J Mol Evol (1998) 46:64–73
© Springer-Verlag New York Inc. 1998
Organization and Nucleotide Sequence of the Cluster of Five Histone Genes
in the Polichaete Worm Chaetopterus variopedatus: First Record of a H1
Histone Gene in the Phylum Annelida
Rosanna del Gaudio, Nicoletta Potenza, Patrizia Stefanoni, Maria L. Chiusano,* Giuseppe Geraci
Department of Genetics, General and Molecular Biology, University of Naples Federico II, Via Mezzocannone, 8, 80134 Naples, Italy
Received: 23 April 1997 / Accepted: 21 July 1997
Abstract. Histone genes were identified and their
nucleotide sequences were determined in the polychaete
marine worm Chaetopterus variopedatus. The genes are
organized in about 390 clusters of 7.3 kbp. Each cluster
contains one copy of the five histone genes. The H1
histone gene present in the clusters is the first ever iso-
lated in the phylum Annelida. The cluster has the unique
peculiarity that all genes contain both the replication-
dependent and the replication-independent 38 mRNA ter-
mination signals. Despite the differences in cluster orga-
nization and transcription polarity of the individual
histone genes between C. variopedatus and Platynereis
dumerilii, the other annelid in which histone genes have
been studied, phylogenetic analysis of the encoded
amino acid sequences clearly groups together those two
organisms in a tree in which the other studied worms find
closely related positions on the same evolutionary
branch.
Key words: C. variopedatus — Nucleotide sequence
— Annelida — Polychaete — H1 gene — Histone gene
cluster — mRNA double termination signal — Phylo-
genesis
* Present address: CRISCEB, Center of Research for Computational
and Biotechnological Sciences, II University of Naples, Via Costanti-
nopoli 16, 80138, Napoli, Italy
Correspondence to: G. Geraci; e-mail geraci@dgbm.unina.it
Introduction
Histones are basic proteins that associate with each other
and with nuclear DNA to form the eukaryotic chromatin.
There are five histone types. Four of them, H3, H4, H2A,
and H2B, form an octameric structure, the nucleosome
‘‘core,’’ that is, the fundamental unit of chromatin. The
fifth histone, H1, participates in the formation of higher-
order chromatin structures.
Histones are among the most conserved proteins, and
their genes and the corresponding frameworks of ar-
rangements have been conserved over vast expanses of
evolutionary time (Miller et al. 1993). Due to their dif-
fusion in eukaryotes and to their characteristics, histones
are considered to represent a model system for the study
of structure, organization, and expression of multigene
families, providing potentially interesting markers for
evolutionary studies and for resolving phylogenetic rela-
tionships (Hentschel and Birnstiel 1981; Maxson et al.
1983a). A number of variant histone proteins are known
to be expressed in specific tissues at specific stages of
embryonic development (Brandt et al. 1979) and at par-
ticular periods of the cell cycle (Shumperli 1986; Osley
1991).
Studies of histone genes and of their organization in a
variety of organisms have shown the occurrence of two
fundamental arrangements. In one, the five histone genes
are clustered, the clusters are repeated in tandem, and the
sequences of the repeated clusters are generally strongly
conserved. In the other, histone genes are dispersed in
the genome in single genes or in incomplete clusters. The
first type of organization is present in the insect Dro-

sophila melanogaster (Lifton et al. 1977), in the trout
Salmo gairdnerii (Connor et al. 1984), in the newt No-
tophtalmus viridiscens (Stephenson et al. 1981), and in
various sea stars (Howell et al. 1987; Cool et al. 1988).
The second type of organization is present in the nema-
tode C. elegans (Roberts et al. 1987) and in some verte-
brates like chicken (Engel and Dodgson 1981), mouse
(Sittman et al. 1981), and human (Albig et al. 1991). In
sea urchins (Maxson et al. 1983b; Angerer et al. 1985)
and in Xenopus laevis (Zernik 1980; Ruberti et al. 1982)
both histone gene arrangements are observed. At present,
in the phylum Annelida, histone genes have been char-
acterized only in the polychaete worm Platynereis
dumerilii (Sellos et al. 1990). Histone gene clusters have
been characterized also in the worm Urechis caupo (In-
gham and Davis 1988; Davis et al. 1992) belonging to
the closely related minor phylum of Echiuroid. In these
two organisms the core histone genes are organized in
repeated clusters that do not contain the H1 histone gene
and this has not been found elsewhere in their genomes.
We have undertaken the characterization of the his-
tone genes in the annelid polychaete marine worm Chae-
topterus variopedatus as an extension of our work on
histone H1 and protamine—the two molecules that or-
ganize the sperm chromatin of this organism (De Petro-
cellis et al. 1983). We show here that in C. variopedatus,
differently than in the other polichaete annelid P. dumer-
ilii, histone genes are organized in clusters also contain-
ing histone H1. We report their complete nucleotide se-
quences. Differences between the histone gene clusters
of C. variopedatus and the other studied annelid concern
also the organization of the genes and their transcription
polarity. Interestingly, C. variopedatus histone gene
clusters have the unique peculiarity that all genes have
two termination signals for the mRNA in their 38 un-
translated regions (38-UTR): the stem-loop–forming pal-
indrome sequence, with the associated purine-rich motif,
typical of the mRNA of replication-dependent genes, ex-
pressed in a strict correlation with the S-phase of the cell
cycle, and the AATAAA polyadenylation signal typical
of the replacement basal replication-independent histone
variants, some of which contain introns, producing stable
polyadenylated mRNAs not linked to the cell cycle
(Hentschel and Birnstiel 1981; Birchmeier et al. 1982).
