Você está na página 1de 185

Volume 23 nmero 4 outubro-dezembro 2005

ISSN 0102-0536
Carlos Alberto Lopes Embrapa Hortalias Csar Augusto B. P. Pinto UFLA Cludio Jos da S. Freire Embrapa Clima Temperado Daniel J.Cantliffe University of Florida Djalma Rogrio Guimares Instituto CEPA Eduardo S. G. Mizubuti UFV Eunice Oliveira Calvete UPF Francisco Bezerra Neto ESAM Francisco Murilo Zerbini Junior UFV Jernimo Luiz Andriolo UFSM Jos Fernando Durigan UNESP - Jaboticabal Jos Magno Q. Luz UFU Jos Orestes M. Carvalho Embrapa Rondnia Luiz Henrique Bassoi Embrapa Semi-rido Maria de Ftima A. Blank UFS Mariane Carvalho Vidal Embrapa Hortalias Maria do Carmo Vieira UFMS Marie Yamamoto Reghin UEPG Marilene L. A. Bovi IAC Paulo Csar T. de Melo ESALQ Paulo E. Trani IAC Renato Fernando Amabile Embrapa Cerrados Ricardo Alfredo Kluge ESALQ Roberval D. Vieira UNESP - Jaboticabal Rogrio L. Vieites UNESP - Botucatu Ronessa B. de Souza Embrapa Hortalias Rovilson Jos de Souza UFLA

ASSOCIAO BRASILEIRA DE HORTICULTURA The Brazilian Association for Horticultural Science IAC - Centro de Horticultura C. Postal 28, 13012-970 Campinas SP Tel./Fax: (0xx19) 3241 5188 ramal 374 E-mail: abh@iac.sp.gov.br Site: www.abhorticultura.com.br Presidente/President Paulo Csar Tavares de Melo USP/ESALQ - Piracicaba Vice-Presidente/Vice-President Dimas Menezes UFRPE - Recife 1 Secretrio / 1st Secretary Valria Aparecida Modolo Instituto Agronmico - Campinas 2 Secretrio / 2nd Secretary Eunice Oliveira Calvete UPF/FAMV - Passo Fundo 1 Tesoureiro / 1st Treasurer Sebastio Wilson Tivelli Instituto Agronmico - Campinas 2 Tesoureiro / 2nd Treasurer Joo Bosco Carvalho da Silva Embrapa Hortalias - Braslia COMISSO EDITORIAL DA HORTICULTURA BRASILEIRA Editorial Committee C. Postal 190 - 70359-970 Braslia DF Tel.: (0xx61) 3385 9088 / 3385 9051 / 3385 9073 / 3385 9000 Fax: (0xx61) 3556 5744 E-mail: hortbras@cnph.embrapa.br Presidente / President Leonardo de Britto Giordano Embrapa Hortalias Coordenao Executiva e Editorial / Executive and Editorial Coordination Sieglinde Brune Embrapa Hortalias Editores / Editors Ana Maria Montragio Pires de Camargo IEA Andr Luiz Loureno IAC Antnio Evaldo Klar UNESP - Botucatu Antnio T. Amaral Jnior UENF Arthur Bernardes Cecilio Filho UNESP - Jaboticabal Braulio Santos UFPR
Hortic. bras., v. 23, n. 4, out.-dez. 2005

A revista Horticultura Brasileira indexada pelo CAB, AGROBASE, AGRIS/FAO e TROPAG. Scientific Eletronic Library Online: http://www.scielo.br/hb www.abhorticultura.com.br

Programa de apoio a publicaes cientficas

Horticultura Brasileira, v. 1 n.1, 1983 - Braslia, Sociedade de Olericultura do Brasil, 1983 Trimestral Ttulos anteriores: V. V. 4-18, 1964-1981, Revista de Olericultura. 1-3, 1961-1963, Olericultura.

No foram publicados os v. 5, 1965; 7-9, 1967-1969. Editorao e arte/Composition Luciano Mancuso da Cunha Reviso de ingls/English revision Patrick Kevin Redmond Reviso de espanhol/Spanish revision Marcio de Lima e Moura Tiragem/printing copies 1.000 exemplares Periodicidade at 1981: Anual. de 1982 a 1998: Semestral de 1999 a 2001: Quadrimestral a partir de 2002: Trimestral ISSN 0102-0536 1. Horticultura - Peridicos. 2. Olericultura - Peridicos. I. Associao Brasileira de Horticultura. CDD 635.05

866

Hortic. bras., v. 23, n. 4, out.-dez. 2005

Volume 23 nmero 4 outubro-dezembro 2005

ISSN 0102-0536

SUMRIO/CONTENT
* Artigos em ingls com resumo em portugus Articles in English, with an abstract in Portuguese

CARTA DO EDITOR / EDITOR'S LETTER


869

PESQUISA / RESEARCH
Comportamento de cultivares de alface americana em Santo Antnio do Amparo Evaluation of crisphead lettuce cultivars in Santo Antnio do Amparo, Brazil J. E. Yuri; R. J. Souza; G. M. Resende; J. H. Mota Qualidade e sanidade de mudas de cebola em funo da adio de composto termfilo Quality and health of onion seedlings by adding thermophilic compost P. Boff; J. F. Debarba; E. Silva; H. Werner Danos causados pelo impacto de queda na qualidade ps-colheita de razes de mandioquinha-salsa Damages caused by drop impact on the postharvest quality of arracacha roots G. P. Henz; R. M. Souza; J. R. Peixoto; L. Blumer Mtodos para a secagem de sementes de cebola submetidas ao condicionamento fisiolgico Evaluation of methods for drying primed onion seeds R. F. Caseiro; J. Marcos Filho Divergncia gentica entre acessos de tomateiro infestados por diferentes populaes da traa-do-tomateiro Genetic diversity among tomato accessions infested by different tomato leaf miner populations G. R. Moreira; D. J. H. Silva; M. C. Picano; L. A. Peternelli; F. R. B. Caliman Emprego de tipos de cobertura de canteiro no cultivo da alface Evaluation of mulch types on lettuce production V. C. Andrade Jnior; J. E. Yuri; U. R. Nunes; F. L. Pimenta; C. S.M. Matos; F. C. A. Florio; D. M. Madeira Diferenciao de estirpes de Potato virus Y (PVY) por RT-PCR RT-PCR For differentiation of Potato virus Y strains in potato L. N. Fonseca; A. K. Inoue-Nagata; T. Nagata; R. P. Singh; A. C. vila Avaliao de clones de batata-doce em Vitria da Conquista Evaluation of sweet potato clones in Vitria da Conquista A. D. Cardoso; A. E. S. Viana; P. A. S. Ramos; S. N. Matsumoto; C. L. F. Amaral; T. Sediyama; O. M. Morais Toxicidade de leos essenciais de alho e casca de canela contra fungos do grupo Aspergillus flavus Evaluation of essential oils from Allium sativum and Cinnamomum zeilanicum and their toxicity against fungi of the Aspergillus flavus group E. C. Viegas; A. Soares; M. G. F. Carmo; C. A. V. Rossetto Produo, aparncia e teores de nitrognio, fsforo e potssio em alface cultivada em substrato com zelita Yield, appearance and content of nitrogen, phosphorus and potassium in lettuce grown in substrate with zeolite A. C.C. Bernardi; M. R. Verruma-Bernardi; C. G. Werneck; P. G. Haim; M. B.M. Monte Rendimento e qualidade de razes de batata-doce adubada com nveis de uria Yield and quality of sweet potato roots fertilized with urea A. P. Oliveira; M. R. T. Oliveira; J. A. Barbosa; G. G. Silva; D. H. Nogueira; M. F. Moura; M. S. S. Braz Colonizao de plantas de alho por Neotoxoptera formosana no DF Colonization of garlic plants by Neotoxoptera formosana in Distrito Federal, Brazil P. A. Melo Filho; A. N. Dusi; C. L. Costa; R. O. Resende *Growth and yield of lettuce plants under salinity *Crescimento e produtividade da alface em condies salinas J. L. Andriolo; G. L. Luz; M. H. Witter; R. S. Godoi; G. T. Barros; O. C. Bortolotto Avaliao dos acessos de alho pertencentes coleo do Instituto Agronmico de Campinas Evaluation of garlic accesses from the collection of the Instituto Agronmico de Campinas P. E. Trani; F. A. Passos; D. E. Foltran; S. W. Tivelli; I. J.A. Ribeiro Avaliao de linhas de beneficiamento e padres de classificao para tomate de mesa Evaluation of packing lines and classification standards for fresh market tomatoes in Brazil M.D. Ferreira; M.K. Kumakawa; C. Andreuccetti; S.L. Honrio; M. Tavares; M.L. Mathias Reao de gentipos de melancia ao crestamento gomoso do caule Response of watermelon cultivars to gummy stem blight G. R. Santos; A. C. Caf Filho Sistemas de tutoramento e conduo do tomateiro visando produo de frutos para consumo in natura Tomato plant staking and training systems for fresh fruit production B. G. Marim; D. J. H. Silva; M. A. Guimares; G. Belfort
Hortic. bras., v. 23, n. 4, out.-dez. 2005

870

875

881

887

893

899

904

911

915

920

925

929

931

935

940

945

951

Secagem e fragmentao da matria seca no rendimento e composio do leo essencial de capim-limo Yield and composition of essential oil of lemongrass in different drying and fragmentation conditions L. C. B. Costa; R. M. Corra; J. C. W. Cardoso; J. E. B.P. Pinto; S.K.V. Bertolucci; P. H. Ferri *Baby corn, green ear, and grain yield of corn cultivars *Rendimentos de minimilho, de espigas verdes e de gros de cultivares de milho I. P. C. Almeida; P. S. L. Silva; M. Z. Negreiros; Z. Barbosa Formas de parcelamento e fontes de adubao nitrogenada para produo de couve-da-Malsia Split forms and sources of nitrogen fertilization for the flowering white cabbage production L. A. Zano Jnior; R. M. Q. Lana; K. A. S Determinao das etapas do processamento mnimo de quiabo Determination of the stages of minimum processing of okra M. A. G. Carnelossi; P. Yaguiu; A. C. L. Reinoso; G. R. O. Almeida; M. L. Lira; G. F. Silva; V. R.R. Jalali Produtividade e qualidade ps-colheita da alface americana em funo de doses de nitrognio e molibdnio Yield and postharvest quality of summer growing crisphead lettuce as affected by doses of nitrogen and molybdenum G. M. Resende; M. A. R. Alvarenga; J. E. Yuri; J. H. Mota; R. J. Souza; J. C. Rodrigues Jnior Influncia da concentrao de BAP e AG3 no desenvolvimento in vitro de mandioquinha-salsa Influence of BAP and GA3 concentration on the in vitro development of arracacha N. R. Madeira; J. B. Teixeira; C. T. Arimura; C. S. Junqueira Produtividade de tomate em ambiente protegido, em funo do espaamento e nmero de ramos por planta Yield of tomato under protected environment in relation to spacing and number of branches per plant L. A. Carvalho; J. Tessarioli Neto Superao de dormncia em sementes de beterraba por meio de imerso em gua corrente Overcoming beetroot seeds dormancy through immersion in running water J. B. Silva; R. D. Vieira; A. B. Ceclio Filho Associao de atmosfera modificada e antioxidantes reduz o escurecimento de batatas gata minimamente processadas Association of modified atmospheres and antioxidants reduce browning of minimally processed potatoes L.L.O. Pineli; C. L. Moretti; G. C. Almeida; A. B.G. Nascimento; A.C. A. Onuki Aplicao de mtodos de agrupamento na quantificao da divergncia gentica entre acessos de tomateiro Cluster analysis in quantifying genetic divergence in tomato accessions M. Karasawa; R. Rodrigues; C. P. Sudr; M. P. Silva; E. M. Riva; A. T. Amaral Jnior Diferentes concentraes de soluo nutritiva para o cultivo de Mentha piperita e Melissa officinalis Mentha piperita (peppermint) and Melissa officinalis (balm) development in different concentrations of nutritive solution L. L. Haber; J. M. Q. Luz; L. F. A. Dro; J. E. Santos Produtividade e armazenamento de cebola cv. Alfa Tropical cultivada em diferentes espaamentos Yield and storage of onion, cv. Alfa Tropical, under different planting spacings G. M. Resende; N. D. Costa Desempenho de gentipos de tomateiro sob cultivo protegido Performance of tomato genotypes grown under protected cultivation C. R. B. Eklund; L. C. S. Caetano; A. Shimoya; J. M. Ferreira; J. M.R. Gomes Tcnicas de colheita para tomate de mesa Harvesting methods for fresh market tomatoes M. D. Ferreira; A. T.O. Franco; M. Tavares Anlise prospectiva do agronegcio gengibre no estado do Paran Prospective analysis of the ginger agrobusiness in Paran State, Brazil R. R.B. Negrelle; E. R. S. Elpo; N. G. A. Rcker Desafios e oportunidades para o agronegcio da cebola no Brasil The challenges and the oportunities for the onion agribusiness N. J. Vilela; N. Makishima; V. R. Oliveira; N. D. Costa; J. C. M. Madail; W. P. Camargo Filho; G. Boeing; P. C. T. Melo

956

960

965

970

976

982

986

990

993

1000

PGINA DO HORTICULTOR / GROWER'S PAGE


1006

1010

1015

1018

ECONOMIA E EXTENSO RURAL / ECONOMY AND RURAL EXTENSION


1022

1029 1034

ERRATA / ERRATA NDICE / CONTENT


1035

NORMAS PARA PUBLICAO / INSTRUCTIONS TO AUTHORS


1045

Hortic. bras., v. 23, n. 4, out.-dez. 2005

carta do editor

Foram sete anos. Entretanto, parece-me que foi ontem. Foi sem dvida um grande aprendizado, uma verdadeira escola de convivncia e de relacionamento humano, dando-me oportunidade de conhecer vrios colegas que de maneira abnegada ajudaram-me na tarefa de conduzir a revista Horticultura Brasileira (HB). Estou falando dos sete anos durante os quais tive a oportunidade de servir a atual Associao Brasileira de Horticultura, ocupando a presidncia da Comisso Editorial da HB. A responsabilidade da continuidade dos trabalhos ficar nos ombros de uma equipe de grande capacidade e competncia, tendo na Presidncia da Comisso Editorial o Dr. Paulo Eduardo de Melo que h exatamente sete anos transferiu-me esta incumbncia. Agradeo a todos os Editores e Consultores ad hoc que durante todos estes anos, apesar do cansao de um dia de aulas, de extenuantes trabalhos de pesquisa, palestras para produtores ou anlise de projetos, reuniram foras para revisar mais um trabalho de pesquisa enviado para ser publicado na HB. Ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq) pelo apoio financeiro revista. Muito grato a todos. Meu agradecimento especial incansvel colega Sieglinde Brune por todos estes anos de companheirismo e dedicao. Tambm agradeo o trabalho srio e competente de nossa secretria Roseli Medeiros Barbosa. Aproveito para desejar nova diretoria da Associao Brasileira de Horticultura, presidida pelo amigo Paulo Csar Tavares de Melo, muito sucesso na conduo da ABH. Boa sorte a todos!

Leonardo de B Giordano Presidente da Comisso Editorial Horticultura Brasileira

Hortic. bras., v. 23, n. 4, out.-dez. 2005

869

pesquisa
YURI, J.E.; SOUZA, R.J.; RESENDE, G.M.; MOTA, J.H. Comportamento de cultivares de alface americana em Santo Antnio do Amparo. Horticultura Brasileira, Braslia, v.23, n.4, p.870-874, out-dez 2005.

Comportamento de cultivares de alface americana em Santo Antnio do Amparo


Jony E. Yuri1; Rovilson Jos de Souza2; Geraldo M. de Resende3; Jos H. Mota4
REFRICON, Rod. Regis Bittencourt s/n km 294, 06850-000 Itapecerica da Serra-SP; E-mail: jonyyuri@uol.com.br; 2UFLA, C. Postal 37, 37200-000 Lavras-MG; 3Embrapa Semi-rido, C. Postal 23, 56300-970 Petrolina-PE; 4UFMS, C. Postal 533, 79.804-970 Dourados-MS
1

RESUMO
Com o objetivo de avaliar o comportamento de cultivares de alface do tipo americana em duas pocas de cultivo, foram conduzidos dois experimentos em Santo Antnio do Amparo (MG), de setembro a dezembro de 1998 e fevereiro a maio de 1999 em condies de tnel. Utilizou-se o delineamento de blocos ao acaso com seis cultivares (Cassino; Legacy; Lucy Brown; Lorca; Lady e Raider) e quatro repeties. As avaliaes de massa fresca total e comercial, circunferncia e comprimento do caule da cabea comercial foram realizadas quando as plantas apresentaram cabea bem formada e compacta. Na primeira poca de plantio, sobressaram-se na caracterstica massa fresca total as cultivares Lady (820,4 g planta-1) e Lucy Brown (790,7 g planta-1) sem, contudo, diferirem da cultivar Lorca (626,6 g planta-1). Para massa fresca comercial destacaram-se as cultivares Lady (620,0 g planta-1) e Lucy Brown (559,3 g planta-1) com maiores rendimentos. A circunferncia da cabea comercial variou de 36,3 a 47,2 cm e o comprimento do caule de 3,3 a 4,5 cm. Para a segunda poca de cultivo no observou-se diferenas significativas entre as cultivares para massa fresca total e comercial. No entanto, todas as cultivares apresentaram massa fresca comercial acima de 850 g planta-1. A circunferncia da cabea variou de 45,4 a 53,4 cm e o comprimento de caule de 3,7 a 4,9 cm. Maiores rendimentos em termos de massa fresca foram obtidos na segunda poca de plantio. Palavras-chave: Lactuca sativa L., rendimento, competio de cultivares.

ABSTRACT
Evaluation of crisphead lettuce cultivars in Santo Antnio do Amparo, Brazil The behavior of crisphead lettuce cultivars at two planting periods was evaluated in two experiments carried in Santo Antnio do Amparo, Minas Gerais State, Brazil, from September to December 1998 and February to May 1999, under a plastic tunnel conditions. The experimental design was a randomized complete block with six treatments (cv Cassino; Legacy; Lucy Brown; Lorca; Lady and Raider) with four replications. The evaluations of total and marketable fresh weight, circumference and stem length of the marketable head were carried out when the plants had well formed and compact heads. In the first cultivation period, the cultivars Lady (820,4 g plant-1) and Lucy Brown (790,7 g plant-1) presented higher fresh weight. However, they did not differ from cultivar Lorca (626,6 g plant-1). The cultivars Lady (620.0 g plant-1) and Lucy Brown (559.3 g plant-1) presented the highest yield of marketable fresh weight. The circumference of marketable heads varied from 36.3 to 47.2 cm and the stem length from 3.3 to 4.5 cm. No significant differences were observed among cultivars for total and commercial fresh mass in the second planting time; However, all cultivars presented commercial fresh mass above 850 g plant-1. The marketable head circumference varied from 45.4 to 53.4 cm and the stem length from 3.7 to 4.9 cm. Highest yield of fresh mass was obtained in the second planting time. Keywords: Lactuca sativa L., yield, cultivar competition.

(Recebido para publicao em 20 de fevereiro de 2004 e aceito em 13 de junho de 2005) alface (Lactuca sativa L.) uma espcie mundialmente conhecida e considerada a mais importante hortalia folhosa (FERNANDES; MARTINS, 1999). A alface do tipo americana, denominada Crisphead lettuce nos Estados Unidos, considerada a mais importante dentre os vegetais para ser consumido em forma de saladas cruas, tendo um consumo per capita superior a 11,3 kg ano -1 no Brasil (SANDERS, 1999). O grupo da alface americana tem apresentado aumento crescente, na regio do sul de Minas Gerais, devido s condies edafoclimticas favorveis e
870

tambm devido proximidade dos grandes centros consumidores (redes fast food). A regio possui mais de 30 produtores em diversos municpios do sul de Minas Gerais, cultivando cerca de 1800 ha por ano, com uma produo de 10.500 toneladas desta folhosa (YURI, 2000). De acordo com Thompson (1944), a alface uma das hortalias mais sensveis s altas temperaturas e isto, na maioria das vezes, o fator mais limitante para o no imbricamento das folhas (formao da cabea). Com base nos resultados de Lenano (1973), Brunini et al., (1976) e Csseres (1980),

verifica-se que a alface se desenvolve bem em temperaturas entre 15 e 20C. Temperaturas acima de 20C estimulam e aceleram o pendoamento. Com o aumento da temperatura, a planta emite o pendo floral precocemente, interrompendo a fase vegetativa, tornando o produto imprprio para consumo e comercializao, devido ocorrncia de sabor amargo das folhas, em funo do acmulo de ltex (CSSERES, 1980). Jackson et al. (1999) relatam que a alface americana requer, como temperatura ideal para o desenvolvimento, 23C durante o dia e 7C noite. Temperaturas muito elevadas podem provoHortic. bras., v. 23, n. 4, out.-dez. 2005

Comportamento de cultivares de alface americana em Santo Antnio do Amparo

car queima das bordas das folhas externas, formar cabeas pouco compactas e tambm contribuir para a ocorrncia de deficincia de clcio, conhecido como tip-burn. Outro fator que afeta a planta o fotoperodo, pois a alface exige dias curtos durante a fase vegetativa e dias longos para que ocorra o pendoamento. Para Robinson et al. (1983), o pendoamento em alface uma caracterstica importante que influencia diretamente o desenvolvimento da cabea. Dias longos associados a temperaturas elevadas aceleram o processo, o qual tambm dependente da cultivar (NAGAI; LISBO, 1980; RYDER, 1986; VIGGIANO, 1990). Segundo Conti (1994), o comprimento do dia no problema para o cultivo da alface no vero brasileiro, pois as cultivares europias importadas j esto adaptadas a dias mais longos do que os que ocorrem no pas de origem. Observa-se que a expanso da cultura est ocorrendo para as reas de latitudes menores e, conseqentemente, o fotoperodo no obstculo. Entretanto, em condies de menores latitudes, verifica-se o aumento da temperatura no perodo do vero, havendo necessidade de se escolher reas de elevadas altitudes. A altitude do local um fator que deve ser levado em considerao para o cultivo da alface, pois influencia diretamente na temperatura. Portanto, regies de menores altitudes no so adequadas ao plantio de vero, devido ao excesso de calor. Verifica-se que nas regies serranas do Rio de Janeiro e no cinturo verde de So Paulo, em altitudes superiores a 800 m possvel cultivar-se ao longo do ano. J em localidades com altitude inferior a 400 m, de clima quente, desde que se utilize cultivares adaptadas pode-se cultivar a alface na maioria dos meses (FILGUEIRA, 2000). As cultivares americanas tm elevada produo de massa fresca, o que relatado por Bernardi e Igue (1973) nas cultivares Great Lakes e New York que pesaram, em mdia, 644,0 e 610,0 gramas, respectivamente. Leal et al. (1974) avaliando o comportamento de cultivares de alface de diferentes grupos na regio Serrana do Estado do Rio de Janeiro, numa poca quente, verificaram
Hortic. bras., v. 23, n. 4, out.-dez. 2005

que a cultivar Mesa 659 foi a que apresentou melhor formao de cabea em relao s demais cultivares estudadas, com 58% das plantas apresentando massa superior a 400,0 gramas. Bueno (1998), nas condies de Lavras, a uma altitude de 918 metros, apresentou em junho, para a cultivar Lorca, uma massa fresca total e comercial por planta de 801,2 e 461,2 gramas, respectivamente. Utilizando a mesma cultivar, local e poca de plantio, Mota (1999) obteve massa fresca total e comercial por planta de 1000 e 695 gramas, respectivamente. Em experimento realizado em Santo Antnio do Amparo (MG), a uma altitute de 1.050 metros, Alvarenga (1999) obteve massa fresca total e comercial por planta de 1011,0 e 677,8 gramas, respectivamente, para a cultivar Raider, avaliadas nos meses de maio e junho. Yuri (2000), em experimento realizado no municpio de Boa Esperana (MG), obteve para os gentipos Lucy Brown, PSR 5338, PSR 4303, PSR 0110, Empire 2000 e Seeker, produtividade comercial de 266,6; 276,1; 293,8; 301,6; 304,4 e 333,8 g planta-1, respectivamente, porm, no mostraram diferenas significativas comparadas Raider (333,8 g planta-1). O presente trabalho teve como objetivo avaliar o comportamento de cultivares de alface americana em duas pocas de plantio, nas condies do municpio de Santo Antnio do Amparo.

MATERIAL E MTODOS
Foram conduzidos dois experimentos na Estao Experimental da Refricon Mercantil Ltda., no municpio de Santo Antnio do Amparo (MG), situado a uma altitude de 1.050 metros, em solo classificado como Latossolo Vermelho Distrofrrico. Utilizou-se o delineamento experimental de blocos casualizados, com quatro repeties, sendo os tratamentos constitudos por seis cultivares de alface americana (Cassino, Legacy, Lucy Brown, Lorca, Lady e Raider). A semeadura foi realizada em bandejas de poliestireno expandido contendo 200 clulas, utilizando-se o substrato comercial Plantmax HT sendo utilizadas mu-

das com 30 dias de idade. O primeiro experimento foi realizado de setembro a dezembro de 1998 (1 poca), com transplante em 26/10/1998, e o segundo de fevereiro a maio de 1999 (2 poca), com transplante em 19/03/1999. Com base nos resultados da anlise das amostras de solo, a rea experimental utilizada na primeira poca foi corrigida com calcrio dolomtico seis meses antes do plantio da alface. A adubao de plantio foi feita dois dias antes do transplantio, utilizando-se uma mistura de adubo formulado 4-30-16 com o termofosfato magnesiano Yoorim Master, em que se aplicou 37,5 kg ha-1 de N; 600,0 kg ha-1 de P205 e 150,0 kg ha-1 de K20. Na segunda poca foi aplicado 400,0 kg ha-1 de P205 e as mesmas doses de N e K20 utilizados anteriormente baseados nos dados de Raij et al. (1996). Os canteiros foram construdos com 45,0 m de comprimento e 1,2 m de largura. A cada dois canteiros foi instalada uma estrutura de proteo, constituda de tnel alto, com 3,0 m de largura e 1,7 m de altura, coberto com filme plstico transparente de baixa densidade, aditivado com anti-UV, de 75 micras de espessura. O tnel teve a funo de proteger as plantas do excesso de chuva (efeito guarda chuva), sendo que o mesmo ficava semi-aberto durante a conduo do experimento. Na rea central de cada canteiro foram demarcadas trs parcelas, ou seja, seis em cada estrutura de tnel alto, onde os tratamentos foram distribudos de modo aleatrio. Cada parcela mediu 4,0 m de comprimento por 1,2 m de largura, onde foram plantadas quatro linhas de alface espaadas entre si de 0,35 m. Em cada parcela, constaram 44 plantas. A rea til da parcela foi formada por 20 plantas das duas linhas centrais do canteiro. O sistema de irrigao utilizado durante a primeira semana nas duas pocas foi por asperso convencional e posteriormente por gotejamento. Este consistiu de duas linhas de tubo gotejador Streamline 6000, com vazo de 1,2 L h-1 por emissor. Aps a instalao dos tubos gotejadores, os canteiros foram cobertos por um filme plstico preto (mulching), com a finalidade de evitar a infestao de plantas daninhas e o contato das folhas da alface com o solo.
871

J. E. Yuri et al.

Tabela 1. Massa fresca total e comercial de cultivares de alface americana em funo das pocas de plantio. Santo Antnio do Amparo (MG), UFLA, 1998/19991.
Cultivar Cassino Legacy Lucy Brown Lorca Lady Raider C.V. (%) Massa fresca total (g planta-1) 1 epoca* 485,6 505,4 790,7 ab 820,4 a 609,4 8,5 c B c B B B c B 2 epoca* * 1226,2 a A 1235,6 a A 1278,8 a A 1199,7 a A 1210,0 a A 1248,5 a A 10,1 Massa fresca comercial (g planta -1) 1 epoca 332,8 b B 376,9 b B 559,3 a 620,0 a 9,7 B B 406,0 b B 415,0 b B 2 epoca 858,2 929,1 1037,2 926,3 970,0 996,3 11,3 a A a A a A a A a A a A

626,6 bc B

1 Mdias seguidas por letras minsculas iguais nas colunas e maisculas nas linhas para cada caracterstica no diferem entre si a 5% de probabilidade pelo teste de Tukey; *Perodo de setembro a dezembro; **perodo de fevereiro a maio.

Uma semana aps o transplantio, teve incio a adubao de cobertura realizada por fertirrigao, utilizando-se os adubos solveis nitrato de potssio, nitrato de clcio, sulfato de magnsio e cloreto de potssio, na dose de 40,0 kg ha-1 de N, 80,0 kg ha-1 de K20 e 50,0 kg ha-1 de Ca, aplicados diariamente . A fertirrigao foi feita at dois dias antes da colheita. O controle de doenas e pragas na primeira poca foi realizado com pulverizaes semanais com produtos base de cobre e com inseticida piretride. Na segunda poca, as pulverizaes foram realizadas, com os mesmos produtos a cada 15 dias, pois as condies climticas foram menos favorveis s pragas e doenas, devido menor precipitao. Para o controle das plantas daninhas, utilizou-se, a capina manual em torno das covas e o herbicida de contato paraquat entre os canteiros, utilizando protetor para evitar a deriva (Chapu de Napoleo). As colheitas foram realizadas aos 67 e 78 dias para os plantios nos anos de 1998 e 1999, respectivamente, quando as plantas apresentaram cabea bem formada e compacta, sendo avaliadas a massa fresca total e comercial, circunferncia da cabea comercial e comprimento do caule. Para a obteno da massa fresca total a planta foi cortada rente ao solo, com as folhas externas e internas e com a cabea compacta. A massa fresca comercial foi obtida removendo-se as folhas externas. Os dados obtidos foram submetidos anlise de varincia conjunta, sendo as mdias comparadas pelo teste de Tukey ao nvel de 5% de probabilidade.
872

RESULTADOS E DISCUSSO
Os resultados evidenciaram efeitos significativos para cultivares, pocas de plantio e a interao entre estes fatores (Tabelas 1 e 2). Para a primeira poca de plantio, maiores rendimentos de massa fresca total foram obtidos com as cultivares Lady (820,4 g planta-1) e Lucy Brown (790,7 g planta-1) que no mostraram diferenas significativas entre si (Tabela 1). Mota et al. (2003) em condies de vero em Lavras; sob cultivo em tnel alto, obtiveram massa fresca de 650,0 g planta -1, para a cultivar Raider, assim como Yuri et al. (2002), nas mesmas condies, no municpio de Boa Esperana, obtiveram para a cultivar Lucy Brown, 972,0 g planta-1, resultados estes semelhantes aos obtidos no experimento. No entanto, sob condies de casa de vegetao, Salatiel et al. (2001) utilizando a cultivar Lorca, nas condies de Jaboticabal, no vero e outono obtiveram 308,5 g planta-1, resultado bem inferior ao obtidos no presente experimento. Na segunda poca de cultivo, as cultivares no apresentaram diferenas significativas entre si para massa fresca total que oscilou entre 1119,7 g planta-1 (cultivar Lorca) a 1278,8 g planta-1 (cultivar Lucy Brown). Nas mesmas condies de cultivo, no municpio de Santana da Vargem, Yuri et al. (2004), obtiveram massa fresca total de 1075,2 g planta-1 para a cultivar Raider. As cultivares Lady e Lucy Brown apresentaram massa fresca total de 620,0 e 559,3 g planta-1, respectivamen-

te, com os melhores desempenhos na primeira poca de plantio (Tabela 1). Em condies de vero, Mota et al. (2003) em sistema de cultivo de tnel alto, em Santana da Vargem, encontraram variaes para as cultivares Raider e Lucy Brown entre 333,8 a 266,6 g planta-1, valores bem inferiores aos obtidos por estas cultivares no presente experimento (415,0 e 559,3 g planta-1, respectivamente). Para a segunda poca de cultivo no se verificaram diferenas significativas entre as cultivares, com massa fresca comercial entre 858,2 e 1037,2 g planta-1. Estes resultados so superiores aos observados por Mota (1999) e Bueno (1998) em condies de cultivo semelhante em Lavras, utilizando a cultivar Lorca, assim como aos alcanados por Gadum et al. (2002) em Botucatu, para as cultivares Raider e Lucy Brown. Todavia, Yuri et al. (2002) obtiveram resultados similares com a cultivar Raider em Boa Esperana (972,0 g planta-1). A cultivar Lady apresentou uma circunferncia de cabea de 47,2 cm na primeira poca e de 52,0 cm na segunda. uma cultivar que apresenta como destaque o tamanho da cabea comercial, o qual determina o melhor rendimento industrial. Na primeira poca, as cultivares Lady, Lucy Brown e Lorca apresentaram os melhores desempenhos com 47,2; 45,9 e 43,0 cm, respectivamente, de circunferncia de cabea, sem, no entanto diferirem entre si. As cultivares Legacy, com 36,3 cm e Cassino, com 40,6 cm, foram as que apresentaram os menores tamanhos de cabea (Tabela 2). Resultados semelhantes foram observados por Mota et al. (2003) que em condies de vero encontraram variaes entre 34,7 a 41,5 cm. Na segunda poca de plantio, a cultivar Lucy Brown apresentou a maior circunferncia com 53,4 cm, no diferindo das cultivares Lady (52,0 cm), Lorca (51,6 cm) e Raider (49,1 cm) (Tabela 2). Estes resultados foram superiores aos obtidos por Bueno (1998) onde a cultivar Lorca apresentou uma circunferncia da cabea de 45,0 cm, e por Mota (1999) que verificou uma circunferncia de 46,5 cm na mesma cultivar. Na Tabela 2 observa-se diferena significativa no comprimento de caule
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Comportamento de cultivares de alface americana em Santo Antnio do Amparo

entre as cultivares. No entanto, essa diferena, no afetou a formao da cabea comercial. Na primeira poca de plantio, a cultivar Legacy apresentou o menor comprimento com 3,3 cm; no entanto, estatisticamente sem diferenciar das cultivares Cassino, Lucy Brown, Lady e Raider. O maior valor foi apresentado pela cultivar Lorca com 4,5 cm (Tabela 2). Resultados semelhantes foram observados para a segunda poca, onde a cultivar Lady mostrou o menor comprimento (3,7 cm), seguida pelas cultivares Cassino, Raider e Lucy Brown, sem diferirem estatisticamente. O comprimento foi inferior ao apresentado por Bueno (1998), com a cultivar Lorca, de 6,8 cm. Mota et al. (2003) em cultivo de alface sob tnel alto, verificaram para as cultivares Raider e Lucy Brown comprimentos de caule de 7,1 e 5,3 cm, respectivamente. Menores comprimentos de caule so desejveis para a alface do tipo americana, principalmente quando destinada indstria de beneficiamento, uma vez que proporcionam menores perdas durante o processamento. Por outro lado, o caule excessivamente comprido acarreta uma menor compacidade da cabea e dificulta o beneficiamento, afetando a qualidade final do produto (YURI et al., 2002; RESENDE et al., 2003). Nas duas pocas avaliadas observaram-se diferenas significativas na massa fresca total e comercial para todas as cultivares testadas, sendo a segunda poca a mais produtiva. Assim como para circunferncia da cabea comercial, com exceo para a cultivar Lady. No comprimento do caule somente as cultivares Legacy e Raider apresentaram os menores valores na primeira poca de cultivo. Entretanto, para as duas pocas, todos os materiais apresentaram o comprimento de caule reduzido e dentro de um patamar considerado aceitvel de acordo com Resende (2004) que relata caules at 6,0 cm como os mais adequados, sendo aceitveis at o patamar de 9,0 cm e inaceitveis ou menos recomendados para processamento aqueles acima deste valor. A melhor performance do cultivo observada na segunda poca de plantio pode ser explicada pela melhor adaptao da cultura s condies de temperaturas mais amenas, tendo como tima a
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 2. Circunferncia de cabea e comprimento de caule de cultivares de alface americana em funo das pocas de plantio. Santo Antnio do Amparo (MG), UFLA, 1998/1999.
Cultivar Cassino Legacy Lucy Brown Lorca Lady Raider C.V. (%) Circunferncia da cabea (cm) 1 epoca* 40,6 36,3 45,9 ab 47,2 a 42,4 bc 3,7 cd B d B B A B 2 epoca* * 45,4 53,4 a 51,6 ab 52,0 ab 5,9 c A A A A 47,3 bc A Comprimento do caule (cm) 1 epoca 4,1 ab A 3,3 b B 4,2 ab A 4,5 a A 3,6 ab A 3,7 ab B 10,4 2 epoca 4,1 ab A 4,9 a 4,9 a A A 4,8 ab A 3,7 b A 4,6 ab A 12,0

43,0 abc B

49,1 abc A

Mdias seguidas por letras minsculas iguais nas colunas e maisculas nas linhas para cada caracterstica no diferem entre si a 5% de probabilidade pelo teste de Tukey; *Perodo de setembro a dezembro; **Perodo de fevereiro a maio.

faixa de 15,5 a 18,3C, conforme relata Sanders (1999), podendo tolerar alguns dias com temperaturas de 26,6 a 29,4C, desde que as temperaturas noturnas sejam baixas. Em funo dos resultados obtidos no presente estudo, pode-se concluir, para as condies do municpio de Santo Antnio do Amparo que a produo de alface do tipo americana vivel nas duas pocas de cultivo testadas, sendo a segunda poca, a mais favorvel para a obteno de melhores rendimentos. As cultivar Lady e Lucy Brown destacaram-se como as mais recomendadas para o cultivo na primeira poca, considerando a massa fresca comercial. Para a segunda poca de cultivo todas as cultivares mostraram-se produtivas no que se refere massa fresca comercial, no diferindo entre si; no entanto, levandose em considerao a maior circunferncia de cabea comercial e menor comprimento de caule, sugere-se as cultivares Lucy Brown, Lady e Raider como as mais promissoras.

LITERATURA CITADA
ALVARENGA, M.A.R. Crescimento, teor e acmulo de nutrientes em alface americana (Lactuca sativa L.) sob doses de nitrognio aplicadas no solo e de nveis de clcio aplicados via foliar. 1999. 117 f. (Tese doutorado) - UFLA, Lavras. BERNARDI, J.B.; IGUE, T. Comportamento de cultivares de alface na regio de Campinas. VI. Cultura de Setembro a Novembro de 1972. Revista de Olericultura: Campinas, v.13, p.29-31, 1973. BRUNINI, O.; LISBO, R.S.; BERNARDINI, J.B.; FORNASIER, J.B.; PEDRO JUNIOR, M.J. Temperaturas bsicas para alface, cultivar White Boston, em sistemas de unidades trmicas.

Bragantia: Campinas, v.19, n.35, p.213-219, 1976. BUENO, C.R. Efeito da adubao nitrogenada em cobertura via fertirrigao por gotejamento para a cultura da alface tipo americana em ambiente protegido. 1998. 54 f. (Tese mestrado) - UFLA, Lavras. CSSERES, E. Produccin de hortalizas. So Jos: Instituto Interamericano de Cincias Agrcolas, 1980. 387 p. CONTI, J.H. Caracterizao de cultivares de alface (Lactuca sativa L.) adaptadas aos cultivos de inverno e vero. 1994. 117 f. (Tese mestrado) ESALQ, Piracicaba. FERNANDES, H.S.; MARTINS, S.R. Cultivo de alface em solo em ambiente protegido. Informe agropecurio, Belo Horizonte, v.20, n.200/201, p.53-56, 1999. FILGUEIRA, F.A.R. Novo Manual de olericultura: agrotecnologia moderna na produo e comercializao de hortalias. Viosa: UFV. 2000, 402 p. GADUM, J.; SEABRA JNIOR, S.; CARNEIRO JNIOR A.G.; GOTO, R. Avaliao de diferentes cultivares de alface tipo Americana na regio de Botucatu sob ambiente protegido. Horticultura Brasileira, Braslia, v.20, n.2, julho, 2002. Suplemento 2. CD-ROM. JACKSON, L.; MAYBERRY, K.; LAEMMLEN, F.; KOIKE, S.; SCHLUBACK, K. Iceberg lettuce production in California. Disponvel em: <http// www.vegetablecrops.ucdavis>. Acesso em: 24 out. 1999. LEAL, N.R.; LIBERAL, M.T.; COELHO, R.G. Comportamento de cultivares de alface (Lactuca sativa L.) na regio serrana do Estado do rio de Janeiro. Revista Ceres, Viosa, v.21, n.118, p.506509, 1974. LENANO, F. Como se cultivam las hortalizas do hojas. Barcelona: Editorial Vecchi, 1973. 228 p. MOTA, J.H. Efeito do cloreto de potssio via fertirrigao na produo de alface americana em cultivo protegido. 1999. 46 f. (Tese mestrado) UFLA, Lavras. MOTA, J.H.; YURI, J.E.; FREITAS, S.A.C.; RODRIGUES JUNIOR, J.C.; RESENDE, G.M.; SOUZA, R.J. Avaliao de cultivares de alface americana durante o vero em Santana da Vargem, MG. Horticultura Brasileira, Braslia, v.21, n.2, p.234-237, 2003. NAGAI, H.; LISBO, R.S. Observaes sobre resistncia ao calor em alface (Lactuca sativaI L.). Revista 873

J. E. Yuri et al. de Olericultura, Campinas, n.18, p.7-13, 1980. RAIJ, B.; CANTARELLA, H.; QUAGGIO, J.A.; FURLANI, A.M.C. (eds). Recomendaes de adubao e calagem para o Estado de So Paulo. 2 ed.Campinas: IAC, 1996. p.22-27. (Boletim 100). RESENDE, G.M. Caractersticas produtivas, qualidade ps-colheita e teor de nutrientes em alface americana (Lactuca sativa L.) sob doses de nitrognio e molibdnio, em cultivo de vero e de inverno. 2004. 139 f. (Tese doutorado) - UFLA, Lavras. RESENDE, G.M.; YURI, J.E.; MOTA, J.H.; SOUZA, R.J.; FREITAS, S.A.C.; RODRIGUES JNIOR, J.C. Efeitos de tipos de bandejas e idade de transplantio de mudas sobre o desenvolvimento e produtividade de alface americana. Horticultura Brasileira, Braslia, v.21, n.3, p.562567, 2003. ROBINSON, R.W.; McCREIGT, J.D.; RYDER, J.E. The genes of lettuce and closely related species. In: JANICK, J. (ed.) Plant breeding reviews. Westport: AVI, 1983, v.1, 397 p. RYDER, E.J. Lettuce breeding . In: Breeding vegetables crops. Westport: AVI, 1986. p. 433-474. SALATIEL, L.T.; BRANCO, R.B.F.; MAY, A.; BARBOSA, J.C.; PAULA, C.M.; CECILIO FILHO, A.B. Avaliao de cultivares de alface em diferentes pocas de plantio, cultivadas em casa de vegetao. Horticultura Brasileira, Braslia, v.19, Suplemento CD-ROM, julho 2001. SANDERS, D. C. Lettuce production: Disponvel em: <http//www.ces.ncsu.edu/depts/hort/hil/ hil-11>. Acesso em: 11 out. 1999. THOMPSON, H.C. Lettuce varieties and culture. Washington: USDA, 1944. 38 p. (Farmers Bulletin, 1953) VIGGIANO, J. Produo de sementes de alface. In: CASTELLANE, P.D. (org.) Produo de sementes de Hortalias. Jaboticabal: FCAV/FUNEP, 1990. p.1-15. YURI, J.E. Avaliao de cultivares de alface americana em duas pocas de plantio em dois locais do sul de Minas Gerais. 2000, 51 f. (Tese mestrado) - UFLA, Lavras. YURI, J.E.; MOTA, J.H.; RESENDE, G.M.; SOUZA, R.J.; RODRIGUES JUNIOR, J.C. Desempenho de cultivares de alface tipo americana em cultivo de outono no sul de Minas Gerais. Cincia e Agrotecnologia, Lavras, v.28, n.2, p.284-288, 2004. YURI, J.E.; SOUZA, R.J.; FREITAS, S.A.C.; RODRIGUES JNIOR, J.C.; MOTA, J.H. Comportamento de cultivares de alface tipo americana em Boa Esperana. Horticultura Brasileira , Braslia, v.20, n.2, p.229-232, jun. 2002.

874

Hortic. bras., v. 23, n. 4, out.-dez. 2005

BOFF, P.; DEBARBA, J.F.; SILVA, E.; WERNER, H. Qualidade e sanidade de mudas de cebola em funo da adio de composto termfilo. Horticultura Brasileira, Braslia, v.23, n.4, p.875-880, out-dez 2005.

Qualidade e sanidade de mudas de cebola em funo da adio de composto termfilo


Pedro Boff1; Joo F. Debarba2; Edson Silva2; Hernandes Werner2
1 EPAGRI - Est. Exp. de Lages, C. Postal 181 88502-970 Lages-SC; E-mail: pboff@epagri.rct-sc.br;2EPAGRI - Est. Exp. de Ituporanga, C. Postal 121, 88400-000 Ituporanga-SC

RESUMO
Avaliou-se, em condies de campo, a influncia de composto termfilo como adubao de base e em cobertura de canteiros, na sanidade e na qualidade de mudas de cebola. A semeadura foi realizada em maio e junho de 1993 e de 1994. Trs experimentos foram delineados em blocos ao acaso, com seis repeties, tendo como tratamentos as adubaes de base por composto termfilo, incluindo descarte de cebola; por formulao comercial organo-mineral; e por composio NPK. Em outro experimento, a adubao mineral e o composto termfilo foram combinadas em esquema fatorial com seis densidades de semeadura, tendo trs repeties. Para a cobertura das sementes no leito de canteiros, foram avaliados num quinto experimento, o p-de-serra de Pinus novo, p-de-serra de Pinus com um ano, solo e composto termfilo, em delineamento de blocos ao acaso, com quatro repeties. A adubao por composto apresentou maior emergncia e sobrevivncia de mudas do que a adubao organo-mineral e mineral, nos trs experimentos estudados. Independentemente da densidade de semeadura, o composto termfilo, como adubao de base, proporcionou maior sobrevivncia de mudas (101,4 pl/m2) e menor intensidade de ataque de Botrytis squamosa (51,7%), em comparao com adubao mineral (85,7 pl/m 2 e 56,8%). Quando usado em cobertura das sementes, o composto propiciou maior emergncia (146,1 pl/m2) e sobrevivncia de mudas (134,8 pl/m2) do que a cobertura com terra (90,2 e 77,5 pl/m2, respectivamente). No houve influncia, entre os tipos de adubao de base e/ou de cobertura, na ocorrncia do tombamento de plntulas de cebola. Palavras-chave: Allium cepa, Botrytis squamosa, tombamento, adubo orgnico, produo de mudas.

ABSTRACT
Quality and health of onion seedlings by adding thermophilic compost The effect of thermophilic compost on onion diseases and seedling quality used as basic fertiliser or bed cover was evaluated. The research was carried out in 1993 and 1994 in Ituporanga, Santa Catarina State, Brazil. Three experiments were conducted in randomised blocks with six replicates. The treatments were thermophilic compost, mineral fertilizer and organic-mineral fertilisers. In another experiment, the compost and the mineral fertiliser were combined with six plant densities in a factorial design experiment. For the seed bed coverage, new and one-year-old Pinus sawdust, soil, and thermophilic compost were evaluated using a randomised block design with four replicates. Thermophilic compost showed higher emergence and survival of onion transplants than organic-mineral and mineral fertiliser. The thermophilic compost increased the survival of onion transplants (101.4 pl/m2) and reduced Botrytis squamosa intensity (51.7%) when compared with the mineral fertiliser (87.7 pl/m2 and 56.8%) regardless of plant density. Onion seedlings grown on seedbeds covered with compost presented higher emergence (146.1 pl/m2) and survival of seedlings (134.8 pl/m2) than those grown using only soil as coverage (90.2 and 77.5 pl/m2, respectively). The occurrence of damping-off did not differ between treatments with fertilisers alone or treatments in which coverage was used in the seedbed.

Keywords: Allium cepa, Botrytis squamosa, damping-off, organic fertiliser, transplants.

(Recebido para publicao em 12 de maio de 2004 e aceito em 5 de julho de 2005)

cultura da cebola (Allium cepa L), nas principais regies de cultivo no Brasil, tem se caracterizado pelo uso intensivo do solo, emprego crescente de agroqumicos e poucas prticas culturais que possam oferecer sustentabilidade ao sistema produtivo (EPAGRI, 2000). Em Santa Catarina por exemplo, o controle das principais doenas da cebola, que vinha sendo feito com duas a trs aplicaes de fungicidas, passou a receber nos ltimos 10 anos, mais de 15 intervenes no mesmo ciclo de cultivo (dados no publicados). Este aumento no uso de agrotxicos decorrente, em grande parte, da expanso da cultura em monocultivo, do

estreitamento gentico das cultivars comerciais e do prprio efeito negativo que estes agrotxicos e a abusiva adubao mineral de alta solubilidade causam flora e fauna local (GONALVES, 2001). A supresso de doenas e pragas em plantios comerciais, pode ser vista como manifestao da estabilidade e sade do agroecossistema (THURSTON, 1992). Portanto, o restabelecimento da sade solo-planta, em termos de conferir resilincia ao agroecossistema em resposta a distrbios, de fundamental importncia na reduo da necessidade de uso de agroqumicos (VAN BRUGGEN; SEMENOV, 2000).

No sul do Brasil, as principais doenas na cultura da cebola so a queimaacinzentada (Botrytis squamosa ) e o mldio (Peronospora destructor) na fase de muda, ao passo que na fase ps-transplante, as mais freqentes so o prprio mldio e a mancha-prpura (Alternaria porri) (BOFF, 1996). A sanidade da muda de cebola durante o perodo de canteiro afeta diretamente o desenvolvimento da cultura no ps-transplante, visto que a necrose e morte de folhas nesta fase, reduz o tamanho de bulbo e enfraquece a qualidade de pelcula dos mesmos para o armazenamento (BOFF, 1994). Tem-se verificado que solos enriquecidos com matria orgnica, via adubo
875

Hortic. bras., v. 23, n. 4, out.-dez. 2005

P. Boff et al.

verde, propiciam plantas de cebola tolerantes ao ataque de doenas e pragas, conferindo maior resistncia de bulbos durante o armazenamento. A influncia da adubao na ocorrncia de doenas em plantas tem sido amplamente discutida e particularmente estudada por alguns autores na adio de compostos orgnicos (HOITINK; FAHY, 1986; PAULITZ; BAKER, 1987; HUBER, 1994; ELAD; SHTIENBERG, 1994). Huelsman e Edwards (1998) observaram que a adio de esterco compostado de gado reduziu, significativamente, a incidncia de bacterioses (Pseudomonas syringae pv. lachrymans e Erwinia tracheiphila) em pepino e da antracnose (Colletotrichum piperatum) em pimento, quando comparado adio de adubo mineral nas propores equivalentes de macronutrientes. Mecanismos envolvidos na promoo de sade de plantas, via adio de composto, incluem o estmulo da atividade antagonista local ou adicionada pelo composto, a induo de resistncia e o efeito trfico na planta (HOITINK; FAHY, 1986; ZHANG et al., 1996; RAUPP, 1999). McQuilken et al. (1994) estudando a ao do extrato aquoso de esterco de gado com palha na atividade de Botrytis cinerea em alface, observaram reduo da severidade desta doena, sugerindo estarem envolvidos mecanismos de antibiose e induo de resistncia. O efeito de resistncia sistmica adquirida, definida como aquela capaz de expressar-se distante do sitio inicial quando exposto ao indutor ou agente externo, sem afetar o DNA gemnico da planta, de particular interesse no controle de doenas da parte area de plantas, via manejo de adubao (VAN LOON et al., 1998; MTRAUX et al., 2000). Os agentes de induo por sua vez, podem ser microorganismos, agentes fsicos ou substncias qumicas capazes de despertar resistncia do hospedeiro a uma larga gama de patgenos. Por outro lado, o potencial supressivo e a induo de resistncia por compostos orgnicos influenciado pelo processo de compostagem e pelo nvel de maturao (HOITINK; FAHY, 1986). No Estado de Santa Catarina, o sistema de cultivo de cebola utiliza-se de mu876

das transplantadas. O ciclo de cultivo relativamente longo e a colheita coincidente com a entrada de cebola da Argentina, obrigando o armazenamento dos bulbos por um perodo de at quatro meses (EPAGRI, 2000). A ocorrncia de perodos chuvosos na poca de colheita obriga o armazenamento dos bulbos, muitas vezes em condies precrias, resultando em grandes perdas (BOFF, 1996). O material advindo do descarte e da subseqente toalete na comercializao dos bulbos composto de escamas, razes, folhas secas e bulbos deteriorados. hbito do produtor de cebola, depositar este material em barrancas de rios, beiras de estradas ou outros locais longe de lavouras, pelo tradicional argumento de que restos culturais trariam doenas aos prximos cultivos de cebola. No obstante esta prtica possa ser justificada, a reciclagem local dos restos de descarte de cebola pelo processo de compostagem poderia oferecer uma melhor alternativa, no s em temos econmicos mas tambm sob ponto de vista ambiental. Quando o processo de compostagem for do tipo termfilo, alcanando temperaturas de at 70 ou 80C, h uma reduo substancial de estruturas de patgenos e insetos-praga presentes nos restos culturais (GALUEKE, 1972; HOITINK; FAHY, 1986). Por outro lado, o composto oriundo do processo termfilo possibilita enriquecimento biolgico, pela colonizao de micro-organismos benficos nos sucessivos revolvimentos da pilha. Do ponto de vista nutricional, o uso de composto orgnico para adubao de plantas propicia disponibilizao gradativa e contnua de nutrientes sem haver excesso e/ou consumo de luxo, favorecendo o metabolismo da proteossntese e minimizando com isto o ataque de doenas e pragas (CHABOUSSOU, 1980; SCHELLER, 2001). O objetivo do presente trabalho foi estudar o efeito do composto termfilo resultante do descarte de bulbos na adubao de base e em cobertura de sementeiras e os possveis efeitos desta tcnica na sanidade e na qualidade de mudas de cebola.

MATERIAL E MTODOS
Conduziram-se cinco experimentos de campo na Estao Experimental da

Epagri, Ituporanga, durante a fase de muda da cebola, nos anos de 1993 e 1994, em Cambissolo lico. Foram instalados trs experimentos em pocas distintas de semeadura (maio/ 93, junho/93 e junho/94) utilizando-se blocos ao acaso com seis repeties. Nos trs experimentos, os tratamentos constaram de trs tipos de adubao de base nas seguintes modalidades: a) Adubao mineral, na dosagem de 300 g/m2 de NPK (frmula 5-20-10), incorporada ao solo 10 dias antes da semeadura; b) Adubao organo-mineral, formulao comercial Prochnov, Trombudo Central (SC), na dosagem de 3 L/m2 incorporada 10 dias antes da semeadura. Nesta formulao utiliza-se cama de avirio e 20% de complemento mineral de NPK (2-2-2); c) Adubao com composto (10 L/m 2 ) oriundo da compostagem termfila. Este composto foi elaborado com capim Cameroon (Pennisetum purpureum) triturado, esterco bovino e descarte de cebola triturado (1:1:1, base em volume), intermediada por finas camadas de cinza-de-arroz (combusto incompleta da casca de arroz), na proporo de 5% do total do composto e de calcrio dolomtico, sendo este ltimo espalhado na quantidade de 100 g/m, em duas seces horizontais da pilha. O composto foi revolvido aos 35 e 70 dias, sendo utilizado aps 120 dias a partir da formao da pilha. Para o ano de 1993, utilizou-se a cultivar de cebola Bola precoce, na semeadura de maio, e a populao Crioula, na semeadura de junho. No ano de 1994, com semeadura em junho, utilizou-se a populao Crioula. Outro experimento com semeadura em junho de 1994, foi conduzido em delineamento de blocos ao acaso, com trs repeties e em arranjo fatorial, utilizando-se a populao Crioula. Os fatores principais foram densidade e tipo de adubao. O fator densidade teve os nveis de 1,0; 2,0; 2,5; 3,0; 4,0 e 5,0 gramas de semente por metro quadrado e o fator adubao, em duas formas de adubao de base: composto e adubao mineral, nas mesmas propores dos experimentos acima descritos. No houve aplicao de fungicida para possibilitar avaliao da intensidade de queima-acinzentada.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Qualidade e sanidade de mudas de cebola em funo da adio de composto termfilo

Tabela 1. Nmero de plantas emergidas (EM), tombadas (TO), remanescentes aps tombamento (ES), sobreviventes at a poca de transplante (SO) e peso fresco em gramas por planta (PF) de mudas de cebola submetidas a diferentes tipos de adubao de base. Ituporanga, EPAGRI, 1993/94.
poca de semeadura Maio/93 Adubao base Composto Organo-min. Mineral C.V. Composto Junho/93 Organo-min. Mineral C.V. Composto Junho/94 Organo-min. Mineral C.V. EM 1/ 203,1 a 179,1 b 171,4 b 12,4 222,6 a 197,4 ab 191,5 b 14,5 138,7 a 119,1 b 122,9 b 10,1 TO 2/ 9,5 ns 11,9 2,4 131, 0,8 ns 2,6 1,2 100, 2,3 ns 1,8 4,3 59,3 ES3/ 194,2 a 177,6 a 116,9 b 15,4 218, a 194, a 184, a 16,2 134, a 118, a 114, b 12,2 SO 4/ 194,0 a 177,5 a 116,7 b 16,5 221,4 a 189,5 ab 166,8 b 24,8 124, a 111, ab 99, b 17,1 PF5/ 3,2 a 2,6 b 2,4 b 23,7 4,1 b 5,6 ab 5,7 a 25,1 3,5 b 4,4 a 3,7 ab 25,4

*Mdias seguidas pela mesma letra, na vertical, dentro de cada poca de semeadura, no diferem entre si (Tukey, 0,05).; ns = diferenas no significativas.

