Você está na página 1de 6

Colgio Municipal de Adustina

Prof: Edlamar Santana Disciplina: EDUCAO FSICA Srie: 3 ANO Data: Turno: VESPERTINO Turma: / 06 /13

ALUNO: _________________________________________________________ ALUNO ALU

Aluno:____________________________________________________ AVALIAO DA II UNIDADE ___________________________ As questes devem ser respondidas no espao preparado, visto que suficiente e adequado. VER_________ Valem (0,3 ponto).Sendo 10 questes dissertativas e 10 questes subjetivas com igual valor. ______MMMMMMMM_____________________________________ _____________________________________________

CLULAS IMORTAIS CONTAM AOS CIENTISTAS A HISTRIA DA EVOLUO DA HUMANIDADE


Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo") O processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. O DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula.

01-

(Unicamp 96) Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir: Por que essas etapas comeam no ncleo? Justifique.

Por quer o ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA.

02-

(G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqncia de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as seqncias de bases do RNA por ele produzido?

UGA GGC GAA

ACU CCG CUU

03-

(Unitau 95) Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.

123-

FOSFATO DESOXIRRIBOSE BASE NITROGENADA

04-

(G2) O que representa o desenho a seguir? Qual o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo que se trata da unidade estrutural do cido desoxirribonuclico (DNA)?

FOSFATO 5- DESOXIRRIBOSE 6- BASE NITROGENADA


4-

05-

(Ufrn 2005) O teste de paternidade usando o DNA tornou-se muito freqente hoje. No entanto, as pessoas tm muitas dvidas a respeito desse tipo de exame. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www.gene.com.br). Justifique como mito ou verdade as alternativas a seguir: I. "O exame de DNA s pode ser feito com sangue." II. "Sou primo da me e estou com medo do resultado ser positivo, mesmo que eu no seja o verdadeiro pai." III. "Ele j morreu e no deixou nenhum outro parente vivo. Nunca poderei provar que ele era o pai do meu filho."

1-MITO - teste de paternidade atravs do DNA, eito com qualquer tecido do organismo humano. 2-MITO o filho apresenta 50% do seu material gentico proveniente do pai e 50% proveniente da me, logo o primo tem semelhanas genticas inferiores a 50%. 3-MITO - o material gentico pode ser colhido de cadveres, em ossos e cabelos.

06-

(Unesp 97) A anlise qumica em amostras de cinco lminas com cidos nuclicos apresentou os seguintes resultados: 1. lmina: ribose 2. lmina: uracila 3. lmina: dupla-hlice 4. lmina: timina 5. lmina: 15% de guanina e 25% de citosina. a) Entre estas lminas, quais se referem a DNA?

Contm DNA as lminas de nmeros 3 e 4.

b) Justifique o resultado obtido com a 5. lmina.

As propores desiguais de CG indicam a presena de acido nucleico formado por hlice simples , podendo ser DNA ou RNA 07-

(Unesp 90) A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases: Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanas entre estas duas molculas de DNA? Justifique sua resposta.

Podemos afirmar que as bases adenina = timina e citosina= guanina e juntas formam 100% de bases nitrogenadas nas duas molculas.

08-

(G2) Considere um segmento de DNA com a seguinte seqncia de bases nitrogenadas: ATT CTA CGC AAA GGC a) Quais so as bases da cadeia complementar a esse segmento?

TAA GAT GCG TTT CCG


b) Se o segmento dado servir de molde para a produo de RNA, qual ser a seqncia de bases desse RNA?

UAA GAU GCG UUU CCG


09(Fuvest 95) No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores?

Na fita dever existir 18% de guanina, 32 % de adenina e 32% de timina.

10-

(G2) Para funcionar como material gentico o DNA apresenta duas propriedades fundamentais. So elas: I - AUTODUPLICAO II TRANSCRIO Explique essas duas propriedades.

