Protein Expression and PuriWcation 47 (2006) 303310 www.elsevier.

com/locate/yprep

Gi/o proteins: Expression for direct activation enquiry

Lorenzo Di Cesare Mannelli a,,1, Alessandra Pacini b,1, Annarita Toscano b, Martina Fortini c, Debora Berti c, Carla Ghelardini a, Nicoletta Galeotti a, Piero Baglioni c, Alessandro Bartolini a
b a Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50134 Florence, Italy Department of Anatomy, Histology and Forensic Medicine, Anatomy Section, University of Florence, Viale Morgagni 85, 50134 Florence, Italy c Department of Chemistry and CSGI, University of Florence, Via della Lastruccia 3, 50019 Sesto F.no, Italy

Received 8 September 2005, and in revised form 7 November 2005 Available online 5 December 2005

Abstract G protein-mediated pathways are fundamental mechanisms of cell signaling. In this paper, the expression and the characterization of the i1, i3, o1, 1, and 2 subunits of the human G protein are described. This approach was developed to evaluate the G protein activation proWle of new compounds. pCR-TOPO T7 vectors, engineered to contain the target sequences, were used to transform Escherichia coli competent cells. Subunits were over-expressed in a preparative scale as fusion proteins with a six-histidine tag, and subsequently puriWed by metal chelate chromatography. Afterward, the His-tag was removed by enterokinase digestion, and the secondary structures of the recombinant subunits were analyzed by circular dichroism. To assess the functionality of the subunits, the rate of GTP hydrolysis and GTP S binding were evaluated both in the absence and in the presence of two modulators: the peptidic activator Mastoparan and the non-peptidic activator N-dodecyl-lysinamide (ML250). Tests were conducted on isolated -subunit and on heterotrimeric complex, alone or reconstituted in phospholipidic vesicles. Our results show that recombinant subunits are stable, properly folded and, fully active, which makes them suitable candidates for functional studies. 2005 Elsevier Inc. All rights reserved.
Keywords: Human Gi proteins; Escherichia coli expression; PuriWcation; Circular dichroism; Mastoparan; Receptor-independent G protein modulation; Direct G protein activator

G proteins are an evolutionarily highly conserved group of molecules known as heterotrimeric guanine nucleotidebinding proteins. Numerous molecules, such as hormones, neurotransmitters, chemokines, local mediators, and sensory stimuli, exert their eVect on cells by binding to heptahelical membrane receptors coupled to heterotrimeric G proteins. When a ligand interacts with a heptahelical receptor on the surface of the cell, the ligand either stabilizes or induces a conformation in the receptor that activates a heterotrimeric G protein, composed of -, -, and -subunits, on the inner membrane surface of the cell [1].

Corresponding author. Fax +39 0554271280. E-mail address: lorenzo.mannelli@uniW.it (L. Di Cesare Mannelli). These authors contributed equally to this work.

According to the current knowledge, 17 genes encode for 23 mammalian G -subunits [24], 5 genes encode for G subunits [5], and 12 genes encode for G -subunits [2,6]. All -subunits share biochemical and structural properties and each of them can be assigned to structurally and functionally related groups [7,8]. Classically, G proteins are divided into four families based on similarity of their -subunits: G i/o, G s, G q/11, and G 12/13. When bound to GTP, G -subunits can regulate intracellular eVectors, such as adenylyl cyclase, phospholipase C , K+, and Ca2+ channels, and cyclic GMP phosphodiesterases. G protein - and -subunits are tightly associated, and form stable dimers that cannot be separated unless the proteins are denatured. Hence, from a functional point of view, they are considered as a single entity, the -dimer. The number of -dimers and, most signiWcantly, of oligomeric