Um quinto experimento foi conduzido em blocos ao acaso com quatro repeties, utilizando-se a cultivar Bola Precoce, com semeadura em maio de 1994. Os tratamentos constaram de quatro coberturas sobre o leito dos canteiros, na espessura de 2 cm, onde as sementes eram previamente semeadas, que foram: a) composto, j descrito acima; b) solo, do prprio local; c) p-de-serra de Pinus, do ano; d) p-de-serra de Pinus, com um ano de idade. Utilizou-se, como adubao de base, 300 g/m2 de adubo mineral NPK, frmula 5-20-10. A profundidade de semeadura foi de 2 cm, utilizando-se como cobertura da semente o p-de-serra de Pinus, exceto no quinto experimento, onde o objeto de estudo foi o tipo de cobertura. O controle de plantas daninhas foi manual. A irrigao foi feita conforme necessidade da cultura, sendo, no mximo, uma vez por semana. As parcelas constaram de 3 m2, tendo como rea til 1 m2. Avaliou-se o nmero de plantas emergidas, nmero de plantas tombadas, nmero de folhas cotiledonares (chicote) tombadas e nmero de plantas remanescentes aps tombamento (estande). Por ocasio do transplante, avaliou-se tambm o nmero de plantas sobreviventes, o peso fresco e seco de plantas. A queimaacinzentada foi avaliada, semanalmente, at 15 dias antes do arranquio das mudas, estimando-se a proporo de rea foliar necrosada pela doena conHortic. bras., v. 23, n. 4, out.-dez. 2005

forme metodologia modificada de Stuker e Boff (1998). A ocorrncia da queima-acinzentada foi estimada considerando-se o nmero de folhas totais, a altura mdia de folhas e a proporo de rea foliar necrosadas devido aos sintomas da doena, em quatro sub-amostras no destrutiva de 0,25 m2 por parcela. As sub-amostras eram delimitadas com auxlio de um quadriculado de madeira (0,5 x 0,5 m) lanado aleatoriamente em cada avaliao. Dados coletados de todos os experimentos foram submetidos anlise de varincia para cada tipo de delineamento, blocos ao acaso ou fatorial, com auxlio do pacote estatstico SAS , seguido de teste de mdias Tukey (0,05), quando o valor de F fosse menor ou igual a 0,05. A no interao entre adubao e densidade no experimento em arranjo fatorial permitiu anlise independente desses fatores. Os dados das caractersticas avaliadas em funo da densidade foram submetidos regresso mltipla e modelos de equao foram selecionados pelo seu maior coeficiente de determinao encontrado.

RESULTADOS E DISCUSSO
A aplicao do composto termfilo proporcionou maior emergncia e sobrevivncia de mudas at o transplante, em comparao com adubao mineral, nas trs pocas de semeadura da cebola estu-

dadas (Tabela 1). A adubao organomineral no diferiu da adubao mineral, em todas as caractersticas consideradas, exceto no nmero de mudas remanescentes aps o tombamento nos experimentos com semeadura em maio de 1993 e junho de 1994 e no nmero de mudas sobreviventes at o transplante, no experimento com semeadura em maio de 1993. Shiau et al. (1999) relataram que certos compostos orgnicos, formulao comercial FBN-5A por exemplo, quando adicionada a substratos promoveram melhor desenvolvimento de plantas de repolho, tanto em casa de vegetao como em plantios comerciais, alm de serem efetivos no controle de Rhizoctonia solani. No quarto experimento com semeadura em junho de 1994 no houve interao, entre o tipo de adubao e a densidade de semeadura da cebola. No fator adubao, observou-se que a adubao mineral e o composto termfilo no diferiram na emergncia de plantas, no peso da massa fresca ou seca produzida e no tombamento (Tabela 2). Entretanto, canteiros enriquecidos pelo composto apresentaram maior sobrevivncia de plantas at o transplante. Em contraste, canteiros adubados organicamente, mesmo apresentando maior densidade de plantas sobreviventes, foram menos atacados por B. squamosa. Sabe-se que o fungo B. squamosa tem sua principal forma de sobrevivncia como esclerdios
877

P. Boff et al.

Figura 1. Massa seca (MSE), severidade por Botrytis squamosa (SEV), peso mdio por planta (PME), Emergncia (EME), sobrevivncia (SOB), tombamento de plntulas (TOM) de mudas de cebola submetidas a diferentes densidades de semeadura. Ituporanga, EPAGRI, 1994.

Tabela 2. Emergncia (EM), sobrevivncia (SO), peso fresco (PF), massa seca (MS), severidade da queima-acinzentada (SE) e tombamento (TO) de mudas de cebola submetidas a aplicao de composto termfilo e adubao mineral. Ituporanga, EPAGRI, 1994.
Adubao Composto Mineral CV EM 1/ 170,9 ns 174,3 ns 20,1 SO 2/ 101,4 a * 85,7 b 28,10 PF3/ 4,61 ns 4,12 ns 60,1 MS4/ 14,9 ns 12,9 ns 53,0 SE5/ 51,7 b* 56,8 a 16,8 TO 6/ 1,3 ns 2,9 ns 124,7

*Mdias seguidas pela mesma letra na vertical no diferem entre si (F = 0,05); ns = diferenas no significativas.

em restos culturais, sendo tambm a fonte primria de inculo entre ciclos de cultivo (BOFF, 1994). A adio de composto que possivelmente possibilitou o aumento da atividade antagonista na rizosfera pde ter reduzido a viabilidade das estruturas de resistncia deste fungo (PEREIRA et al., 1996). De fato, Walker e Maude (1975) observaram que os esclerdios de Botrytis spp sofrem naturalmente antagonismo por Gliocladium roseum, especialmente em solos ricos em matria orgnica. O aumento da densidade de semeadura de 1 para 5 g/m 2 reduziu gradativamente a sobrevivncia e o peso mdio de mudas, independentemente do tipo de adubao utilizada (Figura 1). Os produtores de cebola, no sistema corrente de transplante, utilizam altas densidades, acima de 3 g/m2, com o propsito de melhor aproveitamento da rea
878

de canteiros. Isto, no entanto, favorece a ocorrncia de doenas, principalmente da queima-acinzentada, cuja severidade em pocas midas de inverno, causam morte das mudas atacadas (BOFF, 1994). Resultados semelhantes foram obtidos no adensamento de plantas de cebola em ps-transplante, onde populaes adensadas, acima de 300.000 pl/ ha, aumentou a incidncia de Alternaria porri e reduziu a produo comercial de bulbos (BOFF et al., 1998). A cobertura da semente com composto termfilo proporcionou maior emergncia, maior nmero de mudas remanescentes aps tombamento e maior nmero de mudas sobreviventes at o transplante, em comparao com a cobertura por solo (Tabela 3). Estudos feitos em repolho por Shiau et al. (1999) mostraram que a adio de composto no substrato de mudas no s teve efeito

supressivo nas doenas, mas tambm melhorou substancialmente a qualidade de mudas para plantios comerciais. No presente trabalho, o tombamento de plntulas no diferiu entre as coberturas, embora o tombamento da folha chicote foi maior na cobertura por p-deserra de ano e por composto. A anlise de amostras de plntulas e folhas tombadas no apresentou presena de fitopatgenos, indicando ser o problema de origem abitica. Sua ocorrncia esteve relacionada com altas precipitaes nos dias anteriores avaliao (Dados no apresentados). Provavelmente, a alta umidade no leito do canteiro favoreceu o enfraquecimento da axila foliar, facilitando o tombamento da lmina foliar (chicote). Houve tendncia da cobertura por composto ser melhor que o p-de-serra de ano e este melhor que o p-de-serra novo, quanto emergncia, estande e sobrevivncia de mudas. O composto termfilo pode ter proporcionado maior estabilidade biolgica por no demandar suprimento de nutrientes, principalmente, nitrognio, como estaria acontecendo com a cobertura por p-de-serra, cujo material necessita passar por um processo de estabilizao biolgica (GALUEKE, 1972). Nesta cobertura por p-de-serra, a atividade microbiana requer suprimento extra de nutrientes, a fim de iniciar a decomposio da matria orgnica, o que vem a desequilibrar o desenvolvimento inicial da plntula de cebola (SCHELLER, 2001). O maior teor de massa seca e maior sobrevivncia de plantas (Tabelas 2 e 3) e a menor intensidade da queimaacinzentada (Tabela 2) proporcionado pela adubao de base ou cobertura por composto pode estar relacionado, no seu conjunto, com os mecanismos de suprimento equilibrado de nutrientes e de resistncia induzida patgenos (PEREIRA et al.,1996; SCHELLER, 2001; RAUPP, 1999). Segundo Chaboussou (1987), adubos com fontes nitrogenadas de alta solubilidade, como os formulados minerais N-P-K, deixam a planta em estado de protelise dominante, aumentando as substncias solveis, principalmente aminocidos, que favorecem o parasitismo por fungos. A qualidade de mudas pode ainda ser influenciada pela
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Qualidade e sanidade de mudas de cebola em funo da adio de composto termfilo

Tabela 3. Emergncia (EM), tombamento de plntulas (TOp), tombamento da folha cotiledonar (TOfc), estande aps tombamento (ES), sobrevivncia de plantas por ocasio do transplante (SO), massa seca (MS) e peso fresco (PF) de mudas de cebola submetidas a diferentes coberturas de conteiros. Ituporanga, EPAGRI, 1994.
Cobertura Composto Terra P-de-serra novo P-de-serra de ano C.V. Dias aps semeadura EM 1/ 146,1 a 90,2 b 135,2 a 141,1 a 7,1 30 TOp2/ 4,3 6,6 7,1 9,2 34,8 33 TOfc3/ 50,4 a 17,6 b 34,2 b 36,8 ab 14,5 35 ES4/ 135,3 a 77,8 b 109,3 ab 108,3 ab 11,8 40 SO 5/ 134,8 a 77,5 b 101,8 ab 106,1 ab 15,6 transplante MS6/ 11,7 ns 10,8 10,1 9,7 8,5 = PF7/ 5,1 ns 3,4 4,1 3,6 17,5 =

* Mdias seguidas pela mesma letra, na vertical no diferem entre si (Tukey, 0,05); ns = diferenas no significativas.

micorrizao, cuja adio de compostos orgnicos facilita o estabelecimento desta associao simbitica, com rpida resposta na cultura da cebola (LINDERMAN, 1989). De modo geral, conclui-se que o composto termfilo utilizado, incluindo descarte de cebola, utilizado como adubao de base ou em cobertura de canteiro, propiciou mudas de cebola mais resistentes/tolerantes ao ataque de Botrytis squamosa e maior sobrevivncia de plantas para o transplante. possvel que os produtores de cebola possam obter mudas de melhor qualidade e que respondam a melhores produes de bulbo, pelo uso da adubao orgnica, oriunda do processo de compostagem termfila. Alm disso, o maior teor de massa seca das mudas produzidas em solos enriquecidos por compostagem, pode influir na melhor conservao de bulbos, visto estar relacionado com o teor de slidos solveis que o principal parmetro utilizado na avaliao de conservao dos mesmos (EPAGRI, 2000). No se verificou, neste trabalho, a transmisso de patgenos da cebola atravs do composto, que pudesse inviabilizar a incluso de palha e bulbos descartados no processo da compostagem termfila. Assim, o emprego do processo termfilo de compostagem pode viabilizar a reciclagem adequada de descarte de cebola em vista de dar maior sustentabilidade ao sistema de cultivo, pois propicia destino adequado deste descarte, reduz os riscos da fonte de inculo de patgenos oriundos dos restos culturais e possibilita o aumento da matria orgnica favorecendo o enriquecimento da biodiversidade do solo.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

AGRADECIMENTOS
Os autores agradecem a colaborao de Adriana Campos e de Marcelo Pitz nas atividades de laboratrio e de campo, respectivamente.

LITERATURA CITADA
BOFF, P. O complexo Botrytis spp, causando doenas em cebola. Revista Agropecuria Catarinense, Florianpolis, v.7, n.13, p.14-16, 1994. BOFF, P. Levantamento de doenas na cultura da cebola, em Santa Catarina. Fitopatologia Brasileira, Braslia, v.21, n.1, p.110-114, 1996. BOFF, P.; STUKER, H.; GONALVES, P.A.S. Influncia da densidade de plantas na ocorrncia de doenas foliares e produo de bulbos de cebola. Horticultura Brasileira, Braslia, v.23, n.4, p.448-452, 1998. CHABOUSSOU, F. Les Plants Malades ds Pesticides; bases nouvelles dune prevention contre maladies et parasites. Paris: Ed. Debard, 1980. 270 p. ELAD, Y.; SHTIENBERG, D. Effect of compost water extracts on grey mould (Botrytis cinerea). Crop Protection, v.13, n.2, p.109-114, 1994. EPAGRI. Sistemas de produo para cebola. Florianpolis: Epagri, 2000. 91 p. GALUEKE, C.G. Composting; a study of the process and its principles. Pennsylvania, EUA: Rodale Press, 1972. 110 p. GONALVES, P.A.S. Impacto de adubaes mineral e orgnica sobre a incidncia de tripes, Thrips tabaci Lind., e mldio , Peronospora destructor Berk. Casp., e da diversidade vegetal sobre tripes e sirfdios predadores em cebola , Allium cepa L. So Carlos, UFSCar, 2001. 123 f. (Tese doutorado) HOITINK, H.A.J.; FAHY, P.C. Basis for the control of soilborne plant pathogens with composts. Annual Review of Phytopathology, v.24, p.93-114, 1986. HUBER, D.M. The influence of mineral nutrition on vegetable disease. Horticultura Brasileira, Braslia, v.12, n.2, p.206-214, 1994.

HUELSMAN, M.F.; EDWARDS, C.A. Management of disease in cucumbers (Cucumis sativus) and pappers (Capsicum annum) by using composts and fertility inputs. In: BRIGHTON CROP PROTECTION CONFERENCE: Pests & Diseases, 3. 1998, Brighton, UK. Proceedings Farnham, UK: BCP Council, 1998. p.881-886. LINDERMAN, R.G. Organic amendments and soil-born diseases. Canadian Journal of Plant Pathology, v.11, n.1, p.180-183, 1989. McQUILKEN, M.P.; WHIPPS, J.M.; LYNCH, J.M. Effects of water extracts of a composted manure-straw mixture on the plant pathogen Botrytis cinerea. World Journal of Microbiology and Biotechnology, v.10, n.1, p.20-26, 1994. MTRAUX, J.P.; NAWRATH, C.; GENOUD, T. Systemic acquired resistance. In: INTERNATIONAL SYMPOSIUM OF DURABLE DISEASE RESISTANCE: KEY TO SUSTAINABLE AGRICULTURE, 2000, Ede, NL. Book of abstracts Wageningen, NL: WAU, 2000, p.24. PAULITZ, T.C.; BAKER, R. Biological control of Pythium damping-off of cucumbers with Pythium nunn: influence of soil environment and organic amendments. Phytopathology, v.77, n.2, p.341-346, 1987. PEREIRA, J.C.R.; ZAMBOLIM, L.; RIBEIRO DO VALE, F.X.; CHAVES, G.M. Compostos orgnicos no controle de doenas de plantas. Reviso Anual de Patologia de Plantas, Passo Fundo, v.4, p.353-379, 1996. RAUPP, J. Fertilization systems in organic farming based on long-term experiments . Darmstadt, Germany: Institute for Biodynamic Research, 1999. 62 p. (EU report, project. AIR3CT94-1940). SCHELLER, E. Fundamentos cientficos da nutrio vegetal na agricultura ecolgica. Trad. B.T. Sixel. Botucatu: ABD, 2001. 78 p. SHIAU, F.L.; CHUNG, W.C.; HUANG, J.W.; HUANG, H.C. Organic amendment of commercial culture media for improving control of Rhizoctonia damping-off of cabbage. Canadian Journal of Plant Pathology, v.21, n.2, p.368-374, 1999. STUKER, H.; BOFF, P. Tamanho da amostra na avaliao da queima-acinzentada em canteiros de cebola. Horticultura Brasileira, Braslia, v.16, n.1, p.10-13, 1998. THURSTON, H.D. Sustainable practices for plant disease management in traditional farming systems. Colorado, USA: Westview Press, 1992. 279 p. 879

P. Boff et al. Van BRUGGEN, A.H.C.; SEMENOV, A.M. In search of biological indicators for soil health and disease suppression. Applied Soil Ecology, v.15, n.1, p.13-24, 2000. Van LOON, L.C.; BAKKER, P.A.H.M.; PIETERSE, C.M.J. Systemic resistance induced by rhizosphere bacteria. Annual review of phytopathology, v.36, p.453-483, 1998. WALKER, J.A.; MAUDE, R.B. Natural occurrence and growth of Gliocladium roseum on the mycelium and sclerotia of Botrytis allii . Transaction of the British Mycological Society, v.65, n.2, p.335-337, 1975. ZHANG, W.; DICK, W.A.; HOITINK, H.A.J. Compost-induced acquired resistance in cucumber to Pythium root rot and anthracnose. Phytopathology , v.86, n.10, p.1066-1070, 1996.

880

Hortic. bras., v. 23, n. 4, out.-dez. 2005

HENZ, G.P.; SOUZA, R.M.; PEIXOTO, J.R.; BLUMER, L. Danos causados pelo impacto de queda na qualidade ps-colheita de razes de mandioquinhasalsa. Horticultura Brasileira, Braslia, v.23, n.4, p.881-886, out-dez 2005.

Danos causados pelo impacto de queda na qualidade ps-colheita de razes de mandioquinha-salsa1


Gilmar Paulo Henz; Roberto M. Souza;Jos Ricardo Peixoto; Lucimara Blumer4
2

Embrapa Hortalias, C. Postal 218, 70359-970 Braslia-DF, E-mail: gilmar@cnph.embrapa.br; 3FAV - Universidade de Braslia, 70910-970 Braslia-DF; 4Consultora Estatstica, Prodetab/Embrapa.

RESUMO
Como as razes de mandioquinha-salsa so frgeis e muito suscetveis a ferimentos, avaliou-se os danos fsicos que ocorrem nas razes devido ao impacto de queda no manuseio ps-colheita e suas conseqncias na durabilidade do produto. As razes foram soltas de duas alturas (45 e 90 cm) e trs posies de queda: horizontal; vertical com ombro para baixo (=distal) e para cima (=proximal), simulando-se uma situao comum no beneficiamento e na comercializao. O experimento foi conduzido em delineamento casualizado com trs repeties de 40 razes por parcela. Aps a queda, as razes foram examinadas individualmente, determinandose os tipos de ferimentos (quebradas, rachaduras, rupturas, leses superficiais) em relao quelas aparentemente intactas. A altura de queda afetou diretamente a incidncia de injrias mais graves, como quebras e rupturas. Na queda de 90 cm, a posio de soltura proximal causou 40,7% de rachaduras, 19,2% de rupturas e 22,3% de leses superficiais; na posio distal causou 45,8% de rupturas e 23,3% de quebra nas razes. Em outro experimento, avaliou-se a respirao, perda de matria fresca e a deteriorao em razes submetidas injria por impacto de queda (90 cm) e armazenadas a 5oC e 24oC, comparadas com testemunhas no injuriadas, em trs repeties (1,5 kg razes/parcela) distribudas ao acaso. As razes submetidas injria por queda apresentaram taxas respiratrias superiores em comparao com aquelas intactas quando mantidas na mesma temperatura, e a 24oC variou de 15,3 ml CO2 kg-1 h-1 (intactas) a 34,4 ml CO2 kg-1 h-1 (injuriadas). As razes injuriadas mantidas a 24oC apresentaram 84% de deteriorao aps quatro dias, enquanto aquelas a 5oC no apresentaram deteriorao.

ABSTRACT
Damages caused by drop impact on the postharvest quality of arracacha roots Arracacha roots are very fragile and susceptible to mechanical damage. The postharvest handling system may cause many lesions, mainly by impacts and drops. The effect of drop impact on arracacha roots was simulated in two drop heights (45 and 90 cm) and three release positions of the roots (horizontal, vertical distal and vertical proximal). The experiment was carried out in a randomized block design, with three replicates (40 roots per and three release positions of the roots (horizontal, vertical distal and vertical proximal). The experiment was carried out in a randomized block design, with three replicates (40 roots per parcel). After the drop, roots were examined individually and the resulting mechanical damage was categorized in four types of lesions (broken, fracture, rupture and abrasion) compared to those apparently undamaged. Drop height affected directly the incidence of more serious mechanical damage, such as broken roots and ruptures. The root position also affected the resulting mechanical damage: roots released from the proximal position at 90cm drop height had significantly higher fractures incidence (40.7%), ruptures (19.2%) and superficial lesions (22.3%) than other treatments. At the 90 cm drop height, roots released from the proximal position had 40.7% of fractures, 19.2% of ruptures and 22.3% of superficial lesions; roots released from the distal position caused 45.8% of ruptures and 23.3% of broken roots. The respiration rates and deterioration of arracacha roots submitted to mechanical damage (90 cm height fall impact) and storage (5oC and 24oC) during four days showed that at the same temperature, mechanically damaged roots had higher respiration rates when compared to sound roots, ranging from 15.3 ml CO2 kg-1 h-1 (unbruised) to 34.4 ml CO2 kg-1 h-1 (damaged) at 24oC. Injured roots kept at 24oC had 84% of deterioration after four days, while those kept at 5oC were completely sound. Keywords: Arracacia xanthorrhiza, mechanical damage, lesions, respiration, deterioration.

Palavras-chave: Arracacia xanthorrhiza, danos mecnicos, leses, respirao, deteriorao.

(Recebido para publicao em 17 de Janeiro de 2005 e aceito em 27 de setembro de 2005)

s produtos hortcolas esto sujeitos a diversos tipos de danos aps a colheita, ocasionados por condies inadequadas de manuseio e armazenagem, doenas e injrias mecnicas. A respirao o principal processo fisiolgico em rgos vegetais depois da colheita, sendo afetada por diversos fatores, tais como temperatura, composio da atmosfera e estresses qumicos, biolgicos e fsicos (KAYS, 1991 ; KADER et al.,1992; MORETTI et al.,
1

2000). No Brasil, no existe uma preocupao muito evidente com a incidncia de injrias mecnicas nos sistemas de manuseio ps-colheita adotados para hortalias. Entretanto, as conseqncias dos danos mecnicos podem ser uma causa primria de perdas nas etapas subseqentes porque aceleram a taxa de perda de gua, levando a um acrscimo na taxa respiratria e diminuio da matria seca dos produtos (WILLS et al., 1998).

A mandioquinha-salsa uma hortalia que apresenta vrios problemas ps-colheita, que reduzem substancialmente sua durabilidade e seu valor comercial. Os principais problemas j identificados so a rpida perda de matria fresca, a ocorrncia de podrides e a grande incidncia de danos mecnicos (THOMPSON, 1980; AVELAR FILHO, 1989; HENZ, 2001; SOUZA, 2001; SOUZA et al., 2003). Quando comercializadas sem embalagem e/ou

Parte da dissertao de mestrado em Agronomia apresentada pelo primeiro autor Faculdade de Agronomia e Veterinria da Universidade de Braslia 881

Hortic. bras., v. 23, n. 4, out.-dez. 2005

G. P. Henz et al.

refrigerao, as razes da mandioquinhasalsa tm durao de apenas um a trs dias, dependendo da poca do ano e do sistema de manuseio ps-colheita. Quando a perda de matria fresca ultrapassa 10%, as razes de mandioquinhasalsa tornam-se murchas e enrugadas, sem valor comercial (AVELAR FILHO, 1989). De acordo com Finger e Casali (1988), a taxa respiratria de razes de mandioquinha-salsa variou de 3,4 ml CO2 kg-1 h-1 aps a colheita e alcanou 32,1 ml CO2 kg-1 h-1 aps 60 h, possivelmente provocada pela perda de gua das razes. Assim como ocorre para os demais produtos hortcolas, o armazenamento refrigerado tambm reduz os principais processos fisiolgicos das razes de mandioquinha-salsa, como a respirao, perda de matria fresca e deteriorao (AVELAR FILHO, 1989; HENZ, 1995). As conseqncias de injrias mecnicas na fisiologia e vida-de-prateleira de algumas hortalias j esto bem caracterizadas. O manuseio e a queda de embalagens e frenagens bruscas de caminhes que transportam produtos hortcolas podem ocasionar diferentes tipos de leses por impacto ou compresso (FAO, 1993; SARGENT et al., 1989a; SARGENT et al., 1989b). Os rgos vegetais submetidos a vibraes e danos mecnicos em geral aumentam suas taxas respiratrias em comparao com testemunhas sem injrias (PISARCZYK et al., 1982; SALVEIT et al., 1982; MAO et al., 1995). A severidade e a extenso dos danos mecnicos podem ser afetadas por diversos fatores, sendo os principais (1) a maturidade e o potencial de gua; (2) a orientao celular e do tecido no local do impacto; (3) o formato do objeto causador do impacto; (4) a energia com a qual o rgo chocase com o objeto e o respectivo ngulo; e (5) a temperatura da hortalia no momento da injria (SARGENT et al., 1992; MILLER, 2003). A simulao do impacto de queda de razes de cenoura de quatro cultivares (Imperator, Dominator, Cellobunch e Nantes) de quatro alturas (60; 90; 120 e 150 cm) demonstrou que as rachaduras e quebras resultantes variaram de acordo com a cultivar, altura da queda e tambm da tem882

peratura das razes (CANTWELL et al., 1991). As razes de cenoura mantidas a 0oC apresentaram 70% de rachaduras em relao quelas mantidas a 20oC, que apresentaram somente 15% (CANTWELL et al., 1991). O efeito de temperaturas mais baixas no aumento dos danos mecnicos tambm foi comprovado em frutos de morango submetidos fora de impacto, em uma simulao de trs alturas de queda (13; 20 e 38 cm) nas cultivares Chandler, Oso Grande e Sweet Charlie (FERREIRA et al., 1995). No mesmo trabalho, constatou-se que as foras de compresso causaram maior incidncia de injrias nos frutos (FERREIRA et al., 1995). Os danos mecnicos em hortalias tm sido mais extensivamente estudados para a cultura da batata, principalmente devido mecanizao dos processos de colheita, transporte e beneficiamento, que acarretam problemas de perdas no armazenamento. A incidncia de injrias mecnicas em batata aumentou a taxa respiratria em mais de 100% em todas as cultivares mantidas a 25oC (SCHIPPERS, 1977). medida que os tubrculos passam pelas diferentes etapas do manuseio foi constatado que houve aumento na respirao dos tubrculos (PISARCZYK, 1982). No Brasil, Silva et al. (1993a e 1993b) estudaram o efeito de danos mecnicos de impactos na colheita sobre a taxa respiratria de tubrculos de batata, e as cultivares mais suscetveis ao impacto aumentaram suas taxas respiratrias significativamente de 10 a 18 ml CO2 kg-1 h-1 para 26 a 35 ml CO2. kg-1 h-1. O principal sistema de manuseio ps-colheita da mandioquinha-salsa no Brasil envolve basicamente quatro etapas at alcanar o consumidor, dividindo-se em colheita (1), beneficiamento (2), comercializao no atacado (3) e no varejo (4) (HENZ, 2001). Durante a movimentao do produto nestas diferentes etapas da cadeia de ps-colheita, as razes de mandioquinha-salsa sofrem vrios tipos de danos mecnicos, categorizados como abraso, ruptura parcial, rachadura e quebra em um trabalho anterior (SOUZA et al., 2003). Neste estudo, o tipo de injria mais freqente foi abraso, na forma de leses superficiais, alcanando 78,9% das

razes no varejo, e a etapa em que ocorreu a maior incidncia de outros tipos de injrias mecnicas foi no atacado, onde 7,6% das razes apresentaram rupturas, 4,2% com rachaduras e 10,6% estavam quebradas (SOUZA, 2001; SOUZA et al., 2003). As principais causas de injrias mecnicas identificadas no sistema de manuseio ps-colheita da mandioquinha-salsa adotado em So Paulo foram impacto de queda, abraso e compresso das razes (SOUZA, 2001; SOUZA et al., 2003). O impacto de queda ocorre principalmente durante a movimentao das razes no galpo de beneficiamento, como na operao de descarga das caixas dos caminhes, colocao das razes nas redes de lavao e sua transferncia para a mesa de seleo e na operao de embalagem. Nos estabelecimentos do varejo, as razes so transferidas das caixas para as gndolas, onde tambm podem ocorrer danos mecnicos por quedas de at 1 m de altura. A injria mecnica por abraso ocorre principalmente pelo atrito das razes com a superfcie das caixas de madeira ou de plstico ocasionada pela vibrao durante o transporte por caminhes. A injria por compresso pode ocorrer pelo empilhamento das caixas de madeira nos galpes de beneficiamento, durante o transporte por caminhes ou nos atacadistas, ocasionado principalmente pelo excesso de razes nas caixas do tipo K. A mandioquinha-salsa uma hortalia de preo elevado ao consumidor e a manuteno da integridade fsica das razes importante para a valorizao desta hortalia como mercadoria. O objetivo do presente trabalho foi avaliar as conseqncias fsicas e fisiolgicas nas razes de mandioquinha-salsa submetidas a simulaes de injria mecnica por impacto de queda que ocorrem durante o beneficiamento e a comercializao.

MATERIAL E MTODOS
Simulao do impacto de queda Os experimentos foram realizados no Laboratrio de Ps-Colheita da Embrapa Hortalias, em Braslia-DF. O efeito do impacto por queda em razes de mandioquinha foi avaliado atravs de
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Danos causados pelo impacto de queda na qualidade ps-colheita de razes de mandioquinha-salsa

uma simulao, combinando-se a altura da queda com a posio de soltura das razes. As alturas de queda utilizadas neste experimento foram definidas de acordo com as alturas do contentor plstico de 34 kg de capacidade, da mesa de seleo e das gndolas de exposio da mandioquinha-salsa em supermercados e sacoles. Nestes locais a ocorrncia de quedas de razes relativamente freqente e uma das causas mais relevantes de perdas ps-colheita. Razes de mandioquinha-salsa cv. Amarela Comum das classes 2A e 3A foram adquiridas na CEASA-DF, selecionando-se para a execuo do experimento somente aquelas de tamanho pequeno a mdio, com 8-12 cm de comprimento e dimetro de 2-4 cm, isentas de danos mecnicos e outros defeitos graves (CEAGESP, 2002). O experimento foi conduzido em um delineamento em esquema fatorial 2 x 3 (altura x posio de queda), com trs repeties por tratamento (40 razes/parcela). As razes foram soltas de duas alturas (45 e 90 cm) e em trs posies de queda: (1) horizontal; (2) vertical proximal, com o ombro para cima; (3) vertical distal, com o ombro da raiz voltado para baixo. As razes foram mantidas nas respectivas alturas e posies e deixadas cair livremente sobre um piso plano de cimento rgido e liso. Aps a queda, cada raiz foi examinada individualmente, determinando-se os tipos de danos sofridos como rachaduras, quebra, rupturas e leses superficiais, definidos em um trabalho anterior (SOUZA et al., 2003), e considerando-se tambm aquelas intactas exteriormente, sem dano aparente. Avaliao da respirao e da deteriorao das razes As razes da cv. Amarela Comum foram adquiridas de um produtor no Ncleo Rural Alexandre Gusmo, em Brazlndia-DF, e transportadas para o laboratrio de Ps-Colheita da Embrapa Hortalias. O experimento foi composto por quatro tratamentos, comparandose razes intactas com outras submetidas injria mecnica por impacto de queda de 90 cm de altura em uma superfcie plana e rgida, e armazenamento posterior em duas temperaturas. Cada tratamento teve trs repeties com 1,5
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Significncia (teste F) e graus de liberdade (GL) para injrias resultantes da interao das alturas de queda e posio de soltura das razes de mandioquinha-salsa.
Fator de variao Posio (P) Altura de queda (A) PxA Posio (Altura) Posio (45 cm) Posio (90 cm) Mdia (%) CV (%) GL 2 1 2 4 2 2 Teste F Grave 108,55* * 288,37* * 11,39* * 59,97* * 92,45* * 27,49* * 52,36 9,21 Leve 117,76* * 12,46* * 36,09* * 76,92* * 129,37* * 24,48* * 29,44 20,41 Intacta 168,65* * 251,53* * 127,63* * 148,14* * 294,00* * 2,28 ns 18,06 21,40

** significativo a 1% de significncia; ns = no significativo

kg de razes em mdia por parcela, distribudas ao acaso. As razes (intactas e injuriadas) foram colocadas em frascos de vidro de 5 litros, e armazenadas s temperaturas de 24 2C (75% UR) e a 5 2C (90% UR). A cada hora foram retiradas amostras das atmosferas internas de cada frasco com seringas e injetadas em um cromatgrafo a gs para leitura da concentrao de CO2. Depois de retiradas as amostras os recipientes foram abertos para renovao da atmosfera. Repetiu-se esse procedimento a cada hora, fazendo-se quatro leituras dirias, durante quatro dias. Como padro utilizou-se CO2 na concentrao 1.000 ml/L. Acompanhou-se tambm a perda de matria fresca, atravs de pesagens dirias do material e uma avaliao diria da incidncia de deteriorao causada por Erwinia sp., considerando-se como deterioradas as razes que apresentavam uma ou mais leses de podrido-mole.

RESULTADOS E DISCUSSO
Incidncia de injrias mecnicas causadas por impacto de queda A simulao do impacto por queda das razes de duas alturas em uma superfcie rgida e plana produziu tipos distintos de injrias mecnicas. As leses provocadas pelo impacto de queda foram categorizadas em quatro tipos principais (rachaduras, quebras, leses superficiais e rupturas) para tornar as avaliaes mais rpidas e fceis de serem executadas. Estes danos mecnicos em razes de mandioquinha-salsa foram descritos com mais detalhes no trabalho de Souza et al. (2003). As leses

observadas tambm foram ser separadas pela extenso do dano e importncia na aparncia do produto em defeitos graves (rachaduras, rupturas e quebras) e leves (leses superficiais causadas por abraso), de acordo com a norma de classificao da mandioquinha-salsa proposta pela CEAGESP (2002). As rachaduras caracterizaram-se pelo rompimento parcial da raiz; as quebradas pela separao completa em duas ou mais partes; as rupturas pelo rompimento superficial do tecido, sem destacar-se da raiz; e as leses superficiais apresentaram remoo parcial da periderme. (SOUZA, 2001; SOUZA et al., 2003). As razes sem nenhum dano visvel externamente foram consideradas como intactas. Houve interao significativa entre as alturas e as posies de solturas das razes, que definiu a incidncia e a predominncia de determinados tipos de injrias mecnicas (Tabela 1). A altura da queda afetou a incidncia dos distintos tipos de danos mecnicos, sendo que as razes soltas a 90 cm apresentaram uma predominncia de leses mais graves, como rachaduras, quebras e rupturas. Para todas as posies de soltura das razes, a porcentagem de razes com danos mecnicos aps a queda foi sempre maior na altura de 90 cm (Figura 1), situao tambm observada em razes de cenoura (CANTWELL et al., 1991) e frutos de morango (FERREIRA et al., 1995). Na posio de soltura distal (ponta da raiz para baixo), predominaram as leses mais graves (rachaduras, quebras e rupturas) nas duas alturas (Figura 1), provavelmente devido fora do cho883

G. P. Henz et al.

Figura 1. Incidncia de injrias mecnicas leves e graves em razes de mandioquinha-salsa submetidas a impacto de queda de duas alturas (45 e 90cm) em trs posies de soltura (distal, proximal e horizontal). Braslia, Embrapa Hortalias/FAV-UnB, 2001.

que ocasionado pelo impacto de queda na poro apical da raiz, uma rea bem menor que a poro proximal (ombro). Para esta mesma posio, nas razes soltas a 45 cm de altura predominaram as rachaduras e as rupturas, enquanto a 90 cm houve maior incidncia de rupturas, quebras e rachaduras. Na posio proximal (ou com o ombro da raiz voltado para baixo), constatouse a menor incidncia de injrias mecnicas nas razes soltas a 45 cm, classificadas como intactas, enquanto a 90 cm de queda observou-se uma grande incidncia de razes com rachaduras. Na posio de soltura horizontal, as razes com queda a 45 cm apresentaram grande incidncia de leses superficiais, consideradas como menos graves, e as razes soltas a 90 cm apresentaram uma tendncia de quebra (Figura 1). De acordo com o trabalho executado em cenoura por Cantwell et al. (1991), a temperatura das razes apresentou um grande efeito na incidncia de rachaduras ocasionadas por impacto de queda, sendo maior nas razes mantidas a 0oC em comparao com quelas mantidas a 20oC. Efeito semelhante tambm foi observado em frutos de trs cultivares de morango submetidos a trs alturas de queda (FERREIRA et al., 1995). No presente trabalho, a simulao de impacto de queda foi executado em condio ambiental, com a temperatura das razes variando entre
884

21oC a 23oC. Nos galpes de beneficiamento da mandioquinha-salsa do estado de So Paulo, as temperaturas das razes e do ambiente so mais baixas, variando de 15oC a 21oC, dependendo da poca do ano (HENZ, 2001). Todo o beneficiamento executado noite, geralmente aps as 21 h, estendendo-se pela madrugada at o amanhecer. A gua de crregos da regio geralmente fria, e mantm a temperatura das razes mais baixa. Em tese, provvel que as conseqncias de quedas das razes nesta condio pode provocar danos maiores, principalmente rachaduras. Por outro lado, o armazenamento em baixas temperaturas ainda no utilizado regularmente para mandioquinha-salsa no Brasil. Caso for necessrio, estudos adicionais podero ser executados com as razes da mandioquinha-salsa levando-se em considerao alguns fatores importantes que afetam a extenso e a severidade dos danos mecnicos, como o potencial de gua, a energia com a qual as razes chocam-se contra o cho e o respectivo ngulo do impacto, e a temperatura das razes no momento da injria (SARGENT et al., 1992; MILLER, 2003). Respirao de razes de mandioquinha-salsa A temperatura mais baixa (5oC) reduziu significativamente a respirao das razes de mandioquinha-salsa em comparao quelas mantidas a 24oC, e

nestas duas temperaturas as razes injuriadas apresentaram taxas respiratrias mais elevadas em relao s intactas. As razes mantidas a 5 oC apresentaram menores taxas de respirao, variando de 3,8 ml CO2 kg-1 h-1 (intactas) a 8,3 ml CO 2 kg -1 h -1(injuriadas), e as razes mantidas a 24oC apresentaram taxas respiratrias que variaram de 15,3 ml CO2 kg-1 h-1 (intactas) a 34,4 ml CO2 kg-1 h-1 (injuriadas) (Figura 2). Temperaturas mais baixas reduzem as taxas respiratrias e de deteriorao (WILLS et al., 1998; KAYS, 1991). Finger e Casali (1988) determinaram a taxa respiratria de razes de mandioquinha que variou de 13,4 ml CO2 kg-1 h-1 aps a colheita at 32,1 ml CO2 kg-1 h-1, valores prximos aos determinados neste trabalho para a temperatura de 24oC. As taxas respiratrias foram ajustadas, observando-se uma tendncia de reduo nas razes mantidas a 5oC, com um decrscimo linear naquelas submetidas injria por queda (Y= 12,325 1,645X, R2= 0,88), enquanto as razes mantidas a 24oC (Y= 9,000 + 4,910X, R2=0,84), observou-se um aumento linear na taxa respiratria (Figura 2). Os rgos vegetais submetidos a vibraes e danos mecnicos em geral aumentam suas taxas respiratrias em comparao com testemunhas sem injrias (PISARCZYK et al., 1982; SALVEIT et al., 1982; MAO et al., 1995). As razes de mandioquinha-salsa apresentaram reao semelhante aos de outros produtos hortcolas submetidos a injrias mecnicas, como tubrculos de batata (SCHIPPERS et al., 1977; PISARCZYK et al., 1982; SILVA et al., 1993a e 1993b), e tambm aumentaram a respirao quando submetidas ao impacto por queda ou quando armazenadas em temperaturas mais altas. Este aumento na respirao pode estar envolvido no processo de deteriorao das razes assim como na reparao dos tecidos pela suberizao de partes superficiais. As condies ideais para acelerar o processo de cicatrizao de ferimentos causados por injrias mecnicas em razes de mandioquinha-salsa ainda no foram determinadas. Perda de matria fresca e deteriorao em razes com injrias mecnicas Perda de matria fresca As razes injuriadas mecanicamente apresentaram maiores taxas dirias de
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Danos causados pelo impacto de queda na qualidade ps-colheita de razes de mandioquinha-salsa

perda de matria fresca (PMF) at quatro dias de armazenamento em relao s razes intactas nas duas temperaturas avaliadas (24oC e 5oC). As razes injuriadas mantidas a 24oC apresentaram 8,3% de PMF aps quatro dias (taxa diria de 2,07%), e 6,1% de PMF para as razes mantidas a 5oC, com uma taxa diria de 1,52%. J as razes intactas apresentaram as menores perdas de matria fresca, variando de 4,1% para aquelas mantidas a 24oC a 1,39% para razes conservadas a 5oC, com taxas dirias de 1,02% e 0,34%, respectivamente. A exposio dos tecidos injuriados provavelmente acelerou a perda de matria fresca, principalmente porque as umidades relativas dos ambientes eram relativamente baixas para o armazenamento de produtos hortcolas (78% UR a 24oC e 72% UR a 5oC). Os dados obtidos no presente trabalho em relao perda de matria fresca das razes esto de acordo com observaes empricas sobre a manuteno da integridade e valor comercial da mandioquinha-salsa quando expostos a granel no varejo. Nesta condio, considera-se que as razes durem de um a trs dias, dependendo da poca do ano. Para as razes de cenoura, considera-se que o mximo de perda de matria permissvel para a manuteno do valor comercial das razes de 8%, sendo de apenas 4% para as razes mantidas com as folhas (ROBINSON et al., 1975). Dependendo da extenso do dano mecnico nas razes, a aparncia da mandioquinha-salsa pode ficar comprometida depois de apenas dois dias, perodo em que as leses tornam-se mais visveis e facilmente detectveis. provvel que o limite mximo de perda de matria fresca para as razes de mandioquinha-salsa manterem seu valor comercial situe-se em torno de 6-8%, como j determinado para a cenoura. Acima de 10% de perda de matria fresca, as razes j apresentam danos visveis de murchamento e perdem seu valor comercial (AVELAR FILHO, 1989). Deteriorao As razes de mandioquinha-salsa tiveram sua conservao ps-colheita comprometida a 24oC, independente da incidncia de injrias mecnicas. As
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 2. Respirao de razes de mandioquinha-salsa submetidas a impacto de queda (qda) em comparao com razes intactas (int) armazenadas em duas temperaturas (5oC e 24oC) durante quatro dias. Braslia, Embrapa Hortalias/FAV-UnB, 2001.

razes lesionadas e as intactas mantidas a 24oC apresentaram deteriorao aps quatro dias, alcanando 66% nas razes intactas e 84% nas razes com ferimentos. J as razes intactas e com ferimentos mantidas a 5oC no apresentaram problemas com deteriorao aps quatro dias de armazenamento. O efeito benfico da refrigerao e de embalagens apropriadas para as razes de mandioquinha-salsa j foi demonstrado anteriormente por outros autores (AVELAR FILHO, 1989; HENZ, 2001), sendo uma excelente tecnologia para a manuteno da qualidade e integridade do produto. A maior incidncia de deteriorao nas razes injuriadas mecanicamente era esperada, uma vez que muitos patgenos ps-colheita so dependentes de portas de entrada para iniciar a infeco, principalmente doenas causadas por fungos. No caso da mandioquinha-salsa, provvel que a bactria responsvel pela podrido-mole permanea latente nas lenticelas das razes, iniciando a doena sob condio favorvel, como temperaturas acima de 20oC e umidade relativa acima de 75%. De acordo com os resultados obtidos no presente trabalho, a incidncia de injrias mecnicas causadas por

impacto de queda em razes de mandioquinha-salsa deve ser reduzida no manuseio ps-colheita porque afeta a qualidade e a conservao do produto, de modo semelhante ao que j foi observado para outros produtos hortcolas (KAYS, 1991; KADER et al., 1992; WILLS et al., 1998). O tipo predominante de injria mecnica causada pela simulao do impacto de queda nas razes de mandioquinha-salsa variou de acordo com a altura da queda, sendo quebra (48,3%) para razes soltas a 90 cm e leses superficiais (84%) para razes soltas a 45 cm. A incidncia de injrias mecnicas afetou a respirao das razes de mandioquinha-salsa em relao s razes intactas a 24oC e 5oC, com tendncia a ser mais alta na maior parte do tempo. A perda de matria fresca foi maior nas razes injuriadas mecanicamente em relao s razes intactas a 24oC e 5oC. O uso de embalagens e de refrigerao pode reduzir substancialmente os efeitos negativos da incidncia de injrias mecnicas nas razes, sendo uma tecnologia simples e apropriada para aqueles produtos com maior valor agregado, como a mandioquinhasalsa produzida no sistema orgnico ou razes com maior valor de mercado, como as das classes 3A e B.
885

G. P. Henz et al. KADER, A.A.; KASMIRE, R.F.; MITCHELL, F.G.; REID, M.S.; SOMMER, N.F.; THOMPSOM, J.F. Postharvest technology of horticultural crops. University of California, Berkeley, 1992. 296 p. KAYS, S.J. Postharvest physiology of perishable plant products. New York: Van Nostrand Reinhold, 1991. 532 p. MAO, L.; YING, T.; XI, Y.; ZHEN, Y. Respiration rate, ethylene production, and cellular leakage of fruit following vibrational stree HortScience, v.30, n.1, p.145-149, 1995. MILLER, A.R Harvest and handling injury: physiology, biochemistry and detection. In: BARTZ, J.A.; BRECHT, J.K. (eds.). Postharvest Physiology and Pathology of Vegetables. New York: Marcel Dekker, 2003. p.177-208. MORETTI, C.L.; CALBO, A.G.; HENZ, G.P. Metabolismo respiratrio na ps-colheita de frutas e hortalias. Revista Universa, Braslia, v.8, n.1, p.259-274, 2000. PISARCZYK, J.M. Field harvest damage affects potato tuber respiration and sugar content. American Potato Journal, v.59, p.205-211, 1982. ROBINSON, J.E.; BROWNE, K.M.; BURTON, W.G. Storage characteristics of some vegetables and soft fruits. Annals of Applied Biology, v.81, p.399-408, 1975. SALVEIT, M.E.; LOCY, R.D. Cultivar differences in ethylene production by wounded sweet potato roots. Journal of the American Society for Horticultural Science, v.107, n.6, p.1114-1117, 1982. SARGENT, S.A.; BRECHT, J.K.; ZOELLNER, J.J. Assessment of mechanical damage in tomato packing lines. Transactions of the ASAE, v.30, n.1, p.630-634, 1989a. SARGENT, S.A.; BRECHT, J.K.; ZOELLNER, J.J.; CHAU, K.V.; RISSE, L.A. Reducing mechanical damage to tomato during handling and shipment. Transactions of the ASAE, v.30, n.2, p.714-719, 1989b. SARGENT, S.A.; BRECHT, J.K.; ZOELLNER, J.J. Sensitivity of tomatoes at mature-green and breaker ripeness stages to internal bruising. Journal of the American Society of Horticultural Sciences, v.117, p.119-123, 1992. SCHIPPERS, P.A. The rate of respiration of potato tubers during storage. Potato Research, v.20, p.173-188, 1977. SILVA, J.L.O.; CALBO, A.G.; MARTON, L. Efeito de danos mecnicos de impacto na colheita sobre a respirao da batata. Revista Brasileira de Fisiologia Vegetal , Braslia, v.11, n.1, p.106, 1993a. Resumo. SILVA, J.L.O.; CALBO, A.G.; MARTON, L. Susceptibilidade de cultivares de batata ao escurecimento por impacto. Horticultura Brasileira, Braslia v.11, n.1, p.99, 1993b. Resumo. SOUZA, R.M. Avaliao da incidncia de danos mecnicos na ps-colheita de razes de mandioquinha-salsa (Arracacia xanthorrhia Bancroft). 2001. 69 f. (Tese mestrado) - Universidade de Braslia, Braslia. SOUZA, R.M.; HENZ, G.P.; PEIXOTO, J.R. Incidncia de injrias mecnicas em razes de mandioquinha-salsa na cadeia de ps-colheita. Horticultura Brasileira, Braslia, v.21, n.4, p.712718, 2003. THOMPSON, A.K. Reduction of losses during the marketing of arracacha (Arracacia xanthorrhiza). Acta Horticulturae, v.116, p.60-65, 1980. WILLS, R.; McGLASSON, B.; GRAHAM, D. JOYCE, D. Postharvest: an introduction to the physiology and handling of fruit, vegetables and ornamentals. New York: CAB International, 1998. 262 p.

LITERATURA CITADA
AVELAR FILHO, J.A. Estudo da conservao ps-colheita da mandioquinha-salsa (Arracacia xanthorrhiza Bancroft). 1989. 62 f. (Tese mestrado) - UFV, Viosa. CANTWELL, M.; MORDEN, G.; RUBATZKY, V.; CHEN, P. Tests to monitor carrot cracking and breaking susceptibility. Eucarpia Meeting on Breeding of Carrots, 1991, Monfavet, France. Eucarpia Carrot 91. Proceedings... Paris: INRA/ Eucarpia, 1991. p.91-103. CEAGESP. Classificao da mandioquinha-salsa . So Paulo: CQH/CEAGESP, 2002. 8 p. (folder). FAO. Prevencin de perdidas de alimentos postcosecha: frutas, hortalias y tubrculos. Roma: FAO: 1993. 183 p. (Manual de Capacitacin, 14). FERREIRA, M.D.; SARGENT, S.A.; BRECHT, J.K. Estudo sobre alternativas de manuseio e classificao do morango aps a colheita Horticultura Brasileira, Braslia, v.13, n.1, p.82, 1995. Resumo. FINGER, F.L.; CASALI, V.W.D. Determinao da taxa respiratria em mandioquinha-salsa. Horticultura Brasileira, Braslia, v.6, n.1, p.53, 1988. Resumo. HENZ, G.P. Perdas ps-colheita e mtodos de manejo da podrido-mole causada por Erwinia chrysanthemi e Erwinia carotovora spp. em razes de mandioquinha-salsa. Braslia: Universidade de Braslia, 2001. 255 f. (Tese doutorado). HENZ, G.P. Mtodos de conservao ps-colheita de mandioquinha-salsa. In: V Encontro Nacional sobre Mandioquinha-Salsa. Palestras e trabalhos tcnicos... Venda Nova do Imigrante: SOB/ EMCAPA, 1995. p.21-24.

886

Hortic. bras., v. 23, n. 4, out.-dez. 2005

CASEIRO, R.F.; MARCOS FILHO, J. Mtodos para a secagem de sementes de cebola submetidas ao condicionamento fisiolgico. Horticultura Brasileira, Braslia, v.23, n.4, p.887-892, out-dez 2005.

Mtodos para a secagem de sementes de cebola submetidas ao condicionamento fisiolgico


Roseli Ftima Caseiro2; Julio Marcos Filho1
1

USP/ESALQ, Depto. Produo Vegetal, C. Postal 9, 13418-900 Piracicaba-SP; Bolsista CNPq; 2Ps-graduanda da USP/ESALQ; E-mail: rosecaseiro@hotmail.com

RESUMO
H controvrsias quanto possvel reverso de efeitos benficos do condicionamento fisiolgico quando as sementes so desidratadas imediatamente aps esse tratamento. A presente pesquisa foi conduzida para avaliar a eficincia de diferentes procedimentos de secagem de sementes de cebola aps o condicionamento. Amostras de quatro lotes da cultivar Petroline foram hidrocondicionadas entre duas folhas de papel toalha umedecidas com gua a 15C, por 48 horas, com posterior secagem rpida em estufa com circulao de ar, a 35-40C, por aproximadamente 24 horas; secagem lenta a 20C e umidade relativa de 75%, durante 72 h; incubao das sementes em solues de polietilenoglicol 8000 (340 g/L de gua) a 8C, durante 24; 72 ou 120 horas; incubao das sementes em banho-Maria a 40C, durante 1; 3 e 5 h; incubao das sementes a 35C por 24 e 48 h. Aps a secagem lenta e os procedimentos de incubao, as sementes foram secadas rapidamente, at atingirem teor de gua em torno de 6,0 a 8,0%. O potencial fisiolgico das sementes foi avaliado por meio dos testes de germinao, ndice de velocidade de germinao, envelhecimento acelerado e condutividade eltrica. Adotou-se delineamento experimental inteiramente casualizado, com doze tratamentos e quatro repeties para cada teste. Verificou-se que a incubao em PEG 8000 reduziu drasticamente a germinao e o vigor das sementes condicionadas. No ocorreram variaes acentuadas entre os resultados dos processos de secagem rpida, secagem lenta, incubao em banho-Maria e incubao a 35C. No entanto, o processo de secagem rpida foi considerado como o mais adequado aps o condicionamento das sementes de cebola, pois alm de rpido (o perodo gasto foi de aproximadamente 24 h), o procedimento de execuo mais simples e objetivo. Palavras-chave: Allium cepa, priming, incubao, germinao, vigor.

ABSTRACT
Evaluation of methods for drying primed onion seeds This work was carried out to evaluate drying procedures of primed onion seeds. Samples of four seed lots (cultivar Petroline) were primed between two moistened sheets of germination paper towel, at 15C, during 48 h, and then submitted to the following drying processes: fast drying (in oven with air circulation, under 3540C, during approximately 24 h); slow drying (seeds kept in a chamber under 20C and 50-60% relative humidity during 72 h); incubation in PEG 8000 solution (340 g/L water), under 8C, during 24; 72 and 120 h; incubation in a water bath under 40C, during 1; 3 and 5 h; and incubation in a chamber under 35C, during 24 and 48 h. After the slow drying and the incubation processes, seeds were submitted to fast drying to complete seed desiccation to obtain the moisture content around 6-8% (fresh weight basis). The physiological potential was evaluated through germination, speed of germination, accelerated aging and electrical conductivity tests. The experiment was carried out in a completely randomized design, with 12 treatments and four replicates for each test. Results showed that the incubation in PEG 8000 solution drastically reduced seed germination and vigor of primed seeds. In addition, there were no wide differences among the process of fast drying, slow drying, incubation in water bath and incubation under 35C. The fast drying was considered the best procedure to reduce moisture content of primed onion seeds, with the advantage of being faster (the period required was about 24 h) and more practical.

Keywords: Allium cepa, priming, incubation, germination, vigor.

