecutivas em cada um dos primers.

27

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

TRANSFORMAO DE ESCHERICHIA COLI COM DNA PLASMDICO


OBJECTIVOS
Transformar E.coli com DNA plasmdico. Transformar as clulas com plasmdeo pBR322, pBR322-CAT, pEMBL9 e pEMBL9- CAT. Avaliar a eficincia da transformao. A eficincia da transformao obtida pela razo de transformantes por g de DNA. Nas transformaes com cloreto de clcio podem ser obtidas eficincias superiores a 108 transformantes por g de DNA. No entanto, no laboratrio de rotina de esperar valores na ordem dos 106-7 transformantes por g de DNA. Para que a eficincia seja mxima necessrio ter alguns pontos em considerao como a recolha das bactrias na fase exponencial do seu crescimento, manter as clulas em gelo, prolongar o tempo de contacto entre DNA, cloreto de clcio e clulas e usar material limpo e reagentes puros. Aps o choque trmico, adicionado meio no seletivo e procede-se a uma incubao de 30 a 60 minutos a 37C para que seja expresso o gene de resistncia ao antibitico (Amp). Ter de haver protena suficiente antes das colnias serem plaqueadas em meio seletivo. A enzima que confere a resistncia a -lactamse que degrada o antibitico. Neste trabalho foram usados dois plasmdeos diferentes o clssico pBR322 na sua forma original contm os genes responsveis pela resistncia ampicilina e tetraciclina. Este plasmdeo foi tambm modificado dando origem ao pBR322-CAT por isero do gene CAT no local do gene que codifica para a resistncia tetraciclina, desativando-o. O segundo plasmdeo utilizado o pEMBL9 pertence a uma nova gerao de vetores onde a insero dos fragmentos de DNA ocorre num polylinker localizado na extremidade 5 do gene que codifica para a galactosidase. O plasmdeo contm todos os elementos do promotor necessrio para a induo da expresso desta enzima, quando na presena de

INTRODUO TERICA
Define-se como transformao o processo de introduo de DNA em clulas. Esta tcnica atualmente amplamente utilizada para a amplificao de certos fragmentos de DNA. A primeira descrio de transformao de E.coli aconteceu cerca de 40 anos atrs quando Mendel e Higa demonstraram que clulas de E.coli tratadas com solues geladas de cloreto de clcio, seguidas de aquecimento, eram capazes de importar para o seu interior DNA do bacterifago . Apesar de no se perceber muito bem o mecanismo, a verdade que bactrias sujeitas a baixas temperaturas em solues com caties ficam capazes de importar DNA exgeno. Ao longos dos tempos tm sido feitos vrios ensaios no sentido de melhorar a eficincia do processo, contudo nem sempre se percebe o fundamento por detrs de tais execues.

Neste trabalho recorrer-se- ao cloreto de clcio de modo a tornar as bactrias competentes na importao do DNA. O cloreto de clcio liberta caties clcio em soluo que neutralizam as cargas negativas do DNA e ajudam-no a migrar para o interior das bactrias. O choque trmico que se sucede desorganiza momentaneamente as membranas e faz com que o DNA consiga migrar para o seu interior. As bactrias crescem ento em meio no seletivo e depois so transpostas para meios seletivos. 28

lactose. As clulas transformadas com este plasmdeo quando introduzidas em meio Mac/Lac/Amp, a lactose induz a expresso da galactosidase o que metaboliza a lactose produzindo substncias cidas que baixam o pH e tornam violeta o neutral red. Este fragmento incorpora o DNA exgeno dentro do gene para a galactosidase pelo que a sua atividade fica inibida e as colnias adquirem cor amarela. O plasmdeo pEMBL- CAT foi construdo por insero do gene CAT. A clonagem deste gene permite estudar a induo da expresso em resposta presena de lactose no meio. A correta induo do CAT permite que portadoras do gene sejam resistentes ao cloranfenicol quando crescidas em meio de lactose.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