1046-5928/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2005.11.005

304

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310

G proteins that can be produced by combinatorial association is presumably very large [7,9,10]. The cycle of G protein activation can be broken down into a four-step reaction: (1) In the basal state, the G protein is an -heterotrimer with GDP bound to the -subunit. (2) The agonist-liganded, activated-receptor interacts with the cognate G protein and accelerates the rate of GDP release from the -subunit. (3) In the presence of Mg2+, -subunit binds GTP, and subsequently G -GTP dissociates from -dimer. Both -subunit and -dimer are then free to activate downstream eVectors. (4) The duration of the signal is determined by the intrinsic GTP hydrolysis rate of the G -subunit and the subsequent reassociation of G -GDP with G [1,2]. During activation and deactivation, the G protein subunits interact sequentially with a series of reaction partners, and these interaction points and binding sites provide opportunities for targeting by synthetic ligands, guanine nucleotides, compounds that act at the receptor/ G protein interface or that block the interaction between G protein subunits and eVectors, as well as regulatory molecules. Moreover, the receptors are the target for many pharmaceutical products and are the focus of intense drug discovery eVorts; traditionally, the agonist binding site is the point of intervention. Another possible target for modulation is G proteins that oVer many binding sites, for example the receptorG protein interface, which has been deWned in some detail and involves the intracellular loops of the seven-transmembrane helix receptors with several regions on heterotrimeric G proteins [11,12]. On the other hand, many receptors couple to multiple G proteins and thus cellular stimulation by a receptor often results in the concerted activation of several distinct G proteins leading to the recruitment of multiple eVectors that produce the biological response [13]. On the contrary, there are pathological conditions in which multiple receptors converge on a common G protein-dependent signaling pathway. For example, cardiac hypertrophy is, at least in part, mediated by the chronic stimulation of several Gq-coupled receptors. Akhter et al. [14] have inhibited successfully G q, uncoupling all receptors from G q itself, in a cardiac hypertrophy murine model. Therefore, it would be a powerful preclinical and clinical tool to control the signaling pathway by direct modulation of the single G protein in a receptor-independent manner. This goal can be achieved by compounds that selectively bind distinct G proteins [15,16]. SpeciWc direct G protein ligands would be helpful in disease states associated with altered G protein mutations and functions. Mutations in the genes that encode for many G s isoforms are demonstrated to be involved in Albright Hereditary Osteodystrophy [17], in cancerous disease like GH-secreting pituitary adenomas, in thyroid tumors [18], and bipolar aVective disorders [19]. G inhibitory subunits (G i/o) were identiWed, for the Wrst time, by Katada and Ui [20] that demonstrated a direct

correlation between pertussis toxin (PTX)2-mediated block of adenylyl cyclase inhibition, and ADP ribosylation of a substrate of approximately 40 kDa. Biochemical puriWcation and molecular cloning have led to the identiWcation of eight PTX-sensitive G i subunits [4,8], six of which (G i1, G i2, G i3, G t1, G t2, and G g) are products of separate genes, while G o1 and G o2 are splice variants of the same gene. G z is PTX-insensitive but is numbered as a member of the Gi protein family on the basis of the similarity of function. Mutations in the G i genes have been associated with tumors of the adrenal cortex, endocrine tumors of the ovary [21], and pituitary ACTH-secreting adenomas [22]. A somatic mutation of the GNAI2 gene, coding for the isoform 2 of G i, has been correlated to an idiopathic ventricular tachycardia [23]. Recently, our group has identiWed a Gi protein hypofunctionality in lymphocytes of subjects with either headache or Wbromialgia [24,25]. In this view, it is of particular interest to obtain new compounds that directly activate Gi proteins. Up to now, only few molecules are known to directly bind Gi proteins in a receptor-independent manner [26]: peptides, such as Mastoparan [27,28], Substance P, and Compound 48/80 [29], peptidic hormones, and low molecular weight compounds [30,31], such as alkyl-substituted aminoacid amides, like N-dodecyl-lysinamide (ML250) [32], and lipoamines [33], but at fairly high doses. Moreover, the properties of new compounds are typically evaluated in a cellular system. Nevertheless, the ability to stimulate the Gi/o protein signal in a cellular system fails to demonstrate a direct action on G proteins, because receptor interaction cannot be excluded. To evaluate the eYciency and the potency of new molecules, synthesized as candidate for directly activate Gi proteins, in an isolated protein system, a DNA recombinant-based method was set up to obtain puriWed Gi proteins. Materials and methods Materials TriReagent for total RNA extraction was purchased from Sigma. SuperScript One-Step RT-PCR System, pCR T7-NT-TOPO TA vector, Escherichia coli strain DH5competent cells, and BL21(DE3) plysS One Shot competent cells were purchased from Invitrogen. LuriaBertani (LB) broth was purchased from Invitrogen. TrisHCl, ethylenediaminetetraacetic acid (EDTA), isopropyl- -D-thiogalactoside (IPTG), Triton X-100, lysozyme, and bicinchoninic acid were purchased from Sigma. His-Bind Resin for Ni aYnity chromatography, EKMax, EK-Away resin, and protein marker were purchased from Invitrogen. Protease
2 Abbreviations used: PTX, pertussis toxin; LB, LuriaBertani; EDTA, ethylenediaminetetraacetic acid; IPTG, isopropyl- -D-thiogalactoside; His6, six-histidine; EK, enterokinase; CD, circular dichroism; ORF, open reading frame; MP, Mastoparan.

