J Phytopathol 160:576587 (2012) 2012 Blackwell Verlag GmbH

doi: 10.1111/j.1439-0434.2012.01954.x

Indian Agricultural Research Institute, New Delhi, India

Race Proling and Molecular Diversity Analysis of Fusarium oxysporum f.sp. ciceris Causing Wilt in Chickpea
Sunil C. Dubey, Kumari Priyanka, Vivek Singh and Birendra Singh Authors address: Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, 110012, India (correspondence to Sunil C. Dubey. E-mail: scdube2002@yahoo.co.in) Received January 7, 2012; accepted July 1, 2012 Keywords: races, differential cultivars, genetic diversity, universal rice primers, intersimple sequence repeats, simple sequence repeats, random amplied polymorphic DNA, Fusarium oxysporum f.sp. ciceris

Abstract
Seventy isolates of Fusarium oxysporum f.sp. ciceris (Foc) causing chickpea wilt representing 13 states and four crop cultivation zones of India were analysed for their virulence and genetic diversity. The isolates of the pathogen showed high variability in causing wilt incidence on a new set of differential cultivars of chickpea, namely C104, JG74, CPS1, BG212, WR315, KWR108, GPF2, DCP92-3, Chaffa and JG62. New differential cultivars for each race were identied, and based on differential responses, the isolates were characterized into eight races of the pathogen. The same set of isolates was used for molecular characterization with four different molecular markers, namely random amplied polymorphic DNA, universal rice primers, simple sequence repeats and intersimple sequence repeats. All the four sets of markers gave 100% polymorphism. Unweighted paired group method with arithmetic average analysis grouped the isolates into eight categories at genetic similarities ranging from 37 to 40%. The molecular groups partially corresponded to the states of origin/chickpea-growing region of the isolates as well as races of the pathogen characterized in this study. The majority of southern, northern and central Indian populations representing specic races of the pathogen were grouped separately into distinct clusters along with some other isolates, indicating the existence of variability in population predominated by a single race of the pathogen. The present race proling for the Indian population of the pathogen and its distribution pattern is entirely new. The knowledge generated in this study could be utilized in resistance breeding programme. The existence of more than one race, predominated by a single one, in a chickpea cultivation zone as supported by the present molecular ndings is also a new information.

Introduction
Chickpea (Cicer arietinum L.) is one of the most important pulse crops cultivated in tropical and

temperate regions. Low yield of chickpea is attributed to its susceptibility to several fungal, bacterial and viral diseases (Dubey and Singh 2008). Among the diseases, the wilt caused by Fusarium oxysporum f.sp. ciceris (Padwick) Matuo and K. Sato (Foc) is an important reason for major productivity loss in chickpea worldwide (Haware and Nene 1982). The losses caused by early wilting range from 77 to 94%, while the losses caused by late wilting range from 24 to 65% (Haware and Nene 1980). The disease has been reported from all the chickpea-growing states of India. Its incidence varies from 14.1 to 32.0% (Dubey et al. 2010a) and causes an annual loss of 10% (Singh and Dahiya 1973). The cultivation of resistant varieties is one of the most prudent and cost-effective practices available for the management of Fusarium wilt, but these varieties do not perform satisfactory in different locations (Jimenez-Gasco et al. 2004b) because of their high pathogenic variability that limits the effectiveness of their resistance (Jimenez-Diaz et al. 1993). Eight races of the pathogen (races 0, 1A, 1B/C, 2, 3, 4, 5 and 6) were identied by their reaction on a set of differential chickpea cultivars (Haware and Nene 1982; Jimenez-Diaz et al. 1993). All these races have distinct geographic distribution. Races 1, 2, 3 and 4 were reported only from India, while races 0, 1B/C, 5 and 6 were reported from the Mediterranean region and the USA, thus showing area-specic distribution patterns. Honnareddy and Dubey (2006) established three new races of the pathogen in India based on their reactions on a set of differential cultivars used by earlier workers (Haware and Nene 1982; Jimenez-Gasco et al. 2001). Further, based on the reactions of 64 isolates of Foc representing ve states of India on a set of earlier differentials, most of which did not match with the race-specic reactions, it was suggested that the chickpea cultivars namely KWR108, GPF2 and DCP92-3 that had

Races and Diversity in Fusarium oxysporum f.sp. ciceris

577

shown clear-cut differential reactions for the Indian populations of Foc should be incorporated into the earlier reported set of differentials (Dubey and Singh 2008; Dubey et al. 2010a). Therefore, in the present study, the virulence was tested on a new set of differential cultivars standardized by Dubey and Singh (2008) so as to obtain clear-cut differential responses to Foc isolates. The molecular markers such as random amplied polymorphic DNA (RAPD) (Jimenez-Gasco et al. 2001; Sivaramakrishnan et al. 2002; Honnareddy and Dubey 2006; Singh et al. 2006; Dubey and Singh 2008), RFLP (Barve et al. 2001; Sharma et al. 2009), amplied fragment length polymorphism (AFLP) (Sivaramakrishnan et al. 2002), intersimple sequence repeats (ISSR) (Barve et al. 2001; Dubey and Singh 2008) and simple sequence repeats (SSR) (Dubey and Singh 2008) have been used to determine the variability of Foc. RAPD analysis has been applied widely in the detection and genetic characterization of phytopathogenic fungi (Benali et al. 2011), including race differentiation in several formae speciales of F. oxysporum, that is, f.sp. cubense (Bentley et al. 1994), dianthi (Migheli et al. 1998), pisi (Grajal-Martin et al. 1993) and vasinfectum (Assigbetse et al. 1994). Recently, Dubey et al. (2010b) developed ITS regionbased markers for the detection of Indian isolates of Foc. Universal rice primers (URPs) have been used to ngerprint diverse genomes and to determine the genetic variability of plant pathogenic fungi (Kang et al. 2002; Sharma et al. 2005; Aggarwal et al. 2010). Therefore, URPs were also selected for studying the molecular diversity of Foc along with other molecular markers such as RAPD, ISSR and SSR. Earlier, Dubey and Singh (2008) analysed 64 isolates of Foc by using RAPD, ISSR and SSR markers. But the isolates did not represent the entire Indian pathogenic populations, as they were collected only from ve chickpea-growing states. However, in the present study, 70 isolates of Foc representing pathogenic and morphological groups of 640 isolates (Dhar 2008; Dubey et al. 2010a) were taken from almost all the major 13 chickpea-growing states of India. Earlier workers did not analyse the virulence of the isolates on a set of differentials used for molecular characterization. Instead, they simply correlated the molecular groups with the virulence information available in the literature (Haware and Nene 1982; Jimenez-Diaz et al. 1993), which was supported by the area-specic distribution of the races. Therefore, in the present study, the isolates representing area and morphological group for the entire country were used for molecular characterization as well as for virulence study on a new set of differential cultivars. The aim of the present study was to analyse the virulence of Foc isolates representing various states/ agroecological regions of India on a new set of chickpea differentials to determine the prevalence of various races and their diversity by using RAPD, URP, ISSR and SSR markers.

