Você está na página 1de 23

Instituto Superior de Ciências da Saúde - Norte

Bioquímica 2º ano

Trabalho Realizado por:


Eduarda Catarina Chaves da Silva Teixeira Lopes

Gandra, 3 de Janeiro de 2008


Polineuropatia Amiloidótica Familiar

Índice

Introdução .......................................................................................................... 3
A História da Paramiloidose .............................................................................. 4
A Amiloidose ...................................................................................................... 5
A Paramiloidose ................................................................................................. 7
Sintomas ............................................................................................................ 8
Hereditariedade ................................................................................................. 9
Base Bioquímica ................................................................................................ 10
A Proteína .......................................................................................................... 11
A Proteína Mutada ............................................................................................. 12
Diagnóstico ........................................................................................................ 13
Alterações .......................................................................................................... 16
O Transplante Hepático ..................................................................................... 17
Diagnóstico Pré-Natal ........................................................................................ 18
Diagnóstico Genético Pré-Implantatório ............................................................ 19
Perspectivas Futuras ......................................................................................... 21
Conclusão .......................................................................................................... 22
Bibliografia ......................................................................................................... 23

Bioquímica 2º Ano Página 2


Polineuropatia Amiloidótica Familiar

Introdução
Este trabalho tem como objectivo o estudo de uma doença de origem
portuguesa, a Polineuropatia Amiloidótica Familiar (PAF). Esta doença metabólica é
conhecida por várias designações, como Paramiloidose ou Doença dos Pezinhos, mas
a mais aceite é a designação Polineuropatia Amiloidótica Familiar ou PAF.
A descoberta desta doença foi feita pelo Professor Corino de Andrade pela
observação de doentes com PAF na área da Póvoa de Varzim.
Nesta doença existe uma substância fibrilar insolúvel que se deposita nos
tecidos, a amilóide. A amilóide é constituída por uma proteína, a transtirretina (TTR),
que circula no sangue e tem como função o transporte de hormonas da tiróide, vitamina
A e lípidos.
Em situações normais a proteína é solúvel nos tecidos, quando mutada, esta
torna-se instável e insolúvel, o que provoca a acumulação de fibras amilóides nos
tecidos. Trata-se de uma mutação autossómica dominante com uma probabilidade, de
transmissão de pais para filhos, de 50%.
A Paramiloidose afecta a sensibilidade de estímulos e a capacidade motora,
iniciando-se nos membro inferiores. Tem início entre os 25 e os 35 anos, com uma
evolução entre 10 a 15 anos, ocorrendo depois a morte do indivíduo.
A atenuação da doença pode ser feita através de um transplante hepático
prolongando apenas o intervalo de vida de uma pessoa.

Bioquímica 2º Ano Página 3


Polineuropatia Amiloidótica Familiar

A História da Paramiloidose

Na década de 30, um médico da Póvoa de Varzim, Dr. Américo Graça, observou


doentes com alterações nos membros inferiores. Estas alterações eram localmente
conhecidas como “mal dos pezinhos”.
Devido a esta observação, o Dr. Américo Graça solicitou a ajuda do Professor
Corino de Andrade observou pela primeira vez,
em 1936, uma doente com sintomas diferentes
dos habitualmente encontrados nas doenças
neurológicas.
Esta doente queixava-se de
adormecimento, formigueiro e falta de
sensibilidade térmica e dolorosa nos membros
inferiores. Tinha também dificuldades em andar e
tinha diarreias e perturbações nos membros
superiores semelhantes às dos membros
Imagem 1 - Professor Corino de inferiores.
Andrade

No entanto, pensava-se que tratava-se de uma doença rara apenas encontrada


em Portugal, mas também foi identificada esta doença no Japão, Suécia, Brasil e num
estado Americano, Iowa. Isto deve-se à existência de focos de antigas colónias
portuguesas que oa longo de gerações transmitiu a doença à descendência.
Em Portugal há mais de 560 famílias afectadas, residentes na Póvoa de Varzim,
Vila do Conde, Viana do Castelo, Barcelos, Braga, Figueira da Foz e Serra da Estrela,
estes são os principais focos de paramiloidose no país.