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310

305

inhibitor cocktail was purchased from Roche. [32P]GTP and [35S]GTP S were supplied by Perkin-Elmer. Polyclonal antibodies for G protein i1, i3, o1, 1, and 2 subunits, horse radish peroxidase-conjugated secondary antibody, and i1, i3 standards were purchased from Santa Cruz. Western blot detection kit Opti 4-CN was purchased from Bio-Rad. Mastoparan was purchased from Alexis. N-Dodecyl-lysinamide (ML250) was synthesized by Prof. Fulvio Gualtieri and co-workers, Department of Pharmaceutical Science, University of Florence, according to the synthetic pathway proposed in [32]. RT-PCR and plasmid construction Total RNA from human brain, heart, and lung (brain for isoforms i1 and io, heart for isoforms i3 and 1, and lung for isoform 2) was puriWed using TriReagent (Sigma) and used to synthesize cDNA by SuperScript One-Step RT-PCR System (Invitrogen) according to the manufacturers protocol. The cDNAs encoding human i1 and i3 isoforms were generated by two sequential ampliWcation reactions. In the Wrst reaction, primer pairs were designed to obtain two diVerent fragments of the CDS (fragment A and fragment B) which shared a common primer: the downstream primer of the A fragment and the upstream primer of the B fragment. After reverse transcription and ampliWcation of the two fragments, 10 L of each PCR product was run on 1.2% agarose gel and the ethidium bromide-stained DNA bands were excised from gel. Then, 5 L of the excised DNAs was used as template for a second ampliWcation reaction with the forward primer of the A fragment and the reverse primer of the B fragment. For o1, 1, and 2 subunits PCRs were carried out in one-step with upstream primers annealing to the 5-end starting from ATG and downstream primers complementary to the 3UTR region. The conditions of PCR cycles were 94 C, 2 min; 94 C, 15 s; 60 C 30 s; 68 C, 1 min, and 35 cycles; and 68 C, 5 min. All the primers were designed, using published sequence informations, as described in Table 1. cDNAs of i1, i3, io, 1, and 2 subunits were cloned into E. coli expression vectors, pCR T7-NT-TOPO TA (Invitrogen), which were named as expression plasmids pCR- i1, pCR- i3, pCR- o1, pCR- 1, and pCR- 2, respectively. The resulting vectors encoded G protein subunits, a six-histidine (His6) sequence, and an enterokinase cleavage site. After ampliWcation, puriWcation, and sequencing, the constructed vectors were transformed using E. coli strain BL21(DE3)plysS

competent cells for protein expression using the following protocol. LB media (10 mL) containing 100 g/mL ampicillin and 34 g/mL chloramphenicol were inoculated with 30 L of the glycerol stock of BL21(DE3)plysS pCR-subunit. After overnight at 37 C, 500 L of each culture was used to inoculate 10 mL of the LB media with ampicillin and chloramphenicol. Cells were grown by shaking at 37 C for about 2 h to obtain a cell density that corresponds to an absorbance of 0.8 at 600 nm. The expression of the His6-subunit fusion proteins was induced by the addition of IPTG to a Wnal concentration of 1 mM. The cultures were shaken continuously for 16 h at 37 C, and the cells were subsequently harvested by centrifugation (Beckman model J2-21) at 5000 rpm for 5 min at 4 C. The cell pellets were stored at 80 C until use. PuriWcation of His6-subunit fusion proteins Cell pellets were resuspended in 8 mL of 50 mM Tris HCl buVer, pH 8.0, containing protease inhibitor cocktail (Roche). Cells were incubated for 30 min on ice with 8 mg lysozyme and then sonicated with six 10-s bursts at high intensity. DNA was sheared by passing the preparation through an 18-gauge syringe needle several times. The lysates were centrifuged at 3000g for 15 min to pellet the insoluble debris. Ni aYnity chromatography (IMAC, immobilized metal aYnity chromatography) was used to purify the His-tag fusion proteins. The Ni aYnity resin (2 mL) was packed into a column according to the protocol provided by the manufacturer and loaded with the cell lysates. Columns were washed four times with a buVer containing TrisHCl 50 mM and 20 mM imidazole (pH 8.0). The bound His-tag fusion proteins were eluted by applying 10 mL of a buVer containing TrisHCl 50 mM with 250 mM imidazole (pH 8.0). One milliliter fractions were collected. The protein eluates were dialyzed against TrisHCl 50 mM, pH 8.0, and SDSPAGE was performed using 420% gradient gels to determine the presence of the fusion proteins by anti-subunit primary antibodies (dilution 1:1000) and HRP-conjugated secondary antibody (dilution 1:5000). The yield of the fusion proteins was estimated to be about 810 mg/L of culture. Protein concentration was evaluated by bicinchoninic acid assay. Fusion protein cleavage and puriWcation of subunits The fusion proteins were cleaved by enterokinase (EK) digestion according to the manufacturers protocol. In a

Table 1 Accession number for GenBank protein sequence and primer used to obtain G protein open reading frame Upstream primer
i1 i3 oi 1 2

Downstream primer CAAGACTCTAGTCTACAGAGATCC GTCTGGTCTCAACACTCCACAC CAGGACAAGAGGTCAGTACAAGC GCTACTGGCGTTAGTTCCAGATCT CCTCTCAAAGACTTAAAGGATGGC