Materials and Methods
General Methods. Annelid worms C. variopedatus were kindly pro-
vided by the Zoological Station of Naples (Italy). Specimens were
collected in the bay of Naples in the month of June, when they are
sexually active. Sperm cells were obtained from the parapods of a
single male as described (De Petrocellis et al. 1983) and purified with
several centrifugations in Millipore-filtered sea water. Sperm cells were
lysed in 0.5 M EDTA, 2% SDS, and DNA was extracted and purified
as described (Blin and Stafford 1976).
Construction of Genomic Library. Genomic DNA (10 mg) was
digested to completion with different restriction enzymes to search for
65
fragments possibly containing the complete cluster of histone genes.
Digestion with PstI generated a DNA band, corresponding to fragments
averaging 7.5 kbp in length, that was positive to hybridization using as
probes the different early histone genes of the sea urchin P. lividus,
obtained from the plasmid pPH70 (a gift of G. Spinelli, University of
Palermo). PstI-restricted genomic DNA (10 mg) was fractionated by
electrophoresis on 0.8% (w/v) agarose slab gel in TBE buffer (0.089 M
Tris, 0.089 M sodium borate, 0.009 M EDTA, pH 8.3); the agarose gel
slice containing the PstI fragments of interest was excised from the
slab; and DNA fragments were electroeluted. A genomic library of
these fragments was constructed in pBR322 vector (Promega) using
standard procedures (Maniatis et al. 1982) with the following modifi-
cations: the molecular ratio in the ligation reaction was 2:1 (vector:
DNA insert) and the final reaction volume was 100 ml. The products of
the T4 DNA ligase (Boehringer, Mannheim) were used to transform
CaCl2-competent E. coli HB101 cells. Clones positive to colony hy-
bridization were detected using as a probe the sea urchin early H1
histone gene previously labeled with [32P]-dCTP (3,000 Ci/mmol, Am-
ersham) using the Multiprime DNA labeling system (Amersham).
Clones showing the strongest hybridization signal with the H1 histone
gene after washing to moderate stringency were used for further stud-
ies. The clones were amplified and their DNA inserts were excised and
analyzed by hybridization with each of the early heterologous sea ur-
chin histone genes. The hybridization procedure was as follows. Filters
were prehybridized for 6 h at 65°C in 5× SSPE (150 mM NaCl, 10 mM
Na phosphate, 1 mM EDTA, pH 7.4), 0.1% SDS, 5× Denhardt’s solu-
tion (0.02% bovine serum albumin, 0.02% Ficoll, 0.02% polyvinylpyr-
rolidone), and 100 mg/ml denatured herring sperm DNA. The labeled
probe was then added and hybridization was carried out for 16–18 h at
60°C in the same solution. Filters were then sequentially washed in 2×
SSPE, 0.1% SDS for 5 min at room temperature, for 20 min at 60°C,
and finally in 1× SSPE, 0.1% SDS for 30 min at 60°C. Hybridization
was revealed by exposing Fuji RX film, with intensifying screens, to
the filters at −70°C.
Restriction and Hybridization Analysis of Positive Clones. The
gene maps of the inserts of the selected clones were initially derived
from a set of single and double restriction analyses with PstI, SacI,
BamHI, and EcoRI performed in the conditions specified by the manu-
facturer (Boehringer, Mannheim). Digestion products (125 ng of plas-
mid DNA) were separated by electrophoresis on 1% (w/v) agarose gel
in TBE buffer. The presence of the histone genes in the various frag-
ments of the inserts was established by Southern blot hybridization of
the digests with each of the heterologous sea urchin probes previously
labeled with [32P]-dCTP, as described above, using the Multiprime
DNA labeling kit. Sequence studies were performed on three clones,
3D, 6B, and 8D, and the complete sequences of all five histone genes
was determined on clone 8D.
Plasmid Subcloning and DNA Sequencing. The restriction frag-
ments identified with the heterologous sea urchin probes (see previous
section) were separated on low-melting agarose gel. Each band of
interest was excised from the gel; the DNA was electroeluted and
cloned into appropriately cleaved Bluescript KS and SK plus and minus
vectors (Stratagene). Ligation products were used to transform com-
petent E. coli Tg1 cells that were selected for AMP R: lac− phenotypes.
DNA sequences were determined on both strands of the inserts by the
Sanger method using a modified T7 DNA polymerase kit (Sequenase
version 2.0, Amersham) on double-stranded DNA plasmid, prepared
using Quiagen columns or on single-stranded DNA plasmid produced
with M13 K07 helper phage. The electrophoretic analyses of the se-
quencing reactions were performed with two successive loadings on
6% acrylamide/bisacrylamide (38:2) gel using the Sequi-Gen II appa-
ratus (Bio-Rad). Histone coding sequences of the analyzed DNA frag-
ments were identified using BLAST and PC-gene programs by com-
paring encoded amino acid sequences of all open reading frames with
the protein sequences in the databases.