Voltando à descoberta do Professor Corino de Andrade, sabe-se que com a sua


equipa estudou a doença, até que mais tarde, em 1952, publicou o primeiro artigo
científico sobre a paramiloidose na revista Brain.
A 13 de Julho de 1960 foi criado o Centro de Estudos de Neuropatologia,
conhecido actualmente como Centro de Estudos de Paramiloidose. A esta instituição
compete promover o rastreio de doentes, observação e tratamento, mantendo também
os investigadores informados.

Bioquímica 2º Ano Página 4


Polineuropatia Amiloidótica Familiar

A Amiloidose
A amiloidose, por definição, é a acumulação de várias proteínas fibrilares
insolúveis nos tecidos (amilóide), em quantidades suficientes para prejudicar a função
renal.
A proteína fibrilar, a amilóide, é produziida por células na medula óssea, e esta
pode depositar-se em qualquer tecido ou órgão.
Existem três tipos de amiloidose:
 Primária (AL – coração, pulmão, pele, língua, glândulas tiróide e
intestinos) – quando há doenças associadas;
 Secundária (AA – baço, fígado, rins, glândulas adrenais e linfonodos) –
trata-se de uma forma adquirida ou reactiva, doenças crónicas ou infecções;
 Hereditária – neuropatia motora e sensorial periférica, frequentemente
neuropatia autónoma e amilóide renal e cardiovascular. Neste tipo de amilóide,
encaixamos a paramiloidose.
Esta doença, normalmente, afecta o coração, rins, fígado, baço, sistema nervoso
e tracto gastro intestinal, olhos, pele. Os sinais e sintomas dependem do órgão
afectado.
Os factores de risco para se diagnosticar um indivíduo com amiloidose são a
idade (a partir dos 40 anos), o sexo ( os homens têm maior risco de desenvolver a
doença), outras doenças, e a história familiar (pode ser de origem hereditária e não,
adquirida). Este risco aumenta, quando se trata de pessoas que fazem diálises aos
rins, ou se têm doenças crónicas ou inflamatórias.
Um indivíduo pode não mostrar sintomas, mas se tiver sintomas, estes incluem:
 Inchaço dos tornozelos;
 Perda de peso;
 Fraqueza;
 Dificuldades na respiração;
 Fadiga;
 Língua inchada;
 Alterações cutâneas;
 Batimento cardíaco irregular;
 Etc.

Bioquímica 2º Ano Página 5


Polineuropatia Amiloidótica Familiar

O diagnóstico da amiloidose pode ser feito através da biópsia de tecido (gordura


abdominal, medula óssea ou do recto). Pode ser feita também uma análise ao sangue
e à urina, que poderá detectar a proteína anormal.
A amiloidose pode provocar danos graves:
 Danos renais;
 Dano no coração: fadiga e problemas na respiração;
 Danos no sistema nervoso central, por exemplo, falta de sensibilidade nos
dedos e sensação de queimadura.
Para esta doença não existe cura, o tratamento ajuda apenas a prolongar a vida
de um indivíduo e diminui a produção da proteína anormal.
Dependendo dos sinais, dos sintomas e órgãos afectados, o tratamento é feito
de acordo com estes. Ou seja, poderá fazer-se um regime alimentar especial, terapia,
transplante células estaminais ou transplante de fígado.