ressuspender o sedimento em 20 mL de uma soluo de 100mM de CaCl2 previamente arrefecida. Incubar em gelo durante 20 minutos. Voltar a centrifugar nas mesmas condies. Descartar o sobrenadante e ressuspender as clulas em 500L da mesma soluo de CaCl2. Incubar em gelo durante 4 a 24 horas. A competncia para a transformao aumenta consideravelmente com o aumento do tempo de incubao em gelo at s 24 horas, a partir desse tempo ocorre uma diminuio rpida da competncia adquirida. B. Transformao Medir 50L da soluo que contm as clulas competentes para quatro microtubos devidamente identificados com os quatros plasmdeos. Adicionar 50L da soluo de DNA plasmdico aos quatro microtubos, o DNA plasmdico diferente em cada tubo. Incubar os tubos em gelo durante 20 minutos. Provocar o choque trmico colocando os tubos a 42C durante 2 minutos e voltando a colocar no gelo durante mais 2 minutos. Adicionar 700L de meio LB e incubar a 37C durante 30 minutos com agitao contnua. Plaquear as clulas de acordo com a tabela seguinte.

METODOLOGIA REAGENTES
Usaram-se solues com os plasmdeos pEMBL9, pEMBL9-CAT, pBR322 e pBR322- CAT; meio de cultura LB, LA e Mac/Lac; assim como placas de cultura LA/Amp, LA/Amp/Tet e Mac/Lac/Clor; soluo aquosa de cloreto de clcio; soluo e bactrias E.coli JM101.

PROCEDIMENTO EXPERIMENTAL
A. Preparao de clulas competentes

Inocular 50 mL de LB (meio de cultura) com a estirpe apropriada de E.coli e incubar a 37C com agitao durante a noite. Inocular 200 mL de LB, previamente aquecido a 37C, com 2 mL de da cultura preparada anteriormente e incubar a 37C com agitao at a DO600 estar entre 0,2 e 0,375. Colocar a cultura em tubos pr-arrefecidos e deixar em gelo durante 15 minutos. Centrifugar os tubos a 3000 RPM durante 15 minutos, temperatura de 4C. Descartar, cuidadosamente, o sobrenadante e 29

Tabela 8 Volumes das solues preparadas acima que foram plaqueadas e respectivos meios de cultura utilizados. Os tubos 1, 2, 3 e 4 correspondem aos tubos preparados acima com os plasmdeos pEMBL9, pEMBL9-CAT, pBR322 e pBR322- CAT, respectivamente. O tubo 5 corresponde apenas soluo de clulas competentes resultante do procedimento A..
Tubo Volume /L Meio de cultura

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

com palitos esterilizados, de 10 colnias individuais, dos meios anteriores, para novos meios. Assim dever-se- tranferir colnias referentes ao pEMBL9, pEMBL9- CAT e pBR322-CAT a partir dos meios LA/Amp para placas (diferentes) com os meios Mac/Lac/Clo. As placas so ento incubadas a 37C durante a noite. Verifica-se ento o crescimento das colnias.

RESULTADOS EXPERIMENTAIS
As figuras abaixo correspondem s placas incubadas a 37C durante uma noite.

1 2 3 4 5

125

Mac/Lac/Amp LA/Amp Mac/Lac/Amp LA/Amp LA/Amp/Tet LA/Amp LA/Amp/Tet LA/Amp La/Amp

As placas so ento incubadas a 37C durante a noite. Procede-se ento contagem das colnias e toma-se nota das suas cores nas placas Mac/Lac. Para induzir a expresso do gene CAT e testar a resistncia das clulas ao cloranfenicol, procede-se transferncia, Figura 13 Placa com meio de cultura LA/Amp. Controlo Tubo 5.

Figura 14 Placas com meio de cultura Mac/Lac/Amp (esquerda) e LA/Amp (direita). Corresponde incubao das bactrias com o plasmdeo pEMBL9 Tubo 1. 30

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Figura 15 Placas com meio de cultura Mac/Lac/Amp (direita) e LA/Amp (esquerda). Corresponde incubao das bactrias com o plasmdeo pEMBL9-CAT Tubo 2.

Figura 16 Placas com meio de cultura LA/Amp/Tet (esquerda) e LA/Amp (direita). Corresponde incubao das bactrias com o plasmdeo pBR322 Tubo 3.

Figura 17 Placas com meio de cultura LA/Amp/Tet (direita) e LA/Amp (esquerda). Corresponde incubao das bactrias com o plasmdeo pBR322-CAT Tubo 4.

