Você está na página 1de 6

Diversidade de uma populao de Bacillus resistentes a cloro isolados de uma estao de tratamento de esgoto.

Resumo
Esse artigo descreve a diversidade genotpica e fenotpica de uma populao de bactrias aerbicas Gram positivas isoladas do tanque de cloro de uma estao de tratamento de esgoto. Um total de 12 isolados formadores de endsporos em formato de basto foram identificados utilizando o sequenciamento do 16S rRNA e testes bioqumicos. Comparaes gnicas revelaram que as sequncias obtidas dos isolados variavam de 92,6% a 100%. Pesquisas de similaridade no GenBank mostraram que cinco cepas eram extremamente idnticas a Bacillus subtilis (99~100%) e duas eram quase idnticas a B. megaterium e B. licheniformis. As outras cinco eram prximas ou idnticas a B. cereus, B. thuringiensis e B. anthracis (97~99%) e, por isso, foram agrupadas como B. cereus. Com exceo de uma cepa, todos os clados na rvore filogentica eram idnticos aos ramos formados no dendrograma feito a partir do resultado dos testes bioqumicos. De acordo com os perfis bioqumicos, todos os isolados foram caracterizados como cepas diferentes. Alm da resistncia ao cloro, todas as cepas eram resistentes a pelo menos um dos cinco antibiticos testados. Esses resultados indicam um risco em potencial da propagao de genes de resistncia a antibiticos no ambiente pelas cepas de Bacillus resistentes ao cloro.

Introduo
A disponibilidade de gua est em ritmo decrescente graas crescente presso por fontes de gua pura. Consequentemente, o reuso da gua se tornou uma alternativa sustentvel especialmente em regies ridas com o nordeste do Brasil. Apesar da gua reciclada ser usada globalmente para irrigao agrcola e aplicaes industriais, uma srie de polticas e regulamentaes no reuso da gua foram estabelecidas para ajudas a proteger o meio ambiente dos efeitos adversos em potencial do que antes estava contaminado. O tratamento convencional de esgoto feito a partir da combinao de mtodos fsicos, qumicos e biolgicos com a desinfeco por cloro como ltimo passo do processo. Cloro um dos agentes bactericidas mais usados no tratamento de gua contaminada visto que fcil manipulao, baixo custo e eficcia bem conhecida. Apesar da desinfeco por cloro ser usada para destruir ou inativas organismos patognicos de origem fecal, o mesmo no garante a esterilizao de todos os organismos ali presentes. As bactrias pertencentes ao gnero Bacillus so aerbicas ou anaerbicas facultativas, Gram positivas ou variveis e formam endsporos que exibem resistncia a estresse ambiental. Membros desse gnero so importantes para atividade humana

devido sua alta gama de aplicaes agrcolas, industriais e mdicas. Algumas cepas de Bacillus foram usadas para produo de antibiticos, enzimas e solventes; probiticos; e inseticidas. No entanto, algumas espcies como B. anthracis e B. cereus constituem uma ameaa sade pblica e ao bem-estar. A singularidade dos Bacillus est em sua capacidade de produzir endsporos que podem sobreviver desidratao, calor, frio e ainda serem capazes de germinar. Alm disso, Bacillus apresentam um alto grau de plasticidade gentica que os permite colonizar uma vasta gama de habitats, incluindo esgotos e gua contaminada. Apesar da maioria dos seres vivos serem neutralizados durante o tratamento, microrganismos resistentes a esse processo podem sobreviver e representam um risco em potencial quando liberados ao meio ambiente. Foi revelado que bactrias podem desenvolver resistncia aos agentes utilizados no tratamento de gua entre eles o cloro e o dicloroisocianurato de sdio. Foi sugerido que os organismos resistentes a cloro seriam capazes de produzir enzimas funcionais enquanto a maior parte destas seria desativada em virtude do estresse ambiental. Na literatura, as comunidades microbianas associadas aos sistemas de tratamento de gua foram estudadas atravs de dois pontos de vistas. Do ponto de vista ecolgico, os pesquisados esto interessados em: 1 Avaliar o efeito da gua reciclada no ambiente; 2 Determinar as populaes microbianas que podem ocorrer nesses sistemas e sua diversidade. 3 Associar essas populaes a seu respectivo papel no ambiente 4 Determinar a resistncia ao tratamento e a perspectiva da sade pblica. Os pesquisadores esto interessados em determinar a identidade, patogenicidade e resistncia ao tratamento dos isolados relacionados ao reuso da gua. Considerando que os sistemas de tratamento esto gradualmente selecionando e liberando microrganismos resistentes a cloro de volta para o ambiente, o principal objetivo desse estudo foi a identificao e caracterizao das populaes isoladas resistentes a cloro encontradas nos tranques as estaes de tratamento do nordeste brasileiro.