GenBank Accession No. NM_002069 NM_006496 NM_020988 NM_002074 BC020774

ATGGGCTGCACCTGAGCG ATGGGCTGCACGTTGAGCG ATGGGATGTACTCTGAGCGCAGA ATGAGTGAGCTTGACCAGTTACGG ATGGCCAGCAACAACACCGC

306

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310

representative run, approximately 20 g of subunit fusion protein with His6-tag was cleaved through incubation with EKMax for 16 h at 37 C in a total volume of 30 L EKMax BuVer (500 mM TrisHCl, pH 8.0, 10 mM CaCl2, and 1% Tween 20). After digestion, EKMax was removed by EK-Away resin (Invitrogen) following the manufacturers protocol. Proteins in TrisHCl 50 mM, pH 8.0, solutions were examined by SDSPAGE and immunoblot to verify the presence and the integrity of the G subunits using speciWc antibodies (Santa Cruz). Western blotting results are shown in Fig. 1. Circular dichroism G i/o protein subunits (3 M) were incubated for 10 min at room temperature (2325 C) in a buVer of TrisHCl 50 mM (pH 8.0). Circular dichroism (CD) spectra were recorded at room temperature on a J-715 spectropolarimeter (JASCO, Tokyo, Japan) using a 1 mm path length Hellma quartz cuvette. For each sample, six scans were accumulated at 50 nm/min and measurements were repeated at least twice using freshly prepared solutions to test reproducibility. Background from buVer solution and empty cell contribution was subtracted from each spectrum. Liposome preparation Soy phosphatidylcholine was purchased from Avanti Polar Lipids (Alabama). Multilamellar vesicles (10 mg/mL

total lipid concentration) have been prepared by dispersing a dry lipid Wlm in the buVer (50 mM TrisHCl buVer, pH 8.0). These lipids spontaneously form in water polydisperse vesicular suspensions by simple shaking. This dispersion was subjected to 5 min of forceful shaking, frozen (liquid N2), and thawed (40 C) six times. Then it was sized down to unilamellar vesicles of approximately 90 nm radius by 11 repeated extrusion through two stacked polycarbonate Wlters with 200 nm-sized pores, followed by 11 repeated extrusions through 100 nm-sized pores membranes [34]. Filtration was performed at room temperature with the Extruder by Lipex Biomembranes, Vancouver (Canada), and Nucleopore polycarbonate membranes. The size distribution of unilamellar liposomes was veriWed by dynamic light scattering. Reconstitution of phospholipidic vesicles G protein solution was mixed with liposome to a Wnal concentration of 150 nM for -subunits, 750 nM for -dimer and 0.3 mg/mL for liposomes, in TrisHCl 50 mM (pH 8.0). The system was incubated at room temperature for 20 min and at 4 C overnight. GTP hydrolysis GTPase activity was measured using recombinant G i1 protein according to a standard method [35]. Heterotrimeric complex ( ) was obtained by mixing i1 with 1 2 subunits in a 1/5 concentration ratio and incubated for 1 h at 4 C. Three picomoles of complex alone or incorporated into lipidic vesicles was incubated at 20 C for 30 min in 100 L of a reaction mixture containing 50 mM TrisHCl (pH 8.0), 1 mM EDTA, 1 mM DTT, 0.1% Lubrol, 1.1 mM MgSO4, and 0.5 M [ -32P]GTP (0.1 Ci per tube). Reaction was stopped by the addition of 700 L of an ice-cold 5% (w/v) charcoal suspension in 50 mM NaH2PO4. The mixture was centrifuged at 13,000g for 18 min at 4 C. A fraction of the supernatant (200 L) was counted in 2 mL scintillation solution. The high-aYnity GTPase activity was calculated by subtracting the 32Pi released in the presence of 100 M cold GTP from total 32Pi hydrolyzed. GTP S binding Binding of GTP S (the non-hydrolyzable GTP analog) to recombinant G protein was measured according to a standard method [35]. Three picomoles of -subunit in native conditions or reconstituted into lipoid vesicles was incubated at 30 C (20 C for G o) for 30 min in 100 L of a reaction mixture containing 50 mM TrisHCl (pH 8.0), 1 mM EDTA, 1 mM DTT, 1.1 mM MgSO4, and 0.1 M [35S]GTP S (0.1 Ci/tube). Reaction was stopped by the addition of 1 mL of an ice-cold stop buVer (consisting of 10 mM TrisHCl, pH 8.0, 25 mM MgCl2, and 100 mM NaCl). The diluted samples were Wltered through cellulose nitrate membranes (0.45 m pore size) under weak vacuum.

