Você está na página 1de 96

MEXIC

I
de
O,DF.
INST
ESCU
S
Integraci
egradarh
QU
N
TITUTO
UELANACI
ECCINDEESTU
ndeun
herbicida
UEPARAO
MAES
QUIM
NAHUMT
DR.JU
DRA.FO
POLITC
IONALDE
UDIOSDEPOSG

acomun
asorgano
TESIS

OBTENER
STROENC
MICOBIL
PRESENT

TORRESA
DIRECTORES
UVENCIOGA
ORTUNATAS
CNICON
CIENCIAS
RADOEINVEST
idadmic
oclorados
S
RELGRAD
CIENCIAS
GICAS:
TA:
ARREDON
SDETESIS
LINDEZMAY
SANTOYOTEP
ACIONA
BIOLGICA
TIGACIN
robianac
sysusde
DODE
S
NDO
ER
POLE
AL
AS
capazde
rivados
JUNIO2011

ndice general



INDICEGENERAL
Pgina
1. INTRODUCCIN 1
1.1. Generalidades 1
1.2. Agroqumico 2
1.2.1. Herbicida 4
1.2.2. Clasificacin 4
1.2.3. HerbicidasTriazinicos 5
1.3. Atrazina 6
1.3.1. Permanenciaenelambiente 7
1.3.2. Efectostxicosdelaatrazina 7
1.4. Simazina
8

1.4.1. Permanenciaenelambiente 9
1.4.2. Efectostxicosdelasimazina 9
2. ANTECEDENTES 10
2.1. Degradacindeatrazina 10
2.1.1. Vadedegradacindelaatrazina 14
2.2. Degradacindesimazina 15
2.2.1. Vadedegradacindelasimazina 17
2.3. Degradacindemezclasdeherbicidas 18
3. JUSTIFICACIN 21
4. OBJETIVO 22
4.1. General 22
4.2. Especficos 22
5. DESARROLLOEXPERIMENTAL 23
6. MATERIALES 24
6.1. Microorganismos 23
6.2. Mediodecultivo 24
6.2.1. Mediodeconservacindelascepas 25
6.3. Herbicidaseintermediariosdeladegradacin 26
ndice general



6.3.1. Atrazina 26
6.3.2. Simazina 26
6.3.3. Intermediariosdeladegradacin 27
6.4. Biorreactordelechoempacado 28
7. MTODOSEXPERIMENTALES 29
7.1. Evaluacindelcrecimientodelosmicroorganismosenlosherbicidas
eintermediariosenmediosolido
29
7.2. Evaluacindeladegradacindelosherbicidaseintermediariosen
mediolquidoycultivoporlote.
29
7.3. Capacidaddeadsorcindelamezcladeherbicidasenelmaterialde
soporte.
29
7.4. Inmovilizacindelcultivoseleccionadoenelmaterialdesoporte. 30
7.5. Evaluacincinticadeladegradacindelosherbicidasenelreactor
horizontaldelechoempacado
30
7.6. Evaluacindelacapacidaddedegradacindelosintermediariospor
lacomunidadseleccionadaencultivoporloteenmedioliquidocon
clulasinmovilizadas.
32
7.7. Determinacindecuentaviableenelsoportedelreactor. 33
7.8. Evaluacindelapermanenciadelacomunidadenelreactor. 33
7.9. Seguimientodelosgenesquecodificanparalasenzimasque
degradanlosdiferentesherbicidas.
34
8. MTODOSANALTICOSYTCNICASDEBIOLOGAMOLECULAR 35
8.1. Determinacindeconcentracincelular 35
8.1.1. Recuentodeunidadesformadorasdecolonias(UFC) 35
8.2. Determinacindeconcentracindeherbicidaseintermediarios 35
8.2.1. EspectrofotometraUV 35
8.2.2. Cromatografaliquidadealtaresolucin(HPLC) 36
8.2.2.1. Atrazinaysimazina 36
8.2.2.2. cidocianrico 37
8.2.2.3. Intermediarios 37
8.2.2.4. Intermediariosdeshalogenados 37
8.2.2.5. Intermediarioshalogenados 38
8.2.3. Determinacindeglucosa 38
ndice general



8.2.4. Carbonoorgnicototal(COT) 38
8.2.5. cidocianrico 38
8.3. Tcnicasdebiologamolecular 39
8.3.1. ExtraccindeDNA 39
8.3.2. AmplificacindeDNA 39
8.3.3. Electroforesisengeldeagarosa 41
8.3.4. Electroforesisengelcongradientedetemperatura(TGGE) 41
9. RESULTADOSYDISCUSIN 43
9.1. Comunidadesquedegradanatrazinaysimazina 43
9.2. Pruebasdecrecimientodediferentesmicroorganismosen
intermediariosdeladegradacindelosherbicidasenmedioslido.
43
9.3. Seleccindelacomunidadqueseinmovilizenelreactordelecho
empacado.
48
9.4. Pruebasdecrecimientodelacomunidadartificialenmediolquido 48
9.5. Construccindelreactor 53
9.5.1. Operacinabiticaysaturacindelreactor 54
9.6. Operacindelreactorenrgimencontinuoconlacomunidad
artificialseleccionada.
56
9.6.1. Monitoreodelaacumulacindeintermediariosenla
degradacindelreactor.
61
9.6.2. Monitoreodelaacumulacindecidocianrico 65
9.7. Monitoreodelmantenimientodelacomunidadartificialenel
reactordelechoempacado.
66
9.8. Seguimientodelosgenesquecodificanparalasenzimasque
degradanlosdiferentesherbicidas.
70
10. Conclusin 73
11. Bibliografa 75
11.1. Consultaseninternet 79

ndice de figuras


INDICEDEFIGURAS
Pg.
Figura1.Interaccindelosagentesagroqumicosconlosecosistemas 2
Figura2.Anillostriazina,consustituyentes 5
Figura3.FotosistemaIyII. 6
Figura4.6chloroNethylN'isopropyl1,3,5triazine2,4diamine(Atrazina) 6
Figura5.6chloroN,N'diethyl1,3,5triazine2,4diamine(Simazina) 8
Figura6.Vadedegradacindelaatrazina 14
Figura7.Vadedegradacindelasimazina 17
Figura8.Similitudenlasvasdedegradacindelosherbicidastriazinicos 20
Figura9.Desarrolloexperimental 23
Figura10. Espectrosdeabsorcinencultivosporlote,empleandolamezclade
las cepas seleccionadas de la comunidad que degrada simazina, utilizando
como sustrato la mezcla atrazinasimazina (50:10 ppm). Los resultados
correspondenaduplicados.
45
Figura11.Espectrosdeabsorcindemuestrasdecultivosporlote,empleando
el conjunto de integrantes seleccionados de las comunidades que degradan
simazina(C
3
yC
5
)yatrazina(C
9
,C
10
yC
11
),utilizandocomosustratolamezcla
atrazinasimazina(50:10ppm).
47
Figura 12. Perfil cromatogrfico de la degradacin de atrazina por la
comunidad,encultivoporloteconclulasinmovilizadas.
50
Figura 13. Perfil cromatogrfico que ilustra degradacin de desisopropil
atrazina exgena por la comunidad en cultivo por lote con clulas
inmovilizadas.
50
Figura 14. Perfil cromatogrfico que ilustra la degradacin de desetil atrazina
por la comunidad en cultivo por lote con clulas inmovilizadas (40 ppm de
glucosacomofuentedecarbonoadicional).
52
Figura 15. Perfil cromatogrfico que ilustra la degradacin de desisopropil
atrazina por la comunidad en cultivo por lote con clulas inmovilizadas (40
52
ndice de figuras


ppmdeglucosacomofuentedecarbonoadicional).
Figura16.Esquemayfotografadelreactorairliftempacado 53
Figura 17. Espectros de absorcin de las muestras tomadas en el suministro y
elefluentedelreactoradiferentestiempos,durantelasaturacindelsoporte
conlamezcladeherbicidas.
54
Figura18.Cinticadesaturacindelsoporte.Laconcentracindeherbicidasse
expresa como ppm de atrazina, determinda espectrofotometrcamente (As
221
nm
).
55
Figura 19. Comportamiento de la As221 del suministro y del efluente del
reactoralasdiferentesvelocidadesdeflujo.
56
Figura20.Perfilcromatogrficodelsuministroydelefluentedelreactorauna
cargadelamezcladeherbicidasde0.8mgL
1
d
1
.
57
Figura21.Perfilcromatogrficodelsuministroydelefluentedelreactorauna
cargadelamezcladeherbicidasde2.1mgL
1
d
1
.
57
Figura22.Perfilcromatogrficodelsuministroydelefluentedelreactorauna
cargadelamezcladeherbicidasde4.36mgL
1
d
1
.
58
Figura23.Perfilcromatogrficodelsuministroydelefluentedelreactorauna
cargadelamezcladeherbicidasde8.7mgL
1
d
1
.
58
Figura24.Perfilcromatogrficodelsuministroydelefluentedelreactorauna
cargadelamezcladeherbicidasde17.4mgL
1
d
1
.
58
Figura 25 Perfil cromatogrfico del suministro y el efluente del reactor a una
cargadelamezcladeherbicidasde34.9mgL
1
d
1
.
59
Figura 26. Velocidad volumtica de remocin de la mezcla de herbicidas (Rv
H
)
enfuncindelacargadelamezcladeherbicidas(Bv
H
).
59
Figura 27. Velocidad volumtrica de remocin de cido cianrico (Rv
AC
) en
funcindelacargadecidocianrico(Bv
AC
),suministradocomofraccindela
molculadelosherbicidas.
60
Figura28.Eficienciaderemocindelherbicidaydelcidocianricoenfuncin
delacargadeherbicidas(Bv
H
).
61
ndice de figuras


Figura 29. Perfil cromatogrfico de la mezcla de intermediarios a una
concentracinde10ppmledasa210nm.1)Acidocianurico,2)Hidroxidesetil
desisopropil atrazina, 3) Desetil desisopropil atrazina, 4) Hidroxi desetil
atrazina, 5) Desisopropil atrazina, 6) Hidroxi simazina, 7) Desetil atrazina, 8)
Hidroxiatrazina,9)Simazina,10)Atrazina.
62
Figura 30. Perfil cromatogrfico del efluente del reactor comparado con el
perfil cromatogrfico de la mezcla de intermediarios. Velocidad de flujo: 4 mL
h
1
.
63
Figura 31. Perfil cromatogrfico del efluente del reactor comparado con el
perfilcromatogrficodelamezcladeintermediarios.Velocidaddeflujo:10mL
h
1
.
63
Figura 32. Perfil cromatogrfico del efluente del reactor comparado con el
perfilcromatogrficodelamezcladeintermediarios.Velocidaddeflujo:40mL
h
1
.
64
Figura 33. Perfil cromatogrfico del efluente del reactor comparado con el
perfilcromatogrficodelamezcladeintermediarios.Velocidaddeflujo:80mL
h
1
.
64
Figura 34. Perfil cromatogrfico del efluente del reactor comparado con el
perfil cromtografico de la mezcla de intermediarios. Velocidad de flujo: 160
mLh
1
.
65
Figura 35. Velocidad especfica de remocin de cido cianrico, por S.
maltophilia, en funcin de la carga terica de cido cianrico suministrada al
reactor.
68
Figura 36. Remocin total de los herbicidas por unidad formadora de colonia
enfuncindelacarga.
68
Figura 37. TGGE de muestras de las clulas inmovilizadas del reactor de lecho
empacado
69
Figura38.TGGEdecepaspurasinoculadasenelreactordelechoempacado. 69
Figura39.GelesdeagarosaconelamplificadodelgenatzAparacadaunade 70
ndice de figuras


las muestras tomadas, A) cepas puras, B) clulas libres y C) clulas
inmovilizadas.
Figura40.GelesdeagarosaconelamplificadodelgenatzBparacadaunade
las muestras tomadas, A) cepas puras, B) clulas libres y C) clulas
inmovilizadas.
71
Figura41.GelesdeagarosaconelamplificadodelgenatzCparacadaunade
las muestras tomadas, A) cepas puras, B) clulas libres y C) clulas
inmovilizadas.
72


ndice de tablas


INDICEDETABLAS
Pg.
Tabla1.Clasificacindeplaguicidas 3
Tabla2.Integrantesdelascomunidadesutilizadasduranteeldesarrollodel
trabajo
24
Tabla3.Composicindelmediomnimomineralempleado 25
Tabla4.Composicindelasolucindeoligoelementos 25
Tabla5.ComposicinporcentualdelherbicidaGesaprim90WG 26
Tabla6.ComposicinporcentualdelherbicidaSinamex50SC 27
Tabla7.Clculodevalorescinticos 31
Tabla8.Iniciadoresutilizadosparalaevaluacindelariquezadelasespeciesde
lacomunidadseleccionada
34
Tabla9.Iniciadoresutilizadosparadetectarlapresenciadegenescatablicosen
lacomunidadseleccionada
34
Tabla10.Longituddeondademximaabsorbanciadelosherbicidase
intermediarios
36
Tabla11.MezcladereaccinparalaamplificacindeDNAmediantelatcnicade
PCR
39
Tabla12.CondicionesdelaPCRparalaamplificacindelosgenesdelas
enzimas.
41
Tabla13.CondicionesdeoperacindelequipodeTGGE 42
Tabla14.Integrantesdelascomunidadesysusclavesautilizarduranteel
desarrollodeltrabajo
43
Tabla15.Evaluacindecrecimientodelosintegrantesdelacomunidad
microbianaaisladaquedegradasimazinaenlosherbicidasyenlosdiferentes
44
ndice de tablas


intermediariosdedegradacin
Tabla 16. Evaluacin de crecimiento de los integrantes de la comunidad aislada
demedioconatrazinaenlosdiferentesintermediariosdedegradacin.
46
Tabla 17. Evaluacin del crecimiento de los integrantes de la comunidad
seleccionadaenlosdiferentesintermediariosdedegradacin.
47
Tabla18.Comunidadartificialseleccionadaparainocularelreactor. 48
Tabla 19. Eficiencia de remocin en medio lquido de los herbicidas e
intermediarios de su degradacin en cultivo por lote, por la comunidad artificial
provenientedellechoempacado.
49
Tabla 20. Eficiencia de degradacin de los intermediarios en cultivo por lote,
empleandomediolquidoadicionadoconglucosa.
51
Tabla21.Caractersticasvolumtricasdelreactor 53
Tabla22.Concentracindecidocianricoalasdiferentescargasvolumtricas 66
Tabla 23. . Unidades formadoras de colonias (UFC) provenientes del soporte, a
lasvelocidadesdeflujoensayadas.
67
Tabla24.Resultadosdelbalancedecidocianricoenlaltimavelocidadde
flujodelreactor.
69

Resumen

Resumen
Por razones econmicas, una enorme cantidad de reas boscosas o selvticas, han sido
convertidasencamposdecultivoparalaproduccinintensivadealimentosobiocombustibles.La
economadeplantacin,exigeeliminarlacompetenciaporespaciosynutrientesquerepresentan
para el planto las denominadas malezas con la consecuente utilizacin masiva de herbicidas.
Aunqueestoincrementalaproductividadagrcola,provocaunaseveracontaminacinensuelosy
agua que, finalmente afecta los ecosistemas, pudiendo incluso provocar daos a la salud de los
trabajadores agrcolas. Por su amplio uso, los herbicidas triazinicos representan un importante
grupo de herbicidas. Las striazinas tienen en comn un anillo heterocclico con tres tomos de
nitrgeno y tres de carbono distribuidos simtricamente. Este anillo es responsable del carcter
recalcitrante de este grupo de herbicidas. Aunque la atrazina y la simazina son compuestos
ligeramente solubles en agua, la presencia de agentes humectantes y dispersantes en sus
formulacionescomerciales,favorecenlacontaminacindecuerposdeagua.
Se han reportado diferentes procesos para remover atrazina y simazina de agua contaminada.
Entre ellos tenemos mtodos qumicos y fisicoqumicos, que han demostrado tener elevadas
eficiencias de oxidacin, pero con elevados costos. Los mtodos biolgicos, principalmente los
mtodos aerbicos presentan altas eficiencias de remocin cuando se emplean comunidades
microbianasenvezdecultivosaxnicos.
En el presente estudio se emple una comunidad artificial, integrada a partir de comunidades
previamente aisladas, capaces de degradar los compuestos atrazina y simazina, para metabolizar
una mezcla de atrazinasimazina. La capacidad que presenta esta comunidad para degradar
intermediarios metablicos de ambos herbicidas fue tambin evaluada. Esto se realiz probando
la capacidad de crecimiento de los integrantes de las comunidades en medio slido con los
diferentesherbicidaseintermediarios,evaluandosucrecimientoadiferentestiempos,ydespus
probando la capacidad de las mejores cepas en medio lquido. Basados en estos resultados, la
comunidad artificial compuesta por los gneros Cellulomonas, Pseudonocardia,
Stenotrophomonas,ArthrobacteryRhizobium.
Para la evaluacin cintica y estequiomtrica de esta comunidad, fue construido un reactor de
lecho empacado rectangular en el que la recirculacin de reactantes y de lquido oxigenado a la
biopelcula inmovilizada en el soporte se logr por medio de un canal airlift ubicado en el centro
Resumen

delbioreactor.Enestebioreactorseprobladegradacindelamezclaatrazinasimazina(50:10
ppm), a diferentes velocidades de flujo, que se variaron de 4 mL h
1
a 160 mL h
1
. En todos los
casos,laremocindeherbicidasfuedel100%,medidaporHPLCyCOT,sinembargo,seobservla
aparicindeintermediariosmetablicosqueelCOTnoescapazdedetectar.
La acumulacin de estos compuestos, principalmente el cido cianrico (AC), fue detectada por
HPLC. Conforme se aument la carga volumtrica de herbicidas, la acumulacin de AC se
incrementenelbioreactor.Estopodrarelacionarseconlagradualdisminucindeunabacteria
delgneroStenotrophomonas,quecontienelamaquinariaenzimticaparaladegradacindeAC.
Una vez que finaliz el proceso de biodegradacin, se calcul estequiomtricamente
la eliminacin de AC; la cual se debi a la adsorcin de la biopelcula, biodegradacin
yacumulacin intracelular, presuntamente en las bacterias que carecen de la informacin
genticaparaproducirlaenzimacianricoamidohidrolasa.