31

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Figura 18 Placas com meio de cultura Mac/Lac/Clo. Corresponde incubao das bactrias com o plasmdeo pEMBL9 previamente incubadas em LA/Amp.

Figura 20 Placas com meio de cultura Mac/Lac/Clo. Corresponde incubao das bactrias com o plasmdeo pBR322-CAT previamente incubadas em LA/Amp.

Figura 19 Placas com meio de cultura Mac/Lac/Clo. Corresponde incubao das bactrias com o plasmdeo pEMBL9-CAT previamente incubadas em LA/Amp.

32

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

Tabela 9 Contagem das colnias, avaliao da cor e respectivo clculo da eficincia da transformao. Plasmdeo pLEMB9 pLEMB9- CAT pBR322 Meio de cultura Mac/Lac/Amp LA/Amp Mac/Lac/Amp LA/Amp LA/Amp/Tet LA/Amp pBR322- CAT Controlo LA/Amp/Tet LA/Amp LA/Amp N de colnias 150 600 50 100 3 100 0 50 0 Cor Violeta Brancas/amarelas Brancas/amarelas Brancas/amarelas Brancas/amarelas Brancas/amarelas Brancas/amarelas Eficincia de transformao 7,14 104 2,86 105 2,38104 4,76104 1,4 103 4,76104 2,38104

Nota: Os tubos foram preparados com 5 ng de DNA em 300 L (concentrao de 1,67x10-5 g L-1). Foram plaqueados 125 L, assim a massa de DNA plaqueada foi de 2,1x10-3 g.

CONCLUSES
Os resultados obtidos indicam que ocorre a transformao em todos os plasmdeos, pois em meio LA/Amp ocorreu o crescimento de colnias em meio com o antibitico ampicilina. Isto significa que o gene de resistncia ampicilina foi incorporado e expresso da forma adequada. Isto no se verificou, apenas, para o controlo pois este no continha o gene para a resistncia e portanto as bactrias no conseguiram resistir ao antibitico. As colnias de bactrias cujo plasmdeo analisado foi o pEMBL9 apresentaram cor violeta, isto porque foi expresso o gene para a -galactosidade. Isto originou produtos cidos no meio que tornaram violeta o neutral red. O mesmo no aconteceu aps a insero do gene CAT, que por ser inserido no meio do gene que codifica para a - galactosidade, inibe a sua produo e portanto incapaz de degradar a lactose e acidificar o meio envolvente.

No caso do plasmdeo pBR322 verifica-se que cresce nos meios utilizados com ampicilina e portanto fica provada a sua resistncia nativa ampicilina e tetraciclina. Contudo, a insero do gene CAT feita na poro referente resistncia tetraciclina, e portanto as bactrias com o plasmdeo pBR322-CAT no resistem ao meio rico em tetraciclina. No que diz respeito eficincia das transformaes, os valores obitdos so bastante mais reduzidos do que aqueles que seriam de esperar, sendo obtidos valores na ordem dos 104-5. Isto pode ser explicado pela recolhas das clulas fora da fase exponencial do crescimento, uso de reagentes pouco puros, contaminaes e m importao do plasmdeo por parte das bactrias. Em relao resistncia ao clornfenicol verifica-se que nenhuma das placas apresentava colnias desenvolvidas, pelo que as bactrias introduzidas no resistiram ao clorofenicol. No entanto, este era o

33

resultado esperado para as bactrias com pEMBL9 e pBR322-CAT porque o pEMBL9 no possu o gene que codifica para a clornfenicol acetil transferase e que portanto no consegue degradar o antibitico. As bactrias com pBR322-CAT, apesar de terem o gene CAT no conseguem express-lo porque falta-lhes os elementos do promotor para a transcrio. Seria de esperar que as bactrias com pEMBL9-CAT expressassem o gene CAT porque possuem os elementos do promotor necessrios e

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

encontravam-se em condies com o seu indutor natural, a lactose. O facto de no se ter verificado o crescimento de bactrias neste meio pode ter sido causado pelo mal acondicionamento das colnias, m transferncia das colnias do meio LA/Amp para o meio com clornfenicol, as colnias transferidas no eram resistentes ao clornfenicol, podendo at pensar-se que a lactose no seja o indutor da expresso do gene CAT no plasmdio pEMBL9.