Materials and Methods

Fungal cultures

Single-spore cultures of 70 isolates of Foc representing 13 states (Fig. 1) and four pulse-growing agroecological zones, namely North-Eastern Plains Zone (NEPZ), North-West Plains Zone (NWPZ), Central Zone (CZ) and South Zone (SZ) of India, were selected for the present study (Table 1). These isolates are representative populations of 640 isolates of Foc and have been characterized for their morphological features as well as for pathogenicity (Dhar 2008; Dubey and Singh 2008; Dubey et al. 2010a). The isolates were maintained at 4C on potato dextrose agar.
Virulence analysis

The virulence of 70 representative isolates of the pathogen was tested on a new set of 10 differential cultivars of chickpea, namely C104, JG74, CPS1, BG212, WR315, KWR108, GPF2, DCP92-3, Chaffa and JG62, in a net house during the winter seasons of 2009 2010 and 20102011 as per the procedure described by Dubey and Singh (2008). The rst seven cultivars were from the old set of international differentials (Haware and Nene 1982), and the remaining three were new chickpea cultivars added in place of K850, L550 and Annigeri as suggested earlier (Dubey and Singh 2008; Dubey et al. 2010a).
DNA extraction

DNA was extracted from the single-spore pure cultures of Foc isolates multiplied in potato dextrose broth (20g/l; Hi-media) at 25 1C on a shaking incubator (120 rpm) for 7 days by using cetyl trimethyl ammonium bromide (CTAB) method

Fig. 1 Map of India showing states of collection of isolates of Fusarium oxysporum f.sp. ciceris. The values given in the parentheses are indicating number of isolates

578 Table 1 The details of the isolates of zusarium oxysporum f.sp. ciceris used in the present study Place of collection/ District ICRISAT, Hyderabad DOR, Hyderabad Hyderabad Guntur Nilore Bilaspur Bilaspur Raipur IARI New Delhi IARI New Delhi Anand Anand Junagarh Porbander Hisar Rohtak Sikohpur Dumka Darisi Ranchi Ranchi Ranchi Ranchi Bangalore Dharwad Dharwad Gulberga Simoga Raichur Warangal Jabalpur Indore Rewa Sehore Narsingpur Teekamgarh Jabalpur Badnapur Badnapur Satara Amarawati Dhule Faridpur Firojpur Ludhiana Ropar Dumewal Gurdaspur Abohar Jaipur Jaipur Alwar Udaipur Pulse growing agroecological zones SZ SZ SZ SZ SZ CZ CZ CZ NWPZ NWPZ CZ CZ CZ CZ NWPZ NWPZ NWPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ SZ SZ SZ SZ SZ SZ SZ CZ CZ CZ CZ CZ CZ CZ CZ CZ CZ CZ CZ NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ Accession no. Foc 118 Foc 168 Foc 169 Foc 143 61 Foc 144 62 Foc Foc Foc Foc 127 162 161 53 63 64 65 66 67 68 69 70 Table 1 Continued Place of collection/ District Sriganganagar Hanumangarh Churu Sikar Suratgarh Jetsar IIPR Kanpur Jhansi Gorakhpur Shahjahanpur Lucknow Meerut Kanpur Lalitpur Mahoba Jaunpur Dholi Pulse growing agroecological zones NWPZ NWPZ NWPZ NWPZ NWPZ NWPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ NEPZ

Dubey et al.

S.No. 54 55 56 57 58 59 60

States Rajasthan Rajasthan Rajasthan Rajasthan Rajasthan Rajasthan Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Bihar

Accession no. Foc Foc Foc Foc Foc Foc Foc 68 80 87 36 58 79 119

S.No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53

States Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Chhattisgarh Chhattisgarh Chhattisgarh Delhi Delhi Gujarat Gujarat Gujarat Gujarat Haryana Haryana Haryana Jharkhand Jharkhand Jharkhand Jharkhand Jharkhand Jharkhand Karnataka Karnataka Karnataka Karnataka Karnataka Karnataka AndhraPradesh Madhya Pradesh Madhya Pradesh Madhya Pradesh Madhya Pradesh Madhya Pradesh Madhya Pradesh Madhya Pradesh Maharashtra Maharashtra Maharashtra Maharashtra Maharashtra Punjab Punjab Punjab Punjab Punjab Punjab Punjab Rajasthan Rajasthan Rajasthan Rajasthan

Foc 129 Foc 130 Foc 137 Foc 140 Foc 142 Foc 167 Foc 133 Foc 134 Foc 141 Foc 125

Foc 108 Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc 123 163 122 164 41 66 33 23 100 28 46 97 98 126 121 152 150 151 148 149

NWPZ, North West Plains Zone; NEPZ, North East Plains Zone; CZ, Central Zone; SZ- South Zone.