Abstract

Abstract
Foreconomicreasons,anenormousamountofforestedareashavebeenconvertedinagricultural
lands for extensive food or biofuels production. The plantation economy requires eliminating
weed competition for space and nutrients; with the consequent massive use of herbicides. The
extensive agriculture increased crop productivity, but causes severe soil and water pollution that
ultimatelyaffectaquaticecosystemsandmayevendamagethehealthofagriculturalworkers.The
strazinic compound share a heterocyclic ring with three nitrogen and three carbon atoms
symmetrically arranged. This ring is responsible of the recalcitrance of this group of herbicides.
Although atrazine and simazine are slightly watersoluble compounds, due to the presence of
wettinganddispersantagentsinherbicidecommercialformulations,theycancontaminatewater
bodies.
Different processes have been reported to remove atrazine and simazine from contaminated
water. Among them, the chemical and physicochemical methods have demonstrated high
oxidation efficiencies, but also high cost. Biological methods, especially the aerobic processes,
could remove, economically and efficiently these herbicides, particularly when microbial
communities,insteadaxeniccultures,areused.
In the present study, an artificial community built from previously insolated bacterial strain, able
to degrade atrazine or simazine, was used to metabolize a mixture of atrazine and simazine. The
capability to degrade metabolic intermediaries of both herbicides was also evaluated for this
community. This was done by testing the cell growth of communitys members in solid medium
with different herbicides and intermediaries, assessing growth at different times, and the
evaluatingthedegradationcapabilityofthebeststrainsinliquidmedium.Basedontheseresults,
theartificialcommunitywasintegratedbybacterialstrainspertainingtothegeneraCellulomonas,
Pseudonocardia,Stenotrophomonas,ArthrobacterandRhizobium.
Forthekineticandstoichiometricevaluationofthiscommunity,arectangularpackedbedbiofilm
reactor was constructed. The recirculation of oxygenated liquid and reactants to the attached
biofilmwasachievedbymeansofanairliftchannellocatedatthecenterofthebioreactor.Inthis
bioreactor,thebiodegradationofamixtureofatrazinesimazine(50:10ppm)wasevaluatedatsix
flowrates,rangingfrom4to160mLh1.Inallcases,theremovalefficienciesmeasuredbyHPLC
and TOC were 100%; however, the recalcitrant heterocyclic metabolic intermediaries were not
Abstract

determinedbyCOT.Theaccumulationofcompounds,mainlycyanuricacid(CA),wasdetectedby
HPLC. When the volumetric loading rate of herbicides was increased, CA accumulation was also
increasedinthebioreactor.ThisfactcouldberelatedtothegradualdecayofStenotrophomonas,
bacteriawhichcontainstheenzymaticmachineryforCAdegradation.
Once that biodegradation process ends, it was stoichiometrically estimated that CA removal was
due to biofilm adsorption, biodegradation, and intracellular accumulation; presumptively by
bacterialstrainslackingtheinformationtosynthesizethecyanuricamidohydrolaseenzyme.
Introduccin

1
1. INTRODUCCIN
1.1.Generalidades
Duranteeldesarrollodelahumanidadydespusdequeelserhumanoseconvirtieraen
sedentario, ste ha buscado conseguir el alimento de una forma u otra, principalmente
empleandolaagriculturacomofuenteprincipaldeinsumos,lamentablementelamayora
deloscamposdecultivonosonlosuficientementeproductivos,porloquelageneracin
de planicies para siembra, donde antes se encontraba un bosque, selva, o cualquier
ecosistema,haaumentadoconsiderablemente.
El ser humano en su afn de producir ms y al mismo tiempo conservar el medio
ambiente ha buscado alternativas para aumentar la produccin de los campos de cultivo
actuales, esto mediante el uso de productos agroqumicos (fertilizantes qumicos y
plaguicidas), que aumentan la produccin por hectrea considerablemente (Ewald y
Aebischer,2000).
La implementacin de una agricultura sustentable caracterizada por su inocuidad
medioambiental y la preservacin de los recursos naturales, la utilizacin de recursos
renovables locales y tecnologas apropiadas y baratas, una mnima compra de insumos
externos y por consiguiente, un alto grado de autosuficiencia local, permitira reducir el
uso de fertilizantes y plaguicidas. Desafortunadamente el uso de estos agentes
agroqumicos no es controlado y genera una severa contaminacin al ambiente y ms si
sonutilizadosenexceso,afectandoprincipalmenteloscuerposdeagua(Figura1).

En M
subter
sector
acuacu
10.65
datos
es sign
de los
puntu
(http://

1.2.Ag
Eltrm
plagui
interru
denom
que c
propa
xico el vol
rrneas, asc
r agrcola (8
ulturainten
km
3
de agu
relativosal
nificativa, da
s casos la c
al, lo que d
/www.acsmed
groqumico
minoserefie
cidas.Losp
umpir el c
minacin se
compiten co
ganenferme
Figura
http://e
lumen anua
ciende a 73
83%), y de
siva yotros
uas residuale
acontamina
ado el inten
contaminaci
dificulta el t
ioambiente.co
erealassust
laguicidasso
crecimiento
incluyen in
on los hum
edades(Ellis
1. Interaccin
dafologia.urg.e
al consumid
km
3
, de lo
spus al us
(2%). Por e
es (aguas de
acindeagu
so uso de p
n de acuf
tratamiento
om/lonuevo/ju
tanciasqum
onsustancia
de seres
sectos, hier
manos para
sycol.,1998
n de los age
es/conta/tema

o de agua,
s cuales el
so domstic
nde elsecto
e retorno ag
uaderivadad
plaguicidas y
feros subter
de las den
unio2009).
micasutilizad
asqumicasd
vivos cons
rbas, aves, m
conseguir a
8).
ntes agroqu
a13/imagenes/
tanto de a
mayor porc
co (12%), l
or agrcola e
grcola) al a
delaactivid
y fertilizante
rrneos, ro
ominadas a
dasenagricu
destinadasa
siderados p
mamferos,
alimento, d
micos con lo
/interac.gif ju
aguas supe
centaje le c
a industria
es responsab
o. No exis
adagrcola,
s qumicos.
os y lagos e
aguas de ret
ulturacomo
amatar,rep
plagas. Den
peces y mic
destruyen la
os ecosistema
unio2008
Introducci
rficiales com
orresponde
(3%), y a
ble de gener
sten en el p
perosindu
En la mayo
es difusa y
torno agrco
ofertilizante
peler,regula
ntro de es
croorganism
as siembras
as
in
2
mo
al
la
rar
as
da
ra
no
ola
sy
ro
sta
mos
s y

Introduccin

Este tipo de compuestos se pueden clasificar por su actividad biolgica, naturaleza


qumicaoporcaractersticascomo:persistencia,toxicidad,hidrosolubilidad,ovolatilidad.
Supotencialcomocontaminantedelmediodependedesuspropiedadesfsicas,qumicas
obiolgicas(Tabla1).

Tabla1.Clasificacindeplaguicidas
Actividadbiolgica Insecticidas
Acaricidas
Nematicidas
Fungicidas
Antibiticos
Herbicidas
Rodenticidas
Avicidas
Molusquicidas
Atrayentesyrepelentesdeinsectos
Naturalezaqumica Organoclorados
Organofosforados
Carbamatos
Derivadosdelaurea
Compuestosheterocclicos
Compuestosinorgnicos
Insecticidas, herbicidas,
fungicidas
Insecticidas
Insecticidas,herbicidas
Herbicidas
Herbicidas
Accionesdiversas
Toxicidad Supertxicos
Extremadamentetxicos
Muytxicos
Moderadamentetxicos
Ligeramentetxicos
Prcticamentenotxicos
DL
50
<5mg/Kg
DL
50
550mg/Kg
DL
50
50500mg/Kg
DL
50
5005000mg/Kg
DL
50
515g/Kg
DL
50
>15g/Kg
Fuente:http://edafologia.urg.es/conta/tema13/clasif.htm2008

Introduccin

4
1.2.1.Herbicidas
Los herbicidas son productos qumicos fitosanitarios diseados especficamente para
matar malezas (plantas indeseadas). Los herbicidas selectivos atacan ciertos blancos,
siendo inocuos para el resto de las plantas cultivadas. Los herbicidas utilizados para
limpiar grandes terrenos no son selectivos y matan toda planta con la que entran en
contacto.
Enpasesdondesepracticalaagriculturaintensivayaltamentemecanizada,losherbicidas
hanreemplazadoengranpartelosmtodosmanualesomecnicosdecontroldemalezas
(WhitacreyWare,2004).

1.2.2.Clasificacin
No existe un slo sistema de clasificacin de los herbicidas. Los diferentes sistemas se
basan en criterios muy dispares, como su naturaleza qumica, su mecanismo de accin o
sutoxicidad.Noobstante,sepuedendividirendosgrandesgrupos:

Herbicidas residuales: se aplican al suelo, sobre la tierra desnuda y forman una


pelcula txica que controla el nacimiento de las malas hierbas al atacarlas durante su
germinacin.Dosaplicacionesalaodeherbicidasresidualespuedensersuficientespara
mantenerunsuelolimpiodemalezasquenacendesemilla.Normalmentenosonactivos
sobreespeciesperennesquerebrotanapartirderizomas,estolonesobulbillos.

Herbicidas sistmicos: se aplican sobre la planta, que absorbe el producto y lo


transportaadiferentestejidosmedianteelfloema.

Introduccin

5
1.2.3.Herbicidastriazinicos
Las striazinas contienen un anillo heterocclico simtrico que contiene tres tomos de
nitrgenoytresdecarbono.Puedentenervariossustituyentes(Figura2).
.
R
2
R
3
R
1
NH NH
N
N
N

Seestimaqueposiblementelamitaddelosherbicidasdisponiblespresentanunmodode
accinqueinvolucraalacadenadetransportedeelectronesdelfotosistemaII.Unaetapa
crtica en esta cadena es la reduccin de la plastoquinona (PQ) por la protena Q
A
en la
membrana del tilacoide. Estos herbicidas se enlazan a la protena Q
A
, con lo que se
bloquealareduccindelaPQyseinterrumpeelprocesodetransferenciadeelectrones,
afectndoselasntesisdeATPyNADPHenelcloroplasto(Figura3).Estoimpidelafijacin
de CO
2
, necesaria para la produccin de los carbohidratos indispensables para la
sobrevivencia de la planta. La interrupcin en la transferencia de electrones causa,
adems, un estrs oxidativo por la generacin de radicales libres que producen daos
celulares(Markwellycol.,2007).

Figura2.Anillostriazina,consustituyentes

Loshe
otros.
elimin
compu
triazin

1.3.At
La atr
solubl
los EE
(Dona
erbicidastria
Lamayorca
nar malezas
uestosgene
nicosincrem
trazina
Figura4
azina (Figur
eenagua.L
EUU, alrede
ldsonycol.,
aznicosseu
antidadseu
en sitios ind
ranunimpa
entaelriesg
4.6chloroN
a 4), es un
LaEPAestim
dor de 80
2002).
C H
3
C H
3
Figur
usandeman
usanenprod
dustriales (W
actoserioal
godedesarr
ethylN'isop
polvo blanc
mqueen19
millones de
NH
N
ra3.Fotosiste

neraselectiv
duccindem
Whitacre y W
medioamb
ollarcncer
ropyl1,3,5tr
co sin olor,
999laatraz
e libras, pri
NH
Cl
N
N
emaIyII(Boh
vaenciertos
mazylosus
Ware, 2004)
bienteylae
enhumano
riazine2,4di
no muy vol
inafueelpe
incipalment
H
CH
3
hinski,R.C.199
scultivosyn
sosnoselec
. En genera
exposicina
os(Kettlesyc
iamine(Atraz
ltil que es
esticidams
e en el cul
98).
Introducci

noselectiva
ctivossonpa
l, este tipo
losherbicid
col.,1997).

zina)
relativamen
sempleado
ltivo del m
in
6
en
ara
de
das
nte
en
az

Introduccin

7
1.3.1.Permanenciaenelambiente
La atrazina es altamente persistente en suelos, donde permanece por ms de un ao en
condiciones de baja humedad y temperatura, su movilidad vara de moderada a alta,
sobretodo ensuelosdezonaslluviosascon bajocontenidodearcillaymateriaorgnica.
Debido a su dbil adsorcin a las partculas, a su hidrosolubilidad y a su relativamente
larga vida media (60 a ms de 100 das) representa un riesgo elevado de contaminacin
paralasaguassubterrneas.
En los cuerpos de agua su degradacin es lenta y no se adsorbe fuertemente a los
sedimentos.Enpeces,notiendeabioacumularse,yaquesehanencontradonivelesbajos
de este plaguicida en cerebro, vescula biliar, hgado y tracto digestivo
(http://www2.ine.gob.mx/sistemas/plaguicidas/pdf/atrazina.pdf.Septiembre2009).

1.3.2.Efectostxicosdelaatrazina
Estampliamentedocumentadoquelaatrazinapuraomezcladaconotrosagroqumicos
daadiversasespeciesacuticas(SullivanySpence,2003;RussoyLagidick,2004;Fatimay
col.,2007).Esuncompuestoclastognicoyposiblecarcinognico(Cantemirycol.,1997).
Esunconocidoperturbadordelsistemaendcrinoenanfibios;Anendosisqueestnpor
debajo de los lmites establecidos por la USEPA para agua potable (3 ppb), afecta el
sistemaendcrinoderanas(Hayesycol.,2002).
Este herbicida inhibe la fotosntesis en plantas acuticas afectando la cadena trfica y
causa mltiples efectos en animales, por ejemplo interviene en el sistema respiratorio y
funciones endocrinas del salmn (Moore y Lower, 2001), adems de alterar el
comportamiento social y el comportamiento antipredador en peces dorados (Salgio y
Trijasse,1998).
Introduccin

8
La atrazina causa una reduccin significativa de las poblaciones microbianas en el suelo
(TaiwoyOso,1997),ocasionatumoresenratas(Stevensycol.,1999),yhasidocatalogada
comoposibleagentecarcinognicoenhumanos(IARC1999).
Otro estudio muestra los efectos sobre las larvas de corvina roja, que ven alterado su
crecimiento al crecer en ambientes contaminados con este herbicida, as como un
aumentoenlatasademortalidaddelasmismas(AlvaresyFuiman,2005).

1.4.Simazina
Lasimazina(Figura5)esunherbicidapertenecientealgrupodelastriazinas,esunpolvo
blanco incoloro de olor caracterstico utilizado para el control de malezas de hoja ancha
en cultivos como maz, alfalfa, caa de azcar entre otros. Es de accin sistmica y
residual, se absorbe por las races y se aplica en la preemergencia o posemergencia de
lasmalezasencombinacinconunherbicidadecontactocomoParaquat.Tambinseha
registradocomounalguicida(Mondragnycol.,2008;Ware,2000).

C H
3
NH
NH
Cl
N
N
N
CH
3

Figura 5. 6-chloro-N,N'-diethyl-1,3,5-triazine-2,4-diamine (Simazina)

Introduccin

9
1.4.1.Permanenciaenelambiente
En el suelo presenta una movilidad que vara de baja a alta. En este medio puede ser
biodegradado, generando Ndesetilsimazina y 2cloro4,6bisaminostriazina como
principalesmetabolitos.
En los cuerpos de agua se adsorbe parcialmente a los slidos suspendidos y sedimentos.
Este compuesto es susceptible a la hidrlisis a pH cido, siendo la 2hidroxi4,6
bis(etilamina)striazinaelprincipalproductodeestareaccin.
La volatilizacin desde el suelo y agua no es un destino ambiental importante para este
plaguicida. Su potencial de bioconcentracin en organismos acuticos vara de bajo a
moderado(http://www2.ine.gob.mx/sistemas/plaguicidas/pdf/simazina.pdf.Septiembre2009).

1.4.2.Efectostxicosdelasimazina
Se ha detectado que la simazina causa problemas en el sistema endcrino, afectando la
reproduccin de varias especies acuticas. Se clasifica como categora toxicolgica IV,
como ligeramente txico y en la clasificacin C como posible carcinognico humano
(USEPA,2004.Versinelectrnica).
La simazina est catalogada por la Unin Europea como muy txica para organismos
acuticos, como las algas y Daphnia, originando la prohibicin o restriccin de su uso en
algunospaseseuropeos(EuropeanComission,2003).Lasimazinapuedeocasionarenlos
seres humanos, temblores, dao a testculos, riones, hgado y tiroides, mutaciones y
cncer principalmente de rin, seno y ovarios (Snedeker, 1998; USEPA, 2004. Versin
electrnica),condosismayoresalaMCL(MaximunContaminatLevel,4gL
1
).
Tambinesconsideradomodificadordelsistemaendcrinoyaquecambiaelmetabolismo
de los estrgenos en el cuerpo (Toop y col., 2000; Ralebitso y col., 2002; Birkhoj y col.,
2004).
Antecedentes

10
2.ANTECEDENTES

Los herbicidas triaznicos son un grupo importante de xenobiticos que ingresan al


ambienteatravsderesiduosindustrialesydelaactividadagrcola.Enlamayoradelas
ocasiones, principalmente por su uso indiscriminado, tienen como destino final cuerpos
deaguasuperficialysubterrnea;portalraznsusefectostxicossondegranrelevancia
paralosecosistemasacuticos.
Conelfindeeliminarestosxenobiticosyaslograrladepuracindelaguacontaminada
sehanrealizadounadiversidaddeestudiosdondeseaplicandiferentesmtodos.