(Recebido para publicao em 20 de maio de 2004 e aceito em 3 de julho de 2005 condicionamento fisiolgico (priming) das sementes pode beneficiar diretamente o desempenho de lotes de sementes, ao promover reduo do perodo de germinao e emergncia das plntulas ou, indiretamente, ao favorecer a tolerncia a condies de estresse aps a semeadura como, por exemplo, a baixa disponibilidade de gua (FINCH-SAVAGE, 1995). Segundo Pill (1995), esse tratamento consiste na hidratao controlada das sementes, ativando os processos metablicos necessrios para a germinao sem no entanto permitir a protruso da raiz primria. ApeHortic. bras., v. 23, n. 4, out.-dez. 2005

sar de sua influncia sobre a velocidade, a sincronizao e a percentagem de germinao, a utilizao comercial do condicionamento fisiolgico ainda relativamente baixa (NASCIMENTO, 1998). Um dos aspectos fundamentais para possibilitar a comercializao das sementes condicionadas a reduo cuidadosa do teor de gua aps o tratamento at atingir nvel adequado para o armazenamento. Dependendo do procedimento utilizado, pode haver reverso dos benefcios alcanados durante o tratamento. Estudos realizados por Heydecker et al. (1975) e Furutani et al. (1986) mostraram que se-

mentes de cebola poderiam ser tratadas e posteriormente secadas at atingir o teor de gua inicial, sem reverso dos efeitos benficos do tratamento. Por outro lado, Haigh et al. (1986) verificaram, para a mesma espcie, que aps a secagem ao ar por 24 h em ambiente de laboratrio a 15C, houve reduo da percentagem de emergncia das plntulas em campo; no entanto, para tomate e cenoura, a secagem e o armazenamento das suas sementes por 28 dias no provocaram efeitos prejudiciais. Essa controvrsia persiste quando so consideradas informaes obtidas com outras espcies. Assim, para toma887

R. F. Caseiro e J. Marcos Filho

te (ARGERICH et al., 1989) e com alhoporr (ROWSE, 1996), a secagem das sementes aps o condicionamento promoveu reverso dos efeitos vantajosos obtidos durante o tratamento. Em tomate verificou-se, inclusive, a perda completa da viabilidade das suas sementes. Da mesma forma, a secagem de sementes de alface, realizada a 21C e 45% de umidade relativa do ar, no influenciou a velocidade e a percentagem de germinao (GUEDES; CANTLIFFE, 1980); porm, quando a secagem foi conduzida em estufa, a 32C, houve reverso dos efeitos proporcionados pelo tratamento. Por outro lado, Eira e Marcos Filho (1990), trabalhando com alface, verificaram que tanto a secagem das sementes em ambiente de laboratrio, durante 48 h, como a conduzida em estufa, a 32C, por 12 h, no foram prejudiciais para os dois lotes de sementes avaliados. Desta maneira, verifica-se que os efeitos da secagem ps-condicionamento das sementes dependem do procedimento adotado para a secagem, da espcie considerada e do potencial fisiolgico dos lotes utilizados. Visando solucionar essa questo, trabalhos mais recentes tm includo alternativas para tornar as sementes condicionadas mais resistentes dessecao. Por exemplo, Bruggink e Van der Toorn (1995) constataram que a tolerncia dessecao de sementes germinadas de pepino pde ser induzida pela incubao das mesmas em solues de polietilenoglicol. Procedimentos semelhantes foram utilizados por Bruggink et al. (1999), com reduo do perodo de germinao e manuteno da longevidade similar das sementes no condicionadas. Neste caso, alguns mtodos foram utilizados aps o condicionamento fisiolgico, incluindo a incubao das sementes em polietilenoglicol, a secagem lenta, a secagem rpida e o choque trmico. A similaridade entre o mtodo para induzir a tolerncia das sementes dessecao durante a germinao e aquele utilizado para prevenir a reduo da longevidade de sementes condicionadas indica o envolvimento dos mesmos mecanismos fisiolgicos e que a tolerncia dessecao e a longevidade das sementes so realmente caractersticas relacionadas.
888

A disponibilidade de um mtodo prtico de secagem sem provocar reverso significativa dos benefcios obtidos durante o condicionamento fisiolgico deve apresentar contribuio relevante para a evoluo do conhecimento cientfico e abrir novos caminhos para a pesquisa; alm disso, poderia acelerar o aprimoramento da tecnologia adotada por empresas produtoras de sementes e, conseqentemente, permitir o armazenamento seguro e o aumento da oferta de sementes condicionadas aos produtores de hortalias. Diante do exposto, o presente trabalho teve por objetivo verificar a eficincia de diferentes procedimentos para a secagem de sementes de cebola condicionadas fisiologicamente.

MATERIAL E MTODOS
O presente trabalho foi realizado no Laboratrio de Anlise de Sementes da ESALQ. As sementes foram hidrocondicionadas de acordo com procedimento adotado por Caseiro et al. (2004). Foram constitudos doze tratamentos (testemunha e onze procedimentos para a secagem), arranjados em delineamento experimental inteiramente casualizado, com quatro repeties. Amostras de 5,0 g de quatro lotes de sementes de cebola, cv. Petroline, com potencial fisiolgico diferente, foram embebidas entre duas folhas de papel toalha, durante 48 horas a 15C. Aps o condicionamento fisiolgico efetuou-se a secagem direta das sementes, mediante os procedimentos: a) secagem rpida em estufa com circulao de ar a 35-40C, por aproximadamente 24 h; b) secagem lenta, em cmara a 20C e umidade relativa de 75%, durante 72 h; c) incubao pr-secagem das sementes, em soluo de polietilenoglicol 8000 (340 g/L de gua) a 8C, durante 24; 72 ou 120 h; d) incubao das sementes em banho-Maria a 40C (choque trmico), lacrando-se as sementes em envelopes de alumnio durante uma, trs e cinco h; e) secagem rpida por curto perodo, at que houvesse decrscimo de aproximadamente 6 a 8 pontos percentuais no teor de gua, seguida por acondicionamento em recipientes plsticos e incubao a 35C por 24 e 48 h. Aps a

secagem lenta e os trs procedimentos de incubao, as sementes foram secadas rapidamente, da maneira j descrita, at atingirem teor de gua em torno de 6,0 a 8,0%. O potencial fisiolgico das sementes submetidas aos diferentes tratamentos foi avaliado com a utilizao dos seguintes testes: Grau de umidade Determinado antes e aps os tratamentos, de acordo com as Regras para Anlise de Sementes (BRASIL, 1992), utilizando-se o mtodo da estufa a 105C3C, por 24 h, com duas repeties de 1,0 g de sementes para cada lote. Germinao Testes de germinao foram conduzidos com quatro repeties de 50 sementes para cada lote, distribudas sobre papel chupo (Germibox) e colocadas para germinar a 20C. O substrato foi umedecido com volume de gua equivalente a 2,5 vezes a sua massa. As contagens foram realizadas diariamente at o 12o dia aps a semeadura, computando-se o nmero de plntulas normais, sendo os resultados expressos em percentagem mdia por tratamento e lote. Velocidade de germinao Teste realizado conjuntamente com o de germinao. As avaliaes foram realizadas diariamente, mesma hora, a partir do dia em que foram identificadas as primeiras plntulas normais, que foram computadas e retiradas do substrato. Ao final, com os dados dirios do nmero de plntulas normais foi calculado o ndice de velocidade de germinao (IVG), de acordo com a frmula proposta por Maguire (1962). Os dados foram expressos em ndices mdios de velocidade de germinao para cada lote. Envelhecimento acelerado Foram utilizadas caixas plsticas (11,0 x 11,0 x 3,5 cm) adaptadas, funcionando como compartimento individual ou mini-cmara. Em cada uma, foram colocados 40 ml de soluo saturada de NaCl, conforme Jianhua e McDonald (1996). As sementes foram distribudas uniformemente sobre a tela de alumnio colocada no interior de cada caixa, formando uma camada nica. As caixas
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Mtodos para a secagem de sementes de cebola submetidas ao condicionamento fisiolgico

Tabela 1. Porcentagem de germinao (G), ndice de velocidade de germinao (IVG), envelhecimento acelerado (EA), condutividade eltrica (CE) e grau de umidade (GU) de sementes de cebola, cultivar Petroline, lote 1, submetidas diferentes processos de secagem aps o condicionamento fisiolgico. Piracicaba, ESALQ, 2002.
Tratamentos Testemunha Condicionamento sem secagem Secagem rpida Secagem lenta Banho maria 1 hora Banho maria 3 horas Banho maria 5 horas Incubao PEG 24 horas Incubao PEG 72 horas Incubao PEG 120 horas Incubao 35C 24 horas Incubao 35C 48 horas C.V (%) G (%) 86 a 85 a 86 a 83 a 88 a 90 a 89 a 81 a 79 a 80 a 86 a 87 a 5,73 IVG 7,60 cde 12,07 a 8,90 bcd 9,23 bc 9,52 bc 10,33 b 9,71 bc 7,26 efg 6,69 fg 6,16 g 7,67 def 8,69 cde 6,82 EA (%) 61, cdef 65, bcde 79, a 70, abcd 76, ab 80, a 79, ab 58, def 49, f 50, ef 74, abc 78, ab 6,51 CE m mho/cm -1g-1 202,78 e 74,75 ab 92,05 bcd 114,19 d 104,32 bcd 107,54 cd 102,60 bcd 81,08 abcd 65,66 a 69,61 a 104,82 bcd 107,33 cd 12,63 GU (%) 5,6 44,9 7,9 7,2 7,4 7,5 7,8 7,2 6,9 7,2 6,6 6,9

plsticas foram tampadas e mantidas em uma cmara de envelhecimento (tipo B.O.D.) regulada a 41C0,3C, onde permaneceram por 72 h. Aps esse perodo, foram colocadas para germinar a 20C e avaliadas aos seis dias aps a semeadura. Os resultados foram expressos em percentagem de plntulas normais para cada lote. Avaliaes do grau de umidade, antes e aps o perodo de envelhecimento, permitiram verificar a preciso dos resultados. Condutividade eltrica O mtodo utilizado foi o de condutividade de massa, de acordo com Vieira (1994). Foram avaliadas quatro repeties de 50 sementes para cada lote. Cada repetio foi pesada com preciso de duas casas decimais e, a seguir, colocada em um copo plstico com capacidade para 200 ml, contendo 50 ml de gua deionizada (2mho cm-1 de condutividade) e mantida em germinador a 20C, durante 24 h. Aps esse perodo efetuaram-se as leituras da condutividade eltrica da soluo de embebio, em condutivmetro Digimed-CD-20 e os dados foram expressos em mmho cm-1 g-1 de sementes. Os dados obtidos nesses testes foram submetidos analise de varincia e as mdias comparadas pelo teste de Tukey (p0,05).

RESULTADOS E DISCUSSO
O teste de germinao (Tabelas 1 a 4) no foi suficientemente sensvel para
Hortic. bras., v. 23, n. 4, out.-dez. 2005

detectar variaes no potencial fisiolgico das sementes submetidas aos diferentes procedimentos para a secagem, com ou sem incubao prvia; as diferenas existentes foram identificadas por todos os testes de vigor conduzidos nesta pesquisa, normalmente mais rigorosos que o de germinao. As sementes apenas condicionadas apresentaram ndice de velocidade de germinao (IVG) sempre significativamente superior ao das sementes submetidas ao hidrocondicionamento e secagem, para todos os lotes avaliados (Tabelas 1 a 4). Essa ocorrncia pode ser atribuda necessidade de um perodo adicional para que as sementes com menor grau de umidade atingissem nveis semelhantes aos das mais midas, durante a etapa inicial do processo de germinao. Verificou-se que as sementes no submetidas secagem apresentaram grau de umidade em torno de 45%, enquanto, aps a secagem, esses valores atingiram aproximadamente 7%. Sabe-se que a velocidade de germinao est diretamente relacionada ao grau de umidade da semente (ROSSETTO et al., 1997). No entanto, mesmo aps a secagem, os valores do IVG foram superiores aos obtidos para a testemunha, indicando que a secagem no promoveu a reverso dos efeitos benficos do condicionamento, quando avaliados pela velocidade de germinao. A incubao em polietilenoglicol durante 24; 72 e 120 h e a conduzida a 35C, durante 24 e 48 h, para todos os

lotes avaliados, foram os tratamentos que conduziram aos menores IVG, quando comparados aos demais mtodos (Tabelas 1 a 4). Em contrapartida, os IVG mais elevados foram observados aps a incubao em banho-Maria, durante 3 e 5 h. Entretanto, neste caso, no foi detectada diferena significativa em relao ao processo de secagem rpida, que foi considerado o mtodo mais rpido e prtico. Considerando o comportamento das sementes condicionadas e no secadas, no teste de envelhecimento acelerado (Tabelas 1 a 4), verificou-se que, em presena de soluo saturada de NaCl, as que inicialmente apresentavam grau de umidade em torno de 45,1% (mdia dos quatro lotes), foram cedendo gua para o ambiente durante o teste e, no final, o seu teor de gua permaneceu ao redor de 12,7% (mdia dos quatro lotes). Desta maneira, as sementes no permaneceram com grau de umidade elevado durante todo o teste, o que contribuiu para amenizar os efeitos do envelhecimento acelerado. De acordo com Marcos Filho (1999), as sementes mais midas geralmente so mais sensveis s condies desse teste. Bruggink et al. (1999) observaram que, aps o teste de deteriorao controlada, houve reduo da porcentagem de germinao das no secadas aps o condicionamento; vale destacar que os princpios dos testes de envelhecimento acelerado e de deteriorao controlada so equivalentes. De maneira geral, foi constatado que as sementes condicionadas e secadas
889

R. F. Caseiro e J. Marcos Filho

Tabela 2. Porcentagem de germinao (G), ndice de velocidade de germinao (IVG), envelhecimento acelerado (EA), condutividade eltrica (CE) e grau de umidade (GU) de sementes de cebola, cultivar Petroline, lote 2, submetidas diferentes processos de secagem aps o condicionamento fisiolgico. Piracicaba, ESALQ, 2002.
Tratamentos Testemunha Condicionamento sem secagem Secagem rpida Secagem lenta Banho maria 1 hora Banho maria 3 horas Banho maria 5 horas Incubao PEG 24 horas Incubao PEG 72 horas Incubao PEG 120 horas Incubao 35C 24 horas Incubao 35C 48 horas C.V (%) G (%) 85 a 85 a 87 a 87 a 80 a 81 a 84 a 80 a 82 a 76 a 80 a 82 a 5,97 IVG 8,02 de 13,75 a 10,29 bc 10,28 bc 9,10 cd 10,73 b 10,29 bc 8,11 de 7,49 de 7,05 e 7,86 de 8,37 de 7,03 EA (%) 73, ab 76, a 81, a 58, bc 78, a 73, ab 79, a 52, c 58, bc 48, c 74, ab 76, a 7,45 CE m mho/cm -1g-1 179,18 d 66,74 a 88,77 c 90,21 c 95,58 c 95,14 c 90,60 c 73,11 ab 60,45 a 64,65 a 93,58 c 87,65 bc 6,97 GU (%) 6,6 44,2 7,7 7,3 7,1 7,6 7,7 6,6 6,9 6,8 6,1 6,9

Tabela 3.. Porcentagem de germinao (G), ndice de velocidade de germinao (IVG), envelhecimento acelerado (EA), condutividade eltrica (CE) e grau de umidade (GU) de sementes de cebola, cultivar Petroline, lote 3, submetidas diferentes processos de secagem aps o condicionamento fisiolgico. Piracicaba, ESALQ, 2002.
Tratamentos Testemunha Condicionamento sem secagem Secagem rpida Secagem lenta Banho maria 1 hora Banho maria 3 horas Banho maria 5 horas Incubao PEG 24 horas Incubao PEG 72 horas Incubao PEG 120 horas Incubao 35C 24 horas Incubao 35C 48 horas C.V (%) G (%) 89 a 92 a 89 a 90 a 92 a 93 a 93 a 88 a 91 a 83 a 94 a 90 a 5,78 IVG 9,02 fg 14,24 a 10,71 bcd 10,54 cd 10,37 cde 11,93 b 11,52 bc 8,90 fg 8,93 fg 7,76 g 9,86 def 9,15 ed 5,33 EA (%) 77, bcde 85, abcd 87, abc 80, abcde 83, abcd 87, ab 89, a 75, cde 67, e 73, de 84, abcd 85, abcd 5,75 CE m mho/cm -1g-1 185,26 e 61,58 a 81,60 bc 83,28 bc 90,46 cd 92,42 cd 100,60 d 73,92 ab 64,55 a 69,38 ab 95,35 cd 84,46 bc 7,18 GU (%) 5,3 45,8 7,6 7,3 7,1 7,6 7,9 6,8 6,9 7,0 6,6 6,9

foram mais resistentes s condies de estresse de alta temperatura e alta umidade relativa do ar, as quais foram impostas pelo teste de envelhecimento acelerado. As sementes submetidas aos procedimentos de secagem rpida e incubao em banho-Maria por 1; 3 e 5 h ou em estufa a 35C por 48 h (Tabela 1) e as sementes submetidas ao banho-maria por 5 h (Tabela 3), apresentaram germinao significativamente superiores testemunha. Na presente pesquisa, os procedimentos utilizados para a secagem das sementes de cebola, foram baseados nos por Bruggink et al. (1999), que obtiveram resultados semelhantes com a secagem lenta, banho-Maria (ou choque
890

trmico) e incubao das sementes a 35C; todos esses procedimentos beneficiaram o potencial fisiolgico das sementes. Ao contrrio do verificado no presente trabalho, Bruggink et al. (1999) verificaram que a incubao das sementes de Impatiens walleriana Hook em PEG 8000 foi eficiente para prevenir a reduo do potencial de armazenamento. Esse mesmo procedimento, utilizado por Bruggink e Van der Toorn (1995), havia induzido a tolerncia dessecao de sementes germinadas de pepino. Por outro lado, Bruggink et al. (1999) mencionaram que as sementes de amor-perfeito e de pimento submetidas secagem rpida, foram

mais sensveis ao teste de deteriorao controlada em relao s submetidas secagem lenta e incubao a 35C, respectivamente. Conseqentemente, verifica-se que a eficincia dos mtodos para induzir tolerncia dessecao e/ou melhor desempenho das sementes durante o armazenamento das sementes tambm influenciada pela espcie utilizada. Quando a eficincia dos procedimentos de secagem foi avaliada pelo teste de condutividade eltrica, todos os mtodos provocaram reduo significativa na exudao de solutos quando comparados testemunha. Vrios autores tm sugerido que o condicionamento fisiolgico pode exercer efeito benfiHortic. bras., v. 23, n. 4, out.-dez. 2005

Mtodos para a secagem de sementes de cebola submetidas ao condicionamento fisiolgico

Tabela 4. Porcentagem de germinao (G), ndice de velocidade de germinao (IVG), envelhecimento acelerado (EA), condutividade eltrica (CE) e grau de umidade (GU) de sementes de cebola, cultivar Petroline, lote 4, submetidas diferentes processos de secagem aps o condicionamento fisiolgico. Piracicaba, ESALQ, 2002.
Tratamentos Testemunha Condicionamento sem secagem Secagem rpida Secagem lenta Banho maria 1 hora Banho maria 3 horas Banho maria 5 horas Incubao PEG 24 horas Incubao PEG 72 horas Incubao PEG 120 horas Incubao 35C 24 horas Incubao 35C 48 horas C.V (%) G (%) 93 a 94 a 94 a 92 a 92 a 94 a 92 a 93 a 86 a 88 a 92 a 93 a 6,24 IVG 9,62 ef 16,08 a 11,66 bc 11,14 cd 10,89 cde 12,86 b 12,02 bc 9,74 ef 8,70 f 8,80 f 10,24 de 9,93 def 4,77 EA (%) 82, abc 87, ab 88, ab 88, ab 91, a 78, bc 86, ab 76, bc 70, c 76, bc 87, ab 89, ab 6,21 CE m mho/cm -1g-1 156,90 f 63,53 ab 76,55 cd 84,55 de 89,68 e 91,81 e 91,94 e 71,80 bc 62,07 a 61,56 a 87,94 e 78,13 cd 4,49 GU (%) 6,2 45,4 7,6 7,2 7,1 7,4 7,5 6,4 6,6 6,5 6,1 6,4

co sobre a integridade das membranas celulares (WOODSTOK; TAO, 1981; ARMSTRONG; MCDONALD, 1992). Porm, em outros trabalhos, foi ressaltado que a reduo na lixiviao de solutos aps o condicionamento fisiolgico pode ocorrer principalmente em funo da perda de eletrlitos durante esse tratamento e talvez no esteja relacionada reorganizao das membranas (DEARMAN et al., 1986; CHOJNOWSKI et al., 1997). No entanto, conforme destacaram Woodstock e Tao (1981), durante o processo de condicionamento fisiolgico, a hidratao ocorre de maneira mais lenta, aumentando a disponibilidade de tempo para o reparo ou reorganizao gradual das membranas. Os valores da condutividade eltrica obtidos aps a execuo de todos os mtodos de secagem (Tabelas 1 a 4), exceto incubao em PEG 8000, foram superiores aos observados para as sementes no secadas. Neste caso, a secagem provavelmente provocou desorganizao do sistema de membranas, permitindo maior lixiviao de eletrlitos. Porm, observa-se que aps todos os procedimentos de secagem houve reduo significativa na lixiviao de solutos, quando comparados testemunha, indicando a ocorrncia de reparo no sistema de membranas durante o condicionamento fisiolgico e que, mesmo aps a secagem, pelo menos parte desse reparo e/ou reorganizao foi mantida. No caso da incubao das sementes em PEG 8000, ressalta-se que,
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 5. Grau de umidade (%) aps o perodo de incubao pr- secagem, aps o condicionamento fisiolgico de quatro lotes de sementes de cebola, cultivar Petroline. Piracicaba, ESALQ, 2002.
Tratamentos Secagem lenta Banho maria 1 hora Banho maria 3 horas Banho maria 5 horas Incubao PEG 24 horas Incubao PEG 72 horas Incubao PEG 120 horas Incubao 35C 24 horas Incubao 35C 48 horas Lotes 1 10,1 39,3 40,3 34,7 47,6 48,1 48,4 39,2 33,6 2 10,5 38,9 39,3 35,0 47,3 49,5 48,9 38,1 32,4 3 10,0 38,3 41,1 39,1 48,2 48,7 49,3 40,2 34,6 4 10,0 38,9 39,7 35,7 48,0 49,1 48,8 39,7 29,2 Mdia 10,2 38,9 40,1 36,1 47,8 48,9 48,9 39,3 32,5

ao contrrio dos demais mtodos, as sementes ficaram imersas em soluo e, por isso, novamente pode ter ocorrido perda de eletrlitos no momento da incubao, diminuindo ainda mais a quantidade de lixiviados durante o teste de condutividade eltrica. No teste de condutividade eltrica para todos os lotes avaliados,com exceo do tratamento de incubao em PEG 8000 (Tabelas 1 a 4), a secagem rpida foi o mtodo que provocou as menores perdas de solutos durante o teste; destaca-se ainda que as sementes submetidas ao banho-maria por cinco horas (Tabela 3) e as submetidas ao banho-Maria por 1; 3 e 5 h e incubao a 35C, por 24 h (Tabela 4), apresentaram maiores ndices de lixiviao em relao s secadas rapidamente. De maneira geral, a incubao das sementes em PEG 8000,

durante 24; 72 e 120 h, foi o procedimento menos favorvel manifestao do potencial fisiolgico das sementes, no promovendo a tolerncia dessecao. Com exceo da incubao em PEG 8000 (Tabela 5), os demais procedimentos provocaram decrscimo no grau de umidade das sementes condicionadas, que apresentavam em torno de 45,1% de gua (mdia dos quatro lotes) antes do incio da incubao. No entanto, esses valores permaneceram elevados quando foi efetuada a incubao em soluo de PEG 8000. Isto justifica o desempenho inferior das sementes expostas a essa modalidade de incubao antes da secagem definitiva, pois as sementes mais midas apresentam atividade metablica mais intensa, predispondo-as deteriorao.
891

R. F. Caseiro e J. Marcos Filho

Desta maneira, as sementes de cebola foram sensveis desidratao aps o condicionamento fisiolgico, apenas quando foram mantidas com grau de umidade acima de 47,3%, por perodo superior a 24 h, antes da secagem. No mtodo de incubao em soluo de PEG 8000, as sementes que j haviam iniciado as atividades metablicas mais intensas durante o condicionamento fisiolgico, foram ainda incubadas por perodos de 24; 72 e 120 h, sem que houvesse condies para a continuidade do processo de germinao ou o incio da secagem, permanecendo por mais tempo com teores elevados de gua. De acordo com Vertucci e Farrant (1995), as clulas naturalmente tolerantes dessecao, quando mantidas com graus de umidade associados ocorrncia de atividades catablicas, podem sofrer danos mais severos se permanecerem nessas condies durante perodo prolongado, quando comparadas s secadas rapidamente. Assim, segundo aquelas autoras, a capacidade de tolerncia das sementes dessecao tambm depende da maneira como a secagem realizada. Os dados obtidos no presente trabalho demonstraram que possvel efetuar a secagem aps o condicionamento fisiolgico de sementes de cebola, sem provocar reverso significativa dos efeitos favorveis ao potencial fisiolgico. Como no foram verificadas variaes acentuadas entre os processos de secagem rpida, secagem lenta, incubao em banho-Maria e incubao a 35C, o uso da secagem rpida mais conveniente para a reduo do grau de umidade das sementes condicionadas de cebola pois, alm de rpido, esse procedimento mais prtico que os demais mtodos que envolvem incubao.

LITERATURA CITADA
ARMSTRONG, H.; McDONALD, M.B. Effects of osmoconditioning on water uptake and electrical conductivity in soybean seeds. Seed Science & Technology, v.20, p.391-400, 1992. BRASIL. Ministrio da Agricultura e Reforma Agrria. Regras para anlise de sementes . Braslia: SNDA/DNDV/CLAV, 1992. 365 p. BROCKLEHURST, P.A.; DEARMAN, J. Interactions between seed priming treatments and nine seed lots of carrot, celery and onion. I. Laboratory germination. Annals of Applied Biology, v.102, p.577-584, 1983. BRUGGINK, G.T.; OOMS, J.J.J.; Van der TOORN, P. Induction of longevity in primed seeds. Seed Science Research, v.9, p.49-53, 1999. BRUGGINK, T.; van der TOORN, P. Induction of desiccation tolerance in germinated seeds. Seed Science Research, v.5, p.1-4, 1995. CASEIRO, R.F.; BENNETT, M.A.; MARCOS FILHO, J. Comparison of three priming techniques for onion seed lots differing in initial seed quality. Seed Science and Technology, v.32, n.2, p.365-375, 2004. CHOJNOWSKI, M.; CORBINEAU, F.; CME, D. Physiological and biochemical changes induced in sunflower seeds by osmopriming and subsequent drying, storage and aging. Seed Science Research, v.7, p.323-331, 1997. DEARMAN, J.; BROCKLEHURST, P.A.; DREW, R.L. Effects of osmotic priming and ageing on onion seed germination. Annals of Applied Biology, v.108, p.639-648, 1986. EIRA, M.T.S.; MARCOS-FILHO, J. Condicionamento osmtico de sementes de alface. I. Efeitos sobre a germinao. Revista Brasileira de Sementes, Braslia, v.12, n.1, p.9-27, 1990. FINCH-SAVAGE, W.E. Influence of seed quality on crop establishment, growth, and yield. In: BASRA, A.S. (Ed.). Seed quality: basic mechanisms and agricultural implications. Binghamton, NY: The Haworth Press, 1995. p.361-384. FURUTANI, S.C.; ZANDSTRA, B.H.; PRICE, H.C. The effects of osmotic solute composition and duration and temperature of priming on onion seed germination. Seed Science & Technology, v.14, p.545-551, 1986. GUEDES, A.C.; CANTLIFFE, D.J. Germination of lettuce seeds at high temperature after seed priming. Journal of the American Society for Horticultural Science, v.105, n.6, p.777-781, 1980.

HAIGH, A.M.; BARLOW, E.W.R.; MILTHORPE, F.L. Field emergence of tomato, carrot, and onion seeds primed in an aerated salt solution. Journal of the American Society for Horticultural Science, v.111, n.5, p.660-665, 1986. HEYDECKER, W.; HIGGINS, J.; TURNER, Y.J. Invigoration of seeds. Seed Science & Technology, v.3, p.881-888, 1975. JIANHUA, Z.; McDONALD, M.B. The saturated salt accelerated aging test for small-seeded crops. Seed Science & Technology , v.25, p.123-131, 1996. MAGUIRE, J.D. Speed of germination-aid in selection and evaluation for seedling emergence and vigor. Crop Science, v.2, n.1, p.176-177, 1962. MARCOS-FILHO, J. Teste de envelhecimento acelerado. In: KRZYZANOWSKI, F.C.; VIEIRA, R.D.; FRANA-NETO, J.B. (Eds.). Vigor de sementes: conceitos e testes. Londrina: Abrates, 1999. p.1-24. NASCIMENTO, W.M. Condicionamento osmtico de sementes de hortalias: potencialidades e implicaes. Horticultura Brasileira, Braslia, v.16, n.2, p.106-109, 1998. PILL, W.A. Low water potential and presowing germination treatments to improve seed quality. In: BASRA, A.S. (Ed.). Seed quality: basic mechanisms and agricultural implications. Binghamton, NY: The Haworth Press, 1995, cap.10, p.319-359. ROSSETO, C.A.V.; NOVEMBRE, A.D.L.C.; MARCOS FILHO, J.; SILVA, W.R.; NAKAGAWA, J. Comportamento das sementes de soja durante a fase inicial do processo de germinao. Scientia Agrcola, Piracicaba, v.54, n.1/ 2, p.106-115, 1997. ROWSE, H.R. Drum priming A non-osmotic method of priming seeds . Seed Science & Technology, v.24, p.281-294, 1996. VERTUCCI, C.W.; FARRANT. J.M. Acquisition and loss of desiccation tolerance. In: KIGEL, J. & GALILI, G. (Eds.). Seed development and germination. New York: Marcel Dekker, 1995. p.237-271. VIEIRA, R.D. Teste de condutividade eltrica. In: VIEIRA, R.D.; CARVALHO, N.M. (Eds.). Testes de vigor em sementes. Jaboticabal: Funep, 1994. p.103-132 WOODSTOCK, L.W.; TAO, K.J. Prevention of imbibitional injury in low vigor soybean embryonic axes by osmotic control of water uptake. Physiologia Plantarum, v.51, p.133-139, 1981.

892

Hortic. bras., v. 23, n. 4, out.-dez. 2005

MOREIRA, G.R.; SILVA, D.J.H.; PICANO, M.C.; PETERNELLI, L.A.; CALIMAN, F.R.B. Divergncia gentica entre acessos de tomateiro infestados por diferentes populaes da traa-do-tomateiro. Horticultura Brasileira, Braslia, v.23, n.4, p.893-898, out-dez 2005.

Divergncia gentica entre acessos de tomateiro infestados por diferentes populaes da traa-do-tomateiro
Gisele R. Moreira1; Derly Jos H. da Silva2; Marcelo C. Picano3; Luiz Alexandre Peternelli4; Fabiano Ricardo B. Caliman2
UFV, Gentica e Melhoramento, 36571-000 ViosaMG; E-mail: grmoreira@hotmail.com; 2UFV, Depto. Fitotecnia, 36571-000 Viosa MG;. E-mail: derly@ufv.br; frcaliman@yahoo.com.br; 3UFV, Depto. Biologia Animal, 36571-000 ViosaMG; E-mail: picanco@ufv.br; 4 UFV, Depto Informtica, 36571-000 Viosa MG; E-mail: ptrnelli@dpi.ufv.br
1

RESUMO
Neste trabalho estudou-se a divergncia gentica entre acessos de Lycopersicon spp. com relao resistncia a populaes da traa-do-tomateiro, Tuta absoluta, e verificou-se a importncia relativa dos caracteres da traa-do-tomateiro para a divergncia. Foi conduzido experimento envolvendo quatro populaes do inseto procedentes de Uberlndia (MG), Viosa (MG), Camocim de So Flix (PE) e Santa Teresa (ES) e cinco acessos de tomateiro, Santa Clara, Moneymaker, TOM-601, PI 126445 (L. hirsutum f. typicum) e PI 134417 (L. hirsutum f. glabratum). Foram realizados testes de mdias de Tukey e mtodo de agrupamento de Tocher, e verificada a importncia relativa dos caracteres da traa-do-tomateiro para a divergncia entre acessos por meio do mtodo de Singh. Verificou-se a existncia de variabilidade gentica entre os acessos de tomateiro quando infestados pelas populaes da traa-do-tomateiro provenientes das diferentes regies do Brasil. O acesso Santa Clara foi o mais suscetvel populao de Santa Teresa. Moneymaker e TOM601 foram mais resistentes s populaes provenientes de Camocim de So Flix e Santa Teresa, respectivamente. PI 126445 foi mais resistente s populaes de Santa Teresa e Viosa. PI 134417 foi mais resistente populao de Viosa. Moneymaker e TOM-601 mostraram-se boas fontes a serem utilizadas em programas de melhoramento que visem obteno de cultivars de tomate resistentes traa-do-tomateiro. Os caracteres que mais contriburam para a divergncia entre os acessos de tomateiro foram mortalidade larval, nmero de pupas fmea e nmero de pupas macho. Os caracteres perodo larval e peso de pupas macho no podem ser eliminados em futuras avaliaes de resistncia populao da traa-do-tomateiro proveniente de Uberlndia. Palavras-chave: Lycopersicon spp., Tuta absoluta, recursos genticos, variabilidade gentica, melhoramento de plantas.

ABSTRACT
Genetic diversity among tomato accessions infested by different tomato leaf miner populations The genetic diversity among Lycopersicon spp. accesses was studied, concerning the resistance to various Tuta absoluta populations. An experiment was carried out using four populations of the insect originally from Uberlndia, Viosa, Camocim de So Flix and Santa Teresa and five tomato accessions, Santa Clara, Moneymaker, TOM-601, PI 126445 (L. hirsutum f. typicum) and PI 134417 (L. hirsutum f. glabratum). Tukey mean comparing test and Tocher grouping were accomplished and the relative importance of T. absoluta characters to the genetic divergence among tomato accessions was evaluated by Singh method. There was genetic variability among tomato accessions when infested by tomato leaf miner populations collected from different regions of Brazil. The Santa Clara accession was most susceptible to Santa Teresa population. Moneymaker and TOM-601 were most resistant to Camocim de So Flix and Santa Teresa populations, respectively. PI 126445 was most resistant to Santa Teresa and Viosa populations. PI 134417 was most resistance to Viosa population. Moneymaker and TOM-601 can be utilized in breeding programs aiming to obtain tomato plants resistant to the tomato leaf miner. The characteristics that most contributed to the genetic divergence among tomato accessions were larval mortality, female pupae number and male pupae number. The characters larval period and male pupae weight cannot be eliminated in future resistance evaluations to the population tomato leaf miner from Uberlndia.

Keywords: Lycopersicon spp., Tuta absoluta, genetic divergence, genetic variability, plant breeding.

(Recebido para publicao em 27 de julho de 2004 e aceito em 3 de agosto de 2005) tomate (Lycopersicon esculentum Mill.) uma das mais importantes hortalias cultivadas no mundo. A China e os Estados Unidos so os principais produtores com 25.851 t e 12.275 t, respectivamente (FAO, 2004). O Brasil o maior produtor da Amrica Latina, com aproximadamente, 3,5 milhes de t, sendo os maiores estados produtores Gois, So Paulo e Minas Gerais (AGRIANUAL, 2005). Maior parte das produes brasileira e chinesa destinada ao consumo in
Hortic. bras., v. 23, n. 4, out.-dez. 2005

natura (62% e 95%, respectivamente), enquanto apenas 21% da produo americana destinada a este fim, sendo o restante processado pelas indstrias de alimento (FONTES; SILVA, 2002). Em ambos os casos, h grande exigncia em relao qualidade e aparncia dos frutos. Isto impe constante ateno por parte dos produtores devido ao grande nmero pragas e doenas que ocorre durante o ciclo da cultura, que , portanto, exigente em tratamentos fitossanitrios.

No contexto das pragas, a traa-dotomateiro, Tuta absoluta (Lepidoptera: Gelechiidae), tem sido de grande importncia em praticamente todas as regies onde o tomate cultivado. Os danos so caracterizados por galerias produzidas pelas lagartas nas gemas, brotos terminais, flores, insero dos ramos e frutos e, especialmente s folhas (SOUZA; REIS, 1992). O controle da traa-do-tomateiro baseado na aplicao intensiva de inseticidas, o que tem acarretado, alm do
893

G. R. Moreira et al.

aumento no custo de produo, a reduo da populao de inimigos naturais (MELO; CAMPOS, 2000) e o aparecimento de populaes da praga resistentes aos inseticidas (SIQUEIRA et al., 2001). Uma alternativa para atenuar os problemas citados a utilizao da resistncia presente em espcies silvestres e a incorporao desta no tomateiro cultivado. Dentre estas se destacam os acessos PI 134417 de L. hirsutum f. glabratum e PI 126445 de L. hirsutum f. typicum , os quais contm as metilcetonas, trideca-2-ona (2-TD) e undeca-2-ona (2-UD), e o sesquiterpeno-zingibereno nos exudatos dos tricomas glandulares tipo VI das folhas, respectivamente, que promovem efeitos negativos na biologia e comportamento da praga (RAHIMI; CARTER, 1993; THOMAZINI et al., 2001; LEITE et al., 1999). Alm das espcies citadas a cultivar Moneymaker e a linhagem TOM-601 tm se mostrado promissoras em programas de melhoramento que visam obteno de plantas de tomate resistentes s pragas, por possurem teores de 2-TD nos tricomas glandulares tipo VI das folhas relacionados com a resistncia T. urticae (CHATZIVASILEIADIS et al., 1999; ARAGO et al., 2002). Alm do conhecimento de fontes promissoras de resistncia traa-dotomateiro outro fator importante no melhoramento visando obteno de cultivar resistente a este inseto, a divergncia gentica. Segundo Cruz e Regazzi (1997), com base na divergncia gentica, pode-se selecionar, dentre vrios genitores, aquelas combinaes hbridas de maior efeito hetertico na prognie e maior probabilidade de recuperar gentipos superiores nas geraes segregantes. Vrios mtodos podem ser utilizados para avaliar a divergncia gentica entre genitores, dentre eles os multivariados, como os aglomerativos (mtodos hierrquico e de otimizao) baseados em medidas de dissimilaridade (distncia generalizada de Mahalanobis, distncia euclidiana e distncia euclidiana mdia) tm sido bastante utilizados. Pesquisadores tm constatado a viabilidade da utilizao da distncia
894

generalizada de Mahalanobis, e os mtodos nela baseados, como ferramenta orientadora na escolha de genitores em diversas culturas como milho (CRUZ et al., 1994), feijo (MACHADO et al., 2002), Capsicum spp. (SUDR et al., 2005) e tomate (SUINAGA et al., 2003). Outro fator que deve ser considerado na seleo dos genitores o nmero de caracteres avaliados durante a seleo. necessrio avaliar a importncia de cada caractere para a diversidade, identificando-se aqueles que menos contribuem, sendo recomendvel o descarte em estudos futuros. Neste aspecto, tem-se o mtodo proposto por Singh (1981) o qual divide a distncia de Mahalanobis em partes referentes a cada varivel, e o mtodo de descarte de variveis proposto por Garcia (1998) o qual se baseia no mtodo de Singh (1981) e no posterior agrupamento pelo mtodo de otimizao de Tocher. Ou seja, se na ausncia do carter com pouca contribuio para a divergncia houver alterao no agrupamento original, tal carter no pode ser descartado. O objetivo deste trabalho foi estudar a divergncia gentica entre acessos de tomateiro infestados por populaes de T. absoluta, provenientes de diferentes regies do Brasil, e verificar a importncia relativa dos caracteres da traa-do-tomateiro para a divergncia gentica.

MATERIAL E MTODOS
O experimento foi realizado nos meses de maro e abril de 2001, em condies de casa de vegetao, na Horta da UFV, segundo esquema fatorial 4 x 5, sendo os fatores, respectivamente, populaes de Tuta absoluta e acessos de Lycopersicon spp. As populaes do inseto foram provenientes de Uberlndia (MG), Viosa (MG), Camocim de So Flix (PE) e Santa Teresa (ES), e os acessos de tomateiro utilizados foram Santa Clara (padro de suscetibilidade traa-do-tomateiro), Moneymaker, TOM-601, PI 126445 (L. hirsutum f. typicum) e PI 134417 (L. hirsutum f. glabratum). Os tratamentos foram dispostos no delineamento inteiramente casualizado, com trs repeties. Cada parcela expe-

rimental foi constituda por um vaso de polietileno com capacidade para quinze litros de substrato contendo uma planta de tomateiro com 101 dias de idade no incio das avaliaes. Na constituio das repeties, folhas contendo larvas no segundo estdio de desenvolvimento, de cada populao da traa-do-tomateiro devidamente identificada, foram coletadas das criaes em laboratrio da UFV, depositadas em bandejas e levadas at a horta da UFV. A infestao das plantas foi feita depositando-se dez larvas de T. absoluta em duas folhas totalmente expandidas (cinco larvas por folha) do tero superior de cada uma das plantas a serem avaliadas. A seguir as folhas foram envolvidas por sacolas de organza de 20 x 28 cm. Uma semana aps a infestao iniciaram-se as seguintes avaliaes: nmero de minas grandes (comprimento 0,5cm), nmero de minas pequenas (comprimento < 0,5cm), mortalidade larval em porcentagem e perodo larval em dias (2 ao 4 estdio de desenvolvimento), as quais foram realizadas duas vezes por semana at a fase de pupao. Aps a pupao, foram avaliados o sexo, por meio da avaliao da poro terminal do abdome pupal (COELHO; FRANA, 1987), a razo sexual [nmero de pupas fmea/(nmero de pupas fmea + nmero de pupas macho)] e os pesos das pupas fmea e macho em miligramas. Os caracteres avaliados foram inicialmente submetidos a anlises grficas dos resduos, para testar a normalidade e homogeneidade das varincias. A confirmao da normalidade foi feita por meio dos testes de Shapiro-Wilk e Kolmogorov-Smirnov (P<0,05), enquanto que para homogeneidade foi usado o teste de Bartllet (P<0,05) (STEEL et al., 1997). Estas anlises foram realizadas com o auxlio do programa estatstico SAS. Foi realizada anlise de varincia (a = 5%) e anlises univariada (teste de comparao de mdias de Tukey) e multivariada (mtodo de otimizao de Tocher, baseado na dissimilaridade expressa pela distncia generalizada de Mahalanobis) (CRUZ; REGAZZI,
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Divergncia gentica entre acessos de tomateiro infestados por diferentes populaes da traa-do-tomateiro

Tabela 1. Mdias de oito caracteres de Tuta absoluta em funo da populao da praga e do acesso de tomateiro. Viosa, UFV, 2001.
Populao de T. absoluta Acessos de tomateiro 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 PI 134417 CV (%) 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 PI 134417 CV (%) 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 PI 134417 CV (%) 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 PI 134417 CV (%) 8,75 a A 6,15 b A 9,44 a A 8,94 a A 8,27 b A 50,00 a AB 23,33 b B 30,00 b B 60,00 ab A 6,33 a B 12,67 a AB 6,67 b B 27,67 b A Nmero de minas grandes Uberlndia 1,11 bAB 0,90 a AB 0,87 a B 1,11 ab AB 1,20 a A Viosa 1,23 ab A 1,03 a A 0,98 a A 1,17 a A 1,16 a A 13,09 Nmero de minas pequenas 11,67 a B 9,67 a B 10,33 ab B 53,00 a A 40,46 Mortalidade larval (%) 53,33 a AB 40,00 b B 70,00 a A 73,33 a A 26,00 Perodo larval (dias) 12,94 a A 9,92 ab A 8,04 a A 10,22 a A 7,00 b A 35,18 10,26 a A 5,50 b A 10,33 a A 12,86 a A 8,40 b A 15,08 a A 15,39 a A 14,61 a A 13,00 a A 16,55 a A 3,11 a A 1,70 a AB 3,43 a A 2,63 a AB 0,50 a B CV (%) 23,33 b B 66,67 a A 23,33 b B 46,67 b AB 3,33 b D 20,00 b CD 93,33 a A 43,33 b BC 3,43 a AB 3,14 a AB 4,37 a A 3,45 a AB 1,79 a B CV (%) 1,97 a AB 2,79 a A 2,49 ab AB 0,37 b B 0,80 a AB 14,00 a AB 5,67 a B 25,00 a A 19,67 b AB 12,33 b AB 8,67 a C 3,00 a C 5,67 b C 54,33 a A 33,67 a B 2,67 a AB 1,33 b AB 1,33 ab AB 3,00 a A 0,67 a B CV (%) 3,16 a A 2,92 a A 3,45 ab A 1,83 ab A 3,46 a A
(1)

Nmero de pupas fmea Santa Teresa 1,49 a A 1,01 a B 0,82 a B 0,92 b B 1,09 a B Uberlndia 2,33 b B 6,33 a A 4,33 a AB 4,00 ab AB 3,33 a AB CV (%) 2,00 a AB 3,67 a A 3,00 a A 0,67 b B 0,33 a B Viosa 2,67 b A 2,33 b A 4,00 a A 2,33 bc A 2,33 a A Camocim deSo Flix 4,33 b AB 2,67 b B 4,33 a AB 7,00 a A 4,67 a AB 36,27 Nmero de pupas macho 3,33 a A 0,67 B B 0,67 b B 0,67 b B 0,67 a B 54,70 Peso de pupas fmea (mg) 4,70 a A 2,17 a B 3,46 ab AB 2,73 a B 2,78 a B 25,93 Peso de pupas macho (mg) 3,57 a A 0,87 a B 0,94 b B 0,50 ab B 1,28 a AB 56,59 2,89 a A 2,24 a AB 0,41 b B 0,00 b B 2,17 a AB 4,56 a A 3,83 a A 1,84 b BC 0,80 b C 3,24 a AB 2,00 a AB 4,00 a A 0,33 b B 0,00 b B 2,00 a AB Santa Teresa 7,67 a A 4,00 ab B 3,00 a BC 0,67 c C 3,67 a BC

Camocim deSo Flix 1,18 b A 0,92 a A 0,94 a A 1,11 ab A 1,05 a A

18,00 ab AB 23,00 ab B

43,33 ab AB 30,00 b B

50,00 ab AB 66,67 a AB

(1) Dados transformados: log (x). As mdias seguidas pela mesma letra minscula na linha ou maiscula na coluna no diferem significativamente, pelo teste de comparao de mdias de Tukey, a 5% de probabilidade.

1997). A importncia relativa dos caracteres da T. absoluta para a divergncia gentica foi avaliada como proposto por Singh (1981) e o estudo do descarte de variveis foi feito como proposto por Garcia (1998). Estas anlises foram realizadas com o auxlio do programa estatstico GENES, verso Windows (CRUZ, 2001).

RESULTADOS E DISCUSSO
Houve significncia do efeito de populao de T. absoluta para os caracteres nmero de minas pequenas, mortalidade larval, perodo larval e nmero de pupas fmea. O efeito de acessos de tomateiro no foi significativo apenas nos caracteres perodo larval, nmero de pupas fmea e razo sexual.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Para a interao entre os efeitos de populao de T. absoluta e acessos de tomateiro, houve significncia para todos os caracteres, com exceo do perodo larval e razo sexual (dados no mostrados). Estes resultados evidenciam variabilidade tanto entre as populaes da traa-do-tomateiro quanto entre os acessos de tomateiro, porm a utilizao dos acessos de tomateiro em programas de melhoramento que visam obteno de cultivars resistentes T. absoluta, depende da populao da praga que est sendo analisada. Os maiores coeficientes de variao foram obtidos para os caracteres nmero de pupas macho e peso de pupas macho (54,70% e 56,59%, respectivamente) (Tabela 1). No entanto, esses nveis so aceitveis em termos de preciso

experimental para experimentos de resistncia a insetos. A cultivar Santa Clara apresentou variao de suscetibilidade em relao s diferentes populaes de T. absoluta. A populao da traa-do-tomateiro oriunda de Santa Teresa causou o maior nmero de minas grandes (1,49), teve menor mortalidade larval (3,33) e apresentou maior nmero de pupas fmea (7,67) (Tabela 1). Segundo Suinaga et al. (1999) a cultivar Santa Clara constitui substrato alimentar adequado para lagartas da traa-do-tomateiro, provavelmente devido s baixas concentraes de substncias txicas ou inibidores de origem morfolgica. Na cultivar Moneymaker, a populao de Camocim de So Flix teve a maior mortalidade larval (66,67) e um
895

G. R. Moreira et al.

Tabela 2. Medidas de dissimilaridade gentica entre acessos de tomateiro sob infestao de diferentes populaes de Tuta absoluta, a partir da distncia generalizada de Mahalanobis (Dii2) de nove caracteres de T. absoluta. Viosa, UFV, 2001.
Populao de T. absoluta Uberlndia 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 Viosa 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 Camocim de So Flix 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 Santa Teresa 'Santa Clara' 'Moneymaker' TOM-601 PI 126445 203,792 404,198 136,740 528,470 543,611 38,847 123,758 123,290 5,683 Acesso de tomateiro 'Moneymaker' 162,803 TOM-601 83,286 51,615 PI 126445 101,487 31,461 39,066 81,895 196,330 178,158 793,998 59,884 46,821 878,206 357,703 118,197 PI 134417 49,409 48,998 126,233 92,703 46,117 164,677 141,370 23,632 403,444 24,642 63,813 104,291 221,504 35,369 68,920 236,061

dos menores nmeros de pupas fmea e macho (2,67 e 0,67, respectivamente). Por outro lado, teve pequeno perodo larval (5,50) (Tabela 1). De acordo com Lara (1991) diferenas quanto durao do perodo larval so importantes quando se visa a resistncia de plantas s pragas, visto que, quanto maior esta fase, maior nmero de nstares (estdios de desenvolvimento) sero necessrios para que se complete o desenvolvimento do inseto e, consequentemente, haver menor nmero geraes do inseto. Deste modo, apesar da vantagem adaptativa desta populao, a populao de insetos possivelmente no aumentar, devido alta mortalidade. Na linhagem TOM-601 observou-se que a populao de Santa Teresa causou baixo nmero de minas pequenas (5,67), apresentou alta mortalidade larval (66,67), pequeno nmero de pupas macho (0,33) e baixos pesos de pupas fmea e macho (1,84 e 0,41, respectivamente) (Tabela 1). A resistncia de Moneymaker e TOM-601 s populaes de Camocim de So Flix e Santa Teresa, respectivamente, pode estar relacionada com a presena da 2-TD e 2-UD nos tricomas glandulares tipo VI das folhas, as quais j foram relacionadas com a resistncia desses acessos T. urticae (CHATZIVASILEIADIS et al., 1999; ARAGO et al., 2002).
896

A populao de Santa Teresa causou elevado nmero de minas pequenas (54,33) em PI 126445, entretanto, este acesso pode ser considerado resistente a esta populao devido ao pequeno nmero de minas grandes (0,92), alta mortalidade larval (93,33), pequenos nmeros de pupas fmea e macho (0,67 e 0,00, respectivamente) e baixos pesos de pupas fmea e macho (0,80 e 0,00, respectivamente) (Tabelas 1). Este acesso silvestre tambm manifestou maior resistncia populao de Viosa, visto que, apesar de ter causado elevados nmeros de minas grandes (1,17) e pequenas (53,00), esta populao apresentou elevada mortalidade larval (70,00), nmero e peso relativamente baixos de pupas fmea (2,33 e 1,83, respectivamente) e pequenos nmero e peso de pupas macho (0,67 e 0,37, respectivamente) (Tabela 1). Em PI 134417, elevado nmero de minas grandes (1,16), nmero relativamente alto de minas pequenas (23,00) e pequeno perodo larval (7,00) foram observados quanto a populao de Viosa (MG), entretanto, apresentou alta mortalidade larval (73,33) e pequeno nmero de pupas fmea (2,33) (Tabelas 1). Apesar do elevado nmero de minas grandes causado pela populao de Viosa em PI 126445 e PI 134417, observaram-se altas mortalidades larvais, possivelmente devido aos aleloqumicos

presentes nos exudatos dos tricomas glandulares tipo VI das folhas dessas espcies (EIGENBRODE et al., 1996; LEITE et al., 1999) e/ou presena de componentes lamelares (EIGENBRODE et al., 1996). Segundo Lara (1991) o inseto poder se alimentar de grande quantidade de determinado substrato, mas este no lhe ser favorvel, provocando distrbios no desenvolvimento e podendo causar at a morte. O elevado nmero de minas pequenas em PI 126445 e PI 134417 pode se devido s lagartas caminhando, sobre a superfcie foliar, procura de substrato adequado, uma vez que os aleloqumicos sesquiterpeno-zingibereno e metilcetonas (2-TD e 2-UD), presentes nesses acessos, so volteis (FREITAS et al., 1998; LEITE et al., 1999), ou existncia de substncias deterrentes alimentao de T. absoluta no mesfilo foliar dessas espcies (LIN; TRUMBLE, 1986). A dissimilaridade entre os acessos de tomateiro variou de acordo com a populao da praga com as quais foram infestados. Na populao de Uberlndia, o par mais similar foi Moneymaker e PI 126445 (31,46) e o mais dissimilar foi Santa Clara e Moneymaker (162,80). Na populao de Viosa, Moneymaker e TOM-601 foram os mais similares (5,68), enquanto Moneymaker e PI 126445 foram os
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Divergncia gentica entre acessos de tomateiro infestados por diferentes populaes da traa-do-tomateiro

mais dissimilares (196,33). Nas populaes de Camocim de So Flix e Santa Teresa, observou-se maior similaridade entre Moneymaker e PI 134417 (24,64 e 35,37, respectivamente) e maior dissimilaridade entre Santa Clara e PI 126445 (793,99 e 878,21, respectivamente) (Tabela 2). A identificao de genitores com mxima divergncia gentica tem sido estudada por muitos autores em programas de melhoramento (SUINAGA et al., 2003; MACHADO et al., 2002; SUDR et al., 2005) de modo a maximizar a heterose manifestada nos hbridos e aumentar a probabilidade de ocorrncia de gentipos superiores nas geraes segregantes. De acordo com Cruz et al. (1994) recomenda-se evitar cruzamentos entre indivduos de mesmo padro de similaridade para que a variabilidade no seja restrita a inviabilizar os ganhos a serem obtidos com a seleo. Outro fato importante que deve ser considerado na escolha dos genitores a serem cruzados se os mesmos pertencem a grupos diferentes, evitando-se o cruzamento entre genitores de mesmo agrupamento (CARPENTIERIPIPOLO et al., 2000). Com base no mtodo de otimizao de Tocher foram formados 2; 3; 2 e 3 grupos, quando os acessos de tomateiro foram infestados pelas populaes de Uberlndia, Viosa, Camocim de So Flix e Santa Teresa, respectivamente. Quando infestadas pela populao de Uberlndia, foram alocados em um grupo Moneymaker, TOM-601 e PI 126445 e em outro grupo a cultivar Santa Clara e PI 134417. Quando infestadas pela populao de Viosa, Moneymaker e TOM-601 ficaram em um grupo distinto das espcies silvestres PI 126445 e PI 134417, e em outro grupo distinto a cultivar Santa Clara. Quando a infestao foi feita com a populao de Camocim de So Flix, observou-se mais uma vez que a cultivar Santa Clara teve comportamento diferencial entre os acessos de tomateiro, ficando em grupo isolado. Quando infestadas pela populao de Santa Teresa, Moneymaker e TOM-601 e o acesso silvestre PI 134417 constituram mesmo grupo, ficando em grupos distintos Santa Clara e PI 126445 (TabeHortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 3. Agrupamento dos acessos de tomateiro sob infestao de diferentes populaes de Tuta absoluta pelo mtodo de Tocher, com base na dissimilaridade expressa pela distncia generalizada de Mahalanobis. Viosa, UFV, 2001.
Populao de T. absoluta Uberlndia Viosa Grupo I II I II III Camocim de So Flix Santa Teresa I II I II III Acessos de tomateiro 'Moneymaker', PI 126445, TOM-601 'Santa Clara', PI 134417 'Moneymaker', TOM-601 PI 126445, PI 134417 'Santa Clara' 'Moneymaker', PI 134417, TOM-601, PI 126445 'Santa Clara' 'Moneymaker', PI 134417, TOM-601 PI 126445 'Santa Clara'

la 3). Pode-se concluir, com esses resultados, que a cultivar Santa Clara foi a mais divergente em relao aos demais acessos de tomateiro, ficando em grupo isolado quando infestada por trs das quatro populaes de T. absoluta. Apesar de ter sido observada dissimilaridade gentica intra e inter grupos, no presente trabalho no foi possvel recomendar cruzamentos promissores entre os acessos de Lycopersicon estudados, devido ao fato destes no terem apresentado resistncia simultnea s distintas populaes da traa-do-tomateiro. Num programa de melhoramento interessante que se leve em considerao a variabilidade do inseto, porm a obteno da cultivar de tomate no pode ser resistente traado-tomateiro oriunda de apenas uma localidade especfica. Todavia, pode-se inferir que Moneymaker e TOM-601 podem ser utilizadas em programas de melhoramento que objetivam a obteno de plantas de tomate resistentes T. absoluta, pois foram, em geral, mais prximas geneticamente de PI 126445 e/ou PI 134417, portanto, menos suscetveis s populaes da praga que a cultivar Santa Clara. Com relao importncia relativa dos caracteres para a divergncia gentica entre Lycopersicon spp., segundo o mtodo de Singh (1981), os caracteres com maior influncia na distncia generalizada de Mahalanobis foram mortalidade larval e nmero de pupas fmea, quando estes foram infestados pelas populaes de Uberlndia e Santa Teresa (47,06% e 44,38% e, 45,57% e

33,32%, respectivamente). Quando infestados pelas populaes de Viosa e Camocim de So Flix as maiores contribuies foram do nmero de pupas macho e mortalidade larval (40,19% e 23,29% e, 42,76% e 26,41% respectivamente) (Tabela 4). Quando os acessos de tomateiro foram infestados pela populao da traado-tomateiro proveniente de Uberlndia, os caracteres menos importantes para a divergncia foram perodo larval e peso de pupas macho (0,14% e 0,26%, repetitivamente). Quando infestados pela populao de Viosa, os caracteres menos importantes foram peso de pupas macho e peso de pupas fmea (0,20% e 0,56%). Em relao populao de Camocim de So Flix os caracteres menos importantes foram nmero de minas pequenas e perodo larval (0,12% e 0,66%) e, em relao populao de Santa Teresa os caracteres menos importantes foram perodo larval e razo sexual (0,12% e 0,19%) (Tabela 4). O nmero de caracteres avaliados na seleo de gentipos de suma importncia em programa de melhoramento. Caracteres que contribuem pouco para a divergncia podem ser eliminados aumentando a eficincia da seleo. Com base no mtodo de descarte de variveis proposto por Garcia (1998) constatouse que os caracteres perodo larval e peso de pupas macho no podem ser eliminados em futuras avaliaes de resistncia populao da traa-do-tomateiro proveniente de Uberlndia, devido a mudana no agrupamento original. Todavia, o perodo larval pode ser elimi897

G. R. Moreira et al.

Tabela 4. Contribuio relativa (%) de nove caracteres de Tuta absoluta para a divergncia gentica entre acessos de tomateiro sob infestao de diferentes populaes de Tuta absoluta, utilizando-se a metodologia de Singh. Viosa, UFV, 2001.
Caracteres de T. absoluta MG MP ML PL NPF NPM RS PPF PPM
(1)
(1)

Populao de T. absoluta Uberlndia 1,34 0,96 47,06 0,14 44,38 3,35 1,00 1,51 0,26 Viosa 1,89 1,64 23,29 3,98 6,46 40,19 21,79 0,56 0,20 Camocim de So Flix 2,87 0,12 26,41 0,66 14,35 42,76 1,04 7,34 4,45 Santa Teresa 0,92 1,16 45,57 0,12 33,32 13,50 0,19 3,67 1,55

MG = logaritmo do nmero de minas grandes (comprimento 0,5cm); MP = nmero de minas pequenas (comprimento < 0,5cm); ML = mortalidade larval (%); PL = perodo larval (2 ao 4 estdio de desenvolvimento) (dias); NPF = nmero de pupas fmea; NPM =nmero de pupas macho; RS = razo sexual (nmero de fmeas/ total de indivduos); PPF = peso de pupas fmea (mg); PPM = peso de pupas macho (mg)

nado em avaliaes de resistncia s populaes de Camocim de So Flix e Santa Teresa, e o peso de pupas macho pode ser eliminado quando as plantas forem avaliadas quanto resistncia a populao de Viosa. Em avaliaes envolvendo as populaes de Viosa, Camocim de So Flix e Santa Teresa tambm podem ser eliminados os caracteres peso de pupas fmea, nmero de minas pequenas e razo sexual, respectivamente.

