Você está na página 1de 94

UNIVERSIDADEDELISBOA

FACULDADEDECINCIAS
DEPARTAMENTODEQUMICAEBIOQUMICA

EstudodaRegulaodaExpressodoSintasede
cidosGordosdeSaccharomycescerevisiaena
AquisiodeResistnciaaoPerxidodeHidrognio

AndreiaFilipaPereiraCepeda

MestradoemBioqumica
EspecializaoemBioqumicaMdica

2010

UNIVERSIDADEDELISBOA
FACULDADEDECINCIAS
DEPARTAMENTODEQUMICAEBIOQUMICA

EstudodaRegulaodaExpressodoSintasede
cidosGordosdeSaccharomycescerevisiaena
AquisiodeResistnciaaoPerxidodeHidrognio

AndreiaFilipaPereiraCepeda

MestradoemBioqumica
EspecializaoemBioqumicaMdica

DissertaoorientadapelaProf.DoutoraLuisaCyrne

2010
i

NDICE

AGRADECIMENTOS...............................................................................................................iv
LISTADEABREVIATURASENOMENCLATURA........................................................................v
RESUMO.............................................................................................................................viii
ABSTRACT............................................................................................................................ix
I. INTRODUO.................................................................................................................1
I.1. Osintasedecidosgordos(FAS)deSaccharomycescerevisiae...............................1
I.1.1. OrganizaoefunodoFAS................................................................................2
I.1.2. RegulaodaexpressodosgenesFAS1eFAS2..................................................4
I.1.2.1. RegulaoanveltranscricionaldosgenesFAS1eFAS2..................................5
I.1.2.2. OelementoUAS
INO
eabiossntesedefosfolpidos...........................................7
I.1.2.3. Inositolcomoprincipalefectordaregulaodaexpressodosgenesque
contmoelementoUAS
INO
.............................................................................................10
I.1.2.4. Inositolderivadosefontes...........................................................................12
I.2. AleveduraSaccharomycescerevisiaecomomodelobiolgico..............................14
I.3. Operxidodehidrognio(H
2
O
2
)eostressoxidativo............................................16
I.3.1. OH
2
O
2
comoindutordestressoxidativo............................................................16
I.3.2. OestadoestacionriodeH
2
O
2
comoindutordestressoxidativo......................18
I.3.3. AadaptaoaoH
2
O
2
emS.cerevisiae.................................................................20
I.3.4. AregulaodaexpressognicaemcondiesdeadaptaoaoH
2
O
2
emestado
estacionrio.........................................................................................................................22
II. OBJECTIVOS.................................................................................................................25
III. MATERIAISEMTODOS...............................................................................................27
III.1. Materiais..............................................................................................................27
III.2. Materialbiolgico................................................................................................27
III.3. MtodosExperimentais........................................................................................28
III.3.1. CondiesdeCrescimento..................................................................................28
III.3.2. CurvasdeCrescimento........................................................................................29
III.3.3. DeterminaodasconstantesdeconsumodeH
2
O
2
pelasclulas.....................29
III.3.4. Adaptaodasclulasa150MdeH
2
O
2
emestadoestacionrio....................30
III.3.5. TranslocaodofactornuclearGFPOpi1p.........................................................31
III.3.5.1. Obtenodostransformantesopi1+GFPOpi1p.....................................31
III.3.5.2. VisualizaodatranslocaoporMicroscopiadefluorescncia................31
ii

III.3.6. Quantificaodosnveisdefosfolpidostotaisemclulascontroloetratadas
comH
2
O
2
,porCromatografiaemcamadafinabidimensional...........................................32
III.3.6.1. Extracodoslpidostotais.........................................................................32
III.3.6.2. SeparaodoslpidosporTLCbidimensional.............................................33
III.3.6.3. Quantificaodosfosfatos..........................................................................33
III.3.7. QuantificaodosextractosproteicospeloMtododePeterson.....................34
III.3.8. PCRquantitativoemtemporeal(RealtimeQPCR)...........................................35
III.3.8.1. PreparaodoRNAtotaldaleveduraS.cerevisiae....................................36
III.3.8.2. TratamentocomDNaseI............................................................................36
III.3.8.3. AmplificaodeumasequnciadecidosnucleicosporPCR....................37
III.3.8.4. SntesedaprimeiracadeiadecDNAusandoRevertAid
TM
HMinusReverse
Transcriptase(Fermentas)..............................................................................................38
III.3.8.5. AnliseporPCRquantitativoemtemporeal(RealtimeQPCR)................38
III.3.9. DoseamentodoInositolIntracelular...................................................................40
III.3.9.1. Obtenodeextractostotais......................................................................40
III.3.9.2. Tratamentodoextractocelular..................................................................41
III.3.9.2.1. Precipitaodaprotena.........................................................................41
III.3.9.2.2. CromatografiadeTrocaInica................................................................41
III.3.9.2.3. Liofilizao...............................................................................................42
III.3.9.2.4. Remoodainterfernciadaglucose.....................................................42
III.3.9.3. Mtodoenzimticoespectrofotomtricodedoseamentodoinositol.......42
III.3.10. Anliseestatstica............................................................................................44
IV. RESULTADOSEDISCUSSO..........................................................................................45
IV.1. TranslocaonucleardofactorGFPOpi1p............................................................45
IV.1.1. Caracterizaodasestirpeswt,opi1eopi1+GFPOpi1p..............................46
IV.1.2. OptimizaodascondiesparaestabeleceroestadoestacionriodeH
2
O
2
....49
IV.1.2.1. Actividadedoenzimaglucoseoxidase........................................................49
IV.1.2.2. ConsumodeH
2
O
2
pelasclulasintactas.....................................................49
IV.1.2.3. ClculodosvolumesdeglucoseoxidaseeH
2
O
2
paraestabeleceroEstado
EstacionriodeH
2
O
2
.......................................................................................................51
IV.1.3. VisualizaodatranslocaonucleardofactorGFPOpi1ppormicroscopiade
fluorescncia.......................................................................................................................51
IV.2. QuantificaodosnveisdefosfolpidostotaisporTLCbidimensional..................55
IV.3. QuantificaodediversostranscritosreguladospeloinositolporPCRquantitativo
emtemporeal.................................................................................................................59
iii

IV.4. DeterminaodosnveisdeinositolemclulascontroloetratadascomH
2
O
2
......66
IV.4.1. OptimizaodoMtododeDoseamento...........................................................66
IV.4.2. CurvadeCalibraodoMtodoEspectrofotomtrico.......................................69
IV.4.3. Mediodosnveisintracelularesdeinositolemclulascontroloeadaptadasa
150MdeH
2
O
2
...................................................................................................................69
V. CONSIDERAESFINAIS...............................................................................................72
VI. PERSPECTIVAS..............................................................................................................74
REFERNCIASBIBLIOGRFICAS............................................................................................76

iv

AGRADECIMENTOS

minha orientadora Prof. Dra. Luisa Cyrne pela transmisso de conhecimentos e


experincia cientfica, e pela confiana que demonstrou no meu trabalho. Agradeo pela
capacidadedeestarsemprepresente,porcontribuirparaomeudesenvolvimentointelectual
epeladisponibilidadeparaesclarecerasdvidassemprequenecessrio.
Prof. Dra. Susana Marinho e ao Prof. Dr. Fernando Antunes por contriburem com
sugestesediscussesparaodesenvolvimentodotrabalhoepelaajudaprestada.

A todos os colegas do Grupo da Bioqumica de Oxidantes e Antioxidantes, pelo bom


ambiente de trabalho, pela boa disposio e pelas brincadeiras que me faziam esquecer
qualquerdiadifcil.

minhafamliaeamigos,emparticular:
Aos meus pais e irm, pelo apoio e pacincia demonstrados, e por compreenderem a
dedicaoexclusivanecessriaaestetrabalho.
Rita, sem a qual no teria conseguido ultrapassar mais esta etapa. Obrigada pelo
apoio,pelainfinitapacinciaeporestaressemprepresente!
Filipa, que se tornou uma grande amiga e confidente nos momentos em que me
sentianumbecosemsada.
E por ltimo mas no menos importante, ao Juan pela boa disposio, pelo
companheirismo, pelo apoio incondicional e por se ter revelado um amigo para a vida.
Obrigadaportudo!

LISTADEABREVIATURASENOMENCLATURA

A nomenclatura relativa levedura Saccharomyces cerevisiae utilizada ao longo do trabalho


teveporbaseasnormaspresentesnaliteratura(Cherry,1995):
Estirpeselvagemwt(wildtype)
GeneOPI1
ProtenaOpi1p
Estirpemutanteopi1

3PPI3fosfatofosfoinositol
Abs
xnm
Absorvnciaaxnm
ATPTrifosfatodeadenosina
ATP2NaTrifosfatodeadenosinadisdico
bHLHdoinglsbasicHelixLoopHelix
BrEtBrometodeetdeo
BSAdoinglsBovineSerumAlbumin,albuminadesorobovino
CLCardiolipina
CDPDifosfatodecitidina
CDPDAGCDPdiacilglicerol
CTPTrifosfatodecitidina
DaDalton
DAGDiacilglicerol
DAGPPPirofosfatodediacilglicerol
DNAcidodesoxirribonucleico
DNaseIDesoxirribonucleaseI
dNTPDesoxirribonucletido
dsDNAdoinglsdoublestandDNA
EROsEspciesReactivasdeOxignio
FASdoinglsFattyAcidSynthase,sintasedecidosgordos
G6PDH6fosfatodeglucosedesidrogenase,omesmoqueZWF1
GOGlucoseoxidase
GPxGlutationoperoxidase
H
2
O
2
Perxidodehidrognio
HO

Radicalhidroxilo
vi

INTCloretodeiodonitrotetrazlio
IPCInositolfosfoceramida
MIMioinositol
MIDHMioinositoldesidrogenase
MIPCManosilinositolfosfoceramida
M(IP)
2
CManosildiinositolfosfoceramida
mRNARNAmensageiro
NAD
+
Dinucletidodeadeninaenicotinamida(formaoxidada)
NADHDinucletidodeadeninaenicotinamida(formareduzida)
NADPHFosfatodedinucletidodeadeninaenicotinamida(formareduzida)
O
2
Oxigniomolecular
O
2

Radicalaniosuperxido
1
O
2
Dioxigniosingleto
OD
600
Densidadepticaa600nm
ONOO

Peroxinitrito
PAcidofosfatdico
pbparesdebases
PCFosfatidilcolina
PCRdoinglsPolymeraseChainReaction
PDEouPDMEFosfatidildimetiletanolamina
PEFosfatidiletanolamina
PEGPolietilenoglicol
PGFosfatidilglicerol
PiFsforoinorgnico
PIFosfatidilinositol
PIP4fosfatofostatidilinositol
PIP
2
ouPI(4,5)P
2
4,5bifosfatodefostatidilinositol
PI(3,5)P
2
3,5bifosfatodefostatidilinositol
PMEouPMMEFosfatidilmonometiletanolamina
PMSFFluoretodfenilmetilsuonilo
PSFosfatidilserina
RNAcidoribonucleico
RNaseRibonuclease
RO

Radicalalcoxilo
ROO

Radicalperoxilo
vii

ROOHHidroperxidosorgnicos
SCdoinglsSyntheticComplete,SintticoCompleto
SDSDodecilsulfatodesdio
SODSuperxidodismutase
ssDNAdoinglssinglestandDNA,DNAdecadeiasimples
TAGTriacilglicerol
TFKTampodefosfatosdepotssio
TLCdoinglsThinLayerChromatography,CromatografiaemCamadaFina
TrisTrishidroximetilaminometano
UAS
INO
doinglsinositolsensitiveupstreamactivatingsequence
UVUltravioleta
VLCFAdoinglsVeryLongChainFattyAcids,cidosgordosdecadeiamuitolonga
YNBdoinglsYeastNitrogenBase
ZWF1verG6PDH

viii

RESUMO

AexposiodasclulasdeSaccharomycescerevisiaeadosessubletaisdeH
2
O
2
torna
as mais resistentes a doses letais posteriores, ocorrendo alteraes na permeabilidade da
membrana plasmtica. As clulas adaptadas ao H
2
O
2
apresentam uma menor expresso do
gene FAS1 e uma diminuio da actividade do sintase de cidos gordos. O FAS1 regulado
pelosnveisdeinositol,possuindoasequnciaUAS
INO
naregiopromotora,sendoaexpresso
reprimida quando o inositol aumenta intracelularmente. Na tentativa de compreender os
mecanismos moleculares envolvidos na regulao do gene FAS1 pelo H
2
O
2
, tomouse como
premissa que o H
2
O
2
reprime a expresso do gene FAS1 atravs da induo dos nveis de
inositol.Determinaramseosnveisdeinositolemclulaswtcontroloetratadascom150M
de H
2
O
2
em estado estacionrio (10 min e 20 min), observandose uma diminuio drstica
destes nveis nas clulas tratadas, contrariando a hiptese inicial. Contudo, expondo clulas
opi1 + GFPOpi1p ao H
2
O
2
nas mesmas condies, observouse a translocao mxima da
protena Opi1p do retculo endoplasmtico para o ncleo aos 20 min, de acordo com o
mecanismoderegulaopeloinositol.Paraapoiarahiptese,quantificaramseosfosfolpidos
cuja sntese regulada pelo inositol e analisouse a expresso de alguns genes cujo produto
regulaessasntese.Noforamobservadasdiferenassignificativasnacomposiofosfolipdica
total durante a exposio ao H
2
O
2
, excepto uma tendncia para um aumento de
fosfatidiletanolamina aos 5 min e uma diminuio aos 10 min, e um aumento dos nveis de
fosfatidilcolinaaos20min.OH
2
O
2
reprimiu(INM1,INO2,CHO1,URA7ePIS1)einduziu(GPT2)
a expresso de vrios genes da sntese de fosfolpidos. A expresso de INO1 foi oscilatria,
sendo induzida e reprimida aos 20 e 40 min, respectivamente. A expresso de ITR1 foi
reprimida logo aos 10 min. Estes resultados apoiam a existncia nas clulas de levedura de
uma resposta coordenada da expresso de genes envolvidos na biossntese de fosfolpidos e
cidosgordosaoH
2
O
2
.

Palavraschave:Perxidodehidrognio(H
2
O
2
),FAS1,inositol,Opi1p,UAS
INO
,fosfolpidos.

ix

ABSTRACT

The exposure of Saccharomyces cerevisiae cells to sublethal doses of H


2
O
2
makes
themmoreresistanttoadditionalexposuretolethaldoses,andinduceschangesintheplasma
membranepermeability.CellsadaptedtoH
2
O
2
showadecreasedexpressionoftheFAS1gene
and a decreased activity of fatty acid synthase. FAS1 is regulated by inositol levels, having a
UAS
INO
sequence in its promoter region. FAS1 expression is repressed when intracellular
inositol is increased. To understand the molecular mechanisms of FAS1 regulation by H
2
O
2
, it
washypothesizedthatH
2
O
2
repressesFAS1expressionthroughtheinductionofinositollevels.
Thelevelsof inositolinwtcellsexposedtosteadystate150M ofH
2
O
2
(10 minand20 min)
were determined, and a dramatic decrease in those levels in the treated cells was observed,
contradictingtheoriginalhypothesis.However,whenopi1+GFPOpi1pcellswereexposedto
the same H
2
O
2
conditions, a maximal translocation of Opi1p from the endoplasmic reticulum
to the nucleus at 20 min was observed, which is in accordance with a regulatory role for
inositol. In order to support the original hypothesis, phospholipids, whose synthesis is
regulated by inositol, as well as the levels of expression of some genes whose products
regulate that synthesis, were quantified. No significant differences were found in cellular
phospholipidcompositionduetoexposuretoH
2
O
2
,withtheexceptionofatrendforincreased
phosphatidylethanolamine levels at 5 min and decreased levels at 10 min, and an increased
phosphatidylcholine levels at 20 min. H
2
O
2
repressed (INM1, INO2, CHO1, URA7 e PIS1) and
induced (GPT2) the expression of several genes involved in phospholipid biosynthesis. The
expression of INO1 was oscillatory, being induced and repressed at 20 and 40 min,
respectively.ITR1expressionwasimmediatelyrepressedat10min.Theseresultssupportthe
existence in yeast cells of a coordinated response in the expression of genes involved in
phospholipidandfattyacidbiosynthesistoH
2
O
2
.

Keywords:hydrogenperoxide(H
2
O
2
),FAS1,inositol,Opi1p,UAS
INO
,phospholipids.

I. INTRODUO

I.1. Osintasedecidosgordos(FAS)deSaccharomycescerevisiae

Os cidos gordos so compostos celulares essenciais, que apesar de apresentarem


uma estrutura simples, apresentam funes biolgicas muito diversas: (i) so essenciais
constituio das bicamadas lipdicas que so a base da compartimentalizao subcelular; (ii)
constituem uma forma de armazenamento de energia; (iii) alguns servem de precursores a
compostos biolgicos mais activos podendo, portanto, desempenhar funes de sinalizao
(Schweizer and Hofmann, 2004). So constitudos por um grupo carboxilo numa das
extremidades da molcula, ligado a uma longa cadeia aliftica que varia em tamanho (4 a 36
tomosdecarbono)egraudesaturao(NelsonandCox,2004).
NaleveduraSaccharomycescerevisiae,oscidosgordosapresentamaparticularidade
de no existirem sob a forma de cadeias polinsaturadas (excepto em meios suplementados),
sendoencontradosapenascidosgordossaturadosemonoinsaturados.Oespectrodecidos
gordos em S. cerevisiae simples consistindo, principalmente, em cidos gordos de 16 e 18
carbonos. O cido palmtico (16:0), o cido palmitoleico (16:1) e o cido oleico (18:1) so os
cidosgordosdecadeialongamaioritriosnamembranaplasmticadeS.cerevisiae(Cipaket
al.,2006;Tehlivetsetal.,2007;Tulleretal.,1999;vanderRestetal.,1995).
Oscidosgordoscelularespodemterorigememvriasfontes,paraalmdasntesede
novo a partir do acetilCoA. Na levedura S. cerevisiae a sntese de novo dos cidos gordos
requer diversos enzimas de entre os quais se destacam o acetilCoA carboxilase (ACC1,
tambmdesignadoporFAS3)eosistemaenzimticosintasedecidosgordos(FASfattyacid
synthase). O ACC1 catalisa a carboxilao do acetilCoA pela adio de CO
2
para formar
malonilCoA, servindo este ltimo como dador de dois carbonos numa srie de reaces
cclicas catalisadas pelo sistema enzimtico FAS e por elongases (Figura 1) (Tehlivets et al.,
2007).

Figura 1 Sequncia reaccional da sntese e elongao dos cidos gordos. ACC, AcetilCoA carboxilase; KS, 3
oxoacil sintase; KR, 3oxoacil redutase; DH, enoil desidratase; ER, enoil redutase. Adaptado de (Tehlivets et al.,
2007).

I.1.1. OrganizaoefunodoFAS

A sntese de novo de cidos gordos levada a cabo pelo sistema enzimtico FAS, que
catalisa ciclos de reaces qumicas com vrios passos, essenciais a todos os organismos
(Lomakin et al., 2007). Apesar de apresentar variaes estruturais considerveis nas suas
estruturas moleculares consoante o organismo, o mecanismo de reaco essencialmente o
mesmo em todos os sistemas biolgicos. O sistema composto por vrias actividades
enzimticas [ac(et)il transferase (AC); malonil/acetil ou malonil/palmitoiltransferase (AT,
MPT); oxoacil sintase (KS); oxoacil redutase (KR); enoil desidratase (DH); enoil redutase (ER);
acilcarrierprotein(ACP);tioesterase(TE)],havendoumaorganizaoestruturalespecficaem
cada organismo. As vrias actividades enzimticas podem (i) estar associadas numa nica
3

cadeiapolipeptdicaou(ii)estarassociadasemsistemasmultienzimticos(Figura2).Osistema
FASdiferetambmnasualocalizaosubcelularconsoanteoorganismo,podendolocalizarse
no apenas no citoplasma, mas tambm em organelos e em membranas microssomais.
Ocasionalmente, pode tambm ser encontrado associado a estruturas subcelulares, que
subsequentementeservemdeaceitadorasdosseusprodutosreaccionais.Deacordocomestas
caractersticas,ossistemasFASforamagrupadosem3classes:tipoIa,tipoIbetipoII(Lomakin
etal.,2007;SchweizerandHofmann,2004).

Figura2OrganizaodosdomniosdossistemasFAStipoIemdiversosorganismos.AC,ac(et)iltransferase;AT
ou MPT, malonil/acetil ou malonil/palmitoiltransferase; KS, oxoacil sintase; KR, oxoacil redutase; DH, enoil
desidratase; ER, enoil redutase; ACP, acil carrier protein; TE, tioesterase, PPT, fosfopantetena transferase.
Adaptadode(SchweizerandHofmann,2004).

A levedura S. cerevisiae possui um sistema multienzimtico FAS tipo Ia citoslico,


compostoporduassubunidades,asubunidadeouFas2(com207,863kDa)easubunidade
ou Fas1 (com 220,077 kDa), codificadas pelos genes FAS2 e FAS1, respectivamente. Estas
subunidades so protenas multifuncionais, em que a subunidade Fas1 compreende as
actividades enzimticas acetil transferase (AC), enoil reductase (ER), enoil desidratase (DH) e
malonil/palmitoiltransferase (MPT), enquanto a subunidade Fas2 composta pelas
actividadesenzimticasacilcarrierprotein(ACP),3oxoacilredutase(KR),3oxoacilsintase(KS)
e fosfopantetena transferase (PPT), como se encontra representado na Figura 3. As
subunidades e organizamse em complexos hexamricos
6

6
(6 subunidades e 6
4

subunidades)demassamolecular2,5MDa,paraconstituiremosistemamultienzimticoFAS
funcional(Kolodziejetal.,1996;SchweizerandHofmann,2004;Tehlivetsetal.,2007).

Figura 3 Organizao dos domnios do sistema FAS tipo Ia em Saccharomyces cerevisiae. A subunidade , que
compreende as actividades ACERDHMPT, codificada pelo gene FAS1; a subunidade , que compreende as
actividades ACPKRKSPPT, codificada pelo gene FAS2. AC, acetil transferase; ER, enoil redutase; DH, enoil
desidratase; MPT, malonil/palmitoiltransferase; ACP, acil carrier protein; KR, oxoacil redutase; KS, oxoacil sintase;
PPT,fosfopantetenatransferase.Adaptadode(SchweizerandHofmann,2004).

Curiosamente, no mitocndrio de levedura os cidos gordos so sintetizados por um


sistema FAS tipo II, em que as actividades enzimticas individuais se encontram em
polipptidosdistintos(Tehlivetsetal.,2007).
NaausnciadesuplementaoexgenadecidosgordososistemaFAS,compostopor
Fas1 e Fas2, responsvel pela sntese da maior parte dos cidos gordos celulares. Os genes
quecodificamestassubunidadessoessenciaisparaaviabilidadecelular,sendoasmutaes
nos genes FAS letais em meio de crescimento no suplementado por cidos gordos, devido
ausnciadecidosgordosdecadeialonga(Tehlivetsetal.,2007).Aexpressodosdoisgenes
FAS reprimida na presena de cidos gordos, levando a pensar que so regulados a nvel
transcricional.

I.1.2. RegulaodaexpressodosgenesFAS1eFAS2

AssubunidadesFas1eFas2estopresentesemquantidadesequimolaresnocomplexo

6
,sugerindoumaregulaocoordenadadosgenesFAS1eFAS2.Noentanto,foiobservado
que a quantidade do holoenzima FAS determinada pelos nveis da protena Fas1, e que o
contedodestaprotena controlado aonveldaexpressotranscricionaldo geneFAS1 e da
estabilidadedaprotena(Tehlivetsetal.,2007).Poroutrolado,quandoogeneFAS1foisobre
FAS1 FAS2

5

expressoobservouseumaumentoconcomitantedosnveisdomRNAdogeneFAS2,enquanto
os nveis do mRNA do gene FAS2 diminuram em clulas mutantes fas1. Curiosamente, a
expressodogeneFAS1independentedosnveisdeexpressodeFAS2(Wenzetal.,2001).

I.1.2.1. RegulaoanveltranscricionaldosgenesFAS1eFAS2

A biossntese de sistemas multienzimticos com uma estequiometria de subunidades


bem definida exige uma expresso coordenada dos respectivos genes estruturais. Nos
eucariotas, a activao de genes por sequncias localizadas a montante desses genes um
mecanismo geral que assegura o balano da produo dos respectivos polipptidos em
respostaasinaisregulatrios(Struhl,1989).NocasodaexpressodosgenesFAS1eFAS2deS.
cerevisiae,foiobservadoporvriosautores(Chirala,1992;Schulleretal.,1992)queestesso
reguladosemrespostasuplementaodomeiodecrescimentocomcidosgordoseinositol.
A deleco das regies promotoras dos genes FAS1 e FAS2 revelou a existncia de vrios cis
acting element localizados a montante dos genes, apresentados na Figura 4 (Chirala, 1992;
Wenzetal.,2001).AsregiespromotorasdosgenesFAS1eFAS2apresentamlocaisdeligao
aos factores de transcrio gerais Abf1, Reb1 e Rap1 (Chirala, 1992; Wenz et al., 2001). Foi
visto que a remoo destes locais da regio promotora do gene FAS1 induz uma reduo em
40% na expresso da construo FAS1lacZ (Chirala, 1992). Curiosamente, estas deleces
reduzem a expresso do gene FAS1 sem, no entanto, afectarem a resposta suplementao
comcidosgordosouinositol.
Atravs da deleco das regies promotoras dos genes FAS1 e FAS2 foi tambm
possvel identificar uma sequncia comum localizada a montante desses genes, a sequncia
identificada na Figura 4 por UAS
INO
(inositolsensitive upstream activating sequence). Esta
sequncia UAS
INO
a responsvel pela resposta coordenada da expresso dos genes FAS1 e
FAS2, quando as clulas so suplementadas com os precursores lipdicos inositol e colina
(Wenz et al., 2001). A regulao transcricional dos genes dependentes do elemento UAS
INO

mediadapeloprodutodosgenesINO2eINO4,osfactoresdetranscriocomomesmonome
(Ino2p e Ino4p, respectivamente) e que se ligam aos motivos UAS
INO
. Estes factores de
transcrio contm um motivo estrutural bHLH basic helixloophelix e ligamse como
heterodmero Ino2pIno4p sequncia de consensus WYTTCAYRTG (Schweizer and Hofmann,
2004). Esta sequncia encontrase presente nos motivos UAS
INO
de ambos os genes FAS
(Schweizer and Hofmann, 2004), embora em diferente nmero (Figura 4). Schller e
colaboradores(Schulleretal.,1992)observaramquequandooinositole/ouacolinaestoem
6

excessoouemquantidadesreduzidas,inibemouactivam,respectivamente,atranscriodos
genes que possuem o elemento UAS
INO
nos seus promotores. Mais tarde foi visto que a
expresso dos genes FAS reprimida quando h aumento do inositol intracelular,
independentemente da presena de colina (Jesch et al., 2005). Para alm danecessidade dos
factores Ino2p e Ino4p, a represso/activao da expresso dos genes que possuem o
elementoUAS
INO
nassuasregiespromotorascontroladapelaprotenareguladoranegativa
Opi1p,cujafunodeterminadapelasualocalizaonuclear(verI.1.2.3).