2.1.Degradacindeatrazina

La atrazina es uno de los herbicidas de mayor uso en la agricultura y presenta una


ecotoxicidad elevada, es por eso que se han propuesto diversos mtodos para lograr su
remocindelmedioambiente,destacandolosqumicosylosbiolgicos.
Losmtodosdeoxidacin(Beytulycol.,2009),fotooxidacin(Seemaycol.,2009;Grcicy
col., 2009) y los electroqumicos (Zaviska y col., 2011) han sido estudiados para degradar
atrazina.
Losmtodosmicrobiolgicospuedenserencondicionesaerbicasoanaerbicas.Pranab
y Ligy (2004) reportan que utilizando un cultivo mixto en condiciones de anaerobiosis
degradaron,enunsistemaporlote,concentracionesdeatrazinaquevariaronde0.51.5
mgL
1
. Utilizando una fuente de carbono adicional (dextrosa) obtuvieron un mximo de
degradacindel15%,cuandolacomposicindelmediofuede300mgL
1
dedextrosay5
mgL
1
deatrazina,resaltandoquenohubogeneracindemetano.
Antecedentes

11
Hunter y Shaner (2009) estudiaron la degradacin de atrazina empleando una columna
empacadaconarena(biobarrera),lacualcontenaunacomunidadbacterianayaceitede
soya como fuente de carbono. La atrazina (16.3 mg L
1
) se utiliz como fuente de
nitrgeno obteniendo una degradacin del 97%. Se observtambin que la presencia de
otrafuentedenitrgenoprovocunadisminucindel60%enladegradacindeatrazina.
Tambin se observ una acumulacin de hidroxiatrazina en el efluente por
deshalogenacindelcompuestooriginal,indicandoquelamineralizacinnoescompleta.
Por otra parte Siripattanakul y colaboradores (2009a) estudiaron la biodegradacin
empleando a una comunidad capaz de degradar atrazina en un soporte de arena,
reportandoeficienciasderemocindel42al80%.Losanterioresresultadoshablandelas
limitacionesquepresentanlosprocesosanaerobiospararemoveratrazina.
Enloreferenteaprocesosaerbicos,Siripattanakulycolaboradores(2009b),realizaronel
estudio de la degradacin de atrazina a partir de un suelo contaminado con este
herbicida. Mediante tcnicas de enriquecimiento obtuvieron una comunidad integrada
por 4 microorganismos (Alcaligenes faecalis, Klebsiella ornithinolytica, Bacillus
megateriumyAgrobacteriumtumefaciens)loscualescrecieronenunmediocon100mgL

1
de atrazina con eficiencias de degradacin que variaron del 33 al 51%, posteriormente
identificaronlacomunidadportcnicasmolecularesascomolapresenciadeelgenatzA
enunpardeespeciesaisladas(KlebsiellaornithinolyticayAgrobacteriumtumefaciens).
PorotroladoSatsuma(2009)analizladegradacindelaatrazina(1mgL
1
)utilizandouna
comunidad aislada a partir de muestras tomadas de un ro, observando acumulacin de
cido cianrico que era mineralizado lentamente. Se encontr que la comunidad estaba
integrada por bacterias del genero Nocardioides y Pedomicrobium. La primera era la
responsable de la degradacin de la atrazina y la segunda del cido cianrico,
posteriormente se emple a esta comunidad para degradar otros herbicidas s
clorotriaznicos,encontrandobajaseficienciasderemocindestos.
Antecedentes

12
Tafoya y colaboradores (2009) realizaron la evaluacin cintica de la degradacin de
atrazinaencultivocontinuodeclulasensuspensinyenclulasinmovilizadasencarbn
activado granular utilizando un consorcio microbiano aislado a partir de suelos
contaminados con herbicidas, en las determinaciones realizadas se obtuvieron altas
velocidadesdedegradacin.Conclulasinmovilizadasseobtienevelocidadesyeficiencias
remocinelevadas;R
V
=12.2mgL
1
h
1
yunaeficienciaderemocindel100%.Alrealizarla
prueba con clulas libres se obtuvieron resultados similares de degradacin y en ambos
casos,unabajaacumulacindeintermediarios.
Uno de los antecedentes importantes para este trabajo es el presentado por Macas y
colaboradores (2009), que estudiaron la degradacin de este herbicida aislando una
comunidad a partir de suelos contaminados, la cual fue identificada. Se encontraron los
gneros bacterianos Massilia, Stenotrophomonas maltophilia, Ochrobactrum,
Arthobacter, Microbacterium, Xanthomonas y Ornithinimicrobium, esta comunidad fue
capaz de utilizar atrazina como nica fuente de carbono y nitrgeno en un reactor de
lecho empacado, en rgimen continuo con eficiencias de remocin cercanas al 100%.
Despusdeperiodoslargosdeoperacinseanalizlariquezadelreactorencontrandola
presencia de slo 3 especies S. maltophilia, Ochrobactrum y Arthobacter, de las cuales
slo la primera contiene el gen atzD que codifica a la enzima cido cianrico
amidohidrolasa.
En la Figura 6 se presenta la ruta de degradacin propuesta por Smith y colaboradores
(2005) en donde las enzimas Atz A, B, C, desempean diferentes funciones. La AtzA,
desempealafuncindedeshalogenaciondelcompuesto, generandohidroxiatrazina,en
los siguientes pasos de la va de degradacin se encuentra la AtzB (Netilamelida
amidohidrolasa) y la AtzC (Nisopropilamelida amidohidrolasa). El producto de la hidrlisis es
el cido cianrico, que es la molcula ms recalcitrante de la va de degradacin de este
compuesto.
Antecedentes

13
Paraladegradacindelcidocianrico,sehadescritoyreportadoquePseudomonassp.
produce la enzima especfica para la hidrlisis de este compuesto, la cido cianrico
hidrolasa,codificadaporatzD(Frucheyycol.,2003).
Antecedentes

14
2.1.1.Vadedegradacindelaatrazina
C H
3
C H
3
NH
NH
Cl
N
N
N
CH
3
C H
3
C H
3
NH
NH
O H
N
N
N
CH
3
NH
O H
O H
N
N
N
CH
3
C H
3
C H
3
OH
NH
O H
N
N
N
OH
O H
O H
N
N
N
UREA
NH
3
CO
2
H
2
O
+ +
Atrazina
Hodroxiatrazina
N-etilamelida
N-isopropilamelida
cido Cianurico
O
O
N H
2
NH
N H
2
Biuret
Atz A
Atz B Atz C
Atz D
Atz B
Atz C

Figura6.Vadedegradacindelaatrazina(Smithycol.,2005)
Antecedentes

15
2.2.Degradacindesimazina

Paraladegradacindesimazina,queesunodelosherbicidasmsempleadosenMxico,
tambin se han reportado mtodos de oxidacin qumica (Catalkaya y Kargi 2009), y
mtodos biolgicos. Montalvo y colaboradores (1997) publicaron la determinacin de
parmetros cinticos obtenidos en un reactor de lecho empacado con clulas
inmovilizadas y empleando una comunidad bacteriana (DSZ1). Lo ms relevante es la
elevadaeficienciaderemocindelxenobitico.
Martin y colaboradores (2008b) estudiaron la degradacin de simazina por una
comunidadbacterianaaisladaapartirdesueloscontaminadosconsimazina,encontrando
la presencia de dos microorganismos Pseudomonas sp. y Klebsiella planticola, los que se
cultivaronensimazinautilizandodiferentesconcentraciones(2gmL
1
,5gmL
1
,8gmL

1
) adems se adicion un marcadorde fluorescencia al genatzB (alcual llamaron atzB1),
conelculpudierondetectarenelcultivo,lapresenciadelaenzimaquehidrolizaelgrupo
amino;loquepermitimonitorearelcrecimientodelapoblacincapazdedegradareste
herbicida. Un punto tambin importante de este trabajo fue que no se encontr
acumulacin de cido cianrico, principal intermediario de la degradacin de este
compuesto.

Martin ycolaboradores (2008a) estudiaron la degradacinde simazina en tres diferentes


reactores de pelcula utilizando un cultivo de Klebsiella planticola, realizando
modificacionesalasconcentracionesyobtuvieronvelocidadesderemocinquevariaron
de0.06a3.39mgh
1
,enunreactorconclulasinmovilizadas.

Mornycolaboradores(2006)analizaroncomunidadesbacterianasaisladasdediferentes
tipos de suelos donde se tenan antecedentes de la aplicacin de herbicidas y
determinaron que son capaces de degradar eficientemente en un periodo de 28 das la
simazina(40ppm)presenteenelmedio,predominandoelgneroPseudomonas.
Antecedentes

16

Mondragn y colaboradores (2008) realizaron el aislamiento de una comunidad de


microorganismos capaces de degradar a la simazina empleando un selector continuo. Se
obtuvieron eficiencias de remocin superiores al 97%, operando con cargas volumtricas
desimazinadehasta12mgL
1
h
1
,medianteunacomunidadintegradaporochogneros
microbianos:Ochrobactrum,Mycobacterium,Cellulomonas,Arthobacter,Microbacterium,
Rhizobium, Pseudomonas y Pseudonocardia. Al probar mayores cargas, disminuy la
eficiencia de degradacin. Posteriormente se probaron mezclas de simazina, atrazina, 2
cloro4,6diamino1,3,5triazina (CAAT) y cido cianrico, estos ltimos intermediarios de
ladegradacindelosherbicidas,obteniendoeficienciasderemocindel90%.

LarutadedegradacinpropuestaporEricksonyLee(1989)yKarthikeyanycolaboradores
(2003)semuestraenlaFigura7.

Antecedentes

17
2.2.1.Vadedegradacindelasimazina
C H
3
NH
NH
Cl
N
N
N
CH
3
C H
3
NH
2 NH
Cl
N
N
N
NH
2 N H
2
Cl
N
N
N
NH
2 O H
Cl
N
N
N
OH
O H
Cl
N
N
N
OH
O H
O H
N
N
N
C H
3
NH
2 NH
O H
N
N
N
C H
3
OH
NH
O H
N
N
N
2-cloro-4-amino-6-hidroxi-s-triazina 2, 6-hidroxi-4-amino-s-triazina
C H
3
NH
2 NH
O H
N
N
N
NH
2 O H
O H
N
N
N
2-cloro-4, 6-dihidroxi-s-triazina
2-cloro-4, 6-bis(etilamino)-s-triazina
2-cloro-4-amino-6-etilmino-s-triazina
2-cloro-4, 6-diamino-s-triazina
NH
3
CO
2
H
2
O
+ +
O
O
N H
2
NH
N H
2
Biuret
C H
3
NH
NH
O H
N
N
N
CH
3
2-hidroxi-4, 6-bis(etilamino)-s-triazina
2-hidroxi-4-amino-6-etilmino-s-triazina 2, 4-dihidroxi-6-etilmino-s-triazina
2-hidroxi-4, 6-diamino-s-triazina
Desalquilacion Biolgica Hidrlisis Biolgica
Hidrlisis Biolgica
Hidrlisis Qumica
cido Cianrico
O
O
O
NH
N H
2
Alofanato
O
N H
2
NH
2
Urea

Figura7.Vadedegradacindela
simazina(EricksonyLee,1989;
Karthikeyanycol.,2003)
Antecedentes

18
2.3.Degradacindemezclasdeherbicidas.

Dado que los herbicidas frecuentemente se aplican en forma secuencial o mezclados, es


importante estudiar la degradacin de mezclas de herbicidas. Por ejemplo, Guang Gu y
colaboradores (2003) analizaron la degradacin de tres herbicidas: atrazina, cianazina y
dicrama, en condiciones metanognicas, alcanzando eficiencias de remocin del 60% y
70% para la dicrama y la cianazina, respectivamente. La atrazina result ser an ms
recalcitrantequelosotrosdoscompuestos,
Beynon y colaboradores (2004) estudiaron la degradacin de los herbicidas atrazina,
simazina y cianazina en muestras de suelos y en sabia de maz utilizando tcnicas de
radioistopos para marcar las molculas. Se describe que en suelo, la simazina y la
atrazinasedegradanmslentamentequelacianazina.
Radosevich y colaboradores (1995) estudiaron la biodegradacin de mezclas binarias y
ternarias de atrazina, simazina y cianazina, utilizando un cultivo puro de Ralstonia
pickettii, que fue aislada en un cultivo con atrazina como nica fuente de carbono y
nitrgeno. La velocidad de remocin de atrazina y simazina fue similar y superior a la
velocidadderemocindelacianazina.
Kontchou y Gschwind (1994) emplearon un cultivo mixto de microorganismos para
degradar una mezcla de atrazina, simazina y cianazina, llos demostraron que se obtena
una degradacin completa en un periodo de 6 das. Tambin se reporta que las
velocidades de degradacin de la atrazina no se ven afectadas cuando se encuentran
presentesotrosherbicidasocontaminantes(Griggycol.,1997).
Gebendinger y Radosevich (1999) estudiaron un mecanismo de degradacin de una
mezcla de atrazina y cianazina, determinando que la cianazina inhibe el proceso de
degradacindelaatrazina.
Antecedentes

19
Kontcou y Gschwind (1999) realizaron un estudio sobre la degradacin de mezclas de
herbicidas triaznicos empleando una comunidad (16MIX) enriquecida que degrada
atrazina. La adicin de otros compuestos striazinicos (ciromazina ametrina,
desetilatrazina, hidroxiatrazina, simazina y terbutilatrazina), en un cultivo por lote no
afect la mineralizacin de la atrazina ni la de los otros herbicidas, slo se increment el
tiempodedegradacindelamezcla.
De los antecedentes ms cercanos a esta investigacin encontramos el de Galndez y
colaboradores (2011), quienes estudiaron la degradacin de la mezcla de herbicidas
atrazina y simazina (40:10) por un cultivo binario de Stenotrophomonas maltophilia y
Arthrobacter sp. en un reactor de biopelcula de dos etapas, encontrando una remocin
completa de los herbicidas pero una acumulacin del intermediario ms recalcitrante, el
cido cianrico, adems se monitore la presencia de los genes de la degradacin de los
herbicidas empleando los iniciadores deatzABC y D; El gene atzD nicamente sedetect
enS.maltophilia,quemientrasquelosotrostresserevelaronenlasotrasdoscepas.
De acuerdo con estos antecedentes queda claro que el xito de la degradacin eficiente
de la mezcla de estos herbicidas, depender de los microorganismos que integren la
comunidadseleccionada.
EnlaFigura8semuestralaconvergenciadelasrutasdedegradacindelosherbicidasen
elintermediariocomnqueesladesisopropilatrazina.


Antecedentes

20

C H
3
C H
3
NH
NH
Cl
N
N
N
CH
3
Atrazina
C H
3
NH
NH
Cl
N
N
N
CH
3
Simazina
C H
3
NH
2 NH
Cl
N
N
N
Desisopropilatrazina
NH
2 N H
2
Cl
N
N
N
2-cloro-4, 6-diamino-s-triazina
OH
O H
O H
N
N
N
NH
3
CO
2
H
2
O
O
O
N H
2
NH
N H
2
Biuret
cido Cianrico
O
O
O
NH
N H
2
Alofanato
O
N H
2
NH
2
Urea
+ +

Figura8.Similitudenlasvasdedegradacindelosherbicidas
triaznicos(Lerchycol.,1998)
Justificacin

21
3.JUSTIFICACIN

DebidoaqueenMxiconosetieneunaregulacinyuncontrolsobreelusodeherbicidas
triaznicos, el uso indiscriminado y la falta de capacitacin para la aplicacin de estos
compuestospuedegenerarunacontaminacinmuyseriaenelsueloyprincipalmenteen
loscuerposdeagua.
Se sabe que los compuestos triaznicos de inters para este trabajo (simazina y atrazina)
representan un problema serio por su ecotoxicidad, ya que a pesar de que para el ser
humano no resultan ser tan nocivos, en los cuerpos de agua pueden causar un
desequilibrioenlosecosistemasacuticos.
Es por eso que tomando como base las comunidades aisladas en trabajos previos
(Mondragn y col., 2008; Macas y col., 2009), con capacidad probada para degradar
simazina y atrazina, se pretende integrar una comunidad artificial que sea capaz de
mineralizar completamente mezclas de estos herbicidas en un nuevo tipo de reactor de
biopelculaqueseasusceptibledeescalamiento.
Por lo anterior, y con base en los resultados obtenidos en investigaciones previas se
integrar una comunidad artificial que sea capaz de mineralizar completamente una
mezcla de atrazina simazina empleando un reactor empacado que opere en aerobiosis,
conrecirculacindereactantesylquidooxigenadomedianteundispositivoairlift.

Objetivos

22
4.OBJETIVOS

4.1.Objetivogeneral

Construir una comunidad artificial, a partir de cepas previamente aisladas que sea capaz
dedegradarmezclasdeherbicidastriaznicosempleandounreactordelechoempacado.

4.2.Objetivosespecficos

Analizar el crecimiento de cada una de las cepas, integrantes de dos comunidades


previamenteseleccionadas,enlosherbicidasatrazinaysimazina.

Analizar el crecimiento individual de cada cepa en diferentes intermediarios de la


degradacindelosherbicidas.