(Murray and Thompson 1980). The DNA was dissolved in TE (10 mM Trishydrochloric acid and 1 mM sodium EDTA, pH 8) and stored at 20C. The quality and quantity of DNA were estimated by spectrophotometer.
RAPD, URP, SSR and ISSR analyses

Foc 155 Foc 156 Foc 157 Foc 158 Foc 153 Foc 160 Foc 170 Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc 124 171 128 165 166 19 31 45 62 89 93 18 4 6 11 50

Four different molecular markers, namely RAPD (20), URPs (12), SSR (4) and ISSR (13), were used to determine the genetic diversity within the Indian populations of Foc (70 isolates) originating from 13 states representing four chickpea-growing regions, namely NWPZ, NEPZ, CZ and SZ. Various concentrations of template DNA (25, 50 and 75 ng), MgCl2 (1.5, 2.5 and 3.5 mM), dNTPs (0.2, 0.4 and 0.6 mM) and primers (5, 10 and 15 pmol) were tested for best amplication according to the method described by Cobb and Clarkson (1994). The PCR mixture (25 ll) for RAPD and URP consisted of 50 ng template DNA, 1.0 U Taq polymerase, 2.5 mM MgCl2, 0.6 mM of each dNTP and 10 pmol of primer in 1x reaction buffer (Bangalore Genei, India). Similar PCR mixture was used for SSR and ISSR with 0.2 mM of each dNTP and 18 pmol primer. The 75 ng template DNA for ISSR and 1.5 mM MgCl2 for SSR were used in the mixture. The PCR was performed by using gradient thermal cycler (Eppendorf epTM, Hamburg, Germany) at 94C for 5 min for initial denaturation followed by 40 cycles (RAPD)/ 35 cycles (URP) at 94C for 1-min denaturation, 35C

Races and Diversity in Fusarium oxysporum f.sp. ciceris

579

(RAPD)/55C (URP) for 1-min annealing and 72C for 2-min extension with an elongation at 72C for 5 min. The initial PCR cycling for SSR and ISSR was as follows: 94C for 5 min for initial denaturation followed by 35 cycles of denaturation at 94C for 2 min for SSR and 5 min for ISSR and extension at 72C for 2 min with an elongation at 72C for 7 min. Appropriate annealing temperatures (Tables 2 and 3) for 2 min were used for each primer set. Amplication products were resolved by electrophoresis on agarose gel (1.25%) in 1x TAE buffer stained with ethidium bromide and photographed under UV light by using BioRad Gel-doc system (CA, USA). A 1-kb (Fermentas) ladder was used as marker. The experiment was repeated twice with each primer before nal scoring. The primers that gave reproducible and scorable amplications were used for the analysis.
Observations and data analysis

Wilt reactions were graded as resistant (020% wilt) and susceptible (>20100% wilt) (Haware and Nene 1982). On the basis of the resistant reactions, the cultivars were identied to differentiate the races of the pathogen. DNA bands that could be scored unequivocally for their presence (1) or absence (0) were included in the analysis. Binary matrices were analysed by NTSYS-PC (version 2.0; Exeter Biological Software, Setauket, NY, USA). Jaccards coefcients were clustered to generate a dendrogram by using SHAN clustering programme through Unweighted paired group method with arithmetic average analysis (UPGMA) (Rohlf 1998).

with resistant reaction. The varieties JG74 and C104, which showed resistant reaction against four isolates from Punjab (NWPZ), two isolates from Rajasthan (NWPZ) and one isolate from Madhya Pradesh (CZ), were considered as differentials for the third group. The cultivars BG212 and KWR108, which differentiated two isolates of Delhi (NWPZ), three isolates of Haryana (NWPZ), one isolate of Punjab (NWPZ), one isolate of Maharashtra (CZ) and three isolates of Uttar Pradesh (NEPZ), were considered as differentials for the fourth group. The varieties WR315 and GPF2 were considered as differentials for the fth group consisting of seven isolates from Rajasthan (NWPZ). The sixth group, which had three isolates from Chhattisgarh (CZ), four isolates from Madhya Pradesh (CZ) and six isolates from Jharkhand (NEPZ), was differentiated by cultivars C104 and KWR 108. The seventh group, which included four isolates from Gujarat (CZ), four isolates from Maharashtra (CZ) and two isolates from Madhya Pradesh (CZ), was differentiated by BG212 and GPF2. Only one isolate from Rajasthan (NWPZ) and two isolates from Punjab (NWPZ) were differentiated by GPF2 and DCP92-3 and placed in the eighth group. Differential cultivars for the isolates representing different races were identied. Thus, based on the differential responses, 70 Foc isolates were categorized into eight races of the pathogen (Table 4).
RAPD analysis

Results
Virulence analysis

The isolates originating from each region/state showed variability in respect of wilt incidence ranging from 0 to 100% with similar reaction patterns during 2009 2010 and 20102011 crop seasons (Table S1). The varieties C104 and GPF2 differentiated all the isolates of Andhra Pradesh (SZ) and Karnataka (SZ) from others by showing resistant reaction and were placed in the rst group. The second group, which had seven isolates from Uttar Pradesh (NEPZ) and one isolate from Bihar (NEPZ), was differentiated by JG74 and GPF2