66
Copy Number of Histone Genes. The copy number was determined
by comparing the relative radioactive intensity of the bands containing
the fragments, averaging 7.5 kbp obtained by PstI restriction of geno-
mic DNA, with the radioactive intensity of the insert of plasmid 8D
obtained by hydrolysis of the plasmid with the same restriction nucle-
ase. A set of increasing amounts of the two hydrolyzed DNA samples
were analyzed by electrophoretic separation in adjacent lanes on 0.8%
(w/v) agarose slab gels in TBE buffer. Southern blots of the slabs after
electrophoretic fractionations were sequentially hybridized with three
different homologous histone gene probes derived from clone 8D, pre-
viously labeled with [32P]-dCTP using the Multiprime labeling system.
The amount of DNA loaded in each lane is specified in the legend of
Fig. 3. The results show the occurrence in the genomic DNA of C.
variopedatus of a unique band, of about 7.5 kbp, that hybridizes with
each of the individual gene probes. The amount of bound radioactive
probe in the different lanes was determined both by using the Phos-
phorImager Scanner (Molecular Dynamics) and by comparing the rela-
tive intensity of the radioactive bands on Fuji RX films exposed to the
filters for appropriate lengths of time at −70°C.
Phylogenetic Analysis of the Encoded Histone Molecules. The com-
putational analyses were performed separately on H2A and H2B
C. variopedatus histone genes to determine their relative positions in
phylogenetic trees. The amino acid sequences encoded in the two genes
were compared with those of the corresponding types obtained from the
histone dedicated data bank created by Baxevanis and Landsman at the
National Center for Biotechnology Information (see Fig. 4). The analy-
ses were performed producing multiple alignments and generating phy-
logenetic trees by the neighbor-joining method (Saitou and Nei 1987)
of Clustal W, version 1.6 (Thompson et al. 1994). Trees were plotted
with Phylip, version 3.5c (Felsenstein 1982, 1988).
Results
Construction of the Genomic Library and Isolation
of Clones
The possibility of the occurrence of gene clusters con-
taining all five histone genes was investigated by per-
forming Southern blot analysis of the genomic DNA di-
gested with various restriction enzymes. Hybridization
experiments, performed using the five different sea ur-
chin histone gene probes obtained from the plasmid
pPH70, showed that PstI digestion produced a single
band of about 7.5 kbp that hybridized with all heterolo-
gous probes (see Fig. 3, showing the determination of the
histone genes copy number). The gel band containing the
fragments hybridizing with the sea urchin histone gene
probes was excised from the slab; the fragments were
electroeluted and cloned in pBR322 vector. Clones con-
taining the histone gene cluster were identified by colony
hybridization and amplified to analyze the insert DNA.
Electrophoretic analysis on agarose gel of 25 positive
clones showed that the inserts had average value of about
7.5 kbp, with some length heterogeneity ranging between
about 7 and 8.5 kbp. Five of these clones were analyzed
by hybridizing their excised inserts with each of the five
sea urchin histone genes used as probes. The results of
these hybridization experiments (data not shown) con-
firmed the data obtained on genomic DNA demonstrat-
Fig. 1. Histone gene cluster in clone 8D of C. variopedatus. A Re-
striction map with enzymes used for sequence determination and gene
mapping. B Organization of histone genes. The arrows indicate the
direction of gene transcription. P, PstI; D, DraII; V, EcoRV; E, EcoRI;
S, SacI; X, XhoI; A, AccI.
ing that also the cloned clusters of histone genes of C.
variopedatus contain all histone types, including H1.
Restriction and Hybridization Analysis of Clone 8D
The restriction map (Fig. 1A) shows the enzymes used to
map genes and to produce clones for sequence determi-
nation. The map concerns clone 8D as a representative of
the five clones that were initially chosen for the sequence
analysis. EcoRI and SacI restriction enzymes were used
because data on genomic DNA showed that they cut in
the histone gene cluster. There is a site for BamHI only
in the vector and this was used as an asymmetric site
useful to orient the fragments obtained by SacI hydroly-
sis. The DNA inserts of the selected clones were re-
stricted and the Southern blots of the fragments were
probed with each of the five histone genes from sea
urchin to localize their relative positions in the fragments
and in the clusters. As reported for clone 8D (Fig. 1A),
the H3 gene appeared to be adjacent to H4 and inside the
cluster, because both genes hybridized with a fragment
of about 2.2 kbp produced by SacI hydrolysis. They were
adjacent to H2A because the probes of the three genes
hybridized with the same 4.2-kbp fragment produced by
EcoRI digestion. H1 appeared to be adjacent to H2B
because they both showed a positive hybridization signal
on the same 5.8-kbp fragment produced by EcoRI diges-
tion. The overall results showed that clone 8D contained
one copy of each histone gene in a distinctive organiza-
tion (Fig. 1B).
Nucleotide Sequences of the Histone Genes
The DNA sequence of the histone gene cluster was ini-
tially determined on the three genomic pBR322 clones
3D, 6B, and 8D. The inserts of these clones were frag-
mented into three parts corresponding to the 2.2-kbp
fragment produced by SacI digestion and to the two ad-
ditional 3.1-kbp and 2.0-kbp fragments produced by fur-
ther digestion of the DNA with PstI (Fig. 1A). These
67
68
Fig. 2. Nucleotide and putative encoded amino acid sequences of C.
variopedatus histone genes in the cluster of clone 8D with adjacent 58
and 38 UTRs. No canonical TATA box is present. The conserved
promoter motifs are underlined. The putative CAP sites are underlined
and in bold type. Initial and stop codons of each encoded histone
protein are in bold type. The conserved 38 UTR palindrome with the
adjacent polypurine tract and the polyadenylation signal are underlined.
