Enhanced in vivo fitness of carbapenem-resistant oprD
mutants of Pseudomonas aeruginosa revealed through
high-throughput sequencing
David Skurnika,1,2, Damien Rouxa,1, Vincent Cattoirb,c,3, Olga Danilchankab,3, Xi Lua, Deborah R. Yoder-Himesd,
Kook Hanb, Thomas Guillarda, Deming Jianga, Charlotte Gaultiera, François Guerinc, Hugues Ascharde, Roland Leclercqc,
John J. Mekalanosb, Stephen Loryb, and Gerald B. Piera,2
a
Division of Infectious Diseases, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; bDepartment of
Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115; cÉquipe Antibiorésistance 4655, Faculté de Médecine, Université de Caen
Basse-Normandie, F-14032 Caen, France; dDepartment of Biology, University of Louisville, Louisville, KY 40202; and eDepartment of Epidemiology, Harvard
School of Public Health, Boston, MA 02115
Edited* by Frederick M. Ausubel, Harvard Medical School and Massachusetts General Hospital, Boston, MA, and approved October 11, 2013 (received for
review December 11, 2012)
An important question regarding the biologic implications of
antibiotic-resistant microbes is how resistance impacts the organ-
ism’s overall fitness and virulence. Currently it is generally thought
that antibiotic resistance carries a fitness cost and reduces viru-
lence. For the human pathogen Pseudomonas aeruginosa, treat-
ment with carbapenem antibiotics is a mainstay of therapy that
can lead to the emergence of resistance, often through the loss of
the carbapenem entry channel OprD. Transposon insertion-site se-
quencing was used to analyze the fitness of 300,000 mutants of
P. aeruginosa strain PA14 in a mouse model for gut colonization
and systemic dissemination after induction of neutropenia. Trans-
poson insertions in the oprD gene led not only to carbapenem
resistance but also to a dramatic increase in mucosal colonization
and dissemination to the spleen. These findings were confirmed in
vivo with different oprD mutants of PA14 as well as with related
pairs of carbapenem-susceptible and -resistant clinical isolates.
Compared with OprD+ strains, those lacking OprD were more re-
sistant to killing by acidic pH or normal human serum and had
increased cytotoxicity against murine macrophages. RNA-sequenc-
ing analysis revealed that an oprD mutant showed dramatic
changes in the transcription of genes that may contribute to the
various phenotypic changes observed. The association between
carbapenem resistance and enhanced survival of P. aeruginosa in
infected murine hosts suggests that either drug resistance or host
colonization can cause the emergence of more pathogenic, drug-re-
sistant P. aeruginosa clones in a single genetic event.
S erious political, medical, and public health measures are
being implemented to address the significant problems as-
sociated with drug-resistant pathogens. National and inter-
national campaigns have been instituted to reduce and restrict
antibiotic use to achieve decreases in infections by antibiotic-
resistant organisms (1), which have been met with some success
(2). Although one reason for implementing antibiotic steward-
ship programs is to reduce the selective pressure for emergence of
drug-resistant microbes, an additional expected consequence is a
reduction in extant-resistant microbes from community and hos-
pital environments (3). Extensive studies indicate drug-resistant
microbes have decreased fitness and virulence, reflected by an
impairment in growth in infected hosts (4), lower transmission
rates (5), and reduced virulence manifested by diminished in-
vasiveness and higher clearance rates (6). A general decrease in
the occurrence of drug-resistant organisms can thus potentially be
achieved as the more fit antibiotic-susceptible organisms displace
resistant strains over time (6). However, if antibiotic-resistant mu-
tations can lead to enhanced fitness and virulence, this would
challenge the prevailing paradigm that there is a negative fitness
cost to drug resistance.
www.pnas.org/cgi/doi/10.1073/pnas.1221552110
Pseudomonas aeruginosa is a classical example of a bacterial
pathogen that is often found associated with extremely difficult-
to-treat infections that resist antibiotic therapies. This organism
frequently emerges as a threat to neutropenic, immunosuppressed
patients undergoing treatment for cancer wherein one usually
MICROBIOLOGY
observes the spread of antibiotic-resistant organisms from gas-
trointestinal (GI) sites into the blood stream. It has also been
observed in the setting of cystic fibrosis (CF) that reversion or
displacement of resident drug-resistant P. aeruginosa strains does
not occur even when antibiotic treatment is intermittent (7). This
observation suggests that some mechanisms leading to antibiotic
resistance could also enhance the fitness of P. aeruginosa in vivo
and thus contribute to persistent infections.
Transposon (Tn) insertion-site sequencing (Tn-seq) is a pow-
erful analytical method that in various formats has been called
“INSeq” (insertion-site sequencing) (8, 9), “Tn-seq” (10), or
“high-throughput insertion tracking by deep sequencing” (HITS)
(11). These methods allow one to measure the fitness of col-
lections of insertion mutants under a given growth condition
by using deep sequencing to efficiently quantitate the levels of
Significance
It is thought antibiotic resistance carries a fitness cost and
reduces microbial virulence. Using high-throughput sequencing
analysis of a transposon insertion bank in Pseudomonas aeru-
ginosa, we found enhanced fitness for in vivo mucosal coloni-
zation and systemic spread of strains with transposon insertions
in the oprD gene. This conferred resistance to carbapenem
antibiotics as well as enhanced resistance to killing at acidic pH
and by normal human serum along with increased cytotoxicity
against murine macrophages. RNA-sequencing analysis revealed
that oprD deficiency led to transcriptional changes in numerous
genes that may contribute to the enhanced in vivo fitness ob-
served. Thus, if carbapenem resistance develops during antibi-
otic therapy of P. aeruginosa infections, it may lead to enhanced
fitness and virulence in infected hosts.
Author contributions: D.S., D.R., V.C., O.D., and G.B.P. designed research; D.S., D.R., V.C.,
O.D., X.L., D.R.Y.-H., K.H., T.G., D.J., C.G., and F.G. performed research; D.S., D.R., O.D., H.A.,
R.L., J.J.M., S.L., and G.B.P. analyzed data; and D.S. and G.B.P. wrote the paper.
The authors declare no conflict of interest.
*This Direct Submission article had a prearranged editor.
1
D.S. and D.R. contributed equally to this work.
2
To whom correspondence may be addressed. E-mail: dskurnik@rics.bwh.harvard.edu or
gpier@rics.bwh.harvard.edu.
3
V.C. and O.D. contributed equally to this work.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1221552110/-/DCSupplemental.
PNAS Early Edition | 1 of 6
junction sequences that mark unique Tn-insertion sites on the
bacterial chromosome. To test the hypothesis that changes in the
antibiotic resistance profile of P. aeruginosa could be associated
with enhanced host colonization particularly in the context of
immunosuppression (12), we used INSeq to identify P. aerugi-
nosa genes whose inactivation promotes increased fitness in
neutropenic mice. We constructed a saturated TnSAMDGm (8)
insertion library in the well-characterized P. aeruginosa strain
PA14 (13) and subjected the bank to in vivo selection in a mouse
model for mucosal colonization and dissemination. Tracking of
various mutants indicated that a strong positive selection for the
loss of different gene functions occurred in vivo. Remarkably, loss
of OprD function resulted both in enhanced host colonization and
dissemination, as well as resistance to the carbapenem antibiotics.
Results and Discussion
We have recently reported that antibiotic treated mice can be
used in principle to analyze the GI fitness of P. aeruginosa Tn
mutants (9). In brief, to establish P. aeruginosa GI colonization,
mice received streptomycin and penicillin in sterile drinking
water for 5 d to clear the indigenous commensal GI microbial
flora, after which the PA14 TnSAMDGm insertion bank, grown
overnight in lysogeny broth (LB, designated “input LB”) con-
taining 15 mg gentamicin per L was added to sterile water con-
taining penicillin and gentamicin. The drinking water containing
bacteria was renewed after 72 h and administered to mice for
a total of 6 d after which sterile drinking water was given for 24 h
before mice were killed and their ceca removed. During this time,
the strains with Tn insertions that could colonize and survive in the
cecum of the GI tract were selected (designated “output cecum”).
Following induction of neutropenia after 6 d of mucosal coloni-
zation, the strains with Tn insertions that were able to disseminate
systemically over 24 h were recovered from the spleen (designated
“output spleen”) (14). Splenic dissemination after induction of
neutropenia was considered to indicate fitness for systemic
dissemination.
Tn-seq analysis of the population of organisms derived from
growing the Tn-insertion bank overnight in LB showed there
were no Tn insertions mutants that yielded more than 8,000
sequencing reads out of 106 normalized reads (0.8%) indicating
that the Tn insertions were relatively evenly distributed in the
genome and no Tn insertions were significantly overrepresented
in the bank (Fig. 1A). However, strains with Tn insertions in 13
different genes were strongly overrepresented in the output ce-
cum samples (Fig. 1B). Twelve of these were in genes resulting in
the loss of type IVa pili (15) comprising 380,000 total reads
(38%). Strikingly, strains bearing Tn insertions in the oprD gene,
whose loss leads to acquisition of the resistance to the carba-
penem antibiotics, represented 42% of the output cecum pop-
ulation. The number of sequencing reads of the various oprD
mutants increased from 515 (0.05% of the total reads) in LB to
420,621 in the cecum (Fig. 1B). More dramatically, 94% of the
strains that disseminated to the spleen of neutropenic mice (Fig.
1C) had Tn insertions in the oprD gene (947,397 sequencing
reads in the spleen output group). Whereas a large number of
Tn-insertion mutants showed a significant decrease in their re-
covery from each in vivo environment, mutants carrying Tn
insertions in the oprD gene were dramatically increased in in vivo
fitness [Z = 972.29, P < 10-16, Kal’s statistical test (16)]. To avoid
any bias due to an overrepresentation of the oprD mutants in
water over time, we sequenced the bank of mutants after bacteria
resided in water containing penicillin and gentamicin for 48 h at
room temperature. Tn insertions in oprD represented less than
0.5% of the viable mutants present in such water samples. As the
drinking water containing bacteria was changed after 72 h, the
lack of overrepresentation of the oprD mutant strains at any time
point in the water was confirmed by plating the bank of mutants
that survived for 72 h in water on plates with or without