34

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

SEQUENCIAO DE DNA
OBJECTIVOS
Sequenciar um gene pelo mtodo de Sanger. Isolar uma protena por mtodos bioqumicos e determinao dos primeiros 10 aminocidos (N-terminal). Isto permite o desenho de primers degenerados que podem ser usados na aplificao do cDNA na biblioteca genmica (cDNA). codificantes (ORF Open Reading Frame) para alinhamento com as sequncias aminoacdicas e nucleotdicas residentes nas bases de dados. Isto permite obter informao de bastante relevncia acerca da funo e estrutura do gene, sendo ainda possvel obter informao acerca da evoluo do gene em relao a outros semelhantes j registados. Conhecer a sequncia do gene d-nos tambm informao importante acerca de pores no codificantes do gene 5 e 3, isto utilizado para perceber melhor o funcionamento da regulao gnica e possibilita a aplicao de tcnicas de mutao dirigida a um determinado gene. Por fim, e um dos papis mais importantes da sequenciao aplicada diretamente medicina, a deteco de zonas que apresentem alteraes em determinados nucletidos e que podem originar doenas genticas. Este conhecimento permite a produo aprimorada de tcnicas e frmacos para o tratamento da mutao em causa.

INTRODUO TERICA
A clonagem apenas o incio do estudo de um gene, posteriormente procede-se anlise estrutural e funcional desse mesmo gene. A sequenciao de um gene uma das etapas mais importantes na caracterizao genmica, dado que oferece informao acerca da estrutura gentica. O passo decretrio para a sequenciao do DNA a capacidade de obter fragmentos bem definidos de DNA. Isto justifica a relao estreita entre a clonagem e a sequenciao e um gene, uma vez que a clonagem possibilita a obteno dum elevado nmero de amostras do fragmento de DNA que se pretende estudar.

Nos meados da dcada de 70 comeam a surgir as primeiras tcnicas de clonagem No mbito das tcnicas de DNA molecular e consigo tambm as tcnicas de recombinante, muito importante conhecer sequenciao. O investigador Robert Holley a sequncia do gene para que se possa fazer criara uma tcnica de sequenciao de tRNA o devido manuseamento posteriori. que fora usada, inicialmente, para Normalmente, depois de sequenciado o sequenciar DNA embora com resultados no gene, a sequncia introduzida e corrida muito relevantes. Mais tarde Gilbert e por um software que procura os locais de Sanger trabalham arduamente na tentativa restrio, oferecendo assim um estudo de encontrar uma tcnica que possibilitasse detalhado de tudo do gene em estudo. Estas a sequenciao do DNA. Daqui surgiram informaes so muito importantes, por duas tcnicas, a degradao qumica de exemplo, se quisermos utilizar o gene em Maxam e Gilbert e o mtodo enzimtico de causa como vetor para expresso proteica Sanger. Apesar dos princpios subjacentes ou subclonagem. A sequncia analisada serem diferentes, ambos se baseavam na por software de modo a obter as regies produo de populaes de oligonucletidos que comeavam sempre num local 35

especfico e conhecido e terminavam num determinado resduo. Os locais de terminao so, portanto, nucletidos especficos mas que ocorrem em locais aleatrios ao longo do DNA. Assim podemos obter populaes de oligonucletidos que acabam em A, T, G ou C. Assim sero obtidos oligonucletidos de comprimentos diferentes, consoante a altura em que foi incorporado um ddNTPs e portanto no possvel o crescimento da sequncia a partir desse ponto. Os fragmentos so ento corridos em gel de poliacrilamida onde possvel distinguir fragmentos que diferem apenas num nucletido. O mtodo e Gilbert encontra-se em desuso pelo uso de marcadores radiativos nos extremos dos fragmentos de DNA que eram posteriormente degradados por reaes especficas. Assim a posio de cada nucletido na cadeia de DNA era determinada pela distncia entre o ponto de degradao e a extremidade radioativa visualizada por autoradiografia.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