Note that the amino acid sequences of histones H1, H2B, and H4
appear directly encoded while those of histones H3 and H2A appear
inverted because their genes are encoded on the complementary DNA
strand. The accession number of the cluster sequence is U96764 and
AF007904 in GeneBank.
three fragments, prepared from clone 8D, were cloned
into pBluescript vector and used to perform the complete
sequence analysis of the histone gene cluster. The se-
quence was determined both on subclones prepared on
the basis of restriction sites found in the sequence ini-
tially determined and by extending the analysis directly
on the studied clones by means of synthesized primer
oligonucleotides.
The sequence data confirmed the indications of gene
arrangements derived from the hybridization experi-
ments and permitted one to orient the transcription po-
larity of each gene (Fig. 1B). The nucleotide sequence, as
occurring in clone 8D, demonstrated the presence of a
start codon at 58 nucleotides downstream from the 58
PstI site followed by an open reading frame of 606
nucleotides terminating with TAA. This sequence en-
codes an H1 histone type of 202 amino acids, including
the initial methionine (Fig. 2A). On the basis of the de-
duced amino acid composition and K/R ratio (61 K and
three R), the H1 histone in clone 8D is somatic. After a
spacer of 587 bp there is an open reading frame of 369 bp
terminating with TAA, coding for a 123-amino-acid H2B
histone type, including the first methionine (Fig. 2B). A
spacer of 1,337 bp is then observed followed by an open
reading frame of 408 nucleotides coding for a H3 histone
type of 136 amino acids, including the initial methionine
(Fig. 2C). There is then a spacer of about 800 bp and an
open reading frame of 309 bp terminating with TAG that
encodes a H4 histone type of 103 amino acids, including
the initial methionine (Fig. 2D). After a spacer of 659 bp
there is another open reading frame of 375 nucleotides
terminating with TAA encoding a H2A histone type of
125 amino acids (Fig. 2E). The spacer downstream this
gene is about 1,800 bp, the longest of the cluster, and 38
terminal to the clone.
Analysis of the Genomic Sequences Flanking
Histone Genes
No peculiarity is evident in the sequences 58 to the start
codons of the five histone genes present in the cluster
except that no canonical TATA box is apparent. There
are, however, elements common to other histone genes
of various organisms and to genes transcribed by RNA
polymerase II. In the case of the promoters of H2B and
H2A genes there is the GATCC element (underlined in
Fig. 2B,E) usually present 11 bp upstream of the TATA
box in sea urchin histone genes. This element has been
found to be essential to start transcription at the appro-
priate site (Maxson et al. 1983a; Busslinger et al. 1980).
A similar esamer sequence, 58-GACTTC-38, is present
also 58 to other histone genes. After this element, in the
promoter of H2B, there is another sequence that is typi-
cal of this gene, 58-CCTAATTTGCATATG-38, similar
to the consensus sequence 58-CCTTATTTGCATAAG-
38 corresponding to the H2B-specific-promoter element
 69

Table 1. Transcription termination signals in C. variopedatus histone genes

Spacer Polyadenylation
Genes Palindromea (bp) Purine-rich motif signal

H1 CCAAAGGTCCTTATCAGGACCATCCA 12 CCAAGAA +
H2B CCAAC-GCCCTTATCAGGGCCATCT 12 CCAAGAA +
H3 CAAACGGTCCTTTTTAGGACCAAACA 11 CAAGGAA +
H4 AAAACGGTCCTTATCAGGACCAAACA 11 CAAAGAA +
H2A CCAACGGTCCTTCTCAGGACCACTAT 11 CAGAGAA +
C. varioped GGCT CCTTTACTTC AGGG A CC 11–12 CCAGAGAGAA +
consensus
P. dumerilii TGGCCT A TT TTAAT A GGCCACCA 7–9 CAAAAGA −
consensus
Sea urchin AACGGCC T CT TTTCAGG A GCCACCA 13−15 CAAGAAAGA −
consensus
A G G
Trout A GGCTCTTTTAAGAGCCACCA 13–17 T CAAA A −
consensus

a
Bases forming the stems of the stem-loop structures are underlined.

(Harvey et al. 1982). This sequence appears essential to
activate transcription. It contains an octameric subse-
quence, 58-ATTTGCAT-38, typical of other gene pro-
moters transcribed both by RNA polymerase II and III
(Sive et al. 1986) that interacts with Oct1 protein
(Fletcher et al. 1987). A similar octameric sequence is
present also in the promoter/enhancer of immunoglobu-
lin genes and interacts with Oct2 protein (Scheidereit et
al. 1987). The core histone genes have putative CAP
sites in their 58-UTR (Fig. 2). The individual putative
signal sequences have been identified for their homology
to the corresponding sequences (Sures et al. 1980) re-
ported for the sea urchin (58-PyPyATTCPu-38) and D.
melanogaster (58-NCPuTTPyPu-38). The derived con-
sensus sequence of C. variopedatus is 58-Py/APyATTCPu/
C-38.