In PCR amplication with 20 RAPD primers, 915 bands were observed on agarose gel in the range of 0.254 kb (Table 5). The level of polymorphism on 247 DNA fragments amplied was 100%. A representative RAPD prole of the pathogen with OPF1 primer was created (Fig. 2). At 37% genetic similarity, 70 isolates of the pathogen were classied into eight clusters based on UPGMA (Fig. 3). The rst cluster contained 16 isolates from seven different states representing four zones. Thirty-three isolates from nine states representing four zones were included in the second cluster. The third cluster contained 15 isolates from eight different states representing four zones. The seventh cluster had two isolates, one each from Punjab and Rajasthan, while the fourth (Punjab), fth (Bihar),

Table 2 Analysis of polymorphism obtained with SSR primers in isolates of Fusarium oxysporum f.sp. ciceris Primers MB 05 MB 14 MB 17 MB 18 Total SSR, simple sequence repeats. Sequence (5-3) F:ACTTGGAGGAAATGGGCTTC R:GGATGGCGTTTAATAAATCTGG F:CGTCTCTGAACCACCTTCATC R:TTCCTCCGTCCATCCTGAC F:ACTGATTCACCGATCCTTGG R:GCTGGCCTGACTTGTTATCG F:GGTAGGAAATGACGAAGCTGAC R:TGAGCACTCTAGCACTCCAAAC Annealing temperature(C) 54.3 60.2 55.0 60.0 Total bands (no.) 11 4 5 8 23 Polymorphism (%) 100 100 100 100 Size of amplicons (kb) 0.253.0 0.250.6 0.251.0 0.251.5

580 Table 3 Analysis of polymorphism obtained with ISSR primers in isolates of Fusarium oxysporum f.sp. ciceris Name ISSR 1 ISSR 2 ISSR 3 ISSR 4 ISSR 5 ISSR 6 ISSR 7 ISSR 8 ISSR 9 ISSR 10 ISSR 11 ISSR 12 ISSR-13 Total , not amplied; ISSR, intersimple sequence repeats. Table 4 Races of Fusarium oxysporum f.sp. ciceris and their differential cultivars of chickpea Race 1 2 3 4 Differential cultivar C104 and GPF2 JG74 and GPF2 JG74 and C104 BG212 and KWR108 State/Zone Andhra Pradesh (SZ) Karnataka (SZ) Uttar Pradesh (NEPZ) Bihar (NEPZ) Punjab (NWPZ) Rajasthan (NWPZ) Madhya Pradesh (CZ) Delhi (NWPZ) Haryana (NWPZ) Punjab (NWPZ) Maharashtra (CZ) Uttar Pradesh (NEPZ) Rajasthan (NWPZ) Chhattisgarh (CZ) Madhya Pradesh (CZ) Jharkhand (NEPZ) Gujarat (CZ) Maharashtra (CZ) Madhya Pradesh (CZ) Rajasthan (NWPZ) Punjab (NWPZ) Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Foc Sequence (5-3) CCCGCATCC [CA]9 CCCGGA TCC [GA]9 [CA]8G [CT]8AC [CT]8TG [CA]6AC [GA]6GG [GT]6CC [CAC]3GC [CTC]3GC ACTGACTGACTG ACT GACACGACACGA CACGACAC [CAC]5 Annealing temperature (C) 53.0 53.0 53.0 53.7 53.7 42.0 44.0 44.0 38.0 38.0 49.0 61.4 53.0 Total bands (no.) 5 5 7 7 6 9 9 48 Polymorphism (%) 100 100 100 100 100 100 100 100 100 100 100 100 100

Dubey et al.

Size range of amplicons (kb) 0.41.4 0.31.4 0.31.5 0.31.1 0.41.4 0.252.0 0.42.5

Accession numbers 118,143, 144,168,169 and149 121,126,148,150,151 and 52 119,129,130,133.134,141 and142 125 31,45,62 and93 79 and 80 158 53 and 108 33,41 and 66 89 166 137,140 and167 4,6,11,36,50,58 and 87 127,161 and 162 155, 156, 157 and 70 23, 28, 46, 97, 98 and 100 122,123,163 and164 124,128,165 and 171 153 and160 68 18 and19

5 6 7 8

WR315 and GPF2 C104 and KWR108 BG212 and GPF2 GPF2 and DCP92-3

CZ, Central Zone; NEPZ, North-Eastern Plains Zone; NWPZ, North-West Plains Zone; SZ, South Zone.

sixth (Andhra Pradesh) and eighth (Madhya Pradesh) clusters had a single isolate in each.
URP analysis

grouped in the fth cluster. The seventh cluster had only two isolates from Punjab and Rajasthan.
SSR analysis

The URPs amplied all the isolates of Foc, and the isolates were highly variable in respect of banding proles. A total of 171 bands with 100% polymorphism were obtained using 12 URPs. The size of amplicons ranged from 0.25 to 5 kb (Table 6). The primer URP 2R amplied all the isolates and showed good amplication pattern (Fig. 4). The dendrogram derived from UPGMA grouped the isolates into eight clusters at 40% genetic similarity (Fig. 5). The rst, third, sixth and eighth clusters had a single isolate in each. The second cluster consisted of 13 isolates from six states representing four zones. The fourth cluster had the maximum of 35 isolates from 10 states representing four zones, while 16 isolates from nine states representing four zones were

All SSR primers were found to be polymorphic (100%). A total of 23 bands ranging from 0.25 to 3 kb in size were amplied by using four different sets of SSR primers (Table 2). A representative SSR prole of 70 Fusarium wilt pathogen isolates of chickpea with MB18 primer was created (Fig. 6). UPGMA of the banding pattern grouped 70 isolates into eight clusters at 32% genetic similarity (Fig. 7). The rst cluster had 10 isolates from six states representing four zones. The second cluster had four isolates from three different states representing two zones. The third cluster consisted of 21 isolates from 10 states representing four zones. The fourth cluster included six isolates from four states representing three zones. The fth cluster