Bioquímica 2º Ano Página 6


Polineuropatia Amiloidótica Familiar

A Paramiloidose
A paramiloidose trata-se de uma amiloidose do tipo hereditário. E é definida pelo
depósito de proteína insolúvel nos tecidos, a transtirretina.
Esta doença afecta os rins, coração, aparelho gastro-intestinal, fígado, pele,
nervos periféricos e os olhos.
A paramiloidose engloba as Polineuropatias Amiloidóticas Familiares (PAF), que
são de quatro tipos:
 PAF tipo I, de Andrade ou tipo Português;
 PAF tipo II, de Rukovina ou tipo Indiana;
 PAF de tipo III, de Van Allen ou tipo Iowa;
 PAF tipo IV, de Meretoja ou tipo Filandês.
A doença de que se trata o trabalho é a PAF do tipo I, de Andrade ou tipo
Português.
Trata-se de uma doença neurológica progressiva e crónica, afecta o sistema
nervoso a nível motor, sensitivo e autónomo.
É uma doença hereditária de transmissão autossómica dominante. É incurável,
afectando o ser humano, principalmente a nível biológico, que tem repercussões a nível
psicológico, sociológico, cultural e espiritual.
O maior foco desta doença situa-se em Portugal Continental com uma incidência
desde os 17 aos 78 anos.

Bioquímica 2º Ano Página 7


Polineuropatia Amiloidótica Familiar

Sintomas
A paramiloidose manifesta-se entre os 20 e os 40 anos, e conduz à morte num
espaço de 10 a 12 anos.
As manifestações traduzem-se pela degenerescência progressiva dos nervos. A
zona mais afectada são os membros inferiores, começando pelos pés (pelo qual vem o
nom e Doença dos Pezinhos), alastrando-se ao resto do corpo.
Os principais sintomas são:
 Perda de função motora, de sensibilidade
térmica e de dor;
 Arritmias, obstruções auriculo ventriculares;
 Disfunções eréctil e urinárias;
 Disfunções gastro intestinais;
 Diminuição da filtração glomerular;
 Perturbações oculares.
Em alguns casos há um progresso rápido da doença,
normalmente, num espaço de dois anos, com um
envolvimento multi-órgão (nervos periféricos, rins, coração,
Imagem 2
estômago, intestino).
No estado final da doença, o doente encontra-se acamado ou em cadeira de
rodas, e morre devido a distúrbios cardíacos, e a complicações nutritivas (disfunções
gastro-intestinais).

Bioquímica 2º Ano Página 8


Polineuropatia Amiloidótica Familiar

Imagem 4
3

Hereditariedade
A paramiloidose é uma doença autossómica dominante, em que um indivíduo
portador do gene desta doença, quer seja homozigótico ou heterozigótico, vai
manifestá-la.
Um indivíduo homozigótico para a doença terá uma descendência com 100% de
probabilidade de ser portadora da doença. E um indivíduo heterozigótico para a doença
terá uma descendência com 50% de probabilidade de ser portadora da doença.
Ambos não apresentam diferenças nos sintomas, mas também pode haver
homozigóticos assimptomáticos.
A maioria dos doentes com paramiloidose são heterozigóticos.

Imagem 5 – Hereditariedade da Paramiloidose

Bioquímica 2º Ano Página 9


Polineuropatia Amiloidótica Familiar

Base Bioquímica
Como a paramiloidose é uma doença hereditária, ou seja, envolve os genes. O
gene que codifica para a transtirretina (TTR) localiza-se no braço longo do cromossoma
18 (18q) no locus 11.2-q12.1.

Imagem 6 – Do cromossoma à proteína

Este gene que codifica para a TTR é composto por quatro exões,com cerca de
200 pb (pares de bases) cada.
A mutação ocorre no exão 2, onde há uma alterção do par de bases, em que há
a substituição de uma adenina por uma guanina no primeiro nucleótido do codão, na
posição 30 (ATG transforma-se em GTG).
Esta substituição leva a uma alteração do aminoácido da proteína estável, em
que na posição 30 em vez do aminoácido valina vai estar a metionina (TTR Val30Met).
A substituição do aminoácido provoca alterações estruturais na transtirretina,
tornando-a instável.