Integrar la comunidad artificial con las cepas que muestren mejor crecimiento en los
sustratosmencionados(herbicidaseintermediarios).

Evaluar las velocidades y eficiencias de remocin de mezclas de herbicidas y de los


intermediarios metablicos, en un reactor de lecho empacado, en diversas condiciones
deoperacin.

5.DES
Ochrobactrum,M
Cellulomonas,Ar
Microbacterium,
PseudomonasyP
Com
SARROLLOE
Mycobacterium,
rthobacter,
Rhizobium,
Pseudonocardia,
munidaddegr
desimazi
Simazina
XPERIMENT
Fi
radadora
na
E
I
Eval
h
Eval
a
TAL
igura9.Desa
Evaluacinde
enmedios
ntegracinde
arti
uacindelad
herbicidasen
reactordelec
uacindela
comunidad
Atrazina

rrolloexperim
ecrecimiento
solidocon:
elacomunida
ficial
degradacind
mezclasenu
choempacad
permanencia
enelreactor

2
D
2
2
D
2
H
mental
Comu
o
ad
delos
un
do
adela
r
Inte
la
cidocianri
2cloro4,6d
Desetilatrazin
2hidroxides
2hidroxides
Desisopropila
2hidroxiatra
Hidroxisimazi
Desarrol
Och
Pse
unidaddegrad
deatrazina
HPL
Esp
DQ
Micro
Tcn
TGG
ermediariosd
degradacin
co
diamino1,3,5
na
setilatrazina
setildesisopro
atrazina
azina
ina
lloexperimen
hrobactrum,Artho
eudomonas,Rhizo
Stenotrophomon
dadora

LC
pectroscopiaU
O
obiologacls
icasmolecula
GE
e
5triazina
opilatrazina
ntal
23
obacter,
obium,
nas
UV
sica
ares
3
Materiales

24
6.MATERIALES

6.1. Microorganismos
Lascepasutilizadas(Tabla2)fueronaisladaseninvestigacionesanterioresypresentanla
capacidad para degradar a los herbicidas. Para la degradacin de simazina (Mondragn y
col., 2008), se proporcionaron ocho cepas que integran la comunidad aislada con
capacidad de degradar este herbicida. Para la atrazina se proporcionaron los integrantes
de una comunidad (cinco especies microbianas) aislada y evaluada por Macas y
colaboradores(2009)

Comunidadatrazina Comunidadsimazina
Ochrobactrum
Arthobacter
Pseudomonas
Rhizobium
Stenotrophomonasmaltophilia
Ochrobactrum,
Mycobacterium
Cellulomonas
Arthobacter
Microbacterium
Rhizobium
Pseudomonas
Pseudonocardia

6.2. Mediodecultivo

El medio de cultivo utilizado, para la evaluacin de la degradacin de la mezcla de


herbicidas, fue el reportado por Mondragn y colaboradores (2008) (Tabla 3). Este
tambinseempleparalaevaluacindelaremocindelosintermediariosdurantelas
diferentes etapas del trabajo. Cabe mencionar que el medio formulado fue
complementadoconsolucindeoligoelementos(Tabla4)utilizando1mLL
1
.
Tabla2.Integrantesdelascomunidadesutilizadasduranteeldesarrollodeltrabajo
Materiales

25

Componente Concentracin(gL
1
)
K
2
HPO
4
0.4
KH
2
PO
4
0.1
MgSO
4
0.1
NaCl 0.1
CaCl
2
0.02

Componente Concentracin(gL
1
)
FeSO
4
7H
2
0 0.55
ZnSO
4
7H
2
0 0.23
MnSO
4
7H
2
0 0.34
CoCl
2
6H
2
0 0.065
CuSO
4
5H
2
0 0.047
NaMoO
4
2H
2
0 0.034

*Paraelmedioslidoseagregan20gL
1
deagarbacteriolgico.

6.2.1.Mediodeconservacindelascepas
Lascepasseconservaronenvialesconmediomnimomineralyagarconlamezclade
herbicidas atrazina y simazina como nicas fuentes de carbono y nitrgeno en una
concentracin50:10ppm,respectivamente,aunatemperaturade4C.Porotrolado
las muestras de clulas libres se crioconservaron, a 20 C, en tubos Eppendorf de 2
mLcon0.5mLdeglicerolestrilal70%.
Tabla3.Composicindelmediomnimomineralempleado
Tabla4.Composicindelasolucindeoligoelementos
Materiales

26
6.3. Herbicidaseintermediariosdeladegradacin.

6.3.1. Atrazina
Presentacincomercialdelherbicida
ElproductocomercialsellamaGesaprim90WGyseencuentraenpresentacingranular.
SuscaractersticassemuestranenlaTabla5.

Componente Composicinporcentual
Atrazina(i.a.) 90
Ingredientesinertes:diluyente,
humectanteydispersante.
10

El ingrediente activo (i.a) fue fabricado en E.U.A., la formulacin e importacin las


realizaron Agan Chemical Manofacturers LTD y Novartis Agro, S.A. de C.V.
respectivamente.
Estndardeatrazina
ElestndardeatrazinafueproporcionadoporChemServiceInc.,WestChester,PA.USA.,
conunapurezadel98%.

6.3.2. Simazina
Presentacincomercialdelherbicida
El producto comercial se llama Sinamex 50 SC, y se encuentra en presentacin acuosa
concentrada,equivalentea500gdeingredienteactivo(i.a)L
1
(Tabla6).

Tabla5.ComposicinporcentualdelherbicidaGesaprim90WG
Materiales

27

ElingredienteactivofuefabricadoenIsrael,formuladopor:AganchemicalManufactured
LTD, importado por: Koor Intercomercial, S.A. y distribuido por Dinmica Agrcola y
Ambiental,S.A.deC.V.(DinAgra).

Estndardesimazina
ElestndardesimazinafueproporcionadoporChemServiceInc.,WestChester,PA.USA.,
conunapurezadel99%.

6.3.3. Intermediariosdeladegradacin.
La mayora de los intermediarios fueron proporcionados por ChemService Inc., West
Chester,PA.USA.Lapurezaencadacasofuelasiguiente:
Estndardehidroxiatrazina 99.5%
Estndardehidroxisimazina 98.9%
Estndardedesetilatrazina 99.5%
Estndardedesisopropilatrazina 97.3%
Estndarde2hidroxidesetil,desisopropilatrazina 98.7%
Estndarde2hidroxidesetilatrazina 99.5%
Estndarde2cloro4,6diamino1,3,5triazina 96.7%.
Componente Composicinporcentual
Simazina(i.a) Nomenosde43.5
Ingredientesinertes:diluyente,
humectanteydispersante.
Nomenosde56.5
Tabla6.ComposicinporcentualdelherbicidaSinamex50SC
Materiales

28

EstndardecidoCianrico
El estndar de cido cianrico fue proporcionado por SigmaAldrich Inc. Steinheim,
Germany,conunapurezadel98%.Esteproductoseencuentracomounpolvoblanco.

6.4. Biorreactordelechoempacado
Se construy un reactor rectangular de 22.5 x 22.5 x 31.5 centmetros, de acrlico de 6
mmdeespesor.Elreactortienetrescompartimentos,losdosexternosestnempacados
con fragmentos de roca volcnica. El compartimento central opera como un canal airlift
paracirculacindellquidoaireadoalaszonasempacadas(Figura10).Elvolumentotaldel
reactor es de 11.0 L y el volumen drenado (lquido circulante) es de 6.6 L. La densidad
aparentedelaszonasempacadasesde2.65g/cm
3
.
MtodosExperimentales

29
7.MTODOSEXPERIMENTALES

7.1. Evaluacindelcrecimientodelosmicroorganismosenlosherbicidase
intermediariosenmedioslido

Para seleccionar a las bacterias que integraron el consorcio artificial, se evalu el


crecimiento de las integrantes de las comunidades en los diferentes herbicidas e
intermediarios por el mtodo de crecimiento en placa en el medio selectivo de
propagacin, utilizando cada uno de los intermediarios y herbicidas a una concentracin
de50ppm.

7.2. Evaluacindeladegradacindelosherbicidaseintermediariosenmedio
lquidoycultivoporlote.

Las cepas que presentan mejor crecimiento, en los intermediarios y herbicidas en medio
slido, se propagaron en cultivo por lote con clulas libres utilizando medio mnimo
mineral con una mezcla de atrazina y simazina (50:10), as como cada uno de los
herbicidas por separado y cada uno de los intermediarios metablicos, midiendo la
desaparicinporenespectrofotometraUV.

7.3. Capacidaddeadsorcindelamezcladeherbicidasenelmaterialdesoporte.

Se aliment al reactor empacado con roca volcnica, medio mineral (Tabla 3 y 4),
conteniendo la mezcla de herbicidas atrazina (50 ppm) y simazina (10 ppm), a un flujo
constante de 10 mL h
1
, y se registraron los cambios en la concentracin de los
compuestos,medidosmedianteespectrofotometraUV(221nm),enelefluente.
MtodosExperimentales

30
7.4. Inmovilizacindelcultivoseleccionadoenelmaterialdesoporte.

Lascepasseleccionadasparaintegrarlacomunidadqueseinmovilizenelreactorfueron
extradas de las cajas de agarmedio selectivo con agua estril. Una vez obtenida la
suspensin celular se inocularon dos matraces de 500 mL con 150 mL de medio mnimo
mineral y la mezcla de herbicidas atrazina (50 ppm) y simazina (10 ppm), los cuales se
dejaronencultivoporloteyagitacindurante48horas.Posteriormenteseinyectaronen
elreactorporlospuntosAyB.Unavezrealizadaestaaccinsedejelreactoroperando
enunsistemaporloteporunperiodode72horas.

7.5. Evaluacincinticadeladegradacindelosherbicidasenelreactor
horizontaldelechoempacado

Paralaevaluacindelaremocindelamezcladeherbicidasconlacomunidadartificial,se
construyunreactorhorizontaldebiopelculaconunsistemaairliftparalaoxigenaciny
la recirculacin del lquido. Se determinaron las concentraciones mximas de los
herbicidas con los cuales oper el reactor de acuerdo con la solubilidad de cada uno de
llosydelamezcla.
Una vez iniciada la operacin del reactor, se realiz un monitoreo de su capacidad de
degradacinempleandolaespectrofotometraUV,manejandodiferentesvelocidadesde
dilucin, monitoreando peridicamente y midiendo la concentracin de herbicidas e
intermediarios (principalmente cido cianrico), para una estimacin semicuantitativa de
los niveles de degradacin. Paralelamente se realiz la cuantificacin utilizando HPLC,
adems del Carbono Orgnico Total (COT), para cuantificacin global de la remocin de
herbicidaseintermediarios.
Unavezquesealcanzlaestabilidadconcadavelocidaddeflujosetomaronmuestrasde
piedras del interior del reactor para el monitoreo de la biomasa adherida y la riqueza de
especiesdelacomunidad.
MtodosExperimentales

31
EnlaTabla7semuestranalgunosvalorescalculadosconlainformacinobtenidaconlos
diferentesmtodosdecuantificacindeherbicidaseintermediarios.

Valorescinticos Clculo
CargavolumtricadesustratoBv
H

(mgL
1
h
1
)
B:
H
=
F Sr
I
= Sr
F=flujodealimentacin(mLh
1
)
Sr=Concentracindesustratoenelsuministro(mgL
1
)
V=Volumendeoperacin(mL)
D=Dilucin( =
P
v
;h
1
)
Velocidadvolumtricaderemocin
desustrato:Rv
H
(mgL
1
h
1
)
R:
H
=
F (Sr - S)
I
= (Sr - S)
F=Flujodealimentacin(mLh
1
)
Sr=Concentracindesustratoenelsuministro(mgL
1
)
S=Concentracindesustratoenelefluentedelreactor(mgL
1
)
V=Volumendeoperacin(mL)
D=Dilucin( =
P
v
;h
1
)
cidoCianrico:Sr
AC
(mgL
1
)
(tericoformado)
Eselcidocianricotericamenteformadotomandolarelacin
estequiometricadeladegradacindelosherbicidasacido
cainrico.

C H
3
NH
NH
Cl
N
N
N
CH
3
Simazina
C H
3
C H
3
NH
NH
Cl
N
N
N
CH
3
Atrazina
OH
O H
O H
N
N
N
cido Cianrico
OH
O H
O H
N
N
N
cido Cianrico

CargavolumtricadeAc.Cianrico
Bv
AC
(mgL
1
h
1
)
B:
AC
=
F Sr
AC
I
= Sr
AC

F=flujodealimentacin(mLh
1
)
Sr
AC
=Concentracintericadecidocianricoenelsuministro
(mgL
1
)
V=Volumendeoperacin(mL)
D=Dilucin( =
P
v
;h
1
)
1mg=0.6mg
1mg=0.64mg
Tabla7.Clculodevalorescinticos.
MtodosExperimentales

32
Velocidadvolumtricaderemocin
deAc.Cianrico:Rv
AC
(mgL
1
h
1
)
R:
AC
=
F (Sr
AC
- S
AC
)
I
= (Sr
AC
- S
AC
)
F=Flujodealimentacin(mLh
1
)
Sr
AC
=Concentracintericadecidocianricoenelsuministro
(mgL
1
)
S
AC
=Concentracindecidocianricoenelefluentedel
reactor(mgL
1
)
V=Volumendeoperacin(mL)
D=Dilucin( =
P
v
;h
1
)
cidoCianricodegradado Eselresultadodelbalancedesustrato
AC consumo = AC cntroJo - AC ocumuloJo - AC soliJo

7.6. Evaluacin de la capacidad de degradacin de los intermediarios por la


comunidad seleccionada en cultivo por lote en medio lquido con clulas
inmovilizadas.

Del lecho del reactor se tomaron muestras de fragmentos de soporte conteniendo a las
clulasinmovilizadasyseprocediapesarlasyarealizarlaevaluacindeladegradacin
delosdiferentesintermediariosydelosherbicidas.Estosehizoencultivosumergidopor
lote, usando medio mnimo mineral con los diferentes compuestos a una concentracin
de10ppm.LafaselquidaseanalizempleandoespectrofotometraUVyHPLC.Deigual
forma esta determinacin se realiz en presencia de una fuente adicional de carbono
como fue la glucosa (40 ppm), la cual se cuantific enzimticamente con la tcnica de la
glucosaoxidasaperoxidasa.

MtodosExperimentales

33
7.7. Determinacindecuentaviableenelsoportedelreactor.

Muestras de piedra tomadas a cada una de las velocidades de flujo se pesaron, se


transfirieronauntubo,adicionando3mLdeaguaestril.steseagitenunVortexpor1
minuto.Delasuspensincelularobtenidapordesprendimientodelabiopelculaadherida
al soporte, se realizaron diluciones y se sembraron en medio de cultivo agar cuenta
estndarparaevaluarlasunidadesformadorasdecolonias(UFC).
Para el clculo de UFC g
1
de piedra seca, las UFC mL
1
, obtenidas de cada extraccin, se
multiplicaronporelvolumendeaguautilizadoysedividieronentrelosgramosdepiedra
seca.

7.8. Evaluacindelapermanenciadelacomunidadenelreactor.

Paradeterminarlapermanenciadelacomunidadartificialenelreactordebiopelculase
utilizarontcnicasdemicrobiologabsicacomo:morfologacolonialyrecuentoenplaca
delasdiferentesmorfologas,ademsdequealabiomasadesprendidadelsoportesele
extrajo el DNA para amplificarlo mediante la reaccin en cadena de la DNA polimerasa
(PCR), utilizando los iniciadores U 968GC y L 1041 (Felske y col., 1996), especficos para
16SrDNA(Tabla8).Losampliconesconunalongitudaproximadade500pbseanalizaron
mediantelaelectroforesisengelcongradientedetemperatura(TGGE).

MtodosExperimentales

34

Iniciador Secuencia
**U968GC 5(GCclamp)AACGCGAAGAACCTTAC3
L1014 5CGGTGTGTACAAGACCC3
**EliniciadorU968GCcontieneademsunasecuenciaopinza(clamp)de40nucletidosricaenGC(5
CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG3)queayudaalaseparacindelos
amplificadoscuandoseemplealaTGGE.

7.9. Seguimientodelosgenesquecodificanalasenzimasquedegradanlos
diferentesherbicidas.

Se utiliz para esta evaluacin el DNA obtenido de las clulas inmovilizadas as como de
las clulas libres y las cepas puras, utilizando los diferentes iniciadores reportados para
genes que codifican a las enzimas de la ruta de degradacin de los herbicidas (Tabla 9),
comosonelatzA,B,C(DeSouzaycol.,1998),yelatzD(Frucheyycol.,2003).

Gene
blanco
Iniciadores Tamaodelamplicn
atzD CAAHR 5GCGGATCCAGATGGCCTGTATCGCT3 1400pb
CAAHF 5GCGGATCCTGCGTTCATCGACAGAG3
atzA ATZAR 5TGAAGCGTCCACATTACC3 550pb
ATZAF 5CCATGTGAACCAGATCCT3
atzB ATZBR 5CTCTCCCGCATGGCATCGGG3 550pb
ATZBF 5TCACCGGGGATGTCGCGGGC3
atzC ATZCR 5GTACCATATCACCGTTTGCCA3 600pb
ATZCF 5GCTCACATNGCAGGTACTCCA3
Tabla8.Iniciadoresutilizadosparalaevaluacindelariquezadelasespeciesdela
comunidadseleccionada
Tabla9.Iniciadoresutilizadosparadetectarlapresenciadegenescatablicosenla
comunidadseleccionada
Mtodosanalticosytcnicasdebiologamolecular

35
8. MTODOSANALTICOSYTCNICASDEBIOLOGAMOLECULAR

8.1. Determinacindeconcentracincelular

8.1.1. Recuentodeunidadesformadorasdecolonias(UFC)

Se hicieron diluciones decimales de las muestras del efluente del reactor, o de las
suspensiones celulares obtenidas despus de desprender mecnicamente las clulas
inmovilizadas en el soporte. De cada dilucin se tomaron alcuotas que se sembraron en
placas de agar nutritivo por espatulado. Se cont el nmero de colonias formadas en las
placasysecalculelnmerodeUFCpormililitrodelasuspensinoriginal.