In the region 38 to the stop codons, each of the genes
of clone 8D has the control elements common to all
replication-dependent histone genes: the palindrome se-
quence forming stem-loop and, after 11–12 bp, a purine-
rich region (Hentschel and Birnstiel 1981; Birchmeier et
al. 1982) (Table 1). These two elements are involved in
the binding of the primary mRNA transcript to the U7
snRNP prior to the final definition of the 38 terminus of
the message (Krieg and Melton 1984; Birnstiel et al.
1985). As apparent (Table 1), the stem-loop structures
conform to the consensus sequences derived for other
organisms. However, the H2B histone gene shows the
stem composed of 5 bp, with the unique peculiarity that
only one GC pair is present at the base of the stem.
Surprisingly, downstream the purine-rich element, all
histone genes in the cluster have at least one AATAAA
polyadenylation signal typical of the replication-inde-
pendent histone genes.
In the spacer regions between genes there are several
simple reiterated units, as initially found in the sea urchin
histone gene clusters (Hentschel and Birnstiel 1981). As
an example, there are 17 TA repetitions downstream H3
and in the spacer between H4 and H2A there are three
repetitions of the ATGT motif at about 40 bp from the
CAGAGAA sequence of H2A and an additional 12 rep-
etitions 28 bp downstream the polyadenylation signal.
This spacer sequence has been determined also in clones
6B and 3D, showing identical compositions except for a
small difference in the number of repetitions of the con-
served motifs. A series of four repetitions forming the
sequence 58(TACA)11(TA)14CA(TA)14AC(TGAT)70 is
present in the long spacer downstream H2A. The
stretches of short repeated sequences might be involved
in recombination events. In this case, the small differ-
ence in the number of repetitions in the same repeated
motif in the different clusters found here in the different
clones (8D, 6B, 3D) isolated from the DNA of a single
male organism might represent the consequences of re-
combination events between clusters.
Copy Number Determination
DNA sequence analysis confirmed the results of the hy-
bridization experiments indicating that only one copy of
each histone gene is present in each cluster. For this
reason, both genomic DNA and clone 8D DNA were
hydrolyzed with PstI restriction nuclease to obtain the
electrophoretic DNA band with the fragments containing
the clusters. The number of copies of the cluster in the
haploid genome of C. variopedatus was then determined
by comparing the hybridization signal of the genomic
DNA band with that of clone 8D used as homologous
reference value (Fig. 3). Three different gene probes,
corresponding to genes of different conservation, were
used. The first probe was a PstI-DraII fragment (0.7
kbp), containing the H1 gene. The second probe was a
clone corresponding to the EcoRI-RsaI fragment (350
70
Fig. 3. Copy number of the histone genes in the genome of C. vari-
opedatus. Plasmid 8D DNA containing the histone gene cluster and
genomic DNA were hydrolyzed with PstI and fractionated on agarose
slab gel. Lanes 1–6, decreasing amounts of genomic DNA (10 mg, 5
mg, 2.5 mg, 1.25 mg, 0.6 mg, and 0.3 mg, respectively). Lanes 8–13,
decreasing amounts of the insert DNA present in plasmid 8D (5 ng, 2.5
ng, 1.25 ng, 500 pg, 250 pg, and 125 pg, respectively). Lane 7, undi-
gested genomic DNA (4 mg).
bp) containing the H4 gene prepared by PCR. The third
probe was a part of the coding region of the H2B gene,
obtained by PCR amplification from position 1260 to
1910 (Fig. 2B) and by digesting this product with HpaII
enzyme that generates two fragments: one of 234 bp,
corresponding to most of the coding region (from posi-
tion 1283 to 1517) that was used as a probe, and another
of 358 bp corresponding to the remaining part of the
coding region with the adjacent downstream spacer. De-
termination of the copy number using these three probes
was considered useful to obtain an indication of the ho-
mogeneity of the composition of the clusters concerning
the least conserved H1 gene, the more conserved core
histone gene H2B, and the highly conserved gene H4.
The quantitative results obtained by PhosphorImager
analysis of the radioactivity bound to the genomic DNA
bands, after hybridization with the different probes, were
consistent with each other, giving the same average value
of 390 copies of histone gene clusters/sperm cell. This
value was calculated assuming that the haploid genome
of C. variopedatus contains 1.45 pg DNA, as reported for
the haploid DNA amount of the polychaete annelid
worm P. dumerilii (Sellos et al. 1990).
Discussion
The results reported here on the histone genes and their
organization in the genome of C. variopedatus show the
presence of repeated clusters each containing one copy
of the five histone genes. This is different from the other
known situations of histone genes in annelids. In fact, in
P. dumerilii (Sellos et al. 1990), a worm belonging to the
same polychaete class of C. variopedatus, histone H1, is
not present in the repeated clusters of core histone genes
and has not yet been found elsewhere. Histone H1 is
missing also in the cluster of histone genes of the worm
U. caupo (Ingham and Davis 1988) belonging to the
minor phylum of echiuroids closely related to Annelida.
Other H1 histone genes, in addition to those present in
the repeated clusters, are very likely to be present in the
genome of C. variopedatus. In fact, a different H1 his-
tone gene must be coded in another position not yet
identified because a H1 protein has been isolated from
the sperm cells of this organism, showing a sperm-
specific amino acid composition with K/R ratio of about
2 (De Petrocellis et al. 1983), while the H1 encoded in
the clusters identified here shows amino acid com-
position typical of somatic molecules with K/R ratio of
about 20.