A autoduplicao permite que o DNA produza cpias e possa ser transmitido descendncia. Transcrio a capacidade do DNA produzir o RNA que ser traduzido. em

11-

(UFSC 2008) Todas as formas de vida do nosso planeta tm suas informaes genticas codificadas nas seqncias de bases nitrogenadas dos cidos nuclicos. Assinale as proposies CORRETAS, considerando as informaes abaixo:

Seqncia 1 - AAAGATCCCGAATCGGTCGGCGATTTATCG Seqncia 2 - TTTCTAGGGCTTAGCCAGCCGCTAAATAGC


01) As seqncias 1 e 2 so complementares no DNA e, juntas, representam um segmento de molcula de DNA. 02) Se considerarmos 1 a seqncia molde, o RNAm formado por esta seqncia conter as mesmas bases nitrogenadas da seqncia 2, trocando-se a timina pela uracila. 04) Na seqncia 1 esto representados 30 cdons e 10 nucleotdeos. 08) A seqncia 1 pode ser a representao de um DNA ou de um RNA, dependendo de como for lida. 16) O cdigo gentico exclusivo de cada espcie. Prova disso que determinados aminocidos, como por exemplo, a fenilalanina, so encontrados apenas na espcie humana. 32) Adenina, timina, citosina e guanina so aminocidos essenciais, presentes em todos os seres vivos. 64) Com o seqenciamento do genoma humano foi possvel determinar a seqncia de aminocidos de todas as protenas humanas.

12-

(UEL 2008) Considere a seqncia de bases da fita no molde do DNA de um organismo procarioto: - AAT CCG ACG GGA. Quais seriam as seqncias de bases da fita complementar do DNA, que serve de molde para transcrio, e da fita simples de RNAm transcrito?

a) Fita molde - 3 - TTA GGC TGC CCT - 5 e RNA 5 UUT CCG UCG GGU - 3. b) Fita molde - 3 - UUA GGC UGC CCU - 5 e RNA 5 TTA GGC TGC CCT - 3. c) Fita molde - 3 - AAT CCG ACG GGA - 5 e RNA 5 UUA GGC UGC CCU -3. d) Fita molde - 3 - TTA GGC TGC CCT - 5 e RNA 5 AAU CCG ACG GGA -3. e) Fita molde - 3 - AAU CCG ACG GGA - 5 e RNA 5 TTA GGC TGC CCT - 3.

13-

(UNICENTRO 2007) Com relao a genes, cidos nucleicos e o fluxo da informao gentica, correto afirmar: a) que a diferena entre as bases pricas e pirimdicas est no nmero de pontes de hidrognio, sendo 3 pontes de hidrognio para as bases pricas e 2 pontes de hidrognio para as bases pirimdicas. b) que a duplicao do DNA bidirecional e semiconservativa. c) que o fluxo da informao gentica no ocorre, em circunstncia alguma, de RNA para DNA, mas ocorre sempre de DNA para RNA. d) que, em eucariotos, os genes so transcritos no citoplasma. e) que, composicionalmente, DNA e RNA diferem entre si apenas pela presena das bases nitrogenadas Timina e Uracila, respectivamente.

14-

(UNIOESTE 2008) Escolha a alternativa cujas associaes entre as duas colunas esto todas corretas. COLUNA 1: a. cdigo gentico b. ribossomo c. traduo d. cdon e. anticdon COLUNA 2: I. Organela que traduz a fita de RNAm. II. Sntese de protenas a partir da leitura de RNAm. III. Trinca de nucleotdeos, em RNAm, que codifica um aminocido. IV. Correspondncia entre cdons e aminocidos por eles codificados. V. Trinca de nucleotdeos no RNAt, complementar ao RNAm.

a) a-V; b-III; c-II; d-I; e-IV. b) a-III; b-II; c-II; d-V; e-IV. c) a-V; b-IV; c-III; d-II; e-I d) a-IV; b-I; c-II; d-III; e-V. e) a-I; b-II; c-III; d-IV; e-V.

15-

(UFSC 2009) O DNA a molcula biolgica responsvel pela codificao da informao gentica nos seres vivos. Sobre esse assunto, CORRETO afirmar que: MARQUE AS ALTERNATIVAS CORRETAS: 01) a molcula de DNA formada por duas cadeias caracterizadas por sequencias de bases nitrogenadas. 02) na molcula de DNA podem existir oito diferentes tipos de complementao de bases nitrogenadas. 04) a quantidade de adenina presente em uma das cadeias exatamente igual quantidade de timina da cadeia complementar. 08) na molcula de DNA podem existir cinco diferentes tipos de bases nitrogenadas. 16) no processo de mitose, cada molcula de DNA d origem a quatro molculas de DNA exatamente iguais.

