Você está na página 1de 4

CLONAGEM E EXPRESSO DA PROTENA RECOMBINANTE SnSAG2 DO PROTOZORIO Sarcocystis neurona

PORTELLA, Luiza Pires1;VOGEL, Fernanda Silveira Flores2, JUNIOR, Alceu Gonalves dos Santos3, LEITE, Fabio Pereira Leivas4, SANGIONI, Luis Antonio5.
Autora, Graduanda do Curso de Medicina Veterinria da Universidade Federal de Santa Maria; 2 lupiresportella@gmail.com Orientadora,Universidade Federal de Santa Maria, Departamento de 3 4 Medicina Veterinria Preventiva Co-Autor, Universidade Federal de Pelotas, PPGV. Co-Autor 5 Universidade Federal de Pelotas, Centro de Desenvolvimento Tecnolgico - CDTec. Co-Autor, Universidade Federal de Santa Maria, Departamento de Medicina Veterinria Preventiva.
1

1 INTRODUO O Sarcocystis neurona um coccdeo do filo Apicomplexa, famlia Sarcocystidae (SILVA et al., 2003) e a principal causa de mieloencefalite protozoria equina (MEP),uma doena grave e debilitante, que cursa com disturbios neurolgicos (BLYTHE et al, 1997; GRANSTROM & SAVILLE, 2000). Uma caracterstica da doena a tendncia em afetar um lado ou parte do cavalo mais que outra, ou seja, os sinais clnicos tendem a ser unilaterais. Embora laborioso, o diagnstico de MEP realizado com base no histrico, sinais clnicos, localizao anatmica das leses, mtodos de imunodiagnstico, resposta a terapia, evoluo do caso clnico e excluso de outras doenas (MACKAY, 2000). O teste padro para o diagnstico ante-morten para MEP o Western Blotting (immunoblotting) (DUBEY et al, 2001), porm este teste no realizado rotineiramente no Brasil. Atualmente a imunofluorescncia indireta (IFI) tem se mostrado eficiente no diagnstico imunolgico para MEP, visando a deteco de anticorpos anti-S. neurona no soro de equinos e outros mamferos, bem como em amostras de liquor. Trabalhos tm demonstrado que a IFI pode apresentar sensibilidade e especificidade semelhantes ou melhores quando comparadas ao immunoblotting (DUARTE et al, 2003, JOHNSON et al., 2010). A imunofluorescncia indireta (IFI) fundamentada na reao de anticorpos presentes no soro sanguneo contra antgenos de superfcie do protozorio. Os antgenos fixados na lmina da IFI geralmente so merozotos obtidos a partir de cultivo celular. Porm a dificuldade de cultivo de merozotos do S. neurona in vitro e a consequente obteno do antgeno podem representar um entrave a realizao da tcnica em um nmero grande de amostras. Assim, o desenvolvimento de um teste ELISA, partindo de protenas recombinantes de S. neurona facilitar tanto o diagnstico quanto estudos epidemiolgicos. A proposio de partir para um teste ELISA com protena recombinante se deve ao fato de que quando se utiliza o teste de ELISA, as reaes cruzadas so mais comuns, sendo necessrio considerar pontos de corte mais elevados (HUONG

et al., 1998). Assim a utilizao de uma protena recombinante como antgeno diminuiria a chance de reao cruzada. Os antgenos de superfcie SnSAG do S. neurona so abundantemente expressos e imunodominantes, e podem ser fatores de virulncia importantes que melhoram a capacidade do parasita de infectar e sobreviver no hospedeiro (ELLISON et al., 2003; HOANE et al., 2005). Segundo HOWE et al. (2008), nas 11 cepas de S. neurona testadas por Western Blotting utilizando anticorpos monoclonais, foi detectada a protena SnSAG2. Estes resultados demonstram que esta protena pode ser de grande importncia tanto para testes de diagnstico como potencial imungeno. Assim, o objetivo desse trabalho clonar e expressara protena de superfcie SnSAG2 do S. neurona para ser utilizada em futuros estudos para diagnstico deste protozorio atravs da padronizao de um ensaio imunoenzimtico- ELISA. A utilizao de uma protena recombinante busca uma maior especificidade no ensaio, diminuindo as possibilidades de reaes cruzadas com outros protozorios de mesma famlia.

2 METODOLOGIA (MATERIAL E MTODOS)

Os iniciadores para a amplificao do gene SnSAG2 e a construo do vetor, utilizando o plasmdeo pAE (coleo de vetores do Centro de Biotecnologia Universidade Federal de Pelotas), foram construdos com o auxlio do software Vector NTI 11.0. Esses foram desenhados a partir de sequncias depositadas no GenBank, sendo a sequncia SnSAG2 senso 5 CGAGATCTCCATGGAGACTCCC3 e a SnSAG2 anti-senso 3TCACAGTGTTGTAAGAATTCCC5. O iniciador senso apresenta stio de restrio para a enzima BGl II e o iniciador anti-senso apresenta stio de restrio para a enzima Eco RI. A amplificao do fragmento de DNA de interesse foi realizada por PCR, e posteriormente ligado ao plasmdeo pAE com a enzima T4 DNA Ligase. O clone foi ento inserido em E. coli TOP 10 F atravs de transformao por choque trmico para multiplicao, onde foi cultivado em placa contendo meio slido (LB lowsalt) e ampicilina. Aps realizou-se um screening das colnias recombinantes para seleo das recombinantes pAE/SnSAG2 para posterior extrao do plasmdeo. O plasmdeo pAE/SnSAG2 extrado de um dos clones foi transformado por choque trmico em E. coli BL21 pLyss, cultivado em meio lquido apropriado com ampicilina e a expresso da protena recombinante induzida com IPTG. O resultado da expresso das protenas foi analisado atravs de um gel de poliacrilamidaa 12% e sua caracterizao foi realizada atravs de Western Blotting com anticorpo AntiHistidina. Posteriormente foi realizado um Dot Blotting e um Western Blotting com soro sabidamente positivo para o protozorio S. neurona por imunofluorescncia indireta para confirmao da protena recombinante SnSAG2..