Fig. 1. Analysis of in vivo fitness of Tn insertions in the P. aeruginosa PA14 genome. (A) Circos plot of Tn insertions into strains grown overnight in LB with
their ordered representation (inner blue circle). Gray circular lines represent 2,000, 4,000, 6,000, or 8,000 sequencing reads recovered from the input LB
sample. Outermost circle represents the full PA14 genome. (B and C) Analysis of Tn insertions into genes within the PA14 chromosome revealed strains with
increased in vivo fitness. (B) Ordered representation of the in vivo fitness for cecal colonization of all of the strains with Tn insertions able to grow overnight
in LB. (C) Ordered representation of the in vivo fitness for splenic dissemination of all of the strains with Tn insertions able to colonize the output cecum. Total
number of reads recovered from the input LB and output cecum and spleen samples were normalized to 1,000,000.

2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1221552110 Skurnik et al.

carbapenems (3 mg/L). We confirmed by PCR that only strains
with a Tn inserted in the oprD gene were able to grow on the
carbapenem-containing plates and they represented only 0.5% of
the total strains. In parallel, we observed no difference in the
growth of an oprD mutant strain in vitro (Fig. S1).
Increased fitness was not specific for Tn insertions into genes
encoding for all outer membrane proteins (OMPs) although, as
among the Tn insertions in the 262 genes predicted to encode for
OMPs (17, 18), only 68 were able to colonize the cecum (Fig.
2A). Among them, only the Tn insertions in the oprD gene dis-
played an enhanced fitness for colonization (Fig. 2A).
To further analyze the comparative colonization and dissemina-
tion abilities of wild-type (WT) P. aeruginosa PA14 and strains with
Tn insertions in the oprD gene, we characterized several oprD-de-
ficient variants of strain PA14. Two of these strains, PA14_Tn-
oprD:6–4 and PA14_Tn-oprD:8–1, were retrieved from an ordered
Tn library (19) and had distinct Tn insertions in the oprD gene. An
additional PA14 strain, PA14_Tn-oprD::Spleen, was recovered from
a neutropenic mouse spleen. All of these oprD Tn-insertion strains
showed an enhanced resistance to the carbapenem antibiotic imi-
penem, with a minimum inhibitory concentration (MIC) of ≥6 mg/L
compared with 1 mg/L for the WT PA14 strain.
To acquire correlative data from infected human patients, we
insertion sequence element IS Pa1328 at nucleotide 50 in the
oprD gene and the carbapenem-resistant strain 51-2 had a 12-bp
deletion (base pairs 579–590 included) and a single nucleotide
change (G→A at position 1148 leading to a stop codon) in the
oprD gene (Fig. S2B). We further constructed complemented
strains for the PA14_Tn-oprD::Spleen strain and the 48-2 and 51-
2 strains by conjugating into them a plasmid bearing a full-length
oprD gene (PoprD). The complemented strains had MICs to
imipenem of ≤1 mg/L. Finally, to further study the phenotypes
associated with oprD deficiency, 22 additional clinical strains
were selected (CS1–CS22): 10 strains (CS1–CS10) with a normal
level of transcription of the oprD as determined by quantitative
(q)RT-PCR, and 12 strains (CS11–CS22) with a reduced level of
expression (Dataset S1). The three controls used for the qRT-
PCRs were the PA14 WT strain, a strain with a clean deletion of
the oprD gene, and a strain overexpressing oprD.
Analysis of OprD expression using SDS/PAGE showed that
the 48.4 kDa OprD protein was readily seen in extracts from WT
PA14, the clinical isolates 48-1 and 52-1 and the corresponding
transcomplemented strains (Fig. 2B), whereas no evidence of an
intact OprD protein was found in PA14 ΔoprD strain (used as
a control), the Tn insertions designated 6-4, 8-1, Tn-oprD::
Spleen, and the clinical strains 48-2 and 51-2 (Fig. 2B). This

obtained two additional strains of P. aeruginosa resistant to
carbapenems from a collection of clinical isolates. Pulsed-field
gel electrophoresis (PFGE) (20) was used to identify related
pairs of strains from two patients (Fig. S2A) in which earlier
clinical isolates (strains 48-1 and 51-1) were carbapenem sus-
ceptible (imipenem MIC < 1 mg/L), and later isolates (48-2 and
51-2) carbapenem resistant (imipenem MIC ≥ 32 mg/L). Se-
quencing of the oprD genes from these strains confirmed that
the carbapenem-susceptible isolates had an intact oprD gene,
whereas the carbapenem-resistant strain 48-2 had acquired the
MICROBIOLOGY
result was confirmed using a sensitive silver-staining reagent
(Fig. S3) that also showed the lack of difference of expression in
the other OMPs under these conditions, and suggested that
OprD-truncated protein was not present in OprD mutant strains
(Fig. S3).
As Tn insertions unable to produce type IVa pili were also
positively selected for enhanced GI colonization, the swarming
and the twitching motilities of P. aeruginosa PA14 Tn::oprD were
assessed (15). No change in motility was associated with the loss
of production of OprD (Fig. 2C and Figs. S4 and S5). Therefore,

Fig. 2. Characterization of oprD mutants. (A) Fitness for dissemination of all of the Tn insertions in genes encoding for predicted OMPs that are able to
colonize the cecum. Positive fitness (more than twofold increase) was detected only for Tn insertions into the oprD gene (PA14_51880) (green bar). All of the
insertions in the genes for the remaining OMPs had a reduced fitness (red bars) ranging from a 10-fold to a >10,000-fold decrease in the ratio of reads in the
cecum versus spleen. Black circular lines within the gray circle represents baseline, and thin gray circular lines represent 10-fold changes (i.e., a log10 scale).
Outermost circle represents the full PA14 genome with a 10× magnification of the regions of interest. (B) Analysis of the OMP expression. oprD mutant strains
Tn_oprD (spleen, 6-4, 8-1), clinical isolates (48-2 and 51-2), and PA14 ΔoprD did not express the OprD protein. OprD (arrow) is seen in the OMP extract from
WT PA14, clinical isolates 48-1 and 51-1, and in the complemented (PoprD) strains. M, molecular mass standard. (C) Swarming motility of the oprD mutant
strains. WT PA14, Tn-oprD::Spleen, and Tn-oprD::Spleen (PoprD) strains showed normal motility, whereas the PA14_Tn-pilE strain lacking pili has defective
motility and the PA14_Tn-fliC strain has no motility.