Figura 4 Representao e localizao dos locais de regulao da expresso dos genes FAS1 e FAS2. Esto
evidenciados os locais de activao da transcrio gerais (Rap1, Rep1, Abf1) e a sequncia UAS
INO
, cisacting
elementslocalizadosnasregiespromotorasamontantedosgenesFAS1eFAS2.PresumesequeasequnciaDRS,
na sequncia codificante do gene FAS2, interage com Fas1 directamente ou em combinao com um factor X
desconhecido.Abf1,Reb1eRap1,locaisdeligaodosfactoresdetranscriocomomesmonome;Ino2peIno4p,
factoresdetranscrio; DRS,DownstreamRepressionSite;UAS
INO
,inositolsensitiveupstreamactivating sequence.
Adaptadode(SchweizerandHofmann,2004).

A presena de elementos de controlo semelhantes nas regies promotoras dos genes


FAS1 e FAS2 pode explicar a sua expresso coordenada. No entanto, so necessrios
mecanismos adicionais para assegurar o balano exacto das duas subunidades FAS, como
observado in vivo. Os estudos da expresso de FAS2 numa estirpe fas1 e de FAS1 numa
estirpefas2,feitosporWenzecolaboradores(Wenzetal.,2001),sugeremqueosdoisgenes
no so expressos independentemente um do outro. Na verdade, a subunidade Fas1 actua
como um repressor da expresso do gene FAS2. Usando diferentes genes reprter FAS2lacZ,
comdiferentessequnciasdaregiocodificantedogeneFAS2,osautoresdemonstraramque
7

a sequncia DRS (downstream repression site) presente na regio codificante do gene FAS2
(Figura 4) era responsvel por este efeito repressor. Quando se delectou a sequncia DRS,
houve uma desrepresso da expresso de FAS2, mesmo na ausncia de FAS1. Portanto, FAS1
obviamente interfere com o retardamento da transcrio de FAS2 dependente de DRS. O
mecanismo pelo qual isso acontece ainda desconhecido. De acordo com o esquema
hipottico apresentado na Figura 4, um excesso de subunidade (codificada por FAS1) pode
aliviar a aco de DRS tanto por interaco directa ou em associao com um factor X
desconhecido. Assim, a sntese de subunidade estimulada at um nvel em que as duas
subunidades esto presentes em concentraes celulares equivalentes (Schweizer and
Hofmann,2004).
Os nveis celulares de FAS esto ainda sujeitos a controlo pstraducional. Foi
demonstradaaocorrnciadedegradaodassubunidadesFASnoassociadas,porproteases
vacuolares (subunidade ) e citoplasmticas (subunidade ) (Schweizer and Hofmann, 2004).
Enquanto o oligmero FAS
6

6
proteoliticamente estvel, as suas subunidades livres so
rapidamentedegradadas(Hanetal.,2002;Kvametal.,2005;Schneideretal.,1995).

I.1.2.2. OelementoUAS
INO
eabiossntesedefosfolpidos

A membrana plasmtica separa fisicamente os componentes intracelulares do


ambiente extracelular, controlando a entrada e sada de compostos. A sua estrutura
regulvel, podendo reorganizarse quando sujeita a condies extracelulares adversas. De
entre os componentes mais importantes das biomembranas encontramse os fosfolpidos,
estruturalmente divididos em glicerofosfolpidos e em esfingolpidos. Embora sejam
estruturalmentedistintos,asviasmetablicasdestesdoisgruposdefosfolpidosencontramse
associadas,comopossvelobservarnaFigura5.
A fosfatidilcolina (PC), a fosfatidiletanolamina (PE), o fosfatidilinositol (PI) e a
fosfatidilserina(PS)soosprincipaisfosfolpidospresentesnasmembranasdeS.cerevisiae.As
membranas mitocondriais contm tambm fosfatidilglicerol (PG) e cardiolipina (CL)
(Iwanyshynetal.,2004).
O metabolismo de fosfolpidos em S. cerevisiae um processo complexo que envolve
regulao gnica e bioqumica dos enzimas envolvidos nas suas vias de biossntese (Carman
and Zeimetz, 1996). Os nveis e actividades desses enzimas so controlados a nvel
transcricional e de estabilidade do mRNA, afectando a expresso gnica. Podem ser tambm
8

controladosporvriosfactorescomolpidos(ex.PA,CDPDAG),precursoreslipdicos(inositol
e/oucolina,etanolamina),produtosfosfolipdicos,assimcomopornucletidos(ex.ATPeCTP)
e por modificaes pstraducionais (ex. (des)fosforilao). A disponibilidade de nutrientes
(zinco e azoto), a fase de crescimento, o pH e a temperatura tambm se revelam factores
importantes no processo de regulao da biossntese dos fosfolpidos (Carman and Han,
2009b;CarmanandHenry,2007;CarmanandZeimetz,1996;Iwanyshynetal.,2004).
Os fosfolpidos PE e PC podem ser sintetizados por duas vias distintas: (i) a partir de
CDPdiacilglicerol (CDPDAG) pela via de sntese de novo (assinalada a vermelho na Figura 5),
como todos os outros fosfolpidos, ou (ii) atravs da via metablica de Kennedy (assinalada a
verdenaFigura5)(CarmanandZeimetz,1996).
Ocidofosfatdico(PA)assumeumpapelfulcralnabiossntesedefosfolpidos,nos
por ser um intermedirio principal, como tambm por desempenhar um papel ao nvel da
sinalizaocelularnesteprocesso(Loewenetal.,2004).OPAsintetizadodenovoapartirdo
3fosfato de glicerol (Gro3P) que, por sua vez, transformado em cido lisofosfatdico
(LisoPA) numa reaco catalisada pelo produto do gene GPT2, o enzima 3fosfato de glicerol
aciltransferase.OPApodeaindaserformadoporoutrasvias,taiscomo(i)aacilaodocido
lisofosfatdico pelo lisoPAaciltransferase (LPAAT); (ii) via hidrlise da ligao PO da
fosfatidilcolina (PC) para produzir PA e colina, catalisada pelo fosfolipase D (codificado pelo
gene SPO14); (iii) por fosforilao do diacilglicerol (DAG), catalisada pelo DAG cinase 1
dependente de CTP (codificado pelo gene DGK1); (iv) por desfosforilao do DAGPP
(pirofosfatodediacilglicerol)aPAePi,catalisadapeloDAGPPfosfatase(codificadopelogene
DPP1)(CarmanandHan,2009b;CarmanandHenry,2007).
Uma via de ramificao na biossntese de fosfolpidos envolve os enzimas PS sintase
(codificadopelogeneCHO1)ePIsintase(codificadopelogenePIS1)quecatalisamasntesede
PS e PI, respectivamente, utilizando CDPDAG como substrato. Ao contrrio do que acontece
com o PS sintase, a actividade do PI sintase no regulada por precursores fosfolipdicos,
fosfolpidos, bases esfingides ou fosforilao. A partio de CDPDAG entre PS e PI no
governada pelas afinidades que o PS sintase e o PI sintase tm para o CDPDAG. Dados os
baixosnveisintracelularesdeinositol,provvelqueasntesedePIpeloPIsintaseinvivoseja
reguladapeladisponibilidadedestesubstrato(CarmanandZeimetz,1996).
OfosfolpidoPIumintermedirioparaasntesedefosfoinositis(PIP,PIP
2
e3PPI)e
esfingolpidos (IPC, MIPC e M(IP)
2
C), como se encontra representado Figura 5. Visto isto, a
regulao das actividades enzimticas PI 4cinase (codificado pelo gene PIK1), que catalisa a
conversodePIaPIP,eIPCsintase(codificadopelogeneAUR1),quecatalisaaconversodePI
9

a IPC, podem desempenhar um papel central na partio de PI por estes lpidos (Carman and
Zeimetz,1996).

Figura5ViasbiossintticasdesntesedefosfolpidosemS.cerevisiae.Aviadenovoestassinaladaavermelho
e a via de Kennedy a verde. Encontramse indicados os genes estruturais, estando evidenciados a azul os genes
regulados pelo inositol. As reaces indicadas so catalisadas pelos seguintes enzimas: 1. 3fosfato de glicerol
aciltransferase; 2. lisoPA aciltransferase (LPAAT); 3. CDPdiacilglicerol sintase (CDS); 4. PS sintase (PSS); 5. PS
descarboxilase(PSD);6.PEmetiltransferase(PEMT);7.fosfolpidometiltransferase(PLMT);8.PAfosfatase(PAP);9.
Etanolamina cinase (EK); 10. fosfoetanolamina citidiltransferase (ECT); 11. Etanolamina fosfotransferase (EPT); 12.
Colinacinase;(CK);13.fosfocolinacitidiltransferase(CCT);14.Colinafosfotransferase(CPT);15.DAGaciltransferase
(DGT);16.1fosfatodeinositolsintase(IPS);17.1fosfatodeinositolfosfatase(IPP);18.PIsintase(PIS);19.PIcinase
(PIK);20.PIPcinase(PIPK);21.PI3cinase;22.IPCsintase(IPCS);23.PGPsintase(PGPS);24.PGPfosfatase(PGPP);
25. CL sintase (CLS); 26. Fosfolipase D (PLD); 27. CTP sintase (CTPS); 28. DAG cinase 1 dependente de CTP (DGK1);
29. DAGPP fosfatase (DPP1). 6PGlucose, 6fosfato de glucose; 1PInositol, 1fosfato de inositol; 3P Glicerol, 3
fosfatodeglicerol(Gro3P);LisoPA,cidolisofosfatdico;PA,cidofosfatdico;DAGPP,pirofosfatodediacilglicerol;
DAG, Diacilglicerol; TAG, Triacilglicerol; CDPDAG, CDPdiacilglicerol; PI, Fosfatidilinositol; PIP, 4fosfato
fosfatidilinositol; PIP
2
, 4,5bifosfato de fosfatidilinositol; IPC, Inositol fosfoceramida; MIPC, Manosilinositol
fosfoceramida; M(IP)
2
C, Manosildiinositol fosfoceramida; 3PPI, 3fosfato fosfoinositol; PG, Fosfatidilglicerol; CL,
Cardiolipina; PS, Fosfatidilserina; PE, Fosfatidiletanolamina; PME, Fosfatidilmonometiletanolamina; PDE,
Fosfatidildimetiletanolamina;PC,Fosfatidilcolina;Cho,Colina;Etn,Etanolamina.Adaptadode(CarmanandZeimetz,
1996;Chenetal.,2007).
3PGlicerol LisoPA PA
Etn
PEtn
CDPEtn
DAG
CDPDAG
PG
PGP
PS
PME
PDE
PI
PIP
PIP
2
IPC
MIPC
M(IP)
2
C
3PPI
Inositol
1PInositol
6PGlucose
CL
PE
PC
ViadeKennedy
SCT1
GTP2
DPP1
(2)
(8)
(15)
PAH1
(3)
(16)
INO1
(17)
INM1
CDS1 DGK1
DAGPP
SLC1
ALE1
CTP
PPi
UTP
URA7
URA8 CMP
PIS1 (18)
CHO1
(23) Serina
CMP
(5)
PSD1
PSD2
(6)
CHO2
(7)
OPI3
(7)
OPI3
CO
2
CH
3
CH
3
SPO14
(26)
EKI1
(9)
ECT1
(10)
ATP
ADP
CTP
PPi
CMP
UTP
(27)
Viadenovo
AcilDHAP DHAP
AYR1
DGA1
LRO1
CRD1
PGS1
TAG
Cho
PCho
CDPCho
ATP
ADP
CTP
PPi
UTP
(27)
CMP
CPT1 (14)
CKI1
(12)
PCT1
(13)
PIK1
(1)
(21)
(22) (19)
(20)
(24)
(25)
(27)
(4)
(28)
(29)
AUR1
EPT1 (11)
10

Na Figura 5 esto assinalados os genes que codificam enzimas envolvidos na


biossntese dos fosfolpidos. Na levedura S. cerevisiae a expresso desses genes fortemente
regulada, havendo uma srie deles regulados pelo inositol (genes assinalados a azul) e que
possuem o elemento UAS
INO
, responsvel por essa regulao e que depende dos factores de
transcrioIno2p,Ino4pedaprotenaOpi1p(Iwanyshynetal.,2004).

I.1.2.3. Inositol como principal efector da regulao da expresso dos genes que contm o
elementoUAS
INO

Nalevedura S.cerevisiae abiossntesedefosfolpidosdsedeummodocoordenado


comasntesedeoutrasclassesdelpidos,nomeadamente,cidosgordos(levadaacabopelo
sistema enzimtico FAS), triacilgliceris (TAG), esteris e esfingolpidos (Carman and Han,
2009b). Alguns dos genes envolvidos na sntese destas molculas contm nas suas regies
promotoras o elemento UAS
INO
, que regulado pelos factores de transcrio Ino2p, Ino4p, e
porOpi1p(Iwanyshynetal.,2004).

Figura 6 Interaces regulatrias dos factores de transcrio envolvidos na expresso dos genes FAS
dependente de UAS
INO
, em S. cerevisiae. As interaces que activam (a verde) ou reprimem (a vermelho) a
transcriodosgenesFASencontramseassinaladascomdiferentescores.Sin3,histonedeacetylasecomplex;Ino2p
e Ino4p, factores de transcrio; RNA Pol II, RNA polimerase II; TAD, domnio de activao da transcrio; RID,
domniodeinteracorepressor;SID,domniodeinteracocomSin3;bHLH,basichelixloophelix;UAS
INO
,inositol
sensitiveupstreamactivatingsequence.Adaptadode(SchweizerandHofmann,2004).

11

Foi visto que quando adicionado inositol ao meio de clulas em crescimento


(aumento de inositol), h uma alterao profunda do padro celular lipdico, ocorrendo uma
reprogramao dramtica da sntese e turnover dos lpidos celulares (principalmente dos
lpidos membranares) (Gaspar et al., 2006). Por outro lado, a adio de inositol induz a
expresso de um pequeno nmero de genes, sendo maioritariamente um agente repressor
(genes induzidos: OPI1, DPP1, AUR1, INM1; genes reprimidos: INO1, PSS1/CHO1, CDS1, PSD1,
CHO2/PEM1,OPI3/PEM2,CKI1,CPT1,FAS1,ITR1,PGS1,ACC1)(Gasparetal.,2006;Jeschetal.,
2005). Jesch e colaboradores observaram que muitas das actividades enzimticas envolvidas
na biossntese de fosfolpidos so reprimidas quando as clulas de levedura so expostas ao
inositol(Jeschetal.,2005).Asprincipaisalteraesobservadasdevidasadiodeinositolao
meio de cultura foram um aumento do consumo de PA (Jesch et al., 2005) e de CDPDAG,
precursores intermedirios do PI, observandose um aumento da velocidade de sntese de PI
que, simultaneamente, desencadeia uma alterao na expresso de uma srie de genes
(Gasparetal.,2006).
A expresso sincronizada destes genes (que ocorre na ausncia de inositol) requer a
participao de Ino2p e Ino4p, como j foi referido. Estes dois factores ligamse como
heterodmeros sequncia UAS
INO
(Jesch et al., 2005). Quando h um aumento dos nveis de
inositol no interior da clula, o complexo Ino2pIno4p interage com a protena repressora
Opi1p. A protena Opi1p, por sua vez, interage tambm com Sin3 (histone deacetylase
complex),umdesacetilasedehistonasqueprovocaalteraesnaestruturadoDNAreprimindo
atranscrio(Jeschetal.,2005)(Figura6).
O regulador negativo Opi1p, necessrio represso dos genes que contm as
sequnciasUAS
INO
,foilocalizadonoretculoendoplasmtico(RE)comopartedeumcomplexo
proteicodoqualtambmfazparteaprotenaScs2p(membranespanningprotein).Aprotena
Opi1p interage com a protena Scs2p atravs de um domnio denominado FFAT, e esta
interaco necessria para a reteno da Opi1p no RE (Loewen et al., 2003). No entanto, a
Opi1p tambm se liga ao PA, que se acumula no RE como intermedirio na ausncia de
inositol, e esta ligao necessria em adio interaco com Scs2p para que a Opi1p
permanea no RE (Gaspar et al., 2006) (Figura 7A). Quando adicionado inositol ao meio, os
nveis de PA no RE baixam, como consequncia do aumento da sntese de PI (Gaspar et al.,
2006).EstadiminuiodosnveisdePAsentidadirectamentepelaOpi1p(Jeschetal.,2005),
resultando na sua libertao do RE e na sua subsequente translocao para o ncleo, onde
actuacomorepressoradevriosgenesalvo(Gasparetal.,2006;Jeschetal.,2005)(Figura7B).
Essatranslocaojfoiobservadapormicroscopiadefluorescncia,recorrendoaumaestirpe
12

opi1 transformada com um plasmdeo que possui uma regio GFPOpi1p (Loewen et al.,
2004).

Figura 7 Modelo de regulao da expresso dos genes que possuem o elemento UAS
INO
pelo inositol, em S.
cerevisiae. A. Quando o inositol est ausente, a protena Opi1p localizase no RE, associada protena Scs2p e ao
PA,sendoosgenesquepossuemassequnciasUAS
INO
nasregiespromotorasexpressos.B.Quandooinositolest
presente,osnveisdePAbaixamnoRE,ocomplexoScs2pOpi1pPAdissociado,eaprotenaOpi1ptranslocada
para o ncleo das clulas, ligandose ao heterodmero Ino2pIno4p nas sequncias UAS
INO
, sendo a expresso dos
genes reprimida. Scs2, membranespanning protein; PA, cido fosfatdico; Ino2p e Ino4p, factores de transcrio;
UAS
INO
,inositolsensitiveupstreamactivatingsequence;RE,retculoendoplasmtico.Adaptadode(Carman,2005).

Tendo em considerao o que foi dito, reconhecido o papel do inositol como factor
determinante na regulao da expresso dos genes que contm o elemento UAS
INO
nas suas
regiespromotoras.

I.1.2.4. Inositolderivadosefontes

Os inositis so as nove formas isomricas do ciclohexanohexol, com a frmula


emprica C
6
H
12
O
6
. So um grupo de molculas polares pequenas e quimicamente muito
estveis,quetmpropriedadesversteis.Dosnoveinositisencontradosnanatureza,omio
inositol(Dmioinositol)aformamaisabundante.Porm,cincodasoutrasformas(scilo,epi,
neo, Dquiro e mucoinositol) so tambm utilizadas mas em menor proporo (Figura 8)
(Michell,2008).
13

Figura 8 Diversidade e nomenclatura dos cinco ismeros de inositol mais comuns na natureza. Adaptado de
(Michell,2008).

As duas principais fontes de inositol em levedura e nos eucariotas superiores so a


biossnteseendgenaeouptakeapartirdomeioextracelular(LaiandMcGraw,1994),como
se encontra representado na Figura 9. O inositol tem um papel central na regulao da
biossntesedoscidosgordosedosfosfolpidosemS.cerevisiae(Gasparetal.,2006;Jeschet
al.,2005),assimcomonasuaprpriabiossnteseendgena(LaiandMcGraw,1994)euptakea
partirdomeioextracelular(Miyashitaetal.,2003).

Figura 9 Vias para a biossntese de fosfolpidos, biossntese de inositol e uptake de inositol em S. cerevisiae.
Encontrase apresentado um esquema das vias relevantes. PE, fosfatidiletanolamina; PDME,
fosfatidildimetiletanolamina; PMME, fosfatidilmonometiletanolamina; PA, cido fosfatdico; CDPDAG, CDP
diacilglicerol;Ino1p,1fosfatodeinositolsintase;Itr1peItr2p,transportadoresdeinositollocalizadosnamembrana
plasmtica.Adaptadode(LaiandMcGraw,1994).
14

A sntese de novo do inositol parte do 6fosfato de glucose (G6P), sendo a reaco


catalisadapeloenzima1fosfatodeinositolsintase(Ino1p),codificadopelogeneINO1(Figura
9) (Lai and McGraw, 1994). Este enzima catalisa a converso do 6fosfato de glucose a 1
fosfato de inositol (Ins1P), que depois desfosforilado a inositol, sendo esta reaco
catalisada pelo enzima Inm1p, codificado pelo gene INM1. O gene INO1 possui na sua regio
promotora a sequncia UAS
INO
(Gaspar et al., 2006) sendo, portanto, um gene regulado pelo
inositol. Deste modo, tanto a actividade deste enzima como a expresso do gene INO1 so
reprimidasquandooinositolestpresentenomeiodecrescimento(LaiandMcGraw,1994).
Oinositolpodeaindaserincorporadonaclulaapartirdomeioextracelular(Figura9)
por intermdio de transportadores. A levedura S. cerevisiae possui dois transportadores de
inositol do meio extracelular para o meio intracelular, as protenas Itr1p e Itr2p, que se
encontram na membrana plasmtica e que so codificadas pelos genes ITR1 e ITR2,
respectivamente (Lai and McGraw, 1994; Miyashita et al., 2003). Tanto a actividade como a
regulao destes transportadores so muito diferentes em clulas tipo selvagem (wt). O
transportadorprincipalaprotenaItr1p,sendoItr2pumtransportadorsecundrio,dadoque
adelecodogeneITR2noprovocaumaalteraodramticadaactividadedetransportede
inositol. J a deleco de ambos os genes elimina totalmente o transporte de inositol, o que
indicaqueasprotenasItr1peItr2psoosnicostransportadoresdeinositol.Poroutrolado,
a localizao dos transportadores na membrana plasmtica regulada pela presena de
inositol. Foi demonstrado que aps a adio de inositol ao meio de cultura h um aumento
drstico da velocidade de degradao dos transportadores, diminuindo assim o uptake do
inositol extracelular. Para a degradao dos transportadores necessria a internalizao
endocticadestes,seguidadedegradaoemvacolos(Miyashitaetal.,2003).

I.2. AleveduraSaccharomycescerevisiaecomomodelobiolgico

AslevedurassofungosunicelularespertencentesaofiloAscomycete.Tmvindoaser
reconhecidas como um sistema modelo bastante importante, representando um eucariota
simplescujogenomapodeserfacilmentemanipulado(Sherman,2002).Emborapossuamuma
complexidadegenticasuperiordosprocariotas,partilhamcomelesalgumascaractersticas
quetornamasuautilizaovantajosaemestudosbiolgicos:(i)crescimentosimpleserpido;
(ii) facilidade de isolamento de mutantes e clulas transformantes; (iii) sistema gentico bem
15

definido (genoma j se encontra totalmente sequenciado); (iv) sistema de transformao de


DNA altamente verstil. Para alm destas caractersticas possuem ainda a vantagem de no
serempatognicaseasuamanutenorequererbaixoscustos(Sherman,2002).
Poroutrolado,S.cerevisiaepartilhatambmalgumascaractersticascomasbactrias,
tornandoa um modelo biolgico importante: cresce rapidamente em qualquer tipo de meio
nutritivo,lquidoouslido,desdequeosnutrientessejamsuficientes,conseguindoduplicara
suapopulaoemmenosdeduashoras(Gralla,1997).Podesermanipuladafisiologicamente,
mediante a manipulao do meio de cultura (Jamieson, 1998). Possui uma multiplicidade de
marcadores de seleco, incluindo marcadores de seleco nutricional (ex. HIS3, URA3),
resistncia a frmacos (ex. kanMX, patMX, natMX) e susceptibilidade a frmacos (ex. cyhR)
(Auerbach et al., 2005). Este microrganismo adequase a estudos de stress oxidativo uma vez
queconseguealterarograudeutilizaodarespirao,consoanteotipodefontedecarbono
disponvel(Gralla,1997).
A levedura S. cerevisiae foi o primeiro eucariota cujo genoma foi totalmente
sequenciado(Goffeauetal.,1996).Oseugenomapequeno,contendonumaclulahaplide
cerca de 6000 genes em 16 cromossomas (Hudson, Jr. et al., 1997). Esta estirpe reproduzse
quer por gemulao (reproduo assexuada) quer por conjugao (reproduo sexuada). A
viabilidade dos estados haplide e diplide possibilita diversas aplicaes genticas,
nomeadamente, a obteno de estirpes com mais do que um gene mutado ou o estudo de
mutaesemgenesrecessivos,situaoqueemoutrosorganismosmaiscomplexosseriamais
complicada (Sherman, 2002). Partilha a mesma organizao subcelular que as clulas
eucariotas mais evoludas (ncleo, mitocndrios, complexo de Golgi) e variados enzimas, vias
metablicas e genes reguladores (Gralla, 1997). Por todas as caractersticas referidas, S.
cerevisiaetornouseumdosorganismoschaveeminvestigaogentica(Sherman,2002).
A versatilidade experimental aliada notvel conservao da funo gnica ao longo
da evoluo, faz da levedura S. cerevisiae um modelo biolgico amplamente requisitado,
consistindonumpontodepartidaparaestudosdefenmenosbiolgicos(ex.stressoxidativo)
e processos celulares (ex. vias de sinalizao celular) em eucariotas, podendo ser os
conhecimentosadquiridosposteriormenteaplicadosaeucariotassuperiores.Comomodelode
processoscelularesfundamentaiseviasmetablicasemhumanos,melhorouoconhecimento
e facilitou a anlise molecular de variados genes associados a doenas (Snyder and Kumar,
2002).Oaparecimentodevriaspatologiascomorigememprocessosoxidativosaumentouo
interesse no estudo da sua origem e desenvolvimento, nomeadamente doenas
neurodegenerativas e doenas oncolgicas. Porm, o estudo destes processos em clulas
16

animais bastante demorado e complexo, pelo que a levedura um bom modelo de partida
parasimularascondiesencontradasnasclulasanimais(Cunha,2001).