Races and Diversity in Fusarium oxysporum f.sp. ciceris Table 5 Analysis of polymorphism obtained with RAPD primers in isolates of Fusarium oxysporum f.sp. ciceris Name of primer OPA 3 OPA 12 OPB 17 OPE 7 OPF 1 OPF10 OPF 12 OPF 16 OPM 6 OPM 12 OPM 14 OPM 20 OPN 4 OPN15 OPN 20 P1 P 15 P 17 M 13 OPY 10 Total RAPD, random amplied polymorphic DNA. Sequence (5-3) AGTCAGCCAC TCGGCGATAG AGGGAACGGA AGATGCAGCC ACGGATCCTG GGAAGCTTGG ACGGTACCAG GGAGTACTGG CTGGGCAACT GGGACGTTGG AGGGTCGTTC AGGTCTTGGG GACCGACCCA CAGCGACTGT GGTGCTCCGT CGTTGGATGC GTCGTCGTCGTCGTC TACGGCTGGC GAGGGTGGCGGTTCT CAAACGTGGG Total bands (no.) 12 13 11 12 14 09 15 15 11 13 14 14 14 15 13 14 12 12 14 12 247 Polymorphism (%) 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

581

Size range of amplicons (kb) 0.43.0 0.253.0 0.353.5 0.253.5 0.304.0 0.453.5 0.44.0 0.33.5 0.33.0 0.352.5 0.253.0 0.33.5 0.253.5 0.44.0 0.353.0 0.33.5 0.43.0 0.43.0 0.253.0 0.254.0

Fig. 2 DNA prole generated by random amplied polymorphic DNA (RAPD) primer (OPF 1); M = marker-1 kb; Lanes 15 and 30 (Andhra Pradesh), 68 (Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842 (Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

consisted of 21 isolates from six states representing four zones. The sixth cluster had only two isolates from two states and zones. The seventh cluster consisted of ve isolates from three states representing three zones. The eighth cluster had a single isolate from Madhya Pradesh.
ISSR analysis

Seven of the 13 ISSR primers amplied a total of 48 bands ranging from 0.25 to 2.5 kb in size. With each primer, 59 bands were obtained and a representative ISSR prole of 70 Foc isolates with primer ISSR3 was created (Fig. 8). All the 48 bands were polymorphic and showed 100% polymorphism (Table 3). UPGMA of the ISSR data separated the Foc isolates into eight clusters at 37% genetic similarity (Fig. 9). The rst cluster consisted of 22 isolates from nine different states representing four zones. The second cluster contained 12 isolates from six different states representing all zones. The third cluster contained six isolates from ve different states representing four zones. The fourth cluster consisted of 21 isolates from 10 states representing four zones. The sixth cluster contained six isolates from four different states representing three zones, while the fth, seventh and eighth clusters had a single isolate in each.

Because varieties of chickpea are being evaluated and released for each chickpea-growing zones of India, the isolates were categorized according to their zone of origin. The populations of Foc included in the present study were grouped into eight clusters by using four sets of molecular markers. The genetic similarity dropped to 40% as minimum subclusters were formed in each major cluster that partially corresponded to the races of the pathogen. Of the seventy isolates, 22 were from NWPZ, 17 from NEPZ, 19 from CZ and 12 from SZ. The majority of the isolates (33) were clustered in the second group by using RAPD analysis. This group contained the maximum number of isolates from NWPZ (15 of 22) and NEPZ (9 of 17). Eight isolates of CZ and one isolate from SZ were also included in this group. All the 33 isolates of this cluster were common in the fourth cluster generated by URP analysis, while 17 isolates were common in the third group and the fourth group generated by SSR and ISSR, respectively. The rst cluster of RAPD groups contained 16 isolates, of which maximum nine isolates were from SZ followed by four isolates from NEPZ, two isolates from NWPZ and a single isolate from CZ. The majority (9 of 12) of isolates from SZ (Andhra Pradesh and

582

Dubey et al.

Fig. 3 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with 20 random amplied polymorphic DNA (RAPD) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentage of Jaccards similarity coefcient. Vertical scale representing numbers (Foc 170) and state/zone of origin of the isolates (AP, Andhra Pradesh; CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand, KN, Karnataka, MP, Madhya Pradesh; MH, Maharashtra; PB, Punjab; RJ, Rajasthan, UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone; SZ, South Zone)

Table 6 Analysis of polymorphism obtained with URP primers in isolates of Fusarium oxysporum f.sp. ciceris Primer URP URP URP URP URP URP URP URP URP URP URP URP Total URP, universal rice primers. 1F 2F 2R 4R 6R 9F 13R 17R 25R 30F 32F 38F Sequence (5-3) ATCCAAGGTCCGAGACAACC GTGTGCGATCAGTTGCTGGG CCCAGCAACTGATCGCACAC GGCAAGCTGGTGGGAGGTAC GGCAAGCTGGTGGGAGGTAC ATGTGTGCGATCAGTTGCTG TACATCGCAAGTGACACAGG AATGTGGGCAAGCTGGTGGT GATGTGTTCTTGGAGCCTGT GGACAAGAAGAGGATGTGGA TACACGTCTCGATCTACAGG AAGAGGCATTCTACCACCAC Total bands (no.) 15 15 13 15 15 15 13 10 18 13 15 14 171 Polymorphism (%) 100 100 100 100 100 100 100 100 100 100 100 100 Size range of amplicons (kb) 0.253.5 0.253.0 0.253.5 0.254.0 0.253.5 0.255.0 0.254.0 0.252.5 0.253.5 0.253.5 0.253.5 0.255.0