Skurnik et al. PNAS Early Edition | 3 of 6

the basis for enhanced fitness for GI colonization of oprD
mutants in mice is not the result of a defect in the production of
type IVa pili.
Attempts to mark WT P. aeruginosa PA14 with either strep-
tomycin or tetracycline resistance for in vivo tracking resulted in
a diminution in their ability to colonize the murine GI tract in
comparison with unmarked WT P. aeruginosa PA14 (Fig. S6),
emblematic of the fitness cost usually attributed to the acquisi-
tion of antibiotic resistance (6). Thus, to compare the oprD-
deficient strains with WT PA14, the unmarked WT strain and the
oprD-deficient strains (gentamicin resistant) or the WT and
PoprD-complemented strains (also gentamicin resistant) were
mixed together in drinking water at a ratio of ∼1:1 and the rel-
ative levels of WT and mutant strains in the output samples were
determined by plating cultures on LB agar and LB agar with 15
mg gentamicin per L. We subtracted the colony forming units
(cfu) determined from the latter plates from those on the non-
selective plates to obtain the level of colonization with WT
P. aeruginosa PA14. This ratio was further confirmed by sub-
culturing 100 separate colonies that grew on the LB-agar plates
with and without gentamicin. Analysis of the oprD gene by PCR
for each gentamicin-resistant colony confirmed that they were
oprD mutants and not spontaneous gentamicin-resistant strains.
A similar approach was used to differentiate between oprD-de-
ficient and PoprD-complemented strains, however, carbapenem
plates were used instead of gentamicin plates as both strains
were gentamicin resistant.
Comparing selective fitness during cecal colonization of the
PA14_Tn-oprD::Spleen isolate with the WT PA14 strain and the
complemented PA14_Tn-oprD::Spleen (PoprD) strains revealed
that the PA14_Tn-oprD::Spleen strain out-competed both the
WT and complemented strains, constituting >90% of the isolates
recovered from the cecum (Fig. 3A). Comparing the WT PA14
strain and complemented PA14_Tn-oprD::Spleen (PoprD) strains
in the cecal colonization setting showed that both colonized the
mice at comparable levels (Fig. 3A), supporting the conclusion
that the loss of expression of OprD conferred an in vivo GI col-
onization advantage to the PA14_Tn-oprD::Spleen strain over
the WT PA14 (Fig. 3A). No effect of the empty vector used
for complementation was found in the GI colonization model
(Fig. S7).
Further confirmation that loss of OprD enhanced GI coloni-
zation was obtained by evaluating the competitive colonization
efficacies of WT PA14 against the two carbapenem-resistant
strains from the ordered Tn library, PA14_Tn-oprD:6-4 and
PA14_Tn-oprD:8-1. The PA14_Tn-oprD:6-4 and PA14_Tn-oprD:8-1
strains were stronger cecal colonizers than the PA14 WT strain.
Following induction of neutropenia, more than 90% of the
isolates recovered from the spleen were oprD mutants (Fig. 3 B
and C). Comparative analysis of the competitive colonization
capacities of the P. aeruginosa clinical isolates with an intact
oprD gene, 48-1 and 51-1 with their corresponding related oprD
mutants, 48-2 and 52-2, showed the oprD mutants constituted
>95% of the recovered strains (Fig. 3 B and C). Thus, in all
circumstances, loss of OprD and the consequent acquisition of
carbapenem resistance resulted in enhanced GI colonization
and systemic dissemination during neutropenia. To ascertain
whether the overrepresentation of the oprD mutants was not
merely due to enhanced survival as opposed to enhanced fitness
of these strains, we colonized antibiotic-treated mice with
monocultures of either WT PA14 or streptomycin- or tetracy-
cline-resistant variants, or with the PA14_Tn-oprD::Spleen
strain, and found no difference in the levels of any of these
variants in the ceca after 6 d of colonization (Fig. S8). Thus, in
the absence of competition from the OprD-deficient strains,
WT strains were able to achieve levels of GI colonization com-
parable to that of the oprD mutants.
4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1221552110
Fig. 3. Analysis of the fitness for cecal colonization and systemic dissemi-
nation of the oprD mutant strains. (A) Ratio of cecal colonization between
indicated oprD mutant strain and a strain with intact oprD. (B and C) In vivo
competitive index (CI) for GI tract colonization (B) and systemic dissemina-
tion (C) of the PA14 oprD mutants 6-4 and 8-1 versus WT and of the oprD
mutant clinical strains 48-2 and 51-2 versus a related strain with intact oprD
(48-1 and 51-1, respectively). Each point represents the CI for a single mouse.
The medians are shown as a solid line. A CI > 1 indicates increased fitness.
P. aeruginosa strains with an intact oprD gene were rarely recovered (0–5%)
from the cecum and, consequentially, rarely recovered from the spleen when
in competition with oprD mutants.
We next evaluated several phenotypes that could be related to
the oprD deficiency and account for the increased in vivo fitness
of the oprD mutants by analyzing in vitro survival of WT PA14 or
Tn-insertion mutants in the presence of major host innate im-
mune factors in the serum (21), as well as survival in the acidic
conditions found in the GI tract (pH∼5 in mice) (22). After 180
min in 50% serum, all of the strains lacking OprD survived better
than their isogenic or related parental or trans-complemented
partners containing an intact oprD gene (Fig. 4A). Similarly,
except for one strain (CS23 strain), all of the clinical strains with
a low level of oprD transcription were significantly more resistant
to serum-mediated killing compared with the clinical strains
with a high level of oprD transcription (Fig. 4A). All of the oprD
mutant strains tested were found to survive better at pH 5 than
isogenic or related strains with an intact oprD gene (Fig. 4B).
Furthermore, the PA14_Tn-oprD::Spleen strain displayed higher
levels of cytotoxicity against murine macrophages than either this
mutant complemented with PoprD or to the PA14 WT strain
(Fig. 4C).
To define a mechanism that could explain all these phenotypes
associated with oprD deficiency, we used RNA-seq (23) to de-
termine the transcriptional profiles of WT PA14 and PA14_Tn-
oprD::Spleen strains after in vitro growth. As shown Fig. 5, the
PA14 in vitro transcriptome was quite uniform in that it showed
little variability throughout the whole genome. In contrast, the
PA14_Tn-oprD::Spleen transcriptome showed considerable var-
iability with elevated and reduced transcriptional levels detected
in many different chromosomal locations compared with WT
PA14 (Fig. 5). In total, 97 genes that were clearly transcribed in
WT PA14 were transcriptionally silent in PA14_Tn-oprD::Spleen
when grown in vitro (Dataset S2). In contrast, 60 genes had
transcription levels increased more than 10-fold in the PA14_Tn-
oprD::Spleen strain compared with WT PA14 (Dataset S3).
Interestingly, increases in transcript levels were not found
for the genes encoding most known virulence factors in the
Skurnik et al.
 MICROBIOLOGY
Fig. 4. Phenotypes associated with increased in vivo fitness of oprD mutant strains. (A) Resistance to the antibacterial action of serum of P. aeruginosa strains
with or without oprD deficiencies. OprD deficiency was confirmed by assessing the level of OprD expression (Fig. 2A) or the level of oprD mRNA transcription
(strains CS1–S23; Dataset S1). The P values were determined by t test. (B) Survival for 60 min at pH 5 of either WT P. aeruginosa strains or those with mutations
in the oprD gene. Bars indicate mean percent survival compared with isogenic or related strains with intact oprD. Error bars indicate a single SD of the data.
*P value of less than 0.05 (t test) between the oprD intact and mutant strains; **P value of less than 0.05 between the oprD mutant and isogenic or related
oprD complemented strain. (C) Role of the oprD gene in the cytotoxicity of PA14 against murine macrophages after 1 h of incubation. Two multiplicities of
infection were tested: 20:1 (Upper) and 100:1 (Lower). The PA14 ΔexoU strain was used as a negative control. Error bars indicate the SD of the data.