I.3. Operxidodehidrognio(H
2
O
2
)eostressoxidativo

I.3.1. OH
2
O
2
comoindutordestressoxidativo

A grande maioria dos organismos sobrevive custa de um ambiente aerbio. O


aparecimentodeoxignionaatmosferaduranteoprocessoevolutivoinicialtornoupossvelo
metabolismo respiratrio e o desenvolvimento de sistemas de gerao de energia eficientes
(Temple et al., 2005), mas conduziu tambm a uma variedade de processos de stress celular
devidonaturezareactivadooxigniomolecular(O
2
),levandoproduodemolculasede
radicais livres resultantes do seu metabolismo. Estes produtos, conhecidos geralmente por
espciesreactivasdeoxignio(EROs),incluemumgrandelequedemolculasquepodemser
tidas como oxidantes (como o perxido de hidrognio, H
2
O
2
) ou redutoras (como o radical
anio superxido, O
2

), e todas tm a capacidade de afectar a homeostase redox da clula


(Perroneetal.,2008).Soespciesqumicasaltamentereactivaspodendoconduziravariados
efeitos nocivos, tendo a capacidade de lesar constituintes celulares como o DNA, os lpidos e
asprotenas(Jamieson,1998;Perroneetal.,2008;Templeetal.,2005).
As EROs so geradas endogenamente como consequncia de processos metablicos,
maspodemtambmserformadasporexposiodasclulasacondiesambientaisadversas,
como aumento da presso de oxignio, choque trmico, exposio a radiao ionizante,
metais pesados ou oxidantes qumicos (Jamieson, 1998; MoradasFerreira et al., 1996). As
EROspodemtambmserformadasemconcentraeselevadasduranteprocessosderesposta
imune levadas a cabo por clulas especializadas do sistema imunitrio, os fagcitos, por
exemplo atravs da aco do enzima NADPH oxidase exploso respiratria (Barja, 1993;
Forman,2007;Suzukietal.,1997).
Em ambiente celular podem ser produzidas vrias EROs, nomeadamente, os vrios
radicaiscomooradicalsuperxido(O
2

),oradicalhidroxilo(HO

),radicaisperoxilo(ROO

),os
radicaisalcoxilo(RO

),mastambmmolculascomoodioxigniosingleto(
1
O
2
),operxidode
hidrognio (H
2
O
2
) e outros hidroperxidos orgnicos (ROOH) e ainda o peroxinitrito (ONOO

)
(Cadenas,1998).
17

DevidonaturezaubquadasEROs,nodeestranharqueamaioria(senotodos)os
organismos tenham desenvolvido formas de protegerem os seus componentes celulares
contraostressoxidativo(Jamieson,1998).Sobcondiesfisiolgicasnormais,osmecanismos
de defesa antioxidantes so quase certamente adequados para manter as EROs em nveis
basais, no lesivos, e para reparar os danos celulares infligidos. As defesas primrias
neutralizam as EROs, enquanto as secundrias reparam ou removem os produtos do dano
oxidativoaoDNA,protenaselpidos(MoradasFerreiraetal.,1996).Todososorganismosque
sobrevivem custa do metabolismo aerbio so continuamente expostos a estes agentes,
levando a uma situao de stress oxidativo. O stress oxidativo representa um desequilbrio
entreaproduodeEROseacapacidadeantioxidantedaclulaparadestoxificarrapidamente
osintermediriosreactivosoupararepararosdanoscelularesinduzidos,afavordaproduo
deEROs(Jamieson,1998;Sies,1997).
O perxido de hidrognio (H
2
O
2
) a principal ERO formada endogenamente e a que
apresentaumamaiorestabilidade(Giorgioetal.,2007),daquetenhavindoareceberespecial
ateno por parte da comunidade cientfica devido a ser um forte oxidante e sua presena
ubqua em todos os organismos aerbios (Chance et al., 1979). Os organismos estudados at
aomomentodemonstraramumaelevadasensibilidadeapequenasvariaesnaconcentrao
desta molcula, pelo que se torna bvia a necessidade de possurem mecanismos de
eliminao desta espcie qumica e de obviao dos seus efeitos (Giorgio et al., 2007). Esta
EROtemumadualidadefuncional,umavezquesurgeassociadaavariadasreacesqumicas
deoxidaodetiiseinactivaodeenzimas(Grant,2001)mastambmsinalizaocelular
emdiversosprocessos(desenvolvimento,proliferao,mortecelular,transduodesinal).
O H
2
O
2
pode ser gerado endogenamente atravs de variadas reaco catalisadas
enzimaticamente (Chance et al., 1979). Uma das principais fontes endgenas de H
2
O
2
a
reaco de dismutao do O
2

, catalisada pelos superxido dismutases (SOD). O H


2
O
2
pode
tambmsergeradodirectamentedevidoactividadeenzimticadeoxidasesouaindadurante
o processo de oxidao dos cidos gordos (Cai, 2005; Forman, 2007; Temple et al., 2005;
Zhang and Gutterman, 2007). Por outro lado, o H
2
O
2
pode igualmente ser produzido
extracelularmente em concentraes elevadas durante a resposta imunitria inata levada a
cabo pelos fagcitos, atravs da dismutao do anio superxido catalisada pelo enzima
NADPH oxidase, actuando depois intracelularmente (Barja, 1993; de OliveiraMarques et al.,
2007;Forman,2007;Suzukietal.,1997).
semelhana de outras EROs, quando em concentraes elevadas promove diversos
tiposdedanoscelulares:(i)oaumentodonveldeoxidaodetiisdeprotenasespecficas;
(ii) carbonilao de protenas; (iii) peroxidao lipdica e danos no DNA (Costa et al., 2002;
18

Jamieson,1998;LeMoanetal.,2006).OsdanosinduzidospeloH
2
O
2
podemocorrerdeforma
indirecta, atravs da formao do radical hidroxilo (HO

), extremamente reactivo, que reage


indiscriminadamentecomamaioriadosconstituintescelulares.AproduodeHO

ocorrevia
reacodeFenton(Equao1)porreacocomiesdemetaisdetransioreduzidoscomoo
Fe
2+
eoCu
+
,quesooxidadosduranteoprocesso(Templeetal.,2005;Toledanoetal.,2003).

H
2
O
2
+Fe
2+
Fe
3+
+HO

+HO

Equao1

Em concentraes fisiolgicas (10


9
10
7
M), tm sido atribudas vrias funes
importantesaoH
2
O
2
aonveldasinalizaocelular:(i)induodafosforilaodeprotenas;(ii)
induodosnveisdeCa
2+
;(iii)alteraodograudeoxidaodetiisemprotenasespecficas;
(iv) papel de segundo mensageiro como resposta a citocinas e factores de crescimento
(Forman,2007;LeMoanetal.,2006;Suzukietal.,1997).

I.3.2. OestadoestacionriodeH
2
O
2
comoindutordestressoxidativo

Nosentidodesimularascondiesexistentesinvivoaquandodaexposiodasclulas
ao H
2
O
2
, nomeadamente em situaes de stress oxidativo, tm sido feitas vrias abordagens
em diversos sistemas biolgicos. Porm, a grande maioria delas baseiase na adio de uma
dose bolus de H
2
O
2
correspondente concentrao desejada, sendo o H
2
O
2
consumido pelos
peroxidases intracelulares, como o caso do catalase, sem que haja qualquer fonte de
produodomesmonosentidodeorepor,peloqueasuaconcentraoserdecrescenteao
longodotempoemquedecorreaexperincia(AntunesandCadenas,2001).Estasituaono
se assemelha que ocorre in vivo, que caracterizada por uma concentrao constante de
H
2
O
2
ao longo do tempo. Quando se adiciona H
2
O
2
em condies bolus, a concentrao de
H
2
O
2
vai decrescendo ao longo do tempo (Figura 10B) pelo que h, frequentemente, uma
necessidade de adicionar doses iniciais de H
2
O
2
muito elevadas, na ordem dos 10
5
10
3
M,
duas a cinco vezes superior concentrao de H
2
O
2
encontrada in vivo. Estes nveis
elevadssimosdeH
2
O
2
representamumchoqueagudonofisiolgico,provocammodificaes
oxidativas severas (algumas das quais irreversveis), disrompem a homeostase celular e
induzemrespostascelularesquepodemnoestarrelacionadascomasinduzidaspelasbaixas
concentraes de H
2
O
2
encontradas in vivo. Como tal, a adio de H
2
O
2
em bolus no um
mtodo adequado para estudar questes fundamentais sobre os efeitos biolgicos do H
2
O
2
a
19

nvel regulatrio (Antunes and Cadenas, 2001). Foi, portanto, desenvolvida uma abordagem
experimental que permite mimetizar a concentrao constante de H
2
O
2
observada in vivo, a
aproximao de adio de H
2
O
2
em estado estacionrio (Antunes and Cadenas, 2001) (Figura
10B). O estado estacionrio de H
2
O
2
obtido adicionando ao meio de cultura uma fonte
geradora de H
2
O
2
, o enzima glucose oxidase (GO) (Figura 10A), que compensa o consumo
levado a cabo pelos peroxidases intracelulares (catalase e glutationo peroxidases). O enzima
glucose oxidase utiliza como substrato a glucose presente em excesso no meio de cultura
(AntunesandCadenas,2001).

Figura 10 A. Gerao de um estado estacionrio de H


2
O
2
. O glucose oxidase produz H
2
O
2
a uma velocidade
constanteaolongodotempo(v
2
),enquantoasclulasoconsomemaumavelocidadev
1
,exibindoumacinticade
primeiraordem.B.ComparaodemtodosdeentregadeH
2
O
2
sclulas.ApsaadioexgenadeH
2
O
2
,oH
2
O
2

difundeseparaointeriordasclulaserapidamenteconsumidodevidoacodosenzimasantioxidantes,como
oGlutationoperoxidase(GPx)eocatalase(Cat).Devidoaesteconsumo,naadioembolus(1)tmdeserusadas
elevadasconcentraesdeH
2
O
2
parasereminduzidasrespostascelulares.Naaproximaodeestadoestacionrio
(2) a concentrao de H
2
O
2
mantida constante durante o ensaio devido adio de glucose oxidase (GO),
simultaneamente com uma dose inicial de H
2
O
2
concentrao desejada. Adaptado de (OliveiraMarques et al.,
2009).

v
2
v
1
=k[H
2
O
2
]
[H
2
O
2
]
Produo de H
2
O
2
pelo
enzima glucose oxidase
Consumo de H
2
O
2
pela clula
A
B
20

AadiodeH
2
O
2
emestadoestacionriovantajosarelativamenteadioembolus
porque: (i)mimetizaaproduoendgenadeH
2
O
2
contnuainvivo,contrariamenteadio
embolusquedisrompeahomeostasecelular;(ii)uniformizaaentregadoH
2
O
2
,porqueeste
fornecido numa concentrao de estado estacionrio (concentrao de H
2
O
2
mantmse
constante);(iii)naadioembolusadoseefectivadeH
2
O
2
entregueporcluladesconhecida
porque depende tanto da densidade celular como do consumo de H
2
O
2
pelo meio de
crescimento, o que torna a comparao de dados entre laboratrios difcil; (iv) permite a
distino de respostas celulares de acordo com a concentrao de H
2
O
2
que as desencadeia,
contrariamente adio em bolus, onde as respostas celulares surgem todas associadas; (v)
permitedeterminaraconcentraodeH
2
O
2
aolongodoensaio.
O modelo de estado estacionrio consiste, ento, numa melhor aproximao s
condiesfisiolgicas,comavantagemdenodisromperahomeostasecelular.

I.3.3. AadaptaoaoH
2
O
2
emS.cerevisiae

Durante os processos de stress oxidativo desencadeada uma srie de mecanismos


que permite s clulas adaptaremse s condies adversas no sentido de sobreviverem. Foi
observadoqueoperxidodehidrognioinduzumarespostaadaptativaaostressoxidativoem
S. cerevisiae (Collinson and Dawes, 1992), em clulas previamente expostas a uma dose sub
letaldoagente,esubmetidasposteriormenteaumadoseletaldomesmo.Aprexposiodas
clulas ao H
2
O
2
desencadeia uma srie de processos celulares e moleculares que conferem
uma maior resistncia s clulas quando confrontadas com doses letais deste agente (Branco
etal.,2004).
Os processos biolgicos que esto na base da resposta adaptativa ao stress oxidativo
tm vindo a ser amplamente estudados no s em S. cerevisiae mas tambm em outros
organismos. Em S. cerevisiae os estudos so focados essencialmente nos mecanismos de
remoodasEROs,nosdanoscausadosenosmecanismosdereparaodosmesmos.
A resposta celular ao H
2
O
2
consiste numa diversidade de respostas de sinalizao
celular, com activao de factores de transcrio e mecanismos de sinalizao intracelulares
responsveis pela regulao da expresso de genes que codificam protenas cujos nveis so
alteradoscomoresultadodostressoxidativoinduzidopeloH
2
O
2
(Hasanetal.,2002;Toledano
etal.,2003).
21

UmaspectointeressantedarespostaadaptativaaoH
2
O
2
queainduodediferentes
padres de alteraes proteicas e de expresso gnica em S. cerevisiae tambm observada
em outras situaes de stress oxidativo. Muitas das protenas cuja expresso gnica se
encontra alterada em resposta ao H
2
O
2
, vem tambm a sua expresso alterada quando
expostasaoutrosfenmenosindutoresdestressoxidativoquenoosprovocadospeloH
2
O
2
.
Estas observaes indiciam uma resposta comum entre fenmenos de stress (Godon et al.,
1998;MoradasFerreiraetal.,1996).
Recorrendo ao uso de microchips de DNA e a tcnicas genmicas avanadas foi
possvelobservaralteraesnosnveisdemRNAdurantearespostaadaptativaaoH
2
O
2
.Foram
observadasalteraesemcercadeumterodogenomadeS.cerevisiaesendoque,deentreo
grande nmero de genes que viram a sua expresso alterada, aproximadamente 500 esto
envolvidosnarespostaafenmenosdestress(Caustonetal.,2001;Gaschetal.,2000).Destes
so induzidos aqueles associados ao metabolismo glicdico, resposta ao stress celular e
gerao de energia (via gliclise). Os reprimidos esto ligados traduo e sntese proteicas
(Godon et al., 1998). Foi observado que a respostaao H
2
O
2
caracterizase principalmente por
uma forte induo de genes associados destoxificao de EROs (Superxido dismutases
SOD e glutationo peroxidases GPx) e de genes relacionados com reaces de oxidao
reduointracelulares.Porm,estesresultadosforamobtidosatravsdaadiodeumadose
bolus (letal) de H
2
O
2
, que resulta em concentraes de H
2
O
2
em nada semelhantes s
observadas in vivo. Neste tipo de aproximao experimental a resposta observada envolve
muitomaisgenesdevidoquerprpriarespostadaclulaaostressoxidativoquerenorme
alterao do estado redox da clula, havendo uma juno de diferentes respostas que
conduzem a resultados inespecficos e em muitos casos inconclusivos. Recentemente, foi
estudadaarespostagnicadasclulasdeS.cerevisiaeadaptadasa150MdeH
2
O
2
emestado
estacionrio durante 90 min (Pedroso, 2008) (ver captulo I.3.4). Nestas condies
experimentais foi analisada a expresso gnica por anlise de microarrays, tendo sido
observadas variaes na expresso de um total de 385 genes, correspondendo esses genes a
6%dototalexistentenogenomadeS.cerevisiae(Pedroso,2008).Verificouse,portanto,uma
respostadistintadaquelaobservadacomadiodeH
2
O
2
embolus,devidosobretudosdoses
subletais de H
2
O
2
s quais as clulas foram expostas e maior especificidade da resposta
celular(Pedroso,2008).

22

I.3.4. A regulao da expresso gnica em condies de adaptao ao H


2
O
2

emestadoestacionrio

O perxido de hidrognio uma ERO que continuamente produzida in vivo (i)


intracelularmente, como produto secundrio do metabolismo aerbio, e (ii)
extracelularmente, como resultado da activao dos fagcitos. uma molcula pequena e
neutra e, portanto, difundese facilmente atravs das membranas biolgicas (Pedroso et al.,
2009). Recentemente, foi demonstrado que a difuso de H
2
O
2
atravs da membrana
plasmticadeS.cerevisiaelimitaavelocidadedeconsumodoH
2
O
2
extracelular(Brancoetal.,
2004; SousaLopes et al., 2004). Estas evidncias refutam o paradigma vigente de que o H
2
O
2

se difunde livremente atravs das biomembranas. Este novo modelo implica que sejam
formadosgradientesdeH
2
O
2
atravsdasmembranas(Pedrosoetal.,2009).
Um dos aspectos mais notveis da resposta das clulas presena de H
2
O
2
a
capacidade de se adaptarem presena deste agente atravs da aquisio de resistncia. Foi
visto que clulas expostas a doses subletais de H
2
O
2
(150 M H
2
O
2
em estado estacionrio
durante1590min)conseguemadaptarseaexposiesposteriorescomdosesletais(700M
H
2
O
2
em estado estacionrio durante 60 min) atravs da aquisio de resistncia. Isto
reflectido numa maior velocidade de sobrevivncia das clulas quando expostas a
concentraesletaisdomesmoagente(Pedroso,2008).
Na levedura S. cerevisiae a resposta adaptativa ao stress oxidativo baseiase
principalmente no aumento da expresso dos enzimas que catalisam a eliminao do H
2
O
2
e
dos sistemas responsveis pela reparao dos danos induzidos pelo H
2
O
2
(Pedroso et al.,
2009). Porm, foi recentemente demonstrado que, durante a adaptao de clulas de S.
cerevisiae ao H
2
O
2
, h tambm uma diminuio da permeabilidade da membrana plasmtica
aoH
2
O
2
,limitandooinfluxodesteagente(Brancoetal.,2004).Aalteraodapermeabilidade
ocorre rapidamente durante a adaptao e acompanhada por um decrscimo da fluidez da
membrana (Folmer et al., 2008). Portanto, a diminuio da permeabilidade da membrana
associadaaoaumentodaactividadedosenzimasqueremovemoH
2
O
2
,levaaumaumentodo
gradientedeH
2
O
2
atravsdamembrana(Brancoetal.,2004).
De forma a entender o mecanismo que modula o decrscimo da permeabilidade da
membranaaoH
2
O
2
,averiguousequaisoscomponentesnamembranaplasmticaquepodem
serresponsveispelasalteraesobservadas.FoiobservadoqueaadaptaoaoH
2
O
2
modula
rapidamente a expresso de genes que codificam para enzimas envolvidos na via de
biossntesedoergosterol (ERG1, ERG3,ERG7, ERG25,ERG6)enometabolismolipdico (ELO1,
23

ELO2,ELO3,OLE1,FAS1,FAS3,LAC1,LIP1,GPT2)(Quadro1).Verificousetambmquehuma
alterao do perfil lipdico da membrana plasmtica: a adaptao das clulas ao H
2
O
2
leva a
umaredistribuiodosdomniosricosemesteroleaumaumentodosdomniosordenadosda
membranaplasmtica(Pedrosoetal.,2009).
Um dos genes cuja expresso se encontra reprimida nos instantes iniciais aps
exposio a doses adaptativas de H
2
O
2
o gene FAS1 (Pedroso, 2008) que codifica para a
subunidade do sintase de cidos gordos (FAS), cuja regulao objecto de estudo do
presentetrabalho.

Quadro 1 A adaptao ao H
2
O
2
altera a expresso de genes que codificam enzimas envolvidos na via de
biossntesedoergosterolenometabolismolipdico.Adaptadode(Pedroso,2008).

Gene ORF Descrio

ExpressodemRNAaolongodaadaptaoao
H
2
O
2

15min 30min 60min 90min


Metabolismoergosterol
ERG1 YGR175C Esqualenoepoxidase 2,2
ERG3 YLR056W C5esteroldesaturase 1,9 2,0
ERG7 YHR072W Lanosterolsintase 1,4
ERG2 YGR060W C4metilesteroloxidase 1,0
ERG6 YML008C (24)esterolcmetiltransferase 0,5
Metabolismolpidos
ELO1 YJL196C Elongase 1,2
ELO2 YCR034W Elongase 1,3
ELO3 YLR372W Elongase 1,2 1,1
OLE1 YGL055W Desaturasedecidosgordo 1,1
FAS1 YKL182W Subunidadebetadocidogordosintase 1,6
FAS3 YNR016C AcetilCoAcarboxilase 1,3
LAC1 YKL008C Componentedoceramidasintase 1,3 1,4
LIP1 YMR298W Subunidadedoceramidasintase 1,8
GPT2 YKR067W 3fosfatodeglicerolaciltransferase 2,0
24

FoiobservadoqueoH
2
O
2
reprimeaexpressodogeneFAS1em1,5xaps15minde
exposio a 150 M de H
2
O
2
em estado estacionrio, havendo uma recuperao para os
valoresiniciaisaps60mindeadaptao.AdeterminaodosnveisdemRNAdogeneFAS1
porNorthernblotconfirmouestesresultados(Matiasetal.,2007).Essesnveisdiminuramem
90 e 80% relativamente aos nveis controlo aps exposio a 150 M H
2
O
2
durante 15 e 30
min, respectivamente, regressando aos valores controlo aps 60 min de exposio. Foi
demonstradopelaprimeiravezqueoFAStemumpapelimportantenarespostacelulardaS.
cerevisiae ao H
2
O
2
, visto que durante a adaptao destas clulas a 150 M em estado
estacionriodeH
2
O
2
houveumdecrscimotantodaexpressocomodaactividadeFAS. Mais
relevanteaindafoiofactodequeadiminuiodaactividadeFASem50%,atravsdedeleco
deumdosalelosFAS,aumentouaresistnciadasclulasadosesletaisdesteagente(Matiaset
al.,2007).
OsmecanismospelosquaisodecrscimodaexpressodoFASlevaaumaumentoda
resistncia ao H
2
O
2
ainda no foram completamente elucidados. No entanto, verificouse um
aumentodosnveisdecidosgordosdecadeiamuitolonga(VLCFA)namembranaplasmtica,
sugerindo que estes cidos gordos podem diminuir a permeabilidade da membrana ao H
2
O
2
,
conferindoassimumamaiorresistnciaaesteagente(Matiasetal.,2007).

25

II. OBJECTIVOS

A membrana plasmtica separa fisicamente os componentes intracelulares do


ambienteextracelular,controlandoaentradaesadadecompostos.Aestruturadamembrana
plasmtica regulvel, podendo reorganizarse quando sujeita a condies extracelulares
adversas. Na levedura Saccharomyces cerevisiae, a velocidade de difuso do perxido de
hidrognio(H
2
O
2
)atravsdamembranaplasmticadiminuiduranteaadaptaoaoH
2
O
2
(dose
baixa de H
2
O
2
), tornando as clulas mais resistentes a doses letais de H
2
O
2
. Este aumento de
resistncia ao H
2
O
2
resulta de um decrscimo da permeabilidade da membrana plasmtica
que,emconjuntocomoaumentodaactividadedosenzimasqueremovemoH
2
O
2
,levaaum
aumento do gradiente de H
2
O
2
atravs da membrana plasmtica. A alterao da
permeabilidade ocorre rapidamente durante a adaptao, e acompanhada por um
decrscimo da fluidez da membrana. O mecanismo pelo qual o H
2
O
2
leva a alteraes da
permeabilidade da membrana plasmtica durante a adaptao no conhecido sabendose,
no entanto, que ocorrem alteraes na composio lipdica da membrana plasmtica e nos
nveisdediversasprotenasdafracoisoladadamembranaplasmtica.
As clulas de S. cerevisiae adaptadas ao H
2
O
2
apresentam uma menor expresso do
geneFAS1,quecodificaparaasubunidadeFas1dosintasedecidosgordos(FAS),assimcomo
uma diminuio da respectiva actividade enzimtica. O gene FAS1 pertence a um grupo de
genes regulados pelo inositol, sendo a sua expresso reprimida quando aumenta o inositol
intracelular. Por outro lado, o aumento de inositol induz uma profunda alterao do padro
celular dos lpidos, o que poder influenciar a composio/organizao da membrana
plasmticacomconsequnciasaonveldapermeabilidadedamembranaplasmtica.
O objectivo deste trabalho inserese na tentativa de compreender os mecanismos
moleculares envolvidos na regulao do gene FAS1 induzidos pelo H
2
O
2
. Como hiptese de
trabalho propese que o H
2
O
2
reprime a expresso do gene FAS1 atravs da induo dos
nveis de inositol nas clulas de S. cerevisiae. Para testar esta hiptese proposta uma
abordagem qualitativa e quantitativa usando metodologias complementares de bioqumica e
biologia molecular e celular, no sentido de elucidar o mecanismo molecular pelo qual a
adaptaoaoH
2
O
2
dasclulasdeS.cerevisiaereprimeaexpressodogeneFAS1.

26

No sentido de atingir o objectivo proposto, o trabalho foi dividido em vrias etapas


tendoporbaseasseguintespremissas:

a)OH
2
O
2
induzoaumentodosnveisdeinositol
Abordagem experimental: Determinao dos nveis de inositol em clulas controlo e
submetidasadosesadaptativasdeH
2
O
2
recorrendoaummtodoespectrofotomtrico
b) O H
2
O
2
, atravs do aumento dos nveis de inositol, induz a translocao da Opi1p para o
ncleo
Abordagemexperimental:AnlisedatranslocaonucleardofactorGFPOpi1p,napresenae
ausnciadeH
2
O
2
pormicroscopiadefluorescncia
c) O H
2
O
2
, atravs do aumento dos nveis de inositol, leva a uma alterao do perfil
fosfolipdicoglobal
Abordagemexperimental:Quantificaodosnveisdefosfolpidostotaisemclulascontroloe
tratadascomH
2
O
2
,porTLCbidimensional
d) O aumento dos nveis de inositol induzido pelo H
2
O
2
leva alterao da expresso de
vriosgenes
Abordagem experimental: Quantificao de diversos transcritos regulados pelo inositol por
PCRquantitativoemtemporeal(realtimeQPCR)

Como modelo experimental so utilizadas clulas de Saccharomyces cerevisiae,


tratadas com 150 M de H
2
O
2
em estado estacionrio at 40 min, utilizando o elctrodo de
oxignioparamonitorizaraconcentraodeH
2
O
2
.

27

III. MATERIAISEMTODOS

III.1. Materiais

A Bacto peptona, o YNB (Yeast Nitrogen Base), o Bacto agar e o extracto de levedura
foram adquiridos da Difco (Detroit, MI, EUA). A glucose e o perxido de hidrognio foram
obtidosdaMerck(WhitehouseStation,NJ).Ocatalase(defgadodebovino),oglucoseoxidase
(de Aspergillus niger), o cloreto de iodonitrotetrazlio (INT), o mioinositol desidrogenase (de
Enterobacter aerogenes), o diaforase (de Clostridium kluyveri), o hexocinase, os aminocidos
do meio de crescimento, o fluoreto de fenilmetilsulfanilo (PMSF), o NAD, o trifosfato de
adenosina disdico (ATP2Na), o Triton X100 e o reagente de Folin foram obtidos da Sigma
Aldrich (St Louis, MO, EUA). As placas de slica gel 20 cm x 20 cm para TLC e a resina Dowex
50W200400meshforamobtidasdaFluka(StLouis,MO,EUA).Amembranadeseparaode
fases 1PS foi obtida da Whatman (Kent, UK). A membrana TYPE HA 0,45 m do sistema de
vcuo para recolha das clulas foi obtida da Millipore (Billerica, MA, USA). O kit de extraco
deRNAtotaldeS.cerevisiaefoiadquiridoAmbion(Austin,TX,USA).ADNaseIeokitparaa
sntese da primeira cadeia de cDNA RevertAid
TM
H Minus Reverse Transcriptase foram
adquiridos Fermentas (Maryland, USA). O Brilliant SYBR Green Masater Mix para
amplificaoemPCRquantitativoemtemporealfoiobtidodaStratagen(Kirkland,MA,USA).

III.2. Materialbiolgico

Ao longo do trabalho experimental foram utilizadas as estirpes selvagem BY4741


(wt), a estirpe opi1, que isognica da estirpe wt (com o gene OPI1, que codifica para a
protena Opi1p, mutado), e a estirpe opi1 + GFPOpi1p (estirpe opi1 transformada com o
plasmdeoGFPOpi1p).
Asestirpeswteopi1foramadquiridasnaEUROSCARFencontrandoseosrespectivos
gentipos descritos no Quadro 2. A estirpe opi1 + GFPOpi1p foi obtida aps transformao
da estirpe opi1 com o plasmdeo pTL212, plasmdeo de expresso da GFPOpi1p,
centromrico,construdoapartirdoplasmdeopRS416.EsteplasmdeofoiofertadoProf.Tim
Levine(Loewenetal.,2003).
28

Quadro2EstirpesdeS.cerevisiaeutilizadasnotrabalhoexperimental.
Designao Estirpe Gentipo
wt(haplide) Y00000 BY4741;MATa;his31;leu20;met150;ura30
opi1 Y00943 BY4741;MATa;his31;leu20;met150;ura30;YHL020c::kanMX4

III.3. MtodosExperimentais

III.3.1. CondiesdeCrescimento

O crescimento das culturas foi realizado em meio Sinttico Completo (SC Synthetic
Complete) (Branco et al., 2004). O meio SC constitudo por glucose 2% (m/v), YNB 6,85%
(m/v), aminocidos e bases Triptofano 0,005% (m/v), Histidina 0,01% (m/v), Leucina 0,01%
(m/v), Adenina 0,0025% (m/v), Uracilo 0,0025% (m/v), Treonina 0,02% (m/v), Serina 0,04%
(m/v), Arginina 0,002% (m/v), Metionina 0,002% (m/v), Tirosina 0,003% (m/v), Isoleucina
0,003% (m/v), Lisina 0,003% (m/v), Fenilalanina 0,005% (m/v), Valina 0,015% (m/v), cido
Asprtico0,01%(m/v),cidoGlutmico0,01%(m/v).Assoluesnecessriasparaobtereste
meio foram autoclavadas a 120 C durante 20 min (YNB e glucose), ao passo que as solues
deaminocidosforamautoclavadasa110Cdurante20min.
ParaoarmazenamentofoiusadomeioYPDslido,feitoapartirdemeioYPpeptona
2% (m/v); extracto de levedura 1% (m/v) suplementado com Bacto agar 2% (m/v) e glucose
2% (m/v). O armazenamento foi feito: a) em placas com meio YPD slido, a 4 C (com um
mximo de duas passagens para uma nova placa a cada 20 dias); b) em suspenso numa
soluodeglicerol20%(v/v),a80C.
O crescimento das clulas foi feito em meio lquido, a 30 C e 160 rpm num agitador
orbital.Osestudosforamefectuadoscomculturasemfasedecrescimentoexponencialapsa
ocorrncia de pelo menos dois ciclos de duplicao, feitas a partir de prculturas com 1416
horasdecrescimento.Asleiturasdedensidadepticadasculturasforamefectuadasa600nm
(OD
600
)numespectrofotmetroBeckmanDU68(1OD
600
~2x10
7
clulas).