220 130 90 70 60 40

i1

i3

io

30 20

15

10

2
Fig. 1. SDSPAGE analysis and immunoblot of puriWed and cleaved G proteins. E. coli were harvested at 16 h after IPTG induction. Bacterial lysates were processed by IMAC and puriWed proteins were subjected to EK digestion followed from enzyme removal by EK-Away resin. Recombinant subunits were evaluated by Western blot using primary polyclonal speciWc antibodies and HRP-conjugated secondary antibody.

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310

307

The Wlters were washed with 12 mL of the same buVer and dried. The retained radioactivity was quantiWed by scintillation spectroscopy. SpeciWc binding was calculated by subtracting the GTP S bound in the presence of 100 M cold GTP S from total binding. Statistical analysis All experimental results are expressed as means SEM and statistical analysis was performed by ANOVA. P < 0.05, or P < 0.01 where indicated, was considered as signiWcant. Results and discussion Plasmid construction and protein expression Recombinant G protein i1 and i3 subunits were obtained by RT-PCR with two sequential ampliWcation reactions (data not shown). In the Wrst PCRs, two fragments (A and B) of the cDNA were obtained; after DNA excision from ethidium bromide-stained gel, a second ampliWcation produced the entire open reading frame (ORF). The ampliWcation products of G protein o1 subunit, and of 1 and 2 subunits were obtained by a one-step RT-PCR. cDNAs were subcloned into the expression vector pCRTOPO-T7 (Invitrogen). The pCR-TOPO T7 plasmid was ampliWed by TOP10F E. coli cells and the appropriate constructs were identiWed by restriction digestion after transformation into such strain. Sequencing of pCR-TOPO T7/G , pCR-TOPO T7/G , and pCR-TOPO T7/G have conWrmed the homology with GenBank sequences. These constructs were transformed using E. coli BL21(DE3)plysS cells and the further expressions utilized LB media after induction with IPTG, as described under Materials and methods. After cellular lysis, the proteins were puriWed by IMAC and analyzed by SDSPAGE and immunoblot. The result for all subunits was at least 80% purity (data not shown). Eight to ten milligrams of fusion was produced from 1 liter of culture. Histidine-tag was removed by EKMax, and proteins were puriWed by EK-Away resin (Invitrogen). Western blot analysis was performed to verify protein speciWcity and integrity (results are shown in Fig. 1). G i1, G i3, and G o1 subunits showed a 41 kDa molecular weight, G 1 showed a 36 kDa molecular weight and G 2 5 kDa. Recombinant protein molecular weights are comparable with the actually determined molecular weights and, at least for i subunits, with standard G proteins (data not shown). After cleavage and puriWcation the yield of human G protein subunits was 3.54 mg/L of culture. Circular dichroism analysis Circular dichroism (CD) spectroscopy was carried out as a preliminary structural analysis on the expressed -subunits

of G protein to assess their secondary structure and compare the same to the physiological human subunits. On the basis of the primary sequence the -helical conformation is expected to prevail over the other structural elements [36]. Fig. 2 shows CD spectra of i1, i3, and o1 subunits (3.0 M) in TrisHCl 50 mM buVer solution (pH 8.0); the spectra show the double minima at 222 and 208 nm, typical signature of -helical conformation. These results agree with structural properties of extracted G protein -subunits obtained both by CD [37] and crystallographic analysis [38,39]. The proper refolding in solution, inferred from this spectroscopic investigation, provides a basis for functionality studies. Evaluation of G protein functionality: GTPase activity and GTP S binding To evaluate the functionality of recombinant G proteins, we measured the GTPase activity of the -subunits and the complex, in the absence and in the presence of phospholipidic vesicles. Fig. 3 shows that, according to the published and well-known kinetic data [35], the level of phosphate hydrolyzed by G i/o was 0.1 mol/mol-G /min (Basal, white bar). On the contrary, in the presence of 150 nM of the -dimer ( / 1:5 molar ratio), which physiologically inhibits GTPase activity, the GTP hydrolysis of 30 nM G was reduced by 36% (Basal, striped white bar). Aimed to obtain a more physiological system, we reconstituted the G proteins in phospholipidic vesicles because the presence of a phospholipidic bilayer creates an environment analogous to plasmatic membrane that would be a better condition for the functional protein folding. When G was mixed with phospholipids, no change in GTP hydrolysis was observed (Basal, dark bar). Nevertheless,

0
[ ] (mdeg cm2 dmol -1)

-2000 G o1 G i1 G i3 -4000 200 220 (nm) 240

i1,

260
G
i3,

Fig. 2. CD analysis. Circular dichroism spectra of 3 M G G o1 subunits in TrisHCl 50 mM buVer solution (pH 8.0).