Karnataka) were grouped in this cluster. Of the sixteen isolates, 13 were common in both RAPD and URP, while nine and 10 were common in the rst

cluster and the second cluster of SSR and ISSR, respectively. Altogether, six isolates were commonly clustered by using four primers. Of the fteen isolates

Races and Diversity in Fusarium oxysporum f.sp. ciceris

583

Fig. 4 DNA prole generated by primer universal rice primers (URP) 2R; M = marker-1 kb; Lanes 15 and 30 (Andhra Pradesh), 68 (Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842 (Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

Fig. 5 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with 12 universal rice primers (URP) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentage of Jaccards similarity coefcient. Vertical scale representing numbers (Foc 170) and state of origin of the isolates (AP, Andhra Pradesh; CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand; KN, Karnataka; MP, Madhya Pradesh; MH, Maharashtra; PB, Punjab; RJ, Rajasthan; UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone; SZ, South Zone)

included in the third RAPD group, nine were from CZ followed by three from NEPZ, two from NWPZ and a single isolate from SZ. This group partially corresponded to the fourth group of URPs, the fth group of SSR and the rst group of ISSR analysis. Altogether, six isolates were common for all the markers. An isolate from NWPZ (Foc18, Punjab) belonging to race eight grouped separately in RAPD

(fourth cluster) and URP (third cluster) analyses. This isolate was placed in the second cluster of SSR and the third cluster of ISSR along with other isolates. The fth, sixth and seventh clusters of RAPD and URP analyses represented the isolates of race 2, race 1 and race 3, respectively. The eighth cluster of RAPD and URPs and the remaining clusters of SSR and ISSR analyses had isolates from different parts

584

Dubey et al.

Fig. 6 DNA prole generated by simple sequence repeats (SSR) primer MB18; M = marker-1 kb; Lanes 15 and 30 (Andhra Pradesh), 68 (Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842 (Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

Fig. 7 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with four simple sequence repeats (SSR) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentage of Jaccards similarity coefcient. Vertical scale representing numbers (Foc 170) and state of origin of the isolates (AP, Andhra Pradesh; CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand; KN, Karnataka; MP, Madhya Pradesh; MH, Maharashtra; PB, Punjab; RJ, Rajasthan; UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone; SZ, South Zone)

of the country representing various races of the pathogen.

Discussion
Virulence analysis on a new set of chickpea differential cultivars indicated the existence of highly variable Foc populations across India. The isolates were grouped into eight races, and the differential cultivars for each race were identied. All the isolates originat-

ing from SZ (Andhra Pradesh and Karnataka) were designated as race 1. Most of the isolates included in race 1 corresponded to the rst molecular group of RAPD, SSR and ISSR but to the second molecular group of URPs. A majority of the isolates from Uttar Pradesh and Bihar (NEPZ) grouped in race 2 and partially corresponded to the second molecular group. Four isolates from Punjab, two isolates from Rajasthan (NWPZ) along with one isolate from

Races and Diversity in Fusarium oxysporum f.sp. ciceris

585

Fig. 8 DNA prole generated by primer intersimple sequence repeats (ISSR) 3; M = marker- 1 kb; Lanes 15 and 30 (Andhra Pradesh), 68 (Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842 (Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

Fig. 9 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with 13 intersimple sequence repeats (ISSR) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentage of Jaccards similarity coefcient. Vertical scale representing numbers (Foc 170) and state of origin of the isolates (AP, Andhra Pradesh; CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand; KN, Karnataka; MP, Madhya Pradesh; MH, Maharashtra; PB, Punjab; RJ, Rajasthan; UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone; SZ, South Zone)

Madhya Pradesh (CZ) were placed in race 3. Six isolates from NWPZ (two from Delhi, three from Haryana and one from Punjab), three isolates from NEPZ (Uttar Pradesh) along with one isolate from CZ (Maharashtra) were designated as race 4. Most of the isolates of this race corresponded to the second and the third molecular groups. Seven NEPZ (Rajasthan) isolates were grouped in race 5. Seven isolates from CZ (three from Chhattisgarh and four from Madhya Pradesh) along with six isolates from NEPZ

(Jharkhand) were grouped in race 6. Race 7 had 10 isolates only from CZ (4 from Gujarat, 4 from Maharashtra and 2 from Madhya Pradesh). Race 8 had three isolates only from NWPZ (one from Rajasthan and two from Punjab). Therefore, the races partially corresponded to the chickpea-growing zones of the country as well as the molecular groups generated using four different types of markers. Previous studies based on old differentials showed the presence of eight races of the pathogen worldwide, of which only

586

Dubey et al.