29

III.3.2. CurvasdeCrescimento

Foi necessrio realizar um estudo do perfil de crescimento das estirpes (wt, opi1,
opi1 + GFPOpi1p), conseguido atravs da realizao das suas curvas de crescimento. Este
procedimentofoinecessrioparasepoderdeterminarotempoqueasculturasdemoravama
atingirasdiferentesfasesdecrescimento.
Paracadaestirpeasculturasforaminoculadasa0,03OD
600
/mL,colocadasacrescera
30Ce160rpmnumagitadororbital,eefectuadasleiturasdedensidadeptica(OD)a600nm
emintervalosdetemporelativamentecurtos(1hou1h30).

III.3.3. DeterminaodasconstantesdeconsumodeH
2
O
2
pelasclulas

As culturas foram inoculadas a 0,03 OD


600
/mL a partir de prculturas, colocadas a
crescer a 30 C e 160 rpm num agitador orbital at atingirem 0,15 OD
600
/mL. Nessa altura
adicionouse s culturas um volume de uma soluo de H
2
O
2
9 mM para que a concentrao
finalnaculturafossede150M(dosesubletalaquequeremossujeitarasclulasduranteo
processodeadaptao).
Foi medido o decrscimo da concentrao de H
2
O
2
presente nas culturas durante 60
min.AsdeterminaesforamefectuadasnumelctrododeClark(HansatechInstruments,UK).
A medio foi realizada adicionando a 400 L de gua uma alquota de 400 L da cultura,
adicionando seguidamente 10 L de uma soluo de catalase 1 mg/mL. O sinal do elctrodo
corresponde ao oxignio libertado pela dismutao do H
2
O
2
. A partir desse sinal possvel
determinar a concentrao de H
2
O
2
presente na cultura num determinado instante,
recorrendo a uma curva de calibrao feita diariamente. A curva de calibrao foi feita com
solues padro de diferentes concentraes de H
2
O
2
, feitas a partir de uma soluo de
aproximadamente9mM.Aconcentraorealdessasoluode9mMfoideterminadaapartir
doseuvalordeabsorvnciaa240nm(=43,4M
1
cm
1
).
AconstantedeconsumodeH
2
O
2
,k(min
1
),correspondeaodeclivedarectarelativa
regressolinearajustadaaospontosdarepresentaogrficadeln[H
2
O
2
]vs.tempo(min).H
que ter emcontaqueo consumodeH
2
O
2
depende daconcentraodeclulaspresentesem
cada ensaio e, para que este valor pudesse ser utilizado para o clculo dos volumes de
adaptaoparaestabeleceroestadoestacionriodeH
2
O
2
,efectuouseumanormalizaoem
funo da densidade celular do ensaio. Assim, o consumo de H
2
O
2
(min
1
.(OD/mL)
1
)
30

determinadofazendoarazoentrek(min
1
)eaOD
600
/mLaqueaculturaseencontranoincio
doensaio(Equao2).

Consumo ue B
2
0
2
(min
-1
. (0BmL)
-1
) =
k (mIn
-1
)
OD
600
mL
Equao2

III.3.4. Adaptaodasclulasa150MdeH
2
O
2
emestadoestacionrio

AadaptaodasclulasaoH
2
O
2
foiinduzidaporexposiodasclulasaumadosesub
letal de 150 M de H
2
O
2
em estado estacionrio, durante 1590 min (Branco et al., 2004). A
adaptao iniciouse com as clulas em fase de crescimento exponencial (0,15 OD
600
/mL)
(1OD
600
=23x10
7
clulas).
Para a criao do estadoestacionrio adicionouse, simultaneamente, 150 M H
2
O
2
e
o enzima glucose oxidase s clulas em cultura, de modo a que a velocidade de produo de
H
2
O
2
por parte do glucose oxidase igualasse a velocidade de consumo de H
2
O
2
pelas clulas.
Destemodo,consegueseumaconcentraodeH
2
O
2
constantenodecorrerdosensaios.
Foi efectuada a quantificao do H
2
O
2
presente nas culturas ao longo do tempo de
adaptao, com o intuito de confirmar a criao do estado estacionrio concentrao de
H
2
O
2
pretendida.
Como ao longo do tempo dos ensaios a densidade ptica da cultura vai aumentando,
significando um maior nmero de clulas, o consumo de H
2
O
2
cada vez mais acentuado.
Portanto,aconcentraodeH
2
O
2
naculturavaidiminuindo,peloquenecessrioreportanto
o H
2
O
2
como o glucose oxidase. Os volumes de H
2
O
2
e de glucose oxidase adicionados
inicialmenteparaoestabelecimentodoestadoestacionrioassimcomoosacertosnecessrios
nodecorrer dotempodeadaptaoforamcalculadosapartirdadensidade pticadacultura
noinciodaadaptao,daactividadedoglucoseoxidaseedaconstantede consumodeH
2
O
2

pelasclulas,determinadasexperimentalmente.
AactividadedoglucoseoxidasefoideterminadaemmeioSC,seguindoaproduode
H
2
O
2
peloenzimaaolongodotempo.Oensaiofoifeitoem10mLdemeiodeculturaaoqual
foram adicionados 50 L de uma soluo de glucose oxidase 0,0531U diluda 1000x.
Assumindo uma reaco de primeira ordem, a actividade em M/min corresponder ao
declive da recta ajustada aos pontos do grfico da [H
2
O
2
] (M) vs. tempo (min). Tendo em
consideraoosvolumesdoensaio(meiodeculturaesoluodeglucoseoxidase)calculouse
aactividadeespecficadoenzimaemmol/min/L.
31

Asdeterminaesdaconcentraode H
2
O
2
foramefectuadasnumelctrododeClark
(HansatechInstruments,UK),comoexplicadoemIII.3.3.

III.3.5. TranslocaodofactornuclearGFPOpi1p

III.3.5.1. Obtenodostransformantesopi1+GFPOpi1p

Atransformaodasclulasopi1foiefectuadadeacordocomomtododescritopor
Ito e colaboradores (Ito et al., 1983). A transformao foi feita a partir de uma prcultura
opi1 com 1416h de crescimento, colocada a crescer a 30 C, com agitao a 160 rpm.
Recolheuse 1 mL dessa prcultura para um tubo eppendorf de 1,5 mL. Aps centrifugao
durante 2 min a 3000 rpm (centrfuga Eppendorf 5415), lavouse o sedimento de clulas com
500Ldeguaestril.Apsnovacentrifugao,ressuspendeuseosedimentodasclulasem
500LdeumasoluoTE/LiAc(Acetatodeltio0,1M;TrisHCl10mM,pH8,0;EDTA1mM).
Deixouseasuspensoobtidaa4Cdurante1hora.Paracadatransformaopreparouse,em
tubos eppendorf de 1,5 mL, a mistura de reaco de transformao contendo 50 L de
suspenso celular, 5 L (~100 g) do DNA plasmdico (pTL212), 5 L de DNA carrier (25 g)
previamente desnaturado na placa trmica a 90 C durante 2 min, e 300 L de uma soluo
LiAc/TEcomPEG40%(m/v).Apsincubaoa30C,durante30mincomagitaoa160rpm,
a mistura de reaco de transformao incubou a 42 C durante 20 min. No final desta
incubao colocouse a mistura reaccional a 4 C, durante 30 min. Por fim, centrifugouse a
7000rpmnacentrfugaEppendorf5415durante2min.Osedimentoobtidofoiressuspendido
em100Ldeguaestrileplaqueadoemplacascommeiosintticosemuracilo(SCUra

).As
placasforaminvertidasedeixadasdurantecercade3diasa30C.

III.3.5.2. VisualizaodatranslocaoporMicroscopiadefluorescncia

Preparouseumaculturadaestirpeopi1+GFPOpi1p,inoculando25mLdemeioSC
Ura

a uma densidade celular de 0,03 OD


600
/mL. A cultura cresceu at atingir 0,15 OD
600
/mL.
Foram recolhidos 800 L da cultura para um tubo eppendorf (controlo) e procedeuse
adaptaodasclulascom150MdeH
2
O
2
emestadoestacionrio.Foramtambmrecolhidos
800 L da cultura aos vrios tempos de adaptao. Centrifugouse a suspenso celular
32

equivalente a cada amostra durante 1 min a 8 500 x g (centrfuga Eppendorf miniSpin) e


recolheramse10Ldosedimentocelularparaamontagemdeumalminademicroscpioe
lamela. A emisso de fluorescncia por parte das clulas foi observada num microscpio
Olympus BX41, tendose procedido recolha de imagens utilizando uma mquina fotogrfica
Olympus Digital Camera Camedia C4040 ZOOM, CCD 4 100 000 Pixels. As imagens foram
tratadascomoauxliodosoftwareImageJ1.42q(Abramoffetal.,2004;Rasband,1997).Como
controlodeautofluorescnciaanalisouseumaamostradeumaculturaopi1.

III.3.6. Quantificao dos nveis de fosfolpidos totais em clulas controlo e


tratadascomH
2
O
2
,porCromatografiaemcamadafinabidimensional

III.3.6.1. Extracodoslpidostotais

OslpidostotaisdasclulasdeleveduraS.cerevisiaeforamextradosdeacordocomo
mtodo descrito por Folch e colaboradores (Folch et al., 1957), a partir de 25 OD totais de
clulasdecadaumadasamostras.InoculousemeioSCapartirdeumaprculturadaestirpe
wt,aumadensidadecelularde0,03OD
600
/mLerecolheuseasclulasa0,15OD
600
/mL,aps
vriostemposdeadaptaocom150MdeH
2
O
2
ousemadaptao.Asclulasequivalentesa
500 mL de cultura foram recolhidas com o auxlio de um sistema de vcuo, atravs de uma
membranaMilliporeTYPEHA0,45m.Apsfiltrao,asclulasfiltradasforamressuspendidas
emcercade20mLdeumasoluotampodefosfatosdepotssio0,1M,pH7,4(TFK0,1MpH
7,4),passandoasuspensocelularparatubosfalconde50mLecentrifugandoa4000rpm,1
min (centrfuga Sigma 302). Os sedimentos celulares obtidos foram congelados em azoto
lquido e guardados a 80 C at se proceder extraco dos lpidos totais.Para a extraco
dos lpidos totais, os sedimentos celulares foram ressuspendidos num total de 30 mL de
tampo TFK 0,1M pH 7,4. Transferiuse os ressuspendidos para um tubo do rotor JA20
(centrfugaBeckmanJ221M/E)ecentrifugousea8000rpm(5000xg),10min.Adicionouse
aosedimento1,5mLdesoluotampoTFK0,1MpH7,4,2volumesdeglassbeadse15lde
PMSF. Vortexouse 3x durante 2 min, alternando com colocao no gelo. Diluiuse 2x
(adicionando3mLdetampoTFK)emisturousenovortex.Centrifugousea2500rpm(530x
g),20min,norotorJA20.
Apsesteprocesso,recolheuseosobrenadanteparaumaprovetaesmeriladade100
mL, medindo o volume exacto de extracto recolhido, de forma a procederse extraco de
33

lpidos de acordo com o mtodo de Folch. Antes de se proceder extraco retirouse 50 L


paraumtuboeppendorfecongelousea80C,paraumaposteriorquantificaodeprotena
pelomtodo dePeterson. Aosobrenadantenaprovetaadicionouseclorofrmio:metanol 2:1
(v/v)numaproporo1:20(20xovolumedoextracto).Filtrousecomumfiltrodeseparao
de fases (1PS Whatman) para outra proveta esmerilada de 100 mL. Adicionouse KCl 0,88%
(v/v)numvolumecorrespondentea20%dovolumetotaldefiltrado.Agitousebem,aliviando
a presso. Saturouse com atmosfera de azoto e deixouse as fases orgnica e aquosa a
separar durante cerca de 16h a 20 C. Removeuse cuidadosamente a maior parte da fase
superior(aquosa)trompa.Lavouse2xasparedesdaprovetacommetanol:H
2
O:clorofrmio
(48:47:3) cuidadosamentedemodoanoperturbar asfases.Retirousetodaafaseaquosa
trompacommuitocuidadodemodoanoperturbaraseparaodefases.Afaseorgnicafoi
evaporadasobfluxosuavedeazoto.

III.3.6.2. SeparaodoslpidosporTLCbidimensional

Oslpidos totaisforamanalisadosporTLCbidimensionaldeacordocomomtodode
Connerthecolaboradores(Connerthetal.,2009).Activouseumaplacadeslicagel20cmx20
cmparaTLC(Fluka99570)numaestufaa110Cdurante30min.Ressuspendeuseoextracto
lipdicoem100Ldeclorofrmio:metanol(1:1).Aplicouse80Ldoextractonocantoinferior
esquerdo da placa com a ajuda de um capilar de vidro. Guardouse os restantes 20 L para
quantificao de fosfatos totais. Desenvolveuse o cromatograma na primeira dimenso
usando o sistema de eluentes clorofrmio:metanol:amnia (65:35:5). Retirouse a placa da
cmara de eluio e deixouse secar muito bem ao ar na hotte. Rodouse a placa 90 para a
esquerda e desenvolveuse o cromatograma na segunda dimenso usando o sistema de
solventes clorofrmio:acetona:metanol:cido actico:gua (50:20:10:10:5). Aps secagem da
placa revelouse por exposio a iodo. Marcouse as manchas correspondentes aos vrios
fosfatoscomoauxliodeumlpisdeTLC,paraposteriorrecuperaodaplaca.

III.3.6.3. Quantificaodosfosfatos

OsnveisdefsforonosfosfolpidosseparadosporTLCforamdeterminadosusandoo
ensaio de Bartlett (Dittmer and Wells, 1969). Retirouse as pores de slica onde se
34

encontravam as manchas correspondentes a cada um dos fosfolpidos e transferiuse para


tubos de ensaio novos. Retirouse 3 pores de slica de regies onde no eram visveis
manchas correspondentes a fosfolpidos para utilizar como branco. Preparouse amostras
padrocontendo0,20,40,60,80,100e120LdeumasoluoNaH
2
PO
4
0,5mM.Adicionou
se a todos os tubos (padres e amostras com slica) 0,3 mL de cido perclrico 70% (v/v).
Aqueceramseasamostrasdurante45mina170Cnumbanhodeareia.Adicionouse1mLde
guadestilada,400Ldeumasoluodemolibdatodeamnio1,24%(m/v)e400Ldecido
ascrbico 5% (m/v) a todos os tubos (padres e amostras). Aqueceramse todos os tubos
durante 5 min a 100 C. Deixouse sedimentar a slica dos tubos das amostras e transferiuse
1,5 mL para tubos falcon de 15 mL. Centrifugouse durante 20 min a 2 500 rpm numa
centrfugaHettichRotofix32.Recolheuse1mLdosobrenadante,commuitocuidadoparano
arrastaraslica,emediuseaabsorvnciadecadaumadasamostrasedassoluespadroa
797nmnumespectrofotmetroCamspecM350DoubleBeamUVVisible.

III.3.7. QuantificaodosextractosproteicospeloMtododePeterson

A concentrao de protena nos extractos proteicos foi determinada pelo mtodo de


Peterson(Peterson,1977),umamodificaodomtodoinicialmentepropostoporLowry.
Paraodoseamentoproteicoadicionouse100Ldeextractoproteico(diludo1/40no
caso das amostras a analisar por TLC ou 1/75 no caso das amostras para dosear o inositol) a
900Lde H
2
O,aoqualseadicionou1 mLdereagente de cobre etartarato constitudo por 1
volume de CuSO
4
:5H
2
O 0,1% (m/v), tartarato de sdio 0,2% (m/v) e Na
2
CO
3
a 10% (m/v), 2
volumes de SDS 5% (m/v) e 1 volume de NaOH 0,8 M. Agitouse e esperouse 10 min.
Seguidamente, adicionouse o reagente de Folin diludo 1/7 a todos os tubos e agitouse de
imediato. Passada 1 hora, leuse a absorvncia a 750 nm num espectrofotmetro Camspec
M350 Double Beam UVVisible. A curva padro foi feita adicionando volumes adequados de
uma soluo de BSA 0,1 mg/mL ao volume de H
2
O necessrio para perfazer 1 mL ao qual se
adicionou1mL,demodoaobterpadrescomasconcentraesde10,20,30,40e50g/mL.
Deseguida,adicionouse1mLdoreagentedecobreetartaratoeprocedeusecomodescrito
paraasamostras.Asamostraseospadresforamfeitosemtriplicado.

35

III.3.8. PCRquantitativoemtemporeal(RealtimeQPCR)

A transcrio reversa seguida de PCR quantitativo (quantitative polymerase chain


reaction),ouQPCR,ummtodobastantesensvelparaquantificaodetranscritosgnicos
(Udvardietal.,2008),podendodetectarvariaesmuitopequenasnaexpressognica(Nailis
et al., 2006). A disponibilidade de fluorforos de ligao especfica a dsDNA, tais como SYBR
Green, e de aparelhos de PCR em tempo real (realtime PCR) para placas de 384 poos que
permitem medir fluorescncia no final de cada ciclo de PCR, possibilita a realizao de QPCR
paracentenasdegenesemparalelo.Devidopreciso,sensibilidadeeflexibilidadedatcnica,
esteomtododeeleiodamaioriadoslaboratriosparamedirosnveisdemRNA(Udvardi
etal.,2008).
No presente trabalho experimental a quantificao dos mRNA foi feita por PCR
quantitativo em tempo real (realtime QPCR) em dois passos, onde o produto de uma nica
reaco de PCR usado como template em mltiplas reaces de PCR. Usouse um
procedimento de isolamento de RNA de forma a que se produzisse RNA total de grande
qualidade (kit da AMBION) a partir de todas as amostras a serem analisadas. Seguidamente,
digeriuse o RNA purificado com DNase I para remover o DNA genmico contaminante, que
pode actuar como template durante a reaco de PCR. Confirmouse a inexistncia de DNA
genmico nas amostras de RNA tratadas aps uma reaco de amplificao por PCR usando
um par de primers que amplificam apenas sequncias de DNA. A anlise dos produtos
resultantes foi feita por separao electrofortica num gel de agarose de elevada resoluo.
Aps este processo, partiuse para a sntese da primeira cadeia de cDNA por transcrio
reversa,usandoRevertAid
TM
HMinusReverseTranscriptase(Fermentas).AsntesedocDNAfoi
confirmadaapsumareacodeamplificaoporPCRusandoumparde primersespecficos
para amplificao apenas de sequncias de DNA e os produtos resultantes foram novamente
analisados por separao electrofortica num gel de agarose de elevada resoluo. O cDNA
obtido no processo anterior foi finalmente analisado por QPCR em tempo real, usando os
primers especficos (sequncias determinadas com o auxlio do software Primer Express 3.0)
para a quantificao dos transcritos dos genes em estudo, tendo as reaces de amplificao
decorridonapresenadeBrilliantSYBRGreenMasaterMix(Stratagene).FoiusadoSYBRGreen
para monitorizar a sntese de DNA visto ser um fluorforo que se liga a dsDNA mas no a
ssDNA,equandoseligaadsDNAfluorescecomgrandeintensidadeaumentandoarazoentre
afluorescncianapresenadedsDNArelativamentefluorescncianapresenadessDNA.

36

III.3.8.1. PreparaodoRNAtotaldaleveduraS.cerevisiae

A preparao do RNA total foi feita usando o kit da AMBION para extraco de RNA
totaldeleveduraS.cerevisiae,deacordocomoprotocolodosfornecedores.
O RNA total foi preparado a partir de 75 mL de cultura a 0,15 OD
600
/mL em fase
exponencialdecrescimento,semoucomadaptaodasclulasa150MdeH
2
O
2
emestado
estacionrio. As clulas foram recolhidas por centrifugao a 4 000 rpm, durante 1 min,
temperaturaambiente,nacentrfugaSigma302.Apslavagemdosedimentocomguaestril
epassadoparaumtuboeppendorf,foicongeladocomazotolquidoeguardadoa80C.
Ao tubo com o sedimento de clulas adicionouse as seguintes solues, pela ordem
apresentada: 480 L da soluo de lise, 48 L de SDS 10% (m/v) e 480 L da soluo
fenol:clorofrmio:lcool isoamlico, sendo as clulas completamente lisadas aps a adio de
750LdebeadsZirconiaeagitadasnumvortexdurante10min.Seguidamente,centrifugouse
a suspenso celular a 16 000 x g durante 5 min temperatura ambiente na centrfuga
EppendorfminiSpinetransferiuse400Ldafaseaquosaparatubosfalconfrescosde15mL.
Adicionouse 1,4 mL de tampo de ligao fase aquosa, misturouse bem e de seguida
adicionouse940Ldeetanolabsoluto.Aplicouse700LdamisturaaoFilterCartridgejunto
ao tubo de recolha e centrifugouse durante 0,5 1 min velocidade mxima na centrfuga
EppendorfminiSpinatamisturapassarpelofiltro.Deitouseforaoeludoerepetiusetodoo
processoatacabarasoluo.Porfim,lavouseofiltrocom700Ldesoluodelavagem1e
centrifugouse durante 1 min, nas mesmas condies. Lavouse o filtro 2x com 500 L da
soluodelavagem2/3.Centrifugousedurante1minpararemoveroexcessodesoluode
lavagem.ORNAfoieludodoFilterCartridgeparaumtuboderecolhanovo,aplicando2x50
Ldesoluodeeluioaquecidaecentrifugandodurante1minentrecadaaplicao.
A quantificao do RNA efectuouse recorrendo ao sistema de quantificao
NanoDrop.

III.3.8.2. TratamentocomDNaseI

Para remover o DNA genmico contaminante que pudesse ainda estar presente no
extracto de RNA, fezse um tratamento com DNase I (Desoxirribonuclease I) que degrada
ssDNAedsDNAnodesejado.
37

Para o tratamento de 2 g do RNA total preparado em III.3.8.1. com DNase I, num


volume final de 20 L, adicionouse 2 L da soluo tampo de DNase buffer 10x e 2 L de
DNase I (Fermentas). Incubouse a mistura a 37 C durante 30 min. Aps esse tempo,
adicionouse 1 L de EDTA 25 M e incubouse a 65 C durante 10 min. As amostras foram
guardadas a 80 C para posterior utilizao na sntese de cDNA, aps confirmao da
ausnciadeDNAemcadaamostra.

III.3.8.3. AmplificaodeumasequnciadecidosnucleicosporPCR

A ausncia de DNA nas amostras tratadas com DNase I foi confirmada aps uma
reacodeamplificaoporPCRusandoumpardeprimersqueapenasamplificamsequncias
de DNA. Escolheuse a sequncia do gene ZWF1, que codifica para o 6fosfato de glucose
desidrogenase,paraaconfirmaoanterior.

Quadro3SequnciasnucleotdicasdosprimersutilizadosparaasreacesdeamplificaoPCRdofragmentodo
geneZWF1.
Gene
Nome
primer
Tamanho
primer(nt)
T
m
(C) Sequncia(53) Tamanhodofragmento
amplificado(pb)
ZWF1
ZWF1F
ZWF1R
21
22
66
66
CCAGAGGCTTACGAGGTGTTG
GGGTGCTTTTCGGGCATAACAT
227

Obtevese a mistura reaccional juntando 200 ng de DNA genmico de S. cerevisiae


(controlopositivo)ou1LdoRNAtratadocomDNaseIa5Ldecadaumdosprimersauma
concentraofinalde1pmol/mL,3,76LdedNTPcomumaconcentraofinalde150M,10
Ldasoluotampocompleta,comumaconcentraofinaldeMgCl
2
de2,5mM,1LdeTaq
polimerase e adicionando H
2
O estril para um volume final de 50 L. A reaco de
amplificaoocorreuem30ciclosnumaparelhodePCR,PTC100PeltierThermalCyclerdaRJ
Recharch,sendoque,emcadaciclo,adesnaturaoocorriaa95Cdurante1min,oannealing
a55Cdurante1mineaextensoa72Cdurante1,5min,apsumadesnaturaoiniciala
95Cdurante4min.
38

Aps a amplificao, procedeuse anlise de 15 L dos produtos resultantes da


reaco de amplificao por electroforese num gel de agarose a 2% (m/v), utilizando como
tampo de electroforese a soluo TAE 1x concentrada (TrisHCl 0,4 M pH 7,9, NaAc 1 mM e
EDTANa
2
1 mM) contendo BrEt a 0,2 g/mL. Aps a separao electrofortica a 80 V durante
cerca de 1 hora, o gel foi irradiado com UV e fotografado de modo a averiguar se ocorrera
formaode produto,seestepossuaotamanho correspondente aofragmentopretendidoe
seapenassetinhaformadoumproduto.

III.3.8.4. Sntese da primeira cadeia de cDNA usando RevertAid


TM
H Minus Reverse
Transcriptase(Fermentas)

Para um volume final de reaco de 12 L usouse 1 g de RNA total tratado com


DNaseI,1Lderandomhexamerprimers(100M;0,2g/L),ecompletouseovolumecom
guadestilada.Aqueceuseamisturaat65Cdurante5min,colocandoaposteriormenteno
gelo.Fezseumspindownrpidoeadicionouseasseguintessoluesporestaordem:4Lde
tampodereaco5x,1LdeinibidordeRNaseRiboLock(20unid/L),2Ldeumamistura
de dNTP (10 mM cada) e 1 L RevertAid H Minus Reverse Transcriptase (200 U/L). O
contedo foi gentilmente misturado e centrifugado, procedendose, posteriormente, a uma
incubao a 25 C durante 10 min. Incubouse novamente a mistura de reaco mas a 45 C
durante60mineinactivouseoenzimaaquecendoamisturaa70Cdurante10min.Porfim,
adicionouse40LdeH
2
Oacadareacoeguardaramseasamostrasa20Cduranteuma
semanaoua80Cpormaistempo.
A sntese do cDNA foi confirmada aps uma reaco de amplificao por PCR usando
um par de primers especficos para a amplificao de uma sequncia do gene ZWF1, tal com
descrito em III.3.8.3. Neste caso, analisouse no gel de agarose apenas 1 L do produto de
reacodePCR.

III.3.8.5. AnliseporPCRquantitativoemtemporeal(RealtimeQPCR)

O cDNA obtido no ponto anterior foi analisado por PCR quantitativo em tempo real
(Realtime QPCR) usando o termociclador Mx3000P QPCR e o software MXPRO
TM
QPCR
(Stratagene, LaJolla, CA). No Quadro 4 encontramse as sequncias nucleotdicas dos primers
39

utilizadosparaaquantificaodaexpressodosgenesemestudo.Assequnciasdosprimers
foramdeterminadasutilizandoosoftwarePrimerExpress3.0.