AGRADECIMENTOS
Ao CNPq pela concesso da bolsa de estudo primeira autora e Universidade Federal de Viosa, pela disponibilizao da estrutura fsica e profissional.

LITERATURA CITADA
AGRIANUAL. Anurio da agricultura brasileira. So Paulo: FNP Consultoria e Comrcio, 2005.544 p. ARAGO, C.A.; DANTAS, B.F.; BENITES, F.R.G. Efeito de aleloqumicos em tricomas foliares de tomateiro na repelncia a caro (Tetranychus urticae Koch.) em gentipos com teores contrastantes de 2-tridecanona. Acta Botanica Brasilica, So Paulo, v.16, n.1, p.83-88, 2002. CARPENTIERI PIPOLO, V.; DESTRO, D.; PRETE, C.E.C.; GONZALES, M.G.N.; POPPER, I.; ZANATTA, S.; SILVA, F.A.M. Seleo de gentipos parentais de acerola com base na divergncia gentica multivariada. Pesquisa Agropecuria Brasileira , Braslia, v.35, n.8, p.1613-1619, 2000. 898

CHATZIVASILEIADIS, E.A.; BOON, J.J.; SABELIS, M.W. Accumulation and turnover of 2-tridecanone in Tetranychus urticae and consequences for resistance of wild and cultivated tomatoes. Experimental and Applied Acarology, v.23, p.1011-1021, 1999. COELHO, M.C.F.; FRANA, F.H. Biologia, quetotaxia das larvas e descrio da pupa e adulto da traa do tomateiro. Pesquisa Agropecuria Brasileira, Braslia, v.22, n.2, p.129-135, 1987. CRUZ, C.D. Programa Genes : aplicativo computacional em gentica e estatstica: (verso Windows). Viosa, MG: UFV, 2001. 648 p. CRUZ, C.D.; CARVALHO, S.P.; VENCOVSKY, R. Estudos sobre a divergncia gentica. II. Eficincia da predio do comportamento de hbridos com base na divergncia gentica de progenitores. Revista Ceres, Viosa, v.41, n.234, p.183190, 1994. CRUZ, C.D.; REGAZZI, A.J. Modelos biomtricos aplicados ao melhoramento gentico. 2. ed. Viosa, MG: UFV, 1997. 390 p. EINGENBRODE, S.D.; TRUMBLE, J.T.; WHITE, K.K. Tricome exudates and resistance to beet armyworm (Lepidoptera: Noctuidae) in Lycopersicon hirsutum f. typicum accessions. Environmental Entomology, v.25, n.1, p.90-95, 1996. FAO. Food and Agriculture Organization of the United Nations . Disponvel em: <http:// www.fao.org> . Acesso em: 16 mar. 2004. FONTES, P.C.R.; SILVA, D.J.H. Produo de tomate de mesa, Viosa, MG: Aprenda Fcil, 2002. 196 p. FREITAS, J.A.; CARDOSO, M.G.; MALUF, E.R.; SANTOS, C.D.; NELSON, D.L.; COSTA, J.T.; SOUZA, E.C.; SPADA, L. Identificao do sesquiterpeno zingibereno, aleloqumico responsvel pela resistncia Tuta absoluta (Meyrick, 1917) na cultura do tomateiro. Cincia e Agrotecnologia , Lavras, v.22, n.4, p.483-489, 1998.

GARCIA, S.L.R. Importncia de caractersticas de crescimento, de qualidade da madeira e da polpa na divergncia gentica de clones de eucalipto. 1998. 103 f. (Tese doutorado) UFV, Viosa. LARA, F.M. Princpios de resistncia de plantas. So Paulo: cone, 1991. 336 p. LEITE, G.L.; PICANO, M.; AZEVEDO, A.A.; GONRING, A.H.R. Efeito de tricomas, aleloqumicos e nutrientes na resistncia de Lycopersicon hirsutum traa-do-tomateiro. Pesquisa Agropecuria Brasileira, Braslia, v.34, n.11, p.2059-2064, 1999. LIN, S.Y.H.; TRUMBLE, J.T. Resistance in wild tomatoes to larvae of a specialist herbivore Keiferia lycopersicella . Entomologia Experimentalis et Applicata, v.41, n.1, p.53-60, 1986. MACHADO, C.F.; SANTOS, J.B; NUNES, G.H.S. Escolha de genitores de feijoeiro por meio da divergncia baseada em caracteres morfo-agronmicos. Bragantia, v.59, n.1, p.11-20, 2002. MELO, M.; CAMPOS, A.D. Ocorrncia de inimigos naturais da traa do tomateiro Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae) em Pelotas, Rio grande do Sul. Agropecuria Clima Temperado, Pelotas, v.3, n.2, p.269-274, 2000. RAHIMI, F.R.; CARTER, C.D. Inheritance of zingiberene in Lycopersicon. Theoretical and Applied Genetics, Berlin, v.87, p.593597, 1993. SINGH, D. The relative importance of characters affecting genetic divergence. The Indian Journal of Genetic and Plant Breeding, v.41, p.237-245, 1981. SIQUEIRA, H.A.A.; GUEDES, R.N.C.; FRAGOSO, D.B.; MAGALHES, L.C. Abamectrin resistance and synergism in Brazilian populations of Tuta absoluta (Lepidoptera: Gelechiidae). International Journal of Pest Management, v.47, p.247-251, 2001. SOUZA, J.C.; REIS, P.R. Traa-do-tomateiro: histrico, reconhecimento, biologia, prejuzos e controle. Belo Horizonte: EPAMIG, 1992. 19 p. (EPAMIG. Boletim tcnico, 38). STEEL, R.G.D.; TORRIE, J.H.; DICKEY, D.A. Principles and procedures of statistics a biometrical approach. 3rd ed. New York: McGrawHill, 1997. 666 p. SUDR, C.P.; RODRIGUES, R.; RIVA, E.M.; KARASAWA, M.; AMARAL JNIOR, A.T. Divergncia gentica entre acessos de pimenta e pimento utilizando tcnicas multivariadas. Horticultura Brasileira, Braslia, v.23, n.1, p.2227, 2005. SUINAGA, F.A.; CASALI, V.W.D.; SILVA, D.J.H.; PICANO, M.C. Dissimilaridade gentica de fontes de resistncia de Lycopersicon spp. a Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae). Revista Brasileira de Agrocincia, Pelotas, v.9, n.4, p.371-376, 2003. SUINAGA, F.A.; PICANO, M.; JHAM, G.N.; BROMMONSCHENKEL, S.H. Causas qumicas de resistncia de Lycopersicon peruvianum (L.) a Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae). Anais da Sociedade Entomolgica do Brasil, Londrina, v.28, n.2, p.313-321, 1999. THOMAZINI, A.P.B.W.; VENDRAMIM, J.D.; BRUNHEROTTO, R.; LOPES-MARIA, T.R. Efeito de gentipos de tomateiro sobre a biologia e oviposio de Tuta absoluta. Neotropical Entomology, Londrina, v.30, n.2, p.283-288, 2001. Hortic. bras., v. 23, n. 4, out.-dez. 2005

ANDRADE JNIOR, V.C.; YURI, J.E.; NUNES, U.R.; PIMENTA, F.L.; MATOS, C.S.M.; FLORIO, F.C.A.; MADEIRA, D.M. Emprego de tipos de cobertura de canteiro no cultivo da alface. Horticultura Brasileira, Braslia, v.23, n.4, p.899-903, out-dez 2005.

Emprego de tipos de cobertura de canteiro no cultivo da alface


Valter C. de Andrade Jnior1,4; Jony E. Yuri2; Ubirajara R. Nunes1; Fernando L. Pimenta3; Christiano de S.M. de Matos3; Francisco C. de A. Florio3; Dermival M. Madeira3
1 2

Faculdades Federais Integradas de Diamantina, FCA, Depto. Agronomia, R. da Glria, 187, Centro, 39100-000 Diamantina-MG; UFLA, DAG, C. Postal 37, 37200-000 Lavras-MG; 3Universidade Vale do Rio Verde, UNINCOR, Av. Castelo Branco, 82, Centro, 37410-000Trs Coraes-MG; 4E-mail: valterjr@fafeid.edu.br

RESUMO
Com o objetivo de avaliar o efeito de diferentes coberturas de canteiro sobre as caractersticas agronmicas de cultivares de alface (Lactuca sativa L.) tipo lisa, foi realizado um experimento na Universidade Vale do Rio Verde em Trs Coraes (MG). O delineamento experimental utilizado foi de blocos ao acaso em esquema fatorial 5 x 2, proveniente da combinao de cinco tipos de cobertura (plstico preto, capim braquiria seco, casca de arroz, casca de caf e solo nu) e duas cultivares de alface tipo lisa (Regina e Elisa), com 3 repeties. A colheita foi realizada 42 dias aps o transplantio, sendo avaliados a produo total (t ha-1), produo comercial, massa mdia por planta, dimetro mdio de cabea, dimetro mdio de caule, nmero mdio de folhas e massa mdia de raiz. Foi observada interao significativa entre tipos de cobertura x cultivares somente para a caracterstica massa mdia de raiz, tendo a cultivar Elisa apresentado maior massa mdia de raiz quando utilizadas as coberturas com casca de caf e casca de arroz. A cobertura com casca de caf foi a que proporcionou os melhores resultados, superando os demais tipos de cobertura para todas as caractersticas avaliadas. A cultivar Regina foi superior Elisa em quase todas as caractersticas estudadas, exceto para dimetro mdio de caule onde no foi observada diferena significativa entre as cultivares. Elisa tambm apresentou maior massa mdia de raiz que a cultivar Regina. Palavras-chave: Lactuca sativa L., coberturas de solo, produo.

ABSTRACT
Evaluation of mulch types on lettuce production An experiment was carried out at Universidade Vale do Rio Verde, Minas Gerais State, Brazil, to evaluate the effect of bed coverages on the agronomic characteristics of lettuce cultivars. The experimental design was of randomized complete blocks in a 5 x 2 factorial scheme with five types of mulch (black plastic; dry braquiaria grass; rice husk; coffee husk and nude soil), two leaf lettuce cultivars (Regina and Elisa) and three replications. Plants were harvested 42 days after the transplanting date. The total and commercial yield, average fresh plant plant weight, head average diameter, stem average diameter, leave average number and the root fresh weight were evaluated. Only for the root average weight was observed significant interaction between coverage types and cultivars. The cv. Elisa presented the highest root average weight when the coffee or rice husk were used. The coffee husk proportioned the best results. This coverage exceeded all others in all the evaluated characteristics. The cv Regina was superior to Elisa in almost all studied characteristics, except in stem average diameter where no significant difference was detected between cultivars. Elisa presented higher root weight than Regina.

Keywords: Lactuca sativa L., soil coverages, yield.

(Recebido para publicao em 22 de julho de 2004 e aceito em 3 de agosto de 2005)

a regio sul de Minas concentrase grande nmero de produtores de alface, os quais, em sua maioria, utilizam algum tipo de material como cobertura de canteiro. Entretanto, existe pouca informao sobre os materiais disponveis na regio e que podem ser utilizados como cobertura de solo. Tanto a cobertura com plstico quanto com restos vegetais tm sido exploradas com os objetivos de reduzir a evaporao da gua na superfcie do solo; diminuir as oscilaes de temperatura do solo (ARAJO et al., 1993); permitir o controle de plantas invasoras; oferecer proteo aos frutos, evitando seu contato direto com o solo; obter maior precocidade da colheita e capacidade de influir diretamente, de maneira positiva, sobre a incidncia de pragas e doenas (CASTELLANE, 1995). Os restos
Hortic. bras., v. 23, n. 4, out.-dez. 2005

vegetais contribuem ainda como reserva considervel de nutrientes, cuja disponibilizao pode ser rpida e intensa, dependendo, dentre outros fatores, do regime de chuvas (ROSOLEM et al. 2003); da relao C/N (ROBINSON, 1988) alm de reduzir a lixiviao dos nutrientes e a compactao do solo. Avaliando a utilizao de materiais como cobertura morta do solo no cultivo de pimento, Queiroga et al. (2002) verificaram que o dimetro, nmero, massa de fruto e a produo foram afetados pela cobertura morta, sendo a palha de carnaba superior aos demais materiais usados como cobertura. Segundo os autores, este fato deve-se melhor conservao da umidade do solo, menor incidncia de plantas daninhas, reduo da temperatura do solo e ao for-

necimento de nutrientes s plantas, devido a sua rpida decomposio. Ao avaliar o efeito da cobertura morta sobre o comportamento de cultivares de alface no municpio de Mossor, Maia Neto (1988) verificou que a cobertura morta proporcionou aumentos na produo e na massa mdia de plantas das cultivares Brasil 221, Bab de Vero e Vitria, e tambm reduziu a massa de matria fresca das plantas invasoras. De acordo com Reghin et al. (2002), o uso da cobertura com agrotextil preto proporcionou maior produo de alface (cv. Veneza Roxa) quando comparado cobertura com palha de arroz, (153,68 g e 127,71 g, respectivamente). A palha de arroz picada no apresentou resposta favorvel como cobertura de canteiro, pois permitiu o desenvolvimento de
899

V. C. Andrade Jnior et al.

vrias espcies de plantas daninhas. J o agrotextil preto foi eficiente no controle de plantas daninhas, promovendo melhor desenvolvimento e produo de plantas com maior massa. Tanto o uso da palha de arroz quanto solo nu resultaram em decrscimo na massa fresca da cabea de 18,12 e 13,62%, respectivamente, em relao ao agrotextil preto. Provavelmente, a presena de plantas daninhas interferiu na formao e na massa fresca da cabea de alface. No cultivo da alface, Andreani Jnior e Galbiati Neto (2003) avaliaram a influncia de vrios tipos de cobertura de solo sobre a produtividade e verificaram que as coberturas com bagao de cana e palha de arroz proporcionaram maiores ganhos de peso das plantas, 710,0 e 669,5 gramas, respectivamente, quando comparada ao tratamento terra nua sem capina (355,6 g) e ao tratamento em que se utilizou plstico transparente (280,4 g). A utilizao da cobertura de solo no cultivo da alface tem se mostrado fator determinante no aumento da produo e na qualidade do produto. No entanto, para que a utilizao da cobertura seja vivel preciso que novas alternativas de cobertura, disponveis na regio de cultivo, sejam avaliadas. Este trabalho teve como objetivo avaliar os efeitos de diferentes tipos de cobertura de canteiro sobre a produo e qualidade de duas cultivares de alface tipo lisa.

MATERIAL E MTODOS
O experimento foi realizado no Setor de Olericultura da Universidade Vale do Rio Verde (UNINCOR), Trs Coraes, MG, de 24/09 a 05/12/2003. O clima, de acordo com a classificao de Koppen, Cwb, ou seja, temperado chuvoso, com temperatura mdia do ms mais quente inferior a 22 C. O solo predominante na rea classificado como Latossolo Vermelho distrofrrico, textura argilosa com caractersticas: pH H2O: 5,5; P disponvel = 1,2 mg/dm3; K disponvel = 22 mg/dm3; H+Al3+ = 5,0 mg/dm3; Al3+ = 0,2 cmolc/dm3; Ca2+ = 2,9 cmolc/dm3; Mg2+ = 1,9 cmolc/dm3; SB= 4,9 cmolc/dm3; CTC = 9,9 cmolc/ dm3; MO = 2,4g/dm3.
900

O delineamento experimental utilizado foi em blocos ao acaso em esquema fatorial 5 x 2, proveniente da combinao de cinco tipos de coberturas de canteiro: [Brachiaria decumbens (capim braquiria seco); Oryza sativa L. (casca de arroz); Coffea arabica L. (casca de caf); plstico preto com densidade de 50 micra e testemunha (sem cobertura)] e duas cultivares de alface tipo lisa (Regina e Elisa), com 3 repeties. As mudas foram produzidas sob estufa plstica em bandejas de isopor de 128 clulas contendo substrato artificial Plantimax e transplantadas 30 dias aps a semeadura, em canteiros com 1,25 m de largura e 20 cm de altura, espaados 30 cm um do outro. Foram utilizadas 5 fileiras por canteiro, sendo as parcelas compostas por 25 plantas, espaadas 0,25 m, totalizando 1,56 m2 por parcela. Foi utilizada como rea til as nove plantas centrais de cada parcela, ocupando rea de 0,56 m2. Antes do transplante os canteiros receberam as coberturas orgnicas que apresentavam espessura de aproximadamente 5 cm e a cobertura com plstico preto. Os canteiros foram preparados manualmente e durante o preparo foram aplicados 200 g m-2 de calcrio dolomtico. A adubao de plantio foi com composto orgnico na dose de 40 t ha-1, no sendo utilizada nenhuma formulao qumica. Aos 25 dias aps o transplantio foi realizada adubao em cobertura com a formulao 20-00-20, na dose de 60 kg ha-1. Foram realizadas capinas manuais nas parcelas onde ocorreram infestaes com plantas daninhas e a irrigao foi feita diariamente. A irrigao foi realizada por asperso elevando-se o teor de gua no solo prximo capacidade de campo, durante todo o ciclo da cultura. No houve necessidade de aplicao de defensivos para o controle de pragas e doenas. A colheita foi realizada 42 dias aps o transplantio, sendo avaliadas caractersticas de produo e de qualidade das plantas. A produo total foi obtida pela soma da massa total da parte area de todas as plantas da rea til de cada parcela, sendo expressa em t ha-1. A produo comercial foi determinada aps a retirada das folhas externas que apresentavam colorao amarela ou algum tipo

de injria. Depois procedeu-se a soma da massa comercial de todas as plantas da rea til de cada parcela, sendo tambm expressa em t ha-1. A massa mdia por planta foi obtida dividindo-se a massa total das plantas pelo nmero total de plantas da rea til da parcela, e os resultados expressos em g. O dimetro mdio de cabea foi obtido por medio da parte mais compacta da cabea, no considerando as folhas externas das plantas. O dimetro mdio do caule foi determinado aps a colheita das plantas com razes, sendo a medida feita logo abaixo das primeiras folhas, utilizandose um paqumetro. O nmero mdio de folhas foi obtido aps a obteno de todos os dados referentes s outras avaliaes. Foram retiradas todas as folhas comerciais de cada planta da parcela til e obtido o nmero mdio de folhas. A massa mdia de raiz foi obtida por pesagem do sistema radicular de todas as plantas da rea til. Foi considerado nos resultados, para todas as caractersticas avaliadas, a mdia das nove plantas centrais, correspondente a rea til de cada parcela. A anlise de varincia foi utilizada na avaliao dos tipos de cobertura e de cultivares para as caractersticas estudadas aplicando-se o teste Scott e Knott a 5% de probabilidade para a comparao das mdias. Os dados de nmero mdio de folhas foram transformados em x antes da anlise, sendo apresentados nos resultados os valores das mdias. As anlises estatsticas foram realizadas utilizando-se o programa estatstico SISVAR (FERREIRA, 1999).

RESULTADOS E DISCUSSO
Foram observados efeitos significativos do tipo de cobertura do canteiro e de cultivares sobre todas as caractersticas analisadas, exceto para a caracterstica dimetro mdio de caule, onde no foi observada diferena significativa entre as cultivares. Os resultados no evidenciaram efeitos significativos da interao tipo de cobertura x cultivar para as caractersticas avaliadas, com exceo da massa mdia de raiz (Tabela 1). As produes total e comercial variaram, respectivamente, de 35,63 a 30,71 t ha-1 e de 70,67 a 61,59 t ha-1. A
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Emprego de tipos de cobertura de canteiro no cultivo da alface

cobertura de canteiro com casca de caf superou os demais tipos de cobertura em todas as caractersticas estudadas, proporcionando s cultivares produo total e comercial, massa mdia por planta e nmero mdio de folhas, 77,43%, 77,19%, 77,51% e 29,68% superiores s mdias dos demais tipos de cobertura. Andreani Jnior e Galbiati Neto (2003), trabalhando com alface, no observaram diferenas significativas entre o efeito da cobertura com palha de caf e plstico preto para as caractersticas peso das plantas e nmero de folhas. Ao avaliar diferentes tipos de coberturas de solo no desenvolvimento da alface, Verdial et al. (2001) observaram que a utilizao de cobertura plstica do tipo dupla face proporcionou os maiores valores mdios de produo. No presente estudo, o material orgnico casca de caf superou o material sinttico plstico preto em todas as caractersticas avaliadas. Esse resultado importante, principalmente para a regio do sul de Minas, pois nesta rea alm de existir grande disponibilidade de casca de caf tambm concentra-se grande nmero de pequenos produtores de alface. No foram observadas diferenas significativas entre os efeitos dos demais tipos de cobertura (capim braquiria seco, casca de arroz, plstico preto e solo sem cobertura) sobre as caractersticas estudadas, exceto para massa mdia por planta onde a cobertura com casca de arroz proporcionou um acmulo de massa na planta significativamente maior que o tratamento com capim braquiria seco, plstico preto e solo sem cobertura. Para as demais caractersticas, as coberturas com capim braquiria seco, casca de arroz e plstico preto apresentaram efeitos semelhantes aos observados para o cultivo em solo sem cobertura. Portanto, no presente trabalho estes tratamentos no resultaram em benefcios para a produo. Zizas et al. (2002b) observaram que o uso de casca de arroz reduziu o peso mdio das plantas da cultivar Regina. Neste mesmo trabalho o nmero de folhas/planta no tratamento solo sem cobertura foi significativamente menor que o verificado nas coberturas com plstico vermelho e branco, porm, no diferiu estatisticaHortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Produo total, produo comercial, massa mdia por planta, dimetro mdio de cabea, dimetro mdio de caule, nmero mdio de folhas e massa mdia de raiz de duas cultivares de alface tipo lisa cultivadas em diferentes tipos de cobertura de canteiro. Trs Coraes, UNINCOR, 2003.
Cultivares Tipos de cobertura* * Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Casca de caf Casca de arroz Capim braquiria seco Plstico preto Solo sem cobertura Mdia Regina 73,59 47,96 43,69 47,77 42,78 51,16 A 65,46 42,28 38,83 42,22 36,92 45,14 A 0,460 0,300 0,273 0,299 0,267 0,320 A 23,85 20,41 19,93 20,93 20,63 21,15 A 2,54 2,03 1,91 2,16 2,04 2,13 A 32,93 26,70 24,04 27,85 26,07 27,52 A 15,44 aB 11,15 aB 9,00 aA 12,52 aA 12,48 aA 12,12 B Elisa 67,75 41,32 35,73 30,86 28,49 40,83 B 57,71 35,52 30,91 26,90 24,50 35,11 B 0,423 0,258 0,223 0,193 0,178 0,255 B 20,37 16,44 15,70 16,85 15,41 16,96 B 2,74 2,16 1,87 2,00 1,69 2,09 A 27,89 22,37 19,26 20,45 20,82 22,16 B 21,63 aA 15,55 bA 12,51 bA 12,15 bA 10,22 bA 14,41 A 18,54 a 13,35 b 10,76 b 12,34 b 11,35 b 30,41 a 24,54 b 21,65 b 24,15 b 23,45 b 2,64 a 2,09 b 1,90 b 2,08 b 1,87 b 22,11 a 18,43 b 17,82 b 18,89 b 18,02 b 0,442 a 0,279 b 0,248 c 0,246 c 0,223 c 61,59 a 38,90 b 34,87 b 34,56 b 30,71 b Mdia 70,67 a 44,64 b 39,71 b 39,32 b 35,63 b Produo total (t ha-1)* * - CV= 10,29%

Produo comercial (t ha-1) * * - CV= 12,13%

Massa mdia por planta (g)* * - CV= 10,25%

Dimetro mdio de cabea (cm) * * - CV= 9,66%

Dimetro mdio de caule (cm) ns - CV= 10,90%

Nmero mdio de folhas * * - CV= 4,91%

Massa mdia de raiz (g) * * - CV= 16,45%

**Significativo a 1% pelo teste F; nsno significativo; 1Mdias seguidas por letras minsculas nas colunas e por letras maisculas nas linhas no diferem entre si pelo teste de Scott e Knott.(=0,05).
901

V. C. Andrade Jnior et al.

mente dos tratamentos com plstico preto e casca de arroz. Os autores observaram que a temperatura mdia do solo coberto com casca de arroz foi igual a do solo sem cobertura, 23,9oC, e as coberturas com plstico vermelho e preto foram as que propiciaram maiores temperaturas mdia do solo, 25,3 oC e 25,0oC, respectivamente. Avaliando as cultivares de alface Brisa, Simpson, Vernica, Regina 579, Vera e Tain, em diferentes coberturas de solo, (ZIZAS et al., 2002a), verificaram que a cultivar Regina 579 apresentou maior dimetro do caule e maior nmero de folhas e que o uso de plsticos preto e vermelho resultou em menor massa mdia e produtividade por planta. Os autores relatam que estes resultados podem estar associados s ocorrncias de maiores temperaturas do solo provocadas pela cobertura com estes plsticos em relao aos demais tipos de cobertura. Resultados semelhantes foram encontrados por Chaves et al. (2003) os quais relataram o efeito do plstico em aumentar a temperatura do solo a nveis de afetar o metabolismo da planta, interferindo no seu crescimento e desenvolvimento. Segundo Goto (1998), o uso de cobertura com plstico em alface deve ser avaliado para cada regio de cultivo, uma vez que o aumento da temperatura do solo pode afetar o desenvolvimento de razes e, por conseguinte, a absoro de nutrientes. Verdial et al. (2001) verificaram que a temperatura do solo coberto com plstico preto foi 25,12oC, 1,56oC e 1,72oC, respectivamente, maior que as temperaturas observadas para os tratamentos sem cobertura, sem capina e sem cobertura com capina quinzenal. Um fator que deve ser considerado, embora no tenha sido avaliado, a concentrao e liberao de K da casca de caf para o solo. Conforme relatam Guimares et al. (2002), a casca de caf contm alto teor de K, em mdia 3,75 dag. g-1 de K2O, sendo um resduo da cafeicultura utilizado na adubao dos cafezais com o objetivo de repor o K extrado pelas plantas. Segundo Rosolem et al. (2003) as espcies que acumularam K foram as que liberaram este elemento em maior quantidade. Sendo a casca de caf rica em K pode-se afirmar que a superiori902

dade da cobertura de canteiro com casca de caf em relao aos demais tipos de cobertura pode estar relacionada maior disponibilizao de K para as plantas, contribuindo, conseqentemente, para o melhor desenvolvimento das mesmas. Malavolta (1980) relata que mais de 80% do K encontra-se na forma solvel na planta, sendo, portanto, passvel de lixiviao. A cultivar Regina foi superior Elisa em produo total e comercial, massa mdia por planta, dimetro mdio de cabea e nmero mdio de folhas. Em mdia, a cultivar Regina apresentou produo total e produo comercial, 25,30% e 28,57%, maiores que a cultivar Elisa (Tabela 1). A massa mdia por planta e o dimetro mdio de cabea da cultivar Regina foram 25,5% e 24,71%, respectivamente, superior ao da cultivar Elisa. O nmero mdio de folhas da cultivar Regina (27,52) foi significativamente maior (24,19%) que o da cultivar Elisa (22,16 folhas). Esses dados corroboram com os obtidos por Zizas et al. (2002b), em que a cultivar Regina apresentou maior nmero de folhas/planta e dimetro de caule em relao Elisa. No foi observada diferena significativa entre as cultivares para a caracterstica dimetro mdio de caule (Tabela 1). J a cultivar Elisa apresentou maior massa mdia de raiz, (14,41 g), em relao Regina, (12,12 g), uma diferena de 18,89%. A interao significativa dos tipos de cobertura x cultivares para a caracterstica massa mdia de raiz (Tabela 1) mostra que para a cultivar Regina no foi observada diferena significativa entre os efeitos dos diferentes tipos de cobertura de canteiro. J para a cultivar Elisa, a cobertura com casca de caf foi superior s mdias dos demais tratamentos, em 71,53%, tendo a mesma proporcionado 21,63 g de massa mdia de raiz. Observou-se que a cultivar Elisa apresentou maior massa mdia de raiz quando foram utilizadas as coberturas com casca de caf e casca de arroz, respectivamente, 40,09% e 39,46%. No foram observadas diferenas significativas entre cultivares para os demais tipos de cobertura de canteiro. A diferena significativa do fator cultivar esperada, pois a produo de

uma cultivar funo de seu gentipo e da interao gentipo x ambiente (QUEIROGA et al., 2001; SILVA et al., 2000). Conclui-se que a cobertura de canteiro com casca de caf proporcionou o melhor crescimento e desenvolvimento da alface. Entre as cultivares, a Regina foi superior Elisa quanto s caractersticas de produo total, produo comercial, massa mdia por planta, dimetro mdio de cabea e nmero mdio de folhas. Entretanto, a cultivar Elisa apresentou maior massa mdia de raiz em relao Regina. A maior massa mdia de raiz da cultivar Elisa no influenciou as demais caractersticas avaliadas, baseando-se na hiptese de que uma maior massa mdia de raiz proporcionaria maiores produo total e comercial, massa mdia por planta, dimetro mdio de cabea e do caule e maior nmero mdio de folhas, por explorar melhor o solo, e consequentemente, absorver mais gua e nutrientes. Este fato pode estar relacionado a maior eficincia da cultivar Regina em absorver gua e nutrientes, pois esta foi superior Elisa para a maioria das caractersticas avaliadas. Em termos de massa mdia de raiz, a cultivar Elisa apresentou melhores resultados quando as coberturas de canteiros utilizadas foram casca de caf e casca de arroz.

LITERATURA CITADA
ANDREANI JNIOR, R.; GALBIATI NETO, P. Avaliao da influncia de coberturas mortas sobre o desenvolvimento da cultura da alface na regio de Fernandpolis-SP. Horticultura Brasileira, Braslia, v.21, n.2, Julho, 2003. Suplemento 2, CD-ROM. Trabalho apresentado no 43o Congresso Brasileiro de Olericultura, 2003. ARAJO, R.C.; SOUZA, R.J.; SILVA, A.M.; ALVARENGA, M.A.R. Efeitos da cobertura morta do solo sobre a cultura do alho (Allium sativum L.). Cincia e Prtica, Lavras, v.17, n.3, p.228233, 1993. CASTELLANE, P.D.; SOUZA, A.F.; MESQUITA FILHO, M.D. Culturas olercolas. In: FERREIRA, M.E. CRUZ, M.C.P. (eds). Micronutrientes na agricultura. Piracicaba: POTAFOS/ CNPq, 1995, p.549-584. CHAVES, S.W.P.; MEDEIROS, J.F.; NEGREIROS, M.Z.; NAGO, E.O. Rendimento de alface em funo da cobertura do solo e freqncia de irrigao. Horticultura Brasileira, Braslia, v.21, n.2, Julho, 2003. Suplemento 2, CD-ROM. Trabalho apresentado no 43o Congresso Brasileiro de Olericultura, 2003. FERREIRA, D.F. Sisvar - Sistema de anlise de Hortic. bras., v. 23, n. 4, out.-dez. 2005

Emprego de tipos de cobertura de canteiro no cultivo da alface varincia para dados balanceados. Verso 4.0 (Build 34). Lavras: DEX/UFLA, 1999. (Software Estatstico). GOTO, R. A cultura da alface. In: GOTO, R.; TIVELLI, W.S. Produo de hortalias em ambiente protegido: condies subtropicais. So Paulo: Fundao Editora da UNESP, 1998. p.137-159. GUIMARES, P.T.G.; NOGUEIRA, F.D.; LIMA, P.C.; GUIMARES, M.J.C.L.; POZZA, A.A.A. Adubao e nutrio do cafeeiro em sistema orgnico de produo. Informe Agropecurio, Belo Horizonte, v.23, n.214/215, p.63-81, 2002. MAIA NETO, J.M. Efeito da cobertura morta sobre o comportamento de cultivares de alface (Lactuca sativa L.) no municpio de Mossor. Mossor, 1988, 16 p. (Coleo Mossoroense, srie B, no 515). MALAVOLTA, E.A. Elementos de nutrio mineral de plantas. So Paulo: Agronmica Ceres, 1980. 251 p. QUEIROGA, R.C.F.; BEZERRA NETO, F. NEGREIROS, M.Z.; OLIVEIRA, A.P.; AZEVEDO, L.M.S.B. Produo de alface em funo de cultivares e tipos de tela de sombreamento nas condies de Mossor. Horticultura Brasileira, Braslia, v.19, n.3, p.324-328, 2001. QUEIROGA, R.C.F.; NOGUEIRA, I.C.C.; BEZERRA NETO, F.; MOURA, A.R.B.; PEDROSA, J.F. Utilizao de diferentes materiais como cobertura morta do solo no cultivo de pimento. Horticultura Brasileira, Braslia, v.20, n.3, p.416418, 2002. REGHIN, M.Y.; PURISSIMO, C.; DALLA PRIA, M.; FELTRIM, A.L.; FOLTRAN, M.A. Tcnicas de cobertura do solo e de proteo de plantas no cultivo da alface. Horticultura Brasileira, Braslia, v.20, n.2, Julho, 2002, Suplemento 2. CD-ROM. Trabalho apresentado no 42o Congresso Brasileiro de Olericultura, 2002. ROBINSON, D.W. Mulches ornamental plantings. Authors reply. Hortscience, v.23, n.6, 1988. ROSOLEM, C.A.; CALONEGO, J.C.; FOLONI, J.S.S. Lixiviao de potssio da palha de espcies de cobertura de solo de acordo com a quantidade de chuva aplicada. Revista Brasileira de Cincia do Solo, Viosa, v.27, p.355-362, 2003. SILVA, V.F.; BEZERRA NETO, F.; NEGREIROS, M.Z.; PEDROSA, J.F. Comportamento de cultivares de alface em diferentes espaamentos sob temperatura e luminosidade elevados. Horticultura Brasileira, v.18,n.3, p.183-187, 2000. VERDIAL, M.F.; LIMA, M.S.; MORGOR, A.F.; GOTO, R. Production of iceberg lettuce mulches. Scientia Agrcola, v.58, n.4, p.737-740, 2001. ZIZAS, G.B.; SENO, S.; FARIA JNIOR, M.J.A.; SELEGUINI, A. Efeito da cobertura do solo sobre a produtividade e qualidade de 6 cultivares de alface e das interaes solo/cultivar, no perodo de maio a junho de 2001. Horticultura Brasileira, Braslia, v.20, n.2, Julho, 2002. Suplemento 2. CD-ROM. Trabalho apresentado no 42o Congresso Brasileiro de Olericultura, 2002b. ZIZAS, G.B.; SENO, S.; FARIA JNIOR, M.J.A.; SELEGUINI, A. Interao de cultivares e cobertura do solo na produo e qualidade de alface (perodo de maro a abril de 2001). Horticultura Brasileira, Braslia, v.20, n.2, Julho, 2002. Suplemento 2. CD-ROM. Trabalho apresentado no 42o Congresso Brasileiro de Olericultura, 2002a.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

903

FONSECA, L.N.; INOUE-NAGATA, A.K.; NAGATA, T.; SINGH, R.P.; VILA, A.C. Diferenciao de estirpes de Potato virus Y (PVY) por RT-PCR. Horticultura Brasileira, Braslia, v.23, n.4, p.904-910, out-dez 2005.

Diferenciao de estirpes de Potato virus Y (PVY) por RT-PCR


Leonardo N. Fonseca1; Alice K. Inoue-Nagata2; Tatsuya Nagata3; Rudra P. Singh4; Antonio Carlos de vila2
1

Universidade Vale do Rio Doce, Av. Israel Pinheiro 2000, 35100-000 Governador Valadares-MG; 2Embrapa Hortalias, C. Postal 218, 70359-970 Braslia-DF ; 3Universidade Catlica de Braslia, 70790-160 Braslia-DF; 4Potato Research Centre, Agriculture and Agri-Food Canada, P.O. Box 20280, Fredericton, NB, Canada E3B 4Z7

RESUMO
O Potato virus Y (PVY) tornou-se o maior problema nas reas de produo de batata semente do Brasil. Somente as estirpes comum (PVYO) e necrtica (PVYN) eram detectadas infectando batata no Brasil. Esta situao mudou drasticamente a partir de 1997 quando um surto epidmico de uma variante da estirpe necrtica de PVY causando arcos e anis necrticos na superfcie do tubrculo (PVYNTN) foi observado no pas. Este estudo visou avaliar e validar uma metodologia de diferenciao de estirpes que causam necrose em tubrculos, proposta por Weilguny e Singh (1998). Vinte e oito isolados de PVY originrios de tubrculos infectados de batata, provenientes de quatro estados brasileiros, foram analisados em sua reao em plantas de fumo, por Elisa, utilizando anti-soro policlonal e pelo mtodo 3-primer RT-PCR. Quatro isolados induziram clareamento de nervuras e manchas peroladas em folhas de Nicotiana tabacum conforme esperado para a estirpe comum. Os 24 isolados restantes induziram necrose de nervuras neste hospedeiro portanto, classificados como da estirpe necrtica. Todos os 28 isolados de PVY reagiram positivamente contra o anti-soro policlonal de PVY por Elisa. Trs mtodos de extrao de RNA foram testados, sendo que o mtodo de hidrocloreto de guanidina mostrou-se o mais eficiente e de menor custo. Dos 28 isolados submetidos ao RT-PCR, um isolado de Santa Catarina e trs do Rio Grande do Sul foram diferenciados como PVYO, confirmando os resultados do teste biolgico. Um isolado de PVYN foi detectado no Estado de Santa Catarina e quatro no Rio Grande do Sul. O PVYNTN foi detectado em Minas Gerais (seis isolados), Santa Catarina (trs isolados) e So Paulo (dez isolados). Estes resultados confirmam a presena dessa variante necrtica, PVYNTN, nas principais regies produtoras de batata do Brasil. Palavras-chave: Solanum tuberosum, vrus Y da batata, reao em cadeia da polimerase, potyvrus.

ABSTRACT
RT-PCR For differentiation of Potato virus Y strains in potato The Potato virus Y (PVY) has become the major virus problem in seed potato growing areas of Brazil. Only necrotic and ordinary PVY strains were found infecting potatoes in Brazil. This situation drastically changed around 1997 when an epidemic of a PVY necrotic variant causing necrotic rings on the potato tuber surface was observed in the country. This study aimed to test the tuber necrotic strain differentiation method proposed by Weilguny & Singh (1998). Twenty eight PVY isolates originated from infected tubers and leaves from four Brazilian States were analyzed by host reaction after inoculation in tobacco, by ELISA using polyclonal antiserum and by the 3-primer RT-PCR method. The ordinary strain type isolates induced vein clearing and chlorotic pearl spots on Nicotiana tabacum leaves. All 24 remaining isolates inducing vein necrosis in leaves were classified as necrotic strains. All 28 PVY isolates positively reacted to PVY polyclonal antiserum by Elisa. Three RNA extraction methods were compared and the guanidine hydrochloride method was the most efficient and of the lowest cost. One isolate from Santa Catarina State and three from Rio Grande do Sul out of 28 PVY isolates submitted to RT-PCR method were differentiated as PVYO, confirming the biological test. One isolate of PVYN was detected from Santa Catarina and four from Rio Grande do Sul State. The PVYNTN was detected in Minas Gerais (six isolates), Santa Catarina (three isolates) and So Paulo (ten isolates). These results confirmed the presence of this new variant, PVYNTN in the main potato growing areas of Brazil.

Keywords: Solanum tuberosum, Potato virus Y, virus, polymerase chain reaction, potyvirus.

(Recebido para publicao em 30 de agosto de 2004 e aceito em 15 de agosto de 2005) batata uma das principais hortalias cultivadas no Brasil. Em 2003 a produo brasileira foi de aproximadamente trs milhes de toneladas em uma rea de 149.000 ha (FAO, 2004). Dentre os problemas fitossanitrios da cultura ressaltam-se as viroses, notadamente aquelas causadas pelo Potato virus Y (PVY), da famlia Potyviridae (VAN REGENMORTEL et al., 2000). No Brasil, na ltima dcada, o PVY vem acarretando infeces que variam de 30 a 100% do campo, dependendo das estirpes presentes nas plantas, da cultivar envolvida, da idade da
904

planta infectada, bem como das condies ambientais (SOUZA-DIAS, 2001). Trs estirpes de PVY so conhecidas: PVYC, PVYO e PVYN (DE BOKX; HUTTINGA, 1981) entretanto, mais recentemente surtos epidmicos de uma nova variante necrtica, o PVYNTN, vm sendo relatados em vrios pases como Alemanha, Hungria, Tchecoslovaquia, ustria, Iugoslvia, Frana, Blgica, Estados Unidos e Brasil (BECZNER et al. 1984; WEILGUNY; SINGH, 1998; SOUZA-DIAS et al. 2004). A nova variante necrtica, o PVYNTN, foi descrita primeiramente na Hungria por Beczner

et al. (1984) e no Brasil foi notificada oficialmente ao Ministrio da Agricultura em novembro de 1997 pelo Instituto Agronmico de Campinas (IAC). As estirpes de PVYO e PVYN foram relatadas no Brasil por volta de 1939 por Silberschmidt et al. (1941). Tradicionalmente, a diagnose de PVY em nvel de espcie feita utilizando testes sorolgicos como Elisa (Enzyme linked immunosorbent assay) com anticorpos policlonais ou monoclonais (CLARK; ADAMS, 1977, SINGH et al. 1993). Para diferenciao fenotpica de estirpes de PVY, utiliza-se principalmenHortic. bras., v. 23, n. 4, out.-dez. 2005

Diferenciao de estirpes de Potato virus Y (PVY) por RT-PCR

te a planta indicadora Nicotiana tabacum que manifesta sintomas que vo desde mosaico e necrose at a morte foliar (WEIDEMANN, 1988; SINGH, 1992). A estirpe PVYO causa em plantas de N. tabacum clareamento das nervuras e, posteriormente, manchas peroladas no limbo foliar. A estirpe PVYN e sua variante PVYNTN causam necrose na mesma hospedeira. A variante PVYNTN pode tambm induzir em tubrculos de batata arcos e anis necrticos, sintomas esses ausentes em tubrculos de plantas infectadas com a estirpe PVYN (BECZNER et al., 1984; LE ROMANCER; NEDLLEC, 1997; SOUZA-DIAS, 2001). Em folhas de batata, sintomas de infeco por PVY variam de mosaico leve a severo, podendo causar necrose nas hastes, limbo ou nervuras das folhas. Com a finalidade de distinguir as estirpes PVYN e PVYNTN, Weilguny e Singh (1998) propuseram uma metodologia baseada no mtodo de transcrio reversa (RT) e amplificao por meio da reao em cadeia da polimerase (PCR) do genoma viral, no qual utiliza-se uma combinao de trs oligonucleotdeos. Esta metodologia denominada de 3-primerRT-PCR permite diferenciar a estirpe necrtica (PVYN) da sua variante (PVYNTN). Outros autores, como Nie e Singh (2002), propuseram um sistema uniplex e multiplex de distino de estirpes e variantes de PVY e Rosner e Maslenin (1999) propuseram a diferenciao de variantes de PVY por meio de RT-PCR. Um outro estudo feito para distino das estirpes PVYN e PVYNTN foi proposto por Glais et al. (1996) baseado em padres de restrio. Atualmente encontra-se disponvel no mercado um sistema de deteco de PVYNTN atravs de RT-PCR produzido pela empresa Adgen. Este sistema oneroso e ainda no foi suficientemente validado para os isolados de PVY no Brasil. Uma vez que os anti-soros policlonais contra PVY hoje amplamente utilizados nos sistemas de certificao de batata no Brasil no permitem distinguir as estirpes, h uma demanda urgente em disponibilizar uma metodologia confivel e de baixo custo para identificar as estirpes PVYO, PVYN
Hortic. bras., v. 23, n. 4, out.-dez. 2005

e PVYNTN que ocorrem no Brasil. Embora a legislao de batata-semente no Brasil no diferencie as vrias estirpes de PVY, torna-se necessrio um monitoramento dessa estirpe necrtica devido induo do sintoma de necrose em tubrculo, o que inviabiliza a sua comercializao. Este trabalho tem como objetivo avaliar e validar metodologia de 3-primer RT-PCR proposta por Weilguny e Singh (1998) com os isolados coletados no Brasil. A escolha desse mtodo baseou-se no fato de o mesmo j estar sendo utilizado em sistemas de produo de batata na Amrica do Norte e Peru.

MATERIAL E MTODOS
Manuteno e identificao dos isolados de PVY Cada isolado de PVY foi identificado e mantido na planta indicadora N. tabacum por meio de inoculao mecnica. Os isolados foram recebidos na Embrapa Hortalias de janeiro de 2001 a setembro de 2002. Foram selecionados 28 tubrculos de batata infectados com e sem sintomas nos tubrculos das variedades Monalisa, Atlantic, Achat, Panda e Bintje, oriundas de Minas Gerais, So Paulo, Santa Catarina, Rio Grande do Sul e dois isolados, PVYO e PVYN, caracterizados por Inoue-Nagata et al. (2001), totalizando-se 30 isolados (Tabela 1). Os isolados foram agrupados e nomeados por sigla do estado de origem, nmero do isolado seguido do nome abreviado da cidade onde foi coletado o tubrculo. Teste biolgico e sorolgico Foi realizado com a inoculao de extrato foliar em tampo fosfato a 0,01M, pH 7,0, em plantas de Nicotiana tabacum TNN e Samsun previamente polvilhadas com carborundum 600 mesh. As plantas inoculadas foram avaliadas por sorologia pelo mtodo DASElisa (CLARK; ADAMS, 1977) utilizando anti-soro policlonal contra PVY produzido na Embrapa Hortalias. Extrao de RNA total Foram avaliados trs mtodos a partir de plantas de fumo infectadas: 1)

mtodo proposto por Weilguny e Singh (1998) em que 100 mg de extrato foliar foi adicionado ao tampo TrisHCl a 0,1M e Na2SO3 a 0,02M, pH 8,3, e o RNA total foi extrado por tratamento com fenol/clorofrmio seguido de precipitao com etanol; 2) mtodo Trizol Reagent (Invitrogen), composto por um tampo de isotiocianato de guanidina e fenol. A soluo foi misturada a 100 mg de extrato foliar e o RNA total foi precipitado aps a adio de clorofrmio para a separao das fases. 3) mtodo de hidrocloreto de guanidina (LOGEMANN et al., 1987) com a adio de quatro gotas de extrato de folha em 200 l de tampo hidrocloreto de guanidina a 8,0 M. O RNA total foi extrado com fenol/clorofrmio, precipitado com etanol, seguido de lavagens com acetato de sdio a 3 M, pH 5,2, e etanol 70%. Aps a secagem do precipitado nos trs mtodos, o RNA total foi ressuspendido com 50 l de gua e alquotas de 10 l foram armazenadas a 20oC. Sntese do cDNA e PCR Para a avaliao do mtodo de extrao, o RNA total foi submetido transcrio reversa utilizando-se MMLV reverse transcriptase (Amersham Biosciences). As combinaes de 3primer RT-PCR utilizados foram PVYO anti-senso para transcrio reversa e os oligonucleotdeos PVYO anti-senso e PVYO senso para PCR (Tabela 2) de acordo com Singh et al. (1996) gerando um produto amplificado de 479 pb. Neste experimento foram feitas doze repeties do mtodo Weilguny e Singh (1998) de extrao e cinco repeties de cada um dos outros dois mtodos. Para o experimento de diferenciao das estirpes de PVY, foram utilizados os 28 isolados selecionados e controles de PVYO BR e PVYNBR (Tabela 1). No se utilizou um controle positivo de PVYNTN devido impossibilidade legal de importao de um isolado de PVYNTN caracterizado no exterior. Para assegurar a confiabilidade do teste, todas as reaes foram realizadas com o mesmo lote de primers que foram utilizados do laboratrio do Dr. Rudra P. Singh (Potato Research Centre, Agriculture and Agri-Food, Canada). Trs combinaes de primers foram utilizadas nos
905

L. N. Fonseca et al.

Tabela 1. Diferenciao de isolados de PVY em de quatro estados brasileiros. Braslia, Embrapa Hortalias, 2004.
Isolado/local SC-01(Ca) RS-03(Pe) RS-06(Pe) RS-07(Pe) RS-08(Pe) RS-09(Pe) RS-09A(Pe) SC-01A(Ca) RS-05(Pe) SC-02(Ca) SC-02A(Ca) SC-14(Ca) SP-06(Vg) SP-07(Vg) SP-08(Vg) SP-11(Vg) SP-12(Vg) SP-13(Vg) SP-15(Vg) SP-16(Vg) SP-01(Cp) SP-02(Cp) MG-01(Ib) MG-01(PA) MG-02(PA) MG-03(PA) MG-04(PA) MG-05(PA) PVYOBR PVYNBR Planta sadia Sintomas de anis necrticos em tubrculos + + + + + + + + + + + + + + + + + + + Sintomas em Nicotiana tabacum6 NN6 NN NN NN NN MP MP MP MP NN NN NN NN NN NN NN NN NN NN NN NN NN NN NN NN NN NN NN MP NN SS RT-PCR* 1A/ 2A, RT-PCR* 2A/ 2A, 2S PVYNTN 2S PVYN/ PVYNTN + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + RT-PCR4* PY2/ PY1, PY2 PVYO/PVYN/ PVYNTN + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + Estirpe de PVY detectada5 PVYN PVYN PVYN PVYN PVYN PVYO PVYO PVYO PVYO PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYNTN PVYO PVYN -

1 Estado, nmero do isolado e cidade brasileira de origem (Cidades de origem: Pe=Pelotas, Ca=Canoinhas, Cp=Campinas, Vg=Vargem Grande do Sul, Ib=Ibi, Pa=Pouso Alegre); PVYOBR e PVYNBR so isolados utilizados como controles positivos para as estirpes PVYO e PVYN respectivamente. Em algumas localidades, foram colhidos dois tubrculos de uma mesma planta, de modo que para distinguir um isolado do outro adicionou-se uma letra ao lado; 2Oligonucleotdeos utilizados para a transcrio reversa e amplificao (RT/ PCR), seguido da representao da estirpe amplificada (PVYNTN); 3Oligonucleotdeos utilizados para a transcrio reversa e amplificao (RT/PCR), seguido da representao da estirpe amplificada (PVYN e PVYNTN); 4Oligonucleotdeos utilizados para a transcrio reversa e amplificao (RT/ PCR), seguido da representao da estirpe a ser amplificada (PVY (PVYO, PVYN e PVYNTN); 5Resultado indicando a estirpe diagnosticada (PVYO, PVYN e PVYNTN ); O sinal (+) representa presena de banda no gel de eletroforese para a combinao dos oligonucleotdeos nas reaes de RT, PCR e presena de necrose anelar nos tubrculos; O sinal (-) significa ausncia de banda ou ausncia de necrose anelar nos tubrculos; 6Sintomas em Nicotiana tabacum mecncia. NN : necrose de nervura ; MP : mancha perolada ; SS : sem sintomas.

testes (Tabela 2): para a deteco de todas as estirpes, a RT foi realizada com o oligonucleotdeo PY2 e PY1/PY2 para PCR amplificando um fragmento de DNA de 1,3 Kb. Para a deteco da estirpe necrtica PVYN e da sua variante necrtica PVY NTN foram usados os oligonucleotdeos 2A para RT e 2A/2S para PCR (WEILGUNY; SINGH, 1998), resultando em um fragmento de
906

394 pb; para a deteco somente da variante PVY NTN foram usados os oligonucleotdeos 1A para RT e 2A/2S para PCR (WEILGUNY; SINGH, 1998; SINGH et al, 1998). O tamanho esperado do fragmento foi tambm de 394 pb (Tabela 2). Para cada reao de transcrio reversa do RNA viral foi utilizado 2 l de RNA total na concentrao de 10 mg/l juntamente com 2 l de

tampo para transcrio reversa (5x Amersham), 0,75 l de PBS-tween 1X, 2 l de dNTPs a 2,5 mM, 0,5 l de primer antisenso (0,1 mg/l), 0,125 l de inibidor de RNase (20 unidades/l Amersham) e 0,5 l (100 unidades) de Maloney murine leukemia virus reverse transcriptase (USB) para um volume final de 10 l. O RNA e o primer reverso foram previamente incubados a 65oC por
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Diferenciao de estirpes de Potato virus Y (PVY) por RT-PCR

5 minutos e subseqentemente adicionados mistura que foi incubada por 90 minutos a 37oC para a sntese do cDNA. Aps a obteno da fita de cDNA, 2 l da mesma foi adicionado a uma mistura contendo 2,5 l de tampo com Tris-HCl, pH 8,3 na concentrao de 1,0 mM, 5,32 mM de KCl e 1,6 mM de MgCl2. Adicionou-se 1 l de dNTPs (2,5 mM) 0,5 l de cada primer na concentrao de 0,1 g e 0,125 l de Taq polimerase (1,7 unidades - Invitrogen) para um total de 25 l de reao. A amplificao ocorreu nas seguintes condies: 95oC por 5 minutos, 30 ciclos com desnaturao da fita dupla a 95 o C, anelamento do primer de 55oC (combinao PY1/PY2) ou 63oC (combinao 2A/2S) e extenso a 72oC, todos os passos com durao de 1 minuto. O produto de amplificao por PCR foi aplicado em gel de agarose e observado sob luz ultra-violeta aps tratamento com soluo de 0,5 mg/ml de brometo de etdeo.

Tabela 2. Seqncias dos primers utilizados e sua localizao no genoma viral de PVY. Braslia, Embrapa Hortalias, 2004.
Primers 1A- Antisenso 5'-GGTTGACATAATTTTGCTT - 3' 2A- Antisenso 5'- GCGTGCGATATGTTTTTGC - 3' 2S- Senso 5'- CAGATTGGTTCCATTGAATGC - 3' PY1- Senso 5'-CCCGGATCCGTCTCCTGATTGAAG - 3' PY2- Antisenso 5'- GGGGGATCCAAATCAGGAGATTC -3' PVYO Senso 5'-TGGTGTTCGTGATGTGACCT- 3' PVYO- Antisenso 5'-ACGTCCAAAATGAGAATGCC-3' Localizao (nt) Protena 669-652 607-589 214-234 8362- 8377 9704 -9691 8717- 8736 9196 -9177 P1 P1 P1 NIb 3' UTR CP CP

P1= protena P1; NIb= Nuclear Inclusion body; 3 UTR = regio 3 no traduzida; CP = capa protica;. 1Localizao em relao ao genoma de PVY, acesso U09509; 2Regio genmica de anelamento do primer; Stio de restrio BamHI encontra-se sublinhado.