Imagem 7 – Mutação do exão 2

Bioquímica 2º Ano Página 10


Polineuropatia Amiloidótica Familiar

A Proteína
A substância fibrilar que se deposita nos tecidos, a amilóide, deve-se à falta de
estabilidade da TTR.
Esta proteína é produzida no fígado, plexos coróideus do cérebro e na retina.
Quando mutada, a transtirretina desagrega-se
nos seus monómeros devido à sua instabilidade.
No seu estado normal, a TTR, é muito
estável nos tecidos e solúvel no plasma.
Os monómeros de TTR têm cerca de 127
aminoácidos, com um peso molecular de
aproximadamente de 14 kDa. Cada monómero é
constituído por duas folhas pregueadas β, as

Imagem 8 – Estrutura da proteína cadeias DAGH e CBEF, e por uma pequena


hélice α.
Os monómeros da TTR , trdimensionalmente, têm uma estrutura secundária, a
hélice α é uma estrutura secundária estabilizada por pontes hidrogénio, e as folhas β
têm uma estrutura distendida que também são estabilizadas por pontes de hidrogénio.
A união dos monómeros em dímeros dá-se pela ligação das cadeias β anti-
paralelas, por pontes de hidrogénio.
A ligação de dois dímeros origina um tetrâmero da TTR, cada tetrâmero tem um
peso molecular de cerca de 56 kDa.
As funções da TTR estão relacionadas com:
 Transporte de hormonas da tiróide –
tiroxina;
 Transporte de lípidos;
 Transporte de uma proteína de ligação
da vitamina A, a RBP (Retinol Binding Protein), são
transportadas 2 RBP por cada TTR;
 Manutenção da RBP plasmática (faz
baixar a sua excreção pelo rim).

Bioquímica 2º Ano Página 11


Polineuropatia Amiloidótica Familiar

Imagem 9 – Estrutura do monómero da TTR


A Proteína Mutada
A mutação mais comum em Portugal é a
Val30Met, e trata-se de uma mutação génica.
O aminoácido valina é substituído pelo aminoácido metioinina na posição 30. Na
mesma posição há a substituição de um nucleótido, a adenina pela guanina. Esta
mutação provoca uma produção da TTR alterada. A proteína mutada torna-se assim
solúvel no plasma e instável nos tecidos, e a sua
polimerização leva à deposição de fibras amilóides.
O tetrâmero de TTR é, assim, composto por
mutantes V30M. Este dissocia-se nos seus
monómeros, que quando desdobradas formam as
fibras amilóides.
As diferenças que ocorrem em relação à

Imagem 10 – Tetrâmero da TTR mutação são:


mutada
 Homozigóticos: o tetrâmero da TTR é
composto apenas por mutantes V30M;
 Heterozigóticos: estão mutadas apenas 1, 2 ou 3 subunidades. Estas,
quando dissociadas nos seus monómeros, as subunidades não mutadas mantêm as
características normais.

Imagem 11 – Desagregação/desintegração da proteína e formação das fibras amilóides

Bioquímica 2º Ano Página 12


Polineuropatia Amiloidótica Familiar

Diagnóstico
O diagnóstico molecular da TTR Met30 é efectuado por PCR nested
fluorescente, e posterior detecção da mutação após digestão com enzima de restrição
Nsi I.

O primeiro passo do diagnóstico é a PCR


nested fluorescente, este aumenta a
especificidade de amplificação do DNA em que
são usados dois pares de primers nas sucessivas
reacções de P CR.
Na PCR ocorre a amplificação do exão 2 do
gene de interesse, neste caso o gene da TTR.
Este ocorre através de três passos:
1. Desnaturação da cadeia de DNA;
2. Emparelhamento dos primers;

Imagem 12 – Passos da PCR 3. Síntese.


Usam-se dois pares de primers, um mais
externo e outro mais interno, marcado com um fluorocromo, para amplificar o exão 2 do
gene da TTR, que contém a mutação Met30.