Quadro4SequnciasnucleotdicasdosprimersutilizadosparaasreacesdeamplificaoporPCRquantitativo
emtemporeal.
Gene
Nome
primer
Sequncia
(53)
URA7
URA7F
URA7R
ATTTAGGCAAAACCGTGCAAA
CCACGCGCTCAATCCAAT
GPT2
GPT2F
GPT2R
TTCTCATGACCGTCCTTCGTT
ACTGCGCCCAGAGCCATA
INM1
INM1F
INM1R
ACCGTGATTACTGATGATCCTACCT
CGCCTACTACGGGCTCTTTG
INO1
INO1F
INO1R
TGGACGAGTATTACAGTGAGTTGATG
AGCCAGTAAAGAATCTTCGCAAA
PIS1
PIS1F
PIS1R
GTTTCCCTGGTTACGTGTTCAAG
TGGCATCGTTGTCTGCTAAAA
ITR1
ITR1F
ITR1R
TGTCATTGGCGCAATCTTACA
ACCGAAACCCATGATCAGTCTAC
U2
U2F
U2R
GCTTTCTGTTTCTCCCTTAGTTTGG
AATCCCGCGTTGGACATAAA
CDS1
CDS1F
CDS1R
CCACCTCAAAGGCGATTGA
CGGCGTGACGGATTCG
CHO1
CHO1F
CHO1R
CATTAAGCAGAAGGGCCTCAA
TGATGTTCGTCACTTGTAAATTTTTG

INO2
INO2F
INO2R
GCAGATGTGCCAACTGAGTTCA
GGCGGGTTGTAGTGGTCATT

AsreacesdeamplificaodecorreramnapresenadeBrilliantSYBRGreenMasater
Mix (Stratagene), num aparelho de PCR Applied Biosystems 7900HT Fast RealTime PCR
System,segundooesquemaapresentadonoQuadro5.

40

Quadro5ProgramadeamplificaoutilizadonasreacesdeamplificaoporPCRquantitativoemtemporeal.
Etapa Programadeamplificao
Activaodoenzima 95C,10min
Amplificao (95C,15seg;60C,60seg)x40ciclos
Finalizao 4C

A quantificao dos nveis de mRNA foi feita com o auxlio do SDS Software 2.3 da
AppliedBiosystems,tendoosvaloressidonormalizadosrelativamenteaosnveisdetranscrito
U2naamostra(controlointerno).

III.3.9. DoseamentodoInositolIntracelular

III.3.9.1. Obtenodeextractostotais

Os extractos totais para o doseamento do inositol foram obtidos de acordo com o


mtodo descrito por Azab e colaboradores (Azab et al., 2009), com algumas modificaes.
Inoculouse 1500 mL de meio SC a partir de uma prcultura da estirpe wt, a uma densidade
celular de 0,03 OD
600
/mL e recolheuse as clulas a 0,15 OD
600
/mL, aps vrios tempos de
adaptao das clulas com 150 M de H
2
O
2
(5 e 10 min) ou sem adaptao. As clulas
equivalentes a 500 mL de cultura foram recolhidas com o auxlio de um sistema de vcuo,
atravsdeumamembranaMilliporeTYPEHA0,45m.Apsfiltrao,asclulasfiltradasforam
ressuspendidas em cerca de 20 mL de gua estril, passando a suspenso celular para tubos
falcon de 50 mL e centrifugando a 4 000 rpm, 1 min (centrfuga Sigma 302). Os sedimentos
celularesobtidosforamcongeladosemazotolquidoeguardadosa80Catseproceder
extraco.Ressuspendeuseossedimentoscelularesem1mLdeguaepassouseparatubos
eppendorf.Centrifugousea7000rpmdurante2min(centrfugaEppendorfminiSpin).Lavou
se 3 vezes com gua, centrifugando entre cada lavagem. Ressuspendeuse o sedimento final
em750Ldegua.Adicionouseesferasdevidro(~50%volumedasuspenso)evortexouse
cada amostra 30 vezes em ciclos de 1 min, intercalando com 2 min em gelo. Os extractos
41

celularesforamclarificadosporcentrifugao:2min,3500rpm, 4C(centrfugaSigma4K10
refrigerada Rotor eppendorf 5804 R); transferiuse os sobrenadantes para novos tubos
eppendorferecentrifugousedurante15mina12000rpmnamesmacentrfuga.Recolheuse
ossobrenadanteseconservousea4C.Doextractoobtido,retirouseumaalquotade50L
paraquantificaoproteicapelomtododePeterson.

III.3.9.2. Tratamentodoextractocelular

III.3.9.2.1. Precipitaodaprotena

Deformaaeliminartoda aprotenadasamostras,procedeuseaotratamentodestas
com cido perclrico de acordo com o mtodo descrito por Ashizawa e colaboradores
(Ashizawaetal.,2000).
Tendo em conta que para cada ensaio so precisos um branco e trs replicados (4
amostrasnototal),parasaberovolumedeextractoasubmeteraotratamentodeformaaque
acadaumadasamostrascorrespondessem1500gdeprotena,procedeuseprimeiramente
quantificao proteica pelo Mtodo de Peterson. Esta massa de protena foi calculada de
forma a terse uma quantidade de inositol possvel de ser medida pelo mtodo de Ashisawa,
dadoqueasensibilidadedomtodomuitobaixa(>2nmoldeinositol).
Cada125Ldeamostra(ondesecompletacomguaaalquotadeextractorecolhida
equivalente a 1500 g de protena) foram desproteinizados com 125 L de cido perclrico
16%(p/v),sendotudocentrifugadoa5000xgdurante10min,a4C(centrfugaSigma4K10
refrigerada Rotor eppendorf 5804 R). Os sobrenadantes foram neutralizados com 65 L de
K
2
CO
3
2Mecentrifugadosnovamente.

III.3.9.2.2. CromatografiadeTrocaInica

Para medir apenas inositol (por 1500 g de protena) no ensaio espectrofotomtrico,


as amostras desproteinizadas foram resolvidas numa coluna de troca inica, de forma a
recolherseapenasoinositol,ficandoosrestantescontaminantesretidosnacoluna,deacordo
comomtododescritoporMaslanskieBusa(MaslanskiandBusa,1990).
42

Antesdaprimeirautilizao,ascolunasforamlavadascomgua(aproximadamente5
vezesovolumetotaldacoluna).
As amostras desproteinizadas foram diludas em 5 mL de gua estril e aplicadas a
umacolunadetrocainica(contendoaproximadamente2mLderesinaDowex50W200400
mesh),tendoserecolhidooeludo.Lavouseacolunacom10mLdeguaestrilerecolheuse
novamenteoeludo.Asamostrasforamconservadasa4C.

III.3.9.2.3. Liofilizao

As amostras obtidas aps cromatografia foram congeladas em azoto lquido e


colocadasnumliofilizadordurante36horas,parasecaremtotalmente.

III.3.9.2.4. Remoodainterfernciadaglucose

As amostras liofilizadas foram incubadas com 50 L de uma soluo de hexocinase


[200 mM tampo TrisHCl, 400 mM trifosfato de adenosina disdico (ATP2Na) (o pH da
soluofoiajustadoa8,6pelaadiode10MNaOH)e115U/mLhexokinase],durante1hora
a37Cparaeliminaraglucose(queinterferecomoensaio)(Ashizawaetal.,2000),tendosido
a reaco terminada por incubao a 100 C durante 3 min. As amostras foram depois
colocadasa4C.
A quantidade de inositol foi determinada pelo mtodo espectrofotomtrico descrito
porAshizawaecolaboradores(Ashizawaetal.,2000).

III.3.9.3. Mtodoenzimticoespectrofotomtricodedoseamentodoinositol

Os nveis de inositol intracelulares foram determinados tendo por base o mtodo


descrito por Ashizawa e colaboradores (Ashizawa et al., 2000), com algumas modificaes.
Tratasedeummtodoespectrofotomtricoenzimtico.Baseiasenaoxidaodomioinositol
(MI) e na reduo do NAD
+
pelo enzima mioinositol desidrogenase (MIDH), acoplado
reacocatalisadapeloenzimadiaforasequeconverteocloretodeiodonitrotetrazlio(INT)a
43

formazan,reoxidandoseoNADH.Oformazanresultantemedidoespectrofotometricamente
a492nm(Figura11).

Figura 11 Esquema reaccional do mtodo espectrofotomtrico enzimtico de doseamento do inositol


intracelular.Omioinositol(MI)oxidadopeloenzimamioinositoldesidrogenase(MIDH),sendooNAD+reduzido.
Na reaco acoplada o substrato cloreto de iodonitrotetrazlio (INT) convertido a formazan, cuja formao
seguidaespectrofotometricamentea492nm,sendooNADHreoxidado.Adaptadode(Ashizawaetal.,2000).

As medies foram feitas em microplacas de 96 poos. Misturouse 50 L de soluo


padro ou extracto celular tratado com 50 L de reagente MI (constitudo pelos seguintes
componentes nas concentraes finais indicadas: tampo 210 mM hidrocloreto de
trietanolamina 32 mM K
2
HPO
4
KOH (pH 8.6), 1.2% (v/v) Triton X100, 10 mM NAD, 1.0
U/mLdiaforase,0.1%(p/v)albuminadesorobovinoBSA,2mMINT).Diluiuseamisturaem
100Ldotampo210mMhidrocloretodetrietanolamina32mMK
2
HPO
4
KOH(pH8.6),no
sentidoderesolverumproblemacomasolubilizaodoprodutoINT.Seguiuseaevoluoda
absorvncia da soluo a 492 nm durante breves instantes. Depois, iniciouse a reaco pela
adio de 5 L da soluo MIDH 2,1 U/mL, dissolvido em tampo de fosfatos de potssio 20
mM(pH7,0)(TFK),acadapoo(exceptoaospoosdosbrancos).Deixouseamisturaa25Ce
fezsemediesdeabsorvnciaa492nmaolongodotempoatqueareacoterminasse.A
partirdaAbs
492nm
calculouseocontedoemMI.
Foi preparada uma curva de calibrao com vrios padres de MI na gama de
concentraespretendida(120nmolinositol),tendoseseguidoaevoluodaAbs
492nm
aps
adiodoenzimaMIDHatareacofinalizar.
Todasasmediesforamrealizadasemtriplicado.Osbrancosdospadresdacurvade
calibrao e dos extractos celulares consistiram em amostras submetidas ao mesmo
tratamentodasamostrasnormais,massquaisnofoiadicionadoMIDH.
O aumento da Abs
492nm
devido formao de Formazan, por converso do inositol
devidaacodoMIDH(Abs
492nm
),foicalculadosegundoaEquao3.

mioinositol mioinosose
MIDH
NAD
+
NADH
Formazan INT
Diaforase
44

Equao3
Abs
492nm
= (Abs
492nm ]nuI
-Abs
492nm ncuI
)
umostu
-(Abs
492nm ]nuI
-Abs
492nm ncuI
)
bunco

Aquantidadedeinositolnasamostras(nmolinositol/100gprotena)foicalculadapor
extrapolao dos valores de Abs
492nm
na curva de calibrao, efectuando as correces para
asdiluiesefectuadasecontabilizandoosgtotaisemcadaamostra.

III.3.10. Anliseestatstica

Osresultadosapresentadoscorrespondemmdia_desviopadrodenexperincias
independentes. A comparao de valores entre dois grupos distintos foi feita realizando o
testetdeStudentbilateral,assumindovarinciasiguaisentreosgrupos.Umvalordep<0,05
foi considerado estatisticamente significativo. Ambos os tratamentos foram realizados
recorrendoaoprogramaSigmaStatverso3.5.

45

IV. RESULTADOSEDISCUSSO

O objectivo central do presente trabalho consiste em compreender os mecanismos


molecularesenvolvidosnaregulaodogeneFAS1induzidospeloH
2
O
2
.propostoqueoH
2
O
2

reprime a expresso do gene FAS1 por induo dos nveis de inositol. , portanto, essencial
quantificarosnveisdeinositolemclulascontroloeexpostasadosesadaptativasdeH
2
O
2
,no
sentido de observar se, de facto, o H
2
O
2
induz o aumento dos nveis de inositol
intracelularmente.
OsnveisdeinositoljforammedidosemS.cerevisiae(Azabetal.,2007),pelomtodo
fluorimtrico de Maslanski e Busa (Maslanski and Busa, 1990). No entanto, surgiram diversos
problemas para o reproduzir, nunca tendo sido obtidos resultados reprodutveis (ver IV.4.1).
Portanto, optouse pela optimizao de um mtodo espectrofotomtrico. Como houve uma
sriedeproblemas,tendoseconseguidoresultadosreprodutveisapenasnofinaldotrabalho
experimental,duranteaduraodoprojectoforamsidoadiantadastodasasrestantesetapas
propostas.
Assim, a ordem de trabalhos proposta nos objectivos foi alterada. So, portanto,
apresentados primeiramente os resultados referentes translocao da protena Opi1p do
retculo endoplasmtico para o ncleo das clulas quando submetidas a 150 M de H
2
O
2
em
estadoestacionrio.Seguidamente,osresultadosrelativosquantificaodosfosfolpidose
expresso dos diversos transcritos regulados pelo inositol. Finalmente, os resultados
respeitantes ao doseamento do inositol, sendo inicialmente feita uma breve descrio da
optimizaodomtodo.

IV.1. TranslocaonucleardofactorGFPOpi1p

A translocao da protena Opi1p do retculo endoplasmtico (RE) para o ncleo das


clulas j foi observada em Saccharomyces cerevisiae, por microscopia de fluorescncia, por
Loewen e colaboradores (Loewen et al., 2004). Os autores recorreram a uma estirpe opi1
transformadacomumplasmdeoquepossuiumaregioGFPOpi1p.Submeteramasclulasa
uma dose de 100 M de inositol e recolheram imagens a vrios tempos de incubao. Nas
clulascontrolo(noincubadascominositol)observousefluorescnciaapenasnaperiferiado
ncleo, apontando para uma localizao da protena Opi1p ao nvel do retculo
46

endoplasmtico.Quandoasclulasforamsujeitasaumadosede100Mdeinositolobservou
seoaumentodaintensidadedefluorescncianoncleodasclulascomoaumentodotempo
deincubao.
O objectivo desta etapa do trabalho foi observar o mesmo tipo de translocao, mas
submetendo as clulas da estirpe opi1 + GFPOpi1p no a um aumento da dose de inositol
mas sim a uma dose de 150 M de H
2
O
2
em estado estacionrio, com o intuito de apoiar a
hiptese de que o H
2
O
2
induz o aumento dos nveis de inositol no interior das clulas.
importante referir que no presente trabalho experimental as clulas cresceram sempre na
presenade11Mdeinositol.

IV.1.1. Caracterizaodasestirpeswt,opi1eopi1+GFPOpi1p

Os estudos da adaptao de S. cerevisiae ao H


2
O
2
so normalmente feitos com as
clulas em fase exponencial de crescimento. Nesta fase as clulas encontramse em maior
actividademetablica,transcricionaletraducional,peloquearespostaadaptativaaostress
maisrobustaeeficaz(SousaLopesetal.,2004).
Como etapa inicial foi necessrio caracterizar as estirpes wt, opi1 e opi1 + GFP
Opi1p no que diz respeito ao seu perfil de crescimento, objectivo este conseguido atravs da
realizao das respectivas curvas de crescimento. A comparao do crescimento das estirpes
opi1eopi1+GFPOpi1pcomocrescimentodaestirpewtrelevante,umavezquepermite
analisar se tanto a mutao no gene OPI1 como a transformao tm efeitos no
funcionamento metablico e biolgico da levedura. Por outro lado, este estudo importante
dado que permite ter uma perspectiva do tempo que as culturas demoram a atingir as
diferentesfasesdecrescimento,permitindotambmdefinirascondiesdeadiodoH
2
O
2
s
clulasparaestabeleceroestadoestacionrio.Ascurvasdecrescimentodasestirpeswt,opi1
eopi1+GFPOpi1pencontramse,assim,apresentadasnaFigura12.
Analisandoacurvadecrescimentodasestirpeswt,opi1eopi1+GFPOpi1p(Figura
12), possvel observar um crescimento bastante lento nas primeiras 3 4 horas, onde as
clulasseencontramemadaptaoaosnutrientesexistentesnomeiodeculturafaselag.A
fase de crescimento exponencial foi observada entre as 4 e 13 horas de crescimento, sendo
que a partir desse perodo atingida a fase estacionria com um valor mximo de densidade
celular varivel de estirpe para estirpe. A estirpe wt atinge um valor de densidade celular
mxima de 3,5 OD
600
/mL. A estirpe opi1 atinge valores de densidade celular superiores (3,8
47

OD
600
/mL) aos da estirpe wt quando atinge a fase estacionria, enquanto a estirpe opi1 +
GFPOpi1patingevaloresinferiores(2,9OD
600
/mL),estatisticamentediferentesdosdaestirpe
wt(Figura12).

Figura12Representaodascurvasdecrescimentodasestirpeswt,opi1eopi1+GFPOpi1p.Representao
grficadeOD
600
/mLvs.tempo(min)paraasestirpes: estirpewt; estirpeopi1; estirpeopi1+GFPOpi1p.
Para cada ensaio foram inoculadas culturas a 0,03 OD
600
/mL (1 OD
600
/mL ~ 2 x 10
7
clulas/mL), a partir de pr
culturas,colocadasacrescera30Ce160rpmnumagitadororbital,sendooseucrescimentoseguidomedindoa
densidadepticaa600nm.Ospontosexperimentaiscorrespondemmdia_desviopadrodasleiturasobtidas
emcincoexperinciasindependentes.Foiconsideradoestatisticamentesignificativoumvalordep<0.05.

AtravsdalinearizaodosvaloresdeOD
600
/mLvs.tempo(min)foramdeterminadosa
taxa de crescimento especfico () e o tempo de gerao (t
g
) a partir da fase exponencial de
crescimento, para as trs estirpes. Os valores calculados para as diferentes estirpes
encontramseapresentadosnoQuadro6erepresentadosgraficamentenaFigura13.

Quadro6Valoresde(taxadecrescimentoespecfico)et
g
(tempodegerao)calculadosparaasestirpeswt,
opi1 e opi1 + GFPOpi1p, a partir das respectivas curvas de crescimento. Os resultados apresentados
correspondem mdia _ desvio padro de cinco experincias independentes. Foi considerado estatisticamente
significativoumvalordep<0.05.
(min
1
) t
g
(min)
wt 0,00759_0,000617 91,810_6,839
opi1 0,00651_0,000639 107,196_9,813
opi1+GFPOpi1p 0,00597_0,000560 116,927_10,708

0,0
1,0
2,0
3,0
4,0
0 500 1000 1500 2000
O
D
6
0
0
/
m
L
Tempo (min)
48

A B

Figura13Representaogrficadosvaloresdetaxadecrescimentoespecficoetempodegeraocalculados
paraasestirpeswt,opi1 eopi1 +GFPOpi1p.Representaogrficadosvaloresde(A)(taxadecrescimento
especfico) e (B) t
g
(tempo de gerao) calculados para as estirpes wt, opi1 e opi1 + GFPOpi1p, com base nas
respectivas curvas de crescimento. Os resultados apresentados correspondem mdia _ desvio padro de cinco
experinciasindependentes.*p<0.05vs.wt.

Tal como j havia sido observado em estudos anteriores, a estirpe wt demora


aproximadamente 90 min a duplicar a sua populao (t
g
= 91,810 _ 6,839 min). Esperavase
que a introduo da mutao (opi1) acarretasse consequncias no funcionamento
metablicoe,consequentemente,nocrescimento,factoessequeseverificouvistohaveruma
diminuiodataxadecrescimentoespecficoeumaumentodotempodegerao(Quadro6e
Figura13),assimcomooaumentodovalormximodedensidadecelularqueaestirpeatinge
emfaseestacionria(Figura12).ComatransformaoereintroduodeOpi1p,esperarseia
recuperarafuncionalidadeperdidacomaintroduodamutao,esperandoobtersevalores
detaxadecrescimentoedetempodegeraosemelhantesaosobservadosparaaestirpewt.
Istonoseverificou,tendoseobtidovaloresdetaxadecrescimentoaindamaisbaixosqueos
da estirpe opi1 e valores de tempo de gerao mais elevados (Quadro 6 e Figura 13), assim
como um valor mximo de densidade celular em fase estacionria inferior ao da estirpe wt.
Este fenmeno pode ser explicado pelo facto de as clulas estarem transformadas com um
plasmdeonointegrativomulticpia.DestatransformaoresultamelevadosnveisdeOpi1p
na clula, que podero afectam negativamente as vias que dependem da regulao desta
protena.

0,000
0,002
0,004
0,006
0,008
0,010
wt opi1 opi1+GFP-Opi1p

(
m
i
n
-
1
)
0
20
40
60
80
100
120
140
160
wt opi1 opi1+GFP-Opi1p
t
g
(
m
i
n
)
49

IV.1.2. Optimizao das condies para estabelecer o estado estacionrio de


H
2
O
2

Paraestabeleceroestadoestacionriode150MdeH
2
O
2
foinecessriodeterminara
constantedeconsumodeH
2
O
2
pelasclulasintactaseaactividadedoenzimaglucoseoxidase
nomeiodecultura,demodoqueaproduodeH
2
O
2
peloglucoseoxidaseigualeoconsumo
pelasclulas.
Desta forma, comeou por determinarse a actividade do enzima glucose oxidase no
meiodecultura(meioSC)parasaberqualaquantidadenecessriaaadicionarsculturaspara
contrabalanaroconsumodeH
2
O
2
pelasclulas.

IV.1.2.1. Actividadedoenzimaglucoseoxidase

A actividade do enzima glucose oxidase no meio SC foi determinada conforme


explicado em III.3.4. Determinouse uma actividade de 27,392 M/min, correspondente ao
declive da recta ajustada aos pontos do grfico da [H
2
O
2
] (M) vs tempo (min). Tendo em
conta os volumes reaccionais obtevese uma actividade especfica de 5,478 x 10
3

mol/min/L.

IV.1.2.2. ConsumodeH
2
O
2
pelasclulasintactas

A determinao do consumo de H
2
O
2
pelas clulas intactas foi feita de acordo com o
procedimentoreferidoemIII.3.3.Osvaloresdasconstantedeconsumok(min
1
)edeconsumo
de H
2
O
2
(min
1
.(OD/mL)
1
) obtidos, considerando a normalizao referida encontramse
apresentadosnoQuadro7erepresentadosnaFigura14.
Analisando os valores de consumo de H
2
O
2
para as estirpes wt, opi1 e opi1 + GFP
Opi1p, apresentados no Quadro 7 e representados na Figura 14, pode observarse que as
clulas mutadas opi1 consomem H
2
O
2
a uma velocidade menor, o que pode ser justificado
pelaintroduodamutao,queinterferecomometabolismocelular,nomeadamentecomo
metabolismo dos fosfolpidos. Relativamente estirpe opi1 + GFPOpi1p esperarseia, mais
uma vez, observar um comportamento semelhante ao da estirpe wt, o que no se verificou
possivelmente devido ao facto de as clulas estarem transformadas com plasmdeo no
50

integrativomulticpia,estandopresenteumaconcentraodaprotenaOpi1pmaiorque nas
clulas controlo, o que pode estar a influenciar negativamente, por exemplo, o metabolismo
dealgunsfosfolpidos.

Quadro7ConsumodeH
2
O
2
(min
1
.(OD/mL)
1
)econstantesdeconsumok(min
1
)determinadosparaasestirpes
wt, opi1 e opi1 + GFPOpi1p. Os resultados do consumo de H
2
O
2
(min
1
.(OD/mL)
1
) correspondem media _
desvio padro de pelo menos trs experincias independentes considerando as OD/mL medidas no incio de cada
ensaio (varivel de dia para dia). As constantes de consumo k (min
1
) foram calculadas com base nos consumos
(min
1
.(OD/mL)
1
) considerando 0,15 OD
600
/mL como densidade celular representativa de todos os ensaios. Foi
consideradoestatisticamentesignificativoumvalordep<0.05.

wt opi1 opi1+GFPOpi1p
k(min
1
) 0,015 0,013 0,009
ConsumodeH
2
O
2
(min
1
.(OD/mL)
1
) 0,098 _ 0,009 0,089 _ 0,005 0,063_0,003

Figura14RepresentaodosvaloresdoconsumodeH
2
O
2
(min
1
.(OD/mL)
1
)paraasestirpeswt,opi1eopi1+
GFPOpi1p. Os resultados do consumo de H
2
O
2
(min
1
.(OD/mL)
1
) correspondem media_ desvio padro de pelo
menostrsexperinciasindependentes.*p<0,05vs.wt.

Para uma melhor compreenso destes resultados seria interessante comparar a


actividade dos enzimas que catalisam a remoo do H
2
O
2
, catalase e glutationo peroxidase,
para as diferentes estirpes. Se as actividades enzimticas referidas fossem semelhantes entre
asestirpes,osdiferentesconsumosdeH
2
O
2
observadospodemserjustificadospeloexplicado
anteriormente. No entanto, as diferenas de consumo observadas para as diferentes estirpes
0
0,02
0,04
0,06
0,08
0,1
0,12
wt opi1 opi1+ GFP-Opi1p
C
o
n
s
u
m
o

d
e

H
2
O
2
m
i
n
-
1
.
(
O
D
/
m
L
)
-
1
51

podem indiciar diferentes actividades de catalase e glutationo peroxidase. O aumento de


actividadedestesenzimaspoderindicarumadesrepressodosgenesenvolvidosnaresposta
ao H
2
O
2
e que afectam a permeabilidade da membrana plasmtica a este agente. Nestas
condies, a membrana das clulas de S. cerevisiae tornase mais impermevel ao H
2
O
2
,
justificandoadiminuiodeconsumodeH
2
O
2
observada.

IV.1.2.3. Clculo dos volumes de glucose oxidase e H


2
O
2
para estabelecer o Estado
EstacionriodeH
2
O
2

ApartirdadeterminaoexperimentaldoconsumodeH
2
O
2
pelasclulasintactaseda
actividadedoenzimaglucoseoxidaseemmeioSC,foramdeterminadososvolumesdeglucose
oxidase a adicionar s culturas de modo a contrapor o consumo de H
2
O
2
pelas clulas, no
sentidodeseestabelecerumestadoestacionriode150MdeH
2
O
2
.

IV.1.3. Visualizao da translocao nuclear do factor GFPOpi1p por


microscopiadefluorescncia

Uma vez estabelecidas as condies de adio de 150 M de H


2
O
2
em estado
estacionrio cultura opi1 + GFPOpi1p, analisouse a translocao nuclear do factor GFP
Opi1p.
Recorrendo a microscopia de fluorescncia procedeuse visualizao da protena
Opi1pGFP em clulas opi1 + GFPOpi1p controlo e sujeitas a uma dose de 150 M de H
2
O
2

emestadoestacionrio.Deformaaterseumanootemporaldatranslocaodaprotenado
retculo endoplasmtico para o ncleo das clulas foram recolhidas imagens a vrios tempos
deadaptao.
Paracadaensaio,antesdoinciodaadaptaodasclulasopi1+GFPOpi1p,foifeito
um controlo de autofluorescncia recorrendo estirpe opi1 no tido sido observada
fluorescnciaparaasclulasdestaestirpe(dadosnoapresentados).Relativamentesclulas
opi1+GFPOpi1pcontrolo,nosujeitasaincubaocomH
2
O
2
,foipossvelobservardeforma
clara a marcao apenas na periferia do ncleo (Figura 15A), indicando que a GFPOpi1p se
encontralocalizadaexternamentemembrananuclear.Quandosesubmeteuasclulasauma
dosede150MdeH
2
O
2
emestadoestacionrioobservouseumaumentodaintensidadede
fluorescncia no interior do ncleo com o aumento do tempo de incubao das clulas com

este
10 m
(Figu
fluore
15C).
fluore
eraj
a pro
quan

Figura
estado
(B) 10
indepe
das c
progr
de in
clula
obser
clula
ncle
da in
A
agente.Aos
min j come
ra 15B), se
escente nes
Aos 30 m
escentemen
bastantere
otena Opi1p
doexpostas

a 15 Microsco
o estacionrio.
0 min e (C) 20
endentes.