8.2. Determinacindeconcentracindeherbicidaseintermediarios

8.2.1. EspectrofotometraUV

EnunespectrofotmetroBeckmanDU650seobtuvieronlosespectrosdeabsorcin(200
a 300 nm) de las muestras. Para cada uno de los sustratos se determin la longitud de
onda de absorbenciamxima, Tabla 10. La concentracinde cada uno deellos seestim
enformasemicuantitativamedianteunacurvadecalibracinconstrruidaalalongitudde
ondademximaabsorbenciacorrespondienteacadacompuesto.

Mtodosanalticosytcnicasdebiologamolecular

36

Compuesto nm
Atrazina 221
Hidroxiatrazina 210
Desetilatrazina 214
Desisopropilatrazina 213
2hidroxidesetil,desisopropil
atrazina
208
2hidroxidesetilatrazina 206
Simazina 221
Hidroxisimazina 204
cidocianrico 212
2cloro4,6diamino1,3,5
triazina
208

8.2.2. Cromatografalquidadealtaresolucin(HPLC)

La cuantificacin de los sustratos empleados se realiz mediante cromatografa de


lquidosdealtaresolucin.Encadacasoseutilizunodelossiguientesmtodos.

8.2.2.1. Atrazinaysimazina

Se emple un cromatgrafo de lquidos marca Beckman Coulter Modelo System Gold,


detector de arreglo de diodos, utilizando una columna NovaPack C
18
(4m, 150x3.9mm
ID).Fasemvil(60%agua40%acetonitrilo)conflujoconstante(isocrtico)de1mLmin
1
.

Tabla10.Longituddeondademximaabsorbanciadelosherbicidaseintermediarios.
Mtodosanalticosytcnicasdebiologamolecular

37
8.2.2.2. cidoCianrico

SeempleuncromatgrafodelquidosmarcaShimadzumodeloSPD10Aconundetector
UVusandounacolumnaInertsil(150x4.6mm)(AlltechAssociates,Deerfield,11),5mde
tamao de partcula, con una fase mvil isocrtica de octan sulfonato de sodio 5mM en
H
3
PO
4
al0.05%aunpHde2.8,conunavelocidaddeflujode1mLmin
1
.

8.2.2.3. Intermediarios

Se emple un cromatgrafo de lquidos marca Beckman Coulter Modelo System Gold,


detectordearreglodediodos,utilizandounacolumnaSpherisorbODS(5m,250x4.6mm
ID).Fasemvilacetonitriloreguladordefosfatos0.005MpH7.2,enungradientelineal
de290%conuntiempode60minconflujoconstantede1mLmin
1
.

8.2.2.4. Intermediarios deshalogenados (Hidroxiatrazina, hidroxisimazina, 2hidroxi


desetildesisopropilatrazina,2hidroxidesetilatrazina)

Se emple un cromatgrafo de lquidos marca Shimadzu modelo SPD10A, detector UV,


utilizandounacolumnaNovaPackC
18
(4m,150x3.9mmID).Fasemvil(60%agua40%
acetonitrilo)conflujoconstante(isocrtico)de1mLmin
1
.

Mtodosanalticosytcnicasdebiologamolecular

38
8.2.2.5. Intermediarios halogenados (desetil atrazina, desisopropil atrazina, 2cloro
4,6diamino1,3,5triazina)

Se emple un cromatgrafo de lquidos marca Beckman Coulter Modelo System Gold,


detector de arreglo de diodos, utilizando una columna NovaPack C
18
(4m, 150x3.9mm
ID).Fasemvil(60%agua40%acetonitrilo)conflujoconstante(isocrtico)de1mLmin
1
.

8.2.3. Determinacindeglucosa

Seutilizelmtodocolorimtricobasadoenlaaccindelaenzimaglucosaoxidasasobre
la glucosa. En la reaccin, el perxido liberado oxida estequiometricamente a la
ortodianisidina (que acta como cromgeno) mediante la peroxidasa. Finalmente la
ortodianisidina oxidada en medio acido adquiere un color rosa cuya absorbencia puede
medirsea540nm.Elensayoserealizdelaformatradicional,ajustandoconunblancode
reactivosyempleandountestigodeconcentracinconocida.

8.2.4. Carbonoorgnicototal(COT)

SeutilizelkitdelmtodoHachNo.10129conunintervalode0.320ppmdeCOT.

8.2.5. cidocianrico

SeutilizelkitdelmtodoturbidimtricoHachNo.8139conunintervalode550ppm
decidocianrico.
Mtodosanalticosytcnicasdebiologamolecular

39

8.3. Tcnicasdebiologamolecular

8.3.1. ExtraccindeDNA

SerealizdeacuerdoalprotocolodeUltraCleanSoilDNAisolationKit,marcaMoBIO.

8.3.2. AmplificacindeDNA

ParalareaccindePCRseutilizlamezcladereaccinquesepresentaenlaTabla11.


Componente Volumen(L)
Regulador 2.5
MgCl
2
0.75
dNTPs 0.5
Taqpolimerasa 0.125
H
2
O(gradoBM) 18.925
Iniciador1(10mM) 0.6
Iniciador2(10mM) 0.6
DNAmuestra 1.0
Volumendereaccin 25
Tabla11.MezcladereaccinparalaamplificacindeDNAmediantelatcnicadePCR
Mtodosanalticosytcnicasdebiologamolecular

40
LareaccindePCRserealizaenuntermociclador(AppliedBiosystemsGeneAmpPCRSystem
2400)conelsiguienteprograma:

*Seprograman35ciclosyseutilizarnlosiniciadoressegnelexperimento.
La reaccin en cadena de la polimerasa se desarrolla en tres pasos determinados por
temperaturasytiemposespecficos:
1
mer
paso. Desnaturalizacin (94C por 5min.), en el cual se separan las dos cadenas
complementariasdelDNAblanco.
2
do
paso.35ciclosintegradoporlassiguientestemperaturas
a. 94Cpor1min,queesdondesedesnaturalizaelDNA
b. 55C por 1min, donde se da el apareamiento especfico entre los iniciadores y las
cadenassimplesdelsegmentodeDNAblancodesnaturalizado.
c. 72Cpor2.5min,dondelaDNApolimerasaextiendelalongituddelosiniciadores
apareados al DNA blanco, al ir polimerizando los desoxirribonucletidos libres,
resultando en nuevas cadenas complementarias a las dos cadenas sencillas
presentesaliniciodelareaccin.
3
cer
paso.Extensinfinal(72Cpor10min.).
Para obtener amplicones de los genes que codifican a las enzimas responsables de la
degradacin de los compuestos triaznicos se utilizaron mtodos diferentes al anterior,
estos mtodos se reportan en la Tabla 12, al igual que en el caso anterior los ciclos
empleadosson35.

94 C
55 C
94 C
72 C 72 C
4 C
5 1
1
2.5 10

Unciclo
Mtodosanalticosytcnicasdebiologamolecular

41

8.3.3. Electroforesisengeldeagarosa

El DNA amplificado durante la PCR, se observ mediante una electroforesis en gel de


agarosa, donde se incluy el marcador de peso molecular para comparar el tamao del
amplicnobtenido.ElprocedimientofuedescritoporTafoya(2008).

8.3.4. Electroforesisengelcongradientedetemperatura(TGGE)

Por la tcnica de TGGE se pueden separar fragmentos de DNA de la misma longitud con
diferente secuencia. sta se realiza para determinar en forma dogmtica el nmero
probable de especiesen lacomunidad seleccionada, ascomo la pureza delas cepas una
vezaisladas.
La tcnica consiste en la amplificacin de una regin variable del gen 16S rDNA con una
longitud aproximadamente de 500 pares de bases (pb) y su posterior anlisis por
electroforesisutilizandoungradientedetemperatura(agentedesnaturalizante)alolargo
del gel de poliacrilamida. El gradiente es proporcionado por una base en la cmara de
electroforesis (Tabla 13). Para la amplificacin del gen se usa un iniciador con una
secuenciaadicionalenelextremo5de40pbricaenguaninacitosina(GC).
gen
blanco
CondicionesdePCR
Desnaturalizacin
inicial
Desnaturalizacin Alineamiento Extensin
Extensin
final
atzD 94Cpor5min 94Cpor15seg
63Cpor30
seg
72Cpor
1.5min
72Cpor
10min
atzA
94Cpor5min 94Cpor1min
55Cpor1
min
72Cpor
1min
72Cpor
10min
atzB
atzC
Tabla12.CondicionesdelaPCRparalaamplificacindelosgenesdelasenzimas.
Mtodosanalticosytcnicasdebiologamolecular

42
Durante la migracin de las muestras amplificadas en el gel con el gradiente de
temperaturalasmuestraspresentandiferentesestadosde transicinensuestructura,el
DNA de doble cadena pasa a ser parcialmente de cadena sencilla, este fenmeno ocurre
endeterminadopuntodelgelenelcualsedetendrlamigracinoseharmslenta.La
reginricaenGCactacomounaabrazaderaloqueevitaqueseformeDNAdecadena
sencilla. Como la secuencia de fragmentos es diferente, cada muestra adopta una
conformacin particular de DNA de cadena sencilla parcial, lo que ocasiona que los
fragmentos migren a diferente velocidad, localizndolos en diferentes posiciones a lo
largodelgel.ElprocedimientofuedescritoporTafoya(2008).
Condicionesdeoperacindelequipo

Condicindeoperacin
Gradientedetemperatura 4958C
Voltaje 125V
Tiempodecorrida 2horas
Intensidad 6mA
Potencia 0.8W

Tabla13.CondicionesdeoperacindelequipodeTGGE
Resultadosydiscusin

43
9. RESULTADOSYDISCUSIN

9.1. Comunidadesquedegradanatrazinaysimazina.

Los microorganismos empleados para el desarrollo de este trabajo, fueron aislados en


investigaciones previas. Los microorganismos degradadores de atrazina por Macas y
colaboradores (2009) y los degradadores de simazina por Mondragn y colaboradores
(2008). Los microorganismos integrantes de estas comunidades (Tabla 14), fueron
recuperados de tubos de crioconservacin con glicerol y reactivados empleando placas
de agar cuenta estndar y medio slido selectivo. A la par se verific la pureza de las
cepas.

9.2. Pruebas de crecimiento de los microorganismos en diferentes


intermediariosdeladegradacindelosherbicidasenmedioslido.
Para evaluar el crecimiento de los integrantes de las comunidades mencionadas, se
utilizaron como sustratos a los herbicidas y diferentes intermediarios de degradacin a
unaconcentracinde50ppmconmediomnimomineralyagar.
Comunidadatrazina Clave Comunidadsimazina Clave
S.maltophilia
Arthrobacter
Rhizobium
Ochrobactrum
Pseudomonas
C
9

C
10

C
11

C
12

C
13

Microbacterium
Arthrobacter
Cellulomonas
Mycobacterium
Pseudonocardia
Pseudomonas
Ochrobactrum,
Rhizobium
C
1

C
2

C
3

C
4

C
5

C
6

C
7

C
8

Tabla14.Integrantesdelascomunidadesysusclavesautilizarduranteeldesarrollodeltrabajo
Resultadosydiscusin

44
Primero se realiz la evaluacin de crecimiento en placa de los microorganismos
procedentes de la comunidad degradadora de simazina arrojando los resultados
reportadosenlaTabla15,observandoelcrecimientoalos3y6dasdeincubacin.

Despusdeevaluarelcrecimientoenmedioslidoconintermediariosdeladegradacin,
seseleccionaronalascepas:C
3
(Cellulomonas),C
4
(Mycobacterium),C
5
(Pseudonocardia),
C
7
(Ochrobactrum). Para realizar pruebas de degradacin en medio lquido de las cepas
Cepa
C
1
C
2
C
3
C
4
C
5
C
6
C
7
C
8

Compuesto Das
Atrazina
3 + + ++ +++ +++ ++
6 + ++ +++ +++ +++ + +++ +
Hidroxiatrazina
3 + + ++ ++ ++ + +++ +
6 + ++ +++ +++ +++ + +++ +
Desetil atrazina
3 + ++ + ++ ++ +
6 + + +++ ++ +++ + +++ ++
Desisopropil atrazina
3 + ++ + ++ +++
6 + ++ +++ ++ +++ + +++ +
2hidroxidesetil,
desisopropil atrazina
3 + + ++ + + + ++ +
6 + + +++ +++ +++ + +++ +
2hidroxidesetilatrazina
3 + + +++ ++ ++ + ++ +
6 + ++ +++ +++ +++ + +++ ++
Simazina
3 + + +++ +++ +++ + + +
6 + ++ +++ +++ +++ + +++ +
Hidroxisimazina
3 + + +++ +++ ++ + +++
6 + ++ +++ +++ +++ + +++ +
Acido cianrico
3 + + ++ ++ ++ + +++ +
6 ++ ++ +++ ++ +++ + +++ +
2cloro4,6diamino1,3,5
triazina
3 + + +++ ++ ++ + +++ +
6 + ++ +++ +++ +++ + +++ ++
Tabla15.Evaluacindecrecimientodelosintegrantesdelacomunidadmicrobianaaislada
quedegradasimazina,enlosherbicidasyenlosdiferentesintermediariosdedegradacin.
Paralaevaluacindelcrecimientoserealizconlaescalaquesemarcaacontinuacin:
(+++)Buencrecimiento(++)Ccrecimientoregular(+)Crecimientoescaso()Sincrecimiento

selecc
ppmd
de her
los he
sedeb
especi

Una v
comun
evalua
difere
resulta

Fig
se
atr
ionadas,se
desimazina,
rbicidas. En
rbicidas, se
baaquelac
iesquesetie
vez observa
nidad selecc
acin de la
ntes sustra
adosquese
gura 10. Espe
leccionadas d
razinasimazi
Final
utilizunm
ysepudod
la Figura 10
mantiene s
comunidadc
enenenuna
ado el defic
cionada a pa
comunidad
atos (herbic
observanen
ectros de abs
de la comuni
na(50:10ppm
Inicialt=0d
t=6das
mediomnim
determinarq
0 se observa
in cambios
cuandoescu
abiopelcula
ciente crec
artir del ais
d microbian
cidas e int
nlaTabla16
sorcin en cu
dad que deg
m).Losresult
das

momineralq
queestacom
a que elespe
de absorci
ultivadaens
a.
imiento pre
lamiento co
na provenie
ermediarios
6.
ltivos por lot
rada simazin
tadoscorresp
quecontena
munidadno
ectro corres
n a 221nm,
suspensin
esentado e
on simazina,
ente de me
s) en medi
te, empleand
a, utilizando
pondenadup
Finalt=5
Resulta
a50ppmde
puededegr
spondiente a
posiblemen
pierdelasre
n medio lq
, se procedi
edio con at
io slido,
do la mezcla
como sustra
plicados.
Inicialt=
5 das
adosydiscusi
eatrazinay
adarlamezc
a la mezcla
nte lo anter
elacionesint
quido, por
a realizar
trazina en l
arrojando l
de las cepas
to la mezcla
=0das
in
45
10
cla
de
ior
ter
la
la
los
los
5
Resultadosydiscusin

46

Despus de evaluar el crecimiento en cada uno de los intermediarios de la degradacin,


fueron seleccionadas las cepas C
9
(S. maltophilia), C
10
(Arthrobacter) y C
11
(Rhizobium)
paraintegrarunacomunidadconlosmicroorganismosseleccionadosdelacomunidadde
simazina que crecen en medio slido. Nuevamente se evalu el crecimiento de cada una
deestascepasenmedioslidocondiferentesintermediarios(Tabla17).
Esta comunidad se propag en medio lquido con la mezcla de herbicidas en cultivo por
lote,ylosresultadosfueronsatisfactorioscuandoseanalizporespectrofotometraUVa
221 nm (Figura 11), apreciando una elevada eficiencia de remocin a las 120 horas de
cultivo.
Cepa
C
9
C
10
C
11
C
12
C
13

Compuesto Das
Atrazina
3 ++ ++ +
6 +++ +++ ++ + +
Hidroxiatrazina
3 ++ ++ ++ + +
6 +++ +++ +++ + +
Desetil atrazina
3 +++ ++ + +
6 +++ +++ ++ + ++
Desisopropil atrazina
3 +++ ++ +
6 +++ +++ ++ + +
2hidroxidesetil,desisopropilatrazina
3 +++ ++ + + +
6 +++ ++ ++ + +
2hidroxidesetilatrazina
3 +++ ++ + + +
6 +++ ++ ++ + ++
Simazina
3 +++ + + + +
6 +++ +++ +++ + +
Hidroxisimazina
3 +++ ++ + +
6 +++ +++ ++ + +
Acido cianrico
3 +++ ++ + + +
6 +++ +++ ++ + +
2cloro4,6diamino1,3,5triazina
3 +++ ++ + + +
6 +++ +++ +++ + ++
Tabla16.Evaluacindecrecimientodelosintegrantesdelacomunidad,aisladademedio
conatrazina,enlosherbicidasyenlosintermediariosdedegradacin.
Paralaevaluacindelcrecimientoserealizconlaescalaquesemarcaacontinuacin:
(+++)Buencrecimiento(++)Ccrecimientoregular(+)Crecimientoescaso()Sincrecimiento

Tab
com
Par
(+++
Figura
integra
C
11
),uti
Cepa
Compu
Atrazin
Hidrox
Desetil
Desisop
2hidro
desisop
2hidro
atrazin
Simazin
Hidrox
cido c
2cloro
1,3,5tr
bla17.Evalua
munidadenl
alaevaluacinde
+)Buencrecimie
11. Espectro
ntes seleccio
ilizandocomo
esto
na
iatrazina
atrazina
propil atraz
oxidesetil,
propilatraz
oxidesetil
na
na
isimazina
cianurico
o4,6diamin
riazina
acindelcrec
osdiferentes
elcrecimientosere
nto(++)Cr
os de absorc
onados de las
osustratolam
Das
3
6
3
6
3
6
zina
3
6
zina
3
6
3
6
3
6
3
6
3
6
no 3
6
cimientodelo
sintermediari
ealizconlaescal
recimientoregular
in de mues
s comunidade
mezclaatrazi
Finalt=6d

C
3

s
+++
+++
++
+++
++
+++
++
++
++
+++
++
+++
+++
+++
+++
+++
+++
+++
++
+++
osmicroorga
iosdedegrad
aquesemarcaac
r(+)Crec
stras de cult
es que degra
nasimazina(
Inicialt=0das
as
C
5
C
9

+++ ++
+++ +++
+++ ++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
+++ +++
anismosquei
dacin.
continuacin:
cimientoescaso
tivos por lot
dan simazina
(50:10ppm).