and

308

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310

0,22 0,20 0,18

mol 32P/mol G i/o/min

G + liposomes G G + liposomes

**

0,25

Mastoparan ML250

* * *

0,20

mol 32P/mol Gi/o/min

0,16 0,14 0,12 0,10 0,08 0,06

0,15

0,10

0,5
0,04 0,02 0,00

Basal

Mastoparan 1x10-4M

1x10-7

1x10-6

1x10-5

1x10-4

Fig. 3. Evaluation of GTP hydrolysis. Comparison of GTPase activity between i1 subunit alone and heterotrimeric complex i1 , incubated with or without liposomes. EVect of MP 1 10 4 M on GTPase activity of i1 subunit alone and of heterotrimeric complex i1 , incubated in the presence or in the absence of liposomes. *P < 0.05 vs basal level of G , P < 0.05 vs G , and **P < 0.01 vs basal level of G in the presence of liposomes (ANOVA). Data are expressed as means SEM.

Mastoparan and ML250 concentration

Fig. 4. Comparison of GTP hydrolysis in the presence of MP and ML250. GTP hydrolysis was evaluated on recombinant G i1 protein reconstituted in phospholipidic vesicles and incubated with increasing concentration (1 1071 104 M) of MP or ML250 in the presence of 100 M free Mg2+. *P < 0.01 vs basal level of G i1 (ANOVA). Data are expressed as means SEM.

G complex activity in the presence of phospholipids was able to revert the inhibition due to the presence of the -dimer (Basal, striped dark bar). This eVect was probably due to the presence of phospholipids that induce a G -subunit conformation that facilitates its hydrolytic activity. According to the previous reports [27,28], the same experiments performed in the presence of the peptidic activator Mastoparan (MP), demonstrated that MP 100 M was not able to stimulate the GTPase activity of isolate -subunits (Fig. 3, MP 1 104 M, white bar) but, the same concentration of MP, signiWcantly enhanced the hydrolysis of GTP when the -subunit was bound with the -dimer, both in the absence or in the presence of phospholipidic vesicles (Fig. 3, MP, striped white and dark bars, respectively). Particularly, MP 100 M exerted the maximum eVect when G protein was reconstituted in liposomes as heterotrimeric complex: MP increased the level of phosphate hydrolyzed from 0.11 to 0.20 mol/mol-G /min (Fig. 3, Mastoparan, striped dark bar). Starting from these results, we evaluated the rate of GTP hydrolysis of the heterotrimeric complex in the presence of increasing concentration of MP. Results are shown in Fig. 4: MP (white bars) induced an increase in GTP hydrolysis in a dose dependent manner, accelerating nucleotide hydrolysis up to 86% (at 100 M) with respect to the basal level. Moreover, according to Higashijima et al. [27,28] and Oppi et al. [35], we found that the rate of MP-stimulated GTP hydrolysis was function of Mg2+ concentration, with 100 M magnesium as optimal concentration for maximal MP activity (data not shown). MP is a tetradecapeptide that forms a cationic amphiphilic -helix, probably 100 M Mg2+ allows optimal conformation for interaction between peptide and G protein.

To compare the MP stimulation of GTP hydrolysis with non-peptidic compound, we measured the eVects of ML250. Notably, graphic in Fig. 4 (dark bars) shows that, in the presence of 100 M Mg2+, the Gi protein activator ML250 increased the hydrolysis of GTP up to 43% with respect to the basal level, but with a lesser extent compared with MP. Finally, we evaluated the binding of GTP S, a non-hydrolyzable analog of GTP, on G i/o subunits, in the presence of increasing concentration of ML250 (100 nM 100 M concentration range). Results are indicated in Fig. 5, where it is shown that ML250 stimulated G i1 (dark

120 100
GTPS bound(fmol)

80 60 40 20 0 10-6 10-5 10-4

ML250 Concentration (M)

Fig. 5. GTP S binding. EVect of increasing concentrations of compound ML250 on the stimulation of [35S]GTP S binding on G i1 (), G i3 (), and G o1 () subunits. *P < 0.01 vs eVect of the same concentrations of ML250 on G i1 and G i3 proteins. Data are expressed as means SEM.

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310

309

squares) and G i3 (dark circles) with a lesser potency compared with G o1 (white circles; EC50 47.9 2.0 and 43.9 1.4 for G i1 and G i3, respectively, EC50 27.8 0.7 for G o1). Moreover, 50 M ML250 was able to stimulate GTP S binding, with respect to basal activity, 10-fold for G i1 and G i3, and 25-fold for G o1. Conclusion We have reported the expression and puriWcation of G i1, G i3, G o1, G 1, and G 2 subunits as a 6 His fusion proteins with pCR-TOPO T7 vector. The His6 was used for the puriWcation of the protein subunits by chelating chromatography. Also, an enterokinase cleavage site was used to enable an eYcient removal of the His-tag. IMAC provided a suYcient amount of puriWed protein for subsequent examination as conWrmed by CD experiments. These measurements showed that the bacteria-expressed Gi/o subunits were useful for functional analysis. Aimed to evaluate a direct interaction among these subunits and peptidic and non-peptidic compounds, we clearly demonstrated that the developed method can be applied to study the proWle of new synthesized molecules. Taken together, these results showed that the expressed Gi/o subunits were properly folded, fully active, and therefore suitable for further structural and functional studies. References