RESULTADOS E DISCUSSO
Sorologia e reao dos isolados de PVY em plantas indicadoras de N. tabacum Vinte e oito isolados de PVY foram inoculados em N. tabacum para determinao da estirpe a que pertencem. Isolados caracterizados de PVY (PVYOBR e PVYNBR) foram utilizados como controles. Os isolados SC-1A(Ca), RS-05(Pe), RS-08(Pe), RS-09(Pe), RS-09A(Pe) e PVYOBR causaram em plantas de N. tabacum Samsun e TNN clareamento de nervuras a partir de cinco dias ps inoculao, avanando para manchas peroladas at 12 dias ps inoculao (Tabela 1). Estes sintomas so tpicos da estirpe comum PVYO. Os isolados RS-03(Pe), RS-06(Pe), RS-07(Pe), RS-08(Pe) PVYNBR, SC01(Ca), SC-02(Ca), SC-02A(Ca), SC14(Ca), SP-06(Vg), SP-07(Vg), SP08(Vg), SP-11(Vg), SP-12(Vg), SP13(Vg), SP-15(Vg), SP-16(Vg), SP02(Cp), SP-01(Cp), MG-01(Ib), MG01(PA), MG-02(PA), MG-03(PA), MG04(PA) e MG-05(PA) causaram necrose de nervuras at 12 dias ps inoculao ocorrendo perda foliar at 20 dias aps
Hortic. bras., v. 23, n. 4, out.-dez. 2005

inoculao. Estes sintomas so causados por estirpes necrticas de PVYN ou PVYNTN. Plantas inoculadas apenas com tampo permaneceram sem sintomas. O teste DAS-Elisa realizado nas plantas inoculadas mostrou que todas estavam infectadas com PVY (dados no mostrados). Alm disso, procedeuse inoculao mecnica de cada isolado em Datura stramonium com a finalidade de verificar possveis infeces mistas com outros vrus. Para todos os isolados avaliados, as plantas de D. stramonium no mostraram sintomas. Escolha do mtodo de extrao de RNA total Com a finalidade de otimizar o sistema de extrao de RNA, trs mtodos foram avaliados: Trizol, hidrocloreto de guanidina e o proposto por Weilguny e Singh (1998). Seis isolados de PVY (RS-05, SC-14, SP-11, MG-01(Ib), PVYO e PVYN) foram selecionados para esta avaliao. Os isolados foram multiplicados em plantas de Nicotiana tabacum Samsun para extrao do RNA total. Aps a extrao do RNA total, o RNA foi submetido transcrio reversa com o primer PVYO anti-senso e subseqentemente PCR utilizando o conjunto de primers que amplifica a regio do genoma que codifica a capa protica (PVYO anti-senso e PVYO senso) do vrus (Tabela 2). A comparao da eficincia do mtodo de extrao foi feita individualmente pela avaliao do produto de PCR em gel de agarose (Figura 1). Em todas as cinco repeties realizadas, o mtodo de hidrocloreto de guanidina e o Trizol apresentaram amplificaes efetivas e consistentes (Figura 1). Entretanto, o

mtodo de Weilguny e Singh (1998) apresentou em geral amplificaes errticas e de baixa quantidade. Doze repeties foram realizadas e o resultado manteve-se invarivel. A partir desse ponto, o mtodo com o hidrocloreto de guanidina foi considerado como padro para os experimentos posteriores. RT-PCR para diferenciao das estirpes de PVYO, PVYN e a variante necrtica PVYNTN A inoculao mecnica de plantas de fumo no suficiente para permitir a distino entre PVYN e PVYNTN. Com o intuito de se determinar a presena do PVYNTN no Brasil, avaliou-se o mtodo de 3-primer RT-PCR. O mtodo foi adaptado para diferenciar as estirpes PVYO, PVYN e a variante PVYNTN. A deteco universal de PVY foi realizada com a combinao de oligonucleotdeo PY2 para RT e PY1 e PY2 para PCR. Amplificao de todos os isolados foi confirmada com a presena do fragmento de DNA de 1,3 kb no gel de agarose (Tabela 1, Figura 2). Este resultado demonstrou que as plantas estavam de fato infectadas com PVY. A utilizao do oligonucleotdeo 2A para RT e 2A e 2S para PCR resultou na amplificao do DNA (394 pb) de 25 isolados (Tabela 1, Figura 2). Isso indicou que os isolados SC-01(Ca), RS03(Pe), RS-06(Pe), RS-07(Pe), RS08(Pe), SC-02(Ca), SC-02A(Ca), SC14(Ca), SP-06(Vg), Sp-07(Vg), SP08(Vg), SP-11(Vg), SP-12(Vg), SP13(Vg), SP-15(Vg), SP-16(Vg), SP01(Cp), SP-02(Cp), MG-01(Ib), MG01(PA), MG-02(PA), MG-03(PA), MG04(PA), MG-05(PA) e PVYNBR, pertencem s estirpes PVYN ou PVYNTN.
907

L. N. Fonseca et al.

Figura 1. Teste do mtodo de extrao de RNA total. Nas colunas 1 a 8 (A) foi utilizado o mtodo de extrao de RNA total proposto por Weilguny & Singh (1998). Nas colunas 9 a 16 (B) foi utilizado o mtodo Trizol e nas colunas 1 a 12 (C), foi utilizado o mtodo do hidrocloreto de guanidina. Foram utilizadas as mesmas amostras para os trs mtodos. Nas colunas 1A, 2A, 9B, 10 B, 1C e 2C, foram utilizadas plantas sadias; colunas 3A, 11B e 3C: amostra RS-05 (Pe);colunas 4A, 12B e 4C: isolado SC-14 (Pe); colunas 5A, 13B e 5C: SP11 (Vg); colunas 6A, 14B e 6C: isolado MG-01 (Ib); colunas 7A, 15B, e 7C: isolado PVYNBR; e colunas 8A, 16B, e 8C: isolado PVYOBR. A combinao de primers utilizada foi PVYO antisenso/ PVYO senso e antisenso para RT-PCR, respectivamente. A coluna 9C refere-se ao branco da RT e a 10C refere-se ao controle positivo da RT (isolado SP-16(Vg)), colunas 11C e 12C so os controles negativo e positivo (isolado SP-16(Vg) da PCR. O tamanho da banda esperada foi de 479pb (indicado pelas setas). Foi utilizado como marcador de peso molecular, o 1Kb Ladder (Invitrogen) (M). Braslia, Embrapa Hortalias, 2004.

O grupo dos isolados necrticos possivelmente continham isolados de PVYNTN devido observao de sintomas no tubrculo original (Tabela 1). Para a deteco do PVYNTN combinouse o oligonucleotdeo 1A para RT e 2A e 2S para PCR conforme descrito por Weilguny e Singh (1998). A reao realizada a alta temperatura de anelamento (630C), que necessria para uma correta diferenciao (WEILGUNY; SINGH, 1998). De um total de 25 isolados necrticos, 19 exibiram amplificao especfica de DNA: SC-02(Ca), SC-02A(Ca), SC-14(Ca), SP-06(Vg), Sp-07(Vg), SP-08(Vg), SP11(Vg), SP-12(Vg), SP-13(Vg), SP15(Vg), SP-16(Vg), SP-01(Cp), SP02(Cp), MG-01(Ib), MG-01(PA), MG02(PA), MG-03(PA), MG-04(PA), MG908

05(PA). Estas 19 amostras foram isoladas de tubrculos de batata exibindo sintomas de anis e arcos necrticos na sua superfcie. No houve amplificao de DNA dos demais isolados necrticos e comuns (Tabela 1). At a dcada de 80, o vrus de batata considerado mais importante no Brasil era o Potato leafroll virus (PLRV). Este quadro modificou-se no final da dcada de 90 com o surgimento de uma nova variante necrtica de PVY, o PVY NTN (FIGUEIRA; PINTO, 1995; SOUZA-DIAS, 2001; SOUZA-DIAS, 2004). A primeira notificao oficial da possvel ocorrncia da variante PVYNTN no Brasil foi feita em 1997 pelo Dr. Jos A.C. de Souza Dias ao Ministrio da Agricultura Pecuria e Abastecimento.

Para exemplificar a ameaa desta nova variante necrtica, em 1998, na Eslovnia, um surto epidmico de PVYNTN infectou a quase totalidade das batatas da cultivar Igor (WEILGUNY; SINGH, 1998). O sistema de diferenciao de estirpes de PVY pelo mtodo 3-primer RTPCR (WEILGUNY; SINGH, 1998) explora a caracterstica de alta variabilidade da protena P1. Este estudo comparou isolados eslovnios de PVYNTN e norte americanos de PVYN e PVYC. Testes biolgicos e sorolgicos utilizando anticorpos policlonais e monoclonais no permitiram a diferenciao das estirpes/variantes necrticas. Contudo, utilizando o sistema 3-primer RT-PCR foi possvel diferenciar o PVYNTN de nove isolados de PVYN, 13 isolados de PVYO, um isolado de PVYC alm de seis vrus e um viride que comumente ocorrem na batata. Em condies brasileiras, resultados similares foram obtidos atravs da combinao do 3-primer RTPCR com DAS-Elisa e/ou PCR universal. O sistema mostrou-se efetivo para diferenciar as duas estirpes PVYO e PVYN e a variante necrtica PVYNTN em 28 isolados de PVY originrios de distintos estados produtores de batata do Brasil (Tabela 1). Entretanto, a substituio do mtodo de extrao de RNA total como proposto por Weilguny e Singh (1998) pelo mtodo de hidrocloreto de guanidina (LOGEMANN et al. 1987) foi essencial para a reprodutibilidade e confiabilidade dos resultados. Vale ressaltar que o sistema foi testado com folhas infectadas de fumo e no foram feitos ensaios com folhas e tubrculos de batata. A presena de arcos ou anis superficiais nos tubrculos indicativo da presena da variante necrtica PVYNTN, porm o vrus pode estar presente em tubrculos assintomticos. Sob condies de casade-vegetao, prognie de tubrculos obtidos a partir de tubrculos-me com sintomas de anis quase sempre so assintomticos (dados no mostrados). Segundo Le Romancer e Bedekkec (1997), a presena de anis nos tubrculos est em funo do gentipo de batata, virulncia do isolado e condies ambientais e de armazenamento dos tubrculos.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Diferenciao de estirpes de Potato virus Y (PVY) por RT-PCR

Outros sistemas tambm tm sido testados para diferenciao de espcies virais e estirpes ou variantes de PVY como mtodos de anlise de restrio (GLAIS et al., 1996, ROSNER; MASLENIN, 1999) e o sistema de RTPCR multiplex (KLERKS et al., 2001, NIE; SINGH, 2002). Todavia esses sistemas precisam ser avaliados em condies brasileiras. Um outro fator peculiar ao sistema 3-primer RT-PCR que, diferentemente do sistema taxonmico de diferenciao de espcies virais proposto por Shukla et al. (1994), que preconiza o uso da similaridade da seqncia de aminocidos da capa protica para distino das espcies virais, o sistema 3primer RT-PCR utiliza a protena P1 para a distino de estirpes ou variantes dentro da espcie PVY (WEILGUNY; SINGH 1998). Foi possvel verificar a deteco da variante necrtica de PVYN e PVYNTN em trs dos quatro estados brasileiros pesquisados (MG, SP e SC) porm, isso no significa que o mesmo no esteja presente em outros estados produtores no Brasil. O trabalho de Souza-Dias et. al. (2004) confirma a presena da variante PVYNTN nos estados de MG, SP e acrescenta outros estados como GO e BA. As estirpes PVYO e PVYN tm sido rotineiramente detectadas em todos os estados brasileiros (FIGUEIRA et al.,1996). Um estudo realizado por Moraes (1997) relatou uma maior incidncia da estirpe necrtica PVYN (83%) em relao estirpe comum PVY O (16,4%) nos estados de MG, SP e SC. O sistema 3-primer RT-PCR com as modificaes propostas, demonstrou boa capacidade de distino das estirpes ou variantes de PVY no Brasil. O mesmo possui vantagens como, menos oneroso e razovel rapidez na execuo. Esta metodologia possui um excelente potencial para ser adotada para o estudo da deteco e abrangncia de PVYNTN no Brasil. Aes futuras sero realizadas em nvel principalmente de deteco de estirpes de PVY a partir de folhas e tubrculos de batata.

Figura 2. Gel demonstrativo do teste de diferenciao de estirpes em agarose 2%. A combinao de primer utilizada para A, foi PY2/ PY1, PY2 (RT/ PCR). A combinao dos primers em B, foi 2A/ 2A, 2S (RT-PCR). A combinao dos primers em C foi 1A/ 2A, 2S (RT/ PCR). Colunas 1A, 1B e 1C, representam as amostras sadias (controles negativos). Colunas 2, 3, e 4 (A, B, C) so isolados de PVYO: PVYOBR, SC-01 (Ca) e RS-05 (Pe) respectivamente. Colunas 5 e 6 (A, B e C) so estirpes de PVYN, dos isolados: RS-03 (Pe) e PVYNBR. Colunas 7, 8 e 9 so estirpes de PVYNTN dos isolados SC-14 (Ca), MG-01 (Ib) e SP-11 (Vg). Colunas 11A, 10B e 10C representam os brancos da RT. As colunas 10A, 11B e 11C representam os controles positivos da RT [isolado SP-16(Vg)]. Colunas 13A, 12B e 12C representam os brancos da PCR. Coluna 12A, 13B e 13C representam os controles positivos da PCR [isolado SP16(Vg)]. A seta em A indica fragmento amplificado de 1,3 Kbp e em B e C, de 394 pb. Todas as amostras testadas esto representadas na tabela 2. Foi utilizado como marcador de peso molecular, o 1Kb plus (Invitrogen) (M). Braslia, Embrapa Hortalias, 2004.

LITERATURA CITADA
BECZNER, L.; HORVATH, H.; ROMHANY, I.; FORSTER, H. Studies on the etiology of tuber necrotic ringspot disease in potato. Potato Research, v.27, p.339-352, 1984. Hortic. bras., v. 23, n. 4, out.-dez. 2005

CLARK, M.F.; ADAMS, A.N. Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. Journal of General Virology, v.34, p.475483, 1977. FAO. FAOSTAT Data base Results. Agriculture. Crops primary. Brazil, production and area, 2003. Disponvel em: <http://apps.fao.org>. FIGUEIRA, A.R.; PINTO, A.C.S. Estirpe necrtica do vrus Y da batata em sementes importadas est causando problemas ao bataticultor mineiro. Fitopatologia Brasileira, Braslia, v.20, p.299, 1995. Suplemento. FIGUEIRA, A.R.; PINTO, A.C.S.; MORAES, F.H.R. Alta incidncia da nova estirpe necrtica do vrus Y da Batata est ocorrendo em todos os estados produtores do Brasil. Fitopatologia Brasileira, Braslia, v.21, p.432-433, 1996. Resumo.

FNP CONSULTORIA E COMRCIO. Batata: melhora a distribuio da oferta ao longo do ano. Agrianual: Anurio da Agricultura Brasileira, So Paulo, 2003. p.235-243. GLAIS, L.; KERLAN, C.; TRIBODET, M.; MARIE-JEANNE, V.; ROBAGLIA, C.; ASTIERMANIFASTIER, S. Molecular characterization of potato virus YN isolates by PCR-RFLP. European Journal of Plant Pathology, v.102, p.655-662, 1996. INOUE-NAGATA, A.K.; FONSECA, E.N.; LOBO, T.O.T.A.; VILA; A.C.; MONTE, D.C. Analysis of the nucleotide sequence of the coat protein and 3-untranslated region of two Brazilian Potato virus Y isolates. Fitopatologia Brasileira, Braslia, v.26, p.45-52, 2001. KLERKS, M.M.; LEONE, G.O.M.; VERBEEK, M.; HEUVEL, J.F.J.M.; SCHOEN, C.D. Development of a multiplex AmpliDet RNA for the simultaneous detection of Potato leafroll virus and Potato virus Y in potato tubers. Journal of Virological Methods, v.93, p.115125, 2001. 909

L. N. Fonseca et al. LE ROMANCER, N.; NEDELLEC, N. Effect of plant genotype, virus isolate and temperature on the expression of the potato tuber necrotic ringspot disease (PTNRD). Plant Pathology, v.46, p.104111, 1997. LOGEMANN, J.; SCHELL, J.; WILLMITZER, L. Improved method for the isolation of RNA from plant tissues. Analytical Biochemistry, v.163, p.1620, 1987. MORAES, H.R.M. Estudo comparativo de algumas propriedades biolgicas de cinco isolados do vrus Y da batata (Potato Virus Y - PVY). 1997. Dissertao (Mestrado) - Universidade Federal de Lavras, Lavras. NIE, X.; SINGH, R.P. A new approach for the simultaneous differentiation of biological and geographical strains of Potato virus Y by uniplex and multiplex RT-PCR. Journal of Virological Methods, v.104, n.1, p.41-54, 2002. REGENMORTEL, M.H.V.; FAUQUET, C.M.; BISHOP, D.H.L.; CARSTENS, E.B.; ESTES, M.K.; LEMON, S.M.; MANILOFF, J.; MAYO, M.A.; MCGEOCH, D.J.; PRINGLE, C.R.; WICKNER, R.B. Virus taxonomy classification and nomenclature of viruses. In: INTERNATIONAL COMMITTEE ON TAXONOMY OF VIRUSES, 7., 2000, San Diego. Report ... New York: Academic Press, 2000. ROSNER, A.I.; MASLENIN, L. Diferentiate PVYNTN by unique single: restriction cleavage of PCR products. Potato Research, v.42, p.215-221, 1999 SHUKLA, D.D.; WARD, C.W.; BRUNT A.A. The potyviridae. Wallingford: CAB International, 1994. SILBERSCHMIDT, K.; NOBREGA, N.R.; KRAMER, M. A identificao de vrus encontradas nos campos de multiplicao de tubrculossemente de batatinha. Agricultura , Piracicaba, v.21, p.23-40, 1941 SINGH, R.P. Incidence of tobacco veinal necrotic strain of potato virus Y (PVYN) in Canada in 1990 and 1991 and scientific basis for eradication of the disease. Canadian Plant Disease Survey, v.72, p.113-119, 1992. SINGH, R.P.; BOUCHER, A.; SOMERVILLE, T.H.; DHAR, A.K. Selection of a monoclonal antibody to detect PVYN and its use in ELISA and DIBA assays. Canadian Journal of Plant Pathology, v.15, p.293-300, 1993. SINGH, R.P.; KURZ, J.; BOITEAU, G. Detection of stylet-borne and circulative potato viruses in aphids by duplex reverse transcription polymerase chain reaction. Journal of Virological Methods, v.59, p.189-196, 1996. SINGH, R.P.; SINGH, M.; MCDONALD, J.G. Screening by a 3-primer PCR of North American PVYN isolates for European-type members of the tuber necrosis-inducing PVY NTN subgroup. Canadian Journal of Plant Pathology, v.20, p.227233, 1998. SOUZA-DIAS, J.A.C.; SCAGLIUSI, S.M.; AMANCIO, A.V.; MIRANDA, H.S.; COSTA, A.S. Batata-semente certificada da Argentina encontra-se dentro dos padres brasileiros de sanidade a vrus, mas a presena dos vrus YN e do mosaico da alfafa suscita preocupaes. Summa Phytopathologica , Piracicaba, v.18, n.1, p.35, 1992. Resumo 55. SOUZA-DIAS, J.A.C.; SAWASAKI, H.E.; OKADA, M.M.; WEST-OFFA, L.G. Potato Virus Y: Confirmada a presena em 5 estados produtores de batata no Brasil. Summa Phytopathologica, Piracicaba, v.30, p.99, 2004. Resumo. SOUZA-DIAS, J.A.C.; TRISTO, J.F.; MIRANDA, H.S. Vrus Y da batata-semente cv. Atlantic: alterao na epidemiologia da virose em So Paulo e no Paran. Fitopatologia Brasileira, Braslia, v.20, p.320, 1995. Resumo. SOUZA-DIAS, J.A.C. Raas do vrus Y da batata e a questo da variante NTN. Batata Show , Itapetininga, v.2, p.16-21, 2001. WEIDEMANN, H.L. Importance and control of potato virus YN (PVYN) in seed potato production. Potato Research, v.31, p.85-94, 1998. WEILGUNY, H.; SINGH, R.P. Separation of Slovenian isolates of PVYNTN from the North American isolates of PVYN by a 3-Primer PCR. Journal of Virological Methods, v.71, p.57-68, 1998.

910

Hortic. bras., v. 23, n. 4, out.-dez. 2005

CARDOSO, A.D.; VIANA, A.E.S.; RAMOS, P.A.S.; MATSUMOTO, S.N.; AMARAL, C.L.F.; SEDIYAMA, T.; MORAIS, O.M. Avaliao de clones de batata-doce em Vitria da Conquista Horticultura Brasileira, Braslia, v.23, n.4, p.911-914, out-dez 2005.

Avaliao de clones de batata-doce em Vitria da Conquista


Adriana D. Cardoso1; Anselmo Eloy S. Viana1; Paula Accia S. Ramos2; Sylvana N. Matsumoto1; Cludio Lcio F. Amaral1; Tocio Sediyama3; Otoniel M. Morais1
Universidade Estadual do Sudoeste da Bahia, Depto. Fitotecnia e Zootecnia, C. Postal 95, 45083-900 Vitria da ConquistaBA; Universidade Federal de Viosa, 36570-000 Viosa-MG; 2Bolsista PIBIC/CNPq; E-mail: adriadk@bol.com.br; aviana@uesb.br; acaciaramos@bol.com.br; snaomi@uesb.br; geticamaralclfuesb@bol.com.br; tcyama@ufv.br; otoniel@uesb.br
3 1

RESUMO
Clones de batata-doce foram avaliados em Vitria da Conquista, em experimento, composto por 16 clones oriundos de Janaba (MG), de Viosa (MG), Bom Jardim de Minas (MG), Gurupi (TO), Santo Antnio da Platina (PR), Holambra II (SP), Vitria da Conquista (BA) e Condeba (BA). Os clones avaliados foram: 1; 2; 7; 9; 14; 15; 17; 19; 23; 25; 29; 30; 36; 38; 44 e 100. Utilizou-se o delineamento em blocos casualizados, com 16 tratamentos e 3 repeties. Foram avaliadas as caractersticas das razes tuberosas: produtividade total, peso mdio total, produtividade comercial, peso mdio comercial, comprimento, dimetro e formato. Ainda avaliou-se: resistncia a insetos de solo e peso de ramas. Os dados foram submetidos anlise de varincia e as mdias comparadas pelo teste de ScottKnott a 5% de probabilidade. Os clones 1; 7; 25; 29 e 38 destacaram-se em produtividade de razes tuberosas e os clones 1; 2; 7; 9; 17; 25; 29 e 36 em peso de ramas. Os clones 1; 25 e 36 apresentaram melhor comportamento para o comprimento de razes tuberosas. Palavras-chave: Ipomoea batatas, produtividade, formato de raiz, insetos de solo.

ABSTRACT
Evaluation of sweet potato clones in Vitria da Conquista Sweet potato clones were evaluated in Vitria da Conquista, Bahia State, Brazil. Sixteen clones (1; 2; 7; 9; 14; 15; 17; 19; 23; 25; 29; 30; 36; 38; 44 and 100), originating from Janaba, Viosa, Bom Jardim de Minas, Gurupi, Santo Antnio da Platina, Holambra II, Vitria da Conquista and Condeba were analyzed. Random plots were utilized with 16 treatments and three repetitions. The following characteristics were evaluated: total root yield, average root weight; commercial root yield; average commercial root weight; length, diameter and form of the roots; resistance to soil insects and branch weight. The data were submitted to variance analysis and Scott Knott test with 5% probability. Clones 1; 7; 25; 29 and 38 stood out in root yield and the clones 1; 2; 7; 9; 17; 25; 29 and 36 stood out in branch weight. Clones 1; 25 and 36 presented the best results concerning the length of roots.

Keywords: Ipomoea batatas, yield, root shape, soil insects.

(Recebido para publicao em 27 de outubro de 2004 e aceito em 9 de maio de 2005)

batata-doce (Ipomoea batatas (L.) Lam.) a nica espcie da famlia Concolvulaceae cultivada para fins alimentcios. Outras espcies da mesma famlia, no entanto, so cultivadas para fins ornamentais na sia, frica e Austrlia (HALL; PHATAK, 1993). No Brasil, a batata-doce uma cultura antiga, bastante disseminada e de forma geral, cultivada, principalmente, por pequenos produtores rurais, em sistemas agrcolas com reduzida entrada de insumos (SOUZA, 2000). Segundo Figueiredo (1995), em virtude dessa hortalia apresentar elevada rusticidade e amplo espectro de potencialidade de uso, a batata-doce apresenta-se como espcie de interesse econmico, principalmente, para pases em desenvolvimento e com escassez de alimentos para a populao. O potencial de produo da batatadoce alto, por ser uma das plantas com maior capacidade de produzir energia

por unidade de rea e tempo (Kcal/ha/ dia). As ramas e razes tuberosas so largamente utilizadas na alimentao humana, animal e como matria-prima nas indstrias de alimento, tecido, papel, cosmtico, preparao de adesivos e lcool carburante. Seu consumo per capita bastante variado, desde 2 kg/ hab/ano, nos Estados Unidos a 114 kg/ hab/ano no Burundi (CIP, 2001). O Brasil ocupa o dcimo lugar na produo de batata-doce, produzindo em torno de 498.046 t/ano, com rea plantada de 43.959 ha e produtividade mdia de 11,5 t/ha (IBGE, 2002). Dentre os motivos para essa baixa produtividade destacam-se o uso de variedades pouco produtivas e o baixo nvel tecnolgico empregado (CNPH, 2001). O cultivo relativamente simples e pouco dispendioso, torna-a uma hortalia muito popular e bastante consumida. A regio Sul a maior produtora de batata-doce, com cerca de 251.219 t/ano,

seguida da regio Nordeste, com produo mdia de 158.474 t/ano. O Estado da Bahia produz 19.072 t/ano, sendo que apenas 108 t so produzidas no municpio de Vitria da Conquista (IBGE, 2002). Segundo Murilo (1990), a batatadoce a quarta hortalia mais consumida pela populao brasileira, com mdia de 3,6 kg/hab/ano, superada apenas pela batata, tomate e abbora. Conforme Miranda et al. (1989), nas regies Sul e Nordeste, o consumo mdio estimado em cerca de 5,6 e 6,8 kg, respectivamente. A batata-doce excelente fonte de nutrientes e de energia devido aos teores de carboidratos, acares, sais minerais, vitaminas A, C e complexo B. Alm disso, contm tambm grande quantidade de metionina, que um dos aminocidos essenciais para o bem estar dos seres humanos (MIRANDA et al., 1989).
911

Hortic. bras., v. 23, n. 4, out.-dez. 2005

A. D. Cardoso et al.

A batata-doce apresenta grande diversidade fenotpica e genotpica. A maioria dos produtores utiliza variedades regionais, sendo que grande parte delas pouco produtiva e suscetvel a pragas e doenas (MIRANDA et al., 1984). A base do melhoramento de uma cultura est em sua variabilidade gentica, ou seja, na diversidade de resposta s melhores prticas agronmicas, resistncia a pragas e doenas, tolerncia seca e muitas outras caractersticas. A utilizao eficiente dessa variabilidade depende, em primeiro lugar, de uma coleo bem mantida e significativa das variaes intra e interespecfica disponveis; em segundo lugar, de uma completa avaliao dos caracteres de cada acesso; em terceiro lugar, de um programa de ensaios avanados avaliando os melhores materiais sob condies representativas e de um programa de hibridao para combinar as caractersticas de gentipos distintos (HERSEY; AMAYA, 1982). Apesar da importncia da batatadoce no Brasil, so poucos os trabalhos de pesquisa visando selecionar e indicar cultivares para as diferentes regies do pas, sendo este um dos principais problemas enfrentados pelos produtores (CNPH, 1995). Existe no Brasil um nmero elevado de cultivares, com enorme diversidade gentica entre elas. Como praticamente em todos os municpios brasileiros existem cultivares locais, comum encontrar uma mesma cultivar com nomes diferentes ou diferentes cultivares com o mesmo nome. Segundo Silveira (1993) e Jones et al. (1986), o Brasil possui um vasto germoplasma de batata-doce, mantido por pequenos agricultores, comunidades indgenas e, at mesmo, em hortas domsticas que pode ser avaliado, selecionando-se os mais adequados. O presente trabalho teve como objetivo avaliar caractersticas agronmicas de clones de batata-doce provenientes de diferentes locais cultivados em Vitria da Conquista.

MATERIAL E MTODOS
O experimento foi conduzido em rea experimental da Universidade Estadual do Sudoeste da Bahia, em Vit912

ria da Conquista (BA), a 145351" latitude sul e 404823" longitude oeste, altitude mdia de 900m. A precipitao mdia anual est em torno de 700 a 1200 mm/ano. O solo da rea experimental foi classificado como Cambissolo Hplico Tb, Distrfico, com textura mdia, topografia suavemente ondulada e plana e boa drenagem. Foram utilizados clones de batatadoce, provenientes do Banco de Germoplasma da EPAMIG e da UFV e coletados junto a agricultores da regio. Os clones so citados e classificados pelo local de origem, segundo Oliveira (2002): Clones 1; 2; 7; 9; 14; 15 e 17 de Janaba (MG); Clone 19 de Viosa (MG); Clones 23 e 25 de Bom Jardim de Minas (MG); Clones 29 e 30 de Gurupi (TO); Clone 36 de Santo Antnio da Platina do (PR); Clone 38 de Holambra II (SP); Clone 44 de Vitria da Conquista (BA) e Clone 100 de Condeba BA). O preparo do solo foi feito como recomendado para a cultura da batatadoce. O solo foi arado, gradeado e, em seguida, enleirado. No foram feitas calagem e adubao, objetivando simular ambiente que prevalece nas reas de cultivo dessa cultura nas pequenas e mdias propriedades agrcolas da regio. As ramas foram selecionadas, padronizadas e cortadas com 50 cm de comprimento antes do plantio. Por ocasio do plantio (23/03/2003) utilizou-se leiras, com 30 cm de altura e espaamento de 1,5 m x 0,25 m. No decorrer do experimento, os tratos culturais foram restritos s capinas e irrigaes, feitos sempre que necessrio. O delineamento experimental utilizado foi em blocos casualizados, com 16 tratamentos (clones) e trs repeties, sendo a parcela experimental composta por 6 plantas teis. Aps a colheita, feita em outubro de 2003, foram avaliadas as caractersticas a) Produtividade de razes tuberosas, obtida pela pesagem de todas as razes tuberosas da parcela; b) Peso mdio das razes tuberosas obtido pela diviso da produo total de raiz tuberosa pelo nmero total de razes tuberosas da parcela; c) Produtividade comercial selecionando-se todas as razes tuberosas com peso >80 g da parcela; d) Peso mdio

das razes comerciveis obtido pela diviso da produo comercial pelo nmero total de razes comerciveis da parcela; e) Peso de ramas frescas obtido pela pesagem de toda parte area da parcela; f) Comprimento de razes tuberosas medindo-se individualmente o seu comprimento com o auxlio de uma rgua; g) Dimetro de razes tuberosas determinado na poro central da raiz com auxlio de um paqumetro; h) Formato de razes tuberosas determinado por meio de uma escala de notas estabelecida por Frana et al. (1983), citados por Azevedo et al. (2000), sendo a nota 1 atribuda para razes com formato fusiforme, regular, sem veias ou qualquer rachaduras; nota 2 para razes com formato considerado bom, prximo de fusiforme, com algumas veias; nota 3 para razes com formato desuniforme, com veias e bastante irregular; nota 4 para razes muito grandes, com veias e rachaduras (indesejvel comercialmente) e nota 5 para razes totalmente fora dos padres comerciais, muito irregulares e deformadas, com muitas veias e rachaduras. A atribuio das notas foi feita em razes comerciveis, tomadas ao acaso em cada parcela; i) Danos causados por insetos de solo utilizando-se escala de notas estabelecida por Frana et al. (1983) citados por Azevedo et al. (2000), sendo a nota 1 atribuda para razes livres de danos, com aspecto comercial desejvel; nota 2 para razes com poucos danos, perdendo um pouco com relao ao aspecto comercial (presena de algumas galerias e furos nas razes); nota 3 para razes com danos verificados sem muito esforo visual (presena de galerias e furos nas razes em maior intensidade), com aspecto comercial prejudicado; nota 4 para razes com muitos danos, praticamente imprestveis para comercializao (presena de muitas galerias, furos e incio de apodrecimento) e nota 5 para razes totalmente imprestveis para fins comerciais (repletas de galerias, furos e apodrecimento mais avanado). A anlise estatstica foi realizada utilizando-se o programa SAEG, verso 8.0, procedendo-se anlise de varincia e, posteriormente, as mdias dos tratamentos foram agrupadas atravs do teste de Scott-Knott (1974), a 5% de probabilidade.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Avaliao de clones de batata-doce em Vitria da Conquista

RESULTADOS E DISCUSSO
Para a produtividade de razes tuberosas, foi possvel separar os clones avaliados em 2 grupos (Tabela 1). O primeiro composto pelos clones 1; 7; 25; 29 e 38, apresentou a maior produtividade que o segundo grupo composto pelos clones 2; 9; 14; 15; 17; 19; 23; 30; 36; 44 e 100. Somente quatro clones (14; 19; 30 e 44) apresentaram produtividade inferior mdia nacional que de 8,7 t ha-1 (EMBRAPA, 2003). Azevedo et al. (2000) avaliando o desempenho de clones de batata-doce verificaram produo total mxima de 33,5 t ha-1 com o clone 92762 e mnima com 8,2 t ha-1com o clone 92676. O valor obtido para peso mdio das razes tuberosas variou de 91 a 212,7 g sem diferena entre os clones. Pode-se constatar que os clones 1; 2; 7; 9; 17; 25; 29 e 36 destacaram-se apresentando maior peso de ramas, com valor mximo de 14,1 t ha-1 (Tabela 1). Os clones 14; 15; 19; 23; 30; 38; 44 e 100 apresentaram os mais baixos valores de peso de ramas. No houve diferena estatstica entre os clones avaliados para peso mdio de razes comerciveis, sendo que os dados obtidos variaram de 102 a 286 g. Azevedo et al. (2000) avaliando clones de batata-doce tambm no encontraram diferena significativa entre clones para esta caracterstica. Na Tabela 1, observou-se que os clones 1; 2; 7; 9; 17; 25; 29; 36 e 38 apresentaram maior produtividade comercial, com valor mximo de 21,3 t ha-1. Peixoto et al. (1999) avaliando clones de batata-doce em Uberlndia, encontraram produtividade variando entre 28,0 t ha-1 e 0,7 t ha-1. O clone 1, oriundo de Janaba (MG), foi o que mais se aproximou do valor encontrado por esses autores, com produtividade comercial de 21,2 t ha-1. Houve diferena significativa entre os clones para a caracterstica comprimento de razes tuberosas, sendo os clones 1; 36 e 25 os que apresentaram maiores valores, com 20,69 cm, 18,85 cm e 17,03 cm de comprimento, respectivamente (Tabela 1). Figueiredo (1993)
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Mdias de produtividade de razes tuberosas (PRT), peso de ramas (PR), produtividade comercial (PC) e comprimento das razes tuberosas (CRT) em clones de batata-doce, 2004. Vitria da Conquista, UESB, 2004.
Clone 1 (Janaba - MG) 7 (Janaba - MG) 25 (Bom Jardim de Minas - MG) 29 (Gurupi - TO) 38 (Holambra II - SP) 2 (Janaba - MG) 9 (Janaba - MG) 14 (Janaba - MG) 15 (Janaba - MG) 17 (Janaba - MG) 19 (Viosa - MG) 23 (Bom Jardim de Minas - MG) 30 (Gurupi - TO) 36 (St. Antnio de Platina - PR) 44 (Vitria da Conquista - BA) 100 (Condeba - BA) C.V. (%) PRT (t ha-1) 28,5 a 23,9 a 27,7 a 23,2 a 20,2 a 13,5 b 16,7 b 4,1 b 12,2 b 15,4 b 7,5 b 8,8 b 7,8 b 15,7 b 8,4 b 9,9 b 46,64 PR (t ha-1) 14,1 a 8,6 a 10,5 a 9,9 a 3,4 b 6,7 a 6,3 a 2,1 b 4,1 b 7,5 a 2,8 b 3,0 b 2,6 b 11,5 a 1,4 b 2,6 b 52,72 PC (t ha-1) 21,3 a 11,0 a 17,1 a 12,3 a 11,5 a 19,4 a 19,2 a 11,6 a 13,5 a 2,9 b 6,0 b 4,6 b 5,9 b 5,5 b 4,4 b 7,0 b 59,02 CRT (cm) 20,69 a 17,03 a 18,85 a 15,00 b 15,05 b 16,17 b 13,47 b 15,43 b 13,56 b 14,72 b 15,19 b 15,40 b 12,31 b 15,22 b 13,64 b 13,18 b 13,92

*Mdias seguidas de mesma letra, na coluna, no diferem entre si a 5% de probabilidade pelo teste de Scott-Knott.

obteve valores prximos nas cultivares Paulista e Uberlndia, com 21,5 cm e 18,0 cm, respectivamente. Os demais clones analisados apresentaram comportamento inferior em relao a esta caracterstica. No houve diferena significativa para formato de raiz tuberosa entre os clones avaliados. Todos os clones apresentaram nota de formato de raiz inferior a 3,0, variando de 1,63 a 2,27. Segundo Azevedo et al. (2000), os clones que mais se aproximaram do formato ideal fusiforme (menores notas) so os mais promissores, pois o formato considerado uma importante caracterstica comercial da batata-doce. Peixoto et al. (1999) encontraram formato de clones prximos ao ideal, mas tambm diversos clones com nota superior a 3,0. Assim, os clones analisados em Vitria da Conquista apresentaram bom desempenho em relao a essa caracterstica, sendo considerados bastante promissores. No foi encontrada diferena significativa entre os clones avaliados para dimetro de razes tuberosa, que variou de 2,98 a 5,63 cm. A mdia geral do experimento foi de 4,36 cm. Figueiredo (1993) encontrou valores mdios de dimetro de 5,3 cm na cultivar Paulista e

4,8 cm na cultivar Uberlndia, valores estes tambm prximos mdia de dimetro encontrado neste trabalho. Segundo Miranda et al. (1995), as razes tuberosas de batata-doce de melhor classificao (extra A) devem apresentar dimetro entre 5 e 8 cm e comprimento variando entre 12 e 16 cm. No houve diferena significativa entre os clones em relao resistncia aos insetos de solo. Os clones 25; 29; 36; 38; 44 e 100 apresentaram notas inferiores a 2,0, com alta ou moderada resistncia a insetos de solo. Os clones 1; 2; 7; 9; 14; 15; 17; 19; 23 e 30 alcanaram notas entre 2,0 e 2,6, sendo estes clones os mais resistentes a danos causados pelos insetos, em relao aos demais.

AGRADECIMENTOS
Os autores agradecem Universidade Estadual do Sudoeste da Bahia e Coordenao de Aperfeioamento do Pessoal de Nvel Superior (CAPES).

LITERATURA CITADA
AZEVEDO, S.M.; FREITAS, J.A.; MALUF, W.R.; SILVEIRA, M.A. Desempenho de clones e mtodos de plantio de batata-doce. Acta Scientiarum, v.22, n.4, p.901-905, 2000. 913

A. D. Cardoso et al. CENTRO INTERNACIONAL DE LA PAPA (CIP). La batata em cifras: produccin, utilizacin, consumo e alimentacin. Disponvel em: <http// :www.cipotato.org>. Acesso em: 3 jul. 2001. CENTRO NACIONAL DE PESQUISA DE HORTALIAS. Cultivo da batata-doce. Braslia: EMBRAPA/CNPH, v.7, 1995, 18 p. (Instrues tcnicas do CNP Hortalias) EMBRAPA. Cultivares desenvolvidas pela Embrapa hortalias. Disponvel em: <http:// www.cnpmf.embrapa.br>. Acesso em: 20 nov. 2003. FIGUEIREDO, A.F. Armazenamento de ramas, tipos de estacas, profundidade de plantio e anlise do crescimento de plantas de batata-doce (Ipomoea batatas (L.) Lam.). 1993. 127 f. (Dissertao doutorado) - Universidade Federal de Viosa, Viosa. HALL, M.R.; PHATAK, S.C. Sweet potato Ipomoea batatas (L.) Lam. In: KALLOO, G.; BERGH, B.O. Genetic improvement of vegetable crops. New York, Pergamon Press, 1993, p.693-708. HERSEY, C.; AMAYA, A. Germoplasma de yuca: evolucion, distribuicion y colecion. In: CENTRO INTERNACIONAL DE AGRICULTURA TROPICAL. Yuca, investigacion, produccion y utilizacion. Cali: CIAT, 1982, p.77-89. IBGE. Sistema IBGE de recuperao automtica SIDRA . Disponvel em: <http:// www.ibge.com.br>. Acesso em: 1 nov. 2003. JONES, A. Cytological observations and fertility measurements of sweet potato [Ipomoea batatas (L.) Lam.]. Proccedings of the american Society of Horticultural Sciences, v.86, p.527-537, 1965. MIRANDA, J.E.C.; FRANA, F.H.; CARRIJO, O.A.; SOUZA, A.F.; PEREIRA, W.; LOPES, C.A.; DILVA, J.B.C. A cultura da batata-doce. Braslia: EMBRAPA /CNPH, 1995, 94 p. MIRANDA, J.E.C.; FRANA, F.H.; CARRIJO, O.A.; SOUZA, A.F.; PEREIRA, W.; LOPES, C.A.; DILVA, J.B.C. Batata-doce (Ipomoea batatas (L.) Lam.). 2 ed. Braslia: EMBRAPA/ CNPH, 1989, 19 p. MIRANDA, J.E.C.; FRANA, F.H.; CARRIJO, O.A.; SOUZA, A.F.; AGUILAR, J.A.E. Cultivo da batata-doce doce (Ipomoea batatas (L.) Lam.). Braslia: EMBRAPA, 1984, 7p. MURILO, D.V. Aspectos econmicos da batatadoce. In: Encontro de professores, pesquisadores e extencionistas do Rio Grande do Norte, 4. Mossor: ESAM, 1990, p.21-28. PEIXOTO, J.R.; SANTOS, L.C.; RODRIGUES, F.A.; JULIATTI, F.C.; LYRA, J.R.M. Seleo de clones de batata-doce resistentes a insetos de solo. Pesquisa Agropecuria Brasileira. Braslia, v.34, n.3, p.385-389, 1999. SILVEIRA, M.A. Resistncia de clones de batata-doce (Ipomoea batatas (L.) Lamarck) quanto aos nematides do gnero Meloidogyne e aos insetos de solo. 1993. 41 f. (Dissertao mestrado) Universidade Federal de Lavras, Lavras. SCOTT, A.J.; KNOTT, M. A cluster analysis method for grouping means in the analysis of variance. Biometrics. Washington, v.30, p.507512, 1917. SOUZA, A.B. Avaliao de cultivares de batatadoce quanto atributos agronmicos desejveis. Cincia Agrotcnica. Lavras, v.24, n.4, p.841-845, 2000.

914

Hortic. bras., v. 23, n. 4, out.-dez. 2005

VIEGAS, E.C.; SOARES, A.; CARMO, M.G.F.; ROSSETTO, C.A.V. Toxicidade de leos essenciais de alho e casca de canela contra fungos do grupo Aspergillus flavus. Horticultura Brasileira, Braslia, v.23, n.4, p.915-919, out-dez 2005.

Toxicidade de leos essenciais de alho e casca de canela contra fungos do grupo Aspergillus flavus1
Elson de C. Viegas; Andra Soares; Margarida Gorete F. do Carmo; Claudia Antonia V. Rossetto
UFRRJ, Depto. Fitotecnia, C. Postal 74511, 23890-000 Seropdica-RJ; E-mail: cavrosse@ufrrj.br

RESUMO
Diante da propriedade inibitria de leos essenciais vegetais sobre o desenvolvimento micelial de fungos e da importncia das espcies do grupo Aspergillus flavus, que apresentam potencial para sntese de aflatoxina, este trabalho teve como objetivo avaliar in vitro a toxicidade de leos essenciais vegetais contra fungos do grupo A. flavus, isolados a partir da cultura do amendoim. Inicialmente, foi avaliada a toxicidade de oito leos essenciais vegetais no desenvolvimento micelial de dois isolados do grupo A. flavus, em comparao ao fungicida sinttico benomyl. Em seguida, foi avaliada a toxicidade dos leos de casca de canela (Cinnamomum zeilanicum Breym.) e de bulbilho de alho (Allium sativum L.) contra 37 isolados do grupo A. flavus, durante 12 meses. A maior inibio do desenvolvimento micelial de A. flavus foi obtida com o emprego dos leos essenciais de casca de canela e de bulbilho de alho, e o efeito inibitrio variou com o isolado testado.

ABSTRACT
Evaluation of essential oils from Allium sativum and Cinnamomum zeilanicum and their toxicity against fungi of the Aspergillus flavus group Considering the inhibitory property of essential plant oils on the mycelial development of fungi, and the importance of Aspergillus flavus-like fungi which may produce aflatoxins, this research was designed to evaluate the toxicity of essential oils against fungi belonging to the group A. flavus isolated from peanut crops. The toxicity of eight essential oils against two isolates of A. Flavuslike fungi was evaluated in comparison to the synthetic fungicide benomyl. The toxicity of Cinnamomum zeilanicum Breym. and Allium sativum L. essential oils was also evaluated against 37 fungal isolates for a period of 12 months. The highest inhibition of the mycelial development of A. flavus was obtained with cinnamon and garlic essential oils. The inhibitory effect on growth was variable according to the fungal isolate. Keywords: Cinnamomum zeilanicum Breym., Allium sativum L., Arachis hypogaea L.

Palavras-chave: Cinnamomum zeilanicum Breym., Allium sativum L., Arachis hypogaea L.

(Recebido para publicao em 4 de outubro de 2004 e aceito em 3 de agosto de 2005) lguns fungos dos gneros Aspergillus , Fusarium e Penicillium podem causar problemas no consumo de gros de amendoim, tanto in natura ou quando submetidos extrao de leos, diminuindo o valor nutricional e podendo produzir micotoxinas, dentre elas as aflatoxinas, sintetizadas principalmente por fungos do grupo Aspergillus flavus e que apresentam potencial para causar doenas em animais e em seres humanos (ANGLE et al., 1982; DHINGRA; COELHO NETO, 1998) . Em amendoim, a preveno da contaminao com aflatoxina tem sido obtida com uso de cultivares resistentes (BASHRA et al., 1994), com a adoo de algumas prticas que controlam a colonizao de fungos com potencial aflatoxignico, tais como calagem (ROSSETTO et al., 2003), secagem (FERNANDEZ et al., 1997) e escolha

do tipo de solo (ANGLE et al., 1982) ou que interferem na biossntese de aflatoxina (REDING; HARRINSON, 1994), e com procedimentos para a remoo dos gros contaminados com base em cor e flutuao (DICKENS; WHITAKER, 1975), ou ainda utilizando perxido de hidrognio (CLAVERO et al., 1993). O potencial para controle ps-colheita de fungos do grupo Aspergillus flavus tem sido demonstrado empregando-se produtos com propriedades fungitxicas, principalmente o benomyl (MAEDA et al., 1995; VANZOLINI et al., 2000). A literatura tambm relata a ao de extratos de alho (Allium sativum L.) (BILGRAMI et al. 1992) e de leos essenciais de capim limo (Cymbopogon citratus Stapf) a 3000 ppm em meio BDA (MISHRA; DUKEY, 1994), de manjerico (Ocimum basilicum L.) a 6,0 ml L-1 em

meio Czapek-dox gar (DUBE et al., 1989), de sementes de cenoura (Daucus carota L.) a 3000 ppm (DWIVEDI et al., 1991) e de rizomas de Nardostachys jatamansi DC a 1000 ppm em Czapekdox agar, como eficientes no controle de A.flavus. Alm destes, Mahmoud (1994) observou que citral, citronela e ulgenol impediram o crescimento de A. flavus e a produo de aflatoxina at os oito dias de incubao. Entretanto, aps 15 dias, houve incremento da produo de toxinas. Em relao a outros fungos, Mishra e Dubey (1994) constataram atividade fungitxica do leo essencial de capim limo a 1500 ppm em meio BDA sobre fungos dos gneros Penicillium, Alternaria, Fusarium e Botrytis. Mishra et al. (1995) verificaram que Fusarium oxysporum apresentou inibio de seu crescimento micelial quando submetido ao leo essencial de rizomas de

Parte da Tese de Doutorado apresentada pelo primeiro autor ao Curso de Ps-graduao em Fitotecnia, da Universidade Federal Rural do Rio de Janeiro. 915

Hortic. bras., v. 23, n. 4, out.-dez. 2005

E. C. Viegas et al.

Nardostachys jatamansi na concentrao de 1000 ppm em meio Czapek-dox gar. O objetivo deste trabalho foi avaliar in vitro a toxicidade de leos essenciais vegetais contra fungos do grupo A. flavus isolados a partir da cultura do amendoim.

MATERIAL E MTODOS
Os experimentos foram conduzidos em laboratrios da UFRRJ em 2003, empregando leos essenciais de diversas plantas, solubilizados em dimetil sulfxido (DMSO) e em metanol (MeOH), que foram fornecidos pela EMBRAPA/CTAA, aps extrao pelo mtodo do arraste do vapor, (LANGANAU, 1979) e armazenados em congelador, no perodo de 1986 a 2001. Para avaliar a toxicidade dos leos essenciais no desenvolvimento de fungos do grupo Aspergillus flavus, foi utilizado o mtodo da escavao em placas de Petri (MORAIS, 2000) contendo meio BDA (DHINGRA; SINCLAIR, 1995). Primeiramente, foram selecionados dois isolados de fungos do grupo A. flavus (T52 e T63), obtidos de sementes de amendoim, no cultivo da seca de 2001, e que estavam armazenados em leo mineral por seis meses em cmara fria. Para o preparo do inculo, estes isolados foram incubados em meio BDA a 20C por sete dias e fotoperodo de 12 horas. Em seguida foram feitas suspenses de condios em gua esterilizada e a concentrao ajustada para 10 7 condios ml -1 , com auxlio de hemacitmetro, conforme testes preliminares. Foi utilizado o delineamento inteiramente casualizado, com trs repeties, empregando-se 10 tratamentos, sendo 8 leos essenciais na dosagem de 2,0 mg ml-1 de solvente, e duas testemunhas, o solvente DMSO na dosagem de 1,0 mg ml-1 de metanol e benomyl na dosagem de 0,2 mg 20 ml-1 de gua destilada. As dosagens dos leos essenciais e do fungicida foram selecionadas em testes preliminares. Assim, para cada um dos dois isolados do fungo, foi adicionado 0,1 ml de suspenso de condios em cada placa de Petri contendo meio
916

BDA. Em seguida foram realizados trs orifcios de 7 mm com auxlio de cilindro de cobre. Nestes orifcios foram aplicados com auxlio de pipeta automtica o leo essencial, o solvente ou o fungicida sinttico, conforme o tratamento. A incubao foi realizada a 20oC e fotoperodo de 12 horas por sete dias. Aps este perodo a avaliao foi realizada com a medio do dimetro dos halos de inibio. Para confirmar os resultados foi repetido o experimento anterior, porm apenas com o isolado T52. Adotou-se o delineamento experimental inteiramente casualizado com trs repeties, empregando-se seis tratamentos, sendo quatro leos essenciais na dosagem de 2,0 mg ml-1 de solvente, e duas testemunhas, o solvente DMSO na dosagem de 1,0 mg ml-1 de metanol e benomyl na dosagem de 0,2 mg 20 ml-1 de gua destilada. A ao dos tratamentos sobre o isolado T52 foi avaliada aps incubao a 20oC e fotoperodo de 12 horas por sete dias. Os demais procedimentos foram idnticos ao anterior. A partir dos resultados observados nos dois ensaios anteriores foi realizado o terceiro ensaio, seguindo-se os mesmos procedimentos, a fim de se confirmar a toxicidade dos leos de canela (Cinnamomum zeilanicum Breym) e de alho (Allium sativum L.) em relao a diferentes isolados do grupo Aspergillus flavus. Para tanto, foi testada a ao dos leos contra 32 diferentes isolados do fungo, obtidos no cultivo de amendoim no perodo das guas de 2001. Adotouse o delineamento em blocos ao acaso, em esquema fatorial 2x32 (duas substncias e 32 isolados), e trs repeties. Por placa, foi adicionado 0,1 ml de suspenso na concentrao de 5.107 condios ml-1 de gua destilada. Em seguida, foram realizados trs orifcios de 7 mm com auxlio de cilindro de cobre. Nestes orifcios foram aplicados com auxlio de pipeta automtica, 2,0 mg de leo essencial solubilizado em 1,0 ml de solvente (DMSO + metanol). Aps sete dias de incubao a 20oC e fotoperodo de 12 horas foi realizada a medio do dimetro dos halos de inibio. Aps 12 meses de armazenamento dos extratos foi repetido o experimento anterior, adotando-se delineamento in-

teiramente casualizado em esquema fatorial 2x5 (dois leos essenciais, de alho e de canela, e cinco isolados fngicos obtidos da cultura do amendoim, no cultivo da seca de 2001), com trs repeties. Os demais procedimentos foram idnticos ao experimento anterior. Da regio central e perifrica dos halos de inibio foram retiradas, com auxilio de estilete estril, trs amostras de meio de cultura, que foram repicados para placas de Petri contendo meio BDA. Aps sete dias de incubao a 20oC e fotoperodo de 12 horas foi realizada a avaliao visual do crescimento do fungo. O efeito do leo essencial foi considerado fungisttico quando se observou crescimento do fungo aps a repicagem, e fungicida quando no houve qualquer crescimento. Os dados foram submetidos aos testes de normalidade (Lilliefors) e de homocedasticidade (BARTLEY; COCHRAN) (RIBEIRO JNIOR, 2001). Quando no foi observada a homogeneidade da varincia, os dados foram transformados para log (x). Em seguida foram realizadas as anlises de varincia e teste de Tukey ou ScottKnott, para comparao das mdias, ambos a 5% de probabilidade (PIMENTEL GOMES, 1966). Nas tabelas so apresentadas as mdias originais, sem transformao.

RESULTADOS E DISCUSSO
Entre os leos essenciais testados no primeiro teste, constatou-se com base nos dimetros dos halos de inibio formados que o isolado T63 teve o seu desenvolvimento micelial reduzido de maneira mais acentuada pelos leos de bulbilho de alho e de casca de canela. Para o isolado T52 constatou-se maior inibio pelos leos de folhas de slvia e de casca de canela. No entanto, estes leos sempre apresentaram eficincia significativamente menor que o padro fungicida. O leo de pimenta do reino no inibiu o crescimento micelial de nenhum dos dois isolados, enquanto que os de capim limo e de pimenta longa apresentaram pequena inibio apenas do isolado T52 (Tabela 1). No segundo teste, quando foram avaliados apenas os leos de slvia, alho
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Toxicidade de leos essenciais de alho e casca de canela contra fungos do grupo Aspergillus flavus

Tabela 1. Dimetros dos halos de inibio (mm) formados em culturas de fungos do grupo Aspergillus flavus, isolados de sementes de amendoim no cultivo da seca, em resposta ao emprego de leos essenciais vegetais, do solvente DMSO+metanol (50% v/v) e do fungicida Benomyl. Seropdica, UFRRJ, 2003.
Cultura/origem Nome vulgar Slvia Alho Canela Canela Capim limo Pimenta da Jamaica Pimenta do Reino Gengibre Solvente Benomyl C.V.(%) Nome cientfico Salvia officinalis L. Allium sativum L. Cinnamomum zeilanicum Breym. Cinnamomum zeilanicum Breym. Cymbopogon citratus Stapf. Pimenta officinalis Piper nigrum L. Zingiber officinale Rox. Parte utilizada Folha bulbilho Folha fresca Casca Folha Fruto Fruto Rizoma 11,7b* 4,3bc 7,3bc 10,3bc 3,7c 3,3c 0,0c 3,7bc 0,0c 35,0a 46,41 1o teste T52/semente T63/semente 0,0c 11,7bc 5,0bc 13,0b 0,0c 0,0c 0,0c 3,3bc 0,0c 20,3a 37,12 2o teste T52/semente 5,2cd 8,8bc 4,0cd 13,3b 0,0d 40,0a 37,05

*Mdias seguidas da mesma letra na coluna no diferem entre si a 5% de probabilidade.

e canela, foram confirmados os resultados relacionados inibio do crescimento do isolado T52 pelos leos essenciais de casca de canela e de bulbilho de alho (Tabela 1). Os leos essenciais de alho e de canela possivelmente possuem um princpio ativo com ao fungicida conforme constatado tambm por Bolkan et al. (1981), avaliando a toxicidade de extrato de alho sobre Fusarium monilforme e Rhizoctonia solani. Alm disso foi constatada toxicidade de extrato de leo contra Aspergillus flavus (BILGRAMI et al., 1992), Crinipellis perniciosa, Phytophthora palmivora (BASTOS, 1992), Curvularia spp., Alternaria spp. (BARROS et al., 1995) e Colletotrichum gloeosporiodes (RIBEIRO; BEDENDO, 1999). Utilizando leo essencial de alho, Chalfoun e Carvalho (1987) tambm constataram inibio do crescimento micelial de Gibberella zeae (Schw.), Alternaria zinniae Pape e Macrophomina phaseolina (Tass.) Goid. Foi constatada maior toxicidade do leo essencial de casca de canela que do de bulbilhos de alho, expressa pelos maiores halos de inibio promovidos pelo primeiro em relao ao segundo para a maioria dos isolados testados (Tabela 2). Foi observada ainda resposta diferencial dos isolados quando sensibilidade aos dois leos essenciais testados, detectada pelo teste de ScottKnott. O leo essencial de alho promoveu halos de inibio que variaram enHortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 2. Dimetros dos halos de inibio (mm) formados em culturas de fungos do grupo Aspergillus flavus isolados da cultura do amendoim no cultivo das guas, em resposta ao emprego de leos essenciais de alho e de casca de canela. Seropdica, UFRRJ, 2003.
Culturas Y27 Y82 Y62 Y75 Y11 Y5 Y48 Y10 Y19 Y8 Y43 Y36 Y100 Y67 Y29 Y52 Y59 Y13 Y113 Y12 Y54 Y128 Y66 Y88 Y50 Y65 Y111 Y80 Y73 Y99 Y104 Y130 C.V.(%) Origem Semente Semente Solo Vagem Solo Solo Vagem Solo Solo Solo Semente Vagem Vagem Solo Semente Semente Solo Solo Solo Solo Vagem Semente Solo Vagem Vagem Solo Solo Semente Vagem Semente Solo Semente Extratos Bulbilho de alho Casca de canela 12,0Bc* 22,0Aa 12,0Bc 20,0Aa 10,0Bd 20,0Aa 9,0Bd 20,0Aa 7,0Be 20,0Aa 13,0Bb 19,0Aa 12,0Bc 18,0Ab 12,0Bc 17,0Ab 12,0Bc 17,0Ab 11,0Bc 17,0Ab 10,0Bd 17,0Ab 10,0Bd 17,0Ab 15,0Aa 16,0Ab 12,0Bc 15,0Ac 11,0Bc 15,0Ac 11,0Bc 15,0Ac 11,0Bc 15,0Ac 10,0Bd 15,0Ac 10,0Bd 15,0Ac 10,0Bd 15,0Ac 10,0Bd 15,0Ac 7,0Be 15,0Ac 12,0Bc 14,0Ac 10,0Bd 14,0Ac 10,0Bd 13,0Ac 10,0Bd 13,0Ac 12,0Ac 12,0Ad 12,0Ac 12,0Ad 11,0Ac 11,0Ad 10,0Ad 10,0Ae 10,0Ad 10,0Ae 7,0Be 10,0Ae 2,13

*Mdias seguidas da mesma letra (maiscula na linha e minscula na coluna) no diferem entre si a 5% de probabilidade.
917

E. C. Viegas et al.

Tabela 3. Dimetros dos halos de inibio (mm) formados em culturas de fungos do grupo Aspergillus flavus isolados da cultura do amendoim no cultivo da seca, em resposta ao emprego de leo de alho e de canela, aps 12 meses de armazenamento. Seropdica, UFRRJ, 2003.
Culturas T2 T20 T24 T35 T55 C.V.(%) Origem Solo Semente Semente Pericarpo do fruto Pericarpo do fruto Bulbilho de alho 8,0Ba* 8,3Ba 9,5Aa 12,0Aa 8,0Ba 13,865 Casca de canela 20,0Aa 15,8Aab 9,5Ab 14,6Aab 15,0Aab

AGRADECIMENTOS
Agradecemos ao CNPq pela bolsa de PQ concedida aos dois ltimos autores.