P. aeruginosa genomes (www.mgc.ac.cn/VFs/main.htm). To vali-
date RNA-seq results, we performed individual qRT-PCR deter-
minations that confirmed the lack of significant increases in the
transcription level between the WT PA14 and the PA14_Tn-
oprD::Spleen strains for genes representative of the following
virulence factors: type 1, 2, 3, and 6 secretion systems, type IVa
and IVb pili, exopolysaccharides alginate, PEL, and LPS, as well
as rhl, quinolone quorum-sensing systems and adhesins, flagellins,
Fig. 5. Global analysis of transcript levels in PA14 WT and Pa14_Tn-oprD::
Spleen by RNA-seq. Sequencing reads for each of the 5,977 genes of PA14
WT (blue dots) or PA14_Tn-oprD::Spleen (green dots) corresponding to the
transcript expression of each gene of these two strains grown in LB. A total
of 97 genes expressed in PA14 WT were not expressed in PA14_Tn-oprD::
Spleen strain.
rhamnolipids, pyochelin, pyoverdin, and pyocyanin (Dataset S4).
Overall, transcriptional changes in genes needed for production
of well-established P. aeruginosa virulence factors did not ac-
count for the enhanced fitness of OprD-deficient strains in GI
colonization and dissemination. Thus, either the other tran-
scriptional differences seen in the oprD mutant contributed to
enhanced in vivo fitness or, alternatively, the loss of OprD itself
causes posttranscriptional changes in phenotypic properties that
enhance colonization and dissemination in the host.
We also examined published studies to ascertain if infections
with oprD-mutant, carbapenem-resistant P. aeruginosa strains
were associated with worse clinical outcomes. We hypothesized
that the observed increased fitness of the oprD mutant strains in
laboratory settings could be associated with more severe clinical
outcomes in human infections. Peña et al. (24) reported signifi-
cantly greater mortality after 7 and 30 d of infection in patients
with carbapenem-resistant P. aeruginosa bloodstream infections,
of which ∼95% were due to oprD mutations (25). In a related
analysis, Cabot et al. (26) found that oprD mutations underlay
the acquisition of high-risk infections due to extensively drug-
resistant P. aeruginosa infections. In addition, a recent study
analyzing different mechanisms of antibiotic resistance that oc-
cur in clinical isolates of P. aeruginosa causing severe blood-
stream infections concluded that acquisition of resistance did not
lead to decreased fitness (27). Consistent with the observations
reported here that mutations in the oprD gene in P. aeruginosa
can increase fitness for infection, other studies have reported
that oprD-inactivating mutations can arise in the absence of
carbapenem treatment (28), suggestive of a survival benefit
conferred by OprD loss. Notably, some oprD mutations occur in
isolates with MICs to imipenem or meropenem of 0.06–4 μg/mL,
considered to be within the susceptible range (25), suggesting
that increased fitness and full carbapenem resistance may be sep-
arable properties of the OprD protein. This might be explained
by the findings of Eren et al. (29) who reported that multiple