 Primers externos:
 5’ – TTTCGCTCCAGATTTCTAA – 3’ (forward)
 5’ – GTGGGGGCAAACGGGAAGA – 3’ (reverse)
 Taq
 Condições da PCR para primers externos:
 12 minutos – 94 ºC;
 10 ciclos: 1 minuto(96 ºC), 1 minuto(55 ºC), 1minuto(72 ºC);
 15 ciclos: 1 minuto(94 ºC), 1 minuto(55 ºC), 1 minuto(72 ºC),
7 minuto(72 ºC).

 Primers internos:
 5’ – 6 – FAM – GTTAACTTCTCACGTGTCTT – 3’ (forward)

Bioquímica 2º Ano Página 13


Polineuropatia Amiloidótica Familiar

 5’ – AAGTCCTGTGGGAGGGTTCT – 3’ (reverse)
 Taq
 Condições da PCR para primers internos:
 12 minutos – 94 ºC;
 30 ciclos: 1 minuto(94 ºC), 1 minuto(57 ºC), 1 minuto(72 ºC),
7 minutos(72 ºC).
O segundo passo trata-se da acção da enzima de restrição.
O produto da PCR, com cerca de 195 pb, vão ser digeridos com a enzima de
restrição Nsi I que reconhece o local da mutação da TTR Met30.

Imagem 13 – Passos do uso da enzima de restrição Nsi I e detecção da mutação. O corte com esta
enzima de restrição forma uma extremidade coesiva.

Esta enzima, a Nsi I, vai efectuar um corte simétrico fora do eixo de simetria,
gerando uma extremidade coesiva. Este corte só ocorre no segmento de DNA onde se
encontra a mutação. Caso algum dos segmentos de DNA não contenha a enzima de
restrição esta não vai cortar o DNA.

Bioquímica 2º Ano Página 14


Polineuropatia Amiloidótica Familiar

O terceiro passo trata-se da electroforese.


Os produtos da PCR, após digeridos com a enzima de restrição, são separados
por electroforese (80 V, 60 – 90 minutos) em gel de agarose, e corados com brometo
de etídio.
No final observa-se o gel a luz UV.

Imagem 14 - RFLP. PCR do exão 2 da TTR. As amostras com três bandas, duas das quais resultantes
da clivagem com EcoT22I do segmento amplificado, correspondem aos portadores.

Imagem 15 - Produtos de PCR após digestão com a enzima de restrição NsiI

Ambas as imagens representam o produto de PCR após digeridos pela enzima


de restrição Nsi I. Na primeira imagem, o segmento de DNA que contém a mutação
está representado por três fragmentos, enquanto que naqueles que se vê apenas um
fragmento quer dizer que se trata do DNA normal. Na segunda imagem, vêem-se os
fragmentos que forma curtados porque estão representados por três bandas, a primeira
banda tem cerca de 195 pb cada fragmento, a segunda banda tem cerca de 110, e a
última banda vai ter cerca de 85 pb.
Aqueles que só têm uma banda com cerca de 195 pb cada, mostra que os
individuos não são portadores da doença. As três bandas representam um indivíduo
heterozigótico para a doença, em que o segmento de DNA mutado foi fragmentado em
duas partes, 110 pb para um dos fragmentos e 85 pb para outro fragmento.

Bioquímica 2º Ano Página 15


Polineuropatia Amiloidótica Familiar

Alterações
Na paramiloidose, sabe-se que , a deposição de amilóide dá-se principalmente
ao nível dos nervos. As fibras nervosas a serem afectadas primeiro são as não
mielinizadas e as mielinizadas de pequeno diâmetro, as de grande diâmetro sõa
apenas afectadas em casos avançados da doença.
As células de Sc hwan, por exemplo,
se entrarem em contacto com depósito de
substância amilóide, e são descritos como
apresentando alteraçõesdegenerativas. A
degeneração dos nervos periféricos resulta
de lesões nos gânglios das raízes
posteriores dos nervos raquidianos, que
Imagem 16 – Efeitos da deposição de fibras estão relacionados com o desaparecimento
amilóides nos tecidos.
de sensações de dor e temperatura ao longo
da doença.
Há também uma redução de densidade de fibras nervosas do sistema nervoso
autónomo.
A hipomobilidade do tracto gastro-intestinal superior resulta tanto da deposição
de substância amilóide no estômago, como da
degeneração doss nervos autónomos
intrínsecos, o que explicaria a anorexia,
náuseas e vómitos. Existe também uma alta
incidência de distúrbios cardíacos, devido a
infiltrações de substância amilóide no sistema
circulatório. Esta infiltração é responsável