Resulta
C
10
C
++ +
+++ +
++ +
+++ +
++ +
+++ +
++ +
+++ +
++ +
++ +
++ +
++ +
+ +
+++ +
++ +
+++ +
++ +
+++ +
++ +
+++ +
integraronun
()Sincre
te, empleand
a (C
3
y C
5
) y
adosydiscusi
C
11

+
++
++
+++
+
++
+
++
+
++
+
++
+
+++
+
++
+
++
+
+++
nanueva
ecimiento
do el conjunt
atrazina (C
9
,
in
47
to de
C
10
y
7
Resultadosydiscusin

48
9.3. Seleccindelacomunidadqueseinmovilizenelreactordelecho
empacado.

Unavezanalizadoslosdatosdecrecimientodelascepasenmedioslidoquecontenaa
los diferentes intermediarios; as como la degradacin de la mezcla de herbicidas en
mediolquidoporlosmicroorganismosprovenientesdelasdoscomunidadesprobadas,se
integr la comunidad artificial, misma que se inocul en un reactor de lecho empacado
que oper de manera continua para llevar a cabo la degradacin de la mezcla de
herbicidas a una concentracin de 50 ppm de atrazina y 10 ppm de simazina. Las cepas
seleccionadasparaintegrarlacomunidadartificialsemuestranenlaTabla18.

9.4. Pruebasdecrecimientodelacomunidadartificialenmediolquido

Despus de operar el reactor durante 2200 horas (aproximadamente), se tomaron


muestras de fragmentos de roca volcnica, colonizados por la comunidad artificial, y se
colocaron en matraces que contenan medio mnimo mineral con los herbicidas y los
diferentes intermediarios de su degradacin. Todos ellos probados a una concentracin
de 10 ppm. Se observ que en mayor o menor grado hubo degradacin de los dos
herbicidasydevariosintermediariosmetablicos,peronodecidocianrico,Tabla19.
Comunidadartificialseleccionada
Cepa Clave Origen
Cellulomonas
Pseudonocardia
S.maltophiliaArthrobacter
Rhizobium
C
3

C
5

C
9

C
10

C
11

Mondragnycolaboradores(2008)
Mondragnycolaboradores(2008)
Macasycolaboradores(2009)
Macasycolaboradores(2009)
Macasycolaboradores(2009)
Tabla18.Comunidadartificialseleccionadaparainocularelreactor.
Resultadosydiscusin

49
LadeterminacinserealizmedianteespectrofotometraUVyHPLC.Enlamismatablase
muestranlostiemposderetencinenHPLCdecadaunodelosintermediarios.

Compuesto TR(min)
Eficienciadedegradacin(%)
UV HPLC
Atrazina 6.1 79 100
Hidroxiatrazina 3.2 29 71
Desetilatrazina 3.6 53 78
Desisopropilatrazina 3.2 22 34
2hidroxidesetil,desisopropil
atrazina
2.3 16 48
2hidroxidesetilatrazina 2.5 20 5
Simazina 4.9 61 100
Hidroxisimazina 3.4 43 66
cidocianrico 1.9 0 0
2cloro4,6diamino1,3,5
triazina
2.6 10 3

Se puede observar que esta comunidad muestra una elevada eficiencia de remocin de
ambos herbicidas, prcticamente el100 % (Tabla 19), cuando se determina por HPLC. En
la Figura 12 se aprecia el perfil cromatogrfico de muestras de medio de cultivo
adicionadoconatrazina,dondeseobservaladesaparicindelpicocorrespondienteaeste
herbicida al final del cultivo por lote, pero no para los diferentes intermediarios de la
degradacin. En la Figura 13 se puede apreciar la acumulacin de algunos subproductos
deladegradacincuandoseutilizacomosustratoladesisopropilatrazinaexgena.

Tabla 19. Eficiencia de remocin en medio lquido de los herbicidas e intermediarios de su
degradacinencultivoporlote,porlacomunidadartificialprovenientedellechoempacado.

Para s
adicio
nueva
como
expres
Figu
exg
saber si la
nar una fu
mente un c
fuente de
san en porc
Figura12.
encultivo
ura 13. Perfi
genaporlaco
eficiencia
uente de ca
cultivo por l
carbono ad
entaje (Tab
Perfilcromat
porloteconc
il cromatogr
omunidaden
Intermediario
degradacin
arbono de
ote con cad
dicional. Los
la 20). stos
togrficodel
clulasinmov
fico que ilu
cultivoporlo
Final
Inicia
o
Final

n de estos
fcil asimil
da uno de l
s resultados
s fueron obt
adegradaci
vilizadas.
ustra degrad
oteconclula
al
intermedia
acin, com
os intermed
s de la efici
tenidos por
ndeatrazina
dacin de de
asinmovilizad
Inicial
Resulta
arios puede
mo la glucos
diarios, utiliz
iencia de d
espectrofot
aporlacomu
esisopropilat
das.
adosydiscusi
aumentar
sa, se reali
zando gluco
egradacin
tometra UV
nidad,
trazina
in
50
al
iz
osa
se
V y
0
Resultadosydiscusin

51
HPLC,mientrasqueladeterminacindeglucosaserealizmedianteelmtodoenzimtico
de glucosa oxidasa, observndose para todos los casos un consumo total de la hexosa, a
las72horas.
En la Tabla 20 se aprecia que la adicin de una fuente externa de carbono favorece la
degradacindealgunosintermediarioscomoladesetilatrazinaoladesisopropilatrazina;
porelcontrariotambinexistenaquellosenlosqueladegradacinsevedisminuidapor
este mismo compuesto como es el caso de 2hidroxidesetil, desisopropilatrazina y la
hidroxisimazina.
Al igual que en el caso anterior se aprecia en el cromatograma la desaparicin y en
algunos casos la acumulacin de compuestos de la degradacin de estos mismos
intermediarios(Figura14y15).

Compuesto TR(min)
Eficienciadedegradacin(%)
UV HPLC
Atrazina 6.1 53 100
Hidroxiatrazina 3.2 36 70
Desetilatrazina 3.6 38 100
Desisopropilatrazina 3.2 29 99
2hidroxidesetil,desisopropil
atrazina
2.3 47 27
2hidroxidesetilatrazina 2.5 23 2
Simazina 4.9 82 100
Hidroxisimazina 3.4 0 50
cidocianrico 1.9 0 0
2cloro4,6diamino1,3,5triazina 2.6 9 12


Tabla20.Eficienciadedegradacindelosintermediariosencultivoporlote,empleando
mediolquidoadicionadoconglucosa.

Figura
en cu
adicio
Figura
comun
carbon

a 14. Perfil c
ultivo por lot
onal).
a 14. Perfil
nidad en cult
noadicional).
romatogrfic
te con clul
Intermediario
Intermediar
cromatogrfi
tivo por lote
.
o que ilustra
as inmoviliza
o
rio
Fina
Inicia
co que ilust
e con clulas

la degradac
adas (40 ppm
Final
Inicial
al
al
tra la degra
inmovilizada
in de deset
m de glucosa
dacin de d
as (40 ppm d
Resulta
tilatrazina po
a como fuen
desisopropila
de glucosa co
adosydiscusi
or la comunid
nte de carbo
atrazina por
omo fuente
in
52
dad
ono
la
de
2

Para e
empac
recircu
mater
Estere

Re
Hor

El rea
alimen
rectan
costo,
clulas

Tabla2
9.5
el desarrollo
cado.Elreac
ulacin axia
rial emplead
eactorprese
actor
izontal
o
ctor cuenta
ntacin, com
ngularparaf
resistencia
s.
21.Caracters
.Construcci
o del prese
ctortieneun
al y transve
do fue de ac
entlascara
Alturade
operacin(c
25
a con portas
mo se mue
facilitarsue
alacompac
Figura16.Esq
sticasvolum
ndelreact
nte trabajo
ncanalcent
ersal del lq
crlico con u
ctersticasv
e
cm)
Volum
lquid
66
s para el m
estra en el
scalamiento
ctacinyre
quemayfoto
tricasdelrea

tor
se constru
tralconpare
uido hacia
n difusor de
volumtricas
mendel
do(cm
3
) e
600
muestreo y
l esquema.
o,ademsel
eadecontac
ografadelrea
actor
uy un reac
edesdemal
los compa
e aire de tu
spresentada
Volumen
empacado(c
8400
para entrad
Este react
soportefue
ctoirregular
actorairliftem
Resulta
ctor rectang
laparalaox
rtimentos e
bo perforad
asenlaTabla
n
cm
3
)
Volu
delre
da y salida
tor present
eseleccionad
rparalainm
mpacado
adosydiscusi
gular de lec
xigenaciny
empacados.
do (Figura 1
a21.
umentotal
eactor(cm
3
)
11000
del medio
ta una form
doporsuba
movilizacin
in
53
ho
yla
El
6).
)
de
ma
ajo
de
3

El rea
empac
alimen
ppmd
El grad
esala
semic
hasta
como

F
r
9.5
ctor se emp
cado se pro
ntacindem
desimazina,
do de satura
aentrada,el
cuantitativam
queseigual
losdelospu
Eflue
Eflue
igura17.Esp
eactoradifer
5.1. Operac
pac con ro
ocedi a re
mediomnim
manteniend
acin se mo
puntoA,pu
mentelacon
aronlosesp
untosAyBd
Su
ente
Su
ente
ectrosdeabs
rentestiempo
inabitica
ca volcnica
ealizar una
momineralco
dounflujoc
onitore en l
untoByala
ncentracin
pectrosdelm
deloscompa

uministro
uministro
t=0da
t=30das
sorcindelas
os,durantela

aysaturaci
a hasta el n
prueba de
onunaconc
onstantede
los puntos d
salida(most
deherbicid
mediodesum
artimentose
as
smuestrasto
asaturacind
ndelreacto
nivel de la tu
saturacin
centracind
ealimentaci
de toma de
tradosenla
daenlospun
ministroyde
empacados
Ef
Eflu
madasenels
delsoporteco
Resulta
or
ubera de sa
n del lecho,
e50ppmde
nde10mL
muestra de
Figura17),
ntosdetom
elefluented
(Figura17).
fluente
S
uente
suministroye
onlamezcla
adosydiscusi
alida. Una v
, mediante
eatrazinay
Lh
1
.
l reactor; es
determinan
mademuest
delreactor,
Suministro
Suministro
t=20d
t=41da
elefluentede
deherbicidas
in
54
vez
la
10
sto
do
ra,
as
as
as
el
s.
4
Resultadosydiscusin

55
EnlaFigura18,semuestralavariacinenlaconcentracindeherbicidasestimadacomo
atrazina utilizando una curva patrn de sta, midiendo la absorbencia a 221 nm. La
cinticadesaturacinsesiguihastaquelascurvasnopresentarondiferencias.Despus
deunperiodode40dasdeoperacinsealcanzlasaturacindelsistemadereaccin.
Cabe mencionar que el monitoreo en los puntos A y B no se realiz desde el inicio de la
alimentacindelamezcladeherbicidasenmediomnimomineral,debidoaqueseesper
aquelaconcentracinenlaentradaysalidadelreactorseaproximaraalaestabilizacin.

0
10
20
30
40
50
60
0 10 20 30 40 50
p
p
m

d
e

a
t
r
a
z
i
n
a

Tiempo(das)
Saturaciondellecho
Suministro
Efluente
PuntoA
PuntoB
Figura18.Cinticadesaturacindelsoporte.Laconcentracindeherbicidasseexpresacomoppm
deatrazina,determindaespectrofotometrcamente(As
221nm
)
Resultadosydiscusin

56
9.6. Operacin del reactor en rgimen continuo con la comunidad artificial
seleccionada.
Despusdelaseleccindelacomunidadydelasaturacindellechoconlosherbicidasa
utilizar, se procedi a inocular el reactor con la comunidad seleccionada, dejando operar
al reactor en cultivo por lote por un tiempo de 48 horas, para posteriormente iniciar la
operacinencontinuoaunavelocidaddeflujode4mLh
1
,porunperiodode168horas.
El sistema se oper a diferentes velocidades de flujo y en cada caso se lleg alcanzar el
estadodeestablecomoseapreciaenlaFigura19,dondesemuestranlosflujosprobados
(4mLh
1
,10mLh
1
,20mLh
1
,40mLh
1
,

80mLh
1
,160mLh
1
).

0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
0 1000 2000 3000 4000 5000 6000 7000
A
b
s

2
2
1
n
m

t(h)
OperaciondelReactor
Suministro
Efluente
Figura19.ComportamientodelaAs221delsuministroydelefluentedelreactoralasdiferentes
velocidadesdeflujo.
Flujo:10mLh
1

Carga:2.1mgL
1
d
1

Flujo:20mLh
1

Carga:4.3mgL
1
d
1

Flujo:40mLh
1

Carga:8.7mgL
1
d
1

Flujo:80mLh
1

Carga:17.4mgL
1
d
1

Flujo:160mLh
1

Carga:34.9mgL
1
d
1

Cabem
de int
ms a
(Figura
conun
losres
deinte
estabi
compu

mencionarq
ermediarios
ltas (17.4 y
as 24 a 25).
ntiempode
sultadosarro
ermediarios
lidaddelci
uestopodra
Figu
Figu
queconform
s metablico
34.9 mg L
1
Se puede a
eretencind
ojaronaltas
,amenosq
idocianrico
aserunode
ura21.Perfil
aunaca
ura20.Perfil
aunaca
meseaumen
os (Figuras 2
) se observ
apreciar la s
de1.9min.S
eficiencias
ueseanreca
odificultasu
losprincipa

Efluente
cromatogrfi
argadelame
cromatogrfi
argadelame
Efluent

ntlacarga
20 a 25). Cu
una impor
eal corresp
Sinembargo
dedegradac
alcitrantesa
udetermina
lesintermed
icodelsumin
zcladeherbi
icodelsumin
ezcladeherbi
e
At
Simazina
volumtrica
ando el rea
rtante acum
pondiente a
o,alrealizar
cinnoconc
alaoxidaci
cinporest
diariosacum
Suministr
istroydelefl
cidasde2.1 m
istroydelefl
cidasde0.8m
Suminist
razina
Resulta
aaumentla
ctor oper
ulacin de i
a un posible
rladetermin
cordanteco
nqumica.P
temtodo.P
mulados.
ro
luentedelrea
mgL
1
d
1
.
luentedelrea
mgL
1
d
1
.
ro
adosydiscusi
aacumulaci
con las carg
intermediari
intermedia
nacindeCO
onlapresenc
Porejemplo,
Portanto,es
actor
actor
in
57
n
gas
ios
rio
OT
cia
,la
ste
7

Figura
Figura2
Figura2
E
23.Perfilcro
aunacarg
22.Perfilcrom
aunacargad
24.Perfilcrom
aunacargad
E

Efluente
omatogrfico
adelamezcl
matogrficod
delamezclad
matogrficod
delamezclad
Efluente
Efluente

Su
delsuministr
adeherbicid
elsuministro
deherbicidas
delsuministro
deherbicidas
Su
uministro
roydeleflue
asde8.7 mg
oydelefluent
sde4.36 mgL
oydelefluent
sde17.4 mgL
Suministro
uministro
Resulta
ntedelreact
L
1
d
1
.
tedelreactor
L
1
d
1
.
tedelreacto
L
1
d
1
.
adosydiscusi
or
r
r
in
58 8

Analiz
herbic
herbic
compo
unaef
proba

0
0
0
0
1
1
1
R
v
H

(
m
g
/
L
h
)

Figu
ando los da
cidas se pu
cidas (R
VH
) y
ortamientol
ficienciader
das.
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
0
Figur
ura26.Velocid
tos obtenid
ueden deter
y compararl
linealdeR
VH
remocinde
0.2 0.4
a25Perfilcro
unacarga
E
dadvolumti
ca
os durante
rminar las
las con las
H
conrespect
el100%delo
4 0.6
omatogrfico
adelamezcla
Efluente
caderemoci
argadelame

la evaluaci
velocidades
de suminist
toaB
VH
yco
osherbicida
0.8
Bv
H
(mg/Lh)
odelsuminist
adeherbicida
ndelamez
zcladeherbic
n de la deg
s volumtric
tro (B
VH
) (F
onunapend
asalasdifer
y=x
R=1
1
troyelefluen
asde34.9 mg
Suministro
cladeherbic
cidas(Bv
H
).
Resulta
gradacin de
cas de rem
igura 26). S
ientedeuno
entesveloci
1.2 1.4
ntedelreacto
gL
1
d
1
.
idas(Rv
H
)en
adosydiscusi
e la mezcla
mocin de l
Se observa
oloqueindi
idadesdeflu
4 1.6
Herbicidas
ora
funcindela
in
59
de
los
un
ica
ujo

a
9
Resultadosydiscusin

60
Aunqueenelreactornosellegaellmitedelacapacidadderemocindelosherbicidas,si
seobservalaacumulacindeintermediarios(cidocianrico).EnlaFigura27semuestran
dos lneas. L lnea superior es una recta que representa la remocin total del cido
cianrico(comportamientoideal),lalneainferior,esunacurvaquereflejalaacumulacin
realdeestecompuestoconformeaumentalacargadeherbicidas.