Materiais e mtodos
Microrganismos. As 12 cepas estudas (LAMI 002 at LAMI 013) foram isoladas em uma estao de tratamento de esgoto no Campus Pici na Universidade Federal do Cear, Brasil. As amostras foram coletadas em triplicata da coluna de gua dos tanques de cloro em frascos estreis e imediatamente transportadas para o laboratrio em um refrigerador. Para selecionar as bactrias esporulantes, as amostras foram aquecidas

por 10 minutos a 80C. Posteriormente, 10 diluies em srie foram preparadas usando uma soluo salina estril tamponada com fosfato (pH 7.2) e meio de cultura TSA (Tryptone Soya Agar). Aps incubao por 48 horas a 35C, uma variedade de colnias divergindo em cor, formato, aparncia e tamanho foram selecionadas e inoculadas em TSA. As colnias foram armazenadas a -80C para posterior identificao. Todas as cepas avaliadas nesse estudo foram mantidas na coleo bacteriana do LEMBiotech na UFC. Sequenciamento. O material gentico bacteriano foi extrado atravs do mtodo CTAB (brometo de cetiltrimetilamnio). O rRNA 16S foi amplificado por PCR usando os primers 27F (Para frente: 5 AGAGTTTGATCCTGGCTCAG - 3) e o 1525R (Para trs: 5 AAGGAGGTGATCCAGCC 3) como descrito por Weisburg et at. As reaes de amplificao foram executadas em um volume final de 25 microlitros contendo 300 ng de DNA genmico; 20 mM Tris-HCl, pH 8.4; 50 mMKCl; 1,5 mM MgCl2; 200 micromolar de 2-dixiadenosina-5-trifosfato, 2-dixicitidina-5-trifosfato, 2dixiguanosina-5-trifosfato e 2-dixitimidina-5-trifosfato, 12,5 pmols de cada primer e 1 unidade de Taq DNA polimerase. Todas as reaes do PCR foram conduzidas usando um termociclador PTC-200 programado para uma desnaturao inicial de 4 minutos a 94C seguida por 35 ciclos de 1 minuto a 94C, 1 minuto a 55C e 2 minutos a 72C. O ltimo ciclo foi seguindo por uma extenso de 10 minutos a 72C. A amplificao do DNA foi verificada por eletroforese em gel de agarose a 1%. Aps a confirmao, o produto do PCR foi purificado usando GFX PCR DNA e um kit gel de purificao de bandas. A concentrao do produto do PCR purificado foi mensurada pela absorbncia a 260nm. O sequenciamento do DNA foi executado atravs de um kit de sequenciamento gnico DYEnamic ET e ambas as fitas foram sequenciadas usando primers 27F, 1525R, 782R (5 ACCAGGGTATCTAATCCTGT - 3) e 1100R (5 AGGGTTGCGCTCGTTG 3). As reaes de sequenciamento foram analisadas atravs de um sequenciador automtico MegaBACE 1000. Leituras de alta qualidade (pred > 20) foram usadas para gerar as sequncias quase completas do gene 16S do rRNA usando um pacote Phred/Phrap/Consed. Todas as sequncias foram depositadas no GenBank (Nmeros de acesso: EU082292 E FJ413043-FJ413053). Anlise filogentica. Foram feitas buscas por sequncias homlogas foram feitas usando o programa BLAST (Basic Local Alignment Search Tool). As sequncias obtidas nesse estudo foram alinhadas a sequencias sequncias do gene 16S do rRNA de Bacillus obtidos do GenBank. Todas as sequncias foram das seguintes espcies (para aqueles derivados das sequncias genmicas, a regio genmica correspondente ao gene 16S rRNA mostrado aps o nmero de acesso): Cepas de B. amyloliquefaciens FZB42 (CP000560; 9760-11314), [...].