3 RESULTADOS E DISCUSSO

A amplificao da regio do gene SnSAG2 atravs de PCR foi obtida com sucesso, amplificando um fragmento de 525 pb. Aps a ligao do produto de PCR

ao vetor pAE, este clone foi com transformado em E. coli TOP10F, e cultivado produzindo colnias recombinantes. O screening de vinte e quatro colnias foi realizado pra observar os recombinates pAE/SnSAG2, sendo possvel selecionar oito colnias para extrao do plasmdeo. A partir destas selecionou-se 4 colnias que foram confirmadas atravs de PCR. Neste PCR a regio amplificada confirmou o processo de clonagem da protena recombinante. Os vetores recombinantes obtidos do processo de clonagem foram utilizados para a expresso da protena recombinante e o resultado foi visualizado em gel de poliacrilamida 12% SDS Page, onde observou-se a expresso de diversas protenas, dentre elas uma protena de mesmo peso molecular da protena de interesse (22 kDa). A caracterizao da protena recombinante atravs do Western Blotting com anticorpo anti-histidina confirmou a expresso da protena e o Dot Blotting e Western Blotting utilizando soro sabidamente positivo por imunofluorescncia indireta para o protozorio S. neurona confirmaram a identidade da protena. Assim foi possvel confirmar o processo de clonagem e expresso da protena recombinante SnSAG2 do protozorio S. neurona. Esses resultados preliminares demonstram que a protena recombinante uma candidata promissora para ser utilizada como antgeno na padronizao futura de testes diagnsticos, tais como ELISA e Immunoblotting.

4 CONCLUSO

Diante dos resultados obtidos, conclui-se que as estratgias adotadas para construo do vetor necessrio para a clonagem e expresso da protena recombinante SnSAG2 do protozorio S. neurona em E. coli foi eficaz, bem como os mtodos utilizados para a expresso da protena recombinante e identificao e caracterizao da mesma.

5 REFERNCIAS BLYTHE L. L., GRANSTROM D.E, HANSEN DE, WALKER LL, BARTLETT J, STAMPER S. Seroprevalence of antibodies to Sarcocystis neurona in horses residing in Oregon. Journal of the American Veterinary Medical Association 210: 525527.1997. DUARTE, P.C., DAFT, B. M.; CONRAD, P. A.; PACKHAM, A. E.; GARDNER, I. A. Comparison of a serum indirect fluorescent antibody test with two Western Blottingtests for the diagnosis of equine protozoal myeloencephalitis , Journal of Veterinary Diagnostic Investigation, v.15, p.813, 2003. DUBEY, J.P., LINDSAY, D.S., SAVILLE, W.J.A., REED, S.M., GRANSTROM, D.E., SPEER, C.A.. A review of Sarcocystis neurona and equine protozoal myeloencephalitis (EPM). Veterinary Parasitology, v.95, n.2-4, p.89-131, 2001.

ELLISON, S.P., KENNEDY, T.J., BROWN K.K., Development of an ELISA to detect antibodies to rSAG1 in the horses. Journal of Applied Research in Veterinary Medicine, 1, 318-327. 2003. GRANSTROM, D. E., SAVILLE, W. J. Doenas neurolgicas. In: Reed SM. Medicina interna equina. Rio de Janeiro: Guanabara Koogan, 2000. p. 419-22. HOANE, J.S., MORROW, J.K., SAVILLE, W.J., DUBEY, J.P., GRANSTROM, D.E., HOWE, D.K. 2005.Enzyme-linked immunosorbent assays for the detection of equine antibodies specific to Sarcocystis neurona surface antigens. Clinical and Diagnostic Laboratory Immunology, 12, 1050-1056. HOWE, D.K.; GAJI, R.Y.; MARSH, A.E.; PATIL, B.A.; SAVILLE, W.J.; LINDSAT, D.S.; DUBEY, J.P.; GRANSTROM, D.E. Strains of Sarcocystis neurona exhibit differences in their surface antigens, including the absence of the major surface antigen SnSAG1. I. International Journal for Parasitology. 38, 623-631. 2008. HUONG, L.T.T.; LJUNGSTROM, B.L.; UGGLA, A. et al. Prevalence of antibodies to Neospora caninum and Toxoplasma gondii in cattle and water buffaloes in southern Vietnam. Vet. Parasitol., v.75, Amsterdam, p.53-57, 1998. JOHNSON, A.L.; BURTON, A.J.; SWEENEY, R.W. Utility of 2 Immunological Tests for Antemortem Diagnosis of Equine Protozoal Myeloencephalitis (Sarcocystis neurona Infection) in Naturally Occurring Cases, Journal of Veterinary Internal Medicine, v.24, p.11841189, 2010. MACKAY,R. J. et al. Equine protozoal myeloencephalitis. Veterinary Clinics of North America, 3, v 16, p. 405-425, 2000. SILVA, D.P.G.; BORGES, A.S.; AMORIN, R.M.; GRAFKUCHENBUCK, M.R.; GONALVES. R.C.; CHIACCHIO, S.B.: Mieloencefalite protozoria eqina:Reviso Revista CFMV-Brasilia/Df-Ano IX-N 28 29 Janeiro /Agosto de 2003.