4, namely 1A, 2, 3 and 4, were reported from India (Haware and Nene 1982; Phillips 1988). Previous experimental ndings (Honnareddy and Dubey 2006; Dubey and Singh 2008; Dubey et al. 2010a) showed that the reactions on earlier reported (Haware and Nene 1982) international differential cultivars of chickpea were not able to distinguish the isolates into known races of the pathogen. It was suggested that the international differentials, which were developed during 1982, should be modied with new cultivars of chickpea to obtain distinct differential reactions for the changed populations of the pathogen (Dubey and Singh 2008; Dubey et al. 2010a). Accordingly, the present study was conducted using a modied new set of differential cultivars. The present set of differential cultivars clearly distinguished the existing Indian populations of Foc into eight races instead of four races reported earlier. The differential cultivars standardized for each race in the present study should be tested against the foreign population of the pathogen reported as distinct races. The new distribution pattern of the Indian races of the pathogen is likely to be utilized in resistance breeding programmes. All the four sets of molecular markers used in the present study were found suitable for diversity analysis. Although these markers gave somewhat similar groupings, RAPD and URPs were more efcient for polymorphism and partially grouped the isolates into different race-specic clusters. None of the molecular markers was able to group the isolates consistent with its virulence group, but each molecular group was predominated by a specic race of the pathogen. Most of the isolates belonging to the races 1 and 6 were clustered separately by the use of the four sets of markers. The isolates of race 6 of the pathogens originated from the central part of India, whereas the isolates of race 1 originated from southern India. The isolates from northern India were grouped together by the use of primers and were predominated by the races 2, 3, 4 and 8. Earlier workers also could not establish a strong correlation between molecular and pathogenic groups in respect of Fusariumhost interactions (Jimenez-Gasco et al. 2001, 2004b; Sharma et al. 2009; Datta et al. 2011). Virulence analysis on a set of cultivars is required to authenticate the groups generated by the molecular markers (AbdElsalam et al. 2004). The present study revealed that molecular markers alone are not suitable for the characterization of the races of Foc. Further work is needed to determine the virulence factors for designing specic molecular markers to distinguish different races of the pathogen. The molecular groups generated in the present study only partially corresponded to the chickpea cultivation zones of India. The present ndings are in accordance with the observations made by earlier workers working on Fusarium species that molecular groups were not clearly correlated with the pathogenicity and geographic origin of the isolates (Migheli et al. 1998; Cramer et al. 2003). The genetic variability and phylogenetic relationship existing among the earlier known eight pathogenic

nez-Gasco races of the pathogen were analysed by Jime et al. (2004a), who inferred intraspecic phylogeny in each of the races forming a monophyletic lineage. Moreover, the virulence of races to resistant chickpea cultivars was acquired in a simple stepwise pattern, with few parallel gains or losses. Unlike other pathosystems, Focchickpea had only limited probabilities of obtaining parallel changes in virulence. The ndings of Lebeda and Petrzelova (2004) clearly indicated variability in spatially isolated populations and within the populations of Bremia lactucae, and also geographic differences in virulence. In the present study, differences in virulence were observed among Foc isolates originating from southern and northern parts of India. Similar to the observations made by Lebeda and Petrzelova (2004) in the case of B. lactucae, the distribution of virulence within and among the populations of Foc is probably the result of different selection pressures exerted by a specic resistant gene in the chickpea varieties cultivated in an area. Of the four markers evaluated, RAPD and URPs showed more or less similar grouping patterns because more than 95% of the isolates shared common clustering. SSR and ISSR markers were also found suitable to determine the genetic diversity with approximately 50% isolates showing common grouping patterns. Considering all the four markers together, 34% (24 of 70 isolates) of isolates shared common grouping pattern. (Bayraktar et al. 2008) analysed the genetic variability of Foc isolated from Turkey by using RAPD and ISSR markers. The molecular groups were not correlated with different geographic regions. It is evident from the present study that the molecular groups partially corresponded to the places of origin/zones of the isolates. In addition, the fact that the molecular groups also had isolates from various parts of the country representing different races indicated the migration of the population from one part to other parts of the country through infected seeds and contaminated soils. The present study clearly re-characterized the Indian populations of Foc into eight races on the basis of virulence analysis on a new set of 10 differential cultivars of chickpea. The racial distribution patterns partially corresponded to the chickpea-growing zones of India. Diversity analyses carried out using RAPD, URPs, SSR and ISSR markers also grouped the isolates into eight clusters, and these clusters partially corresponded to the chickpea-growing zones as well as races of the pathogen. Similarly, the groups generated by virulence and molecular analyses partially corresponded to each other when all the four markers were considered together.
Acknowledgement
Authors are thankful to ICAR, New Delhi, India, for nancial support through outreach project.

References
Abd-Elsalam KA, Omar MR, Migheli Q, Nirenberg HI. (2004) Genetic characterization of Fusarium oxysporum f.sp. vasinfectum