As sequncias gnicas do 16S rRNA de Lactobacillus casei [...] foram obtidas do GenBank e utilizadas como grupos externos. O alinhamento das sequncias foi produzido e editado manualmente pelos programas ClustalW e BioEdit 7.0.5 respectivamente. O alinhamento mltiplo foi ento utilizado para gerar uma rvore filogentica atravs do programa MEGA 4.0. O mtodo Neighbor-Joining foi empregado utilizado usando o parmetro Kimura 2 de sequncia de evoluo para calcular as distncias. A estabilidade dos clados recuperados foi avaliada pelo teste de inicializao usando 1000 rplicas. Todas as posies contendo falhas e informaes ausentes foram eliminadas. [IMAGEM DA RVORE FILOGENTICA] Caracterizao fenotpica. A caracterizao fenotpica das cepas foi alcanada usando os mtodos microbiolgicos tradicionais disponveis em Bergeys Manual of Systematic Bacteriology. As seguintes caractersticas fenotpicas foram selecionadas como critrio: Morfologia da colnia (tamanho, forma e pigmentao), morfologia da clula (Teste de Gram, tamanho, forma e presena de endsporo e motilidade), testes de catalase e oxidase, interferncia do oxignio no crescimento, fermentao de carboidratos, produo de indol (composto aromtico heterocclico do grupo amina), teste de Voges-Proskauer (determina a capacidade dos microrganismos de produzirem produtos metablicos neutros a partir do metabolismo da glicose), uso do citrato como fonte de carbono, tolerncia ao sal (crescimento em presena de at 10% de NaCl), pH (crescimento de 2 at 12), termotolerncia (de 5 a 55 C) e resistncia a hipoclorito (crescimento em presena de at 10000mg/L de hipoclorito de sdio). Todos os isolados foram testados quanto a sua capacidade de produzir amilase, gelatinase, caseinase, esterase, lcool desidrogenase, lipase, quitinase, hemolisina e biossurfactantes. A sensibilidade a 5 antibiticos (amoxacilina, cloramfenicol, eritromicina, tetraciclina e vancomicina) tambm foi testada. Uma anlise bioqumica em blocos foi executada usando o coeficiente de similaridade euclidiano do Paleontological Statistics Software.

Resultados e discusso
As populaes isoladas dos tanques de cloro da estao de tratamento de esgoto estudadas so compostas por organismos principalmente clulas em forma de basto gram-positivas, aerbicas e capazes de esporular. As sequncias quase completas do gene 16S rRNA foram determinadas em todas as cepas e o tamanho variava de 1255 pares de base (cepa LAMI 007) at 1481 pares de base (LAMI 008). A comparao por pares excluindo os sites com falhas revelou que as sequncias tinha ndice de similaridade variando de 92,6% (sequncias das cepas LAMI 003 e LAMI 012) a 100% (entre as sequncias das cepas LAMI 002 e LAMI 005). Buscas por similaridade

no GenBank usando BLAST mostraram que as sequncias de 5 cepas (LAMI 002, 003, 005, 008 e 009) eram relacionadas (de 99 a 100% de semelhana) s sequncias gnicas do 16S rRNA de diferentes cepas de Bacillus subtilis. Por outro lado, as sequncias das cepas LAMI 007 e 011 eram quase idnticas (99%) a espcies homlogas de cepas de Bacillus megaterium e Bacillus licheniformis respectivamente. As outras 5 cepas (LAMI 004, 006, 010, 012 e 013) eram muito prximas ou idnticas (97 a 99%) s sequncias correspondentes de cepas de Bacillus cereus, Bacillus thuringiensis e Bacillus anthracis. Logo, as 12 cepas foram classificadas como sendo Bacillus megaterium (LAMI 007), Bacillus licheniformis (011), Bacillus subtilis (002, 003, 005, 008 e 009) e Bacillus cereus (004, 006, 010, 012 e 013). Ademais, a rvore Neighbor-Joining (Figura1), derivada do alinhamento de 65 sequncias gnicas do 16S rRNA, mostraram que 4 ramos principais se agruparam como B. subtilis, B. licheniformis, B. megaterium e B. cereus. O estudo revelou que a caracterizao do 16S rRNA sozinha no foi suficiente para identificar todos os Bacillus isolados. achado que as cepas relacionadas ao grupo de B. cereus evoluram a partir de um ancestral comum e tem as sequncias do 16S virtualmente idnticas entre si, o que dificulta a caracterizao molecular das cepas estudadas. Baseando-se nessa similaridade genotpica, o grupo de B. cereus inclui B. cereus, B. anthracis, B. thuringiensis, B. pseudomycoides, B. weihestephanensis e B. mycoides. At a data, a taxonomia dessas espcies foi baseada na anlise das caractersticas morfolgicas, bioqumicas, fisiolgicas e imunolgicas. Entre essas espcies, B. thuringiensis se diferencia de B. cereus por produzir uma toxina plasmtica, j B. anthracis se diferencia de B. cereus e B. thuringiensis pela produo de toxina. Apesar de ser conhecido que alguns plasmdeos possam ser perdidos atravs da cultura em laboratrio, foi demonstrada previamente a transferncia de plasmdeos codificantes de toxina entre cepas de B. cereus cultivadas em B. thuringiensis, confirmando a possibilidade de transferncia gnica entre diferentes espcies de Bacillus. Pesquisadores continuam procurando aprimorar a diferenciao entre as bactrias do grupo de B. cereus. Pela anlise dos perfis bioqumicos e fisiolgicos, os 12 isolados foram caracterizados em diferentes cepas. A caracterizao fenotpica geral mostrada nas tabelas 2 e 3. De acordo com esses resultados, as cepas que esto mais relacionadas pela anlise das sequncias do 16S exibiram diferentes perfis bioqumicos e fisiolgicos. No entanto, exceto a cepa 0006, os clados formados pelo sequenciamento do 16S na rvore filogentica eram idnticos aos grupos formados no dendrograma baseado nos perfis bioqumicos das cepas. Essa descoberta mostra que o grupo de B. cereus e B. megaterium compartilham algumas similaridades e pertencem a um grupo diferente do que formado por B. subtilis e B. licheniformis.