Para com
clulas quan
rama ImageJ
ntensidade d
a, passando
rvar dois pic
as controlo,
eo (Figura 16
tensidade d
A
5mindeinc
ou a observ
endo que o
te comparti
min j foi
te no ncleo
eduzido(dad
p est a des
aumadose
opia de fluores
(A) clulas co
0 min. As imag
mprovar que,
ndo exposta
J (Abramoff
de fluoresc
pelo ncleo
cos de inten
havendo um
6C). J para
e fluorescn
cubaoasd
varse uma
o mximo d
mento foi o
notria um
o, sendo que
dosnoapre
slocarse do
subletalde

scncia de clu
ntrolo (sem H
2
gens apresenta
, de facto, s
as ao H
2
O
2
,
et al., 2004
ncia ao long
o. Analisando
nsidade de f
ma quebra n
as clulas ex
ncia medid
B
diferenaso
grande qua
do nmero
observado ao
ma diminui
e aos 40 min
esentados).E
o retculo en
eH
2
O
2
emes
ulas opi1 + G
O
2
); clulas ex
adas so repre
e observou
fezse um
; Rasband, 1
go das clul
o os resultad
fluorescnci
otria da int
xpostas ao H
da que se ca
bservadasfo
ntidade das
de clulas
os 20 min d
o do n
n o nmero
Estesresultad
ndoplasmtic
tadoestacio
FPOpi1p cont
postas a 150
esentativas de
um aument
tratamento
1997) que po
las, traando
dos apresent
a localizado
tensidade de
H
2
O
2
aos 20
aminha do c
orampouco
s clulas ma
marcadas
de exposio
mero de c
de clulas c
dosapoiam
co para o n
onrio.
rolo e exposta
M H
2
O
2
em es
um conjunto
to da fluores
das imagen
ossibilita a a
o uma linha
tados na Fig
s na perifer
e fluorescn
min, observ
itoplasma p
C
notrias,ma
rcadas no n
com a pro
o ao H
2
O
2
(F
clulas mar
com esse fen
ahiptesed
cleo das c
as a 150 M H
2
stado estacion
de trs exper
scncia no n
ns recorrend
aquisio do
a que atrave
ura 16, po
ria do ncle
ncia no inter
ase um aum
ara a perife
0
52
asaos
ncleo
otena
Figura
rcadas
ntipo
deque
clulas

2
O
2
em
rio aos
rincias
ncleo
do ao
perfil
essa a
ossvel
eo nas
ior do
mento
ria do
m10
53

ncleo das clulas, sendo essa intensidade de fluorescncia observada na periferia do ncleo
mantida quando se atinge o ncleo, como pode observarse pelo patamar de intensidade de
fluorescnciarepresentadonaFigura16D.

Figura16Perfisdeintensidadedefluorescnciaaolongodasclulasopi1+GFPOpi1pcontroloeexpostasa
150MdeH
2
O
2
.Imagemdemicroscopiadefluorescnciade:(A)Clulascontrolo(semH
2
O
2
);(B)clulasexpostas
a 150 M H
2
O
2
em estado estacionrio aos 20 min. Perfil de intensidade de fluorescncia de: clulas
controlo (sem H
2
O
2
); clulas expostas a 150 M H
2
O
2
em estado estacionrio aos 20 min. Os resultados
apresentadossorepresentativosdeumconjuntodetrsexperinciasindependentes.


Aquando da visualizao das clulas ao microscpio notouse sempre uma certa
heterogeneidade em cada preparao, isto , algumas clulas com fentipo distinto daquele
observado para a maioria. No de estranhar esta heterogeneidade pois as clulas opi1 +
GFPOpi1pestotransformadascom umplasmdeonointegrativo,oquefazcomque possa
haverumnmerodiferentedeplasmdeosemcadaclulatransformada,logocomintensidade
de expresso diferente. Para uma melhor quantificao do fenmeno observado, em cada
preparao,clulascontroloeadaptadascomH
2
O
2
aos10e20min,foicontadoonmerode
clulas correspondentes aos vrios fentipos observados, tendose achado por bem distribu
los por trs categorias: (a) clulas marcadas apenas na periferia; (b) clulas marcadas no
20
30
40
50
0 10 20 30 40 50
I
n
t
e
n
s
i
d
a
d
e

d
e

f
l
u
o
r
e
s
c

n
c
i
a

1
0

1
0
(
u
n
i
d
a
d
e
s

a
r
b
i
t
r

r
i
a
s
)
Distncia (pxeis)
A
B
C
0m5
54

ncleo; (c) clulas aberrantes ou de fentipo duvidoso. Depois de uma anlise detalhada das
vrias imagens recolhidas e das contagens efectuadas, representouse graficamente a
percentagemdeclulascomosfentiposmaioritrios(aeb)relativamenteaototaldeclulas
contadas,paraasclulascontroloeclulassubmetidasa150MdeH
2
O
2
durante10e20min,
considerando sempre as clulas de fentipo minoritrio (c) para o total de clulas contadas.
ComopossvelobservarnaFigura17,quandonohexposioaoH
2
O
2
(controlo)amaioria
dasclulasencontrasemarcadaapenasnaperiferiadoncleo(70,2%),indicandoqueaOpi1p
se encontra associada ao retculo endoplasmtico. Aos 10 min esse nmero comea a decair,
observandoseumaumentodonmerodeclulasmarcadasnoncleo(62,6%),indicandoque
aOpi1pestatranslocarseparaestecompartimento.Aos20minapsaexposioaoH
2
O
2
a
maioria das clulas encontrase marcada no ncleo (78,4%), sendo residual o nmero de
clulas marcadas apenas na periferia (5,4%) (Figura 17). Para os vrios tempos observados, o
nmerodeclulasaberrantesouduvidosascorrespondeuaaproximadamente18%dototalde
clulasanalisadas.

Figura17Nmerodeclulasopi1+GFPOpi1pcomosfentiposmaioritrios,duranteaexposioa150M
H
2
O
2
emestadoestacionrio.controloclulascontrolo,noexpostasaoH
2
O
2
;10minclulasexpostasa150M
H
2
O
2
em estado estacionrio aos 10 min; 20 min clulas expostas a 150 M H
2
O
2
emestado estacionrio aos 20
min. Percentagemdeclulasmarcadasnoncleo; Percentagemdeclulasmarcadasapenasnaperiferia. Os
dados apresentados resultam de trs experincias independentes, tendo sido contado um total de 476 clulas
controlo,374clulasexpostasa150MH
2
O
2
aos10mine445clulasexpostasa150MH
2
O
2
aos20min.

Os dados apresentados confirmam a translocao da protena Opi1p do retculo


endoplasmticoparaoncleodasclulasquandoestassoexpostasaumadosesubletalde
150 M de H
2
O
2
em estado estacionrio, apoiando a hiptese de que o H
2
O
2
actua como
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
controlo 10 min 20 min
N

m
e
r
o

d
e

c

l
u
l
a
s

(
%
)
55

indutor de um aumento dos nveis de inositol no interior das clulas sendo desencadeado,
posteriormente,estemecanismodetranslocao.

IV.2. Quantificao dos nveis de fosfolpidos totais por TLC


bidimensional

Como foi referido na introduo, a biossntese dos fosfolpidos em S. cerevisiae um


processo bastante complexo que envolve tanto regulao gnica como bioqumica. Todas as
reacesda viadebiossntese defosfolpidosestodependentesdaregulaodosenzimase
pelos prprios metabolitos. Tanto a expresso como a actividade desses enzimas afectam o
comportamentoglobaldavia(CarmanandHan,2009b).
Viuse que quando adicionado inositol (75 M) ao meio de clulas S. cerevisiae em
crescimento, h uma reprogramao dramtica da sntese e turnover dos lpidos celulares
(Gaspar et al., 2006) que,em ltima anlise, poderinfluenciar a composio/organizao da
membrana plasmtica com resultados na permeabilidade da mesma. Sabese ainda que o
inositol um dos factores responsveis pelo controlo transcricional dos genes que codificam
para muitos dos enzimas necessrios biossntese de fosfolpidos. Alm disso, viuse que
muitas das actividades enzimticas para a biossntese de fosfolpidos so reprimidas quando
clulasdelevedurasoexpostasainositol(Gasparetal.,2006;Jeschetal.,2005).
Vrios autores viram que as principais alteraes observadas devidas adio de
inositol ao meio de cultura foram um aumento do consumo de PA (Jesch et al., 2005) e de
CDPDAG, precursores intermedirios de PI, verificandose um aumento da velocidade de
sntesedePIque,simultaneamente,desencadeiaumaalteraonaexpressodemuitosgenes
(Gasparetal.,2006).
Tendoemcontaqueseesperaobservarumaumentodosnveisdeinositolquandoas
clulasdeS.cerevisiaesoexpostasadosesadaptativasdeH
2
O
2
,colocouseahiptesedeque
este agente, atravs do aumento dos nveis de inositol, leve a uma alterao do perfil
fosfolipdicoglobal.Foivistotambmque,quandoasclulassoexpostasadosesadaptativas
de H
2
O
2
, ocorre a translocao da protena Opi1p do retculo endoplasmtico para o ncleo
(resultados obtidos em IV.1.). No modelo proposto por Loewen e colaboradores (Loewen et
al.,2004)atranslocaodaOpi1pparaoncleodasclulasdevesediminuiodosnveisde
PA,resultantedamobilizaodesteparaasntesedePI,quandonapresenadeinositol.
56

Comointuitodecompreendermelhorestaregulaotocomplexa,quantificouseos
nveistotaisdosvriosfosfolpidosemclulascontroloesujeitasa150MdeH
2
O
2
emestado
estacionrio, por TLC bidimensional. Os tempos de adaptao ao H
2
O
2
foram escolhidos de
acordo com os resultados da microscopia de fluorescncia. Na anlise da translocao da
Opi1p para o ncleo, foi visto que quando as clulas foram expostas a doses adaptativas de
H
2
O
2
, aos 10 min de adaptao j se observou um nmero significativo de clulas marcadas
fluorescentemente no ncleo, sendo que aos 20 min j a protena Opi1p se encontrava no
ncleo da maioria das clulas visualizadas. Foram, portanto, escolhidos os tempos de
adaptaode10e20minparaanlisedosnveisdefosfolpidos.Partindodopressupostoque
as alteraes que se pretendem observar nos nveis dos fosfolpidos ocorrem antes deste
mecanismodetranslocao,escolheuseotempode5mincomorefernciaparaasalteraes
ocorridasnosmomentosiniciaisdeexposioaoH
2
O
2

Quantificouse, ento, os nveis de fosfolpidos em extractos totais de clulas wt


controloeexpostasa150MdeH
2
O
2
emestadoestacionrioaos5,10e20mindeadaptao
aesteagente,encontrandoseosresultadosapresentadosnoQuadro8enaFigura18.
Analisando os resultados da Figura 18 e aps o tratamento estatstico dos mesmos,
observouse que no houve diferenas significativas no que respeita aos fosfolpidos totais
durante a exposio das clulas ao H
2
O
2
comparativamente com as clulas controlo. Porm,
pode observarse uma tendncia para um aumento de PE aos 5 min e uma diminuio dos
nveisdestefosfolpidoaos10mindeexposioa150MdeH
2
O
2
emestadoestacionrio.De
igual forma, pode dizerse que h uma tendncia para um aumento dos nveis de PC aos 20
mindeexposio.NoquedizrespeitoaosnveisdePI,esperavaobservarseumaumentodos
mesmos, tal como referido atrs. No entanto, no foram observadas alteraes, o que pode
serjustificadoporumaprovvelmobilizaodePIparafosfoinositiseesfingolpidosdurante
o processo adaptativo (ver Figura 5). Relativamente aos nveis de PA, dado que se observou
uma translocao da Opi1p para o ncleo das clulas, que resulta de uma diminuio dos
nveisdePA,esperarseiaobservarumadiminuioduranteaadaptaodasclulasaoH
2
O
2
,
o que no se observou. Visto que se procedeu quantificao dos fosfolpidos totais
provvel que, a haver alteraes, estas possam ocorrer localmente na clula e, desde modo,
estarem a passar despercebidas quando a anlise global. Uma abordagem alternativa seria
isolarafracodoretculoendoplasmticonosentidodequantificarosnveisdestefosfolpido
neste compartimento e poder concluir acerca do efeito do H
2
O
2
sobre esses nveis e,
consequentemente, justificar a translocao da Opi1p para o ncleo das clulas, de acordo
comomodelodeLoewenecolaboradores(Loewenetal.,2004).

57

Quadro8Quantificaodosnveisdefosfolpidostotaisemclulaswtcontroloeexpostasa150MdeH
2
O
2
em
estadoestacionrio.CLcardiolipina;PEfosfatidiletanolamina;PAcidofosfatdico;PCFosfatidilcolina;PS
Fosfatidilserina;PIfosfatidilinositol.Osresultadosapresentadoscorrespondemmdia_desviopadrodepelo
menosseisexperinciasindependentes.Foiconsideradoestatisticamentesignificativoumvalordep<0.05.
nmolPi/mgprotena
Fosfolpidos
CL PE PA PC PS PI
Controlo 0,26_0,08 3,56 _ 0,51 0,48 _ 0,17 3,74 _ 0,46 0,79_0,12 4,37_0,53
Adaptao
150MH
2
O
2
5min 0,25_0,10 4,23 _ 1,32 0,69_ 0,19 3,71 _ 0,70 0,61_0,30 4,52_1,01
10min 0,24_0,21 3,03_ 0,36 0,46 _ 0,15 3,51 _ 0,92 0,60_0,36 3,79_0,59
20min 0,41_0,03 3,59_ 1,16 0,62_ 0,12 4,63 _ 1,29 0,94_0,24 4,50_1,17

Figura18Quantificaodosnveisdefosfolpidostotaisemclulaswtcontroloeexpostasa150MdeH
2
O
2
em
estadoestacionrio. Clulascontrolo; Clulasadaptadasa150MH
2
O
2
aos5min; Clulasadaptadasa
150 M H
2
O
2
aos 10 min; Clulas adaptadas a 150 M H
2
O
2
aos 20 min. CL cardiolipina; PE
fosfatidiletanolamina; PA cido fosfatdico; PC Fosfatidilcolina; PS Fosfatidilserina; PI fosfatidilinositol. Os
resultadosapresentadoscorrespondemmdia_desviopadrodepelomenosseisexperinciasindependentes.
Foiconsideradoestatisticamentesignificativoumvalordep<0.05.

Anteriormenteforamquantificadosos nveisdefosfolpidosnamembrana plasmtica


de S. cerevisiae (Pedroso et al., 2009), tendo sido observado um aumento em 44% dos nveis
dePCaos90mindeadaptaoaoH
2
O
2
.RelativamentequantificaodosnveisdePCtotais
0,0
1,0
2,0
3,0
4,0
5,0
6,0
7,0
CL PE PA PC PS PI
n
m
o
l

P
i

m
g

p
r
o
t
e

n
a
Fosfolpidos
58

observouse tambm um aumento dos nveis deste fosfolpido aos 20 min de adaptao
(Figura 18), confirmando a tendncia para a manuteno desses nveis aumentados com o
tempo de adaptao das clulas ao H
2
O
2
. No que diz respeito aos nveis de PE foi observada
umadiminuioem46%destefosfolpidonamembranaplasmticaaos90mindeadaptao
aoH
2
O
2
,notendosidoobservadaamesmatendncianosnveistotaisdefosfolpidos(Figura
18).
interessante referir que as alteraes dos nveis de fosfolpidos induzidos pelo
inositol observadas por Gaspar e colaboradores (Gaspar et al., 2006) representam uma
situao em que as clulas crescem na presena de 75 M de inositol, sendo os nveis de
fosfolpidos destas clulas comparados aos de clulas que crescem na ausncia de inositol
(controlo). No presente estudo, as clulas crescem normalmente na presena de 11 M de
inositol,oquepodernofacilitaravisualizaodealteraesnosnveistotaisdefosfolpidos
aps o tratamento com 150 M de H
2
O
2
em estado estacionrio, podendo este tratamento
induzirapenaspequenasalteraesnosnveisdeinositol,noatingindoos75Mdeinositol
utilizadosnoestudoanterior.
Relativamente proporo de cada fosfolpido nas clulas controlo observouse, do
fosfolpidopresente em maiorquantidadeparaofosfolpidopresente em menorquantidade,
PI>PC>PE>PS>PA>CL(Figura18).Hquereferirqueestaordemnosealterouquandofoi
contabilizado o total de fosfolpidos em cada ensaio (dados no apresentados). Comparando
estesvalorescomosobtidosporIwanyshynecolaboradores(Iwanyshynetal.,2004),PC>PE
> PI > PS > PA > CL, possvel observar que h diferenas para os fosfolpidos presentes em
maior quantidade. No entanto, estas discrepncias podem ser explicadas analisando os
resultados apresentados por Daum e colaboradores (Daum et al., 1999), onde se observam
diferenasnasproporesdosvriosfosfolpidosemdiferentestiposdeclulas.Porm,estas
diferenas podem tambm ser justificadas pelas diferentes composies dos meios de
crescimento utilizados. No presente trabalho experimental, as clulas crescem num meio
sinttico (meio pobre) na presena de 11 M inositol. O meio de crescimento das clulas
utilizadoporIwanyshynecolaboradores(meiosinttico)totalmentedesprovidodeinositol.
No caso de Daum de colaboradores as clulas crescem num meio com 0,1M de inositol e
desprovidodecolina.Poroutrolado,asdiferenasobservadaspodemdeversesensibilidade
da tcnica que conduz a erros significativos (ver desviospadro na Figura 18). Se os desvios
padroforemtidosemconta,podedizersequeaquantidadedosfosfolpidosPC,PEePIso
equiparveis, s podendo fazerse uma comparao mais exacta aumentando o nmero de
replicadosexperimentais.
59

As dificuldades na anlise dos nveis dos fosfolpidos devemse essencialmente


sensibilidade da tcnica. A TLC uma tcnica sujeita a bastantes erros, sendo que os
resultados vm afectados por eles. Esses efeitos so notrios essencialmente para os
fosfolpidos cujos nveis so reduzidos, como o caso do PA, no sendo possvel observar
diferenas significativas entre clulas controlo e adaptadas ao H
2
O
2
. Por este motivo,
necessrio um grande nmero de replicados experimentais. Futuramente, poderseia
quantificarosnveisdosfosfolpidosatravsdetcnicasmaissensveis,recorrendoamarcao
com istopos radioactivos, como
32
P
i
e
32
P, como j foi feito por Iwanyshyn e colaboradores
(Iwanyshyn et al., 2004) e por Jani e Lopes (Jani and Lopes, 2009), respectivamente. O
isolamento de fraces celulares, no sentido de analisar o que acontece aos nveis dos
fosfolpidos a nvel local, tambm uma hiptese a considerar. Neste caso, teria de ser
analisadoocontedodefosfolpidosnoRE,nomeadamenteosnveisdePA,quetidacomoa
molculasinalizadoradosnveiscelularesdeinositol.
Pode,ento,concluirsequeaestaabordagemdequantificaototaldosfosfolpidos
no foi conclusiva relativamente aos resultados esperados. Pensase, no entanto, que estes
resultados advm de estar a fazerse uma anlise global dos nveis de fosfolpidos e no em
fracescelularesisoladas.

IV.3. Quantificao de diversos transcritos regulados pelo


inositolporPCRquantitativoemtemporeal

NoseguimentodosresultadosobtidosparaaanlisedatranslocaodaOpi1pparao
ncleo das clulas quando expostas a doses adaptativas de H
2
O
2
, e tendo esta protena uma
funo repressora da transcrio dos genes que possuem a sequncia UAS
INO
nos seus
promotores, determinouse os nveis de expresso de diversos transcritos regulados pelo
inositol.
Comointuitodeanalisaraexpressodevriosgenesquecodificamenzimasdasvias
desntesedosfosfolpidos,cujaexpressodealgunsdelessepensaestaralteradaemresposta
ao aumento dos nveis de inositol induzidos pelo H
2
O
2
, quantificouse vrios transcritos por
PCRquantitativoemtemporeal.
Para este estudo, foram seleccionados vrios genes potencialmente relevantes na
respostaaoH
2
O
2
.Deacordocomahiptesedetrabalhoproposta(oH
2
O
2
induzumaumento
deinositolnaclula),foramescolhidosgenesquepodemestarrelacionadoscomessepossvel
60

aumento. Os genes INO1 e INM1, cujos produtos esto envolvidos na sntese de novo de
inositolapartirde6Pglucose(Figura5),foramescolhidosdevidosuaimportncianasntese
endgena de inositol. O gene ITR1, que codifica para o transportador Itr1p, foi seleccionado
devidosuarelevncianomecanismodetransportedeinositoldoexteriorparaointeriorda
clula.OgeneINO2codificaparaofactordetranscrioIno2p,umdosfactoresqueseliga
sequncia UAS
INO
, que tal como se disse anteriormente uma sequncia regulada pelo
inositol.Aanlisedasuaexpressotambmdeextremaimportnciavistoestaraestudarse
os mecanismos moleculares da expresso do gene FAS1, um dos genes que possuem a
sequnciaUAS
INO
nassuasregiespromotoras.dereferirquequeroINO1,queroITR1,quer
oINO2,sogenesreguladospeloinositol.
Foram ainda seleccionados alguns genes relevantes nas vias de biossntese dos
fosfolpidos.OgenePIS1 estenvolvidonasntese dePIa partirdoinositoledeCDPDAG.O
gene GPT2 codifica o enzima 3fosfato de glicerol aciltransferase 2, importante na converso
de 3fosfato de glicerol a cido lisofosfatdico, que depois convertido a PA. O gene CDS1
responsvelpelacodificaodoenzimaCDPdiacilglicerolsintase,quecatalisaaconversode
PA em CDPDAG. O gene CHO1, que codifica o enzima fosfatidilserina sintase (PS sintase),
envolvido na sntese de PS, relevante para a anlise da via de novo da biossntese dos
fosfolpidos. O gene URA7, cujo produto o enzima CTP sintetase, relevante nas vias de
sntese de CDPDAG a partir de PA, mas tambm na sntese de PE e PC. importante referir
queaexpressodosgenesCDS1eCHO1controladapelosnveisdeinositolintracelulares.
Paraadeterminaodosnveisdetranscrito,analisousequaisasalteraesocorridas
aos 10, 20 e 40 min de adaptao das clulas a uma dose de 150 M de H
2
O
2
em estado
estacionrio,porcomparaocomclulascontrolo.Ostemposdeadaptaoescolhidosesto
relacionados com as alteraes observadas nos estudos de translocao da Opi1p para o
ncleodasclulaspormicroscopiadefluorescncia,jexplicadoanteriormente.Observouse
o incio da translocao da Opi1p para o ncleo aos 10 min estando a Opi1p totalmente
translocadaaos20min.Dasededuzqueasalteraesobservadasaonveldaexpressodos
genesseroiniciadasprximodos10mindeadaptaooudepois.Comotal,escolheramseos
10,20e40mindeadaptaodasclulasaoH
2
O
2
paraanalisaressaspossveisalteraes.
Os RNA totais foram preparados de acordo com o kit da AMBION, como descrito em
III.3.9.1., sendo posteriormente quantificados no NanoDrop. De forma a remover o DNA
contaminante que possivelmente estaria presente no extracto de RNA tratouse as amostras
comDNaseI(Fermentas),quedegradaossDNAeodsDNA.ParaconfirmaraausnciadeDNA
genmico contaminante nas amostras tratadas com DNase I, fezse uma reaco de
amplificao por PCR usando um par de primers que apenas amplificam sequncias de DNA.
61

1000
200
400
600
800
1400
2000
230pb
Foram usados os primers ZWF1F e ZWF1R para as reaces de amplificao do fragmento do
gene ZWF1, que codifica para o enzima 6fosfato de glucose desidrogenase. Foi usado DNA
genmicocomocontrolopositivoeumaalquotadosvriosRNAstratados.Apsamplificao,
procedeuse anlise dos produtos resultantes da reaco de amplificao por electroforese
numgeldeagarosea2%(m/v)comBrEt0,2g/mL,talcomodescritoemIII.3.9.3.NaFigura
19 encontramse apresentados resultados representativos da separao electrofortica
efectuadaparaasvriasamostras.

Figura 19 Anlise dos produtos de PCR dos RNAs aps tratamento com DNase, utilizando o par de primers
ZWF1FeZWF1R.(1)DNAgenmico;(2)a(5)RNAtratadocomDNase;(2)RNAcontrolodeclulasnotratadascom
H
2
O
2
;(3),(4)e(5)RNAdeclulastratadascom150MdeH
2
O
2
emestadoestacionriodurante10min,20mine
40min,respectivamente.Osresultadossorepresentativosdeseisexperinciasindependentes.

Como possvel observar pela anlise da Figura 19, no houve formao de produto
dePCRnasamostrastratadascomDNase,peloquepodeconcluirsequeotratamentocomo
enzimafoieficaz(Figura19).Assim,prosseguiuseparaasntesedaprimeiracadeiadecDNA,
talcomodescritoemIII.3.8.4.,paradepoisseranalisadaporPCRquantitativoemtemporeal.
A sntese de cDNA foi confirmada por PCR utilizando os primers do gene ZWF1, tal como
descrito anteriormente, tendo os produtos resultantes da reaco de amplificao sido
analisadosporelectroforesenumgeldeagarosea2%(m/v)comBrEt0,2g/mL(Figura20).