Determinations of the histone gene copy number with
three different probes of different sequence conservation
have shown the presence of about 390 copies of the
cluster per haploid genome in C. variopedatus (Fig. 3).
This value is similar to that found in P. dumerilii (Sellos
et al. 1990) while in U. caupo the cluster copy number is
about 100 (Ingham and Davis 1988). The high number of
histone gene clusters is a characteristic that annelids
share with echinoderms and some amphibians (Table 2).
The possibility that the high reiteration of the histone
genes to be activated during the initial cleavage stages
might be a mechanism to provide the high levels of his-
tone production necessary to assemble the rapidly in-
creasing amount of chromatin finds support in the pre-
sent results concerning an organism with a high rate of
cell division in the initial embryonic stages.
The histone gene clusters are different in C. variope-
datus and in the other annelid not only in the presence of
the histone H1 gene but also in the relative positions of
the individual genes and their transcription polarity. In
fact, H3 and H4 histone genes are contiguous and present
between H2B and H2A in C. variopedatus, while in P.
dumerilii H3 and H4 histone genes are at the extremes of
the cluster, separated by H2B and H2A (Table 2). In the
echiuroid U. caupo, a gene asset identical to that of P.
dumerilii is present if the direction of the gene cluster is
inverted in the 58-38 direction. In the clusters of the an-
nelids and in U. caupo, H3 and H4 genes, like H2A and
H2B genes, are transcribed from different DNA strands
but their relative directions of transcription are different.
In C. variopedatus transcription polarities are divergent
for H3 and H4 genes and convergent for H2A and H2B,
just the opposite of what occurs in P. dumerilii and in U.
caupo (Table 2). The differences in the structure and
organization of the clusters of histone genes in other
phyla are not so large even when comparison is made
between different classes. As an example, in Echinoder-
mata, the gene cluster is complete in the class Echinoidea
(sea urchins), where the H1 histone gene is associated
with the core histone genes, and is incomplete in the
class Asteroidea (sea stars), where the H1 histone gene is
not present in the cluster; but, in both classes, the genes
are transcribed from only one DNA strand showing the
same transcription polarity (Table 2).
The encoded amino acid sequences of the core histone
genes, when analyzed for phylogenetic relations, indicate
 71

Table 2. Organization and transcription polarity of C. variopedatus histone gene clusters

Insert length
Group Species (kbp) Reiteration Order of genes
→ ← → ←
Coral A. formosa 3.8 150 H 3–H2B–H2
← → ←
A–H →
4
Nematodes C. elegans 4 – H3–H4–H2B−H2 A
← → ← →
5.6 – H4−H3−H2A−H2B
→ → → → →
Sea urchins S. purpuratusa 6.5 300 H 1−H 4−H2 B−H 3−H2 A
→ → → →
Sea stars P. ochraceusb – High copy No. H 2A−H4 –H3 –H2 B
→ ← → ←
Annelida P. dumerilii 6 660 H4–H2 B–H2 A−H3
→ → ← → ←
C. variopedatus 7.3 800 H1–H2 B–H3 –H4 –H2 A
→ ← → ←
U. caupo 5 100 H3–H2 A–H2 B–H4
← → ← → ←
Fruit fly D. melanogaster 5 100 H3–H4–H2 A–H 2B–H1
→ → → → →
Fish S. gardnerii 10.2 145 H4–H2 B–H1–H2A–H3
→ → ← → →
Amphibia N. viridiscens 9.0 600–800 H1–H3–H2B–H2A–H4
→ → → → →
X. borealis 8.5 – H4–H2A–H2B–H1–H3
16 60 H1–H2B–H2A–H1–H4–H3
X. tropicalis 10.5 – H1–H3–H4–H2A–H2B
X. laevis 14 30 H4–H3–H2A–H2B
→ ← → → →
8.5 – H4–H2A–H2 B–H1–H3
(+ 7 other arrangements)

a
Other sea urchins show the same gene organization.
b
Other sea stars show the same gene organization.

that the proteins of the two annelids are distinctive and

close to each other. It has not been possible to extend this
comparative analysis to the H1 histone gene because that
sequenced here in C. variopedatus is the first somatic in
the phylum Annelida. The comparison of deduced amino
acid sequences of C. variopedatus histones with those of
the other organisms reported in the dedicated histone
gene data bank of Baxevanis and Landsman has been
made using H2A and H2B histone genes because they
are distinctive in the different organisms. The results
common to the analyses performed individually on H2A
and H2B genes can be presented in a simplified unrooted
phylogenetic tree that clearly shows that the sequences
have the expected phyletic relations (Fig. 4). In this tree,
worms are grouped together in close relation with in-
sects. In detail, C. variopedatus and P. dumerilii are
closest to each other (polycheates), forming a group with
U. caupo (echiuroid) and Sipunculus nudus (sipunculoid) Fig. 4. Simplified unrooted phylogenetic tree based on H2A and H2B
(Kmiecik et al. 1983, 1991), both belonging to minor histones. Branch lengths are not proportional to phylogenetic distances.
