Você está na página 1de 51

GENTICA HUMANA CENTRO UNIVERSITARIO DO MARANHO

Biologia Molecular : Fundamentos


Prof. Dr. Lidio Gonalves Lima Neto

UNICEUMA

Mestrado em Biologia Parasitria


Lab. Biologia Molecular Aplicada ao Diagnstico

Importncia Clnica da Biologia Molecular

Diagnstico molecular

doenas hereditrias doenas metablicas doenas infecciosas neoplasias

Predisposio a doenas cardiovasculares e outras

fatores de risco genticos

Avaliao da resposta teraputica

farmacogentica

Tpicos

Estrutura e propriedades fsico-qumicas dos cidos nucleicos

Cdigo gentico Cromossomos e genes Hereditariedade

Estrutura e Propriedades dos cidos Nuclicos

Estrutura do DNA
cido desoxiribonuclico
(5)

Composio

cadeia de nucleotdeos
Acar - desoxiribose grupo fosfato base nitrogenada
Orientao 5 3

Nucleotdeo

Bases nitrogenadas

Adenina (A) Citosina (C) Guanina (G) Timina (T)

(3)

Estrutura do DNA

Estrutura

dupla fita em hlice fita sense

informao gentica na direo 5 3 seqncia complementar

fita antisense

Funo

Informao gentica do organismo

Cdigo gentico

codons

seqncia de 3 nucleotdeos (ATC GAC TTC AGC ...)

Watson & Crick (1950)


6

Estrutura do DNA
5

Pareamento das bases nitrogenadas


Bases nitrogenadas

A=T CG

GC T=A
Bases nitrogenadas 3
Ponte de hidrognio

Molcula de fosfato

Molcula de acar
7

Estrutura do DNA
Cadeias anti-paralelas

Esqueleto acar-fosfato

Fita sense

Pontes de hidrognio entre as bases

Fita antisense

http://152.16.198.53/GeneticsModules/Design/page.asp?CourseNum=1&LessonNum=1 8

Formas do DNA
Pareamento das bases

Dupla Hlice

Cromossoma

Formas superenroladas

GM Cooper.The Cell (2000)

Estrutura do RNA
cido ribonuclico

Estrutura

Fita simples

Acar: ribose bases: A, C, G, U (uracila)

Funo

transferncia da informao na clula expresso gnica

Tipos de RNA

mRNA RNA mensageiro tRNA - anti-codon e aminocido rRNA RNA ribossmico


10

Diferenas entre RNA e DNA


RNA Acar Bases Ribose Adenina (A) DNA Deoxirribose Adenina (A)

Citosina (C)
Uracila (U) Guanina (G) Tipo de cadeia Simples

Citosina (C)
Timina (T) Guanina (G) Dupla
bases
Pareamento das bases Esqueleto acarfosfato

Estabilidade ao calor Estabilidade ao pH alcalino Hidrlise por enzimas

baixa

alta

baixa RNases

alta DNAses
cido ribonucleico cido desoxiribonucleico

11

Desnaturao da dupla fita do DNA pelo calor

temperatura

Watson J. Recombinant DNA (1992)

12

Dissociao e Re-associao da dupla fita do DNA


Re-associao Calor, OHcondies especiais

Estado natural

dissociado

Re-associado
13

Molculas de DNA e RNA


Anlise da integridade

Eletroforese em gel de agarose


M M
DNA 28S 18S
100 bp
M 1 2 3 4 5 6

RNA

14

15

16

Quantificao do DNA
Espectrofotometria no UV

Salazar et al. Clin Chem, 44:1478, 1998

17

Cdigo Gentico

Fluxo da informao gentica


DNA

RNA

Protena
(funo bioqumica especfica)

www.nhgri.nih.gov/DIR/VIP

19

Transferncia da informao
Transcrio

Membrana nuclear

Ribossomo mRNA (molde)

Traduo

Peptdeo

http://152.16.198.53/GeneticsModules/Design/page.asp?CourseNum=1&LessonNum=1 20

Cdigo gentico

GM Cooper.The Cell (2000)