pelas anormalidades cardíacas, muito Imagem 17


frequentes, na PAF.

Bioquímica 2º Ano Página 16


Polineuropatia Amiloidótica Familiar

O Transplante Hepático
O principal órgão produtor da proteína, a TTR, é o fígado.
A substituição do fígado de um indivíduo com paramiloidose por um fígado
saudável, para além de diminuir os níveis de proteína anormal no sangue, também
prolonga a vida de um indivíduo.
Os resultados podem ser:
• A temperatura dos pés e das mãos voltam ao normal;
• Há melhoria na sensibilidade;
• Quanto à função motora, não há qualquer alteração, nem nos órgãos
danificados;
• Em casos avançados, mesmo com o transplante, não é possível notar
melhoria do indivíduo.
Existem outras duas terapêuticas usadas para reduzir os altos níveis de TTR
Met30 no sangue: a imunoadsorção e a plasmaférese. Como não são muito eficazes,
usa-se normalmente o transplante hepático como melhor solução.
Assim, o transplante de fígado é o mais usado, pois pára o progresso da doença
no ponto de evolução, sendo mesmo possível demonstrar objectivamente a regressão
de lesões.
A TTR não é unicamente sintetizada no fígado, sendo também sintetizada nos
plexos coróideos e na retina. A produção de TTR pelos plexos coróideos não cessa
após o transplante de fígado. Os problemas oculares são comuns e podem-se tornar
sérios após o transplante de fígado.

Bioquímica 2º Ano Página 17


Polineuropatia Amiloidótica Familiar

Diagnóstico Pré-Natal
Implica a realização de uma amniocentese às 14/16 semanas de gravidez. Este
processo implicaria uma interrupção da gravidez por volta das 17 semanas, caso se
concluí-se que o diagnóstico desse positivo e os pais assim o pretendessem, tornava-
se na maioria das vezes agressivo para os casais, tanto do ponto de vista ético e
religioso, como moral.

Bioquímica 2º Ano Página 18


Polineuropatia Amiloidótica Familiar

Diagnóstico Genético Pré-Implantatório


O diagnóstico hereditário tem como objectivo detectar anomalias hereditárias no
embrião, permitindo a transferência selectiva dos embriões não afectados, e evitar a
interrupção volutária da gravidez (IVG).
O diagnóstico pré-natal (DPN) tem sido usado para prevenção da transmissão
de doenças genéticas, quer pela biópsia das vilosidades coriónicas, quer pela
amniocentese. A desvantagem é a de necessitar de interrupção voluntária da gravidez,
nos casos positivos.
Com o fim de prevenir a transmissão de doenças genéticas e em simultâneo
evitar a IVG, desenvolveu-se o Diagnostico Genético Pré-Implantatório (DGPI). Por
este método, é possível seleccionar ovócitos e embriões livres da doença em questão.
Pode ser oferecido a casais férteis ou inférteis, portadores de uma determinada
patologia genética, com deficiências genéticas germinais ou com abortamentos de
repetição. Ao permitir a transferência selectiva de embriões não afectados o DGPI evita
a IVG. Tem, no entanto, a desvantagem de, para haver acesso a embriões in vitro,
exigir o recurso à tecnologias de Reprodução Medicamente Assistida (RMA).
O primeiro DGPI foi efectuado há cerca de uma década, e utilizou a PCR para a
selecção de embriões do sexo feminino em famílias portadoras de patologias ligadas
ao cromossoma X.
Para efectuar a DGPI é necessário recorrer à RMA com fecundação por injecção
intracitoplasmática de espermatozóides (ISCI). A análise genética pode ser efectuada
sobre o ovócito (1º e 2º glóbulos polares), ou no embrião durante a janelade
totipotência (dia 3 do desenvolvimento: 6-12 blastómeros). A biópsia dos glóbulos
polares tem como limitações a restrição da análise ao genoma materno, só podendo
ser aplicada quando é a mulher portadora da anomalia genética.
O método mais utilizado, para o DGPI, é a biópsia de embriões em divisão,
procedimento em que se remove por microcirurgia um ou dois blastómeros ao 3º dia de
desenvolvimento embrionário após ISCI.