Skurnik et al. PNAS Early Edition | 5 of 6

outer-membrane carboxylate channels (Occ) like OprD with
different substrate specificities are found among various Gram-
negative bacteria, raising the possibility that some strains of
P. aeruginosa might possess additional Occ channels involved in
carbapenem uptake.
Although almost all prior reports indicated no obvious fitness
cost for causing severe infections by OprD deficient/carbapenem-
resistant P. aeruginosa, our studies suggest there might be en-
hanced in vivo fitness of P. aeruginosa as a result of acquisition of
oprD-inactivating mutations. Mechanistically, this is likely due to be
the collective properties of OprD-deficient P. aeruginosa including
enhanced serum resistance, a better ability to survive in hostile
environments such as the acidic pH of the stomach, increased cy-
totoxicity against phagocytes, and other yet-to-be-discovered prop-
erties contributing to enhanced fitness. Notably, OprD-deficiency
does not appear to confer any enhanced fitness in noninfectious
settings, as a previous study (30) on 328 unrelated P. aeruginosa
isolates from 69 localities in 30 countries on five continents col-
lected from diverse clinical (human and animal) and environmental
habitats over the last 125 y found no OprD-deficient strains among
environmental isolates. However, the prevalence of OprD-deficient
strains in CF and non-CF patients from the same study was 16%
and 10%, respectively.
In a broader context, our findings imply that carbapenem
treatment and the consequent selection of P. aeruginosa oprD
mutant strains can lead to enhanced in vivo fitness and potentially
to an increase in virulence. If additional studies validate an in-
creased fitness and/or virulence of OprD-deficient P. aeruginosa,
1. Kaki R, et al. (2011) Impact of antimicrobial stewardship in critical care: A systematic
review. J Antimicrob Chemother 66(6):1223–1230.
2. Sabuncu E, et al. (2009) Significant reduction of antibiotic use in the community after
a nationwide campaign in France, 2002-2007. PLoS Med 6(6):e1000084.
3. Levin BR (2001) Minimizing potential resistance: A population dynamics view. Clin
Infect Dis 33(Suppl 3):S161–S169.
4. Andersson DI (2006) The biological cost of mutational antibiotic resistance: Any
practical conclusions? Curr Opin Microbiol 9(5):461–465.
5. Randall LP, et al. (2008) Fitness and dissemination of disinfectant-selected multiple-
antibiotic-resistant (MAR) strains of Salmonella enterica serovar Typhimurium in
chickens. J Antimicrob Chemother 61(1):156–162.
6. Andersson DI, Hughes D (2010) Antibiotic resistance and its cost: Is it possible to re-
verse resistance? Nat Rev Microbiol 8(4):260–271.
7. Folkesson A, et al. (2012) Adaptation of Pseudomonas aeruginosa to the cystic fibrosis
airway: an evolutionary perspective. Nat Rev Microbiol 10(12):841–851.
8. Goodman AL, et al. (2009) Identifying genetic determinants needed to establish
a human gut symbiont in its habitat. Cell Host Microbe 6(3):279–289.
9. Skurnik D, et al. (2013) A comprehensive analysis of in vitro and in vivo genetic fitness
of pseudomonas aeruginosa using high-throughput sequencing of transposon
libraries. PLoS Pathog 9(9):e1003582.
10. Dong TG, Ho BT, Yoder-Himes DR, Mekalanos JJ (2013) Identification of T6SS-dependent
effector and immunity proteins by Tn-seq in Vibrio cholerae. Proc Natl Acad Sci USA
110(7):2623–2628.
11. Gawronski JD, Wong SM, Giannoukos G, Ward DV, Akerley BJ (2009) Tracking in-
sertion mutants within libraries by deep sequencing and a genome-wide screen for
Haemophilus genes required in the lung. Proc Natl Acad Sci USA 106(38):
16422–16427.
12. Tancrède CH, Andremont AO (1985) Bacterial translocation and gram-negative bac-
teremia in patients with hematological malignancies. J Infect Dis 152(1):99–103.
13. Lee DG, et al. (2006) Genomic analysis reveals that Pseudomonas aeruginosa virulence
is combinatorial. Genome Biol 7(10):R90.
14. Koh AY, Priebe GP, Pier GB (2005) Virulence of Pseudomonas aeruginosa in a murine
model of gastrointestinal colonization and dissemination in neutropenia. Infect
Immun 73(4):2262–2272.
15. Burrows LL (2012) Pseudomonas aeruginosa twitching motility: Type IV pili in action.
Annu Rev Microbiol 66:493–520.
16. Kal AJ, et al. (1999) Dynamics of gene expression revealed by comparison of serial
analysis of gene expression transcript profiles from yeast grown on two different
carbon sources. Mol Biol Cell 10(6):1859–1872.
6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1221552110
the findings might impact decisions related to infection control
and treatment of P. aeruginosa infections. Thus, a careful evalu-
ation might need to be made regarding the empiric use of car-
bapenems in hospitals, particularly in intensive care units and
hematology departments, if there is a potential that treatment of
patients with suspected but unconfirmed P. aeruginosa infection
might, in the long run, be more harmful than beneficial.
Materials and Methods
The murine model of GI tract colonization and systemic dissemination by
P. aeruginosa and the DNA preparation for Illumina sequencing were as
described (8, 14). The PFGE was interpreted according to previously used
criteria (20). The bacterial OMPs were detected by SDS/PAGE. Twitching
motility was assessed using 1.5% agar LB plates and swarming assays per-
formed using supplemented fresh plates of M9 minimal medium. The serum
killing experiments were performed with pooled human serum. The cyto-
toxicity experiments used RAW264.7 cells. The library for the RNA-seq was
prepared using Encore Complete Prokaryotic RNA-Seq DR Multiplex Systems
kit (NuGEN), and cDNA fragmentation was done using Qsonica Sonicator
Q800R. A full description of methods is available in SI Materials and Methods.
Bacteria, plasmids, and primers used in this study are presented in Tables S1
and S2 and Dataset S5.
ACKNOWLEDGMENTS. This work was supported by National Institutes of
Health Grants R01 AI022535 (to G.B.P.), R37 AI021451 (to S.L.), and
AI26289 (to J.J.M.). D.R. was a recipient of grants from the AXA Research
Fund, the Fondation pour la Recherche Médicale, and the Société de Réan-
imation de Langue Française. D.R.Y.-H. was a recipient of a postdoctoral
fellowship from the Cystic Fibrosis Foundation.
17. Montor WR, et al. (2009) Genome-wide study of Pseudomonas aeruginosa outer
membrane protein immunogenicity using self-assembling protein microarrays. Infect
Immun 77(11):4877–4886.
18. Winsor GL, et al. (2011) Pseudomonas Genome Database: Improved comparative
analysis and population genomics capability for Pseudomonas genomes. Nucleic Acids
Res 39(Database issue):D596–D600.
19. Liberati NT, et al. (2006) An ordered, nonredundant library of Pseudomonas aerugi-
nosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103(8):
2833–2838.
20. Tenover FC, et al. (1995) Interpreting chromosomal DNA restriction patterns pro-
duced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin
Microbiol 33(9):2233–2239.
21. Mishra M, et al. (2012) Pseudomonas aeruginosa Psl polysaccharide reduces neutro-
phil phagocytosis and the oxidative response by limiting complement-mediated
opsonization. Cell Microbiol 14(1):95–106.
22. McConnell EL, Basit AW, Murdan S (2008) Measurements of rat and mouse gastro-
intestinal pH, fluid and lymphoid tissue, and implications for in-vivo experiments.
J Pharm Pharmacol 60(1):63–70.
23. Cattoir V, et al. (2013) Transcriptional response of mucoid pseudomonas aeruginosa
to human respiratory mucus. mBio 3(6): e00410-e00412.
24. Peña C, et al.; Spanish Network for Research in Infectious Diseases REIPI (2012) Pro-
spective multicenter study of the impact of carbapenem resistance on mortality in
Pseudomonas aeruginosa bloodstream infections. Antimicrob Agents Chemother
56(3):1265–1272.
25. Ocampo-Sosa AA, et al. (2012) Alterations of oprd in carbapenem-intermediate
and -susceptible strains of Pseudomonas aeruginosa isolated from patients with
bacteremia in a Spanish multicenter study. Antimicrob Agents Chemother 56(4):
1703–1713.
26. Cabot G, et al.; Spanish Network for Research in Infectious Diseases (REIPI) (2012)
Genetic markers of widespread extensively drug-resistant Pseudomonas aeruginosa
high-risk clones. Antimicrob Agents Chemother 56(12):6349–6357.
27. Hocquet D, et al. (2007) Pseudomonas aeruginosa may accumulate drug resistance
mechanisms without losing its ability to cause bloodstream infections. Antimicrob
Agents Chemother 51(10):3531–3536.
28. Wolter DJ, et al. (2008) Emergence of carbapenem resistance in Pseudomonas aeru-
ginosa isolates from a patient with cystic fibrosis in the absence of carbapenem
therapy. Clin Infect Dis 46(12):e137–e141.
29. Eren E, et al. (2012) Substrate specificity within a family of outer membrane car-
boxylate channels. PLoS Biol 10(1):e1001242.
30. Pirnay JP, et al. (2009) Pseudomonas aeruginosa population structure revisited. PLoS
ONE 4(11):e7740.
Skurnik et al.
Supporting Information
Skurnik et al. 10.1073/pnas.1221552110
SI Materials and Methods
Murine Model of Gastronintestinal Tract Colonization and Systemic
Dissemination by Pseudomonas aeruginosa. C3H/HeN mice (female
6–8 wk old) were housed in groups of four in sterilized cages
equipped with filter hoods. As described previously (1), mice
(n = 8) received streptomycin (2 mg/mL) and penicillin (1,500
UI/mL) in sterile drinking water for 5 d to reduce the levels of