faz com que ocorra a competio entre a incluso dos dNTPs que levam continuao do alongamento da cadeia e a incluso de um ddNTP que finaliza a cadeia. Fazendo a reao com os quatro ddNTP, obtm-se os respectivos oligonucletidos com os primers na extremidade 5. Estes fragmentos so corridos em gel em 4 poos diferentes. A revelao feita por fluorescncia ou por exposio a uma placa fotogrfica (Raios X). Assim podemos ler a sequncia do fundo para o topo, sendo essa a ordem dos nucletidos da extremidade 5>3. A tcnica mais recente para a sequenciao do DNA marca os ddNTPs ao invs de marcar os primers. Assim basta fazer uma reao, pois os oligonucletidos obtidos so depois corridos em gel no interior de capilares (electroforese capilar) e os diferentes ddNTPs so identificados por anlise laser em equipamentos automticos. Isto possvel por marcao dos ddNTPs com marcadores fluorescentes de cores diferentes.

O outro mtodo mais comummente RESULTADOS EXPERIMENTAIS utilizado e baseia-se na adio de um ddNTP especfico a uma mistura de todos os dNTPs, o que, aleatoriamente, ir incorporar um Sequncia de Aminicidos: ddNTP e finalizar a polimerizao de uma N-Ser-Tyr-Cys-Leu-Pro-Met-Ser-Pro-Arg-Ala-C das cadeias. Isto acontece porque no existe o grupo OH no C3. Isto impede a formao da ligao fosfodister entre dois nucletidos vizinhos, impedindo a Sequncia reconhecida pela enzima de continuao do alongamento da cadeia. restrio EcoRI: Neste mtodo, recorre-se a um primer que 5 GAATTC 3 hibridriza na cadeia simples de DNA e leva polimerizao de uma nova cadeia Sequncia reconhecida pela enzima de complementar. Repete-se o procedimento restrio HindIII: com quatro meios reacionais diferentes em 5 AAGCTT 3 que cada um deles contm um dos quatro tipos de ddNTPs. O primer est marcado Por anlise dos resultados de electroforese radioactivamente ou por um marcador (Anexo 1) possvel obter a sequncia da fluorescente, fazendo com que os cadeia que se formou por emparelhamento fragmentos possam ser identificados em gel. com a cadeia a sequenciar, sendo que as A adio de uma pequena poro de ddNTP 36

bandas que mais migraram correspondem aos oligonuclotidos que terminaram nos nucletidos mais prximos da extremidade 5. Assim a sequncia complementar ser a correspondente sequncia alvo cuja Sequncia da amostra A

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

sequncia ocorre de 5 para 3 quando a anlise feita pela complementar de cima para baixo no gel. As sequncias obtidas para o gene em causa encontram-se abaixo representadas.

5TAGCGAATTCACCAGGTTCCGAACATCGCCATTCCAGGGAACTCATTGAGTCTAGCCTA ACTAACGACCCATGTCGCCCCGTGAAAAGCTTCGCCTA 3 Sequncia da amostra B 5TAGCGAATTCATTATCCCCGATCTAGTAACGCATCCTCTAACTAGCGTGAATTATGTCA TATTGCCTGCCCATGTCCCCGCGTGCGAAGCTTCGCCTA 3 Sequncia da amostra C 5TAGCGAATTCAATCGACCCA...GGTCACAACCTTCCGGCTCAAGCCTAACCTAGTTAA GACCCTATGTCTCCCCGAGCTAAGCTTCGCCTA3 As sequncias acima correspondem s sequencias originais de cDNA amplificado para cada clone e foram obtidas por complementaridade com as sequncias determinadas pela anlise do gel obtido por electroforese. A amarelo encontra-se assinalados os locais de restrio EcoRI e a azul os locais de restrio HindIII. O primer utilizado na amplificao por PCR de cada gene emparelhou com as sequncia assinaladas a negrito nas sequncias. As sequncias dos primers para cada um dos clones encontra-se apresentada abaixo. Assim para o clone A foi usado um primer com a sequncia, 3-GGGTACAGGGGCGCA-5 Para o clone B, a sequncia do primer foi, 37 3-GGGTACAGCGGGGCA-5 Por fim, o clone C foi amplificado por PCR com um primer de sequncia, 3-GGATAAAGAGGGGCT-5 De forma a descobrir qual dos clones codifica para a sequncia de aminocidos pretendida, verifica-se qual das seguintes sequncias apresentam os tripletos de nucletidos que codificam para cada um dos aminocidos da sequncia. Assim verifica-se que o clone em causa o B. 5-ATG TCA TAT TGC CTG CCC ATG C -Met Ser Tyr Cys Leu Pro Met TCC CCG CGT GCG-3 Ser Pro Arg Ala- N

Acima encontra-se a sequncia codificante do clone B e respectiva sequncia de aminocidos que codificam (negrito).