Fertilização in vitro de embriões criados em laboratório:


• Os embriões são criados em laboratório;
• Ao terceiro dia, devem ter entre 8 ou 12 células;
• Retiram-se duas células ao embrião e faz-se uma biópsia;
• Faz-se uma analise genética de forma independente;

Bioquímica 2º Ano Página 19


Polineuropatia Amiloidótica Familiar

• Após 42 horas obtêm-se os resultados da biópsia;


• Caso o resultado dê negativo, o embrião é implantado no útero da mãe,
se acontecer o caso de ser positivi, terá de se proceder a novas análises
embriológicas;
• Tem uma taxa de sucesso de aproximadamente 22%.
• Não tem qualquer apoio do estado.

Bioquímica 2º Ano Página 20


Polineuropatia Amiloidótica Familiar

Perspectivas Futuras

• Fase de Priming – impedir a dissociação do tetrâmero em monómeros, e


consequente formação de espécies intermediárias (potencialmente amiloidogénicas).
• Fase de Extensão – inibição da associação das espécies intermediárias e
crescimento das fibras.
• Fase de Disrupção – desagregação de fibras já formadas.

Bioquímica 2º Ano Página 21


Polineuropatia Amiloidótica Familiar

Conclusão
Com este estudo conclui-se que a Polineuropatia Amiloidótica Familiar é um tipo
de Amiloidose, tratando-se de uma doença hereditária, crónica e progressiva. Tem um
início tardio, em que o tempo de vida de um indivíduo diminui drásticamente, sendo
fatal.
O tratamento desta doença apenas pára a sua evolução por alguns anos,
através do transplante hepático. O Diagnóstico Genético Pré-Implantatório permite às
pessoas com paramiloidose diagnosticar se os seus embriões são ou não portadores
da doença, caso não seja portador é implantado no útero da mãe.
Através da Bioquímica foi possível o diagnóstico da doença, com uso de
técnicas bioquímicas, como por exemplo, uso de enzimas de restrição para detecção
de mutações, PCR, electroforese, etc.

Bioquímica 2º Ano Página 22


Polineuropatia Amiloidótica Familiar

Bibliografia
• BERKOW, Robert; FLETCHER, Andrew J.; B.,M.; CHIR, B., Manual Merk de
Medicina, 16ª Edição. São Paulo, Brasil. Roca, 1995.
• http://www.paramiloidose.com
• http://www.paramiloidose.org
• http://www.icicom.up.pt/blog/blogoscopio/arquivos/001523.html
• http://www.ff.ul.pt/paginas/cm/geneticahumana200405/resumos/Paramiloidose.d
oc -
• http://medicina.med.up.pt/bcm/trabalhos/2005/SemDoencadospezinhos.ppt
• http://www.mayoclinic.com/print/amyloidosis/DS00431/DSECTION=all&METHOD
=print
• http://www.cienciaviva.pt/healthxxi/topics.asp?lang=pt&accao=ibmc1_pt
• www.mac.min-saude.pt/pdfs/revista5.pdf

Bioquímica 2º Ano Página 23

Você também pode gostar