LITERATURA CITADA
ANGLE, J.S.; DUNN, K.A.; WAGNER, G.H. Effect of cultural practices on the soil populations of Aspergillus flavus and Aspergillus parasiticus. Soil Science Society of America Journal, v.46, n.2, p.301-303, 1982. BARROS, S.T.; OLIVEIRA, N.T.; MAIA, L.C. Efeito do extrato de alho (Allium sativum) sobre o crescimento micelial e germinao de condios de Curvularia spp. e Alternaria spp . Summa Phytopathologica, Piracicaba, p.168-170, v.21, n.2, p.168-170, 1995. BASHRA, S.M. A phytoalexin and aflatoxin producing peanut seed culture system. Peanut Science, v.21, n.1, p.130-134, 1984. BASTOS, C.N. Inibio do crescimento micelial e germinao de esporos de Crinipelles perniciosa e Phytophthora palmivora por extrato de bulbo de alho (Allium sativum). Fitopatologia Brasileira, Braslia, v.17, n.4, p.454-456, 1992. BILGRAMI, K.S.; SINHA, K.K.; SINHA, A.K. Inhibition of aflatoxin production and growth of Aspergillus flavus by eugenol and onion and garlic extracts. Indian Journal of Medical Research, v.96, p.171-175, 1992. BOLKAN, H.A.; RIBEIRO, W.R.C. Efeito do extrato de alho em Cylindrocladium clavatum, Fusarium moniliforme var. s ubglutinan s e Rhizoctonia solani . Fitopatologia Brasileira, Braslia, v.6, n.1, p.565-566, 1981. CLAVERO, M.R.; HUNG, Y.; BEUCHAT, L.R.; NAKAYAMA, T. Separation of aflatoxin contaminated kernels from sound kernels by hidrogen peroxide treatment. Journal of Food Protection, v.56, n.2, p.130-133, 1993. CHALFOUN, S.M.; CARVALHO, V.D. Efeito do extrato e de leo industrial sobre o desenvolvimento de fungos. Fitopatologia Brasileira , Braslia, v.12, n.3, p.234-235, 1987. DICKENS, J.W.; WHITAKER, T.B. Efficacy of electronic color sorting and handpicking to remove aflatoxin contaminated kernels from commercial lots of shelled peanuts. Peanut Science, v.2, n.1, p.45-50, 1975. DHINGRA, O.D., COELHO NETO, R.A. Micotoxinas em gros. Reviso Anual de Patologia de Plantas, Passo Fundo, v.6, n.1, p.49-101, 1998. DHINGRA, O.D., SINCLAIR, J.B. Basic plant pathology methods. Boca Raton: Lewis Publishers. 1995. 434 p. DUKE, S.; UPADHYAY, P.D.; TRIPATHI, S.C. Antifungal, physicochemical, and insect-repelling activity of the essential oil of Ocimum basilicum. Canadian Journal Botany, v.67,n.7, p.2085-2087, 1989. DWEVIDI, S.K.; DWIVEDI, S.K.; PANDEY, V.N.; DUBEY, N.K. Effect of essential oils of some higher plants on Aspergillus flavus Link. Infesting stored seeds of guar [ Cyamopsis tetragonoloba L.(Taub.)]. Flavour and Fragrance Journal, v.6, n.4, p.295-297, 1991. Hortic. bras., v. 23, n. 4, out.-dez. 2005

*Mdias seguidas da mesma letra (maiscula na linha e minscula na coluna) no diferem entre si a 5% de probabilidade.

Tabela 4. Avaliao da atividade dos leos de alho e de casca de canela sobre isolados de fungos do grupo Aspergillus flavus, isolados da cultura do amendoim no cultivo da seca, aps 12 meses de armazenamento. Seropdica, UFRRJ, 2003.
Culturas T2 T20 T24 T35 T55 Origem Solo Semente Semente Vagem Vagem Bulbilho de alho Centro halo Periferia halo Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica Casca de canela Centro halo Fungicida Fungisttica Fungisttica Fungisttica Fungisttica Periferia halo Fungisttica Fungisttica Fungisttica Fungisttica Fungisttica

tre 7,0 e 15,0 mm. Porm para 34% dos isolados testados, estes halos foram maiores do que 12,0 mm, valor considerado por Gunatilaka et al. (1994) como ideal para testes in vitro. O leo essencial de canela proporcionou halos de inibio que variaram entre 10,0 e 22,0 mm, com valores maiores que 12,0 mm para 87% dos isolados testados. Wilson et al. (1997) constataram que o extrato do gnero Allium e o leo essencial de Cinnamomum zeilanicum demonstraram a maior atividade antifngica sobre Botrytis cinerea, em relao aos demais extratos e leos essenciais testados. Em geral, os leos foram ativos contra todos os isolados do grupo A. flavus testados, conformando ainda dos resultados de Morais (2000) que cita grande variao quanto sensibilidade de fungos a leos essenciais. Aps 12 meses de armazenamento dos leos, foi constatado maior dimetro dos halos de inibio quando se empregou o leo de casca de canela em comparao ao leo de bulbilho de alho (Tabela 3). Alm disso, quando foi aplicado o leo de casca de canela, observou-se maior dimetro de halo de inibio para T2, isolado do solo, que para o
918

T24, isolado de semente. J quando foi empregado o leo de alho no foi constatada diferena entre os isolados quanto sensibilidade, com base nos dimetros dos halos de inibio formados. Quando foi realizada a repicagem a partir da regio dos halos de inibio foi observado que, dos pontos retirados prximos ao centro, somente no houve crescimento do isolado T2 quando foi empregado o leo de casca de canela (Tabela 4). Para os demais isolados houve crescimento micelial, inclusive das amostras retiradas a partir do centro dos halos (Tabela 4). Para Mishra e Dubey (1994), o potencial antifngico por longa durao facilita o isolamento futuro dos componentes dos leos. Pode-se concluir que a maior inibio relativa, in vitro, do desenvolvimento micelial de A. flavus foi obtida com o emprego dos leos essenciais de bulbilho de alho e principalmente, de casca de canela. Existe variabilidade na populao do fungo quanto sensibilidade aos leos. Novos estudos so necessrios a fim de se comprovar a eficincia destas substncias no controle de Aspergillus flavus em sementes destinadas ao consumo ou semeadura.

Toxicidade de leos essenciais de alho e casca de canela contra fungos do grupo Aspergillus flavus FERNANDEZ, E.; ROSOLEM, C.A.; MARINGONI, A.C.; OLIVEIRA, D.M.T. Fungus incidence on peanut grains as affected by drying method and Ca nutrition. Field Crops Research, v.52, n.1, p.9-15, 1997. LANGANAU, I.E.E. The essential oils . Huntington. New York, 1979, v.1, 227 p. MAEDA, J.A; LAGO, A.A.; GERIN, M.A.N. Tratamento com fungicida no comportamento de sementes de amendoim. Bragantia, Campinas, v.54, n.1, p.103-111, 1995. MAHMOUD, A.L.E. Antifungal action and antiaflatoxigenic properties of some essencial oil constituents. Letters in Applied Microbiology, v.19, p.110-113, 1994. MISHRA, D.; CHATURVEDI, R.D.; TRIPATHI, S.C. The fungitoxic effect of the essential oil of the herb Nardostachys jatamansi DC Tropical Agriculture, v.72, n.1, p.48-52,1995. MISHRA, D.; DUBEY, N.K. Evaluation of some essential oils for their toxicity against fungi causing deterioration of stored food commodities. Applied and Environmental Microbiology, v.60, n.4, p.1101-1105, 1994. MORAIS, L.A.S. Atividade antimicrobiana de extratos de algumas plantas medicinais sobre fitopatgenos do tomateiro (Lycopersicon esculentum Mill.) . 2000. 109 f. Dissertao (Mestrado em Fitotecnia) - Universidade Federal Rural do Rio de Janeiro, Seropdica. PIMENTEL GOMES, J.I. Curso de estatstica experimental. So Paulo. Nobel, 1996. 404 p. REDING, C.L.C.; HARRINSON, M.A. Possible relationship of succinate dehydrogenase and fatty acid syntetase activities to Aspergillus parasiticus growth and aflatoxin production. Mycopathologia, v.127, n.3, p.175-181, 1994. RIBEIRO JNIOR, J.I. Anlises estatsticas no SAEG. Viosa. UFV, 2001. 301 p. RIBEIRO, L.F.; BEDENDO, I.P. Efeito inibitrio de extratos vegetais sobre Colletotrichum gloeosporioides agente causal da podrido de frutos de mamoeiro. Scientia Agricola, Piracicaba, v.56, n.4, p.90-101, 1999. ROSSETTO, C.A.V.; LIMA, T.M.; VIEGAS, E.C. Contaminao fngica do amendoim em funo das doses de calcrio e das pocas de amostragem. Bragantia, Campinas, v.62, n.3, p.437-415, 2003. WILSON, C.L.; SOLAR, J.M.; El-GHAOUTH, A.; WISNIEWSKI, M.E. Rapid evaluation of plant extracts and essential oils for antifungal activity against Botrytis cinerea. Plant Disease, v.81, n.2, p.204-210, 1997. VANZOLINI, S.; TORRES, R.M.; PANIZZI, R.C. Efeito do tamanho, da densidade e do tratamento fungicida sobre a qualidade de sementes de amendoim. Revista Ceres, Viosa, v.47, n.274, p.603-612, 2000.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

919

BERNARDI, A.C.C.; VERRUMA-BERNARDI, M.R.; WERNECK, C.G.; HAIM, P.G.; MONTE, M.B.M. Produo, aparncia e teores de nitrognio, fsforo e potssio em alface cultivada em substrato com zelita. Horticultura Brasileira, Braslia, v.23, n.4, p.920-924, out-dez 2005.

Produo, aparncia e teores de nitrognio, fsforo e potssio em alface cultivada em substrato com zelita
Alberto C.C. Bernardi1; Marta R. Verruma-Bernardi2; Carlos G. Werneck3; Patrick G. Haim3; Marisa B.M. Monte4
1

Embrapa Solos/Embrapa Pecuria Sudeste, C.Postal 339, 13560-970 So Carlos-SP; E-mail: alberto@cppse.embrapa.br; 2UFF, Depto. Nutrio e Diettica e UFSCar, Depto. Tecnologia Agroindustrial e Scio-Economia Rural, Araras-SP; E-mail: verruma@cca.ufscar.br; 3 UFRRJ, Engenharia Agronmica, Seropdica-RJ; 4CETEM/MCT, Rio de Janeiro-RJ

RESUMO
Neste trabalho foi avaliado e relaciondar a produo, teores de N, P e K e a aparncia de alface cultivada em substrato com zelita enriquecida com N, P e K. Os tratamentos utilizados foram quatro nveis (20; 40; 80 e 160 g/vaso) de zelitas enriquecidas com H3PO4/ apatita, KNO3 e KH2PO4, alm de uma testemunha cultivada em soluo nutritiva. Avaliou-se a produo da alface e os teores de N, P e K no tecido da parte area. O teste de ordenao foi utilizado para comparar a aparncia das amostras. A alface cultivada em meio com zelita enriquecido com fontes de fsforo apresentou maior produo e qualidade visual equivalente alface testemunha, cultivada em soluo nutritiva. Houve correlaes significativas entre os teores de N e os atributos sensoriais cor e tamanho, e entre os teores de P e o tamanho das plantas. A anlise sensorial foi uma ferramenta adequada para avaliar a qualidade da alface.

ABSTRACT
Yield, appearance and content of nitrogen, phosphorus and potassium in lettuce grown in substrate with zeolite In this research we evaluated and related yield and tissue levels of N, P and K in shoot tissues and appearance of lettuce plants grown in a substrate with N, P and K enriched with zeolite. Treatments comprised of four levels (20; 40; 80 and 160 g/pot) of zeolite enriched with H3PO4/apatite, KNO3 and KH2PO4, and a control grown in a nutrient solution. Lettuce yield and N, P and K levels in the shoot tissues were evaluated. Ordering test was carried out to compare the appearance of the samples. Lettuces grown in substrate with zeolite enriched with phosphorus sources showed higher yield, and equivalent visual quality in comparison with the control. There were significant correlations between N level in tissues and the sensory attributes of plant color and size, and between the P levels and the size of the plant. The sensory analysis of the appearance was an adequate tool to identify the quality of lettuce. Keywords: Lactuca sativa, stilbite, sensory analysis, preference test.

Palavras-chave: Lactuca sativa, estilbita, anlise sensorial, teste de ordenao.

(Recebido para publicao em 4 de outubro de 2004 e aceito em 5 de agosto de 2005) alface a mais popular das hortalias folhosas e seu consumo ocorre principalmente na forma natural. Assim, o aumento da produo dessa hortalia necessrio devido ao aumento do consumo, funo da crescente elevao populacional e da mudana no hbito alimentar do consumidor, em razo da conscientizao sobre a importncia nutricional das hortalias (CORTEZ et al., 2002). importante alimento para a sade humanas, por ser fonte de vitaminas e de sais minerais, alm de apresentar baixo valor calrico. Com a tendncia de crescimento do mercado hortcola, os produtores tm adotado novos sistemas de cultivo, como os protegidos (tneis e estufas) e o hidropnico, em alternativa ao sistema tradicional a campo. Existe ainda uma nova possibilidade que o cultivo zeopnico, no qual plantas so cultivadas em substrato artificial composto
920

pelo mineral zelita misturados a rochas fosfticas, e que funciona como um sistema de liberao controlada e renovvel de nutrientes para as plantas. Este mineral apresenta trs propriedades principais, que conferem grande interesse para uso na agricultura pela alta capacidade de troca de ctions, alta capacidade de reteno de gua livre nos canais e alta habilidade na adsoro. Assim, a zelita pode atuar na melhoria da eficincia do uso de nutrientes por meio do aumento da disponibilidade de P da rocha fosftica, na melhora do aproveitamento do N (NH4+ e NO3-) e reduo das perdas por lixiviao dos ctions trocveis, especialmente K+ e tambm como um fertilizante de liberao lenta (ALLEN et al . , 1995; NOTARIO-DEL-PINO et al., 1994; BARBARICK et al., 1990). No entanto, no bastam alternativas viveis para o aumento quantitativo da

produo e a manuteno do fornecimento o ano todo, pois o consumidor de hortalias tem se tornado mais exigente, havendo necessidade de se obter principalmente produtos de qualidade. A qualidade final de um produto agrcola resultado de diversos fatores, entre estes os nveis de fornecimento de nutrientes. A qualidade a soma de todas caractersticas combinadas que produzam uma hortalia com valor nutritivo, aceitvel e desejvel como alimento humano. A aparncia externa das hortalias de grande importncia, uma vez que o consumidor somente adquire o produto mais atrativo. A anlise sensorial pode ser uma ferramenta adequada para avaliar a qualidade ou aparncia externa das hortalias. Esta tcnica utilizada para medir, analisar e interpretar de forma rpida e criteriosa os atributos fsicos e qumicos dos alimentos atravs da percepo
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produo, aparncia e teores de nitrognio, fsforo e potssio em alface cultivada em substrato com zelita

pelos sentidos da viso, olfato, tato, audio e gustao (MATTHHEIS; FELLMAN, 1999; MEILGAARD et al., 1988; AMERINE et al., 1965). Esta avaliao baseia-se em tcnicas que so fundamentais na percepo psicolgica e fisiolgica, sendo que o grau de apreciao de um produto alimentcio est ligado a um processo subjetivo. O sentido da viso se antecipa na percepo a todas as outras informaes, e possibilita aquisio de informaes sobre aspectos do alimento como estado, tamanho, forma, textura e cor (DUTCOSKY, 1996). Resultados obtidos por Siomos et al. (2001) mostraram que com a avaliao da qualidade visual foi possvel a diferenciao de alfaces produzidas em diferentes substratos de cultivo. O objetivo deste trabalho foi avaliar e relacionar a produo, teores de N, P e K e a aparncia de alface cultivada em substrato com zelita enriquecida com N, P e K.

MATERIAL E MTODOS
O experimento foi conduzido em casa-de-vegetao, em vasos com 3 kg de substrato inerte, composto de areia lavada com gua destilada e cido clordrico diludo (3:1 v:v). A zelita utilizada foi coletada na Bacia do Parnaba, no Maranho, onde se localiza o principal depsito de zelita natural do Pas, com grande potencial de aproveitamento econmico (REZENDE; ANGLICA, 1991). O material coletado foi concentrado em mesa vibratria, resultando em um produto com 84% de zelita estilbita e com capacidade de troca de ctions de 2,5 cmolc g-1. A frmula qumica determinada da zelita foi: (CaO)0,82 (Na2O)0,19 (K2O)0,15 (MgO)0,56 (Fe2O3)0,30 (TiO2)0,11 (Al2O3)1,85 (SiO2)16 (H 2O) 4,7. A zelita concentrada foi enriquecida por meio da incubao com solues contendo H3PO4 1 mol L-1 (ZP), KNO3 0,5 mol L-1 (ZNK) e K2HPO4 1 mol L-1 (ZPK). A relao utilizada foi de 1:40 por 24 horas, com temperatura e agitao constantes. Aps a incubao, a suspenso foi filtrada e o material slido desidratado a 100 oC. A zelita enriquecida com H3PO4 recebeu, ainda, a adio de fosfato natural (34% de P2O5) na proporo de 2:1 na base de massa.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

O delineamento experimental foi em blocos ao acaso, com trs repeties. Utilizaram-se 11 tratamentos: Z20, Z40, ZP20, ZP40, ZP80, ZP160, ZNK40, ZNK80, ZPK20, ZPK40, e a testemunha (sem adio de zelita). As doses e concentraes de nutrientes em cada tratamento esto na Tabela 1. A zelita apresentava traos de outros elementos, entre eles o fsforo, razo pela qual o material concentrado apresentou uma pequena porcentagem de P disponvel. A testemunha recebeu todos os nutrientes necessrios para o desenvolvimento das plantas por meio de uma soluo nutritiva, com a composio (mg L-1): N = 210; P = 31; K = 234; Ca = 200; Mg = 48; S = 65; B = 0,5; Cu = 0,02; Fe = 5,0; Mn = 0,5; Zn = 0,2, e Mo = 0,02. O preparo dessa soluo foi feito segundo Sarruge (1975). O fornecimento foi realizado em quatorze aplicaes de 150 ml de soluo nutritiva por vaso com duas plantas, totalizando 2,1 L por vaso. As aplicaes ocorreram ao longo de todo ciclo de cultivo, sendo que na primeira semana de cultivo o intervalo de fornecimento foi de trs dias, e nas seguintes o intervalo foi de 1 dia. Nos dias em que no se forneceu soluo, as plantas receberam gua da irrigao. Quando a zelita utilizada no possua um dos macronutrientes em teste, N, P ou K, este era adicionado na forma de soluo, na mesma concentrao fornecida testemunha. Desse modo todos os tratamentos receberam as mesmas quantidades de Ca, Mg, S, B, Cu, Fe, Mn, Mo e Zn. Os tratamentos foram iniciados em 26/06/2003, com o transplante para os vasos de cultivo, de duas mudas da alface cv. Regina, aos 30 dias aps a germinao. Ao final de 30 dias de cultivo, ambas plantas de cada vaso foram avaliadas com relao aparncia, produo e teores de nutrientes na parte area. A anlise da aparncia foi realizada pelo teste de ordenao de preferncia (ABNT, 1994), utilizando-se 53 provadores no treinados. O teste foi aplicado para os atributos de cor, tamanho e presena de leses e para a preferncia de compra. Os provadores atriburam notas de 1 a 11, de modo que o tratamento que apresentasse cor mais intensa, maior tamanho, menos leses e

fosse o preferido para ser comprado, receberia as menores notas. Em seguida foram realizadas avaliaes da produo e dos teores dos macronutrientes N, P e K na parte area das alfaces. A parte area das plantas foi colhida e pesada e, em seguida seca a 65oC em estufa de circulao forada de ar. Foram realizadas determinaes, na matria seca, dos teores totais de N, no extrato da digesto sulfrica e determinados pelo mtodo semi-micro Kjeldhal. Tambm foram feitas determinaes de P e K, no extrato da digesto nitro-perclrica e determinados por espectrometria de plasma induzido (ICP-OES) e fotometria de chama, respectivamente, de acordo com a metodologia de Carmo et al. (2000). A interpretao dos resultados dos atributos (cor, tamanho, presena de leses, e preferncia de compra) foi realizada por meio do teste de Friedman, utilizando-se a tabela de Newel e MacFarlane, conforme ABNT (1994). Os resultados de produo e teores de N, P e K foram analisados estatisticamente utilizando-se a anlise de varincia e teste de Tukey (5%). Estabeleceuse o coeficiente de correlao de Pearson (r), entre as mdias de produo e teores de nutrientes e a somatria das notas dos atributos.

RESULTADOS E DISCUSSO
Os melhores tratamentos para produo das alfaces (peso fresco) foram ZP40, ZP20, ZP80 e ZPK20, no havendo diferenas significativas entre eles (Tabela 2). Porm, foram significativamente maiores que a produo obtida com a testemunha, que recebeu todos os nutrientes de forma balanceada por meio de soluo nutritiva, sendo que estes valores representam aumentos de 56; 46; 39 e 30%, respectivamente. Os resultados indicam o potencial, para o cultivo desta hortalia, da utilizao da zelita acidificada e em mistura com apatita (tratamentos ZP) nas doses de 20; 40 e 80 g do material por vaso. Outro aspecto interessante que as produes obtidas com a zelita acidificada em mistura com a apatita foram equivalentes obtida com a zelita enriquecida com uma fonte solvel de fsforo (KH2PO4).
921

A. C. C. Bernardi et al.

Tabela 1. Tratamentos utilizados em funo dos nutrientes adicionados zelita, dose de zelita por vaso e quantidade de nutrientes fornecidas. So Carlos, Embrapa Solos, 2004.
Tratamentos Enriquecimento Z 20 Z 40 ZP 20 ZP 40 ZP 80 ZP 160 ZNK 40 ZNK 80 ZPK 20 ZPK 40 zelita concentrada zelita concentrada zelita + H3PO4 + apatita zelita + H3PO4 + apatita zelita + H3PO4 + apatita zelita + H3PO4 + apatita zelita + KNO3 zelita + KNO3 zelita + KH2PO4 zelita + KH2PO4 Concentrao* (mg kg-1) N (N-NO 3) 0,1 0,1 0,2 0,2 0,2 0,2 93796 93796 0,1 0,1 P 17 17 130 7130 7130 7130 17 17 11289 11289 K 3,9 3,9 3,9 3,9 3,9 3,9 15210 15210 41925 41925 Zelita (g por vaso) 20 40 20 40 80 160 40 80 20 40 Quantidade fornecida pela zelita (mg/vaso) N (N-NO 3) 0,002 0,004 0,004 0,008 0,016 0,032 3752 7504 0,002 0,004 P 2O 5 0,78 1,56 327 653 1306 2612 1,56 3,11 517 1034 K2O 0,09 0,19 0,09 0,19 0,38 0,75 733 1466 1010 2021

* Extrados em pasta de saturao (Embrapa, 1997).

Tabela 2. Produo (peso fresco) e teores de N, de P e de K de alfaces cultivadas em substrato com zelitas. Mdia de trs repeties. So Carlos, Embrapa Solos, 2004.
Tratamentos Z 20 Z 40 ZP 20 ZP 40 ZP 80 ZP 160 ZNK 40 ZNK 80 ZPK 20 ZPK 40 Testemunha Teste F CV%
(1)

Produo (g por vaso) 190,90 def 162,83 296,74a 315,89a 283,30ab 220,83 cde 160,14 180,91 f ef f

Teores (g kg-1) N 24,69 de 26,65 bcde 30,19abcd 32,15abc 32,06abc 31,17abc 21,28 33,55a 32,67ab 26,09 cde 10,54* * * 7,30 6,15 e 26,93 bcde P 2,30 d 2,37 d 4,52 bc 5,70ab 6,02ab 5,80ab 2,97 cd 2,83 cd 6,07ab 7,13a 2,55 d 24,66* * * 14,44 1,85 K 34,97 33,70 37,17 35,47 33,90 35,47 33,00 34,50 32,33 36,27 35,13 0,69N.S. 8,52 -

263,55abc 239,25 bcd 202,61 def 24,38* * * 8,40 56,11

DMS(2)

Mdias seguidas de letras diferentes diferem significativamente pelo teste de Tukey a 5%. (1) CV% = coeficiente de variao; (2)DMS = diferena mnima significativa. *, **, *** indicam significncia para p < 0,05; 0,01; e 0,001, respectivamente. N.S. indica no significativo.

Estes resultados esto em concordncia com os de Allen et al. (1995) que concluram que uma mistura adequada da zelita clinoptilolita e rocha fosftica da Carolina do Norte foi eficiente para o cultivo intensivo de trigo (Tritticum aestivum cv. Coker). Barbarick et al. (1990) tambm verificaram que a combinao de zelita e rocha fosftica pode ser um eficiente fornecedor de fsforo para as plantas, desde que outros elementos essenciais no sejam limitantes. Os resultados da Tabela 2 tambm indicam que os demais tratamentos (ZPK40; ZP160; Z20; ZNK80; Z40 e
922

ZNK40) apresentaram produes (peso fresco) estatisticamente equivalentes testemunha. Estes resultados demonstram, assim, o potencial para utilizao do mineral zelita enriquecida, como fonte de nutrientes para esta hortalia folhosa. Confirmando os resultados obtidos por Notario-Del-Pino et al. (1994) e Williams e Nelson (1997) com alfafa e crisntemo, respectivamente. A anlise de tecidos vegetais uma medida direta da disponibilidade de nutrientes no substrato de cultivo, pois os resultados correspondem quantidade de nutriente absorvida pelas plantas.

Desta forma, o teor de nutrientes nos tecidos vegetais reflete sua real disponibilidade, pois existe uma relao entre o fornecimento de um nutriente pelo substrato de cultivo ou por um fertilizante e a concentrao nas folhas, e uma relao entre essa concentrao e a produo da cultura. Tal tcnica pode estar sujeita a algumas limitaes tais como pocas de amostragem, interpretao, contaminao da amostra, deficincias e excessos de nutrientes (MALAVOLTA et al. 1997). Os teores de nitrognio na parte area da alface (Tabela 2) foram significativamente maiores, nos tratamentos ZPK40 e ZPK20, aos quais foram adicionados o KH 2PO 4. Provavelmente houve uma interao positiva entre o fornecimento de fsforo no substrato de cultivo, e a absoro de nitrognio pelas plantas de alface. Estes teores, assim como os dos tratamentos ZP40; ZP80 e ZP160, podem ser considerados adequados, adotando-se a faixa de 31 a 40 g kg -1 , proposta por Reuter e Robinson (1997). Nos demais tratamentos no foram observadas diferenas significativas em relao testemunha, cultivada com soluo nutritiva, e esto todos abaixo da faixa adequada (REUTER; ROBINSON, 1997). Challinor et al. (1995) tambm haviam observado baixos teores de nitrognio em cravo cultivado em substrato com zelita. Os teores de nitrognio na parte area observados neste estudo foram inferiores aos de Fernandes et al. (2002), que encontraram o valor mdio de 47 g
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produo, aparncia e teores de nitrognio, fsforo e potssio em alface cultivada em substrato com zelita

kg-1 para a cultivar Regina cultivada em sistema hidropnico. Observa-se na Tabela 2 que os teores de fsforo na parte area das plantas de alface foram significativamente maiores que a testemunha, nos tratamentos ao qual foi adicionado zelita uma fonte do nutriente, na forma de KH2PO4 (ZPK40; ZPK20) ou na forma de apatita (ZP80; ZP160; ZP40; ZP20). Nestes tratamentos, as concentraes encontradas na parte area esto dentro da faixa (4 a 6 g kg-1) considerada como adequada para a cultura (REUTER; ROBINSON, 1997). No entanto so inferiores aos teores estabelecidos por Fernandes et al. (2002), que encontraram valores de 8,5 g kg-1. Estes valores evidenciam a maior disponibilidade do macronutriente fsforo no substrato que recebeu o mineral zelita enriquecida com apatita. Notario-Del-Pino et al. (1994), em um experimento em casa-de-vegetao com alfafa, compararam o fornecimento de fsforo e potssio, atravs da zelita (phillipsita) com o KH2PO4, e confirmaram o aumento dos teores deste nutriente na planta. Os resultados do presente estudo indicaram que os teores de potssio no diferiram significativamente em funo dos tratamentos utilizados (Tabela 2). Esta ausncia de diferenas entre as fontes de fornecimento do nutriente tambm foi observada por Challinor et al. (1995) em cravo. Diferentemente, Williams e Nelson (1997) observaram em crisntemo, que as plantas cultivadas em substrato com zelita enriquecida com potssio, apresentaram maiores teores que as testemunhas que receberam fertilizantes na forma solvel. Os resultados da concentrao de potssio, nos tecidos da parte area, foram menores que o valor mdio de 71 g kg-1 encontrado por Fernandes et al. (2002) para a mesma cultivar de alface utilizada neste estudo. Tambm esto abaixo da faixa adequada (50 a 80 g kg-1) proposta por Reuter e Robinson (1997). A aparncia o atributo que mais causa impacto na escolha por parte do consumidor e dentro desta, a cor a caracterstica mais relevante. Isto porque a cor caracteriza sobremaneira o produto, constituindo-se no primeiro critrio para sua aceitao ou rejeio. A apaHortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 3. Somatrio das notas das alfaces pelos 53 provadores no treinados. So Carlos, Embrapa Solos, 2004.
Tratamentos Z 20 Z 40 ZP 20 ZP 40 ZP 80 ZP 160 ZNK 40 ZNK 80 ZPK 20 ZPK 40 Testemunha Cor 304,ab 367, b 307,ab 276,ab 255,ab 243,a 436, b 296,ab 272,ab 310,ab 356, b Tamanho 489, c 445, c 253,ab 195,a 203,a 183,a 513, c 321, b 272,ab 290,ab 319, b Leses 277, b 316, b 302, b 341, b 296, b 322, b 436, c 239,ab 192,ab 374, b 162,a Preferncia 354, b 367, b 321,ab 295,ab 234,a 282,ab 504, c 250,ab 267,ab 383, b 222,a

Valores seguidas de letras diferentes diferem estatisticamente pelo teste de Friedman. Diferena mnima = 112.

Tabela 4. Coeficientes de correlao de Pearson (r) entre as mdias dos pesos fresco, teores de N, P e K e o somatrio das notas dos atributos de cor, tamanho, presena de leses e preferncia de compra. So Carlos, Embrapa Solos, 2004.
Cor Peso fresco Teor N Teor P Teor K
* ** ***

Tamanho -0,789* * -0,860* * * -0,752* * -0,370


N.S.

Leses -0,062N.S. -0,168 0,191 0,116


N.S. N.S. N.S.

Preferncia -0,416N.S. -0,519N.S. -0,188N.S. -0,112N.S.

-0,539N.S. -0,803* * -0,624* -0,252


N.S.

, , indicam significncia para p < 0,05; 0,01; e 0,001, respectivamente. N.S. indica no significativo.

rncia geral e a cor esto relacionadas com a qualidade, ndice de maturao e deteriorao do produto. O consumidor espera uma determinada cor para cada alimento e qualquer alterao nesta, pode diminuir sua aceitabilidade (DELLA-MODESTA, 1994). Na Tabela 3 esto a soma das notas atribudas s alfaces pelos 53 provadores que participaram do teste de preferncia. Observou-se que o atributo cor foi o que apresentou menores variaes entre os tratamentos. As maiores diferenas observadas foram no tamanho e na presena (ou ausncia) de leses. O teste de preferncia pode ser considerado como uma das mais importantes etapas da anlise sensorial, pois representa o somatrio de todas as percepes sensoriais e expressa o julgamento, por parte do consumidor, sobre a qualidade do produto (DUTCOSKY, 1996). Os resultados deste teste indicaram que a alface preferida foi a testemunha, cujos nutrientes foram fornecidos em quantidades adequadas atravs

de soluo nutritiva, e a alface obtida no substrato com o tratamento ZP80 (zelita + apatita, na dose de 80 g por vaso). Os outros tratamentos ZP (160; 40 e 20), ZNK80 e ZPK20 tambm obtiveram alta preferncia de compra pelos provadores. Os resultados de Siomos et al. (2001) tambm mostraram que a avaliao visual da aparncia foi adequada para diferenciar alface obtida em diferentes substratos. Os coeficientes de correlao de Pearson (r) entre as mdias dos pesos fresco, teores de N, P e K e o somatrio das notas dos atributos de cor, tamanho, presena de leses e preferncia de compra esto na Tabela 4. Observaram-se correlaes significativas (r = -0,79**) entre a mdia peso fresco da alface e o somatrio das notas dadas pelos provadores para o atributo tamanho. O coeficiente negativo justifica-se pelo fato de que o tratamento que aparentava ser o de maior tamanho recebeu a menor nota, estabelecendo-se assim a correlao negativa.
923

A. C. C. Bernardi et al.

Houve tambm correlaes significativas e negativas entre os teores de nitrognio na parte area das plantas e as notas dos atributos cor (r = -0,80**) e tamanho (r = -0,86***). Isso justificvel em funo das funes fundamentais que este nutriente exerce no metabolismo vegetal. O nitrognio constituinte de todas as protenas e cidos nuclecos da planta e tambm o teor deste macronutriente nas folhas um dos fatores que determina o contedo de clorofila (MENGEL; KIRKBY, 1982; MARSCHNER, 1995; MALAVOLTA et al., 1997). Por isso, nos tratamentos onde houve maior disponibilidade de nutriente, as plantas apresentaram cor mais verde, mais intensa e maior tamanho. O teor de fsforo das folhas da parte area da alface correlacionou-se significativamente (r = -0,75**) com o atributo sensorial de tamanho avaliado pelos provadores. A explicao que o P, nos vegetais, um componente dos fosfolipdeos da membrana, dos acares fosforilados e das protenas, tambm parte integrante do DNA (acido desoxiribonucleco), RNA (cido ribonucleico), ATP (adenosina 5trifosfato); PEP (fosfoenolpiruvato), NADPH (nicotinamida adeninadinucleotdeo difosfato) e outros compostos bioqumicos que utilizam o fosfato como armazenamento de energia (MENGEL; KIRKBY, 1982; MARSCHNER, 1995; MALAVOLTA et al., 1997). Como vrios processos metablicos vitais dependem desse suprimento de energia, a nutrio adequada deste nutriente vai interferir diretamente sobre a sntese de protenas e de cidos nuclecos, e conseqentemente influenciar o crescimento das plantas, como mostraram os resultados. No houve correlaes significativas entre os teores de K os atributos sensoriais avaliados. Os resultados mostraram que o uso das zelita pode ser uma fonte eficiente

de nutrientes N, P e K. A alface cultivada em meio com zelita apresentaram maior produo e qualidade visual equivalente alface testemunha, cultivada em soluo nutritiva. Houve correlaes significativas entre os teores de N e os atributos sensoriais cor e tamanho, e entre os teores de P e o tamanho. A anlise sensorial foi uma ferramenta adequada para avaliar a qualidade da alface.

AGRADECIMENTOS
FINEP atravs do CT Mineral, pelo financiamento do trabalho. Aos Drs. Nlio G.A.M. Rezende, da CPRM; Hlio Salim de Amorim e Fernando de Souza Barros, da UFRJ; e Paulo Renato Perdigo Paiva, do CETEM.

LITERATURA CITADA
ALLEN, E.; MING, D.; HOSSNER, L.; HENNINGER, D.; GALINDO, C. Growth and nutrient uptake of wheat in a clinoptilolitephosphate rock substrate. Agronomy Journal , Madison, v.87, n.6, p.1052-1059, 1995. AMERINE, M.A.; PANGBORN, R.M.; ROESSLER, E.B. Principles of sensory evaluation of food. New York: Academic Press, 1965. 802 p. ASSOCIAO BRASILEIRA DE NORMAS TCNICAS. Teste de ordenao em anlise sensorial: NBR 13170, Rio de Janeiro, 1994. 76 p. BARBARICK, K.A.; LAI, T.M.; EBERL, D.D. Exchange fertilizer (phosphate rock plus ammonium-zeolite) effects on sorghumsudangrass. Soil Science Society of America Journal, v.54, n.3, p.911-916, 1990. CARMO, C.A.F.S.; ARAJO, W.S.; BERNARDI, A.C.C.; SALDANHA, M.S. Mtodos de anlise de tecidos vegetais utilizados na Embrapa Solos. Rio de janeiro: Embrapa Solos, 2000. 41 p. (Embrapa Solos. Circular Tcnica, 6). CHALLINOR, P.F.; PIVERT, J.M.; FULLER, M.P.; LE-PIVERT, J.M.; ADAMS, P.; HIDDING, A.P.; KIPP, J.A.; SONNEVELD, C.; KREIJ, C. The production of standard carnations on nutrientloaded zeolite. Acta Horticulturae, v.401, p.293299, 1995. CORTEZ, L.A.B; HONRIO, S.L.; NEVES FILHO, L.C.; MORETTI, C.L. Importncia do resfriamento para frutas e hortalias no Brasil. In: CORTEZ, L.A.B.; HONRIO, S.L.; MORETTI, C.L. Resfriamento de frutas e hortalias. Braslia: Embrapa Informao Tecnolgica. 2002. p.17-35.

DELLA-MODESTA, R.C. Manual de anlise sensorial de alimentos e bebidas. Rio de Janeiro: EMBRAPA-CTAA, 1994. 67 p. DUTCOSKY, S.D. Anlise sensorial de alimentos. Curitiba: Editora Champagnat, 1996. 123 p. EMBRAPA. Centro Nacional de Pesquisa de Solos. Manual de mtodos de anlise de solo. Rio de Janeiro: EMBRAPA/CNPS, 1997. 212 p. (EMBRAPA-CNPS. Documentos, 1). FERNANDES, A.A.; MARTINEZ, H.E.P.; PEREIRA, P.R.G.; FONSECA, M.C.M. Produtividade, acmulo de nitrato e estado nutricional de cultivares de alface, em hidroponia, em funo de fontes de nutrientes. Horticultura Brasileira, Braslia, v.20, n.2, p.195-200, 2002. MALAVOLTA, E.; VITTI, G.C.; OLIVEIRA, S.A. Avaliao do estado nutricional das plantas: princpios e aplicaes. 2.ed. Piracicaba: POTAFOS, 1997. 319 p. MARSCHNER, H. Mineral nutrition of higher plants. New York: Academic Press, 1995. 889 p. MATTHHEIS, J.P.; FELLMAN, J.K. Preharvest factors influencing flavor of fresh fruit and vegetables. Postharvest Biology and Technology, v.15, p.227-232, 1999. MEILGAARD, M.; CIVILLE, G.V.; CARR, B.T. Sensory evaluation techniques. 2. ed. Boca Raton: CRC Press, 1988. 281 p. MENGEL, K.; KIRKBY, E.A. Principles of plant nutrition. 3.ed. Bern: International Potash Institute, 1982. 655 p. NOTARIO-DEL-PINO, J.S.; ARTEAGAPADRON, I.J.; GONZALEZ-MARTIN, M.M.; GARCIA-HERNANDEZ, J.E. Response of alfalfa to a phillipsite-based slow-release fertilizer. Communications in Soil Science and Plant Analysis, New York, v.25, n.13-14, p.2231-2245, 1994. REUTER, D.J.; ROBINSON, J.B. Plant analysis: an interpretation manual. 2.ed. Sydney: Inkata Press.1997. 572 p. REZENDE, N.G.A.M.; ANGLICA, R.S. Sedimentary zeolites in Brazil. Mineralogica et Petrographica Acta, v.42, p.71-82, 1991. SARRUGE, J.R. Solues nutritivas. Summa Phytopatologica, Piracicaba, v.1, p.231-3, 1975. SIOMOS, A.S.; BEIS, G.; PAPADOPOULOU, P.P.; NASI, P.; KABERIDOU, I.; MALOUPA, E.; GERASOPOULOS, D. Aerial biomass, root biomass and quality of four lettuce cultivars grown hydroponically in perlite and pumice. Acta Horticulturae, n.548, p.437-443; 2001. WILLIAMS, K.A.; NELSON, P.V. Using precharged zeolite as a source of potassium and phosphate in a soilless container medium during potted chrysanthemum production. Journal of the American Society for Horticultural Science, v.122, n.5, p.703-708; 1997.

924

Hortic. bras., v. 23, n. 4, out.-dez. 2005

OLIVEIRA, A.P.; OLVEIRA, M.R.T.; BARBOSA, J.A.; SILVA, G.G.; NOGUEIRA, D.H.; MOURA, M.F.; BRAZ, M.S.S. Rendimento e qualidade de razes de batata-doce adubada com nveis de uria. Horticultura Brasileira, Braslia, v.23, n.4, p.925-928, out-dez 2005.

Rendimento e qualidade de razes de batata-doce adubada com nveis de uria


Ademar P. de Oliveira1; Mrcia Roseane T. de Oliveira2; Jos A. Barbosa2; Geomar G. da Silva2; Dijauma H. Nogueira2; Mcio F. de Moura2; Maria do Socorro S. Braz2
UFPB, CCA, C. Postal 02, 58397-000 Areia-PB; Bolsista produtividade em pesquisa CNPq; E-mail: ademar@cca.ufpb.br, 2UFPB, Progr. Ps-graduao, 58397-000 Areia-PB
1

RESUMO
Estudos que visem o aumento do rendimento e da qualidade de razes da batata-doce, podem se constituir em importantes ferramentas para melhorar a condio scio-econmica da regio Nordeste, pelo fato desta ser uma das hortalias de grande importncia nessa regio. Com o objetivo de avaliar o efeito de nveis de uria no rendimento e qualidade de razes comerciais de batata-doce, cultivar Rainha Branca, instalou-se um experimento de julho a novembro/ 2003, na UFPB, em Areia. O delineamento experimental foi blocos casualizados com cinco tratamentos (0; 115; 230; 345 e 460 kg ha-1) de uria, em adubao de cobertura aos 30 e 60 dias aps o plantio, em quatro repeties. Utilizaram-se parcelas teis com 28 plantas, espaadas de 0,80 x 0,30 m. A produo de razes comerciais em funo dos nveis de uria, atingiu valor mximo estimado de 18,8 t ha-1, no nvel de 339 kg ha-1 de uria, superando a produtividade mdia nacional de razes comerciais, em 8,8 t ha-1. O teor de glicose (acares redutores), nas razes da batata-doce, aumentou em funo dos nveis de uria, at o nvel de 187 kg ha-1, com teor mximo de 8,7%. O teor de amido foi reduzido com a elevao dos nveis de uria, com percentual mnimo de 57% no nvel de 460 kg ha-1. Contudo, o teor mnimo de amido situou-se dentro da faixa definida para a espcie. Palavras-chave: Ipomoea batatas, nutrio mineral, produo, glicose, amido.

ABSTRACT
Yield and quality of sweet potato roots fertilized with urea Studies with the objective of increasing yield and quality of sweet potato roots, could be an important tool to improve the socio economic condition in the northeastern area of Brazil, due to the importance of this vegetable in that area. The present work was done to evaluate the effect of urea levels on yield and quality of sweet potato cultivar Rainha Branca. The experiment was conduced from July to November/2003, in Paraba State, Brazil. The experimental design was of randomized blocks with five treatments (0; 115; 230; 345 and 460 kg ha-1 of urea), in cover fertilization at 30 and 60 days after planting date, in four replications. Plots with 28 plants, spaced 0,80 x 0,30 m apart were used. Commercial root yield of 18.8 t ha-1 was obtained when 339 kg ha-1of urea were employed, a much better result compared to the national average of 8.8 t ha-1of commercial roots The glucose level (reducing sugars) on the sweet potato roots, increased with the increase of the urea levels, up to 187 kg ha-1of urea with a maximum of 8.7% of glucose. Starch level was reduced with increasing urea levels, with minimum percent of 57% at the level of 460 kg ha-1. However, the starch minimum level was within the range defined for this species. Keywords: Ipomoea batatas, mineral nutrition, yield, glucose, starch.

(Recebido para publicao em 8 de outubro de 2004 e aceito em 3 de agosto de 2005) batata-doce uma cultura de grande importncia econmico-social, participando no suprimento de calorias, vitaminas e minerais alimentao humana. a quarta hortalia mais consumida no Brasil e destaca-se de outras culturas por apresentar alto rendimento por rea. Produz razes tuberosas que apresentam na sua composio, Ca, K e carboidratos variando entre 25 e 30%, dos quais 98% so facilmente digestveis, alm de vitaminas A, do complexo B, e C, ferro, clcio e fsforo (MIRANDA, 2003). No Brasil, a batata-doce cultivada em praticamente todos os estados, principalmente nas regies sul e nordeste, onde se constitui em uma das mais importantes fontes de alimento. Na Paraba mais cultivada e difundida nas regies
Hortic. bras., v. 23, n. 4, out.-dez. 2005

prximas aos grandes centros consumidores, sendo considerado o estado maior produtor nordestino e o quarto em nvel nacional (SOARES et al., 2002). Apesar deste destaque, paradoxalmente a nvel nacional, um dos estados que possui uma das mais baixas produtividades, em torno de 6,8 t ha-1. A falta de um programa de nutrio mineral para a cultura, um dos principais fatores responsveis por esta baixa produtividade (SILVA et al., 2002). O nitrognio o segundo nutriente mais exigido pela batata-doce (FILGUEIRA, 2000). Seu fornecimento via adubao funciona como complementao capacidade de seu suprimento nos solos, a partir da mineralizao de seus estoques de matria orgnica, geralmente baixa em re-

lao s necessidades das plantas (MALAVOLTA, 1990). Na batata-doce, a utilizao do nitrognio merece ateno especial. Em solos com alta disponibilidade desse elemento ocorre um intenso crescimento da parte area, em detrimento da formao de razes tuberosas, e naqueles com deficincia, inicialmente ocorre clorose nas folhas mais velhas, seguido das mais novas, sendo que com o agravamento da deficincia surgem manchas necrticas internevais, podendo ocorrer absciso das folhas, ocorrendo igualmente reduo significativa na qualidade (CHAVES; PEREIRA, 1985). O amido considerado o principal componente da raiz da batata-doce, seguido dos aucares mais simples, sacarose, glicose, frutose, maltose. Na
925

A. P. Oliveira et al.

indstria de alimentos utilizado para melhorar as propriedades funcionais, sendo empregado em sopas, molhos de carne, como formador de gel em balas e pudins, estabilizante em molhos de salada, na elaborao de compostos farmacuticos, na produo de resinas naturais e na elaborao de materiais termoplsticos biodegradveis (CEREDA et al., 2001). Os teores de amido nas razes das plantas podem variar, entre outros aspectos, em funo da adubao. Portanto, o estudo e conhecimento sobre a influncia desse fator na acumulao de amido nas razes das plantas, proporcionar melhoria na qualidade e no rendimento industrial do produto. A nutrio equilibrada, tanto em macro como em micronutrientes, aumenta a produo e melhora a qualidade do produto em vrios aspectos (MALAVOLTA, 1987). Alguns autores relatam efeitos da nutrio orgnica e mineral na qualidade de algumas hortalias produtoras de razes comerciais. No inhame, Souto (1989), detectou resposta positiva em termos de produo aplicao de fertilizantes nitrogenados, mas verificou baixo contedo de gordura, fibra bruta e protena bruta nas tberas. Oliveira et al. (2002) verificaram reduo da matria seca e aumento nos teores de amido e cinzas, em funo do emprego de esterco bovino e de galinha. O teor de amido tambm influenciado pela adubao com NPK (KAYODE, 1985). Na batata-doce, Silva (2004), observou elevao do teor de amido, em funo do emprego de fsforo. O objetivo deste trabalho foi avaliar a influncia da adubao nitrogenada no rendimento e qualidade das razes comerciais de batata-doce.

MATERIAL E MTODOS
O trabalho foi conduzido na Universidade Federal da Paraba, em Areia, entre julho e novembro/2003, em delineamento experimental de blocos casualizados, com cinco tratamentos, compostos pelos nveis de 0; 115; 230; 345 e 460 kg ha-1 de uria, em quatro repeties. O solo da rea foi classificado como NEOSSOLO REGOLTICO Psamtico Tpico, textura franca, cuja
926

anlise qumica na camada de 0-20 cm, resultou em: pH (H2O) = 6,5; P = 36,84 mg dm-3; K = 119,88 mg dm-3; Al+3 = 0,00 cmolc dm-3; Ca+2 = 2,55 cmolc dm-3; Mg+2 = 0,55 molc dm-3 e matria orgnica = 8,11 g dm-3. A adubao de plantio foi realizada conforme recomendaes do Laboratrio de Qumica e Fertilidade do Solo da UFPB e constou da aplicao de 20 t ha-1 de esterco bovino, 200 kg ha-1 de superfosfato simples e 68 kg ha-1 de cloreto de potssio. Na adubao de cobertura, aplicaram-se os nveis de uria, definidas no delineamento experimental, a metade aos 30 dias e a outra metade aos 60 dias aps o plantio. O preparo do solo constou de arao, gradagem e confeco de leires. No plantio, foram utilizadas duas ramas por cova, da cultivar Rainha Branca, retiradas de plantio jovem, cortadas com um dia de antecedncia, para facilitar o manejo, sendo secionadas em pedaos de aproximadamente 40 cm de comprimento, contendo em mdia oito entrens. As ramas foram enterradas pela base com auxlio de um pequeno gancho, numa profundidade aproximada de 10 cm. Foram utilizadas parcelas constitudas por seis leires de sete plantas, no espaamento de 0,80 m entre leires e 0,30 m entre plantas, e ocupou uma rea de 14 m2 com 54 plantas. Utilizaram-se os quatro leires centrais como rea til, excluindo-se a primeira e a ltima planta de cada leiro, resultando em 28 plantas avaliadas. Durante a conduo do experimento foram realizadas irrigaes pelo sistema de asperso convencional nos perodos de ausncia de precipitao, com turno de rega de trs dias; capinas com auxlio de enxadas com o objetivo de manter a cultura livre da competio com plantas daninhas; amontoas para proteger as razes contra raios solares e manter a formao dos leires. No efetuou-se aplicaes de agrotxicos em decorrncia da ausncia de pragas e/ou doenas. A colheita foi realizada aos 120 dias aps o plantio, onde foram obtidos os dados de produo comercial, a qual correspondeu ao peso das razes de formato uniforme, lisas com peso igual ou superior a 80 g, conforme Embrapa

(1995). Amostras de aproximadamente um quilograma de cada tratamento e repetio foram levadas ao laboratrio da UFPB, para determinao dos teores de glicose (acares redutores) e de amido, conforme metodologia do Instituto Adolfo Lutz (1985). Os resultados obtidos foram submetidos anlises de varincia e de regresso polinomial, utilizando-se o software SAEG 8.0 (2001). Dentro das doses de N, foram testados em cada caracterstica avaliada, os modelos polinomiais (linear, quadrtico e cbico). O critrio para a escolha do modelo foi definido atravs da significncia pelo teste F a 5% de probabilidade e do maior valor de coeficiente de determinao (R2).

RESULTADOS E DISCUSSO
As anlises de varincia e de regresso revelaram efeitos significativos dos nveis de uria (P<0,05), sobre a produo de razes comerciais e sobre os teores de glicose e amido nas razes. A produo de razes comerciais de batata-doce em funo das doses de N, atingiu valor mximo estimado de 18,8 t ha-1 no nvel de 339 kg ha-1 de uria (Figura 1), demonstrando uma boa produo nas condies do municpio de Areia. Esse resultado evidencia que essa hortalia responde ao fornecimento de uria. Esta produtividade superou em 10 t ha-1 a produtividade mdia nacional de razes comerciais de batata-doce que de 8,8 t ha-1 (Embrapa, 1995). Mendona e Peixoto (1991) obtiveram respostas significativas para a produtividade, produo por planta e peso mdio de razes comerciais na batata-doce, avaliando nveis de adubao com N, P e K. Nas condies edafoclimticas do Estado de Virgnia (USA), Phillips et al. (2005), observaram elevao do rendimento de razes comerciais da batatadoce, em funo do emprego de N, at o nvel de 84 kg ha-1 Provavelmente, o nvel de uria responsvel pela mxima produo de razes comerciais, juntamente com os nutrientes contidos no solo, supriu de forma equilibrada a batata-doce. O equilbrio entre os elementos nutritivos proporciona maiores produes do que
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Rendimento e qualidade de razes de batata-doce adubada com nveis de uria

maiores quantidades de macro-nutrientes isoladamente (PRIMAVESI, 1985). Embora os teores de P (36,84 mg dm-3) e K (111,88 mg dm-3), originalmente presentes no solo fossem respectivamente, baixo e alto, os resultados obtidos para o rendimento em funo do fornecimento de uria devem-se, em parte, ao baixo teor de matria orgnica (0,81%). De acordo com Pottker e Roman (1994), o teor de matria orgnica tem sido classicamente utilizado para estimar a disponibilidade de nitrognio e, consequentemente, a necessidade de adubao. Teixeira et al. (1994) enfatizaram que em solos degradados, os baixos teores de matria orgnica podem determinar menor disponibilidade de nitrognio para culturas, resultando numa das principais limitaes produtividade agrcola. A reduo na produo de razes comerciais verificada nos nveis acima de 339 kg ha-1 de uria, pode indicar que o excesso deste nutriente foi prejudicial formao de razes comerciais na batata-doce, possivelmente em funo da elevada produo de massa verde e formao de razes adventcias (EMBRAPA, 1995). Em solos com alta disponibilidade de nitrognio ocorre intenso crescimento da parte area, em detrimento da formao de razes tuberosas, decorrente do crescimento vegetativo exuberante (CHAVES; PEREIRA, 1985). Tambm, pode ter ocorrido efeito indireto do amnio, reduzindo a absoro de outros ctions, de forma que a absoro destes seria reduzida pela planta (CARNICELLI et al., 2000). Huett (1989) verificou reduo de produtividade em varias hortalias, em funo de doses elevadas de N. O teor de glicose (acares redutores) nas razes da batata-doce aumentou em funo da elevao dos nveis de uria, at o nvel de 187 kg ha-1de uria, com teor mximo de glicose de 8,7%, quando ento, comeou a decrescer (Figura 2). Esse teor foi semelhante ao obtido, por Cereda et al. (2001), para a espcie, (8,5 a 9%) em razes originadas de plantio com adubao balanceada. A presena de glicose acentua o sabor da batata-doce, favorecendo suas caractersticas de mesa e de processamento (PICHA, 1986). PortanHortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 1. Produo comercial de razes de batata-doce, em funo de nveis de uria. Areia, CCA-UFPB, 2004.