[14]

[15] [16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24] [1] H.E. Hamm, The many faces of G protein signalling, J. Biol. Chem. 273 (1998) 669672. [2] S.R. Sprang, G protein mechanism: insights from structural analysis, Annu. Rev. Biochem. 66 (1997) 639678. [3] M.I. Simon, M.P. Strathmann, N. Gautam, Diversity of G proteins in signal transduction, Science 252 (1991) 802808. [4] G.B. Downes, N. Gautam, The G protein subunit gene families, Genomics 62 (1999) 544552. [5] A.J. Watson, A. Katz, M.I. Simon, A Wfth member of the mammalian G protein -subunit family, J. Biol. Chem. 269 (1994) 2215022156. [6] K. Ray, C. Kunsch, L.M. Bonner, J.D. Robishaw, Isolation of cDNA clones encoding eight diVerent human G protein gamma subunits, including three novel forms designated the gamma 4, gamma 10, and gamma 11 subunits, J. Biol. Chem. 270 (1995) 2176521771. [7] J.R. Hepler, A.G. Gilman, G proteins, Trends Biochem. Sci. 17 (1992) 383387. [8] T.A. Fields, P.J. Casey, Signalling functions and biochemical properties of pertussis toxin-resistant G-proteins, Biochem. J. 321 (1997) 561571. [9] D.E. Clapham, E.J. Neer, G protein beta gamma subunits, Annu. Rev. Pharmacol. Toxicol. 37 (1997) 167203. [10] T. Schneider, P. Igelmund, J. Hescheler, G protein interaction with K+ and Ca2+ channels, Trends Pharmacol. Sci. 18 (1997) 811. [11] B. Konig, A. Arendt, J.H. McDowell, M. Kahlert, P.A. Hargrave, K.P. Hofmann, Three cytoplasmic loops of rhodopsin interact with transducin, Proc. Natl. Acad. Sci. USA 86 (1989) 68786882. [12] S. Verrall, M. Ishii, M. Chen, L. Wang, T. Tram, S.R. Coughlin, The thrombin receptor second cytoplasmic loop confers coupling to Gq-like G proteins in chimeric receptors, J. Biol. Chem. 272 (1997) 68986902. [13] K.L. Laugwitz, A. Allgeier, S. OVermans, K. Spicher, J. Van Sande, J.E. Dumont, G. Schultz, The human thyrotropin receptor: a heptahe-