16-

(UEPG 2008) A respeito da molcula de DNA, assinale o que for correto. MARQUE AS ALTERNATIVAS CORRETAS. 01) Durante a duplicao do DNA, as pontes de hidrognio que ligam as bases nitrogenadas se rompem, e as duas fitas se separam. Cada uma das fitas originais, ento separadas, serve agora como molde para a produo de fitas novas. 02) Alm da capacidade de se duplicar, o DNA tambm fabrica RNA. A duplicao uma propriedade que permite a transmisso da informao gentica s clulas-filhas, ao passo que a produo de RNA relaciona-se sntese de protenas, no citoplasma. 04) O DNA uma molcula constituda por duas cadeias de nucleotdeos, em cada uma das quais os nucleotdeos esto ligados uns aos outros pelos fosfatos. As duas cadeias esto ligadas uma outra pelas suas bases nitrogenadas, por meio de pontes de hidrognio, e essas ligaes ocorrem entre pares de bases especficas. Sendo assim, a adenina liga-se somente timina, e a citosina liga-se sempre guanina. Toda essa estrutura apresenta-se torcida e em forma de dupla-hlice. 08) O DNA sempre tem a forma de dupla-hlice e sempre constitudo por apenas quatro tipos de nucleotdeos. Na verdade, uma molcula de DNA pode diferir da outra pelo nmero total de nucleotdeos. Embora o menor DNA conhecido tenha ao redor de 5.500 nucleotdeos, a maioria das molculas de DNA tem algumas centenas de milhares de nucleotdeos. Assim, varia muito o tamanho de uma molcula para outra. Alm do tamanho, as molculas de DNA diferem pela sequencia dos pares de bases.

17-

(UTFPR 2008) Os cidos nucleicos so macromolculas essenciais vida. Todos os organismos vivos contm cidos nucleicos na forma de DNA (cido desoxirribonucleico) e RNA (cido ribonucleico). Alguns vrus s contm DNA, enquanto outros s possuem RNA. Sobre as funes do DNA e do RNA esquematizadas a seguir foram feitas as seguintes afirmativas:

I) A duplicao do DNA (em 1) semiconservativa, cada nova molcula contm metade da velha. II) O processo de transcrio (em 2) acontece somente com a presena da enzima transcriptase reversa.

III) A traduo (em 3) transforma uma sequencia de nucleotdeos em uma sequencia de aminocidos. IV) As protenas so macromolculas formadas pela unio de aminocidos unidos por ligaes peptdicas. V) DNA e RNA so macromolculas formadas por unidades chamadas nucleotdeos. Esto corretas somente as afirmativas: a) I, II, III e IV. b) I, III, IV e V. c) II, III e V. d) III, IV e V. e) I, II, III e V.

18-

(UEMS) Indique a caracterstica abaixo que no est relacionada ao RNA:

a) encontrado no nuclolo, cromossomas e citoplasma. b) Suas bases pirimdicas so citosina e uracila. c) Cora-se pela reao de Feulgen. d) Tm sequncias de nucleotdeos que codificam sequncias especficas de aminocidos. e) Tem fita nica e pareamento de bases.

19- (UFMS) Com relao natureza do material gentico assinale as alternativas corretas.
(01) Alm das diferenas na sua composio qumica, o DNA e o RNA apresentam diversidade quanto sua estrutura molecular. (02) As caractersticas funcionais de uma protena variam conforme o nmero e a posio dos aminocidos na sua molcula. (04) Os aminocidos possuem na sua composio qumica bsica o grupo cido carboxlico (COOH), o grupo amino (NH2), bsico, e a diferena entre um aminocido e outro est no Radical (R) que se liga a esses grupos. (64) Quem determina a sequencia, o nmero e os tipos de aminocidos que fazem parte da composio da protena a sequencia de bases do RNA mensageiro que lhe deu origem.

20- (Unicap-PE) Julgue as afirmativas: Como verdadeiras ( V ) ou falsas (F ).


( V ) A engenharia gentica permite introduzir genes artificialmente construdos em outras clulas, nas quais eles podero realizar os processos de replicao e transcrio. ( F ) Clonagem molecular a transferncia de genes de um organismo para outro. Sem alterao do seu gentipo. ( V ) O projeto genoma tem como objetivo principal localizar, nos 23 pares de cromossomos, os 100 mil genes humanos.

A avaliao no dever medir a quantidade de acertos, e sim o repensar sobre os acertos e possveis enganos cometidos com o entendimento do momento em relao atividade proposta. Esse entendimento poder amadurecer e alcanar um nvel superior a partir das reflexes em anlise. Acredito na avaliao como forma de reflexo confirmao do conhecimento e aprendizagem. DESEJO UMA BOA REFLEXO PARA TODOS. PROF EDLAMAR SANTANA