Figura 2. Teor de glicose em razes comerciais de batata-doce, em funo de nveis de uria. Areia, CCA-UFPB, 2004.

to, doses acima daquela responsvel pelo mximo teor de glicose nas razes comerciais podem reduzir sua qualidade, no reduzindo seu rendimento, isso porque para a obteno do rendimento mximo foi necessrio o fornecimento de 359 kg ha-1 de uria. O teor de amido foi reduzido com a elevao dos nveis de uria, com percentual mnimo de 57% no nvel de 460 kg ha-1 (Figura 3). Contudo, o teor mnimo de amido encontra-se dentro da faixa definida para a espcie que de 13,4% (CEREDA et al., 2001) e superou o teor de amido em razes de batatadoce de 16%, obtido por Silva (2004), em funo de doses de fsforo, tambm

nas condies de clima e solo da presente pesquisa. Em batata, Magalhes (1985) e Pimpini et al. (1992), relatam que o excesso de nitrognio proporciona reduo no teor de amido. Em inhame, Oliveira et al. (2002), observou reduo no teor de amido em rizforos colhidos aos noves de idade, em funo da adubao organo mineral. A cultura estava bem suprida de K pelo emprego do esterco bovino que continha na sua composio qumica concentrao 9,75 g kg-1, pela alta concentrao no solo fornecida pelas adubaes orgnica e mineral, aliadas a quantidade deste nutriente, originalmente no solo. O potssio em altas doses
927

A. P. Oliveira et al. MIRANDA, J.E.C. Batata-doce. EMBRAPACNPH. Disponvel em <http:// www.cnph.embrapa.br/cultivares/batatadoce.htm>. Acesso em: 03 jul. 2003. OLIVEIRA, A.P.; FREITAS NETO, P.A.; SANTOS, E.S. Produtividade de inhame, em funo de fertilizao orgnica e mineral e de pocas de colheita. Horticultura Brasileira, Braslia, v.19, n.2, p.144-147, 2002. PICHA, D.H. Carbohydrate changes in sweet potatoes during curing and storage. Journal American Society Hotticultural Science. v.111, n.6, p.89-92. 1986. PHILLIPS, S.B.; WARREB, J.G.; MULLINS, G.L. Nitrogen rate and application timing effect Beauregard sweet potato yield and quality. Hortscience, n.40, v.1, p.214-217, 2005. PIMPINI, F.; GIARDINI, L.; BORIN, M.; GIANQUINTO, G. Effects of poultry manure and mineral fertilizer on the quality of crops. Journal of Agricultural Science. Cambridge, v.118, n.2, p.215-222, 1992. POTTKER, D.; ROMAN, E. Efeito de resduos de culturas e do pousio de inverno sobre a resposta do milho a nitrognio. Pesquisa Agropecuria Brasileira, Braslia, v.29, p.763-770, 1994. PRIMAVESI, A. Manejo ecolgico do solo: A agricultura em regies tropicais. 8. ed. So Paulo: Nobel, 1990. 542 p. REIS JUNIOR, R.A. Produo, qualidade de tubrculos e teores de potssio no solo e no pecolo de batateira em resposta abubao potssica. 1995. 115 f. (Dissertao mestrado) - Universidade Federal de Viosa, Viosa. SAEG. Sistema para Anlises Estatsticas e Gentica ; verso 8.0, Viosa: Fundao Arthur Bernardes. 2001. SILVA, J.B.C.; LOPES, C.A.; MAGALHES, J.S. Cultura da batata-doce. In: CEREDA, M.P.; Agricultura: Tuberosas amilceas Latino Americanas, So Paulo: Cargill, 2002, v.2, p.449-503. SILVA, J.E.L. Rendimento e teor de amido da batata-doce em funo de doses de P2O5 e de espaamentos de plantio. 2004. 68 f. (Dissertao mestrado) - Universidade Federal da Paraba, Areia. SOARES, K.T.; MELO, A.S.; MATIAS, E.C. A Cultura da batata-doce (Ipomoea batatas (L.) Lam). Joo Pessoa: EMEPA-PB, 2002. 26 p. (EMEPA PB. Documentos, 41). SOUTO, J.S. Adubao mineral e orgnica do car da costa ( Dioscorea cayennensis Lam.). 1989, 57 f. (Dissertao mestrado) - Universidade Federal da Paraba, Areia. TEIXEIRA, L.A.; TESTA, V.M.; MIELNICZUK, J. Nitrognio no solo, nutrio e rendimento de milho afetados por sistemas de cultura. Revista Brasileira de Cincia do Solo, Campinas, v.18, p.207-214, 1994.

Figura 3. Teor de amido em razes comerciais de batata-doce, em funo de nveis de uria. Areia, CCA-UFPB, 2004.

reduz o amido, em decorrncia do aumento da absoro e acmulo desse nutriente na planta, acarretando reduo do potencial osmtico e aumento da absoro de gua, o que causa diluio dos teores de amido nos tubrculos (REIS JUNIOR, 1995). No inhame Dioscorea cayennensis (OLIVEIRA et al., 2002), observaram relao direta do K com o teor de amido nos rizforos. Tambm, a reduo no teor de glicose, em nveis acima de 198 kg ha-1, pode ter contribudo para a reduo do teor amido, isso porque a glicose nas razes polimerizada em amido (CEREDA et al., 2001).

LITERATURA CITADA
CARNICELLI, J.H.A.; PEREIRA, P.R.G.; SEDIYAMA, M.A.N.; CAMARGOS, M.I. Qualidade de cenoura em funo de doses de nitrognio. Horticultura Brasileira, Braslia, v.18, Suplemento, p.834-835, 2000. CEREDA, M.P.; FRANCO, C.M.L.; DAIUTO, E.R.; DEMIATE, J.M.; CARVALHO, L.J.C.B.; LEONEL, M.; VILPOUX, D.F.; SARMENTO, S.B.S. Propriedades gerais do amido. Campinas, Fundao Cargill, 2001. CHAVES, L.H.G.; PEREIRA, H.H.G. Nutrio e adubao de tubrculos. Campinas: Cargill, 1985. p.46-86.

EMBRAPA. Centro Nacional de Pesquisa de Hortalias. Cultivo da batata-doce (Ipomoea batatas (L.) Lam). 3. ed. Braslia: Ministrio da Agricultura, do Abastecimento e Reforma Agrria, 1995. (EMBRAPA-CNPH. Instrues Tcnicas, 7). FILGUEIRA, F.A.R . Novo Manual de Olericultura: Agrotecnologia moderna na produo e comercializao de hortalias, Viosa, 2000, 402 p. HUETT, D.O. Effect of nitrogen on the yield and quality of vegetables. Acta Horticulture, v.247, p.205-209, 1989. INSTITUTO ADOLFO LUTZ. Normas analticas do instituto Adolfo Lutz: Mtodos fsicos e qumicos para a anlise de alimentos. 3 ed., So Paulo: 1985. KAYODE, G.O. Effects of NPK fertilizers on tuber yield, starch content and dry matter accumulation of white guinea yam (Dioscorea rotundata) in a forest alfisol of south Western Nigeria. Experimental Agriculture. Ibadan, v.21, n.4, 1985, p.389-393. MAGALHES, F.R. Nutrio e adubao da batata. Ed. Nobel, So Paulo, 1985, 51 p. MALAVOLTA, E. Manual de adubao e calagem das principais culturas. So Paulo: Agronmica Ceres, 1987, 496 p. MALAVOLTA, E. Pesquisa com nitrognio no Brasil passado, presente e perspectivas. In: SIMPSIO BRASILEIRO SOBRE NITROGNIO EM PLANTAS 1., Itagua, 1990. Anais. Itagua, Sociedade Brasileira de Fisiologia Vegetal, 1990, 1990. p.89-177. MENDONA, A.T.C.; PEIXOTO, N. Efeitos do espaamento e de nveis de adubao em cultivares de batata-doce. Horticultura Brasileira , Braslia, v.9, n.2, p.80-82, 1991.

928

Hortic. bras., v. 23, n. 4, out.-dez. 2005

MELO FILHO, P.A.; DUSI, A.N.; COSTA, C.L.; RESENDE, R.O. Colonizao de plantas de alho por Neotoxoptera formosana no DF. Horticultura Brasileira, Braslia, v.23, n.4, p.929-930, out-dez 2005.

Colonizao de plantas de alho por Neotoxoptera formosana no DF


Pricles de A. Melo Filho1; Andr N. Dusi2; Cludio Lcio Costa3; Renato de O. Resende3
1

Universidade Federal Rural de Pernambuco, Depto Agronomia, Dom Manoel de Medeiros s/n 52171-900 Recife-PE; E-mail: pericles@ufrpe.br; 2Embrapa Hortalias, C. Postal 218, 70359-970 Braslia-DF; 3Universidade de Braslia, Instit. Biologia, 70919-970 Braslia-DF

RESUMO
Plantas de alho da cv. Amarante, cultivadas em casa de vegetao para deteco da ocorrncia de viroses, foram naturalmente infestadas por afdeos de colorao escura durante a primavera de 2001. Com o objetivo de identificar a espcie em questo foram coletados indivduos alados, capturados com armadilha constituda por bandeja amarela com gua, alm de formas pteras. A identificao da espcie foi feita segundo a chave descritiva elaborada por Blackman & Eastop (1984) e por comparao com espcimes de Neotoxoptera formosana e N. oliveri da coleo do Depto. Fitopatologia da Universidade de Braslia. O afdeo encontrado em alho pertence espcie Neotoxoptera formosana Takahashi, 1921.

ABSTRACT
Colonization of garlic plants by Neotoxoptera formosana in Distrito Federal, Brazil Garlic plants (cv. Amarante) cultivated during the spring in the greenhouse for detection of viruses, were found to be naturally colonized by a dark aphid. For species identification, specimens of the few alatae individuals collected by pan yellow water traps and many apterae individuals were compared to the species descriptions in Blackman & Eastop (1984). The specimens were also compared with Neotoxoptera formosana and N. oliveri from the aphid collection of the Phytopathology Department of the University of Braslia. The aphid found in the garlic plants belongs to the species Neotoxoptera formosana Takahashi, 1921. Keywords: Allium sativum, aphid.

Palavras-chave: Allium sativum, afdeos.

(Recebido para publicao em 26 de outubro de 2004 e aceito em 3 de agosto de 2005) alho (Allium sativum L.) uma das hortalias mais cultivadas no mundo e largamente empregado na culinria brasileira. No Brasil, a cultura destaca-se como uma das cinco hortalias de maior relevncia (RESENDE, 1997). Vrios agentes fitopatognicos, especialmente os vrus, provocam reduo na produtividade de bulbos. Entre os vrus de maior importncia encontramse os potyvrus Onion yellow dwarf virus (OYDV) e Leek yellow stripe virus (LYsV), o carlavrus Garlic common latent virus (GarCLV) e vrias espcies de allexivrus, todos transmitidos por afdeos (CONCI et al., 1999), com exceo dos allexivrus que so transmitidos por caros. Desses, apenas OYDV isoladamente chega a causar perdas na produo de bulbos de at 50 % (WALKEY; ANTILL, 1989). Plantas de alho so constantemente visitadas por diversas espcies de afdeos e entre eles so encontrados: Lipaphis sp. (Mordvilko), Rhopaloshiphum sp. (Koch), Aphis sp. (L.), Geopenphigus sp. (Hille), Myzus sp. (Passerini), Hyperomyzus sp. (Brner) e Neotoxoptera sp. (Theobald) (MELO FILHO et al., 2000; MELO FILHO et al., 2002). Mais de oitenta e seis
Hortic. bras., v. 23, n. 4, out.-dez. 2005

espcies de vrus so transmitidas por afdeos (PAIVA; KITAJIMA, 1985). Blackman e Eastop (1984) relataram a ocorrncia de Neotoxoptera formosana em plantas do gnero Allium no Japo, China, Taiwan, Coria, Austrlia, Nova Zelndia, Hawai e Amrica do Norte. No Brasil no h relato de sua ocorrncia em A. sativum. O presente trabalho teve como objetivo a deteco da ocorrncia de viroses em plantas de alho naturalmente infestadas por afdeos.

MATERIAL E MTODOS
Plantas de alho da cv. Amarante foram cultivadas durante a primavera, em casa de vegetao na Embrapa Hortalias, para estudos de viroses. Durante o cultivo ocorreu infestao natural por uma espcie de afdeo de colorao escura. As plantas colonizadas foram transportadas para insetrio com tela anti-afdeo para manuteno das populaes e posterior captura de adultos com uso de armadilha constituda por bandeja amarela com gua e detergente. Foram preparadas lminas semipermanentes para observao da

morfologia dos espcimes com auxlio de microscpio composto. Os espcimes foram comparados com as descries encontradas em Blackman e Eastop (1984) e Costa et al. (1993), com espcimes encontrados na coleo de afdeos do Departamento de Fitopatologia da Universidade de Braslia, alm de registros fotogrficos das principais caractersticas morfolgicas dos espcimes atravs do uso de microscpio esteroescpio Zeiss, quer sejam: N. formosana (adultos pteros de colorao magenta, vermelha a preto, antena escura da base ao pice, sifnculo escuro ou plido s em formas jovens, forma alada vermelho escura ou preta, com bordado em toda extenso das nervuras das asas); N. oliveri (adultos pteros de colorao vermelha escura, antena com base clara e segmentos terminais negros, sifnculo plido em adultos, forma alada vermelho escura a preta, com bordados estreitos na base e no pice) (Blackman; Eastop, 1984).

RESULTADOS E DISCUSSO
As colnias de afdeos detectadas sobre as plantas de alho eram de colo929

P. A. Melo Filho et al.

chave de classificao de famlias e subfamlias descrita em Costa et al. (1993) e em Blackman e Eastop (1984), pode-se concluir que se trata da ocorrncia de N. formosana sobre alho no Brasil. Este o primeiro relato da colonizao de N. formosana sobre plantas de alho no Brasil.

LITERATURA CITADA
BLACKMAN, R.L.; EASTOP, V.F. Aphids on the worlds crops: an identification guide. New York: John Wiley & Sons, 1984. 466 p. CONCI, V.C.; CANAVELLI, A.E.; LUNELLO, P.A.; CAFRUNE E.E. Mosaico del ajo. In: Projecto de investigaciones en fitovirologia. Instituto de Fitopatologia y Fisiologia Vegetal IFFIVE y Instituto Nacional de Tecnologia Agropecuria INTA. Argentina, 1999. p.1-6. COSTA, C.L.; EASTOP, V.F.; BLACKMAN, R.L. Brazilian Aphidoidea: I. Key to families, subfamilies and account of the phylloxeridae. Pesquisa Agropecuria Brasileira. Braslia, v.28, n.2, p.197-215, 1993. MELO FILHO, P.A.; TANABE, C.M.N.; DUSI, A.N.; TORRES, A.C.; VILA, A.C.; BUSO, J.A.; RESENDE, R.O. Degeneration of garlic (Allium sativum L.) plants caused by virus infection after four sequential field generations. Virus Reviews & Research. v.5, n.2, p.198, 2000. MELO FILHO, P.A.; DUSI, A.N.; BUSO, J.A.; TORRES, A.C.; VILA, A.C.; RESENDE, R.O. Degeneration of garlic plants caused by virus infection after five sequential field generations. Summa Phytopathologica, Piracicaba, v.28, n.1, p.141, 2002. RESENDE, G.M. Desempenho de cultivares de alho no norte de Minas Gerais. Horticultura Brasileira, Braslia, v.15, n.2, p.127-130, 1997. PAIVA, F.A.; KITAJIMA, E.W. Doenas provocadas por vrus e por patgenos que causam sintomas semelhantes s viroses. Informe Agropecurio, Belo Horizonte, v.11, n.122, p.2936, 1985. SAKO, I.; TANIGUCHI, T.; OSAKI, T.; INOUYE, T. Transmission and translocation of garlic latent virus in rakkyo (Allium chinense G. Don). Proceedings of the Kansai Plant Protection Society. n. 32, 21-27, 1990. WALKEY, D.G.A.; ANTILL, D.N. Evaluation of viruses-free and virus-infected garlic ( Allium sativum L.). Journal of Horticultural Science. v.64, n.1, p.60, 1989.

Figura 1. Colonizao por Neotoxoptera formosana sobre plantas de alho no Brasil: A) Agrupamento dos espcimes na poro mediano-basal das folhas; B) Forma aptera apresentando forma ovalada, colorao negra e sifnculo* escuro e clavado; C) Antena apresentando longo processo terminalis*; D) Forma alada apresentando decorao ao longo de todo o comprimento das nervuras das asas**. Braslia, Embrapa Hortalias, 2001.

rao escura e com a maioria dos espcimes localizados da poro mediana para a basal das folhas (Figura 1A). Os espcimes pteros, quando observados ao microscpio estereoscpio, apresentaram forma ovalada e de colorao negra a magenta, com sifnculo clavado tambm de colorao escura (Figura 1B), porm plido nas formas jovens. Estas caractersticas concordam com aquelas descritas por Blackman e Eastop (1984) a respeito das espcies de afdeos que colonizam plantas de alho. A antena de colorao escura desde a base at o pice. Essa caracterstica permite a separao entre Neotoxoptera formosana e N. oliveri (Blackman; Eastop, 1984). H na antena a presena de longo processo

terminalis (Figura 1C). As asas apresentam as nervuras uniformemente bordadas em toda a sua extenso (Figura 1D), sendo esta outra importante caracterstica que separa Neotoxoptera formosana de N. oliveri (Blackman; Eastop, 1984). Isto reforou a hiptese de se tratar da espcie Neotoxoptera formosana. De acordo com Sako et al. (1990), N. formosana comprovadamente transmissor de Garlic latente vrus (GarLV). No trabalho os autores comprovaram transmisso desse vrus para plantas de Allium chinese. Isso torna esse afdeo potencialmente transmissor dessa espcie de vrus para outras espcies do gnero Allium. Com base nas observaes registradas e descries encontradas na

930

Hortic. bras., v. 23, n. 4, out.-dez. 2005

ANDRIOLO, J.L.; LUZ, G.L.; WITTER, M.H.; GODOI, R.S.; BARROS, G.T.; BORTOLOTTO, O.C. Growth and yield of lettuce plants under salinity. Horticultura Brasileira, Braslia, v.23, n.4, p.931-934, out-dez 2005.

Growth and yield of lettuce plants under salinity


Jernimo L. Andriolo1; Gean L. da Luz2; Maiquel H. Witter3; Rodrigo dos S. Godoi1; Gisele T. Barros1; Orcial C. Bortolotto4
UFSM, CCR, Depto. Fitotecnia, 97105-900 Santa Maria-RS; E-mail: andriolo@smail.ufsm.br; 2Acadmico do curso de agronomia, UFSM; 3Bolsista PIBIC-CNPq; 4Bolsista FAPERGS
1

ABSTRACT
Lettuce plants, cv. Vera, were grown under five salinity levels in a hydroponical experimental set-up using a 0.15 m deep sand growing bed. A standard nutrient solution was used, with the following composition, in mmol L-1: 16.9 NO3-; 2.0 H2PO4-; 1.0 SO4 4.0 Ca++; 10.9 K+ e 1.0 Mg++, and, in mg L-1, 0.42 Mn; 0.26 Zn; 0,05 Cu; 0,50 B; 0,04 Mo, and 4.82 chelated Fe. The five salinity levels compared as treatments were obtained by varying the concentration of the standard nutrient solution, reaching average electrical conductivities (EC) of 0.80; 1.93; 2.81; 3.73 and 4.72 dS m-1, for T1, T2, T3, T4 and T5, respectively. The nutrient solution at each salinity level was supplied from a reservoir by means of a flooded-type electrical pump, for 15 minutes, at intervals of 90 minutes during the day and 420 minutes during the night. A completely randomised experimental design was used with four replications and 20 plants per plot. Four plants of each plot were harvested at 32 days after planting, to determine shoot and root dry mass, shoot fresh weight, leaf area and number of leaves per plant. Number of leaves was 18 per plant and was not affected by treatments. Dry mass of leaves increased 24,4% from T1 to T3. No relationships were found on data from stem and root dry mass. A positive effect of EC was recorded on shoot fresh mass, which increased 28.5% from T1 to T2, and decreased 16.5% from T2 to T5. Maximum LAI estimated value was 4.3 m2 m-2 for an EC of 2.6 dS m-1. Salinity levels above 2.0 and 2.6 dS m-1 reduce fresh yield and plant growth, respectively.

RESUMO
Crescimento e produtividade da alface em condies salinas Plantas de alface, cv. Vera, foram cultivadas em cinco nveis de salinidade em um dispositivo experimental composto por uma camada de areia de 0,15 m de profundidade. Foi empregada uma soluo nutritiva padro, com a seguinte composio, em mmol/L: 16,9 de NO3-; 2,0 de H2PO4-; 1,0 de SO4; 4,0 de Ca++; 10,9 de K+ e 1,0 de Mg++, e, em mg L 1, 0,42 de Mn; 0,26 de Zn; 0,05 de Cu; 0,50 de B; 0,04 de Mo, e 4,82 de Fe quelatizado. Os cinco nveis de salinidade foram obtidos por variaes na concentrao da soluo nutritiva padro, atingindo valores mdios de condutividade eltrica (CE) de 0,80; 1,93; 2,81; 3,73 e 4,72 para T1, T2, T3, T4 e T5, respectivamente. A soluo nutritiva em cada nvel de salinidade foi fornecida a partir de um reservatrio atravs de uma bomba submersa, durante 15 min, em intervalos diurnos de 90 min e noturnos de 420 min. Um dispositivo experimental inteiramente casualizado foi empregado, com quatro repeties e 20 plantas por parcela. Quatro plantas de cada tratamento foram coletadas aos 32 dias aps o plantio para determinar a massa seca da parte area e das razes, a massa fresca da parte area, a rea foliar e o nmero de folhas. O nmero de folhas por planta foi igual a 18, sem diferena significativa entre os tratamentos. A massa seca de folhas aumentou 24,4% de T1 para T3. A massa seca do caule foi reduzida nos nveis salinos mais elevados, porm no foi observada relao dos tratamentos com a massa seca do caule e das razes. Foi observado efeito positivo na massa fresca da parte area, a qual aumentou 28,5% de T1 para T2, decrescendo 16,5% de T2 para T5. O valor mximo estimado do ndice de rea foliar foi de 4,3 m2 m-2 para uma EC de 2,6 dS m 1. Concluiu-se que nveis salinos acima de 2,0 e 2,6 dS m 1 reduzem o crescimento e a massa fresca das plantas, respectivamente. Palavras-chave : Lactuca sativa , fertirrigao, hidroponia, salinidade.

Keywords: Lactuca sativa, fertigation, hydroponics, salinity.

(Recebido para publicao em 4 de novembro de 2004 e aceito em 5 de agosto de 2005) ettuce (Lactuca sativa) is the most important horticultural NFT-grown crop in Brazil. Standard nutrient solutions are prepared using high quality water and electrical conductivity is monitored daily to fit values between 1.4 and 2.0 dS m-1 (FAQUIN; FURLANI, 1999). This is so to prevent plant saline stress in periods of high transpiration demand, or reduction in growth rate due to low availability of mineral nutrients. The use of nutrient solutions prepared from low quality water or by re-using nutrient solutions has hardly been
Hortic. bras., v. 23, n. 4, out.-dez. 2005

considered a possibility for this crop. The main reason is the high sensitivity of lettuce plants to salinity (SHANNON; GRIEVE, 1999). As a consequence, the remaining volumes of nutrient solution at the end of the cropping period are discharged in the environment. This practice is nowadays criticisable in a worldwide context searching for sustainable agricultural production systems. One of the possibilities to reduce environmental pollution from hydroponical horticultural production

systems is recycling and re-using the nutrient solution. The ionic concentration of the nutrient solutions used to grow horticultural crops is higher than that at which nutrients are absorbed by plants. Hence, the growth of the crop is followed by an increasing imbalance of the ionic concentration of the nutrient solution. In order to adjust periodically the ionic balance to the original level, it is necessary to do laboratory mineral analysis or electrodecomputing measurements. Both methods are difficult to carry out in the
931

J. L. Andriolo et al.

nowadays social and economic context of commercial production. For re-using a recycled nutrient solution without previous mineral nutrient analysis, a fraction of it is added to the standard nutrient solution being prepared, disregarding its mineral composition. This practice would lead to high salinity levels in the nutrient solution. The initial effect of salinity at cellular level is due to its osmotic effects. Shoot and root growth rate is reduced, resulting in smaller and fewer leaves and shorter plant stature. The effects of salinity depends on interactions with environmental variables such as water vapour deficit, temperature and solar radiation (YEO,1999). Lettuce has been considered as a moderately salt sensitive crop, with a threshold electrical conductivity (EC) of 1.3 dS m-1, and a negative slope of 13.0 for each unit of added salinity above this threshold value (AYERS et al., 1951). Nevertheless, the root growing media may affect the response of plants to salinity. Pasternak et al. (1986) reported that yield and quality of soil grown lettuce was not affected by sprinkling with water at 4.4 dS m-1. Positive effects of salinity in fruit quality has been reported for horticultural soilless growing crops such as tomato (CUARTERO; MUOZ, 1999; LI; STANGUELLINI, 2001; BOLARIN et al., 2001) and muskmelon (MAVROGIANOPOULOS et al., 1999). For hidroponically grown lettuce crops, results are scarce in the literature. The goal of this work was to determine the effect of salinity on growth, development and yield of hydroponically grown lettuce plants.

MATERIAL AND METHODS


An experimental set-up was made inside a polyethylene tunnel, at the Universidade Federal de Santa Maria. The soil surface was dug up in order to make a 1.3 m length, 1.2 m width and 0.25 m depth tank into the soil, which was covered with a 200 m black polyethylene sheet. A fibber cement tile (3.05 m length and 1.10 m width) was placed over the tank with a slope of 3% and covered with a 200 m black
932

polyethylene sheet. The tile gullies were filled with 0.015-0. 025 m particle size gravel and covered with a 1,5 10-3 m polyethylene screen. Sand of 0.00150.003 m particle size was used to make up a 0.15 m depth growing bed over the tile. (For more details, see ANDRIOLO et al., 2004). A flooded-type electrical pump was placed at the bottom of the upper end of the tank, and connected to a pipe to drive the nutrient solution up to the surface of the sand bed. The pump was put to work by means of a timer until the nutrient solution started to flow away from the lower side of the growing bed. After the pump was switched off, the nutrient solution drained off from the growing bed across the polyethylene screen and the tile gullies. Finally, the set-up was covered by a white polyethylene sheet. On June 18, 2004, six-leaved lettuce plantlets, cv. Vera, were transferred to the sand bed through cuttings made in the polyethylene sheet. Plant density was 25 plants m-2. Water and nutrients were supplied by means of a standard nutrient solution with the following composition, in mmol L -1 (CASTELLANE; ARAJO, 1995): 16.9 NO3-; 2.0 H2PO4-; 1.0 SO4; 4.0 Ca++; 10.9 K+ and 1.0 Mg++, and, in mg L-1, 0.42 Mn; 0.26 Zn; 0.05 Cu; 0.50 B; 0.04 Mo, and 4.82 chelate Fe. The pH and electrical conductivity (EC) was 5.8 and 2.9 dS m-1, respectively. The pump delivered the nutrient solution for 15 minutes, at intervals of 90 minutes during the day and 420 minutes during the night. The tunnel was ventilated on sunny days by opening the lateral sides, to reach similar values of maximum air temperatures inside and outside of it. Five salinity levels were compared as treatments, obtained by varying the concentration of the standard nutrient solution. The target EC values of treatments were 0.8; 1.85; 3.0; 4.0 and 5.0 dS m-1, for T1, T2, T3, T4 and T5, respectively. The actual EC values averaged over the experimental period were 0.80; 1.93; 2.81; 3.73 and 4.72 dS m-1, respectively. Electrical conductivity and pH were measured daily. A volume of water or an aliquot of nutrient solution at the required concentration was added every time the measured EC value was

10% above or below the original value, respectively. The volumes to be added were estimated by a proportionality coefficient of the volume of nutrient solution contained into the reservoir, estimated by the depth of the liquid inside it. The pH was maintained in the range between 5.0 e 6.0 by additions of H3PO4 or KOH, from a titration curve previously determined in the laboratory. A completely randomised experimental design was used, with four replications and an experimental set-up for each plot. Four plants of each plot were harvested at 32 days after planting (DAP), when fully expanded older leaves began to senesce. The number of leaves longer than 0.01 m were counted. Specific leaf area (SLA) was determined on the basis of dry mass of 100 leaf disks (5 10-4 m2), sampled on all leaves. Leaf area index (LAI) was estimated by extrapolating the SLA to the plant leaf dry mass. Shoot fresh weight was determined and roots were carefully removed out from the sand and washed in water. Dry mass of leaves, stem and roots were determined after drying at 60C until constant dry weight was reached. Statistical models were fitted by regression analysis.

RESULTS AND DISCUSSION


The number of leaves was 18 per plant and was not affected by treatments. Dry mass of leaves increased 24,4% from T1 to T3 (Figure 1a). Treatments T4 and T5 maintained this value and the data fitted a polynomial model (Figure 1a). Stem dry mass was slightly reduced, root dry mass was not affected by treatments, and no relationship was found on data from both variables (Figure 1a). Dry mass fractions did not differ among treatments, and average values were 0.93 for leaves, 0.02 for stem and 0.05 for roots. A positive effect of EC levels was recorded on shoot fresh mass, which increased 28.5% from T1 to T2, fitting a polynomial model with a maximum estimated value of 170.7 g/plant for an EC of 2.0 dS m-1 (Figure 1b). A 16.5% linear decrease was found from T2 to T5. Leaf area data fitted a polynomial model, with a maximum LAI estimated
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Growth and yield of lettuce plants under salinity

value of 4.3 m2/m2 for an EC of 2.6 dS m-1 (Figure 2). Lettuce growth was affected by low concentrations of the nutrient solution, probably due to low availability of mineral nutrients. Nevertheless, dry mass accumulation was not reduced at concentrations of the nutrient solution higher than 2.8 dS m-1. This implies uptake of carbon by leaves and mineral nutrients by roots were not affected. Effects of salinity on plant growth and yield have been attributed to simultaneous reduction in leaf area and root growth, affecting photosynthesis and water and mineral uptake (SHANON; GRIEVE, 1999). Salinity has been measured as the total salt concentration in the root media, disregarding ions in solution. Nevertheless, when salinity is due to NaCl, its effects are associated with accumulation of Na+ and Cl- in cells and/ or to ionic imbalance leading to physiological disturbances (BOLARIN et al., 2001). This was not the case in the present experiment, as a balanced nutrient solution was prepared from high quality water. When dealing with salinity, it should be advisable to separate the effects from water with NaCl from those arising from the concentration of the nutrient solution. This conclusion should be considered while growing fruiting horticultural crops commercially at high EC levels to improve physiological quality (CUARTERO; FERNADEZ-MUOZ, 1999; LI; STANGUELLINI, 2001). Although plant dry mass was not affected by high nutrient solution concentrations, fresh weight and leaf area were reduced. This effect might be attributed to its influence on water uptake by plants. The estimated upper threshold value of 2.0 dS m-1 and the linear slope of 14.9 (Figure 1b) were higher than those of 1.3 dS m-1 and 13.0 respectively, reported by Ayers et al. (1951). These discrepancies might be associated to genotype differences and to environmental conditions influencing plant water demand. The effect on fresh weight was more pronounced than on leaf area, suggesting leaves had some degree of plasticity at low water deficit. Nevertheless, when water deficit rises
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figure 1. Dry mass of shoot organs (a) and shoot fresh weight (b) of lettuce plants grown hydroponically at five concentrations of the nutrient solution. Santa Maria, UFSM, 2004.

by effect of high nutrient solution concentration, its influence on leaf area was similar to that on fresh weight. Present results were obtained in winter, when daily maximum air temperatures did not exceed 29C and average global solar radiation was about 8.4 MJ m-2 day-1 (BURIOL et al., 2000). This environmental condition was near the optimal 15-25C range for the lettuce crop (GOTO, 1998). Thus, relationships showed in this paper could be interpreted as a preponderant effect of the nutrient solution concentration. These effects might be enhanced by environmental conditions stimulating water uptake by plants (YEO, 1999), such as high temperatures and solar radiation during spring and summer. In this way, a second variable estimating

the effect of environment on growth under saline conditions should be determined and considered when dealing with mechanistical models for the lettuce crop. The time intervals of fertigation should also be considered. Short time intervals between fertigations might be used to prevent the rising in salinity in the rooting media as a consequence of plant transpiration. In this case, growing in sand or other substrates would be similar to doing it in NFT facilities. On the other hand, if long time intervals between fertigations are used, EC values may increase, reducing plant fresh weight and leaf area. Marketable quality of lettuce is determined mainly by plant size, which depends on fresh weight. For
933

J. L. Andriolo et al. AYERS, A.D.; WADLEIGH, C.H.; BERNSTEIN, L. Salt tolerance of six varieties of lettuce. Proceedings of the American Society for Horticultural Science, v.57, p.237-242, 1951. BOLARIN, M.C.; ESTAN, M.T.; CARO, M.; ROMERO-ARANDA, R.; CUARTERO, J. Relationship between tomato fruit growth and fruit osmotic potential under salinity. Plant Science, v.160, p.1153-1159, 2001. BURIOL. G.A.; ESTEFANEL, V.; ANDRIOLO, J.L.; MATZENAUER, R.; TAZZO, I.F. Disponibilidade de radiao solar para o cultivo do tomateiro durante o inverno no Estado do Rio Grande do Sul. Pesquisa Agropecuria Gacha, v.6, n.1, p.113-120, 2000. CASTELLANE, P.D.; ARAJO, J.A.C. Cultivo sem solo - Hidroponia. 4. ed. Jaboticabal: FUNEP, 1995. 43 p. CUARTERO, J.; FERNNDEZ-MUOZ, R. Tomato and salinity. Scientia Horticulturae, v.78, p.83-125, 1999. FAQUIN, V.; FURLANI, P.R. Cultivo de hortalias de folhas em hidroponia em ambiente protegido. Informe Agropecurio , v.20, n.200/201, p.99-104, 1999. GOTO, R. A cultura da alface. In: GOTO, R.; TIVELLI, S.W. (Ed.). Produo de hortalias em ambiente protegido: condies subtropicais. So Paulo: FUNESP, 1998, p.137-159. LI, Y.L.; STANGHELLINI, C. Analysis of the effect of EC and potential transpiration on vegetative growth of tomato. Scientia Horticulturae, v.89, p.9-21, 2001. MAVROGIANOPOULOS, G.N.; SPANAKIS, J.; TSIKALAS, P. Effect of carbon dioxide enrichment and salinity on photosynthesis and yield in melon. Scientia Horticulturae, v.79, p.51-63, 1999. PASTERNAK, D., DE MALACH, Y., BOROVIC, I., SHRAM, M., AVIRAM, C. Irrigation with brackish water under desert conditions. IV. Salt tolerance studies with lettuce (Lactuca sativa L.). Agric. Water Manage, v.11, p.303-311. 1986. SHANNON, M.C.; GRIEVE, C.M. Tolerance of vegetable crops to salinity. Scientia Horticulturae, v.78, p.5-38, 1999. YEO, A. Predicting the interaction between the effects of salinity and climate change on crop plants. Scientia Horticulturae, v.78, p.159-174, 1999.

Figure 2. Leaf area index (LAI) of lettuce plants grown hydroponically at five concentrations of the nutrient solution. Santa Maria, UFSM, 2004.

commercial purposes, results showed that salinity levels above 2.0 and 2.6 dS m-1 reduce fresh yield and plant growth, respectively. On the other hand, the fact that, plants were able to grow shoot and roots with a nutrient solution conductivity of about 4.7 dS m-1 suggests that water uptake is the key variable controlling lettuce plant size at concentrations of the nutrient solution above the threshold value. In this way, recycling and re-using nutrient solutions is a practice that could be taken in account. This might be done by adding

successive aliquots of recycled nutrient solutions during the growth of the crop, every time the measured EC values of the nutrient solution had to be raised to its original threshold. This hypothesis should be tested by more experiments.

CITED LITERATURE
ANDRIOLO, J.L.; LUZ, G.L.; GIRALDI, C.; GODOI, R.S.; BARROS, G.T. Cultivo hidropnico da alface empregando substratos: uma alternativa a NFT?. Horticultura Brasileir a, Braslia, v.22, n.4, p.794-798, 2004.

934

Hortic. bras., v. 23, n. 4, out.-dez. 2005

TRANI, P.E.; PASSOS, F.A.; FOLTRAN, D.E.; TIVELLI, S.W.; RIBEIRO, I.J.A. Avaliao dos acessos de alho pertencentes coleo do Instituto Agronmico de Campinas. Horticultura Brasileira, Braslia, v.23, n.4, p.935-939, out-dez 2005.

Avaliao dos acessos de alho coleo do Instituto Agronmico de Campinas


Paulo E. Trani1; Francisco A. Passos1; Dulcinia E. Foltran2; Sebastio W. Tivelli1; Ivan J.A. Ribeiro3
1 Instituto Agronmico, Centro de Horticultura, C. Postal 28, 13012-970 Campinas-SP; E-mail: petrani@iac.sp.gov.br; 2APTA-UPD de Tiet, C. Postal 18, 18530-970 Tiet-SP; E-mail: dulcineia@aptaregional.sp.gov.br; 3Instituto Agronmico, C. Postal 28, 13012-970 Campinas-SP

RESUMO
Cinqenta acessos de alho pertencentes ao banco de germoplasma do Instituto Agronmico de Campinas foram avaliados em campo, nos municpios de Tiet e Jundia (SP), Brasil, em 2003, em blocos ao acaso, com trs repeties. Os dados obtidos foram submetidos anlise de varincia, sendo as mdias comparadas pelo teste de Skott-Knott, em nvel de 5% de probabilidade. Os acessos Piedade e Gigante de Curitibanos apresentaram excelente desempenho para produtividade e qualidade do bulbo, nos dois locais. Por outro lado, os acessos Bulbilho Areo 2 e Andradas Manoel Lopes 2 apresentaram interao com o ambiente, o primeiro para o tamanho do bulbo e o segundo para a produtividade. Comparando-se os resultados de Jundia com os obtidos em Tiet, nota-se que em Jundia houve maior variabilidade gentica para a produtividade e para o dimetro do bulbo, devido ao menor efeito ambiental. Palavras-chave: Allium sativum L., banco de germoplasma, produtividade.

ABSTRACT
Evaluation of garlic accesses from the collection of the Instituto Agronmico de Campinas Fifty accesses from the garlic germplasm bank of Instituto Agronmico de Campinas were evaluated in Tiet and Jundia, So Paulo State, Brazil. The field trials were carried out in 2003, and the experimental design was randomized blocks with three replicates. The data were subjected to an ANOVA and the means compared using the Skott-Knott test at a 5% probability level. The access Piedade and Gigante de Curitibanos showed excellent performance for yield and bulb quality in both locations. On the other hand, environmental interaction occurred for access Bulbilho Areo 2 and Andradas Manoel Lopes 2. For the first one, the bulb size was different and for the second the yield changed. A greater genetic diversity on yield and bulb diameter was observed in Jundia, due to lower environmental effects. Keywords: Allium sativum L., germplasm bank, yield.

(Recebido para publicao em 4 de novembro de 2004 e aceito em 3 de agosto de 2005) Brasil produziu 114.436 t de alho em 15.715 ha em 2002 (IBGE, 2002), para um consumo estimado em 140 mil toneladas neste mesmo ano (DELLAMARIA, 2003). Segundo Camargo Filho (2003) a produtividade de alho no estado de So Paulo foi de aproximadamente 6,4 t ha-1 em 2003. Os acessos do banco de germoplasma do Instituto Agronmico de Campinas (IAC) tm revelado produtividades superiores a esta mdia. O Centro de Horticultura do IAC mantm um banco de germoplasma de alho com 50 acessos e realiza experimentos regionais com esse germoplasma desde a dcada de 40. Dentre os acessos mantidos nessa coleo, encontram-se germoplasmas seminobres que podem ser utilizados por produtores em substituio aos alhos nobres. Os alhos semi-nobres so recomendados para o plantio em So Paulo pois so mais adaptados s condies
Hortic. bras., v. 23, n. 4, out.-dez. 2005

de fotoperodo e temperatura, dispensam o tratamento de vernalizao, so produtivos e de boa qualidade comercial. Os bulbos e bulbilhos desses acessos so arroxeados, porm, so mais claros do que os do alho nobre. O nmero de bulbilhos por bulbo de 15 em mdia e no produzem palitos (CAMARGO FILHO et al., 1996; SIQUEIRA et al., 1996). So indicados para plantio em So Paulo as cvs. Amarante, Chins, Gigante de Curitibanos, Lavnia e Roxinho (TAVARES et al., 1998). A expanso da rea cultivada com alhos nobres e roxos ocorrida na dcada de 80 e 90 no Brasil em reas novas ou que tradicionalmente cultivavam os alhos comuns e brancos, aumentou o custo de produo da cultura especialmente para a aquisio de semente. O custo de produo por hectare, de alho vernalizado, para So Paulo, foi de US$6.070,00 (maro/1995: R$1,00 = US$0,90) (TRANI et al., 1997). Este

alto custo foi semelhante ao valor observado em Santa Catarina, de US$6.946,00 (CARMARGO FILHO et al., 1996). Nos coeficientes tcnicos para a cultura do alho vernalizado, o custo da semente representou 51% do valor dos insumos ou 33% do custo total, enquanto o custo de vernalizao foi de cerca de 16% do preo da semente ou 5% do custo total (TRANI et al., 1997). Esse custo elevado dificulta o cultivo de alhos nobres para os pequenos produtores e produtores familiares de diversas regies brasileiras. A cultura do alho uma atividade econmica importante no sistema de agricultura familiar. Alm de empregar mo-de-obra desde o plantio at a colheita, permite a utilizao da mo-deobra num perodo que essa estaria ociosa. Com isto, favorece a fixao do homem ao campo e proporciona uma renda extra para a famlia. As mutaes somticas e a seleo cuidadosa dos produtores deram origem
935

P. E. Trani et al.

a um grande nmero de cultivares de alhos semi nobres e comuns com caractersticas agronmicas distintas. Estas cultivares so exploradas economicamente no sistema de agricultura familiar nas distintas regies produtoras de So Paulo, as quais apresentam caractersticas edafoclimticas diferentes. Em 1987, Lisbo et al. (1993) avaliaram o comportamento de acessos de alho em trs municpios paulistas (Monte Alegre do Sul, Pariquera-Au e Guatapar). Os acessos estudados apresentaram comportamento diferente em cada municpio. Em Monte Alegre do Sul, os acessos IAC Lavnia 1632 (9,2 t ha-1), Roxinho I-5063 (6,3 t ha-1) e Peruano (5,6 t ha-1) foram superiores aos demais, enquanto em Pariquera-Au os mais produtivos foram Santa Catarina Roxo (4,9 t ha-1); Cajuru I-2315 (4,9 t ha-1); So Jos 4999 (4,5 t ha-1) e Areal n2 I-3978 (4,4 t ha-1). Nenhum dos acessos avaliados em Pariquera-Au obteve produtividade superior a 5,0 t ha-1 devido s condies climticas locais. Por outro lado, os acessos mais produtivos em Guatapar foram o Peruano (7,2 t ha-1) e o Chins (4,8 t ha-1). No municpio paulista de Tiet, Lisbo et al. (1991) avaliaram o comportamento de dez acessos de alho, em 1988. O acesso Lavnia foi o mais produtivo entre os dez testados, com produtividade de 12,8 t ha-1. Os demais acessos revelaram produtividades superiores cultivar tradicionalmente cultivada na regio (Roxinho de Goinia), que produziu apenas 1,7 t ha-1. Dentre os outros acessos merecem ser destacados os gentipos Chins, Mineiro e Roxinho, com produtividades de 8,1; 7,9 e 7,7 t ha-1, respectivamente. Como parte do programa de pesquisa e adaptao de tecnologias regionais, o IAC, em conjunto com a CATI, estudaram o comportamento varietal do alho em Guatapar em 1988 e em Ribeiro Preto no ano seguinte. Os resultados de 1989 em Ribeiro Preto confirmaram os dados do ano anterior obtidos em Guatapar. As mdias de produtividade e peso mdio dos bulbos nos dois anos de estudo, demostraram que os acessos Lavnia (12,3 t ha-1 e 28,8 g), Cateto Roxo (10,7 t ha-1 e 27,5 g), Roxinho (10,7 t ha-1 e 25,0 g) e Chins (9,1 t ha-1
936

e 24,1 g) foram superiores aos demais acessos avaliados (LISBO et al., 1991; LISBO et al., 1993). Segundo Siqueira et al. (1996), o acesso Assa (IAC-3702) foi identificado no banco de germoplasma do IAC, como sendo muito semelhante ao acesso Cateto Roxo. Portanto, ele pode substituir o acesso Cateto Roxo com vantagens, pois seus bulbos apresentam em mdia 10 dentes ou bulbilhos, enquanto no Cateto Roxo ocorrem mais de 30 dentes. Alm disso, as plantas do acesso Assa so tolerantes ao pseudoperfilhamento. Diante disto, os pequenos produtores que cultivam Cateto Roxo para consumo prprio e vendas locais, podem passar a utiliz-lo em plantios comerciais ou experimentais. Os resultados obtidos indicam que as produtividades dos acessos de alho so muito variveis de regio para regio, de acordo com as condies edafoclimticas e os tratos culturais empregados. O objetivo deste trabalho foi avaliar o nmero de bulbos por hectare, a produtividade, o peso mdio e o dimetro dos bulbos, que so relacionados qualidade comercial de gentipos do banco de germoplasma de alho do Centro de Horticultura do IAC.

MATERIAL E MTODOS
Dois experimentos de campo foram instalados em duas localidades do estado de So Paulo, em 2003, para avaliao de 50 acessos de alho, pertencentes ao banco de germoplasma do Centro de Horticultura do Instituto Agronmico de Campinas. O primeiro experimento foi instalado em 03/04/2003 em Tiet, enquanto o segundo ocorreu em 10/04/2003 em Jundia. Os bulbilhos de cada acesso utilizado no plantio foram selecionados em peneira n2 (peso 1,5-2,0 g). O alho foi plantado em linhas simples transversais aos canteiros, os quais tinham um metro de largura. O espaamento entre as linhas foi de 0,25 m e, entre plantas, de 0,1 m. Cada parcela conteve 0,5 m2 de rea total e foi composta de duas linhas transversais. No experimento de Tiet cada linha foi plantada com sete bulbilhos, num total de 14 bulbilhos por parcela, ou 0,35 m2 de rea cultivada.

Em Jundia por sua vez, cada linha de plantio nos canteiros conteve 6 bulbilhos, num total de 12 bulbilhos por parcela, ou 0,30 m2 de rea cultivada. Em ambos os locais os tratos culturais (calagem, adubao, irrigao, tratos fitossanitrios, e etc.) foram realizados de acordo com Trani et al. (1997). Independentemente do ciclo, todos os acessos foram colhidos no mesmo dia em cada local. Em Tiet a colheita ocorreu em 08/09/2003, e no dia seguinte, 09/09/2003, foi colhido o experimento em Jundia. Em ambas as localidades, foram avaliados quatro caracteres: nmero de bulbos por parcela, produtividade (t ha-1), peso mdio do bulbo (g) e dimetro mdio do bulbo (mm). O dimetro mdio do bulbo foi obtido por meio da mdia aritmtica de trs bulbos por parcela escolhidos ao acaso. Para efeito de comparao dos acessos quanto produtividade em 2003 com os resultados obtidos em experimentos anteriores, os dados de peso total de bulbos em g parcela-1 no experimento de Tiet/SP foram convertidos para t ha -1 por meio da equao ProdutividadeTiet (t ha-1) = (2,857 * peso total de bulbos (g parcela-1) * 0,007. Por motivos idnticos, os dados de peso total de bulbos em g parcela-1 no experimento de Jundia/SP foram convertidos para t ha-1 por meio da equao ProdutividadeJundia (t ha-1) = (3,333 * peso total de bulbos (g parcela-1) * 0,007. Considerou-se que um hectare de cultivo de alho corresponde a 7.000 m2 de canteiros, o que origina o fator 0,007. Os experimentos foram conduzidos em blocos ao acaso com trs repeties. Os dados obtidos foram submetidos ao teste de Hartley, em nvel de 5% de probabilidade, para verificar a homogeneidade de varincias. Em ambos os experimentos os dados originais foram submetidos anlise de varincia, e tiveram as mdias comparadas pelo teste de Scott-Knott, em nvel de 5% de probabilidade (FERREIRA, 2005).

RESULTADOS E DISCUSSO
Devido heterogeneidade dos quadrados mdios residuais (GOMES, 1970), os resultados dos experimentos so apresentados separadamente.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Avaliao dos acessos de alho pertencentes coleo do Instituto Agronmico de Campinas

Para a varivel nmero de bulbos por hectare no houve efeito significativo de acessos no experimento de Tiet em razo da uniformidade de emergncia dos bulbilhos, ocorrendo reduzido nmero de falhas (Tabela 1). Tanto na anlise de varincia quanto no teste de ScottKnott no houve diferenas significativas em Tiet. Por outro lado, na anlise de varincia, para o experimento em Tiet observou-se que houve efeito altamente significativo de acessos para os caracteres produtividade, peso mdio do bulbo e dimetro mdio do bulbo. O peso mdio do bulbo, que est relacionado ao tamanho ou volume do mesmo, foi o principal fator a influenciar a produtividade. Os coeficientes de variao para a produtividade, peso mdio do bulbo e dimetro mdio do bulbo, foram 18,4%, 16,6% e 8,0%, respectivamente (Tabela 1). Em Tiet foram detectadas cinco classes para a produtividade. O acesso Bulbilho Areo 2 com produtividade de 14,9 t ha-1, e o acesso Piedade com produtividade de 13,4 t ha-1, superaram estatisticamente os demais. Na segunda classe ficaram os acessos Gigante de Curitibanos e Andradas Manoel Lopes 2, que produziram 10,9 t ha-1 e 10,1 t ha-1, respectivamente. O acesso Gigante de Curitibanos foi o padro de referncia neste experimento devido a sua expresso no cultivo comercial. Comparando a produtividade de acessos do experimento em Tiet com os obtidos por Lisbo et al. (1991) no mesmo local, duas consideraes merecem ser destacadas. Primeiro, a maior produtividade obtida no ano de 1988 pelos autores com o acesso Lavnia foi de 12,8 t ha-1, o que no muito diferente das produtividades expressas no presente experimento para os acessos Bulbilho Areo 2 e Piedade. Segundo, os acessos de melhor produtividade no trabalho de Lisbo et al. (1991) revelaram uma produtividade bem abaixo no experimento atual, com exceo de Mineiro que havia produzido 7,9 t ha-1 e agora produziu 7,6 t ha-1. Este resultado pode ser explicado pela interao entre gentipo e ambiente. Resultados semelhantes s produtividades dos acessos foram obtidos para
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Mdias do nmero de bulbos (mil ha-1), produtividade (t ha), peso mdio do bulbo (g), e dimetro mdio do bulbo (mm) de 50 acessos de alho do banco ativo de Germoplasma do IAC em Tiet, IAC, 2003.
Acesso Bulbilho Areo 2 Piedade Gigante de Curitibanos Andradas Manoel Lopes 2 BGH 5952 Mendona 5062 Roxo Capim Catetinho do Paran Mineiro Tatu 3705 Canela de Ema BGH 5935 BGH 5947 Bom Repouso Santa Catarina Roxo Gigante Tiet Cateto Precoce I-99 Cateto Roxo So Jos 4999 BGH 5963 Peruano Biso BGH 4842 Santa Catarina Branco Lavnia 3208 BGH 5936 Areal n2 3978 BGH 6394 Car Sacaia Goinia BGH 4823 Chins Esalq Vera Cruz 5004 Do Reino de Araras Formosa 4713 Andradas Manoel Lopes 1 Roxo Araras Chins 4653 Mexicano Lavnia 1632 Gravata Assa 3702 BGH 0525 Roxinho 5063 Alho Preto Roxo Mineiro Mossor BGH 4814 Amarante Embrapa Roxo de Araras 2 Cajuru 2315 C.V. (%) F Nmero de bulbos (mil ha-1) 1 266,0 a 280,0 a 266,0 a 274,0 a 300,0 a 280,0 a 280,0 a 274,0 a 280,0 a 266,0 a 280,0 a 280,0 a 294,0 a 266,0 a 266,0 a 280,0 a 274,0 a 294,0 a 274,0 a 266,0 a 280,0 a 266,0 a 280,0 a 280,0 a 280,0 a 260,0 a 246,0 a 266,0 a 294,0 a 266,0 a 286,0 a 280,0 a 274,0 a 274,0 a 274,0 a 274,0 a 286,0 a 266,0 a 274,0 a 266,0 a 254,0 a 286,0 a 280,0 a 280,0 a 260,0 a 266,0 a 260,0 a 274,0 a 266,0 a 260,0 a 7,1 0,9ns Produtividade Peso mdio (t ha) 1 do bulbo (g) 1 14,9 a 13,4 a 10,9 b 10,1 b 8,6 c 8,4 c 8,2 c 7,9 c 7,6 c 7,6 c 7,2 d 6,8 d 6,4 d 6,4 d 6,3 d 6,2 d 6,2 d 6,0 d 5,8 d 5,8 d 5,7 d 5,6 d 5,6 d 5,4 d 5,3 d 5,3 d 5,1 d 5,0 e 5,0 e 4,8 e 4,7 e 4,7 e 4,7 e 4,7 e 4,6 e 4,6 e 4,6 e 4,5 e 4,2 e 4,2 e 4,1 e 4,0 e 3,9 e 3,9 e 3,8 e 3,8 e 3,5 e 3,3 e 2,9 e 2,5 e 18,4 18,4* * 55,8 a 47,9 b 40,8 c 36,9 c 28,9 d 30,1 d 29,1 d 28,8 d 27,3 d 28,3 d 25,7 d 23,7 e 21,7 e 23,8 e 23,5 e 22,3 e 22,7 e 20,3 e 21,3 e 21,9 e 20,3 e 21,3 e 20,2 e 19,3 f 19,2 f 20,5 e 20,8 e 18,8 f 16,9 f 18,1 f 16,5 f 16,9 f 17,3 f 17,3 f 16,8 f 16,8 f 16,0 f 16,8 f 15,6 f 15,8 f 16,3 f 14,2 f 13,8 f 13,8 f 14,5 f 14,1 f 13,6 f 11,9 f 10,6 f 9,8 f 16,6 15,1* * Dimetro mdio do bulbo (mm) 1, 2 48,9 a 49,3 a 44,6 b 42,3 b 39,8 b 37,9 c 37,5 c 36,1 c 36,2 c 37,5 c 35,4 c 34,0 d 35,0 c 36,5 c 36,4 c 35,2 c 36,2 c 32,3 d 33,8 d 33,3 d 32,4 d 32,5 d 33,3 d 32,7 d 32,2 d 31,5 e 33,3 d 33,1 d 33,0 d 32,2 d 30,4 e 33,0 d 31,0 e 31,0 e 32,7 d 30,6 e 30,2 e 32,3 d 29,2 e 31,2 e 29,4 e 27,5 f 28,3 f 28,5 f 25,0 f 30,8 e 27,8 f 27,0 f 26,8 f 26,3 f 8,0 10,9* *

1 Mdias seguidas pela mesma letra na coluna no diferem entre si (teste de Scott-Knott, 5%); 2Baseado na mdia aritmtica de 3 bulbos/parcela (0,35 m2), escolhidos ao acaso; ** Efeito de acessos (P < 0,01); nsAusncia de efeito de acessos.