12345M

Figura
ZWF1F
tratad
resulta
feita
osres
dimin
estad
H
2
O
2

acord
dimin
respe
result
obser
nos
a pro
gluco
intere
pelo
40 m
repre
H
2
O
2

expre
ao H
temp
expre
a20Anlised
F e ZWF1R. (C
as com 150 M
adossorepres

As amost
adetermina
sultadosdae
Relativam
nuiosignif
do estacion
nosocon
do com os re
nuiodaex
eito expre
tadosaos40
rvouse um
sejamestatis
oduo do e
osea1fosfat
essante nota
H
2
O
2
,notan
min. Gasch e
esso do gen
eumaindu
esso do gen
H
2
O
2
, havend
posde20e4
essodosme
dosprodutosd
) DNA genmic
M de H
2
O
2
em
sentativosdese
tras de cDNA
aodosnve
expressog
menteaosge
icativadaex
rio. Os resul
nclusivospoi
esultados de
xpressodes
sso do gen
0mindeexp
ligeiro aume
sticamented
nzima 1fosf
todeinosito
ar que h u
doseumau
colaborado
ne INO1 aos
odaexpre
ne ITR1 dimi
do valores e
40minitosde
ensageirosd
dePCRapsas
co; (2) cDNA d
m estado estac
eisexperincia
A foram ana
eisdemRNA
nicaaprese
enesenvolvid
xpressode
ltados da ex
sobtiveram
e Gasch e co
stegeneaos
ne INO1, est
osioaoH
2
ento da expr
diferentedo
fato de inos
ol,podendo
m comporta
umentodae
res observa
10 min e no
essodeste
inuiu gradua
estatisticame
eexposioa
destegene,e
sntesedaprim
de clulas no
ionrio durant
sindependente
alisadas por
Adoconjunto
entadosnaFi
dosnasntes
INM1aos10
xpresso des
sevaloresc
olaboradores
20mindee
ta permane
2
O
2
estejama
resso de IN
controlo.Ist
itol sintase,
esteseropa
amento oscil
expressoao
ram o mesm
o intervalod
geneaos20
almente ao l
ente diferen
aoH
2
O
2
.Em
enopodend

meiracadeiade
tratadas com
e 10 min, 20 m
es.
PCR quanti
odegeness
igura21.
seendgena
0mindeexp
te gene aos
comumgran
s (Gasch et a
exposioa
ceu praticam
afectadospo
NO1, embora
topodeindi
que catalisa
assolimitant
latrio da ex
os20min,se
mo tipo de r
de tempo de
0mindeexp
ongo do tem
ntes relativa
boraestejam
doextrapola
ecDNA,utiliza
H
2
O
2
; (3), (4) e
min e 40 min,
tativo em te
eleccionado
adeinositol,
posioa15
20 e 40 min
ndeerro.Este
al., 2000), o
0,32mMde
mente inalte
orumgrande
os nveis de
carumesfo
a a convers
teparaasn
xpresso des
eguidadeum
resposta osc
30 a 50 min
posioa0,3
mpo de adap
amente ao
maseranali
arparaosnv
ndoopardep
e (5) cDNA de
respectivamen
empo real, s
s,encontran
observouse
0MdeH
2
O
n de exposi
esdadosest
nde foi vista
eH
2
O
2
.Noq
erada, embo
eerro.Aos2
e expresso
rodaclula
o de 6fosfa
tesedeinos
ste gene ind
madiminui
cilatria com
nde exposi
32mMdeH
ptao das c
controlo pa
sadososnv
veisdeprote
62
primers
clulas
nte. Os
sendo
ndose
euma
O
2
em
o ao
tode
a uma
uediz
ora os
20min
ainda
apara
ato de
sitol.
duzida
oaos
m uma
o ao
2
O
2
.A
clulas
ara os
veisde
ena,
63

provvel que tambm estes estejam diminudos na membrana plasmtica. Se assim for, a
haveraumentodeinositolnaclula,estenoadvmdeummaioruptakeapartirdoexterior,
mas sim da sntese de novo. A diminuio da expresso do gene ITR1 est de acordo com o
aumento de inositol esperado, dado que se sabe que tanto a expresso como os nveis deste
transportadordiminuemquandohumaumentodeinositolintracelularmente.Relativamente
aosdadosdeGaschecolaboradores,observouseumarepressodaexpressodeITR1aos10
minenovamenteentreos30eos50mindeexposioaoH
2
O
2
,oqueestdeacordocomos
nossosdados.

Figura 21 Variaes da expresso de vrios genes, devidas exposio a 150 M de H


2
O
2
em estado
estacionrioemS.cerevisiae. C,clulasnotratadascomH
2
O
2
; 10,clulastratadascom150MdeH
2
O
2
em
estadoestacionriodurante10min; 20,clulastratadascom150MdeH
2
O
2
emestadoestacionriodurante
20 min; 40, clulas tratadas com 150 M de H
2
O
2
em estado estacionrio durante 40 min. Os resultados
apresentadoscorrespondemmdia_desviopadrodeseisexperinciasindependentes.*p<0,05vs.wt.

0
100
200
300
400
500
600
GTP2
N

v
e
i
s

d
e

e
x
p
r
e
s
s

o

d
e

m
R
N
A

(
u
n
i
d
a
d
e
s

a
r
b
i
t
r

r
i
a
s
)
Genes
*
*
0
20
40
60
80
100
120
140
160
URA7 PIS1
N

v
e
i
s

d
e

e
x
p
r
e
s
s

o

d
e

m
R
N
A

(
u
n
i
d
a
d
e
s

a
r
b
i
t
r

r
i
a
s
)
Genes
*
*
*
0
20
40
60
80
100
120
140
160
INM1 INO1 ITR1 INO2 CHO1 CDS1
N

v
e
i
s

d
e

e
x
p
r
e
s
s

o

d
e

m
R
N
A

(
u
n
i
d
a
d
e
s

a
r
b
i
t
r

r
i
a
s
)
Genes
C
10'
20'
40'
*
*
*
*
*
*
*
*
*
64

AexpressodogeneINO2,quecodificaofactordetranscrioIno2p,diminuiuaos10
e aos 20 min de exposio ao H
2
O
2
, havendo uma reposio dos nveis de expresso para os
nveiscontroloaos40min.EstesresultadospodemserexplicadopelofactodogeneINO2ser
regulado pelo inositol. Por outro lado, foi observada a translocao da protena Opi1p para o
ncleo em resposta ao H
2
O
2
, concordante com a activao do mecanismo de regulao da
expresso dos genes que possuem a sequncia UAS
INO
nas regies promotoras. Estes dados
esto de acordo com os de Gasch e colaboradores,em que foi observada uma diminuio da
expressodeINO2duranteaexposioaoH
2
O
2
nosinstantesiniciais.importantereferirque
o facto de o gene INO2 estar reprimido no significa que a protena Ino2p (factor de
transcrio) no esteja em quantidade e com actividade suficientes para exercerem a sua
funo no mecanismo de regulao da expresso dos genes que possuem as sequncias
UAS
INO
,comoocasodoFAS1.
Os nveis de expresso do gene GTP2 aumentam drasticamente durante a exposio
dasclulasaoH
2
O
2
,resultadosestesconcordantescomosobtidosporGaschecolaboradores.
IstolevaacrerqueosnveisdePAdeveroestaraumentados,vistoestegenecodificarparao
enzima3fosfatodeglicerolaciltransferase2quecatalisaaconversode3fosfatodeglicerola
cidolisofosfatdico,umdosprecursoresdePA.Poroutrolado,humamanutenodonveis
de expresso do gene CDS1 (tambm observada por Gasch e colaboradores), que codifica o
enzima CDPdiacilglicerol sintase que catalisa a converso de PA em CDPDAG, e uma
diminuio da expresso de URA7 (igualmente observada por Gasch e colaboradores),
envolvido na sntese de CTP que actua como cofactor nesse processo de converso, o que
indicaquepoderestaraocorrerumaacumulaodePA,conduzindoaoaumentodosnveis
deste fosfolpido intracelularmente. Na verdade, tal como se viu anteriormente, no foram
observadas neste trabalho variaes significativas nos valores totais de PA na clula. No
entanto, o PA pode estar simultaneamente a ser convertido em pirofosfato de diacilglicerol
(DAGPP)ouDAG,sendoesteltimoutilizadonasntesedeTAGounasntesedePEePCpela
viadeKennedy(verFigura5).
Parece haver uma tendncia para a manuteno dos nveis de expresso de CHO1,
envolvido na sntese de PS a partir de CDPDAG, o que est de acordo com a tendncia para
uma diminuio dos nveis deste fosfolpido observada, ainda que essa diminuio no seja
significativa (Figura 18). Estes dados esto de acordo com os resultados de Gasch e
colaboradores, onde se observou uma manuteno da expresso de CHO1, havendo apenas
uma ligeira induo da expresso aos 30 min de exposio ao H
2
O
2
. Observouse uma
diminuio da expresso do gene PIS1, envolvido na sntese de PI a partir de CDPDAG e
inositol, o que pode indiciar uma diminuio dos nveis deste fosfolpido. Na verdade, esta
65

observao no est de acordo com o modelo de regulao pelo inositol, em que a um


aumento de inositol corresponde um aumento de PI. No entanto, aquando da quantificao
total deste fosfolpido na clula no se notaram variaes dos seus nveis ao longo do tempo
de exposio ao H
2
O
2
. Porm, tal como discutido anteriormente, o PI pode estar a ser
mobilizado para os seus derivados, fosfoinositis e esfingolpidos. Os resultados obtidos por
Gasch e colaboradores esto de acordo com o que seria esperado, observandose uma
repressodaexpressodogenePIS1.
AnalisandoosnveisdeexpressodeURA7sobopontodevistadaviadeKennedy,a
diminuiodaexpressodessegenepoderiajustificarumadiminuiodasntesedePEapartir
da etanolamina e de PC a partir da colina e, consequentemente, uma diminuio dos nveis
destes fosfolpidos. Tendo em considerao os resultados da quantificao dos fosfolpidos
totais, em que se observou uma tendncia para um aumento dos nveis de PE aos 5 min de
exposioaoH
2
O
2
eumadiminuioaos10min,observandosetambmumatendnciapara
um aumento dos nveis de PC aos 20 min, pode concluirse que a biossntese destes
fosfolpidos bastante complexa e est sujeita a uma regulao bastante apertada, sendo
necessria uma anlise mais detalhada dos vrios genes envolvidos nas vias que conduzem
sua sntese. Os dados de Gesch e colaboradores apoiam esta hiptese, visto que observaram
uma diminuio da expresso deste gene aquando da exposio das clulas a 0,32 mM de
H
2
O
2
.
Todos os resultados relativos expresso dos genes regulados pelo inositol (INO1,
CDS1,CHO1,ITR1eINO2)soidnticosaosjobtidosporGaschecolaboradores,aindaqueas
concentraes de H
2
O
2
sejam ligeiramente superiores (0,32 mM) s utilizadas no presente
trabalho (0,15 mM). Estes dados apoiam, portanto, a hiptese proposta da regulao da
expressodaexpressodosgenesquepossuemassequnciasUAS
INO
(comoocasodoFAS1)
peloH
2
O
2
serfeitaporintermdiodoinositol,atravsdosistemaOpi1pIno2pIno4p.
Embora esteja sempre a falarse em expresso gnica, o mais correcto seria a
determinao das actividades dos diferentes enzimas envolvidos nas vias de biossntese dos
fosfolpidos. Tendo em conta os resultados obtidos, e visto ainda permanecerem algumas
dvidas acerca dos mecanismos de regulao inerentes biossntese de fosfolpidos,
fundamental determinar os nveis de inositol no interior das clulas, no sentido de observar
quais as diferenas a nvel quantitativo deste precursor fosfolipdico quando as clulas so
submetidasa150MdeH
2
O
2
emestadoestacionrio.

66

IV.4. Determinao dos nveis de inositol em clulas controlo e


tratadascomH
2
O
2

O objectivo central do presente trabalho consiste em compreender os mecanismos


molecularesenvolvidosnaregulaodogeneFAS1induzidospeloH
2
O
2
.propostoqueoH
2
O
2

reprime a expresso do gene FAS1 por induo dos nveis de inositol. , portanto, essencial
quantificarosnveisdeinositolemclulascontroloeexpostasadosesadaptativasdeH
2
O
2
,no
sentido de verificar se, de facto, o H
2
O
2
que induz o aumento dos nveis de inositol
intracelularmente.
Aps uma vasta pesquisa, optimizouse um mtodo espectrofotomtrico para
determinarosnveisdeinositolemclulasdeS.cerevisiae(verIV.1.3.1).

IV.4.1. OptimizaodoMtododeDoseamento

O inositol est envolvido em muitos processos fisiolgicos, e as alteraes no seu


metabolismoestonabasedevariadosestadospatolgicos.Umadasmaioresdificuldadesnos
estudos dessas patologias tem sido a inexistncia de um mtodo simples e especfico para
mediodosnveisdeinositol(Inouyeetal.,1988).
A medio da concentrao de inositol em amostras biolgicas tem sido feita por
ensaios de microbiologia (Eastcott, 1928), cromatografia gasosa (GC) (Clements, Jr. and
Reynertson, 1977), cromatografia gasosa acoplada a espectrometria de massa (GCMS) (Niwa
et al., 1983; Ostlund, Jr. et al., 1993), cromatografia lquida de elevada resoluo (HPLC)
(Kuroda et al., 1994) e por ensaio fluorimtrico enzimtico (MacGregor and Matschinsky,
1984). Porm, estes mtodos apresentam uma srie de desvantagens, visto que as amostras
necessitam de tratamento prvio e as vrias etapas desse tratamento so complicadas,
levandoametodologiasqueresultamnumabaixasensibilidadedosmtodos.Paraalmdestes
mtodos, foi j descrito um mtodo enzimtico muito sensvel, usando por princpio a
ciclizao de NADH (Kato et al., 1973; MacGregor and Matschinsky, 1984). No entanto, este
mtodoconsisteemmuitospassos,quedificultamoprocesso.
Os nveis de inositol j foram medidos em S. cerevisiae, por Azab e colaboradores
(Azab et al., 2007). Estes autores mediram os nveis de inositol recorrendo ao mtodo
fluorimtrico de Maslanski e Busa (Maslanski and Busa, 1990), no qual foi medido 0,8 0,9
nmoldeinositolpor100gdeprotenaemclulaswt.Estemtodobastantesensveletem
67

umlimitededetecobaixo.Ofactodolimitededetecoserbaixovantajoso,poispermite
detectar quantidades reduzidas de inositol. No entanto, a grande sensibilidade faz com que
haja uma maior susceptibilidade a erros devido grande propagao de pequenas variaes
quepossamserintroduzidasnosistema.Nopresentetrabalhoexperimental,tentoumedirse
os nveis de inositol por este mtodo, mas nunca foram obtidos resultados reprodutveis. A
elevadasensibilidadedomtodoconduziuagrandesvariaesdeintensidadedefluorescncia
entre os vrios replicados de uma mesma amostra, no se tendo tambm observado
diferenasentreospoosdobrancoedoteste.
Procurouse, ento, outro mtodo que permitisse dosear o inositol no interior das
clulas. Recentemente, Ashizawa e colaboradores (Ashizawa et al., 2000) optimizaram um
mtodo espectrofotomtrico enzimtico para medio de inositol em soro de rato. Baseiase
na oxidao de mioinositol (MI) e na reduo do NAD
+
pelo enzima mioinositol
desidrogenase (MIDH), acoplado reaco catalisada pelo enzima diaforase que converte
cloretodeiodonitrotetrazlio(INT)aformazan,reoxidandoseoNADH.Oformazanresultante
medido espectrofotometricamente a 492 nm (Figura 11). Este mtodo tem a vantagem de
ter brancos da curva e das amostras baixos, havendo apenas um aumento da absorvncia
quaseimperceptvelnodecorrerdoensaio.Noentanto,asensibilidadedomtodobastante
baixa, de aproximadamente 2 nmol, tornandose complexa a sua optimizao quando se
queremmedirquantidadesbaixasdeinositol.
Antes de tudo, fezse um estudo terico para definir quais as concentraes de cada
um dos enzimas e metabolitos no sistema reaccional, de forma a que o sistema evolusse de
forma controlada, tendo em ateno que o INT e o NAD devem estar em excesso
relativamenteaosenzimasdosistema reaccional.Asconcentraeseactividadesenzimticas
definidasencontramsereferidasemIII.3.9.3.
ComofoiefectuadoporAshizawaecolaboradores,reproduziuseacurvadecalibrao
at 30 nmol de inositol, tendose observado linearidade at 20 nmol, tal como referido pelos
autores.
Seguidamente, partiuse para os ensaios com os extractos citoslicos de levedura,
tendo surgido uma srie de problemas. Inicialmente, efectuouse o ensaio com extracto final
sem ser sujeito a qualquer tipo de tratamento. Quando se adicionou MIDH ao sistema viuse
um aumento muito rpido da absorvncia para valores superiores ao limite de deteco do
leitor de microplacas. Tentou efectuarse vrias diluies do extracto antes de adicionar ao
poo de reaco, tendose observado valores de absorvncia inferiores mas, no entanto,
perdeusesensibilidadepoisaodiluirseoextractoesttambmadiminuirseaquantidadede
inositolquesequermedir.Paraalmdesteproblemaviuseque,quandoseadicionavaMIDH
68

emadiessucessivasocorriaumincrementonosvaloresdeabsorvnciaemtodasasadies,
indiciando que o MIDH estaria a interferir com a medio, ou algum dos componentes do
sistema reaccional estaria a contribuir para estes aumentos sucessivos de absorvncia aps a
adiodeMIDH.
Dados os problemas observados, resolveu fazerse um tratamento das amostras logo
apsaobtenodoextractofinal.TalcomoindicadoporAshizawaecolaboradores,tratouse
o extracto com cido perclrico 16% (p/v), neutralizando seguidamente com K
2
CO
3
2M, para
precipitartodaaprotenadoextractoequepoderestarainterferircomoensaio.Apseste
tratamento, incubouse ainda as amostras com hexocinase, no sentido de eliminar toda a
glucosequeseobservouinterferircomoensaio(Ashizawaetal.,2000).Foifeitonovamenteo
ensaio, com o extracto tratado e sem qualquer diluio, tendose observado um aumento de
absorvnciatantonopoodobrancocomonopooteste,devidoaoaumentodaturbidezdas
amostras nos poos (formao de um precipitado) quando se adicionou o reagente MI ao
extracto tratado. Testouse ainda um ensaio em que se retirou ao reagente MI alguns dos
componentes que se pensou interferirem com o ensaio: a) sem Triton; b); sem BSA; c) sem
Triton e sem BSA. Em todos os casos continuou a haver aumento de absorvncia devido ao
referido aumento de turbidez nos poos dos brancos e teste. Essa turbidez s deixou de ser
to acentuada quando se diluiu o extracto 100x, mas a temos o problema de estar a diluir
tambm100xoinositolaquantificar.
Dado que o mais provvel que ainda houvesse interferentes no extracto convinha
arranjarummtodoqueeliminasseamaioriadelessemqueoinositolfosseperdidoaolongo
do processo. Maslanski e Busa (Maslanski and Busa, 1990) referem um mtodo de
cromatografia de troca inica, usando uma resina Dowex 50W 200400 mesh, no qual as
amostras so eludas com gua recuperandose o inositol. O volume de gua com o qual as
amostras foram eludas e o volume de gua a aplicar no final para lavar a coluna foram
optimizadosdeformaarecuperartodooinositolaaplicarcoluna.
Noentanto,aindatnhamosoproblemadabaixasensibilidadedomtodo,quealiado
a todos os processos de tratamento poderia conduzir a perdas significativas. Como tal, fezse
um upscaling da cultura de forma a que no final, em cada poo, tivssemos quantidade
suficiente de inositol para que se pudesse efectuar uma medida minimamente rigorosa.
Optimizouseaquantidadedeculturae,consequentemente,aquantidadedeprotena(g)de
forma a terse, pelo menos, aproximadamente 6 nmol de inositol em cada poo de reaco.
Assim, todo o processo de preparao da amostra e o mtodo de doseamento encontramse
descritosempormenoremIII.3.9.Resumidamente:

69

A. Preparaodoextracto
B. Quantificaodeprotena,deformaaaplicar~6nmolinositolemcadapoo
C. Precipitaodaprotenacomcidoperclricoeneutralizao
D. Cromatografiadetrocainica,paraeluiroinositol
E. Tratamentocomhexocinase
F. EnsaioespectrofotomtricodeAshizawaecolaboradores

IV.4.2. CurvadeCalibraodoMtodoEspectrofotomtrico

Para a medio do inositol intracelular foi necessrio traar primeiro uma curva de
calibrao. Reproduziuse a curva de calibrao apresentada por Ashizawa e colaboradores
(Ashizawa et al., 2000) de acordo com a metodologia apresentada em III.3.9.3., tendose
observadolinearidadeat20nmol,talcomoreferidopelosautores.

IV.4.3. Medio dos nveis intracelulares de inositol em clulas controlo e


adaptadasa150MdeH
2
O
2

Areproduodacurvadecalibraodomtodofoirelativamentesimples.Noquediz
respeito medio dos nveis de inositol em amostras biolgicas, nomeadamente em S.
cerevisiae, o processo foi algo complicado. Teve de ser feito um conjunto de testes e
optimizaes,jreferidosemIV.4.1.
Apstodasasoptimizaesefectuadas,foramanalisadasamostrasdeclulascontrolo
e amostras recolhidas aos tempos de adaptao de 5 e 10 min de incubao das clulas com
150MdeH
2
O
2
.Paraasclulascontroloobservouseumaumentodosvaloresdeabsorvncia
a 492 nm nos poos aos quais foi adicionado o enzima MIDH (Figura 22A). Para as clulas
submetidas a 150 M de H
2
O
2
durante 5 e 10 min, no houve um aumento de absorvncia a
492nm significativamente diferente do observado para as amostras com o enzima MIDH
relativamenteabsorvncianasamostrassquaisnofoiadicionadooenzimaMIDH (Figura
22B e Figura22C). Isto indica que h uma diminuio dos nveisde inositol quando as clulas
soexpostasadosesadaptativasdeH
2
O
2
.

70

B C

Figura 22 Ensaio representativo do doseamento do inositol intracelular em clulas controlo e expostas a 150
MdeH
2
O
2
.Encontramseapresentadososresultadosobtidosparaumdosensaiosefectuados.representadaa
variao de absorvncia a 492 nm em funo do tempo (min). A. Clulas controlo; B. Clulas expostas a 150 M
H
2
O
2
aos 5 min; C. Clulas expostas a 150 M H
2
O
2
aos 10 min. Branco do ensaio (sem MIDH); Teste
(comMIDH).Osresultadosapresentadossorepresentativosdetrsexperinciasindependentes.

Para os ensaios efectuados nas clulas controlo, foram quantificados os nveis de


inositol, tendo sido obtido o valor de 0,9 nmol inositol / 100 g protena. No foi possvel
quantificar a diminuio dos nveis de inositol que ocorreu quando as clulas foram
submetidas a 150 M de H
2
O
2
, mesmo partindo de amostras com trs vezes mais inositol,
tendoseverificadoomesmoperfildeevoluodeabsorvnciaaolongodotempo(dadosno
apresentados).Ofactodenoseterconseguidodosearoinositolemclulassubmetidasa150
M de H
2
O
2
em estado estacionrio pode estar relacionado com a baixa sensibilidade do
mtodo,jdiscutidaantes,nopermitindodetectarquantidadesmuitobaixasdesteprecursor
fosfolipdico.
0
500
1000
1500
2000
2500
3000
0 5 10 15 20 25 30 35
A
b
s

4
9
2
n
m
Tempo(min)
0
500
1000
1500
2000
2500
3000
0 5 10 15 20 25 30 35
A
b
s

4
9
2
n
m
Tempo(min)
0
500
1000
1500
2000
2500
3000
0 5 10 15 20 25 30 35
A
b
s
4
9
2
n
m
Tempo(min)
71

Concluise, assim, que os nveis de inositol diminuram drasticamente durante a


adaptaodasclulasaoH
2
O
2
,aocontrriodoqueseesperavaobservar,ouseja,umaumento
dosnveisdeinositolaquandodaadaptaodasclulas.
A diminuio dos nveis de inositol observada nos instantes iniciais do processo
adaptativo ao H
2
O
2
poder deverse a uma baixa sensibilidade do mtodo de doseamento
utilizado.Osvriostratamentosaqueasamostrasbiolgicassosujeitas,anterioresaoensaio
dedoseamento,poderodealgumaformainduziralteraes,nomeadamentedegradaoou
converso do inositol noutro(s) intermedirio(s), que se reflectem aquando do ensaio. O
inositol pode ainda estar a ser mobilizado para a sntese de PI ou dos seus derivados
(fosfoinositiseesfingolpidos).Outrahipteseparaadiminuiodosnveisdeinositolpoder
ser a presena nas amostras de algum componente desconhecido, provavelmente produzido
duranteoprocessodeadaptaodasclulas,cujasnteseprovavelmenteinduzidapeloH
2
O
2
,
equeestarainterferircomomtododedoseamentoutilizado.

72

V. CONSIDERAESFINAIS

O objectivo do presente trabalho centrouse no estudo da regulao do gene FAS1


peloH
2
O
2
,nomeadamenteaonvel dacompreensodosmecanismosmolecularesenvolvidos
nessaregulao.ComohiptesedetrabalhopropssequeoH
2
O
2
terumaacorepressora
sobreaexpressodogeneFAS1porintermdiodainduodosnveisdeinositolintracelulares
nasclulasdeS.cerevisiae.
Quando as clulas de S. cerevisiae foram expostas a 150 M de H
2
O
2
em estado
estacionrio observouse uma diminuio acentuada dos nveis de inositol. Embora a
metodologia utilizada para o doseamento do inositol ainda tenha que ser optimizada,
nomeadamente na determinao da presena de interferentes no extracto das clulas
tratadas com H
2
O
2
, este resultado contraria a hiptese de trabalho. No entanto, a apoiar a
hiptesepropostafoiobservadaatranslocaodaprotenaOpi1pdoretculoendoplasmtico
paraoncleodasclulasquandoexpostasaoH
2
O
2
nasmesmascondiesexperimentais.Por
outro lado, os resultados da expresso dos genes que possuem as sequncias UAS
INO
nas
regies promotoras, e regulados pelo sistema Opi1pIno2pIno4p, esto de acordo com o
modeloproposto,apoiandomaisumavezapresentehiptesedetrabalho.Assim,tudoindica
para que a regulao da expresso do gene FAS1 pelo H
2
O
2
seja feita atravs do sistema
Opi1pIno2pIno4p.
Porm, os resultados da quantificao dos fosfolpidos no foram conclusivos.
Esperava observarse uma diminuio dos nveis de PA e um aumento dos nveis de PI,
resultantesdoaumentodeinositol(Loewenetal.,2004).Contudo,adiminuiodosnveisde
inositol pode resultar de uma mobilizao do inositol para a formao de PI (havendo um
aumentodasntesedePI)eestefosfolpidoestarasersimultaneamentemodificadoparadar
origemaosseusderivadosfosfoinositis,justificandoanoobservaodoaumentodosnveis
de PI (Carman and Zeimetz, 1996; Michell, 2008). de salientar que alguns dos fosfatos de
fosfatidilinositol so molculas de sinalizao que actuam nas vias de secreo e endocitose
(PI(4,5)P
2
) e que regulam, nomeadamente, o trfico membranar (PI3P e PI(3,5)P
2
) (Michell,
2008),cujosnveispoderoestaraumentadosquandoasclulassoexpostasaoH
2
O
2
.Ano
observaodadiminuiodosnveisdePAnaanlisedefosfolpidostotais,resultanosda
baixa sensibilidade da tcnica utilizada para a quantificao dos fosfolpidos, assim como do
facto de estar a fazerse o doseamento deste fosfolpido numa amostra de extractos totais e
noumdoseamentonoretculoendoplasmtico.
73

Alguns dos resultados obtidos ao longo deste trabalho apoiam a hiptese de a


expressodogeneFAS1,quandoasclulassoexpostasaoH
2
O
2
,serreguladapeloinositolvia
oselementosUAS
INO
.Noentanto,ofactodenoteremsidoobservadosoaumentodosnveis
deinositoleinduesnosnveisdePAePI,indicaqueprovavelmenteosistemapoderestara
sofrer regulao por outros factores que no o inositol. Vrios autores viram j que a
regulao da expresso dos genes com os elementos UAS
INO
pode ser controlada pela
presena/ausncia de zinco (disponibilidade de nutrientes) ou ainda nas diferentes fases de
crescimento da levedura (Carman, 2005; Carman and Han, 2009a; Carman and Henry, 2007;
Iwanyshynetal.,2004).
Globalmente, os resultados da expresso gnica obtidos neste trabalho esto de
acordocomasobservaesdeGaschecolaboradores(Gaschetal.,2000),apesardeasclulas
teremsidoexpostasaconcentraesdiferentesdeH
2
O
2
.
Considerando os resultados obtidos no presente trabalho possvel constatar que as
vias de biossntese dos fosfolpidos esto sujeitas a um controlo bastante apertado e, tendo
em vista a sua melhor compreenso e estudo, necessria uma anlise mais pormenorizada
dos vrios genes envolvidos nessas vias assim como o uso de tcnicas mais sensveis de
quantificaodosfosfolpidosemetabolitosdasvias.
J havia sido visto que o gene FAS1 regulado pelo inositol via o elemento UAS
INO
.
Emboraosresultadosdopresentetrabalhonoconfirmemquehumaregulaopeloinositol
induzida pelo H
2
O
2
, de qualquer modo h uma regulao coordenada da expresso do gene
FAS1 e de genes envolvidos na sntese de fosfolpidos que apresentam a mesma sequncia
UAS
INO
nasregiespromotoras.NosendooinositoloelementoreguladorinduzidopeloH
2
O
2
,
provvel que haja um outro factor indutor que actue via este elemento UAS
INO
responsvel
pelaexpressocoordenadadessesgenesanteriores.
Todos os resultados obtidos no decorrer deste trabalho experimental apontam mais
uma vez para a existncia de uma resposta global complexa e multifactorial durante a
adaptao das clulas de S. cerevisiae ao H
2
O
2
(Pedroso, 2008) ocorrendo, neste caso, a
respostacelularaonveldaexpressognicaedacomposiofosfolipdica.