Data from the histone gene bank of Baxevanis and Landsman, access:
phyla closely related to annelids. C. elegans (nematode)
http://www.ncbi.nln.nih.gov/Baxevani/HISTONES/.
is positioned before the bifurcation of echiuroids, sipun-
culoids, and polychaetes and also before the bifurcation
of Insects while echinoderms are on another branch. This as a result of functional needs specific of the particular
structure is in line with the generally accepted phyloge- organisms.
netic relationships. An additional point of interest is provided by the pres-
It is apparent from the results reported here on the ence in the 38UTR of all genes in the cluster of C. vari-
histone gene clusters of C. variopedatus that the relative opedatus of two different 38 termination signals for the
positions of the individual genes and their transcription mRNAs (Table 1). This is a peculiar asset so far unique
polarity are not very useful or indicative of phylogenetic for histone genes in a cluster. In fact, a double 38 termi-
correlations. The apparent mobility of the histone genes nation signal has been recently reported for the H2B, H3,
might depend, among other causes, on the short repeated and H4 genes in D. melanogaster (Akhmanova et al.
sequences present in the spacer regions observed be- 1997) and only for two other individual genes, a murine
tween genes that might facilitate, as outlined in the pre- H1 histone gene (Cheng et al. 1989) and a human (Man-
ceding section, DNA mobility in the genomes, possibly nironi et al. 1989) and a murine H2A.X gene (Nagata et
72
al. 1991). The meaning of the presence of the 38 double
termination signals on all histone genes of C. variope-
datus is not clear. A possible speculation is that they
might have been initially present in the 38 region of all
histone genes and eventually one signal was eliminated
for a more efficient and specific transcription control.
This hypothesis, however, requires knowledge of histone
gene structures in other low forms of eukaryotes. In any
case, the peculiar characteristics of C. variopedatus his-
tone gene clusters add to the definition of phylogenetic
relationships and have shown the quite different rel-
evance, for phylogenetic analysis, of gene composition
and of gene organization.
Acknowledgments. This work has been supported in part by CNR
contract n° 95.02892.CT14 and by Italian M.U.R.S.T. 40% funds, proj-
ect Liveproteins.
References
Akhmanova A, Miedema K, Kremer H, Hennig W (1997) Two types of
polyadenylated mRNAs are synthesized from Drosophila replica-
tion-dependent histone genes. Eur J Biochem 244:294–300
Albig W, Kardalinou E, Drabent B, Zimmer A, Doenecke D (1991)
Isolation and characterization of two human H1 histone genes
within clusters of core histone genes. Genomics 10:940–948
Angerer L, DeLeon D, Cox K, Maxson R, Kedes L, Kaumeyer J,
Weinberg E, Angerer R (1985) Simultaneous expression of early
and late histone messenger RNAs in individual cells during devel-
opment of the sea urchin embryo. Dev Biol 112:157–166
Birchmeier C, Grosschedl R, Birnstiel L (1982) Generation of authentic
38 termini of a H2A mRNA in vivo is dependent on a short inverted
DNA repeat and on spacer sequences. Cell 28:739–745
Birnstiel ML, Busslinger M, Strub K (1985) Transcription termination
and 38 processing: the end is in site! Cell 41:349–359
Blin N, Stafford DW (1976) Isolation of high-molecular-weight DNA.
Nucleic Acids Res 3:2303
Brandt WF, Strickland WN, Strickland M, Carlisle L, Woods D, Von
Holt C (1979) A histone programme during the life cycle of the sea
urchin. Eur J Biochem 94:1–10
Busslinger M, Portmann R, Irminger JC, Birnstiel ML (1980) Ubiqui-
tous and gene-specific regulatory 58 sequences in a sea urchin his-
tone DNA clone coding for histone protein variants. Nucleic Acids
Res 8:957–977
Cheng G, Nandi A, Clerk S, Skoltchi AI (1989) Different 38-end pro-
cessing produces two independently regulated mRNAs from a
single H1 histone gene. Proc Natl Acad Sci USA 86:7002–7006
Connor W, Mezquita J, Winkfein RJ, States JC, Dixon GH (1984)
Organization of the histone genes in the rainbow trout (Salmo
gairdnerii). J Mol Evol 20:227–235
Cool D, Banfield D, Honda BM, Smith MJ (1988) Histone genes in
three sea star species: cluster arrangement, transcriptional polarity
and analyses of the flanking regions of H3 and H4 genes. J Mol
Evol 27:36–44
Davis FC, Shelton JC, Ingham LD (1992) Nucleotide sequence of the
Urechis caupo core histone gene tandem repeat. DNA Seq 2:247–
256
De Petrocellis B, Parente A, Tomei L, Geraci G (1983) A H1 histone
and a protamine molecule organize the sperm chromatin of the
marine worm C. variopedatus. Cell Differ 12:129–135
Engel JD, Dodgson JB (1981) Histone genes are clustered but not
tandemly repeated in the chicken genome. Proc Natl Acad Sci USA
78:2856–2860
Felsenstein J (1982) Numerical methods for inferring evolutionary tree.