the indigenous microbiota. The plasmid pSAMDGm (2), (3)
derived from pSAMBt (4) was used to create a TnSAMDGm
transposon (Tn) mutant library of 300,000 mutants in P. aerugi-
nosa PA14. One aliquot of the of PA14 Tn insertions library was
grown overnight in lysogeny broth (LB) (5) containing 15 mg
gentamicin/L and then added to sterile water containing peni-
cillin (1,500 UI/mL) and gentamicin (15 mg/L). The PA14 Tn-
insertion population was administered to mice via drinking water
for 6 d. To maintain the level of PA14 Tn insertions, the water
was changed after 72 h. After 6 d, the drinking water was ex-
changed for sterile water containing penicillin (1,500 UI/mL)
and gentamicin (15 mg/L) until the end of the experiment. Mice
were colonized in two different groups: the gastrointestinal (GI)
colonization group and the dissemination group. For ascertaining
the Tn insertions surviving the colonization period, mice (n = 4)
were euthanized and ceca harvested 24 h after the exchange for
sterile water. To induce systemic dissemination, mice (n = 4) were
injected on the same day sterile water was provided with 250 μg of
the neutrophil-depleting rat IgG2 monoclonal antibody RB6-8C5
that targets the Ly6G antigen. This dose of antibody renders mice
severely neutropenic (polymorphonuclear leukocyte counts <100)
for 5 d (1). When moribund (or 48 h after antibody injection),
neutropenic mice were killed and spleens harvested, homogenized
in LB containing 15 mg gentamicin/L and grown overnight at 37 °C.
Genomic DNA was extracted from each sample of the initial and
recovered bacterial populations using QIAamp DNA Mini Kit
(Qiagen), quantified, and stored at −20 °C.
DNA Preparation for Illumina Sequencing. Illumina libraries were
prepared as described (4) with the following exceptions: 20 μg of
DNA from all samples were used at the start of library prepa-
ration; DNA was concentrated using a Speed-vac before gel
loading and extraction; DNA from 1.2 to 1.5 kb was gel-extracted
for further processing; and Kapa BioSystems High Fidelity
Polymerase was used in the final PCR amplification step.
Determination of the Sequences at the Tn-Insertion Sites. All sequences
retrieved from the Illumina sequencing reactions were trimmed to
eliminate those reads with quality scores less than 0.05 and/or
sequences with ambiguous nucleotides. All trimmed sequences from
the LB and cecum and spleen output samples were mapped on the
annotated genome of P. aeruginosa strain PA14, from -120 nu-
cleotides (to include promoter regions) to the end of each ORF.
Ambiguous reads were excluded, and no mismatches were allowed
for the mapping.
Statistical Analysis. Data were analyzed using the RNA-sequencing
(RNA-seq) module of the Bioinformatics Workbench software
package (CLC; www.clcbio.com/index.php?id=1240). For each
Tn insertion, the significance of the difference in proportion of
reads from one environment to the other (LB to cecum and then
cecum to spleen) was estimated using the statistical test defined
by Kal et al. (6). The test is based on a statistical score Z that
follows a normal distribution under the null hypothesis of no
difference in proportions of read between the two environments
Skurnik et al. www.pnas.org/cgi/content/short/1221552110
that are compared. All P values were adjusted for multiple com-
parisons using Bonferroni correction.
Prevalence of the oprD Mutants in Water After 72 h. The bank of
PA14 mutants was suspended in water, and after 72 h, an aliquot
plated on LB with or without 3 μg imipenem/mL. The presence of
a Tn inserted in the oprD gene in the mutants able to grow on
imipenem-containing media was confirmed by PCR.
The prevalence of the Tn-oprD mutants in the water after 72 h
was determined by determining the ratio of the colony forming units
(cfu) growing on LB to the cfu growing on LB with imipenem.
Competitive Assays. To assess the in vivo fitness of PA14 mutants, we
obtained selected PA14 mutants from the PA14 Non-Redundant
Transposon Insertion Mutant Set (7). The insertion sites for each Tn
were confirmed by PCR. The GI tract decontamination described
above using penicillin-streptomycin in the drinking water was used
on four mice for each competition experiment. The drinking water
was replaced with penicillin water containing a 1:1 ratio of WT
PA14 and a single PA14 Tn-mutant (5 × 107 cfu/mL for each strain)
for 6 d. Mice were then given sterile drinking water with penicillin
alone, and 24 h later the mice were euthanized and the ceca har-
vested. Serial dilutions were plated on LB agar with or without
antibiotics. To evaluate the final ratio of PA14 mutants (gentamicin
resistant) and WT PA14 (gentamicin susceptible), the samples were
plated on LB agar and LB agar with 15 mg gentamicin/L. We
subtracted the cfu determined from the latter plates from those on
the nonselective plates to obtain the level of colonization with WT
P. aeruginosa PA14. This ratio was further confirmed by sub-
culturing 100 individual colonies that grew on the LB-agar plates on
plates with and without gentamicin. Analysis of the oprD gene by
PCR for each gentamicin-resistant colony confirmed that they were
oprD mutants and not spontaneous gentamicin-resistant strains. LB
agar with or without imipenem (3 mg/L) were used to distinguish
between the mutated oprD isolates from the WT oprD isolates,
when complemented strains (gentamicin resistant) were in compe-
tition with gentamicin-resistant mutants or when the two pairs of
clinical P. aeruginosa isolates, confirmed to be related by pulse-field
gel electrophoresis (PFGE) (see section PFGE), were in competi-
tion. The competitive index (CI) was defined as the ratio of cfu for
the mutant compared with the cfu obtained for the WT strain in the
output sample.
Selection of oprD Mutants from the PA14 Random Tn-Insertion Bank.
Homogenized spleens from the neutropenic mice were streaked
onto LB plates with gentamicin, and isolated colonies were
screened for a Tn insertion into the oprD gene by PCR amplifi-
cation of the entire oprD gene. Insertion of TnSAMDGm within
the oprD gene would result in a 1.7-kb increase in the size of the
1.8-kb PCR product obtained from the WT oprD gene. This al-
lowed us to identify Tn-oprD mutants in the spleen samples.
P. aeruginosa Clinical Isolates. Two pairs of clinical isolates, each
containing an imipenem-susceptible variant and an imipenem-
resistant variant, were used. These strains were isolated in 2011 at
the University Hospital, Caen, France. One pair was isolated
from the same stool specimen of a patient hospitalized in the
Hematology Department, whereas the second pair was isolated
from the same respiratory-tract specimen of a patient hospital-
ized in the medical intensive care unit. Sequencing of the oprD
genes confirmed that the imipenem-susceptible strains had a WT
oprD gene, whereas the imipenem-resistant isolates had mutated
oprD sequences. A total of 22 other clinical strains were also
1 of 8
selected from the same Institute. The level of oprD transcription
in these strains was determined by quantitative (q)RT-PCR. The
study was approved by the Institutional Review Board of the
Caen University Hospital, and informed consent was obtained in
accordance with the Declaration of Helsinki.
qRT-PCR. From bacteria grown to late-exponential growth phase in
LB, total RNA was extracted using the ZR Fungal/Bacterial RNA
MiniPrep Kit (Zymo Research) as recommended by the manu-
facturer. Residual chromosomal DNA was removed by treating
samples with the TURBO DNA-free kit (Life Technologies).
DNase-treated RNA samples were quantified using a BioSpec-
nano spectrophotometer (Shimadzu) and the integrity (RNA
Integrity Number > 8) was assessed using the Agilent 2100 Bi-
oanalyzer. qRT-PCR experiments were performed using the
QuantiFast SYBR Green RT-PCR Kit (Qiagen) and the CFX
Connect Real-Time PCR Detection System (Bio-Rad Labora-
tories) according to manufacturers’ recommendations. Tran-
script levels in each sample were determined using gyrB and oprL
as housekeeping reference genes. Each experiment was per-
formed in triplicate. Primers used are presented in Dataset S5.
PFGE. PFGE analysis of genomic DNA fragments of the clinical
isolates was carried out after digestion with the restriction en-
donuclease SpeI, the electrophoresis was performed with a
CHEF-DRIII apparatus (Bio-Rad), and PFGE patterns were
interpreted according to previously used criteria (8).
Outer-Membrane Protein Analysis. Bacterial outer-membrane pro-
teins (OMPs) were detected by SDS/PAGE as previously described
(9). Briefly, bacterial cells were broken by sonication, and mem-
branes were collected by ultracentrifugation at 100,000 × g for 1 h.
The inner membrane was solubilized with 1% sodium N-laur-
oylsarcosinate. Proteins in the outer membrane were separated by
SDS/PAGE and gels were stained with Comassie blue or Pierce
Silver Stain Kit (Thermo) for visualization.
Imipenem Etest. Minimal inhibitory concentrations of imipenem
were determined by using the Etest method (BioMérieux) ac-
cording to the manufacturer’s recommendations.
Construction of the P. aeruginosa PA14 oprD Knock-Out Mutant. The
oprD-deletion mutant (PA14 ΔoprD) was derived from WT PA14
using the replacement vector pEXG2 as described previously
(10). Two fragments flanking the oprD gene were amplified by
PCR with oprD_del primers (F1 and R1 for the upstream
fragment and F2 and R2 for the downstream fragment; Tables