21

Fase de leitura da traduo


Sequncia UAUGCAAAGCUGCGUAAUCG

Trs fases de leitura possveis so : (1) UAU GCA AAG CUG CGU A G
Tir Ala Asn Leu Arg

(2) (3)

AUG CAA AGC UGC GUA GC


Met Gln Ser Cis Val

UGC AAA GCU GCG UAG CG


Cis Lis Ala Ala Stop UAG codon de finalizao
22

AUG codon de iniciao

Cromossomos e Genes

Genoma

Conjunto de genes de um organismo


Gene

Unidade de herana Tipos

Estruturais

Reguladores

Genoma Humano

3.000 Mb 80.000 genes

http://152.16.198.53/GeneticsModules/Design/page.asp?CourseNum=1&LessonNum=1 24

Estrutura do genoma humano

DNA nuclear

cromossomos lineares - 3 x 109 pb (2m) 22 autossmicos e 2 sexuais

http://www.ncbi.nlm.nih.gov/mapview/

25

Estruturas dos cromossomos

http://www.virtual.epm.br/cursos/genetica/htm/base.htm

GM Cooper.The Cell (2000)

26

GM Cooper.The Cell (2000)

27

Telmeros e Telomerases
Telmeros
Extremidade dos cromossomos lineares

riboenzimas que preservam os telmeros durante a replicao do DNA (mantem a integridade do genoma)

GM Cooper.The Cell (2000)

28

Estrutura do genoma humano

DNA mitocondrial

Circular 16.500 pb

http://www.ncbi.nlm.nih.gov/mapview/

29

Estrutura dos genes humanos

GENE:
EXON
Transcrio
DNA

Traduo
mRNA tRNA Aminocido Peptdeo

Seqncia de nucleotdeos codificadora


INTRON

Seqncia de nucleotdeos no codificadora


(1978 - Gilbert )

30

xons e ntrons humanos


MENOR QUE 10 Kkb

10 kbO

MENOR QUE 100 kb 10 20 30 40

50

60

70

80

90

100 kb

tRNA 100%
Histona H4 100%

Albumina srica 12%

Colgeno alfa1(II)
HPRT 4%

20%

Interferon-alfa 100% Insulina 33% Beta-globina 38% 46% HLA classe I

Apolipoprotena B 38%
Receptor da LDL 11% Fenilalanina hidroxilase

MAIOR QUE 100 kb O 100 200 300 400 500 600 700 800 900 1000 1100 1200 1800 1900 2400 2500 kb

Fator VIII CFTR

3% 2,4%

NF1

4%
Utrofina 1,4% Cadeia pesada Ig * Cadeia leve Ig *

Distrofina

0,6%

31

Processamento do RNA

GM Cooper.The Cell (2000)

32

34

Hereditariedade

Unidade hereditria

Gentipo e Fentipo
O gentipo de uma pessoa a sua constituio gentica. O fentipo a expresso observvel de um gentipo como um caracter morfolgico, bioqumico ou molecular.

Locus Gnicos
Os cromossomos existem aos pares nas clulas somticas. Cada gene ocupa um lugar definido no cromossomo. Esse lugar definido denominado locus gnico http://www.virtual.epm.br/cursos/genetica/htm/base.htm
36

Genes Alelos

http://www.virtual.epm.br/cursos/genetica/htm/base.htm

37

Homozigoze e Heterozigose

Homozigotos e Heterozigotos
Os genes alelos no so necessariamente idnticos. Quando nas clulas de um indivduo os genes alelos para um determinado carter no so idnticos, o indivduo denominado heterozigoto para o carter denominado pelo par de genes. Quando os genes alelos so idnticos, o indivduo denominado homozigoto para aquele carter. http://www.virtual.epm.br/cursos/genetica/htm/base.htm
38

Smbolos

39

Padres de Herana Monognica


Herana Autossmica Dominante
Um dado fentipo expressado da mesma maneira em homozigotos e heterozigotos. Toda pessoa afetada em um heredograma possui um genitor afetado, que por sua vez possui um genitor afetado, e assim por diante, como no heredograma abaixo:
Nos casamentos que produzem filhos com uma doena autossmica dominante, um genitor geralmente heterozigotico para a mutao e o outro genitor homozigtico para o alelo normal. Pode-se escrever os gentipos dos pais como:

Ex. Hipercolesterolemia Familial


http://www.virtual.epm.br/cursos/genetica/htm/base.htm
40

Padres de Herana Monognica


Herana Autossmica Recessiva
Os distrbios autossmicos recessivos expressam-se apenas em homozigotos, que, portanto, devem ter herdado um alelo mutante de cada genitor.
O risco de seus filhos receberem o alelo recessivo de cada genitor, e serem afetados de 1/4. A maioria dos genes dos distrbios autossmicos recessivos est presente em portadores dos genes. Eles podem ser transmitidos nas famlias por numerosas geraes sem jamais aparecer na forma homozigtica. A chance de isto acontecer aumentada se os pais forem aparentados. A consanguinidade dos genitores de um paciente com um distrbio gentico uma forte evidncia em favor da herana autossmica recessiva daquela afeco.

Ex. Hipercolesterolemia autossmica recessiva


http://www.virtual.epm.br/cursos/genetica/htm/base.htm
41

Hipercolesterolemia
doena monognica
dieta
bile

plasma

3
intestino

col LDL

colesterol

msculo e adipcito

fgado

TG col
VLDL 1= Hipercolesterolemia familial 2= Defeito Familial de apo B 3= Hipercolesterolemia autossmica recessiva (Protena adaptadora do receptor) 4= Sitosterolemia

Triglicerdeos (TG)

Goldstein & Brown. Science 292:1310, 2001

42

Herana ligada e restrita ao Sexo

43

Herana ligada ao Sexo

44

Herana restrita ao Sexo

45

Padres de Herana Monognica


Herana Recessiva Ligada ao X
Uma mutao ligada ao X expressa-se fenotipicamente em todos os homens que a recebem, mas apenas nas mulheres que so homozigticas para a mutao. Mulheres heterozigotas podem expressar o fentipo (considerando a Hiptese de Lyon).

Ex. Hemofilia A Distrofia muscular de Duchene


http://www.virtual.epm.br/cursos/genetica/htm/base.htm
46

Critrios para a identificao da herana recessiva ligada ao X

1. No h nunca transmisso pai-filho. 2. O relacionamento entre irmandades com pessoas afetadas se faz atravs de mulheres.

47

Padres de Herana Monognica


Herana Dominante Ligada ao X
Um fentipo ligado ao X descrito como dominante se ele se expressar regularmente em heterozigotos. Em um heredograma dominante ligado ao X, todas as filhas e nenhum filho de homens afetados so afetados; se alguma filha no for afetada ou algum filho for afetado, a herana deve ser autossmica.

Ex. Raquitismo Hipofosfatmico


http://www.virtual.epm.br/cursos/genetica/htm/base.htm
48

Critrios para a identificao da herana dominante ligada ao X


1. Homens afetados tero todas as filhas afetadas, porm nenhum filho. 2. A segregao da caracterstica, na prognie de mulheres afetadas, indistinguvel da observada na herana autossmica dominante. 3. Observam-se mais mulheres que homens com a condio (se a caracterstica rara, haver duas vezes mais mulheres que homens com a condio).

49

Padres de Herana Polignica


Alterao em um nico gene
Mutaes

Alteraes em vrios genes


Mutaes e Polimorfismos (>1%)

Outros genes

Doena monognica

normal

Doena Polignica

Hingorani, Atherosclerosis, 2000

50

Aterosclerose
Doena polignica e multifatorial
Apo A I Apo B

Polignica
polimorfismos

Apo C III Apo E

RLDL
LRP LPL

CETP

X genotipagem

Y Outros genes
Fatores ambientais

ACAT MTHFR eNOS PNO1 PNO2 ECA

normal

DCV

Hbitos alimentares Estresse Sedentarismo Hbito de fumar

Fibrinognio
Fator V de Leiden PAI 51

Hingorani, Atherosclerosis, 2000