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

CONCLUSES
Atravs do mtodo de Sanger foi possvel descobrir que primer foi usado nos ensaios de PCR de cada um dos clones. Para alm disso foi possvel identificar a sequncia codificante que codifica para a sequncia de

aminocidos em causa, sendo essa correspondente ao clone B. A identificao dos primers utilizados para a amplificao das sequncias por PCR foi feito por anlise, na sequncias codificante, dos nucletidos que agrupados 3 a 3 diferiam no mximo no ltimo nucletido desses tripletos. Isto por definio de mistura de primers degenerados.

38

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

CLONAGEM DE C DNA Y - TUB


OBJECTIVOS
Clonar o gene de cDNA y-TUB. Verificar, experimentalmente, o resultado da transformao de bactrias com DNA com diferentes tratamentos.

EQUIPAMENTO
Usou-se o transiluminador de UV; mini- coluna SV; centrfuga

PROCEDIMENTO EXPERIMENTAL
A. Digesto e purificao do DNA O plasmdeo recombinante pSK-yTUB previamente digerido com EcoRI de acordo com o procedimento descrito em Anlise electroforritca de DNA digerido com enzimas de restrio. Aplicar em gel de poliacrilamida o marcador de pesos moleculares, o plasmdeo recombinante no digerido e os produtos da digesto. Correr o gel de poliacrilamida a 100V at a frente do gel percorrer 2/3 do gel. Visualizar o gel num transiluminador UV. Excisar as bandas do gel correspondentes aos produtos da digesto. Colocar as bandas num Eppendorf. Determinar a massa da banda excisada por pesagem do tubo Eppendorf antes e depois da adio da exciso. Adicionar 1L de Membrane Binding Solution por cada 1mg de gel. Vortexar vigorosamente e incubar a 65C at a agarose se dissolver completamente. Transferir a soluo resultante para uma mini-coluna SV previamente inserida num tubo coletor. Centrifugar velocidade mxima durante 1 minuto, descartar o filtrado e voltar a colocar a coluna dentro do tubo. Adicionar 700L de Membrane Wash Solution. Centrifugar velocidade mxima durante 1 minuto. Descartar o filtrado e colocar a coluna dentro do tubo. Repetir o passo 8. Com 500L de Membrane Wash Solution. Transferir a mini-coluna SV para um Eppendorf limpo e adicionar 50L de gua ultra-pura e centrifugar velocidade mxima durante 1 minuto. Por fim descartar

INTRODUO TERICA
O DNA complementar (cDNA) amplamente utilizado quando se pretende amplificar um gene que codifica para uma determinada protena. A vantagem do cDNA que no contm os intres que o gene original conteria, assim apenas amplificada a sequncia codificante, poupando-se recursos e ignorando o processamento do mRNA. O gene em causa, neste caso cDNA, inserido num vetor, que pode ser um plasmdeo, e introduzido em bactrias de modo a que o crescimento das colnias aumente a quantidade de cDNA e leve formao de colnias com o gene em causa.

METODOLOGIA REAGENTES
Usou-se soluo contendo o plasmdeo recombinante pSK-yTUB digerido com a enzima de restrio EcoRI; Agarose (1%); marcadores de pesos moleculares; membrane binding solution; membrane wash solution; tampo de ligao (5x); soluo de T4-ligase; soluo de E.coli JM101 competentes; placas com meio Mac/Lac/Amp.