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

lical receptor capable of stimulating members of all four G protein families, Proc. Natl. Acad. Sci. USA 93 (1996) 116120. S.A. Akhter, L.M. Luttrell, H.A. Rockman, G. Iaccarino, R.J. Lefkowitz, W.J. Koch, Targeting the receptor-Gq interface to inhibit in vivo pressure overload myocardial hypertrophy, Science 280 (1998) 574577. M. Freissmuth, M. Waldhoer, E. BoWll-Cardona, C. NanoV, G-protein antagonists, Trends Pharmacol. Sci. 20 (1999) 237245. M. Hohenegger, M. Waldhoer, W. Beindl, B. Boing, A. Kreimeyer, P. Nickel, C. NanoV, M. Freissmuth, Gs alpha-selective G protein antagonists, Proc. Natl. Acad. Sci. USA 95 (1998) 346351. Z. Farfel, A.S. Brickman, H.R. Kaslow, V.M. Brothers, H.R. Bourne, Defect of receptor-cyclase coupling protein in pseudohypoparathyroidism, New Engl. J. Med. 303 (1980) 237242. L. Vallar, A. Spada, G. Giannattasio, Altered Gs and adenylate cyclase activity in human GH-secreting pituitary adenomas, Nature 330 (1987) 566568. S. Andreopoulos, P.P. Li, K.P. Siu, S.J. Kish, J.J. Warsh, Altered CTXcatalyzed and endogenous [32]ADP-ribosylation of stimulatory G protein alpha s isoforms in post-mortem bipolar aVective disorder temporal cortex, J. Neurosci. Res. 72 (2003) 638645. T. Katada, M. Ui, Direct modiWcation of the membrane adenylate cyclase system by islet-activating protein due to ADP-ribosylation of a membrane protein, Proc. Natl. Acad. Sci. USA 79 (1982) 31293133. J. Lyons, C.A. Landis, G. Harsh, L. Vallar, K. Grunewald, H. Feichtinger, Q.Y. Duh, O.H. Clark, E. Kawasaki, H.R. Bourne, et al., Two G protein oncogenes in human endocrine tumors, Science 249 (1990) 655659. E.A. Williamson, P.G. Ince, D. Harrison, P. Kendall-Taylor, P.E. Harris, G-protein mutations in human pituitary adrenocorticotrophic hormone-secreting adenomas, Eur. J. Clin. Invest. 25 (1995) 128131. B.B. Lerman, B. Dong, K.M. Stein, S.M. Markovitz, J. Linden, D.F. Catanzaro, Right ventricular outXow tract tachycardia due to a somatic cell mutation in G protein subunit alpha i2, J. Clin. Invest. 101 (1998) 28622868. N. Galeotti, C. Ghelardini, M. Zoppi, E. Del Bene, L. Raimondi, E. Beneforti, A. Bartolini, A reduced functionality of Gi proteins as a possible cause of Wbromialgia, J. Rheumatol. 28 (2001) 22982304. N. Galeotti, C. Ghelardini, M. Zoppi, E. Del Bene, L. Raimondi, E. Beneforti, A. Bartolini, Hypofunctionality of Gi proteins as aetiopathogenic mechanism for migraine and cluster headache, Cephalalgia 21 (2001) 3845. Y. Odagaki, N. Nishi, T. Koyama, Receptor-mediated and receptorindependent activation of G-proteins in rat brain membranes, Life Sci. 62 (1998) 15371541. T. Higashijima, S. Uzu, T. Nakajima, E.M. Ross, Mastoparan, a peptide toxin from wasp venom, mimics receptors by activating GTP-binding regulatory proteins (G proteins), J. Biol. Chem. 263 (1988) 64916494. T. Higashijima, J. Burnier, E.J. Ross, Regulation of Gi and Go by mastoparan, related amphiphilic peptides, and hydrophobic amines, mechanism and structural determinants of activity, J. Biol. Chem. 265 (1990) 1417614186. M. Mousli, C. Bronner, J. Bockaert, B. Rouot, Y. Landry, Interaction of substance P, compound 48/80 and mastoparan with the -subunit C-terminus of G protein, Immunol. Lett. 25 (1990) 355358. A. Hagelken, L. Grnbaum, B. Nrnberg, R. Harhammer, W. Schunack, R. Seifert, Lipophilic beta-adrenoceptor antagonists and local anesthetics are eVective direct activators of G-proteins, Biochem. Pharmacol. 47 (1994) 17891795. J.L. Bueb, M. Mousli, C. Bronner, B. Rouot, Y. Landry, Activation of Gi-like proteins, a receptor-independent eVect of kinins in mast cells, Mol. Pharmacol. 38 (1990) 816822. C. Lesckhe, R. Storm, E. Breitweg, T. Exner, B. Nrnberg, W. Schunack, Alkyl-substituted amino acid amides and analogous diand triamines: new non-peptide G protein activators, J. Med. Chem. 40 (1997) 31303139. E. Breitweg-Lehmann, C. Czupalla, R. Storm, O. Kudlacek, W. Schunack, M. Freissmuth, B. Nrnberg, Activation and inhibition of G proteins by lipoamines, Mol. Pharmacol. 61 (2002) 628636.

310

L. Di Cesare Mannelli et al. / Protein Expression and PuriWcation 47 (2006) 303310 [37] T. Tanaka, T. Khono, S. Kinoshita, H. Mukai, H. Itoh, M. Ohya, T. Miyazawa, T. Higashijima, K. Wakamatsu, -Helix content of G protein subunit is decreased upon activation by receptor mimetics, J. Biol. Chem. 273 (1998) 32473252. [38] D.E. Coleman, A.M. Berghuis, E. Lee, M.E. Linder, A.G. Gilman, S.R. Sprang, Structures of active conformations of Gi alpha 1 and the mechanism of GTP hydrolysis, Science 265 (1994) 14051412. [39] M.A. Wall, D.E. Coleman, E. Lee, J.A. Iniguez-Lluhi, B.A. Posner, A.G. Gilman, S.R. Sprang, The structure of the G protein heterotrimer Gi alpha 1 beta 1 gamma 2, Cell 83 (1995) 10471058.

[34] M.J. Hope, M.B. Bally, G. Webb, P.R. Cullis, Production of large unilamellar vesicles by a rapid extrusion procedure. Characterization of size distribution, trapped volume and ability to maintain a membrane potential, Biochim. Biophys. Acta 812 (1985) 5565. [35] C. Oppi, T. Wagner, A. Crisari, B. Camerini, G.P Tocchini Valentini, Attenuation of GTPase activity of recombinant G o by peptides representing sequence permutations of mastoparan, Proc. Natl. Acad. Sci. USA 89 (1992) 82688272. [36] The secondary structure has been predicted from the amminoacidic sequence through the PSIPRED program available at: <http:// bioinf.cs.ucl.ac.uk/psipred/>.