En la Figura 28 se muestra que aun cuando la eficiencia de remocin de herbicidas en


funcindelacargavolumtricaaplicadaalreactoresdel100%,laeficienciaderemocin
delcianricodecrece,acumulndoseenconsecuenciaelintermediario.
y=x
R=1
y=0.4663x+0.0155
R=0.998
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
0 0.2 0.4 0.6 0.8 1
R
v
A
c

C
N

(
m
g
/
L
h
)

Bv
AcCN
(mg/Lh)
Comportamiento
ideal
Comportamiento
expeimental
Figura27.Velocidadvolumtricaderemocindecidocianrico(Rv
AC
)enfuncindelacarga
decidocianrico(Bv
AC
),suministradocomofraccindelamolculadelosherbicidas.
Resultadosydiscusin

61

9.6.1. Monitoreodelaacumulacindeintermediariosenladegradacin
delreactor.

Mediante HPLC se monitore, para cada flujo probado en el sistema de reaccin, la


formacindelosdiferentesintermediariosdeladegradacindelosherbicidas.
Se utiliz un mtodo modificado con respecto al reportado por Carabias y colaboradores
(2002), que permiti la separacin e identificacin de cada uno de los intermediarios
disponibles para la realizacin de este trabajo (Figura 29), que fueron ms que los
reportados por estos autores. Este mtodo se logr adecuar a un cromatgrafo de
lquidosmarcaBeckmanCoulterModeloSystemGold,condetectordearreglodediodos,
utilizandounacolumnaSpherisorbODS(5m,250x4.6mmID).Fasemvilacetonitrilo
reguladordefosfatos5mMpH7.2,enungradientelinealde290%enuntiempode60
minconflujoconstantede1mLmin
1
sincontroldetemperatura.

0
0.2
0.4
0.6
0.8
1
1.2
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6
E
f
i
c
i
e
n
c
i
a

d
e

r
e
m
o
c
i
o
n

Bv
H
(mg/Lh)
Herbicidas
Ac.Cianurico
Figura28.Eficienciaderemocindelherbicidaydelcidocianricoenfuncindelacargade
herbicidas(Bv
H
).

Al ana
compa
que b
herbic
atrazin
retenc
flujoc
Fig
pp
desi
alizar las di
ararlas con
bsicamente
cidas aparec
na(HDEIA)d
cin (Figura
omolomue
2
1
gura29.Perfi
mledasa21
sopropilatraz
7)
ferentes m
el patrn de
se acumul
ce otro inte
dadalacerc
33). Esta ac
estranlasfig
3
4
lcromatogrf
10nm.1)Acid
zina,4)Hidro
Desetilatrazi
uestras del
e la mezcla
la cido cia
ermediario;
anadelos
cumulacin
uras33y34
5
6
ficodelamez
docianurico,
oxidesetilatra
ina,8)Hidrox

reactor a
de interme
anrico. Sin
aparenteme
picosyaque
se mantien
4.
7
8
zcladeinterm
2)Hidroxide
azina,5)Desi
xiatrazina,9)
las velocida
ediarios (Figu
embargo,
ente la 2h
esloseco
e durante la
9
mediariosau
setildesisopr
isopropilatra
Simazina,10
Resulta
ades de fluj
uras 30 a 34
al aumenta
idroxideset
rriunpoco
as ltimas v
10
naconcentra
ropilatrazina
azina,6)Hidro
0)Atrazina.
adosydiscusi
jo probadas
4), se obser
ar la carga
tildesisiprop
oeltiempo
velocidades
acinde10
,3)Desetil
oxisimazina,
in
62
s y
rva
de
pil
de
de
2

Figura
delam
Figur
dela
a30.Perfilco
mezcladeint
ra31.Perfilc
amezcladein
rmatogrfico
termediarios.
romatogrfic
ntermediarios

odelefluente
Velocidadde
codelefluent
s.Velocidadd

delreactorc
eflujo:4mLh
edelreactor
deflujo:10m
comparadoco
h
1
.
rcomparadoc
mLh
1
.
Resulta
onelperfilcr
conelperfilc
adosydiscusi
omatogrfico
cromatogrfic
in
63
o
co
3

Figur
dela
Figura
delam
ra32.Perfilcr
mezcladein
a33.Perfilcro
mezcladeint
romatogrfico
termediarios
omatogrfico
ermediarios.
odelefluente
.Velocidadd
delefluente
Velocidadde

edelreactor
eflujo:40m
delreactorc
eflujo:80mL
comparadoc
Lh
1
.
comparadoco
h
1
.
Resulta
conelperfilc
onelperfilcro
adosydiscusi
romatogrfic
omatogrfico
in
64
o
o
4

Elcid
los co
detect
compu
22, d
volum

Figura
delam
9.6

docianrico
ompuestos t
tada por el
uesto media
onde se ap
mtrica.
34.Perfilcro
mezcladeinte
6.2. Monito
esunodelo
triaznicos y
mtodo de
ante el mto
precia que
matogrficod
ermediarios.V
oreodelaac
oscompuest
y debido a
e COT. Por
odo Hach. Lo
su concen

delefluented
Velocidadde

cumulacind
tosmsreca
la estabilida
tal motivo
os resultado
tracin aum
delreactorco
flujo:160mL
decidocia
alcitrantese
ad de la m
se realiz l
os obtenidos
menta conf
omparadoco
Lh
1
.
Resulta
anrico
nlavaded
olcula no
la determin
s se muestra
forme aume
nelperfilcro
adosydiscusi
egradacin
alcanza a s
acin de es
an en la Tab
enta la car
omtografico
in
65
de
ser
ste
bla
rga
5
Resultadosydiscusin

66

CargaVol.(mg
L
1
d
1
)
cidoCianrico(mgL
1
)
Terico MtodoHach
0.872
36.5
8
2.181 11
4.363 14
8.727 15
17.454 18
34.90 19

9.7. Monitoreodelmantenimientodelacomunidadartificialenelreactorde
lechoempacado.
Cuando se alcanz la estabilidad en cada carga volumtrica, se tomaron muestras de
soporte del interior del reactor para evaluar la riqueza de las especies. Despus de la
recuperacin de las clulas, se realiz la cuenta viable (Tabla 23) y la extraccin de DNA,
mismoqueseamplificconlosiniciadoresUyLparaobservarlariquezadelasespecies
porTGGE.
Alrealizarlacuentaviablesepudieronapreciar5morfologascolonialesdiferentes;lade
S. maltophilia, que claramente se puede diferenciar del resto, est presente en todas las
condiciones de operacin probadas. Esta cepa tiene la informacin gentica para
sintetizarlaenzimacianricohidrolasa(AtzD)(Tafoya,ycol.,2009,Galndezycol.,2011).
Sin embargo, la cuenta viable de esta bacteria disminuy, coincidentemente con la
acumulacindecidocianrico,conformeseaumentalacargadeherbicidas(Tabla23).

Tabla22.Concentracindecidocianricoalasdiferentescargasvolumtricas
Resultadosydiscusin

67

Carga(mgL
1
d
1
) UFCtotales/g UFCS.maltophilia/g S.maltophilia*)
0.8 1.101E+04
2.1 3.431E+03 2.795E+03 0.81
4.3 1.358E+04 2.497E+03 0.18
8.7 3.424E+03 1.141E+03 0.33
17.4 6.201E+03 1.069E+03 0.17
34.9 1.312E+04 0.245E+03 0.018
* =FraccindelapoblacindeS.maltophilia.

Para comprobar si haba una relacin entre el decaimiento en la velocidad de remocin


del cido cianrico y la disminucin de la poblacin bacteriana poseedora de AtzD, se
calcul la velocidad especfica de remocin de las UFC totales y la de S. maltophilia, y su
relacin con la carga volumtrica de herbicidas. Aparentemente, aumenta continua y
exageradamente la velocidad especfica de remocin de AC de esta bacteria (Figura 35),
entantoquelavelocidadcorrespondientealacomunidadcompletaseincrementaabajas
cargas de herbicidas, alcanza un mximo y comienza a decrecer cuando se aumenta el
suministrodeherbicidas(Figura36).Amboscomportamientos,permitensuponerqueno
toda la remocin de cido cianrico se puede adjudicar a la bacteria que tiene la
capacidad de degradarlo (S. malthophilia), sino que el resto de la comunidad bacteriana
tienealgnpapelenlaremocindeestecompuesto;fundamentalmentedemecanismos
de adsorcin y/o acumulacin intracelular del cianrico, ya que para el resto de las
bacterias es un subproducto terminal que presuntamente no pudiesen secretar en su
totalidad.
Tabla23.Unidadesformadorasdecolonias(UFC)provenientesdelsoporte,alasvelocidadesde
flujoensayadas.
Resultadosydiscusin

68

Para confirmar esta hiptesis, se hizo la determinacin de cianrico adsorbido y


acumulado en la biopelcula. Se estim la cantidad de cido cianrico presente en el
reactor,yenlasclulasapartirdemuestrasdesoporteobtenidasalaltimavelocidadde
flujo,deacuerdoalsiguientebalance:
EntroJo = Consumo +Acumulocion +SoliJo
0
0.00001
0.00002
0.00003
0.00004
0.00005
0.00006
0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5
R
t
/
U
F
C
S
t
e
n
o

Bv
ACN
(mg/Lh)
0
0.000002
0.000004
0.000006
0.000008
0.00001
0.000012
0.000014
0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5
R
t
/
U
F
C
t
o
t

Bv
AC
(mg/Lh)
Figura35.Velocidadespecficaderemocindecidocianrico,porS.maltophilia,enfuncindela
cargatericadecidocianricosuministradaalreactor.
Figura36.Remocintotaldelosherbicidasporunidadformadoradecoloniaen
funcindelacarga.

Adem
valor t
(1%).S
S.mal

g
tota
%

La acu
peso m
(Trany
En cua
banda
decor
obten
presen

Tabl
sdeobserv
terico sum
Sepuedede
ltophilia(Tab
E
g
AC

ales
6
%
umulacin in
molecular re
ycol.,2009)
anto a los r
asdelascinc
rrimientode
idos de las
ntanelmism
Figura 37.
inmovilizad
a24.Resulta
varunaimp
inistrado), h
ecirqueelre
bla24).
Entrada
167040
100
ntracelular d
elativament
,cuandolas
resultados o
coquesees
elosamplific
s cepas pur
mofrente(Fi
TGGE de mu
dasdelreacto
dosdelbalan
ortanteacu
hubo un peq
estodelcian
Consumo
3210240
25
de compues
e grande, c
sclulasson
obtenidos p
speraban(Fi
cados,yaqu
ras pudimos
gura38).
uestras de la
ordelechoem
ncedecidoc

mulacinint
quea adsor
nricoefectiv
o
Biope
0 62
tos se ha re
omo pigme
sometidasa
or la TGGE,
gura37),es
uealrealizar
s apreciar q
as clulas
mpacado
cianricoenl
tracelularde
rcin del com
vamentefue
Acumulac
elcula
737
1
eportado en
ntos (Fava
acondicione
, slo se log
todebidoa
rlamismap
que efectiva
Figura38.TG
enelreactor
laltimavelo
Resulta
ecidocian
mpuesto en
emetaboliza
cin
Clulas
1356720
22
n el caso de
y col., 1993
esdeestrs.
gr la separ
lasimilitud
pruebaconl
amente alg
GGEdecepas
rdelechoem
ocidaddeflujo
adosydiscusi
rico(22%d
n la biopelcu
ado(25%),p
Salida
321024
52
molculas
3), o cateco
.
racin de tr
delosfrent
osamplicon
unas de el
spurasinocul
mpacado.
odelreactor.
in
69
del
ula
por

40
de
les
res
tes
nes
las
adas
.
9
3

Seapr
defluj
podra

Finalm
anteri
inmov
atzA:
Este
corres
las cep
igualf

Figura
B)Mu
PM=M
C
3
,C
5
,
20
CL
,4
4,10,2
500pb
3000pb
700pb
A)
reciaadem
jo,lacualse
atratarsede
9.8. Seg
dife
mente se
ormente,em
vilizadas,en
gen codific
spondientea
pas puras (F
formaenlas
a41.Electrof
uestrasdec
Marcadordepes
C
9
,C
10
yC
11
.Fue
40
CL
,80
CL
,160
C
20,40,80y160
s,queexiste
evuelvems
eS.maltophi
guimientod
erentesherb
obtuvieron
mpleandoel
lasdiferente
ca a la e
alprimerpa
Figura 39 A)
clulasinm
ferogramasd
lulaslibresy
omolecular
entedeDNA:ce
L
(mL/h).Fuente
.FuentedeDNA
500pb
3000pb
700pb
elapredomi
stenuealfin
iliadadoaq
elosgenes
bicidas.
amplicone
lDNAdelas
escondicion
nzima que
sodelava
, en todas l
ovilizadas(F

elamplicn(
C)Muestrasd
epaspuras
edeDNA:clula
A:Clulasinmov
b
b
b
B)

inanciadeu
naldelaope
quesucomp
quecodifica
es de los
scepaspura
nesdeopera
deshaloge
dedegrada
as cargas en
Figura39C).
550pb)delg
declulasinm
slibresdelreact
ilizadasdelreac
unabandaen
eracin,esta
ortamiento
anlasenzim
s genes c
as,delascl
acindelrea
ena a la a
cin,seenc
n las clulas

genatzAcorr
movilizadas.
torendistintas
ctorendistintas
500pb
3000pb
700pb
Resulta
nlasprimera
abandapre
essimilar.
masquedegr
atablicos
ulaslibresy
actor.
atrazina, y
cuentrapres
s libres (Figu
espondiente
condicionesde
condicionesde
b
C)
adosydiscusi
asvelocidad
sumiblemen
radanlos
mencionad
ydelasclu
correspon
senteentod
ura 39 B) y
a:A)cepasp
operacin.
operacin.
in
70
des
nte
dos
las
de
das
de
puras,
0
5
30
7

atzB
Esteg
aunqu
estan
condic

500pb
000pb
700pb
A)
Figura
PM=Ma
C
3
,C
5
,C
20
CL
,40
4,10,20
enestapre
ueestprese
imnovilizad
cionesdeop
a40.Gelesde
arcadordepeso
C
9
,C
10
yC
11
.Fue
0
CL
,80
CL
,160
CL

0,40,80y160.
esenteenalg
ente,tieneu
das en el s
peracindel
50
300
70
eagarosacon
A)cepasp
omolecular
ntedeDNA:cep
(mL/h).Fuente
FuentedeDNA:
gunasdelas
unaamplifica
oporte, clar
reactor(Fig
00pb
00pb
00pb
B)
nelamplificad
puras,B)clu
paspuras
deDNA:clulas
Clulasinmovil

scepaspura
acininespe
ramente se
ura40C).
dodelgenatz
laslibresyC)
libresdelreacto
izadasdelreacto
as(Figura40
ecifca(Figur
aprecia su
3
tzBparacada
clulasinmo
orendistintasco
orendistintasc
Resulta
0A),yenlas
ra40B).En
u presencia
500pb
000pb
700pb
C)
aunadelasm
ovilizadas.
ondicionesdeo
condicionesdeo
adosydiscusi
sclulaslibre
lasclulasq
en todas
muestrastom
peracin.
operacin.
in
71
es,
ue
las
adas,
1
5
30
7

atzC
La pre
Arthro

atzD
Esteg
degrad
dadoq
porun
iniciad

500pb
000pb
700pb
A)
Figur
A)ce
PM=M
C
3
,C
5
,
20
CL
,4
4,10,
esencia de e
obacter(C
10
)
gencodifica
dacion. No
quehaydeg
nacianrico
doressealin
a41.Gelesd
paspuras,B)
Marcadordepes
C
9
,C
10
yC
11
.Fu
40
CL
,80
CL
,160
C
20,40,80y160
ste gen es m
,delascepa
alaenzima
se logr am
gradacionde
hidrolasac
earon,debid
eagarosaco
clulaslibres
somolecular
entedeDNA:ce
CL
(mL/h).Fuente
0.FuentedeDNA
ms especfi
aspuras(Fig
quehidroliz
mplificar en
elcidocian
odificadapo
doacambio
500pb
3000pb
700pb
B)
nelamplifica
syC)clulas
epaspuras
edeDNA:clula
A:Clulasinmov

ica y slo se
gura41).
zaelinterm
ninguna de
nrico,sepu
orungendi
osnucleotd
adodelgena
inmovilizadas
aslibresdelreac
vilizadasdelreac
e encuentra
ediarioms
las muestra
uedepresum
ferente,on
icos,enelge
5
30
7
atzCparacad
s.
ctorendistintas
ctorendistintas
Resulta
en Pseudon
srecalcitrant
as tomadas
mirqueste
noseamplif
enblanco.