39

a mini-coluna SV e guardar o filtrado em gelo. B. Ligao Preparam-se quatro solues com a composio apresentada na tabela abaixo. Tabela 10 Volumes medidos para 4 tubos eppedorf diferentes de modo a provocar a ligao do cDNA ao vetor pKS. Reaes Soluo A B C D Vetor pKS digerido 5L 5L 5L 10L 10L 10L cDNA Tampo de ligao 4L 4L 4L 4L Taq ligase 1L 1L 1L Agitar suavemente a mistura por colises suaves com o dedo no fundo do tubo. Incubar a 37C durante uma hora, em alternativa poder-se- incubar a 4C durante a noite. Congelar a mistura a -20C. C. Transformao Descongelar uma alquota de clulas E. Coli JM101 competentes em gelo. Colocar num Eppendorf 5L de pKS e num outro 5L da mistura de ligao obtida no procedimento B. Para um outro tubo medir 5L de gua ultra-pura, este ser o controlo negativo. A cada um dos tubos adicionar 50L das clulas competentes e misturar com movimento circulares efectuados com a ponta da pipeta. Incubar os tubos em gelo durante 20 minutos. Provocar o choque trmico das clulas colocando-as a 42C durante 2 minutos e colocar novamente em gelo durante 2 minutos. Adicionar 200L de meio LB e incubar a 37C durante 30 minutos com agitao. Plaquear as clulas em meio Mac/Lac/Amp. Incubar as placas durante a noite a 37C.

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

RESULTADOS EXPERIMENTAIS
Aps a incubao, as placas obtidas tinham o aspecto das figuras abaixo apresentadas.

Figura 21 Placa resultante do crescimento de colnias de bactrias transformadas com a mistura reacional A.

Figura 22 Placa resultante do crescimento de colnias de bactrias transformadas com a mistura reacional B.

Figura 23 Placa resultante do crescimento de colnias de bactrias transformadas com a mistura reacional C.

40

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

no baixe as colnias apresentam-se brancas. Assim, verifica-se que a placa A apresenta colnias de bactrias que incorporarm o cDNA. A no expresso do gene LAC quando o cDNA incorporado explicado pelo facto da incorporao acontecer no meio do gene LAC, impedindo a sua expresso. Figura 24 Placa resultante do crescimento de colnias de bactrias transformadas com a mistura reacional D. Tabela 11 Contagem das colnias e avaliao da eficincia da transformao. A B C D
Colnias Colnias Transformadas Eficincia (%)

No que diz respeito reao na ausncia de cDNA, o vetor fecha expresso sem o cDNA inserido. Isto faz com que as bactrias resistam ampicilina mas que todas elas expressem para a -galactosidade, fazendo com que todas as colnias sejam violetas (diminuio do pH provocada pela libertao de cido frmico). As placas B e C no apresentam colnias, porque as bactrias so incapazes de sobreviver. No C no apresentam o vetor que contm o gene que codifica para a resistncia ampicilina, dando origem a bactrias susceptveis e que no resistem. No caso do B, como no se adiciona a Taq Ligase, o plasmdeo no capaz de ciclizar e portanto no possvel proceder transcrio para a que o gene de resistncia ampicilina seja expresso e portanto as bactrias no se conseguem desenvolver. Por contagem das colnias, verifica-se que a transformao ocorreu em 22,6% das bactrias que deram origem s respectivas colnias.

128 0 0 63

29 0 0 0

22,6 0,0 0,0 0,0

CONCLUSES
A reao A corresponde poro onde realmente teria de haver a transformao e realmente isso aconteceu, isto porque existem algumas colnias amarelas que correspondem s colnias de bactrias transformadas, uma vez que no expressam o gene LAC e que portanto no produzem - galactosidade que degrada a lactose originado cido frmico que leva a um abaixamento do pH. Esse abaixamento evidenciado pelo aparecimento da cor violeta em corante neutral red. Caso o pH

41

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

BIBLIOGRAFIA
Sunckel, C; Protocolos das aulas experimentais de Biologia Molecular; Instituto de Cincias Biomdicas Abel Salazar; Porto; 2009/2010 Andrysik, Zdenek ; Bernstein, William Z. ; Deng, Li; The novel mouse Polo-like kinase 5 responds to DNA damage and localizes in the nucleolus, Nucleic Acids Researchs, 38, 9, 2010, 2931-2943.

42

Licenciatura em Bioqumica 2012/2013 Relatrios da Aulas Prticas de Biologia Molecular

ANEXOS

43