74

VI. PERSPECTIVAS

Os resultados obtidos durante o presente trabalho experimental revelamse


importantes para a compreenso da resposta adaptativa das clulas de S. cerevisiae ao H
2
O
2
,
nomeadamente na compreenso dos mecanismos moleculares envolvidos na regulao do
geneFAS1.Noentanto,oprocessodeintegraodessesresultadosnosentidodeestabelecer
uma relao entre as alteraes observadas e quaisquer modelos dos processos biolgicos
relacionados com a resposta adaptativa das clulas ao H
2
O
2
sempre uma tarefa complexa.
Tendoemvistaesteobjectivo,osresultadosapresentadosdeverosercomplementadoscom
novasabordagensexperimentais.
A premissa principal do presente trabalho foi a represso da expresso do gene FAS1
pelo H
2
O
2
atravs da induo dos nveis de inositol intracelulares. Porm, foi observada uma
diminuio dos nveis de inositol durante a exposio de 10 e 20 min a 150 M de H
2
O
2
em
estado estacionrio, justificados de vrias formas j amplamente discutidas. Seria de todo
interessante, seno essencial, dosear este precursor fosfolipdico com recurso a outros
mtodosmenossusceptveisdeerroemaissensveis,nosentidodeconfirmaroucontrariaros
resultados obtidos. Apesar da diminuio dos nveis de inositol obtidos atravs do ensaio
espectrofotomtrico utilizado, foram obtidos outros resultados que apoiam a hiptese
proposta(aumentodeinositol).Nosentidodeesclarecerestacontrovrsia,deveriamaindaser
quantificadososfosfoinositise/ouosfosfatosdefosfatidilinositole/ouosesfingolpidos.
Seria tambm interessante quantificar os nveis do transportador de inositol Itr1p na
membrana plasmtica assim como os nveis do factor de transcrio Ino2p no ncleo, por
Westernblot.PoderseoaindaefectuarestudosdeImunofluorescnciaparaoItr1peparao
Ino2p, no sentido de ter uma percepo visual e temporal da localizao celular destes
factoresedoqueestdefactoaocorrer,ecomplementarassimosdadosdeWesternblot.
Osdadosdaquantificaodosfosfolpidostotaispermitiramtiraralgumasconcluses,
masnoforamsuficientementeesclarecedores.Seriadetodointeressanterecorreratcnicas
maissensveisdeosdosear,recorrendoamarcaocomistoposradioactivos,como
32
Pie
32
P,
comojfoifeitoporCarmanecolaboradores(Iwanyshynetal.,2004)eporJanieLopes(Jani
and Lopes, 2009), respectivamente. A anlise de fraces celulares isoladas tambm uma
hipteseaconsiderar,tendoemvistaaanlisedoqueocorreaosnveisdefosfolpidosanvel
local. Esta abordagem pode revelarse importante para a compreenso do mecanismo de
translocaodaprotenaOpi1pparaoncleo,peloqueaquantificaodosnveisdePAnuma
fracoisoladanoretculoendoplasmticodetodoointeresse.
75

Para a anlise da expresso gnica foram seleccionados alguns geneschave que,


possivelmente, poderiam esclarecer acerca das principais alteraes ocorridas durante o
processodeadaptaodasclulasaoH
2
O
2
.Osdadosdeexpressognicaobtidosajudarama
compreender algumas alteraes ocorridas nomeadamente nas vias de biossntese dos
fosfolpidos. Porm, uma anlise incompleta pode ser uma fonte de erro no que respeita
elao de concluses, pelo que uma anlise mais pormenorizada da expresso de mais genes
que regulam as vias ou que codificam para enzimas das vias de biossntese dos fosfolpidos
ser um ponto a ter considerao em estudos futuros. Uma vez que uma maior expresso
gnicanemsempresignificamaiorquantidadedeprotena(ouenzima)e,consequentemente,
no significa maior actividade enzimtica, caso os resultados de expresso gnica se revelem
inconclusivos podero ser procuradas formas de determinar as respectivas actividades
enzimticasdosenzimascontroladoresdasvias.
Paraalmdosgenesenvolvidosdirectamentenasviasdebiossntesedosfosfolpidos,
seria de todo o interesse a anlise da expresso de outros genes, nomeadamente os
envolvidos no mecanismo de translocao da protena Opi1p para o ncleo das clulas,
associado regulao da expresso dos genes que possuem a sequncia UAS
INO
nos seus
promotores. Este estudo j foi iniciado no presente trabalho, com a anlise da expresso do
gene INO2. Porm, seria interessante analisar a expresso do gene SCS2, que codifica para a
protena Scs2p, que faz parte do complexo PAOpi1pScs2p. Poderia tambm estudarse a
expresso do gene OPI1 e quantificar o produto da expresso no sentido de analisar se o
aumento de fluorescncia observado no ncleo das clulas durante o processo adaptativo se
deveutranslocaodaprotenaOpi1pdoretculoendoplasmticoparaoncleodasclulas
ouaumaumentodeexpressodogenequesetraduziunumamaiorquantidadedeprotena.
EstesestudospoderiamaindasercomplementadosporImunofluorescncia.
Todos estes pontos devem ser tidos em conta em estudos futuros, de forma a
compreender de forma mais integrada os mecanismos associados resposta adaptativa das
clulas de S. cerevisiae ao H
2
O
2
, nomeadamente na compreenso dos mecanismos
molecularesenvolvidosnaregulaodogeneFAS1.

76

REFERNCIASBIBLIOGRFICAS

1. Abramoff,M.D.,Magalhes,P.J.,andRam,S.J.(2004)ImageProcessingwithImageJ.
BiophotonicsInternational.11(7),3642.
2. Antunes, F. and Cadenas, E. (2001) Cellular titration of apoptosis with steady state
concentrationsofH
2
O
2
:submicromolarlevelsofH
2
O
2
induceapoptosisthroughFenton
chemistry independent of the cellular thiol state. Free Radic.Biol.Med. 30 (9), 1008
1018.
3. Ashizawa,N.,Yoshida,M.,andAotsuka,T.(2000)Anenzymaticassayformyoinositol
intissuesamples.J.Biochem.Biophys.Methods.44(12),8994.
4. Auerbach, D., Arnoldo, A., Bogdan, B., Fetchko, M., and Stagljar, I. (2005) Drug
DiscoveryUsingYeastasaModelSystem:AFunctionalGenomicandProteomicView.
CurrentProteomics.2(1),113.
5. Azab,A.N.,He,Q.,Ju,S.,Li,G.,andGreenberg,M.L.(2007)Glycogensynthasekinase
3 is required for optimal de novo synthesis of inositol. Mol.Microbiol. 63 (4), 1248
1258.
6. Azab,A.N.,Mehta,D.V.,Chesebro,J.E.,andGreenberg,M.L.(2009)Ethylbutyrate,a
valproatelike compound, exhibits inositoldepleting effects a potential mood
stabilizingdrug.LifeSci.84(12),3844.
7. Barja, G. (1993) Oxygen radicals, a failure or a success of evolution? Free
Radic.Res.Commun.18(2),6370.
8. Branco, M. R., Marinho, H. S., Cyrne, L., and Antunes, F. (2004) Decrease of H
2
O
2

plasma membrane permeability during adaptation to H


2
O
2
in Saccharomyces
cerevisiae.J.Biol.Chem.279(8),65016506.
9. Cadenas, E. (1998) Mechanisms of Antioxidant Action. Free Radicals, Oxidative Stress,
andAntioxidants,Ozben,ed.PlenumPress.pp.237251.
10. Cai,H.(2005)NAD(P)Hoxidasedependentselfpropagationofhydrogenperoxideand
vasculardisease.Circ.Res.96(8),818822.
11. Carman, G. M. (2005) Regulation of phospholipid synthesis in yeast by zinc.
Biochem.Soc.Trans.33(Pt5),11501153.
12. Carman,G.M.andHan,G.S.(2009a)Phosphatidicacidphosphatase,akeyenzymein
theregulationoflipidsynthesis.J.Biol.Chem.284(5),25932597.
13. Carman, G. M. and Han, G. S. (2009b) Regulation of phospholipid synthesis in yeast.
J.LipidRes.50Suppl6973.
14. Carman, G. M. and Henry, S. A. (2007) Phosphatidic acid plays a central role in the
transcriptional regulation of glycerophospholipid synthesis in Saccharomyces
cerevisiae.J.Biol.Chem.282(52),3729337297.
77

15. Carman, G. M. and Zeimetz, G. M. (1996) Regulation of phospholipid biosynthesis in


theyeastSaccharomycescerevisiae.J.Biol.Chem.271(23),1329313296.
16. Causton, H. C., Ren, B., Koh, S. S., Harbison, C. T., Kanin, E., Jennings, E. G., Lee, T. I.,
True, H. L., Lander, E. S., and Young, R. A. (2001) Remodeling of yeast genome
expressioninresponsetoenvironmentalchanges.Mol.Biol.Cell.12(2),323337.
17. Chance, B., Sies, H., and Boveris, A. (1979) Hydroperoxide metabolism in mammalian
organs.PhysiolRev.59(3),527605.
18. Chen, M., Hancock, L. C., and Lopes, J. M. (2007) Transcriptional regulation of yeast
phospholipidbiosyntheticgenes.Biochim.Biophys.Acta.1771(3),310321.
19. Cherry, J. M. (1995) Genetic nomenclature guide. Saccharomyces cerevisiae. Trends
Genet.1112.
20. Chirala, S. S. (1992) Coordinated regulation and inositolmediated and fatty acid
mediated repression of fatty acid synthase genes in Saccharomyces cerevisiae.
Proc.Natl.Acad.Sci.U.S.A.89(21),1023210236.
21. Cipak, A., Hasslacher, M., Tehlivets, O., Collinson, E. J., Zivkovic, M., Matijevic, T.,
Wonisch, W., Waeg, G., Dawes, I. W., Zarkovic, N., and Kohlwein, S. D. (2006)
Saccharomyces cerevisiae strain expressing a plant fatty acid desaturase produces
polyunsaturated fatty acids and is susceptible to oxidative stress induced by lipid
peroxidation.FreeRadic.Biol.Med.40(5),897906.
22. Clements, R. S., Jr. and Reynertson, R. (1977) Myoinositol metabolism in diabetes
mellitus.Effectofinsulintreatment.Diabetes.26(3),215221.
23. Collinson, L. P. and Dawes, I. W. (1992) Inducibility of the response of yeast cells to
peroxidestress.J.Gen.Microbiol.138(2),329335.
24. Connerth, M.,Grillitsch, K.,Kofeler,H., andDaum,G.(2009)Analysisoflipid particles
fromyeast.MethodsMol.Biol.579,359374.
25. Costa, V. M., Amorim, M. A., Quintanilha, A., and MoradasFerreira, P. (2002)
HydrogenperoxideinducedcarbonylationofkeymetabolicenzymesinSaccharomyces
cerevisiae:theinvolvementoftheoxidativestressresponseregulatorsYap1andSkn7.
FreeRadic.Biol.Med.33(11),15071515.
26. Cunha, M. L. (2001) Papel do glutationo na respostaao stress oxidativo induzido pelo
AAPH(dihidrocloretode2,2'azobis(2amidinopropano)emSaccharomycescerevisiae
na fase de crescimento exponencial e estacionria. Relatrio de estgio cientfico da
licenciaturaemBioqumica,FCUL.
27. Daum,G.,Tuller,G.,Nemec,T.,Hrastnik,C.,Balliano,G.,Cattel,L.,Milla,P.,Rocco,F.,
Conzelmann, A., Vionnet, C., Kelly, D. E., Kelly, S., Schweizer, E., Schuller, H. J., Hojad,
U., Greiner, E., and Finger, K. (1999) Systematic analysis of yeast strains with possible
defectsinlipidmetabolism.Yeast.15(7),601614.
28. de OliveiraMarques, V., Cyrne, L., Marinho, H. S., and Antunes, F. (2007) A
quantitative study of NFkappaB activation by H
2
O
2
: relevance in inflammation and
synergywithTNFalpha.J.Immunol.178(6),38933902.
78

29. Dittmer,J.C.andWells,M.A.(1969)Quantitativeandqualitativeanalysisoflipidsand
lipidcomponents.MethodsinEnzymology.14,482530.
30. Eastcott, E. V. (1928) Wilders "Bios." The isolation and identification of "Bios I.".
J.Phys.Chem.32,10941111.
31. Folch, J., Lees, M., and Sloane Stanley, G. H. (1957) A simple method for the isolation
andpurificationoftotallipidesfromanimaltissues.J.Biol.Chem.226(1),497509.
32. Folmer,V.,Pedroso,N.,Matias,A.C.,Lopes,S.C.,Antunes,F.,Cyrne,L.,andMarinho,
H. S. (2008) H
2
O
2
induces rapid biophysical and permeability changes in the plasma
membraneofSaccharomycescerevisiae.Biochim.Biophys.Acta.1778(4),11411147.
33. Forman, H. J. (2007) Use and abuse of exogenous H
2
O
2
in studies of signal
transduction.FreeRadic.Biol.Med.42(7),926932.
34. Gasch, A. P., Spellman, P. T., Kao, C. M., CarmelHarel, O., Eisen, M. B., Storz, G.,
Botstein,D.,andBrown,P.O.(2000)Genomicexpressionprogramsintheresponseof
yeastcellstoenvironmentalchanges.Mol.Biol.Cell.11(12),42414257.
35. Gaspar, M. L., Aregullin, M. A., Jesch, S. A., and Henry, S. A. (2006) Inositol induces a
profound alteration in the pattern and rate of synthesis and turnover of membrane
lipidsinSaccharomycescerevisiae.J.Biol.Chem.281(32),2277322785.
36. Giorgio, M., Trinei, M., Migliaccio, E., and Pelicci, P. G. (2007) Hydrogen peroxide: a
metabolic byproduct or a common mediator of ageing signals? Nat.Rev.Mol.Cell Biol.
8(9),722728.
37. Godon, C., Lagniel, G., Lee, J., Buhler, J. M., Kieffer, S., Perrot, M., Boucherie, H.,
Toledano,M.B.,andLabarre,J.(1998)TheH
2
O
2
stimuloninSaccharomycescerevisiae.
J.Biol.Chem.273(35),2248022489.
38. Goffeau,A.,Barrell,B.G.,Bussey,H.,Davis,R.W.,Dujon,B.,Feldmann,H.,Galibert,F.,
Hoheisel, J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes, H. W., Murakami, Y.,
Philippsen, P., Tettelin, H., and Oliver, S. G. (1996) Life with 6000 genes. Science. 274
(5287),546,5637.
39. Gralla,E.(1997)Superoxidedismutase:StudiesintheYeastSaccharomycescerevisiae.
OxidativeStressandtheMolecularBiologyofAntioxidantDefenses.495523.
40. Grant, C. M. (2001) Role of the glutathione/glutaredoxin and thioredoxin systems in
yeastgrowthandresponsetostressconditions.Mol.Microbiol.39(3),533541.
41. Han, G., Gable, K., Kohlwein, S. D., Beaudoin, F., Napier, J. A., and Dunn, T. M. (2002)
The Saccharomyces cerevisiae YBR159w gene encodes the 3ketoreductase of the
microsomalfattyacidelongase.J.Biol.Chem.277(38),3544035449.
42. Hasan, R., Leroy, C., Isnard, A. D., Labarre, J., BoyMarcotte, E., and Toledano, M. B.
(2002) The control of the yeast H
2
O
2
response by the Msn2/4 transcription factors.
Mol.Microbiol.45(1),233241.
43. Hudson, J. R., Jr., Dawson, E. P., Rushing, K. L., Jackson, C. H., Lockshon, D., Conover,
D., Lanciault, C., Harris, J. R., Simmons, S. J., Rothstein, R., and Fields, S. (1997) The
79

complete set of predicted genes from Saccharomyces cerevisiae in a readily usable


form.GenomeRes.7(12),11691173.
44. Inouye,M.,Mio,T.,andSumino,K.(1988)Measurementofinositolinuremicserumby
selectedionmonitoring.Jpn.J.Med.27(1),2933.
45. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) Transformation of intact yeast
cellstreatedwithalkalications.J.Bacteriol.153(1),163168.
46. Iwanyshyn, W. M., Han, G. S., and Carman, G. M. (2004) Regulation of phospholipid
synthesisinSaccharomycescerevisiaebyzinc.J.Biol.Chem.279(21),2197621983.
47. Jamieson, D. J. (1998) Oxidative stress responses of the yeast Saccharomyces
cerevisiae.Yeast.14(16),15111527.
48. Jani, N. M. and Lopes, J. M. (2009) Regulated transcription of the Saccharomyces
cerevisiae phosphatidylinositol biosynthetic gene, PIS1, yields pleiotropic effects on
phospholipidsynthesis.FEMSYeastRes.9(4),552564.
49. Jesch, S. A., Zhao, X., Wells, M. T., and Henry, S. A. (2005) Genomewide analysis
revealsinositol,notcholine,asthemajoreffectorofIno2pIno4pandunfoldedprotein
responsetargetgeneexpressioninyeast.J.Biol.Chem.280(10),91069118.
50. Kato, T., Berger, S. J., Carter, J. A., and Lowry, O. H. (1973) An enzymatic cycling
method for nicotinamideadenine dinucleotide with malic and alcohol
dehydrogenases.Anal.Biochem.53(1),8697.
51. Kuroda, N., Tada, S., Kajikawa, T., Niimi, M., Ishida, T., and Kawanishi, K. (1994)
Determination of sugars and polyols in red cells by highperformance liquid
chromatographywithpulsedamperometricdetection.J.Jpn.Diabetes.37,695698.
52. Kvam, E., Gable, K., Dunn, T. M., and Goldfarb, D. S. (2005) Targeting of Tsc13p to
nucleusvacuole junctions: a role for verylongchain fatty acids in the biogenesis of
microautophagicvesicles.Mol.Biol.Cell.16(9),39873998.
53. Lai, K. and McGraw, P. (1994) Dual control of inositol transport in Saccharomyces
cerevisiae by irreversible inactivation of permease and regulation of permease
synthesisbyINO2,INO4,andOPI1.J.Biol.Chem.269(3),22452251.
54. Le Moan, N., Clement, G., Le, M. S., Tacnet, F., and Toledano, M. B. (2006) The
Saccharomycescerevisiaeproteomeofoxidizedproteinthiols:contrastedfunctionsfor
thethioredoxinandglutathionepathways.J.Biol.Chem.281(15),1042010430.
55. Loewen, C. J., Gaspar, M. L., Jesch, S. A., Delon, C., Ktistakis, N. T., Henry, S. A., and
Levine, T. P. (2004) Phospholipid metabolism regulated by a transcription factor
sensingphosphatidicacid.Science.304(5677),16441647.
56. Loewen,C.J.,Roy,A.,andLevine,T.P.(2003)AconservedERtargetingmotifinthree
familiesoflipidbindingproteinsandinOpi1pbindsVAP.EMBOJ.22(9),20252035.
57. Lomakin,I.B.,Xiong,Y.,andSteitz,T.A.(2007)Thecrystalstructureofyeastfattyacid
synthase,acellularmachinewitheightactivesitesworkingtogether.Cell.129(2),319
332.
80

58. MacGregor, L. C. and Matschinsky, F. M. (1984) An enzymatic fluorimetric assay for


myoinositol.Anal.Biochem.141(2),382389.
59. Maslanski, J. A. and Busa, W. B. (1990) A Sensitive and Specific Mass Assay for myo
Inositol and Inositol Phosphates in Methods in Inositide Research (Irvine, R. F., ed),
RavenPress,Ltd.,NewYork,113126.
60. Matias, A. C., Pedroso, N., Teodoro, N., Marinho, H. S., Antunes, F., Nogueira, J. M.,
Herrero, E., and Cyrne, L. (2007) Downregulation of fatty acid synthase increases the
resistance of Saccharomyces cerevisiae cells to H
2
O
2
. Free Radic.Biol.Med. 43 (10),
14581465.
61. Michell, R. H. (2008) Inositol derivatives: evolution and functions. Nat.Rev.Mol.Cell
Biol.9(2),151161.
62. Miyashita, M., Shugyo, M., and Nikawa, J. (2003) Mutational analysis and localization
of the inositol transporters of Saccharomyces cerevisiae. J.Biosci.Bioeng. 96 (3), 291
297.
63. MoradasFerreira, P., Costa, V., Piper, P., and Mager, W. (1996) The molecular
defencesagainstreactiveoxygenspeciesinyeast.Mol.Microbiol.19(4),651658.
64. Nailis, H., Coenye, T., Van, N. F., Deforce, D., and Nelis, H. J. (2006) Development and
evaluationofdifferentnormalizationstrategiesforgeneexpressionstudiesinCandida
albicansbiofilmsbyrealtimePCR.BMC.Mol.Biol.7,2533.
65. Nelson, D. A. and Cox, M. M. (2004) Lehninger, Principles of Biochemistry.
W.H.Freeman.
66. Niwa, T., Yamamoto, N., Maeda, K., Yamada, K., Ohki, T., and Mori, M. (1983) Gas
chromatographicmassspectrometricanalysisofpolyolsinurineandserumofuremic
patients. Identification of new deoxyalditols and inositol isomers. J.Chromatogr. 277,
2539.
67. OliveiraMarques, V., Marinho, H. S., Cyrne, L., and Antunes, F. (2009) Role of
hydrogen peroxide in NFkappaB activation: from inducer to modulator.
Antioxid.Redox.Signal.11(9),22232243.
68. Ostlund, R. E., Jr., McGill, J. B., Herskowitz, I., Kipnis, D. M., Santiago, J. V., and
Sherman, W. R. (1993) Dchiroinositol metabolism in diabetes mellitus.
Proc.Natl.Acad.Sci.U.S.A.90(21),99889992.
69. Pedroso, N. (2008) Papel da membrana plasmtica na adaptao de Saccharomyces
cerevisiae ao H
2
O
2
. Tese de Doutoramento em Bioqumica Regulao Bioqumica,
FCUL.
70. Pedroso,N.,Matias,A.C.,Cyrne,L.,Antunes,F.,Borges,C.,Malho,R.,deAlmeida,R.
F.,Herrero,E.,andMarinho,H.S.(2009)Modulationofplasmamembranelipidprofile
and microdomains by H
2
O
2
in Saccharomyces cerevisiae. Free Radic.Biol.Med. 46 (2),
289298.
71. Perrone, G. G., Tan, S. X., and Dawes, I. W. (2008) Reactive oxygen species and yeast
apoptosis.Biochim.Biophys.Acta.1783(7),13541368.
81

72. Peterson, G. L. (1977) A simplification of the protein assay method of Lowry et al.
whichismoregenerallyapplicable.Anal.Biochem.83(2),346356.
73. Rasband, W. S. (1997) ImageJ. U.S.National Institutes of Health, Bethesda, Maryland,
USA.http://rsb.info.nih.gov/ij/.
74. Schneider, R., Massow, M., Lisowsky, T., and Weiss, H. (1995) Different respiratory
defective phenotypes of Neurospora crassa and Saccharomyces cerevisiae after
inactivation of the gene encoding the mitochondrial acyl carrier protein. Curr.Genet.
29(1),1017.
75. Schuller, H. J., Hahn, A., Troster, F., Schutz, A., and Schweizer, E. (1992) Coordinate
genetic control of yeast fatty acid synthase genes FAS1 and FAS2 by an upstream
activationsitecommontogenesinvolvedinmembranelipidbiosynthesis.EMBOJ.11
(1),107114.
76. Schweizer,E.andHofmann,J.(2004)MicrobialtypeIfattyacidsynthases(FAS):major
playersinanetworkofcellularFASsystems.Microbiol.Mol.Biol.Rev.68(3),501517.
77. Sherman,F.(2002)Gettingstartedwithyeast.MethodsEnzymol.350,341.
78. Sies,H.(1997)Oxidativestress:oxidantsandantioxidants.Exp.Physiol.82(2),291295.
79. Snyder, M. and Kumar, A. (2002) Yeast genomics: past, present, and future promise.
Funct.Integr.Genomics.2(45),135137.
80. SousaLopes, A., Antunes, F., Cyrne, L., and Marinho, H. S. (2004) Decreased cellular
permeability to H
2
O
2
protects Saccharomyces cerevisiae cells in stationary phase
againstoxidativestress.FEBSLett.578(12),152156.
81. Struhl, K. (1989) Molecular mechanisms of transcriptional regulation in yeast.
Annu.Rev.Biochem.58,10511077.
82. Suzuki, Y. J., Forman, H. J., and Sevanian, A. (1997) Oxidants as stimulators of signal
transduction.FreeRadic.Biol.Med.22(12),269285.
83. Tehlivets, O., Scheuringer, K., and Kohlwein, S. D. (2007) Fatty acid synthesis and
elongationinyeast.Biochim.Biophys.Acta.1771(3),255270.
84. Temple, M. D., Perrone,G. G., and Dawes, I. W. (2005) Complex cellular responses to
reactiveoxygenspecies.TrendsCellBiol.15(6),319326.
85. Toledano,M.B.,Delaunay,A.,Biteau,B.,Spector,D.,andAzevedo,D.(2003)Oxidative
stressresponsesinyeast.inTopicsinCurrentGenetics,SpringerVerlag.241303.
86. Tuller,G.,Nemec,T.,Hrastnik,C.,andDaum,G.(1999)Lipidcompositionofsubcellular
membranes of an FY1679derived haploid yeast wildtype strain grown on different
carbonsources.Yeast.15(14),15551564.
87. Udvardi, M. K., Czechowski, T., and Scheible, W. R. (2008) Eleven golden rules of
quantitativeRTPCR.PlantCell.20(7),17361737.
82

88. vanderRest,M.E.,Kamminga,A.H.,Nakano,A.,Anraku,Y.,Poolman,B.,andKonings,
W.N. (1995) Theplasma membraneofSaccharomyces cerevisiae:structure,function,
andbiogenesis.Microbiol.Rev.59(2),304322.
89. Wenz, P., Schwank, S., Hoja, U., and Schuller, H. J. (2001) A downstream regulatory
elementlocatedwithinthecodingsequencemediatesautoregulatedexpressionofthe
yeast fatty acid synthase gene FAS2 by the FAS1 gene product. Nucleic Acids Res. 29
(22),46254632.
90. Zhang, D. X. and Gutterman, D. D. (2007) Mitochondrial reactive oxygen species
mediated signaling in endothelial cells. Am.J.Physiol Heart Circ.Physiol. 292 (5), 2023
2031.