Q Rev Biol 57:379–404
Felsenstein J (1988) Phylogenies from molecular sequences: inference
and reliability. Annu Rev Genet 22:521–565
Fletcher C, Heintz N, Roeder RG (1987) Purification and character-
ization of OTF-1, a transcription factor regulating cell cycle ex-
pression of a human histone H2B gene. Cell 51:773–781
Harvey RP, Robins AJ, Wells JR (1982) Independently evolving
chicken histone H2B genes: identification of a ubiquitous H2B-
specific 58 element. Nucleic Acids Res 10:7851–7863
Hentschel CC, Birnstiel ML (1981) The organization and expression of
histone gene families. Cell 25:301–313
Howell AM, Cool D, Hewitt J, Ydenberg B, Smith MJ, Honda BM
(1987) Organization and unusual expression of histone genes in the
sea star Pisaster ochraceus. J Mol Evol 25:29–36
Ingham LD, Davis FC (1988) Cloning and characterization of a core
histone gene tandem repeat in Urechis caupo. Mol Cell Biol 8:
4425–4432
Kmiecik D, Couppez M, Belaiche D, Sautiere P (1983) Primary struc-
ture of histone H2A from nucleated erythrocyte of the marine worm
Sipunculus nudus. Presence of two forms of H2A in the sipunculid
chromatin. Eur J Biochem 135:113–121
Kmiecik D, Belaiche D, Sautiere P, Loucheux-Lefebvre MH, Kerckaert
JP (1991) Complete sequence of Sipunculus nudus erythrocyte his-
tone H2B and its gene. Identification of an N,N-dimethylproline
residue at the amino-terminus. Eur J Biochem 198:275–283
Krieg PA, Melton DA (1984) Formation of the 38 end of histone
mRNA by post-transcriptional processing. Nature 308:203–206
Lifton RP, Goldberg ML, Karp RW, Hogness DS (1977) The organi-
zation of the histone genes in Drosophila melanogaster: functions
and evolutionary implication. Cold Spring Harb Symp Quant Biol
42:1047–1051
Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a labo-
ratory manual. Cold Spring Harbor Laboratory, New York
Mannironi C, Bonner WM, Hatch CL (1989) H2A.X a histone isopro-
tein with a conserved C-terminal sequence, is encoded by a novel
mRNA with both DNA replication type and polyA 38 processing
signals. Nucleic Acids Res 17:9113–9126
Maxson R, Cohn R, Kedes L, Mohun T (1983a) Expression and orga-
nization of histone genes. Annu Rev Genet 17:239–277
Maxson R, Mohun T, Gormezano G, Childs G, Kedes L (1983b) Dis-
tinct organizations and patterns of expression of early and late
histone gene sets in the sea urchin. Nature 301:120–125
Miller DJ, Harrison PL, Mahony TJ, McMillan JP, Miles A, Odorico
DM, ten Lohuis MR (1993) Nucleotide sequence of the histone
gene cluster in the Coral Acropora formosa (Cnidaria; Sclerac-
tinia): features of histone gene structure and organization are com-
mon to diploblastic and triploblastic metazoans. J Mol Evol 37:
245–253
Nagata T, Kato T, Morita T, Nozaki M, Kubota H, Yagi H, Matsushiro
A (1991) Polyadenylated and 38 processed mRNAs are transcribed
from the mouse histone H2A.X gene. Nucleic Acids Res 19:2441–
2447
Osley MA (1991) The regulation of histone synthesis in the cell cycle.
Annu Rev Biochem 60:827–861
Roberts SB, Sanicola M, Emmons SW, Childs G (1987) Molecular
characterization of the histone gene family of Caenorhabditis el-
egans. J Mol Biol 196:27–38
Ruberti I, Fragapane P, Pierandrei-Amaldi P, Beccari E, Amaldi F,
Bozzoni I (1982) Characterization of histone genes isolated from
Xenopus laevis and Xenopus tropicalis genomic libraries. Nucleic
Acids Res 10:1544–1550
Saitou N, Nei M (1987) The neighbor-joining methods: a new method
for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425
Scheidereit C, Heguy A, Roeder RG (1987) Identification and purifi-
cation of a human lymphoid-specific octamer-binding protein
(OTF-2) that activates transcription of an immunoglobulin pro-
moter in vitro. Cell 51:783–793

Schumperli D (1986) Cell-cycle regulation of histone gene expression.
Cell 45:471–472
Sellos D, Krawetz SA, Dixon GH (1990) Organization and complete
nucleotide sequence of the core-histone-gene cluster of the annelid
Platynereis dumerilii. Eur J Biochem 190:21–29
Sittman DB, Chiu IM, Pan CJ, Cohn RH, Kedes LH, Marzluff WF
(1981) Isolation of two clusters of mouse histone genes. Proc Natl
Acad Sci USA 78:4078–4082
Sive HL, Heintz N, Roeder RG (1986) Multiple sequences elements are
required for maximal in vitro transcription of a human histone H2B
gene. Mol Cell Biol 6:3329–3340
Stephenson EC, Erba HP, Gall JG (1981) Characterization of a cloned
73
histone gene cluster of the newt Notophthalmus viridiscens. Nucleic
Acids Res 9:2282–2295
Sures I, Levy S, Kedes LH (1980) Leader sequences of Strongylocen-
trotus purpuratus histone mRNAs start at a unique heptanucleotide
common to all five histone genes. Proc Natl Acad Sci USA 77:
1265–1269
Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving
the sensitivity of progressive multiple sequence alignment through
sequence weighting, positions-specific gap penalties and weight
matrix choice. Nucleic Acids Res 22:4673–4680
Zernik J (1980) Xenopus laevis histone gene: variant H1 genes are
present in different clusters. Cell 22:807–815