500pb
000pb
700pb
C)
daunadelas
condicionesde
condicionesde
adosydiscusi
nocardia (C
5
tedelava
. Sin embar
esdegrada
icporquel
muestrastom
operacin.
operacin.
in
72
) y
de
rgo
do
los
madas,
2
Conclusiones

73
10.CONCLUSIONES

Se construy una comunidad artificial capaz de degradar la mezcla de herbicidas


atrazinasimazina (50:10 ppm) como nica fuente de carbono y nitrgeno en un
reactordelechoempacado.

Las cepas aisladas de la comunidad proveniente de medio con simazina no fueron


capaces de degradar la mezcla de herbicidas (atrazina y simazina) en medio lquido;
pero cuando se complementaron con las cepas ms activas de la comunidad aislada
enatrazina,fueroncapacesdedegradarlamezcladeherbicidassatisfactoriamente.

Lacomunidadseleccionada,tienelacapacidaddedegradaralgunosintermediarosde
la degradacin y en menor medida a aquellos que presentan una estructura muy
similar a la del cido cianrico. Cuando se adicion glucosa al medio conteniendo
intermediarios metablicos, se aument la eficiencia de degradacin de algunos de
ellos.

La eficiencia de remocin de los herbicidas para las diferentes cargas volumtricas


probadasenelreactorfueelevada,peroseacumulanlosintermediariosdelarutade
degradacin (principalmente cido cianrico) conforme aumentan las cargas. A la
mxima carga de herbicidas probada, la comunidad present una acumulacin
importanteintracelulardecidocianrico;aproximadamentelamitaddelaeficiencia
deremocinsedebialaretencindelcompuestoenelinteriordelasclulas.

PormorfologacolonialseobservaquelacepadeS.maltophilia,comienzaadisminuir
conforme aumenta la carga de herbicidas, lo que coincide con la acumulacin de
intermediariosmetablicos.

Conclusiones

74
Sedetectlapresenciadelosgenesquecodificanalasenzimasqueintervienenenla
va de degradacin de los herbicidas: atzA, atzB y atzC. El gen atzD que codifica a la
cianrico hidrolasa no fue detectada. Sin embargo como hay degradacin del cido
cianrico se presume que existe en la comunidad otra enzima diferente a la
reportada.

Bibliografa

75
10.BIBLIOGRAFA
Agency for Toxic Substances and Disease Registry (ATSDR), Division Toxicologia. 2003. Atlanta GA.
DepartamentodesaludyservicioshumanosdelosEEUU.Serviciosdesaludpublica.

Alvares, M.C.; Fuiman, L.A. 2005. Environmental levels of atrazine and its degradation products
impairsurvivalskillsandgrowthofreddrumlarvae.Aquat.Toxicol.74:229241.

Beynon, K.I.; Stoydin, G.; Wright, A.N.; 2004. A comparison of the breakdown of the triazine
herbicides cyanazine, atrazine and simazine in soils in maize. Pesticide Biochem. Physiology.
Abstract.

Beytul,A.;Nihal,O.;Cherrier,R.;Mehmet,A.O.2009.Degradationofatrazineinaqueousmdium
by electrocatalytically generated hydroxyl radicals. A kinetic and mechanistic study. Water
Research.43:19241934.

Birkhoj, M.; Nellemann,C.; Jarfelt, K.; Jacobsen, H.;Andersen,R.H.;Dalgaard,M.;Vinggaard, A.M.


2004. Te combined antiandrogenic effects of five commonly used pesticides. Toxicol. Appl.
Pharmacol.201:1020.

Bohinski,R.C.1998.Bioqumica.5edicin.Mxico.Ed.AddisonWesleyLongman.

Cantemir, C.; Cozmei, C.; Scutaru, B.; Nicora, S.; Carasevici, E. 1997. p53 protein expression in
peripherallymphocytesfromatrazinechronicallyintoxicatedrats.Toxicol.Lett.93:8794.

Carabias, R.; Rodrguez, E.; Herrero, E.: Snchez, F.J. & Prado, M.G. 2002. Determination of
herbicides and metabolites by soildphase extraction and liquid chromatography evaluation of
pollutionduetoherbicidesinsurfaceandgrouwndwaters.J.Chromatogr.950:157:166.

Catalkaya, E.C.; Kargi, F. 2009. Advanced oxidation and mineralization of simazine using Fenton`s
reagent.Hazard.Mater.95:1016.

De Souza, M.; Seffernick, J.; Martinez, B.; Sadowsky, M.J. & Wackett, L.P. 1998. The atrazine
catabolismgenesatzABCarewidespreadandhighlyconserved.J.Bacteriol.180:19511954

Donaldson,D.;Kiely,T.;Grube,A.2002.PesticidesIndustrySalesandUsage,1998and1999Market
Estimates.USEPA,Washington,DC.EPA733R02001,34pp.

Ellis,M.D.;Baxendale,F.P.&Keith,D.L.1998.G981347ProtectingBeesWhenUsingInsecticides,
HistoricalMaterialsfromUniversityofNebraskaLincolnExtension,9p.

Erickson, L.E. & Lee, K.H. 1989. Degradation of atrazine and related striazines. Crit. Rev. Environ.
Control.19:114.

Ewald,A.J.&Aebischer,N.J.2000.Trendsinpesticideuseandefficacyduring26yearsofchanging
agricultureinSoutherEngland.Environ.Monit.Assess..64:493529.
Bibliografa

76

Fatima, M.; Mandiki S.M.N.; Douxfils, J.; Silvestre, F.; Coppe, P.; Kestemont, P. 2007. Combined
effects of herbicides on biomarkers reflecting immuneendocrine interacions in goldfish immune
antioxidanteffects.Aquat.Toxicol.81:159167.

Fava,F.;DiGioia,D.;Romagnoli,C.;Marchetti,L.&Mares,D.1993.Biosynthesisandcytoplasmatic
accumulationofachlorinatedcatecholpigmentduring3chlorobenzoateaerobiccometabolismin
Pseudomonasfluorescens.Arch.Microbiol.160:350357.

Felske,A.,Engelen,B.,Nubel,U.&Backhaus,H.1996.Directribosomeisolationfromsoiltoextract
bacterialrRNAforcommunityanalysis.Appl.Environ.Microbiol.62:416267.

Fruchey, I.; Shapir, N.; Sadowsky, M.J. & Wackett, L.P. 2003. On the origins of cyanuric acid
hydrolase;purification,substrates,andprevalenceofatzDfromPseudomonassp.StrainADP.Appl.
Environ.Microbiol.69:36533657.

Galndez, S.P.; Ramos, O.; Ruiz, N.; Salmeron, A.; Jurez, C.; Ahuatzi. D.; Curiel, E. & Galndez, J.
2011.SimultaneousdegradationofatrazineandsimazinebyabinarycultureofStenotrophomonas
maltophilia and Arthrobacter sp. in a twostage biofilm reactor. J. Chem. Technol. Biotechnol.
86:554561.

Gebendinger, N.; Radosevich, M. 1999. Inhibition of atrazine degradation by cyanazine and


exogenousnitrogeninabacterialisolateM913.Appl.Microbiol.Biotechnol.51:375383.

Guang Gu, J.; Fan, Y.; Don Gu, J. 2003. Biodegradability of atrazine, cyanazine and dicamba under
methanogenicconditioninthreesoilsofChina.Chemosphere.52:15151521.

Grcic, I.; Muzic, M.; Vujevic, D.; Koprivanac, N. 2009. Evaluation of atrazine degradation in
UV/EZSM5/H
2
O
2
systemusingfactorialexperimentaldesign.Chem.Engineerin.150:476484.

Grigg,B.C.; Bishoff, M.; Turco, R.F. 1997. Cocontaminated effects on degradation of triazine
herbicidesbyamixedmicrobialcultura.Agric.FoodChem.45:9951000.

Hayes, T.B.; Collins, A.; Lee, M.; Mendoza, M.; Noriega, N.; Stuart, A.A.; Vonk, A. 2002.
Hermaphroditic, demasculinized frogs after exposure to the herbicide atrazine at low ecologically
relevantdoses.Proc.Natl.Acad.Sci.USA,99:54765480

Hunter,W.J.&Shaner,D.L.2009.Nitrogenlimitedbiobarriersremoveatrazinefromcontaminated
water:lavoratorystudies.ContaminantHydrology.103:2937.

(IARC)InternationalAgencyforResearchonCancer(1999)Evaluatingcarcinogenicrisksinhumans.
Some chemicals that cause tumours of the kidney or urinary bladder in rodents and some other
substances.WorldHealthOrganization,Lyon73:59113

Karthikeyan,R.; davis, C.; Erickson, E.; AlKhatib, K.; Kulakow, P.; Barnes, L. P.; Hutchinson, L.;
Nurzhanova, A. 2003. Studies on responses of nontarget plants to pesticides. Review Hazardous
SubstanceResearchCentre.KansasStateUniversity.
Bibliografa

77

Kettles,M.A.;Browning,S.R.;Prince,T.S.&Horstman,S.W.1997.Triazineherbicideexposureand
breastcancerincidence:anecologicstudyofKentuckycounties.EnvironHealtPerspect105:1222
1227

Kontchou,Y.C.;Gschwind,N.1994.Mineralizationoftheherbicideatrazineasacarbnsourcebya
Pseudomonasstrain.Agric.FoodChem.43:22912294.

Kontchou. Y. & Gschwind. N. 1999. Biodegradation of sTriazine compounds by a stable mixed


bacterialcommunity.Ecotoxicol.Environ.Safety.43:4756.

Lerch, R.N.; Blanchard, P.E.; Turman, E.M. 1998. Contribution hydroxylated atrazine degradation
productstothetotalatrazineloadinmidwesternstreams.Environ.Sci.Technol.32:4048.

Macas,A.;Tafoya,A.;Ruiz,N.;Salmern,A.;Jurez,C.;Ahuatzi,D;Mondragn,M.E.;Galndez,J.
2009. Atrazine biodegradation by a bacterial community immobilized in two types of packedbed
biofilmreactors.World.J.Microbiol.Biotechnol.25:21952204.

Markwell.J.;Namuth,D.;Hernndez,I.2007.Introduccinalosherbicidasqueactanatravsde
lafotosntesis.DepartmentofAgronomyandHorticultureatUniversityofNebraskaLincoln,USA.

Martin,M.;Casasus,L.;Garbi,C.;Nande,M.;Vargas,R.;Robla,J.I.;Sanchez,M.;Allende,J.L.2008a.
A new mathematical model to evaluate simazine removal in three different immobilizedbiomass
reactors.WaterResearch.42:10351042.

Martin,M.; Gibello, A.; Lobo, C.; Nande, M.; Garbi, C.; Fajardo, C.;Barracaracciolo, A.; Grenni, P.;
MartinezIigo, M.J. 2008.b Application of fluorescence in situ hybridization technique to detect
simazinedegradingbacteriainsoilsamples.Chemosphere.71:703710.

Mondragn,M.E;Ruiz,N.;Tafoya,A.;Jurez,C.;Curiel,E.;Galndez,J.2008.Chemostatselectionof
abacterialcommunityabletodegradestriaziniccompounds:continuoussimazinebiodegradation
anamultistagepackedbedbiofilmreactor.J.Ind.Microbiol.Biotechnol.35:767776.

Montalvo, D.M.; Mengs, G.; Ferrer, J.; Allende, J.L.; Alonso, R. & Martin, M. 1998. Simazine
degradation by immobilized and suspended soil bacterium. Inter. Biodegradation and Biodeg.
40:9399.

Moore,A.;Lower,N.2001.Theimpactoftwopesticidesonolfactorymediatedendocrinefunction
inmaturemaleAtlanticsalmon(Salmosolar)parr.Comp.Biochem.Physiol.129:269276

Moran,A.C.;Muller,A.;Manzano,M.;Gonzlez,B.2008.Simazinetreatmenthistorydeterminesa
significant herbicide degradation potential in soils that is not improved by bioaugmentation with
Pseudomonassp.ADP.Appl.Microbiol.101:2635.

Bibliografa

78
Pranab, K. & Ligy, P. 2004. Atrazine degradation in anaerobic environmental by mixed microbial
consortium.WaterResearch.38:22772284.

Radosevich,M.;Traina,S.J.;Touvinen,O.H.;1995.Degradationofbinaryandternarymixturesofs
triazinesbyasoilbacterialisolated.Environ.Sci.andHealth.30:457477.

Ralebitso, K.T.; Senior, E.; Van Verseveld, H.W. 2002. Microbial aspects of atrazine degradation in
naturalenvironments.Biodegradation.13:1119.

Russo, J. & Lagidick, L. 2004. Effects of enviromental concentrations of atrazine on hemocyte


densityandphagocyticactivityofpondsnailsLymneastagnalis.Enviro.nPollut.127:303311.

Sanger,F.1981.DeterminationofnucleotidesequencesinADN.Science,214:12051210.

Salgio, P.; Trijasse, S. 1998. Behaivoral responses to atrazine and durionin goldfish.Arch.Environ.
Contam.Toxicol.35:484491.

Satsuma, K. 2009. Complete biodegradation of atrazine by a microbial community isolated from a


naturallyderivedriverecosystem(microcosm).Chemosphere.10:1016.

Seema,J.;Ramesh,Y.;Jayaram,R.V.2009.Photolyticandphotocatalyticdegradationofatrazinein
thepresenceofactivatedcarbn.Chem.Engineerin.148:342347.

Siripattanakul, P.; Wirojanagud, W.; McEvoy, J. 2009.a A feasibility study of immobilized and free
mixedculturabioaugmentationfortreatingatrazineininfltrate.Hazard.Mater.168:13731379.

Siripattanakul, P.; Wirojanagud, W.; McEvoy, J.; Limpiyakorn, T.; Khan, E. 2009.b Atrazine
degradationbystablemixedculturesenrichedfromagricultiralsoilandtheircharacterization.Appl.
Microbiol.106:988992.

Smith, D.; Alvey, S.; Crowley, D. E. 2005. Cooperative catabolic phatways within an atrazine
degradingenrichmentculturaisolatedfromsoil.Microbiol.Ecol.53:265273.

Snedeker, M.S. 1998. Program on Breast Cancer and Environmental Risk Factors. (BCERF). Cornell
University.

Stevens, J.; Breckenridge, C.B. & Wetzel, L. 1999. A risk characterization for atrazine: oncogenicity
profile.JToxicolEnvironHealth56:69109

Sullivan, C.L. & Spence K.M. 2003. Effects of sublethal concentrations of atrazine and nitrate on
metamorphosisoftheAfricanclawedfrog.Environ.Toxicol.Chem.22:627635.

Tafoya A. 2008. Biodegradacin del herbicida triaznico, atrazina, por una comunidad bacteriana,
seleccionada en quimiostato, inmovilizada en reactores de lecho empacado; Tesis de Doctorado.
EscuelaNacionaldeCienciasBiolgicas.IPN
Bibliografa

79

Tafoya,A.;Macas,A.;Ruiz,N.;Jurez,C.;Galndez,J.2009.Kineticsofatrazinebiodegradationby
suspendedandinmovilizedmixedmicrobialcellcultivatedincontinuoussystems.J.Chem.Technol.
Biotechnol.84:982991.

Taiwo,L.B.&Oso,B.A.1997.Theinfluenceofsomepesticidesonsoilmicrobialflorainrelationto
changesinnutrientlevel,rockphosphatesolubilizationandPreleaseunderlaboratoryconditions.
AgricEcosystEnviron65:5968

Tran, N.P.; Park, J.K.; Hong, S.J. & Lee, C.G. 2009. Proteomics of proteins associated with
astaxanthin accumulation in the green algae Heamatococcus lacustris under the influence of
sodiumorthovanadate.BiotechnolLett.31:19171922.

Toop, E.M.; Zhu, H.; Nour, M.S.; Houot, S.; Lewis, M.; Cuppels, D. 2000. Characterization of an
AtrazineDegrading Pseudominobacter sp. Insolated from Canadian and French agricultural soils.
Appl.Environ.Microbiol.66:27732782.

Ware,G.W.2000.ThepesticideBook.5
th
ed.ThomsonPublications.Fresno,California.123145.

Whitacre, D.M. & Ware, G.W. 2004. Una introduccion a los herbicidas. University of Minnesota.
http://ipmworld.umn.edu./ipmsite.htm

Zaviska,F.;Drogui,P.;Blais,J.F.;Mercier,G.&Lafrance,P.2011.Experimentaldesignmethodology
applied to electrochemical oxidation of the herbicide atrazine using Ti/IrO2 and Ti/SnO2 circular
anodeelectrodes.J.Hazard.Mater.185:14991509.

Zhang, C.; Wang, L.; Pan, G.; Wu, F.; Deng, N.; Milhot, G.; Mestankova, H.; Bolte, M. 2009.
Degradation of atrazine photoinduced by Fe (III) pyruvate complex in the aquerous solution.
Hazar.Mater.169:772779.


Bibliografa

80
10.1. Consultaseninternet

http://dicc.hegoa.efaber.net/listar/mostrar/7
http://edafologia.urg.es/conta/tema13/imagenes/interac.gif/2008
http://www.acsmedioambiente.com/lonuevo/junio2009
http://www2.ine.gob.mx/sistemas/plaguicidas/pdf/atrazina.pdf.Septiembre2009.
http://www2.ine.gob.mx/sistemas/plaguicidas/pdf/simazina.pdf.Septiembre2009.
http://edafologia.urg.es/conta/tema13/clasif.htm
USEPA (U. S. Environmental Protection Agency). 2004. EPA Ground wter & drinking wter.
Consumer factsheet on: Simazine. Version electrnica:
http://www.epa.gov/safewater/contaminants/dw_contaminats/dw_contamfs/simazine.html