Races and Diversity in Fusarium oxysporum f.sp. ciceris isolates by random amplication of polymorphic DNA (RAPD) and amplied fragment length polymorphism (AFLP). J Plant Dis Prot 111:534544. Aggarwal R, Tripathi A, Yadav A. (2010) Pathogenic and genetic variability in Tilletia indica monosporidial culture lines using universal rice primer-PCR. Eur J Plant Pathol 128:333342. Assigbetse KB, Fernandez D, Dubois MP, Geiger JP. (1994) Differentiation of Fusarium oxysporum f.sp. vasinfectum races on cotton by random amplied polymorphic DNA (RAPD) analysis. Phytopathology 84:622626. Barve MP, Haware MP, Sainani MN, Ranjekar PK, Gupta VS. (2001) Potential of microsatellites to distinguish four races of Fusarium oxysporum f.sp. ciceri prevalent in India. Theor Appl Genet 102:138147. Bayraktar H, Dolar FS, Maden S. (2008) Use of RAPD and ISSR markers in detection of genetic variation and population structure among Fusarium oxysporum f. sp. ciceris isolates on chickpea in Turkey. J Phytopathol 156:146154. Benali S, Mohamed B, Eddine HJ, Neema C. (2011) Advances of molecular markers application in plant pathology research. Eur J Sci Res 50:110123. Bentley S, Pegg KG, Dale JL. (1994) Optimization of RAPD ngerprinting to analyze genetic variation within populations of Fusarium oxysporum f.sp. cubense. J Phytopathol 142:6478. Cobb BD, Clarkson JM. (1994) A simple procedure for optimizing the polymerase chain reaction (PCR) using modied Taguchi methods. Nucleic Acids Res 22:38013805. Cramer RA, Byrne PF, Brick MA, Panella L, Wickliffe E, Schwartz HF. (2003) Characterization of Fusarium oxysporum isolates from common bean and sugar beet using pathogenicity assays and random-amplied polymorphic DNA markers. J Phytopathol 151:352 360. Datta S, Choudhary RG, Shamim M, Singh RK, Dhar V. (2011) Molecular diversity in Indian isolates of Fusarium oxysporum f.sp. lentis inciting wilt disease in lentil (Lens culinaris Medik). Afr J Biotechnol 10:73147323. Dhar V. (2008) Wilt of crops with special reference to cultural, morphological, molecular characterization and pathogenic variability of isolates in India, Final technical report (20042008), ICAR ad-hoc project, pp 6885. Dubey SC, Singh SR. (2008) Virulence analysis and oligonucleotide ngerprinting to detect diversity among Indian isolates of Fusarium oxysporum f.sp. ciceris causing chickpea wilt. Mycopathologia 165:389406. Dubey SC, Singh SR, Singh B. (2010a) Morphological and pathogenic variability of Indian isolates of Fusarium oxysporum f. sp. ciceris causing chickpea wilt. Arch Phytopathology Plant Protect 43:174189. Dubey SC, Tripathi A, Singh SR. (2010b) ITS RFLP ngerprinting and molecular markers for detection of Fusarium oxysporum f. sp. ciceris. Folia Microbiol 55:629634. Grajal-Martin MJ, Simon CJ, Muehlbauer FJ. (1993) Use of random amplied polymorphic DNA (RAPD) to characterize race 2 of Fusarium oxysporum f.sp. pisi. Phytopathology 83:612614. Haware MP, Nene YL. (1980) Inuence of wilt at different stages on the yield loss in chickpea. Trop Grain Legume Bull 19:3840. Haware MP, Nene YL. (1982) Races of Fusarium oxysporum f.sp. ciceri. Plant Dis 66:809810. Honnareddy N, Dubey SC. (2006) Pathogenic and molecular characterization of Indian isolates of Fusarium oxysporum f.sp. ciceris causing chickpea wilt. Curr Sci 91:661666. Jimenez-Diaz RM, Alcala-Jimenez AR, Hervar A, Trapero-Casas JL. (1993) Pathogenic variability and host resistance in the Fusarium

587 oxysporum f.sp. ciceri/Cicer arietinum pathosystem. In: Arseniuk E, Goral T, (ed.) Third Proceedings of European seminar: Fusariummycotoxins Taxonomy, Pathogenicity and Host Resistance. Rodzikov, Poland: Plant Breeding and Acclimatization Institute, pp 8794. Jimenez-Gasco MM, Perez-Artes E, Jimenez-Diaz RM. (2001) Identication of pathogenic races 0, 1B/C, 5 and 6 of Fusarium oxysporum f.sp. ciceri with random amplied polymorphic DNA (RAPD). Eur J Plant Pathol 107:237248. Jimenez-Gasco MM, Milgroom MG, Jimenez-Diaz RM. (2004a) Stepwise evolution of races in Fusarium oxysporum f.sp ciceris inferred from ngerprinting with repetitive DNA sequences. Phytopathology 94:228235. nez-Gasco MM, Navas-Corte s JA, Jime nez-D az RM. (2004b) Jime The Fusarium oxysporum f.sp. ciceris/Cicer arietinum pathosystem: a case study of the evolution of plant-pathogenic fungi into races and pathotypes. Int Microbiol 7:95104. Kang HW, Park DS, Go SJ, Eun MY. (2002) Fingerprinting of diverse genomes using PCR with universal rice primers generated from repetitive sequence of Korean weedy rice. Mol Cell 13:281 287. Lebeda A, Petrzelova I. (2004) Variation and distribution of virulence phenotypes of Bremia lactucae in natural populations of Lactuca serriola. Plant Pathol 53:316324. Migheli Q, Briatore E, Garibaldi A. (1998) Use of random amplied polymorphic DNA (RAPD) to identify races 1, 2, 3 and 8 of Fusarium oxysporum f.sp. dianthi in Italy. Eur J Plant Pathol 104:49 57. Murray MG, Thompson WF. (1980) Rapid isolation of high molecular weight DNA. Nucleic Acids Res 8:43214325. Phillips JC. (1988) A distinct race of chickpea wilt in California. Int Chickpea Newslett 18:1921. Rohlf FJ. (1998) NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System. Version 2.02. Setauket, NY, Exeter Software. Sharma M, Gupta SK, Sharma TR. (2005) Characterization of variability in Rhizoctonia solani by using morphological and molecular markers. J Phytopathol 153:449456. Sharma M, Varshney RK, Rao JN, Kannan S, Hoisington D, Pande S. (2009) Genetic diversity in Indian isolates of Fusarium oxysporum f.sp. ciceris, chickpea wilt pathogen. Afr J Biotechnol 8:1016 1023. Singh KB, Dahiya BS. (1973) Breeding for wilt resistance in chickpea. In: Symposium on Problem and Breeding for Wilt RESISTANCE in Bengal Gram. New Delhi, IARI, pp 1314. Singh BP, Saikia R, Yadav M, Singh R, Chauhan VS, Arora DK. (2006) Molecular characterization of Fusarium oxysporum f.sp. ciceri causing wilt of chickpea. Afr J Biotechnol 5:497502. Sivaramakrishnan S, Kannan S, Singh SD. (2002) Genetic variability of Fusarium wilt pathogen isolates of chickpea (Cicer arietinum L.) assessed by molecular markers. Mycopathologia 155:171178.

Supporting Information
Additional Supporting Information may be found in the online version of this article: Table S1. Reaction of chickpea varieties against different isolates of Fusarium oxysporum f.sp. ciceris. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.