S1 and S2) using chromosomal DNA of PA14 as template.
Overlap-extension PCR was used to assemble these segments in a
second reaction mixture by using upstream forward (oprD_del-F1-
HindIII) and downstream reverse primers (oprD_del-R2-XbaI).
The fusion product was cloned into pEXG2 as HindIII–XbaI
fragment, resulting in pEXG2-oprDdel, and transformed in Es-
cherichia coli Sm10λpir with selection on LB agar containing
gentamicin (15 mg/L). For the isolation of a PA14 ΔoprD mutant,
pEXG2-oprDdel was transferred from E. coli Sm10λpir into PA14
by conjugation, followed by selection of gentamicin-resistant PA14
colonies on LB agar containing gentamicin (15 mg/L) and irgasan
(25 mg/L). The merodiploid gentamicin-resistant PA14 strain was
then streaked on LB agar containing 6% sucrose. Sucrose-re-
sistant colonies were tested to confirm gentamicin susceptibility
that confirmed excision from the genome of the pEXG2 back-
bone. The oprD deletion was confirmed by PCR (Tables S1 and
S2), OMP analysis (Outer-Membrane Protein Analysis), and tested
for imipenem-resistance by Etest (Imipenem Etest).
Single-Copy Complementation of oprD Mutants. Complementation
was achieved by amplifying a 1.6-kb EcoRI–HindIII fragment
Skurnik et al. www.pnas.org/cgi/content/short/1221552110
containing the intact oprD gene from WT PA14 using the pri-
mers oprD_compF and oprD_compR. The oprD gene was
cloned into mini-CTX1 (11) as a EcoRI–HindIII fragment, re-
sulting in CTX1-oprD, and transformed into E. coli Sm10λpir
with selection on LB agar containing tetracycline (10 mg/L).
Following sequencing, CTX1-oprD was conjugated into the
P. aeruginosa oprD mutant strains as described above. The oprD
mutants complemented with CTX1-oprD were selected on LB
agar containing irgasan (25 mg/L) and tetracycline (75 mg/L).
Complementation was verified by PCR and OMP analysis and
tested for imipenem susceptibility by Etest.
Overexpression of the OprD in P. aeruginosa. To construct the OprD
overexpressing vector, the oprD gene from strain PA14 con-
taining its own Shine–Dalgarno sequences was cloned into
pMMB67EH using In-Fusion HD Cloning Kit (Clontech Labo-
ratories, Inc.), transformed into E. coli DH5α, and mobilized
into P. aeruginosa PA14. OprD protein was overexpressed at late
exponential growth phase by adding 2 mM (final) of isopropyl
thiogalactoside for 30 min at 37 °C.
Isolation of Tetracycline- and Streptomycin-Resistant Mutants. To
create a tetracycline-resistant variant of strain PA14, the tetA
gene was inserted between PA14_59170 and PA14_51960 on the
Pseusomonas aeruginosa Pathogenicity Island (PAPI)-1 island.
The PA14 streptomycin-resistant mutant was obtained by se-
lection during passage on LB agar plates containing increasing
concentrations of streptomycin.
Measurements of Growth Kinetic. P. aeruginosa strain PA14 WT,
Tn insertions in the oprD gene, Tn_oprD-6–4 and Tn_oprD-8–1,
the Tn_oprD::Spleen strain, and the Tn_oprD::Spleen strain
complemented with an empty vector [Tn_oprD::Spleen(EV)] or
with the cloned oprD gene [Tn-oprD::Spleen(PoprD)] were ini-
tially grown on LB agar, then cells from these plates were used to
inoculate LB medium that was placed at 37 °C with shaking at
250 rpm. The OD650 nm was recorded every 30 min.
Twitching Motility and Swarming Assays. Twitching motility was
assessed using 1.5% agar LB plates dried for 3 h at 37 °C. Strains
were inoculated at the very bottom of the LB plates and in-
cubated at 37 °C for 24 h and then left at room temperature.
Swarming assays were performed using fresh plates of M9 min-
imal medium supplemented with amino acids (0.5%), dextrose
(11 mM), CaCl2 (1 mM), and MgSO4 (1 mM) and solidified with
agar (0.5%).
pH Sensitivity. Strains were grown overnight in LB medium at 37 °C
for 20 h with shaking. Bacteria were diluted 1:200 to an OD650 nm
of 0.4 in HBSS+0.1% gelatin (∼5 × 105 cfu/mL), adjusted to pH 5
or pH 7 with HCl or sodium hydroxide, respectively, and in-
cubated for 60 min at 37 °C with rotation. Serial dilutions of the
samples were spread on LB plates and counted after overnight
growth at 37 °C.
Serum Killing. Strains were grows in LB harvested during early
logarithmic phase (OD650 = 0.4) and adjusted in physiological
saline to ∼2 × 106 bacteria per mL (dilution ∼1:100). Each strain
was incubated in pooled human serum (final concentration of
the sera: 50%) for 180 min at 37 °C with rotation. Serial dilutions
of the different samples were spread onto LB plates and cfu
counted after overnight growth at 37 °C.
Cytotoxicity Experiments. RAW264.7 cells (ATCC TIB-71) were
grown in DMEM supplemented with 2 mM L-glutamine, 100 U/mL
penicillin, 100 μg/mL streptomycin, and 10% heat-inactivated FBS.
Cells were maintained at 37 °C and 5% CO2. Host cells were
seeded in 24-well plates at a density of 2 × 105 cells per well in
2 of 8
drug-free media. The following day the cells were washed two
times with PBS and infected with P. aeruginosa strains that were
grown in LB until early logarithmic phase and washed with DPBS.
Multiplicity of infection of 20 or 100 were used. Cytotoxicity was
assessed using CytoTox 96 Non-Radioactive Cytotoxicity Assay
(Promega). Uninfected cells, as well as cells infected with the
PA14 ΔexoU strain, were used as negative controls. A positive
control (i.e., 100% death) were noninfected macrophages lysed
with Lysis Solution. Experiments were performed in quadruplicate
and repeated twice. Representative experimental results are shown
as means ± SD.
RNA Extraction and RNA-Seq of P. aeruginosa PA14 WT and PA14_Tn
oprD::Spleen. RNA was extracted from three independent repli-
cates of WT P. aeruginosa PA14, and the Tn-oprD::Spleen strain
grown to early log phase in LB. The RiboPure-Bacterial Kit
(Invitrogen) was used for RNA purification per manufacturer
1. Koh AY, Priebe GP, Pier GB (2005) Virulence of Pseudomonas aeruginosa in a murine
model of gastrointestinal colonization and dissemination in neutropenia. Infect
Immun 73(4):2262–2272.
2. Skurnik D, et al. (2013) A comprehensive analysis of in vitro and in vivo genetic fitness
of pseudomonas aeruginosa using high-throughput sequencing of transposon libraries.
PLoS Pathog 9(9):e1003582.
3. Dong TG, Ho BT, Yoder-Himes DR, Mekalanos JJ (2013) Identification of T6SS-
dependent effector and immunity proteins by Tn-seq in Vibrio cholerae. Proc Natl
Acad Sci USA 110(7):2623–2628.
4. Goodman AL, et al. (2009) Identifying genetic determinants needed to establish
a human gut symbiont in its habitat. Cell Host Microbe 6(3):279–289.
5. Bertani G (2004) Lysogeny at mid-twentieth century: P1, P2, and other experimental
systems. J Bacteriol 186(3):595–600.
6. Kal AJ, et al. (1999) Dynamics of gene expression revealed by comparison of serial
analysis of gene expression transcript profiles from yeast grown on two different
carbon sources. Mol Biol Cell 10(6):1859–1872.
Fig. S1. Growth curves in LB medium of WT P. aeruginosa PA14, mutants of PA14 with a Tn inserted in the oprD gene (PA14_Tn-oprD::Spleen, PA14_Tn-
oprD:8-1 and PA14_Tn-oprD:6-4), and PA14 oprD mutant strain complemented with an empty vector [PA14_Tn-oprD::Spleen(EV)] or the oprD gene [PA14_Tn-
oprD::Spleen(PoprD)].
Skurnik et al. www.pnas.org/cgi/content/short/1221552110
recommendations. DNaseI treatment was performed to remove
DNA traces. The quality of RNA was analyzed using NanoDrop
1000 (Thermo Scientific). An RNA-seq library was prepared
using Encore Complete Prokaryotic RNA-Seq DR Multiplex
Systems kit (NuGEN) according to manufacturer instructions.
cDNA fragmentation was done using Qsonica Sonicator Q800R.
Sequencing was performed using Illumina HiSeq2000 platform
in the Biopolymers core facility at Harvard Medical School. CLC
Genomics Workbench software was using to map RNA reads to
PA14 genomic DNA.
Circos Plot Figures. Circos figures were drawn following the instruc-
tions provided at www.circos.ca.
Ethics Statement. All animal studies conducted in this research
were approved by the Harvard Medical Area Institutional Animal
Care and Use Committee under protocol number 02791.
7. Liberati NT, et al. (2006) An ordered, nonredundant library of Pseudomonas aeruginosa
strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103(8):2833–2838.
8. Tenover FC, et al. (1995) Interpreting chromosomal DNA restriction patterns produced
by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin Microbiol
33(9):2233–2239.
9. Masuda N, Sakagawa E, Ohya S (1995) Outer membrane proteins responsible for
multiple drug resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother
39(3):645–649.
10. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP (1998) A broad-host-range
Flp-FRT recombination system for site-specific excision of chromosomally-located DNA
sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants.
Gene 212(1):77–86.
11. Hoang TT, Kutchma AJ, Becher A, Schweizer HP (2000) Integration-proficient plasmids
for Pseudomonas aeruginosa: Site-specific integration and use for engineering of
reporter and expression strains. Plasmid 43(1):59–72.
3 of 8
Fig. S2. (A) PFGE of clinical strains of P. aeruginosa. (B) oprD sequences from two pairs of isogenic clinical strains. The carbapenem-resistant strain 48-2 has
acquired the insertion sequence element IS Pa1328 (green highlighted portion) and the carbapenem-resistant strain 51-2 has a 12-bp deletion and a single
nucleotide change (yellow highlighted portions) in the oprD gene. M, molecular mass standard.