Esse estudo tambm mostra que os mtodos qumicos tradicionais de desinfeco de esgoto atravs do cloro no so eficientes na eliminao de bactrias formadoras de endsporo, incluindo Bacillus potencialmente patognicos. Os endsporos esto entre as formas bacterianas mais resistentes a antisspticos e desinfetantes por causa da presena da membrana externa que impede a penetrao de vrios biocidas. Em adio, o ambiente interno do esporo, com baixa quantidade de gua e pH, tambm pode contribuir para sua resistncia. Como resultado do tratamento de esgoto, a maior parte das bactrias patognicas removida ou inativada, mas os microrganismos resistentes a essa desinfeco podem persistir e se disseminar no ambiente aqutico. Alm disso, vrios desses organismos carregam genes de resistncia a antibiticos e, quando esse tipo de gene produzido, o mesmo pode ser liberado nos ecossistemas naturais onde as bactrias no patognicas poderiam servir como reservatrio de genes de resistncia. Nesse estudo, as cepas testadas (004, 005, 006, 010, 011 e 012) eram resistentes a pela menos 1 dos 5 antibiticos testados (TABELA 4). Apenas de ser essencial considerar a disseminao de microrganismos resistentes a cloro e antibiticos pelos sistemas de tratamento de esgoto, tambm necessrio considerar a aplicabilidade dessas bactrias resistentes ou de seus produtos na biotecnologia. Microrganismos so uma fonte em potencial para o desenvolvimento de enzimas altamente otimizadas sob as condies fsico-qumicas que aquele organismo habita. As cepas de Bacillus estudadas eram capazes de crescer em uma alta gama de temperaturas (5 a 50 C), pH (3 a 12), concentraes de sal (2 a 10%) e suportavam concentraes de hipoclorito de at 5000mg/L. Em adio, algumas cepas produziam biossurfactantes, que so compostos tensoativos de grande aplicabilidade alimentcia, agroqumica, cosmtica e farmacutica. Com a exceo de LAMI 006 e 011, todas as cepas mostraram significante capacidade de emulsificao. Foi notvel a capacidade da cepa LAMI 008 de produzir surfactina usando suco de caju como substrato, para a degradao de hidrocarbonetos do petrleo usando esporos bacterianos encapsulados em microesferas de quitosana como j demonstrado.

Concluso.
Esse estudo mostra que os Bacillus patgenos de origem humana e animal podem sobreviver desinfeco tradicional por cloro, minando o usado dessa gua para certos fins como irrigao agrcola sem algum tratamento adicional. O principal risco envolve a proliferao de organismos patognicos e os genes de resistncia a antibiticos no ambiente. Os isolados analisados so pertencentes de um diverso grupo de Bacillus com perfis bioqumicos distintos, apesar de compartilharem alguma similaridade gentica. Em adio, os isolados mostraram potencial biotecnolgico para uso na produo industrial de enzimas de biossurfactantes.