Fig. S3. Analysis of the OMP expression. OprD protein (arrow) is seen in the outer membrane extracted from WT P. aeruginosa PA14 in the clinical strains 48-1
and 51-1 and in the complemented (PoprD) strains. No difference in expression in the other OMPs from related strains was seen.

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 4 of 8

Fig. S4. Swarming of P. aeruginosa strain with intact oprD (strains PA14 WT and clinical strains 48-1 and 51-1), mutated oprD (strains PA14_Tn-oprD:6-4, 8-1,
and clinical strains 48-2 and 51-2), or complemented in trans with the oprD gene (PorpD).

Fig. S5. Twitching motility of P. aeruginosa strains with intact oprD (strains PA14 WT and clinical strains 48-1 and 51-1) mutated oprD (strains PA14_Tn-oprD:6-4, 8-1,
and clinical strains 48-2 and 51-2), or complemented in trans with the oprD gene (PorpD).

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 5 of 8

Fig. S6. Relative competitive fitness of P. aeruginosa PA14 WT strain versus antibiotic-marked PA14 strain for GI tract colonization. Error bars represent the
SD. strep R, streptomycin resistance; tet R, tetracycline resistance.

Fig. S7. Lack of a role for the empty vector in the fitness for the colonization of the GI tract of the mice. Competition in cecal colonization between WT
P. aeruginosa PA14, an oprD Tn-insert recovered from the spleen (PA14_Tn-oprD::Spleen), this oprD_ Tn-insert complemented by an empty vector [PA14_Tn-oprD::
Spleen (EV)], and this oprD Tn insert complemented with oprD gene [PA14_Tn-oprD::Spleen (PoprD)].

Fig. S8. Level of P. aeruginosa present in the ceca of mice singly colonized for 5 d by different strains of P. aeruginosa PA14: PA14WT, PA14 tet R, PA14
streptomycin resistance (strept R), and P14_Tn-oprD::Spleen.

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 6 of 8

Table S1. Bacterial strains and plasmids
Strain or plasmid Genotype or phenotype Source

Strains
E. coli
Sm10λpir thi-1 thr-1 leuB26 tonA21 lacY1 supE44 recA integrated RP4-2 Tc::Mu Kmr λpir Ref. 1
P. aeruginosa
PA14 Wild-type strain Ref. 2
PA14 oprD::Tn_6.4 GentR; oprD:: MrT7 at base 318 Ref. 3
PA14 oprD::Tn_6.4 poprD TetR; PA14 oprD::Tn_6.4 attB::CTX1-oprD This study
PA14 oprD::Tn_8.1 Gent; oprD:: MrT7 at base 1144 Ref. 3
PA14 oprD::Tn_8.1 poprD TetR; PA14 oprD::Tn_8.1 attB::CTX1-oprD This study
PA14 oprD::Tn_spleen GentR; oprD::himar, isolated from the spleen output This study
PA14 oprD::Tn_spleen poprD TetR; PA14 oprD::Tn_spleen attB::CTX1-oprD This study
PA14 oprD::Tn_cecum GentR; oprD::himar, isolated from the cecum output This study
PA14 oprD::Tn_cecum poprD TetR PA14 oprD::Tn_cecum attB::CTX1-oprD This study
48.1 ImiS; clinical isolate This study
48.2 ImiR; mutant derived from the strain 48.1, with the ΔISPa1328 inserted at bp 51 This study
relative to the start site of translation
48.2 poprD TetR; 48.2 attB::CTX1-oprD This study
51.1 ImiS; clinical isolate This study
51.2 ImiR-mutant derived from the strain 51.1, with a 12 bp deletion (bases 579–590) This study
and a point mutation at bp 1017 relative to the start site of translation
resulting in a stop codon
51.2 poprD TetR; 48.1 attB::CTX1-oprD This study
PA14ΔoprD PA14 derivative with an in-frame markerless deletion of oprD This study
PA14ΔoprD poprD TetR; PA14ΔoprD attB::CTX1-oprD This study
PA14 pilE::Tn Gent; pilE::MrT7 at base 46 Ref. 3
Plasmids
pSAM_Bt AmpR EryR; suicide delivery vector with mariner transposase himar1c9, Ref. 4
Illumina bridge PCR priming sites (P7), bla, ermG, rp4 oriT/oriR6K
pSAM_DGm AmpR GentR; pSAM_DYH with the gentamicin resistance cassette from pUC19Gm This study
cloned in as a MfeI/XbaI fragment
pEXG2-oprDdel GentR; 1.05 kb fragment composed of sequences flanking 5′ and 3′ ends of oprD, This study
cloned into pEXG2as a HindIII–XbaI fragment
CTX1-oprD TetR; oprD from PA14 cloned into mini-CTX1 at EcoRI–HindIII sites, This study
R R R R S R
Amp , ampicillin resistant; Ery , erythromycin resistant; Gent , gentamicin resistant; Imi , imipenem resistant; Imi , imipenem susceptible; Tet , tetracycline
resistant.

1. Miller VL, Mekalanos JJ (1988) A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in
Vibrio cholerae requires toxR. J Bacteriol 170(6):2575–2583.
2. Rahme LG, et al. (1995) Common virulence factors for bacterial pathogenicity in plants and animals. Science 268(5219):1899–1902.
3. Liberati NT, et al. (2006) An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103(8):2833–2838.
4. Goodman AL, et al. (2009) Identifying genetic determinants needed to establish a human gut symbiont in its habitat. Cell Host Microbe 6(3):279–289.

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 7 of 8

 Table S2. Primers
Name Sequence (5′–3′) Position*

Sequencing of oprD and its promoter region

oprD_F CACCTACGCAGATGCGACAT −185
oprD_R GTGACCTCGAACCTGAACAT +1575
oprD-int-F AGACCGCGACCGGCTTCCA +472
oprD-int-R TGGAAGCCGGTCGCGGTCT +491
Deletion of oprD
oprD_del-F1-HindIII AGCGCGAAGCTTAACAGGAGACATGCCGTGGATA −522
oprD_del-R1 TGCCGGGTTTTTTCGTTGCCTGTCGGTCGACACTTTCATTGTGATTGCTCCT +22
oprD_del-F2 AGGAGCAATCACAATGAAAGTGTCGACCGACAGGCAACGAAAAAACCCGGCA +1332
oprD_del-R2-XbaI GCATTGTCTAGAGCCGGTCTGGCTGCGTACAG +1858
Cis complementation of oprD
oprD_compF CCGGAATTCAACTGCTCACCTACGCAGATGCG −192
oprD_compR CGCCCAAGCTTTGGCCCATGTGACCGGTACCTATG +1433
Confirmation of Tn inserts
PA14_pilE_compF CCGGAATTCATGAACCCCTTACGTCTTCTCGCC
PA14_pilE_compR CGCCCAAGCTTTTGCCTTTTTCTTGTCTCGGCGC

Restriction sites are underlined. F, forward; R, reverse.

*Position according to the first nucleotide of the oprD coding sequence.

Other Supporting Information Files

Dataset S1 (XLSX)
Dataset S2 (XLSX)
Dataset S3 (XLSX)
Dataset S4 (XLSX)
Dataset S5 (XLSX)

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 8 of 8