937

P. E. Trani et al.

Tabela 2. Mdias do nmero de bulbos (mil ha-1), produtividade (t ha), peso mdio do bulbo (g), e dimetro mdio do bulbo (mm) de 50 acessos de alho do banco ativo de Germoplasma do IAC em Jundia, IAC, 2003.
Acesso Bulbilho Areo 2 Piedade Gigante de Curitibanos BGH 5952 Lavnia 1632 Roxo Capim Andradas Manoel Lopes 2 BGH 5935 Mineiro Tatu 3705 Gigante Tiet BGH 4842 Peruano Biso Mendona 5062 Chins Esalq BGH 5947 Cateto Roxo Areal n2 3978 Bom Repouso Santa Catarina Roxo Lavnia 3208 So Jos 4999 Catetinho do Paran Cateto Precoce I-99 Mexicano Sacaia Goinia 24 Chins 4653 BGH 6394 BGH 0525 Car BGH 5963 Vera Cruz 5004 Roxo Mineiro BGH 5936 Cajuru 2315 Formosa 4713 Roxinho 5063 BGH 4814 Amarante Embrapa Santa Catarina Branco Andradas Manoel Lopes 1 Roxo Araras Roxo de Araras 2 Do Reino de Araras Alho Preto Mossor Assa 3702 Canela de Ema Gravata C.V. (%) F Nmero de bulbos (mil ha-1) 1 273,0 a 287,0 a 273,0 a 287,0 a 273,0 a 287,0 a 280,0 a 280,0 a 287,0 a 280,0 a 287,0 a 273,0 a 296,3 a 287,0 a 296,3 a 280,0 a 326,7 a 287,0 a 263,7 a 310,3 a 280,0 a 287,0 a 287,0 a 296,3 a 287,0 a 273,0 a 343,0 a 256,7 a 296,3 a 263,7 a 273,0 a 287,0 a 280,0 a 303,3 a 256,7 a 287,0 a 280,0 a 263,7 a 287,0 a 310,3 a 280,0 a 280,0 a 240,3 a 296,3 a 296,3 a 303,3 a 287,0 a 233,3 a 263,7 a 280,0 a 8,6 1,7* Produtividade Peso mdio (t ha) 1 do bulbo (g) 1 13,1 a 11,6 b 11,4 b 9,8 c 9,6 c 9,3 c 9,0 c 8,7 d 8,6 d 8,3 d 8,1 d 8,1 d 7,5 e 7,4 e 7,2 e 7,1 e 7,1 e 7,0 e 7,0 e 7,0 e 6,9 e 6,7 f 6,5 f 6,5 f 6,5 f 6,5 f 6,3 f 6,3 f 5,9 f 5,7 g 5,6 g 5,6 g 5,6 g 5,5 g 5,4 g 5,4 g 5,4 g 5,3 g 5,2 g 5,2 g 5,1 g 5,1 g 5,1 g 5,0 g 4,9 g 4,5 h 4,5 h 4,4 h 3,4 i 3,1 i 7,8 42,9* * 48,0 a 40,5 b 41,7 b 34,3 c 35,3 c 32,4 c 32,2 c 31,0 d 29,9 d 29,8 d 28,3 d 29,8 d 25,3 e 25,7 e 24,3 e 25,3 e 21,7 f 24,5 e 26,7 e 22,6 f 24,6 e 23,3 f 22,8 f 21,9 f 22,5 f 23,6 e 18,5 g 24,4 e 20,1 g 21,5 f 20,7 f 19,7 g 19,9 g 18,1 g 21,2 f 18,8 g 19,3 g 20,1 g 18,0 g 16,7 g 18,3 g 18,3 g 21,0 f 16,8 g 16,7 g 14,7 h 15,5 h 18,7 g 12,8 i 11,0 i 8,2 46,1* * Dimetro mdio do bulbo (mm) 1, 2 39,3 c 47,3 a 45,3 a 38,3 c 39,3 c 38,7 c 40,7 b 35,0 d 32,3 e 35,3 d 41,7 b 36,0 d 32,7 e 37,0 d 32,3 e 33,0 e 30,3 e 33,7 e 33,0 e 36,3 d 32,0 e 35,3 d 33,3 e 34,7 d 32,7 e 31,0 e 30,3 e 31,7 e 31,7 e 29,7 e 32,0 e 32,0 e 31,0 e 23,7 g 31,0 e 31,0 e 29,0 f 27,7 f 28,7 f 27,0 f 28,7 f 32,3 e 29,7 e 28,7 f 28,0 f 26,3 f 41,7 b 24,0 g 20,7 h 26,7 f 5,1 30,6* *

1 Mdias seguidas pela mesma letra na coluna no diferem entre si (teste de Scott-Knott, 5%); 2Baseado na mdia aritmtica de 3 bulbos/parcela (0,3 m2), obtidos ao acaso; *Efeito de acessos (P < 0,05); ** Efeito de acessos (P < 0,01)

o peso mdio do bulbo no experimento em Tiet, no qual seis classes foram detectadas. O acesso Bulbilho Areo 2, com mdia de 55,8 g por bulbo, superou os demais. Na segunda classe destacou-se o acesso Piedade com mdia de 47,9 g por bulbo. O acesso Gigante de Curitibanos e Andradas Manoel Lopes 2, que produziram pesos mdios de bulbo de 40,8 e 36,9 g, respectivamente, ocuparam a terceira classe (Tabela 1). No experimento em Tiet foram obtidas seis classes para o dimetro mdio do bulbo, varivel relacionada ao tamanho de bulbos selecionados. Os acessos Piedade, com 49,3 mm e Bulbilho Areo 2, com 48,9 mm, superaram os demais. Os acessos Gigante de Curitibanos, Andradas Manoel Lopes 2 e BGH 5952, com 44,6 mm, 42,3 mm e 39,8 mm respectivamente, situaram-se em segundo lugar. As mdias referentes ao nmero de bulbos por hectare, produtividade (t ha-1), peso mdio do bulbo (g) e dimetro mdio do bulbo (mm) referentes aos 50 acessos avaliados em Jundia, bem como o valor de F da anlise de varincia e a comparao pelo teste de Skott-Knott encontram-se na Tabela 2. A anlise de varincia para o nmero de bulbos por hectare mostrou-se estatisticamente significativa para o experimento em Jundia. O teste de SkottKnott para esta varivel detectou apenas uma classe, demonstrando no haver diferena entre o nmero de bulbos por hectare de cada acesso avaliado. A semelhana entre o nmero de bulbos por hectare era esperada em funo da metodologia adotada no experimento e a uniformidade de brotao. Para o experimento em Jundia foram detectadas 9 classes de produtividade. O acesso Bulbilho Areo 2 foi o mais produtivo com 13,1 t ha-1 superando os demais. Na classe seguinte esto os acessos Piedade e Gigante de Curitibanos, com magnitudes respectivas de 11,6 t ha-1 e 11,4 t ha-1 (Tabela 2). Estes acessos superam Lavinia 1632, que nos experimentos de Lisbo et al. (1991) e Lisbo et al. (1993), foi o mais produtiva em So Paulo, e que neste ensaio posicionou-se na terceira classe de produtividade, com 9,6 t ha-1, juntamente com outros acessos.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

938

Avaliao dos acessos de alho pertencentes coleo do Instituto Agronmico de Campinas

O teste Skott-Knott detectou 9 classes para o peso mdio do bulbo para os acessos cultivados em Jundia. O acesso Bulbilho Areo 2 superou os demais com mdia de 48,0 g por bulbo. Por sua vez, Piedade e Gigante de Curitibanos expressaram pesos mdios de bulbo semelhantes na segunda classe, com valores de 40,5 g e 41,7 g, respectivamente (Tabela 2). Para o dimetro mdio do bulbo, o maior valor em magnitude foi verificado para o acesso Piedade, com 47,3 mm, que no diferiu do acesso Gigante de Curitibanos, que expressou 45,3 mm de dimetro. Estes acessos foram superiores em dimetro aos acessos Mossor e Andradas Manoel Lopes 2, que produziram dimetro mdio de bulbo de 41,7 mm e 40,7 mm, respectivamente. Houve semelhana de resultados entre os dois locais quando se comparam o peso mdio do bulbo com a produtividade e com o dimetro do bulbo. A exceo no experimento em Jundia (Tabela 2) foi o acesso Mossor que apresentou baixa produtividade (4,5 t ha-1) e cabea grande (41,7 mm). Portanto, os melhores tamanhos de bulbo aliados boa produtividade em Jundia foram alcanados pelos acessos Piedade e Gigante de Curitibanos. As produtividades foram maiores do que a produtividade normal para o alho em So Paulo, que de 4 a 8 t/ha (LISBO et al., 1993; TAVARES et al., 1998). Apesar da produtividade do acesso

Bulbilho Areo 2 ter sido de 13,1 t ha-1, comercialmente o dimetro mdio do seu bulbo classifica o acesso em categoria inferior dos acessos Piedade e Gigante de Curitibanos, em razo de variaes de 36 a 45 mm do dimetro serem classificadas como tamanho 4, ao passo que variaes de 46 a 55 mm classificam o gentipo como tamanho 5 (TRANI et al., 1997), o que um fator importante no valor monetrio para o alho. Os acessos Piedade e Gigante de Curitibanos exibiram excelente desempenho para produtividade e qualidade do bulbo, nos dois locais avaliados. Em contraposio, os acessos Bulbilho Areo 2 e Andradas Manoel Lopes 2 apresentaram interao com o ambiente, o primeiro para o tamanho do bulbo e o segundo para a produtividade. Aos agricultores, recomenda-se o plantio experimental destes quatro acessos de alho, porque revelaram produtividade e qualidade superior em relao s cultivares tradicionalmente plantadas.

LITERATURA CITADA
CAMARGO FILHO, W.P. rea e produodos principais produtos da agropecria do estado de So Paulo: levantamento subjetiva estado de So Paulo. So Paulo, 2003. Disponvel em: <http://www.iea.sp.gov.br/out/ ibcoiea.php >. Acesso em: 27 ago. 2004. CAMARGO FILHO, W.P.; TRANI, P.E.; SIQUEIRA, W.; BERNHARDT, L.W.; MAZZEI, A.R.; SILVA, C.G.; URYU, E.N.; CABRERA FILHO, J. Repensando a agricultura paulista cadeias produtivas do alho, da cebola e condimentos. So Paulo, 86 p., 1996. (no publicado)

DALLAMARIA, G.C.M. A cultura do alho no Brasil. Batata Show, ano 3, n.6, p.32-33, 2003. FERREIRA, D.F. Programa Sisvar verso 4.3 (Build 45). DEX/UFLA, Lavras (MG). Disponvel em :<http://www.dex.ufla.br/danielff/ dff02.htm>. Acesso em: 15 mar. 2005. GOMES, F.P. Curso de estatstica experimental. 4a. ed. So Paulo: Livraria Nobel, 1970, 430 p. INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATSTICA Produo Agrcola Municipal: Alho. Braslia, 2002. Disponvel em: <http:// w w w. s i d r a . i b g e . g o v. b r / b d a / t a b e l a / protabl.asp?z=t&o=1&i=P>. Acesso em 27 ago. 2004. LISBO, R.S.; FORNASIER, J.B.; GROPPO, G.A.; NEVES, J.P.S.; BARBOSA, L.A.V.; INADA, I.; RODRIGUES, A.; VERAGUAS, S.; FERNANDES, S.C.S. Avaliao de cultivares de alho. Campinas, Coordenadoria de Assistncia Tcnica Integral. Programa de Pesquisa e Adaptao de Tecnologias Regionais, n.22, mai. 1991. LISBO, R.S.; SIQUEIRA, W.J.; FORNASIER, J.B.; TRANI, P.E. Alho. In: FURLANI, A.M.C.; VIEGAS, G.P., Ed. O melhoramento de plantas no Instituto Agronmico. Campinas, Instituto Agronmico, 1993. p.222-253. 524 p. SIQUEIRA, W.J.; TAVARES, M.; TRANI, P.E. Variedades de alho para o estado de So Paulo. Campinas, Instituto Agronmico, 1996. 26 p ( Boletim Tcnico, 165) TAVARES, M.; TRANI, P.E.; SIQUEIRA, W.J. Alho. In: Instrues agrcolas para as principais culturas econmicas, editado por Joel Irineu Fahl, Marcelo Bento Paes de Camargo, Maria Anglica Pizzinatto, Juarez Antonio Betti, Arlete Marchi Tavares de Melo, Isabela Clerici Demaria e Angela Maria Cangiani Furlani. 6. ed. rev. atual. Campinas, Instituto Agronmico, 1998. p.175-176. (Boletim IAC, 200). TRANI, P.E.; TAVARES, M.; SIQUEIRA, W.J.; SANTOS, R.R.; BISO, L.G.; LISBO, R.S. Cultura do alho: recomendaes para seu cultivo no estado de So Paulo. Campinas, Instituto Agronmico, 1997. 39 p (Boletim Tcnico, 170)

Hortic. bras., v. 23, n. 4, out.-dez. 2005

939

FERREIRA, M.D.; KUMAKAWA, M.K.; ANDREUCCETTI, C.; HONRIO, S.L.; TAVARES, M.; MATHIAS, M.L. Avaliao de linhas de beneficiamento e padres de classificao para tomate de mesa. Horticultura Brasileira, Braslia, v.23, n.4, p.940-944, out-dez 2005.

Avaliao de linhas de beneficiamento e padres de classificao para tomate de mesa


M.D. Ferreira1; M.K. Kumakawa2; C. Andreuccetti1; S.L. Honrio1; M. Tavares3; M.L. Mathias2
1 UNICAMP, Fac. Eng. Agrcola, Conselho Integrado de Tecnologias de Processos, Distrito Baro Geraldo, C. Postal 6011, 13083-875 Campinas-SP; E-mail: marcos.ferreira@agr.unicamp.br, 2UNICAMP, Fac. Eng. Mecnica, Campinas-SP; 3Universidade Federal de Uberlndia, Fac. Matemtica, Av. Joo Naves de vila, 2121, 38408-100 Uberlndia-MG.

RESUMO
Atualmente, existem disponveis no mercado brasileiro alternativas quanto a equipamentos de beneficiamento e classificao para tomate de mesa, sendo os mais comuns aqueles que realizam a padronizao atravs dos parmetros tamanho e peso do produto. Neste trabalho realizou-se um levantamento em cinco unidades de beneficiamento e classificao para tomate de mesa, localizadas na regio de Campinas (SP), caracterizando o tipo de equipamento, seu funcionamento, as etapas envolvidas no processo e aferindo a classificao utilizada pelos galpes, comparando-a com aquela determinada pelo Programa Brasileiro para a Modernizao da Horticultura, desenvolvido pela Companhia de Entrepostos e Armazns Gerais de So Paulo, Ceagesp. A classificao dos tomates foi realizada medindo-se os dimetros transversais dos frutos por meio de um paqumetro digital. Na avaliao das linhas de beneficiamento e classificao, observou-se grande variao nas etapas do processo: quanto s dimenses, determinou-se aproximadamente 99% de diferena entre os comprimentos aferidos; quanto ao nmero e ao tipo de escovas, na etapa de lavagem encontrou-se o mnimo de 4 escovas e o mximo de 19 escovas nylon, na etapa de secagem o mnimo de 5 e o mximo de 15 escovas espuma (poliuretanopoliter), e na etapa da segunda secagem, incluindo o polimento, o mnimo de 6 e o mximo de 64 escovas, preferencialmente de origem animal, crina. Observou-se ainda para os padres de classificao maiores o no cumprimento das normas nos galpes de beneficiamento avaliados. Das 14 amostragens realizadas nas 5 unidades de beneficiamento, 57,2% enquadraram-se s normas de classificao recomendadas. Palavras-chave: Lycopersicon esculentum Mill, escovas, galpes, normas, dimetros de frutos.

ABSTRACT
Evaluation of packing lines and classification standards for fresh market tomatoes in Brazil Currently, are available in the Brazilian market some alternatives of packing and standardization equipment for fresh market tomatoes. The most common ones classify the fruits through their size and weight. Five packing line units for classifying fresh market tomatoes, located in the Campinas region, Brazil, were evaluated. The type of equipment was characterized; the involved steps in the process, and the working functions were analysed. A comparison was done between the classification recommended by the Brazilian Program for the Modernization of the Horticulture (developed by the CEAGESP), and those used in the different packing houses evalkuated. The classification was carried out measuring the transversal diameter of the fruits with a digital paquimeter. A large variation was observed (99%) in the length of the packing lines. In the washing step the number of brushes varied from 4 to 19 nylon brushes. In the drying step, the number of foam brushes (polyurethane-polyether) ranged from 5 to 15, and from 6 to 64 brushes of animal origin (horse poil mainly) in the second drying and polishing step. For bigger classification standards a lack of fulfillment of the norms was observed. From the 14 samples taken in the 5 packing houses, only 57.2% worked accordingly to the recommended norms.

Keywords: Lycopersicon esculentum Mill, brushes, packing houses, standards.

(Recebido para publicao em 15 de agosto de 2004 e aceito em 3 de agosto de 2005)

egundo Canado Jr. et al. (2003), o tomateiro a segunda hortalia cultivada no mundo, sendo que em quantidade produzida superada apenas pela batata. Das 108.499.056 t mtricas de produo mundial de tomate em 2002, 3.518.163 foram produzidas pelo Brasil, colocandoo como oitavo produtor mundial, correspondendo a uma rea colhida de 62.291 ha. O volume comercializado na Ceagesp (SP) neste mesmo ano foi de 243.794 t, sendo o tomate salada responsvel por 189.405 t, com preo mdio de R$0,85/kg baseado no volume comercializado na Ceagesp (FNP CONSULTORIA
940

& AGROINFORMATIVOS, 2004). Os mesmos autores afirmaram que uma boa alternativa para aumentar a lucratividade dos produtores otimizar a logstica de produo, colheita e distribuio do tomate, o que acarretaria numa melhora de qualidade do produto e numa diminuio das perdas ps-colheita. As perdas na ps-colheita podem ser causadas por danos mecnicos, armazenamento imprprio, manuseio excessivo, transportes inadequados e grande tempo de exposio no varejo. Danos mecnicos devido a impactos, compresso, vibrao, cortes e ra-

chaduras esto relacionados com alteraes fisiolgicas, metablicas, de aroma, sabor e qualidade em diversos produtos hortcolas (MORETTI et al . , 1998). Danos mecnicos podem ser ocasionados por uma pequena fora, por impacto com outro fruto ou em uma superfcie dura, sendo cumulativos durante as prticas de manuseio ps-colheita (MOHSENIN, 1986; SARGENT et al., 1992). Portanto, as etapas de manuseio do produto, desde o campo at o consumidor, devem ser cuidadosamente coordenadas e integradas para maximizar a qualidade final do produto
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Avaliao de linhas de beneficiamento e padres de classificao para tomate de mesa

(SARGENT et al, 1992). Hyde e Zhang (1992) relatam que as escovas utilizadas em uma linha de beneficiamento e classificao possuem diferentes velocidades de acordo com a sua finalidade. Porm, a velocidade excessiva das escovas e/ou a excessiva exposio a elas, tambm podem causar danos aos frutos, em especial se as escovas utilizadas possurem superfcies pontiagudas e rgidas. Uma linha de beneficiamento e classificao de frutas e hortalias composta por etapas como recebimento, prseleo, lavagem, secagem, classificao e embalagem (MILLER et al . , 2001). Segundo Ferreira et al. (2004), os frutos so avaliados, dentre outros parmetros, pelo tamanho que, por sua vez, medido atravs da circunferncia ou dimetro transversal. Para Belm (2003), a classificao garante um padro nico para os produtores, atacadistas e consumidores finais, promove maior facilidade na comercializao, possibilitando que os melhores agricultores possam ter seus produtos valorizados, diminuindo as perdas, alm de garantir ao consumidor um elevado padro de qualidade de frutas e hortalias. A classificao do tomate de mesa tambm interfere na qualidade final, uma vez que este suscetvel a danos provocados pelo manuseio incorreto, seja da classificao manual ou da mecnica. Produtos com caractersticas de tamanho e peso padronizados so mais fceis de ser manuseados em grandes quantidades, pois apresentam menores perdas, produo mais rpida e melhor qualidade (CHITARRA; CHITARRA, 1990). Objetivou-se com este trabalho caracterizar os equipamentos (nacionais e importados) de beneficiamento e classificao para tomate de mesa em cinco unidades localizadas na regio de Campinas (SP), identificando as etapas envolvidas no processo e os parmetros de funcionamento tais como material utilizado, tipo de classificadora, escovas empregadas na etapa de limpeza e lavagem. Estabeleceu-se tambm o relacionamento entre a classificao utilizada pelas unidades referidas com a recomendada pelo Programa Brasileiro para a Modernizao da Horticultura
Hortic. bras., v. 23, n. 4, out.-dez. 2005

(CEAGESP, 2000), verificando se as normas preconizadas estavam sendo cumpridas.

MATERIAL E MTODOS
A caracterizao dos equipamentos de beneficiamento e classificao foi realizada pela identificao dos materiais utilizados na construo do classificador, das medidas de rotao de operao das esteiras de lavagem, secagem e polimento. Dimensionou-se o tipo de mquinas beneficiadoras empregadas por meio de medidas feitas com o auxlio de uma trena profissional. Foi mensurado o tamanho de cada etapa do equipamento, aferindo-se tanto o comprimento quanto as larguras interna e externa. Na etapa de limpeza, polimento e secagem, identificaram-se a quantidade e qualidade das escovas utilizadas, classificando o material das escovas de acordo com sua origem em vegetal, animal e sinttico. Para avaliao das condies das escovas foi utilizada uma escala de notas de 1 a 5, correspondente ao nvel de conservao das escovas (1=escovas em pssimo estado de conservao, com ausncia no nmero de cerdas; 2=estado de conservao ruim, mas sem falhas na escova; 3=intermedirio, escovas em uso, com cerdas eretas, mas apresentando algum desgaste por uso; 4=escovas novas com pouco uso; 5=escovas recm instaladas). Foram avaliadas as escovas nas etapas referentes lavagem, secagem e polimento. Aferiu-se a rotao de operao das escovas (rpm) nas etapas j mencionadas atravs da determinao de um ponto de referncia, utilizando-se um cronmetro de preciso, considerando um minuto como tempo padro. Realizaram-se cinco repeties para cada grupo de escovas, considerando-se como resultado final a mdia das repeties. A eficincia do processo de classificao foi avaliada por medies do dimetro transversal dos frutos. Verificouse sua adequao dentro das normas de padro e classificao indicadas pelo Programa Brasileiro para a Modernizao da Horticultura (CEAGESP, 2000), determinando-se a eficincia dos equipamentos utilizados nas unidades pesquisadas. A metodologia baseou-se

em recomendaes de Sargent et al. (1991) e Lopez Camelo et al. (2003). Amostras foram coletadas nos padres de classe (dimetros) 3A, 2A e 1A, conforme disponibilidade nos galpes, respectivamente equivalente s classes Grande, Mdio e Pequeno (CEAGESP, 2000), denominaes mais usadas aps embalamento, em um nmero de 100 frutos para cada padro de classificao. A anlise dos resultados foi feita pelo Teste t, para um intervalo de confiana de 90%. A confiabilidade de 90% para o mtodo foi adotada segundo o limite de tolerncia para mistura de tomates pertencentes a classes diferentes, que no deve ultrapassar 10% de frutos que pertenam classe imediatamente superior e/ou inferior, conforme descreve o Programa Brasileiro para a Modernizao da Horticultura (CEAGESP, 2000) e Ferreira et al. (2004).

RESULTADOS E DISCUSSO
As cinco unidades de beneficiamento e classificao estudadas foram nomeadas de Galpes 1 a 5, sendo que todos trabalhavam com capacidade inferior mxima. Galpes 1, 2 e 3 eram compostos de equipamentos mistos, etapa de recebimento e limpeza (lavagem, secagem e polimento) de origem nacional, e classificao com maquinrio importado. Galpes 1 e 3 utilizavam-se da classificao por dimetro e cor; Galpo 2, classificao por peso e cor. Galpo 4 possua linha de beneficiamento e classificao por peso importada, sendo a classificao por cor realizada manualmente. Galpo 5, beneficiamento e classificao por dimetro em equipamento nacional atravs da esteira de lona. Os Galpes 1, 2 e 5 classificavam, no perodo da pesquisa, frutos com formato redondo e os Galpes 3 e 4, tomates oblongos (CEAGESP, 2000). Quanto caracterizao das etapas das linhas de beneficiamento e classificao observa-se, na Tabela 1, um diferencial entre os comprimentos das etapas constituintes do equipamento de beneficiamento, bem como no comprimento total desta, que neste caso variou de 18,84 m a 37,49 m. Constatou-se que somente em um galpo o recebimento
941

M. D. Ferreira et al.

Tabela 1. Caracterizao dimensional (comprimento, m) em cinco unidades de beneficiamento e classificao para tomate de mesa. Campinas, UNICAMP, 2003.
Etapas Tanque Recebimento Recebimento Lavagem Esteira Secagem Secagem 2/Polimento Seleo Sada Seleo Etapa Alimentao Entrada Colorimetro Colorimetro Sada Colorimetro Linha Classificao Total Dimenses dos galpes de beneficiamento (m) Galpo 1 EI* 3,47 1,92 EI* 1,75 3,8 EI* EI* 6,28 EI* 1,8 EI* 6,44 25,46 Galpo 2 EI* 2,24 2,45 EI* 0,75 2,4 4,8 2,45 EI* 2,85 1 1,85 16,7 37,49 Galpo 3 EI* 2 2,45 1,55 0,93 0,93 EI* EI* 1,62 EI* 1,7 EI* 9,52 20,7 Galpo 4 4,57 3,1 1,43 EI* 1,43 3,86 EI* EI* 5,7 EI* EI* EI* 9 29,09 Galpo 5 EI* 3,4 2,1 EI* 1,65 3,8 2,5 EI* EI* EI* EI* EI* 5,39 18,84

*EI = etapa inexistente.

Tabela 2. Classificao das escovas em cinco galpes de beneficiamento e classificao para tomates de mesa, quanto ao nmero e material utilizado nas etapas de lavagem, secagem e polimento. Campinas, UNICAMP, 2003.
Etapas Galpes Lavagem N Escovas 1 2 3 4 5 15 19 10 4 16 Material Nylon Crina Nylon Nylon Nylon Secagem N Escovas 15 5 9 6 14 Material Espuma Espuma Espuma Espuma Espuma Secagem2/Polimento N Escovas 30 64 16 6 30 Material Crina PVC Crina Nylon Crina

Tabela 3. Rotaes das escovas nas diferentes etapas em cinco galpes de beneficiamento e classificao para tomate de mesa. Campinas, UNICAMP, 2003.
Galpes 1 2 3 4 5 Etapas (rotao rpm) Lavagem 162 76 102 46 168 Lavagem 2 EI* EI* 77 EI* EI* Secagem 118 119 26 46 115 Secagem 2 EI* EI* 26 EI* 148 Polimento 118 11 26 46 131

*EI = etapa inexistente.

ocorreu em tanques de gua. Importante salientar que essas diferenas de comprimento encontradas podem estar relacionadas ao tipo de classificador utilizado e ao volume dirio de produo. Outro aspecto observado refere-se s dimenses da etapa de limpeza (lavagem, secagem e polimento) que diferiram entre as unidades pesquisadas. To942

davia, no eram proporcionais ao comprimento mximo de cada linha, ocorrendo, portanto, equipamentos com menores dimenses totais, mas proporcionalmente com maiores dimenses nas etapas de limpeza. O Galpo 4 apresenta o menor nmero de escovas nas trs etapas (Tabela 2). Enquanto que na etapa de Secagem2/

Polimento o Galpo 2 apresentou o maior nmero. Esta mquina de classificao no utilizava escovas no polimento, somente realizando secagem. Observa-se portanto uma grande diferena no nmero e tipos de escovas nas linhas de beneficiamento avaliadas. Miller et al. (2001) relatam que a utilizao de escovas transversais para limpeza praticamente universal para frutas e hortalias, juntamente com a aplicao de algum detergente ou desinfetante. O fruto deve ser localizado imediatamente sobre o espao entre a primeira e segunda escova, mas no sobre a escova, porque cada linha de frutas passar entre as escovas. As escovas da maioria dos galpes estavam em condies razoveis, nota 3 na escala proposta. Pode-se destacar os Galpes 2 e 3 por terem apresentados as escovas em melhores condies, notas 4 e 5. A etapa de polimento apresentou escovas em melhores condies de funcionamento enquanto que as da etapa de secagem estavam em condies mais comprometedoras (nota 2). Para que o processo de limpeza seja efetivo e para o adequado funcionamento das escovas, estas devem ser continuadamente verificadas, pois ocorre desgaste por uso, com o acmulo de impurezas, as quais prejudicam o seu apropriado funcionamento. Para tanto, revises peridicas so recomendadas (SARDI, 2001). Observa-se na rotao das escovas das etapas de lavagem, secagem e polimento, diferenas entre os galpes (Tabela 3). Nota-se que o Galpo 4 apresentou uma rotao baixa em todas as etapas, enquanto que os Galpes 1 e 5 se destacaram pela elevada rotao. Hyde e Zhang (1992) relatam que uma reduo na velocidade das escovas reduz a intensidade das injrias causadas pelas escovas e pela abraso de um fruto contra o outro. Com a reduo da velocidade das escovas, ocorre uma conseqente reduo no nmero de impactos por segundo, porm, com a reduo do fluxo do produto, o impacto total pelo choque de fruta contra fruta pode continuar o mesmo. Assim, recomenda-se para cultivares de maior sensibilidade uma reduo na velocidade das escovas, mas com um fluxo normal de operao dos frutos.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Avaliao de linhas de beneficiamento e padres de classificao para tomate de mesa

Tabela 4. Resultados das classificaes dadas pelos diferentes Galpes conforme formato dos tomates. Campinas, UNICAMP, 2003.
Galpes Formato fruto Redondo 1 Redondo Redondo Redondo 2 Redondo Redondo 3 Oblongo Oblongo Oblongo 4 Oblongo Oblongo Oblongo 5 Oblongo Oblongo Varivel 1A 2A 3A 2A Md* 2A 3A 1A 2A 1A* * (Extrinha) 1A 2A 1A 2A 3A n1 100 100 100 100 100 100 100 100 100 100 100 100 100 100 Mdia (mm) 59,38 69,22 77,35 53,17 56,22 61,67 52,86 58,52 45,19 46,03 54,25 58,99 69,57 76,26 Desvio Intervalo Intervalo padro (mm) amostra (mm) padro* (mm) 2,96 3,43 5,22 2,82 2,48 4,43 3,35 3,18 2,98 2,88 4,30 2,58 3,47 2,95 58,89-59,87 68,65-69,79 76,48-78,22 52,71-53,64 55,80-56,63 60,94-62,41 52,31-53,42 57,99-59,05 44,70-45,69 45,55-46,51 53,53-54,96 58,56-59,42 68,99-70,15 75,77-76,75 50-65 65-80 Acima de 80 65-80 65-80 Acima de 80 40-50 50-60 40-50 40-50 50-60 50-65 65-80 Acima de 80 Condio Adequado Adequado Inadequado Inadequado Inadequado Inadequado Inadequado Adequado Adequado Adequado Adequado Adequado Adequado Inadequado

*Esta unidade no utilizava classificao 1A, mas considerava esta como a de menor dimetro. **Unidade 4 considerava o menor dimetro como extrinha (1A), no existindo a classificao 3A.

Quanto aos padres de classificao, observa-se na tabela 4 os resultados referentes verificao ou no da adequao dentro das normas para todos os galpes pesquisados. Os parmetros indicados nas tabelas so: Varivel (classificao adotada pelos Galpes pesquisados); n1 (tamanho da amostra por padro de classe); Mdia (mdia dos dimetros amostrados, mm); DP (Desvio Padro da amostra, mm); Intervalo da amostra (intervalo calculado a partir do Teste t com intervalo de confiana de 90%, conforme metodologia); e Intervalo padro, intervalo de dimetros indicados pela CEAGESP (2000) para diferentes padres de classe. No Galpo 1, observa-se que, para as classes de dimetros 1A e 2A, as normas foram atendidas, admitindo-se tolerncia de mistura de 10%, conforme indica CEAGESP (2000). Ou seja, diante das anlises, determinou-se que o Intervalo da amostra est contido no Intervalo padro. Para tomate 1A, dentro da amostragem de 100 frutos, 98 deles enquadravam-se nas normas de padro e classificao da CEAGESP. Para tomate 2A, 96 frutos atenderam a classificao conforme norma. Enquanto que para os tomates classificados como 3A, 27 frutos estavam de acordo com a legislao, isto significa que o Intervalo da amostra no pertence ao
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Intervalo padro, o primeiro estando abaixo do segundo. Logo, tomates que foram classificados como Grande (3A) estavam sendo supervalorizados, sendo mais adequada a classificao tamanho Mdio (2A). Todavia para Galpo 2, observa-se diferena entre a classificao dada por essa unidade de beneficiamento e a classificao indicada pela Ceagesp, para todos os nveis de classe analisados. Os intervalos das amostras no esto contidos nos intervalos padres de classificao, sendo aqueles inferiores a esses. Neste caso, todos os tomates dessa unidade, durante a poca da pesquisa, estavam sendo supervalorizados. Os tomates classificados como Mdio (2A) e Grande (3A) so, conforme norma Ceagesp (2000), tomates de tamanho Pequeno, com dimetros variando de 50 a 65 mm. J no Galpo 3, o tomate classificado como 1A, est sendo desvalorizado, uma vez que o Intervalo da amostra est acima do Intervalo padro, ou seja, o adequado seria denominar o tomate como 2A (tamanho Mdio) e no como 1A (Pequeno). Para a outra classe analisada (2A), determinou-se que a norma estava sendo atendida, com 71 frutos correspondendo a classificao conforme Ceagesp (2000). O Intervalo da amostra est contido no Intervalo padro.

No caso do Galpo 4, levantou-se que, para todos os nveis de classes pesquisados (1A, 1A Extrinha e 2A), as normas foram atendidas de maneira satisfatria segundo os padres de classificao da Ceagesp (2000). Os intervalos das amostras esto contidos nos intervalos padres indicados pela legislao. Encontraram-se 94 frutos enquadrados na norma para as classificaes 1A e 1A Extrinha e para tomate 2A, obtiveram-se 80 frutos com dimetros de acordo com a norma. Dentre os tomates classificados pelo Galpo 5, aqueles denominados como 1A e 2A encontram-se dentro das normas sugeridas pela Ceagesp (2000), com 98 e 91 frutos, respectivamente, atendendo a legislao. J para o tomate classificado como 3A o Intervalo da amostra no est contido no Intervalo padro. O tomate, nesse caso, estava sendo supervalorizado, uma vez que deveria ter sido classificado como 2A (tamanho Mdio). A partir dessa anlise, observa-se que o tipo de equipamento utilizado nas diferentes unidades pesquisadas, bem como sua devida calibrao, afetaram os resultados de classificao para tomate de mesa. Os resultados mostram diferenas entre os galpes para beneficiamento de tomate quanto ao equipamento utilizado, dimenses externas, nmero e tipo de escovas e rotaes das escovas. Ob943

M. D. Ferreira et al.

serva-se atravs dessas informaes um potencial para pesquisas futuras, com a criao de parmetros para melhor funcionamento e eficincia nas etapas de uma linha de beneficiamento e classificao. Para a avaliao das normas de classificao, os menores padres (frutos com menores dimetros transversais) so coincidentes para o Padro Ceagesp (2000), enquanto as encontradas para os maiores padres no o so, na sua maioria, discordando dos resultados encontrados por Sargent et al. (1991). Os equipamentos que realizam classificao utilizando como padro o dimetro do fruto (Galpes 1, 3 e 5) atenderam em sua maioria (62,5%) as normas preconizadas pela Ceagesp (2000). Dos 37,5% equipamentos restantes que no estavam atendendo as normas nessas unidades, 25% estavam supervalorizando e 12,5% subvalorizando o produto. Os outros dois galpes (2 e 4) classificam os frutos por peso, porm, no foi possvel comparar as unidades, uma vez que em uma delas as normas no foram atendidas em nenhuma classificao realizada, enquanto que na outra unidade as classificaes dos frutos se adequaram s normas. Todas as unidades de classificao falharam em pelo menos uma classe, no atendendo os limites pr-estabelecidos e somente uma delas atingiu as normas da CEAGESP (2000) nas categorias classificadas. O melhor resultado obtido, nesse caso, contou com equipamento importado para a classificao atravs da aferio do peso dos frutos (Galpo 4). Porm, o tipo de equipamento, seja ele importado ou nacional, por si s, no satisfatrio para avaliar a eficincia das operaes de classificao. Deve-se atentar para outros quesitos, de acordo com Sargent et al. (1991), tais como a calibrao do equipamento (a freqncia e o rigor com que essa tarefa realizada) e a velocidade das esteiras transportadoras. No caso do no cumprimento da norma, segundo Lopez et al. (2003), as atribuies podem ser dadas seqncia de operaes e ve-

locidade das correias de transporte. Logo, a calibrao dos equipamentos deve ser feita freqentemente, com o intuito de evitar a desvalorizao ou a supervalorizao do produto, rotulandose o produto de acordo com a legislao, no prejudicando os consumidores finais. Faz-se necessrio a realizao de treinamento dos operadores, a fim de que esses possam efetuar a adequao dos equipamentos s classificaes, conforme os diferentes dimetros e variedades existentes, comparando-se o dimetro classificado com aquele indicado pela norma. No caso da classificao obtida no se adequar s normas, como encontrado na maioria dos galpes estudados nessa pesquisa, Gayet et al. (1995) afirmaram que indispensvel proceder eliminao manual dos frutos considerados fora de calibre e a sua incluso nos lotes correspondentes. Para a garantia de um produto de qualidade necessrio que as normas estabelecidas, nesse caso para tomate de mesa, se adaptem, de acordo com Ferreira et al . (2004), realidade agrcola com vistas as cultivares de diferentes formatos, tamanhos e cores. Por isso, relevante a formao de recursos humanos que possam dar apoio a essa realidade, a existncia de cursos e treinamentos para os trabalhadores e o compromisso dos produtores diante desses fatores.

AGRADECIMENTOS
Os autores agradecem a Fundao de Amparo a Pesquisa do Estado de So Paulo, FAPESP (O presente trabalho faz parte do Projeto UNIMAC).

LITERATURA CITADA
BELM, M.Q. Padronizao das frutas. Revista Agroamaznica . Disponvel em: <http:// www.revistaagroamazonia.com.br/12fruticultura04.htm>. Acesso em: out. 2003. CANADO JNIOR, F.L.; CAMARGO FILHO; W.P.; ESTANISLAU, M.L.L.; PAIVA, B.M.; MAZZEI, A.R.; ALVES, H.S. Aspectos econmicos da produo e comercializao do tomate para mesa. Informe Agropecurio, Belo Horizonte, 2003, v.24, n.219, p.7-18.

CEAGESP. Programa Brasileiro para Modernizao da Horticultura. Normas de Classificao do Tomate. Centro de Qualidade em Horticultura. CQH/CEAGESP. 2000. So Paulo (CQH. Documentos 26). CHITARRA, M.I.; CHITARRA, A.B. Ps-colheita de frutos e hortalias: fisiologia e manuseio. Lavras: ESAL/FAEPE, 1990. 320 p. FERREIRA, S.M.R., FREITAS, R.J.S., LAZZARI, E.N. Padro de identidade e qualidade do tomate (Lycopersicon esculentum Mill.) de mesa. Cincia Rural, Santa Maria, v.34, n.1, p.329335, 2004. FNP Consultoria & Agroinformativos. Anurio da Agricultura Brasileira Agrianual 2004. So Paulo: FNP, 2003, 496 p. GAYET, J.P.; BLEINROTH, E.W.; MATALLO, M.; GARCIA, E.E.C.; GARCIA, A.E.; ARDITO, E.F.G.; BORDIN, M.R. Tomate para exportao: procedimentos de colheita e ps-colheita. Ministrio da Agricultura, do Abastecimento e da Reforma Agrria, Secretaria do Desenvolvimento Rural, Programa de Apoio Produo e Exportao de Frutas, Hortalias, Flores e Plantas Ornamentais. Braslia: EMBRAPA-SPI, 1995. 34 p. (Srie Publicaes Tcnicas FRUPEX: 13). HYDE, G.M.; ZHANG, W. Apple Bruising Research Update: Packingline Impact Evaluations. Tree Fruit Postharvest Journal, v.3, n.3, p.12-15, 1992. LOPEZ CAMELO, A.F.; HORVITZ, S.; GOMEZ, P.A. An approach for the evaluation of efficiency of onion packinghouse operations. Horticultura Brasileira, Braslia, v.21, n.1, p.51-54, 2003. MILLER, W.M.; WARDOWSKI, W.F.; GRIERSON, W. Packingline Machinery for Florida Citrus Packinghouses. Extension Bulletin 239. Florida Cooperative Extension Service. Institute of Food and Agricultural Sciences, University of Florida. 2001, 26 p. Disponvel em: <http://edis.ifas.ufl.edu/BODY_AE184>. MOHSENIN, N.N. Physical properties of plant and animal materials. Vol. I. New York:Gordon Beach Science Publishers,1986, 841 p. MORETTI, C.L.; SARGENT, S.A.; HUBER, D.J.; CALBO, A.G.; PUSCHMANN, R. Chemical composition and physical properties of pericarp, locule, and placental tissues of tomatoes with internal bruising. Journal of the American Society for Horticultural Science, 1998, v.123, n.4, p.656-600. S.A.R.D.I SOUTH AUSTRALIAN RESEARCH AND DEVELOPMENT INSTITUTE, 10 th September 2001. Disponvel em: <http:// www.sardi.sa.gov.au/pages/horticulture/citrus/ cit_page.htm:sectID=184&tempID=93>. SARGENT, S.A.; BRECHT, J.K.; TALBOT, M.T.; ZOELNER, J.J. Performance of perforatedbelt sizers as affected by size standards for fresh market tomatoes. Applied Engineering in Agriculture, v.7, n.6, p.724-728, 1991. SARGENT, S.A.; BRECHT, J.K.; ZOELLNER, J.J. Sensitivity of tomatoes at mature-green and breaker ripeness stages to internal bruising. Journal of the American Society for Horticultural Science, v.117, n.1, p.119-123, 1992.

944

Hortic. bras., v. 23, n. 4, out.-dez. 2005

SANTOS, G.R.; CAF FILHO, A.C. Reao de gentipos de melancia ao crestamento gomoso do caule. Horticultura Brasileira, Braslia, v.23, n.4, p.945950, out-dez 2005.

Reao de gentipos de melancia ao crestamento gomoso do caule1


Gil Rodrigues dos Santos2; Adalberto C. Caf Filho3
2

Universidade Federal de Tocantins, Campus de Gurupi, C. Postal 66, 77400-000 Gurupi-TO; 3Universidade de Braslia, Depto. Fitopatologia, 70910-900 Braslia-DF; gilrsan@uol.com.br

RESUMO
Face importncia do crestamento gomoso do caule e escassez de relatos da reao de gentipos de melancia na literatura nacional e internacional, este trabalho teve por objetivo avaliar a resposta de gentipos comerciais de melancia ao crestamento gomoso. No campo, estudou-se o nvel de infeco nas folhas em delineamento de blocos ao acaso com nove cultivares de melancia e quatro repeties, com inoculao de duas plantas por parcela aos 43 dias aps o plantio (DAP). Foram avaliadas as cultivares Crimson Sweet, Onix, Rubi, Safira, Eureka, Georgia, Sheila, Savana e Riviera. Em casa de vegetao, estudou-se a infeco no caule em vasos, com delineamento inteiramente casualizado, com trs repeties, em esquema fatorial de 9 x 3, sendo o fator a = cultivares e o fator b = isolados. Foram avaliadas as mesmas cultivares do ensaio de campo, com inoculao artificial com disco de miclio aos 15 dias aps a semeadura, quando do surgimento da primeira folha definitiva. Os isolados de D. bryoniae utilizados na inoculao das plntulas foram: UnB 76 (Melo-DF), UnB 75 (Melancia-PE) e UnB 81 (Abbora-DF). Dentre as cultivares avaliadas no campo, Riviera mostrou-se mais resistente e apresentou menores (P<0,05) ndices de infeco foliar aos 74 e 79 dias aps plantio (DAP), e tambm menor valor da rea abaixo da curva de progresso de doena (AACPD). Foram altamente suscetveis Crimson Sweet, Rubi, Onix e Safira, que apresentaram os mais altos nveis de infeco nas folhas aos 74 DAP e tambm altos valores de AACPD. Na avaliao da doena no caule, em casa de vegetao, Riviera tambm apresentou a menor AACPD (P<0,05). Foi significativa a correlao (r=0,77) entre a resposta das cultivares em campo (resistncia das folhas) e em casa de vegetao (resistncia no caule). Palavras-chave: Citrullus lanatus, Didymella bryoniae.

ABSTRACT
Response of watermelon cultivars to gummy stem blight Gummy stem blight, caused by Didymella bryoniae, is one of the most important watermelon diseases. Nevertheless, there are relatively few published studies on the response of watermelon genotypes to the disease. This paper reports results of studies on the response of commercially available watermelon cultivars to gummy stem blight. Leaf infection was studied in a randomized complete block field experiment with nine watermelon genotypes and four replicates. Two plants per experimental plot were inoculated 43 days after planting. Cultivars Crimson Sweet, Onix, Rubi, Safira, Eureka, Georgia, Sheila, Savana and Riviera were evaluated. Stem infection was studied in the greenhouse, in a completely randomized design, with three replicates, in a 9 X 3 factorial, where plant cultivars corresponded to factor a and pathogen isolates corresponded to factor b. The same nine cultivars were examined following artificial inoculation with mycelial disks inserted into stems, 15 days after planting date, when plants were at the first adult leaf stage. The D. bryoniae isolates were UnB 76 (Melon-DF), UnB 75 (WatermelonPE) and UnB 81 (Pumpkin-DF). In the field experiment, Riviera was the most resistant genotype, with significantly (P<0.05) lower values of leaf infection at 74 and 79 DAP and the smallest area under disease progress curve (AUDPC). Crimson Sweet, Rubi, Onix and Safira were the most susceptible genotypes based on foliar disease levels 74 days after planting and also based on the AUDPCs. In the greenhouse, Riviera also presented the smallest (P<0.05) AUDPC in stems. A significant correlation (r=0.77) was detected between disease measurements in the greenhouse (stem response) and in the field (foliar response). Keywords: Citrullus lanatus, Didymella bryoniae.

(Recebido para publicao em 2 de dezembro de 2004 e aceito em 14 de setembro de 2005) entre as doenas da melancia (Citrullus lanatus) o crestamento gomoso do caule, ou cancro da haste, uma das principais devido aos seus efeitos na reduo da produtividade e qualidade dos frutos (SANTOS et al., 2005b). Os sintomas incluem cancro no caule, queima das folhas e tambm apodrecimento de frutos (SCHENCK, 1968). A doena vem despertando preocupao nos permetros irrigados da regio nordeste do Brasil (DIAS et al. 1996), e em outros pases, como nos Estados Unidos (EVERTS, 1999; KEINATH; DUTHIE,

1998; SITTERLY; KEINATH, 1996; SCHENCK, 1960) e no Caribe (BALA; HOSEIN, 1986). O agente causal o fungo Didymella bryoniae (Auersw) Rehm (=Mycosphaerella citrullina (C.O. Sm.) Gross.), anamorfo Ascochyta cucumis Fautrey & Roum (= Phoma cucurbitacearum (Fr.) Sacc.), que tem como hospedeiras diversas espcies de Citrullus, Cucumis, Cucurbita, e outros gneros da famlia Cucurbitaceae (KEINATH, 1995). Figueiredo e Cardoso (1964) registraram a doena pela primeira vez no Brasil, com o patgeno em

sua forma assexuada. Recentemente, Caf-Filho e Santos (2004) registraram e descreveram a forma perfeita de Didymella bryoniae no Brasil. Em rea de cultivo comercial, o controle qumico aumentou a produo em at 16,9 t por ha (SANTOS et al., 2005a). Em um estudo especfico para estimativa de perdas de produo, verificou-se reduo de at 19,2% na produtividade devido ao crestamento gomoso (SANTOS et al., 2005b). Entretanto, o controle qumico do crestamento gomoso dificultado devi-

Parte da tese de doutorado do primeiro autor apresentada Universidade de Braslia, UnB, Braslia, DF. 945

Hortic. bras., v. 23, n. 4, out.-dez. 2005

G. R. Santos e A. C. Caf Filho

do rpida infeco das folhas pelo patgeno (ARNY; ROWE, 1991; VAN STEEKELENBURG, 1985), necessitando vrias aplicaes de fungicidas. Alm disso, existem relatos de resistncia do patgeno a determinados princpios ativos (EVERTS, 1999; MALATHRAKIS; VAKALOUNAKIS, 1983; SANTOS et al., 2004). At o momento, ainda h escassez de informao sobre a reao de gentipos de cucurbitceas, com boa aceitao comercial, resistentes doena, e diversos trabalhos relatam a busca de fontes de resistncia para o melhoramento (DIAS et al., 1996; DUSI et al., 1994; MCGRATH et al . , 1993; SUMNER; HALL, 1993; WEHNER; AMAND, 1993). Uma outra abordagem a avaliao da resposta dos gentipos comerciais disponveis ao crestamento gomoso. O conhecimento da resposta das cultivares infeco por D. bryoniae, importante para capacitar os produtores quanto tomada de decises agronmicas, e pode ter impacto imediato no manejo da doena. O controle via resistncia gentica, mesmo parcial, pode ser usado em conjunto com outras medidas e reduzir o uso de agrotxicos, reduzindo o custo de produo e contribuindo para a melhor conservao do ecossistema. Segundo Cohen et al. (1993), alm da preocupao com a sade pblica, os produtores rurais so motivados a otimizar as prticas culturais utilizando menos defensivos qumicos e optando pela utilizao de cultivares resistentes a doenas. Sowell e Pointer (1962) identificaram o gentipo PI 189225 como fonte de resistncia ao crestamento gomoso. Norton e Cosper (1985) confirmaram a resistncia de PI 189225 e comentaram que este gentipo, alm do PI 271778, possibilitaram retrocruzamentos que resultaram no lanamento de cultivares de melancia resistentes ao crestamento e outras doenas. No Brasil, Dias et al. (1996) examinaram 70 acessos de melancia quanto resistncia a D. bryoniae, incluindo PI 189225, o qual apresentou reao varivel (suscetvel a resistente) em diferentes ensaios. A cultivar Crimson Sweet, uma das mais plantadas no Brasil, foi utilizada como padro de susceptibilidade. Esses auto946

res encontraram seis fontes de resistncia para uso em futuros trabalhos de melhoramento, sendo PI 189255 uma delas. Exceto pelo estudo de Dias et al. (1996), so poucos os trabalhos envolvendo a identificao de fontes de resistncia a D. bryoniae em melancia no Brasil. Nenhum trabalho foi encontrado comparando gentipos comerciais. Este trabalho teve por objetivo quantificar a resposta de gentipos comerciais de melancia ao crestamento gomoso do caule. Essa informao poder ser til para o manejo integrado da doena.

MATERIAL E MTODOS
Avaliao da resistncia nas folhas O estudo foi realizado de 9/12/2003 a 8/03/2004, em condies de campo na Estao Biolgica da Universidade de Braslia, em Braslia, DF. O experimento foi instalado em local no cultivado nos dois anos anteriores e sem histrico de plantio de cucurbitceas. Aps arao e gradagem, a rea foi adubada com 800 kg/ha da frmula N-P-K 4-14-8. A semeadura foi feita em covas, no espaamento de 2 x 2 m, colocando-se 5 sementes/cova a 2 cm de profundidade. Cada parcela foi composta por quatro covas semeadas com a mesma cultivar. Decorridos 30 dias aps o plantio (DAP) foi feito o desbaste, deixando-se duas plantas por cova e em seguida foi realizada adubao de cobertura com 200 kg/ha da frmula N-P-K 20-00-20. Durante todo o ensaio foram feitas trs capinas de forma manual aos 15; 30 e 40 DAP e foi conduzido o direcionamento das ramas para o interior da parcela, visando-se evitar a mistura de ramas entre cultivares diferentes. O suprimento de gua para as plantas foi conforme a distribuio das chuvas no local do ensaio. Foram feitas aplicaes do inseticida Metamidofs na dose de 0,24 kg/ha, aos 20, 30 e 45 DAP, visando-se diminuir o nvel de infestao de pragas. No foram utilizados fungicidas durante a conduo do trabalho. Aos 43 DAP duas plantas de cada parcela foram inoculadas utilizando-se um pedao de caule de 10 cm de comprimento/planta, naturalmente

infectado e obtido em cultivo comercial afetado pelo crestamento gomoso do caule. Aps ferimento do colo por frico com o fragmento infectado, este foi depositado ao lado da planta inoculada. Devido s condies do clima favorveis doena (chuvas, temperatura amena e alta umidade do solo e do ar, Figura 3) no foi feita cmara mida nas plantas inoculadas. Estas serviram de foco inicial de inculo. Foi utilizado o delineamento em blocos ao acaso com nove tratamentos e quatro repeties. Os tratamentos constaram dos gentipos de melancia atualmente mais plantados no pas: Crimson Sweet (cultivar) e dos hbridos Onix, Rubi, Safira, Eureka, Georgia, Sheila, Savana e Riviera. Quando os primeiros sintomas da doena foram observados nas folhas, iniciou-se o monitoramento da doena, utilizando-se uma escala de notas de 0 a 9 onde: 0-planta sadia; 1-menos de 1% da rea foliar afetada; 3-entre 1 e 5% da rea foliar afetada; 5-entre 6 e 25% da rea foliar doente; 7-entre 26-50% da folha doente; 9-mais que 50% da rea foliar afetada (SANTOS et al., 2005a). Para obteno das curvas de progresso da doena, converteram-se as notas para porcentagens de rea foliar doente pelo ponto mdio de cada nota, em cada uma das parcelas estudadas aos 44; 49; 54; 59; 64; 69; 74; 79; 84 e 89 DAP. A cada avaliao, foram coletadas folhas infectadas visando-se comprovar a presena de D. bryoniae nas plantas, por meio de exame em microscpio estereoscpico e tico. A rea Abaixo da Curva de Progresso de Doena (AACPD) de cada tratamento foi calculada segundo Shaner e Finney (1977) e a anlise de varincia e teste de mdia foram executados utilizando-se o programa SigmaStat v.2 (Jandel Scientific Software). Os materiais foram separados em classes de resistncia com base nas AACPDs e nas porcentagens de rea foliar atacadas em cada poca de avaliao no campo, considerando-se Crimson Sweet como padro de suscetibilidade (DIAS et al., 1996). Avaliao da resistncia no caule Para o exame da resistncia no caule foi conduzido um experimento em casa de vegetao, de maio a julho de 2004, em vasos de polietileno, capaciHortic. bras., v. 23, n. 4, out.-dez. 2005

Reao de gentipos de melancia ao crestamento gomoso do caule

dade de 3,0 kg, contendo uma mistura de terra vegetal + esterco, na proporo de 3:1. O substrato foi previamente desinfestado com brometo de metila e utilizado aps 4 dias. Foram semeadas quatro sementes por vaso de cada cultivar e aps a germinao das sementes e emergncia das plntulas, foram mantidas duas plntulas em cada vaso. A unidade experimental foi constituda por trs vasos com um total de seis plantas por cada repetio. A irrigao foi realizada diariamente com regador molhando-se toda a planta. O experimento foi repetido para confirmao dos resultados. Utilizou-se o delineamento inteiramente casualizado com trs repeties e em esquema fatorial de 9 x 3, sendo o fator a = cultivares e o fator b = isolados. As mesmas cultivares estudadas em campo foram estudados neste ensaio. Foram utilizados os seguintes isolados de D. bryoniae para inoculao no caule: UnB 81 (Abbora-DF), UnB 76 (Melo-DF) e UnB 75 (Melancia-PE). A inoculao foi feita em plntulas com 15 dias decorridos da semeadura, quando do surgimento da primeira folha definitiva. Utilizou-se disco de miclio que ficou preso ao caule por meio de um alfinete estril. Plntulas tratadas apenas com alfinete estril representaram a testemunha. Aps a inoculao, as plntulas ficaram sob cmara mida por 24 h e em sala de incubao com fotoperodo de 12 h e temperatura de 23+4oC. Decorridas 24 h da inoculao iniciou-se diariamente a avaliao da doena nas plntulas por um perodo de oito dias. Utilizou-se uma escala de notas adaptada para doena no caule, onde: 0=ausncia de doena; 1=presena de leso no caule e 2=presena de leso no caule e tombamento e morte das plntulas. Para avaliao da resistncia infeco no caule, considerou-se o progresso da doena nas seis plntulas de cada repetio durante os oito dias consecutivos. Para anlise estatstica foi calculada a AACPD. A anlise de varincia, teste de mdias e correlao dos dados de AACPD de campo e casa de vegetao foram executadas utilizando-se o programa SigmaStat v.2 (Jandel Scientific Software).
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Avaliao da resistncia nas folhas de cultivares de melancia, em duas pocas, ao crestamento gomoso em condies de campo. Braslia, UnB, 2004.
Cultivar Crimson Sweet Onix Rubi Safira Sheila Georgia Eureka Savana Riviera Area foliar infectada (%)* 74 DAP* * 26,5 a 26,5 a 26,5 a 26,5 a 17,8 ab 15,0 ab 12,0 ab 6,0 3,0 ab b 79 DAP 41,5 ab 35,8 ab 47,3 a 41,5 ab 41,5 ab 47,3 a 32,3 ab 20,8 ab 9,0 b

*Mdias seguidas de mesma letra nas colunas no diferem entre si pelo Teste de Tukey a 5% de probabilidade. Os dados originais foram transformados para x. **DAP: dias aps plantio.

a ab ab ab ab ab ab

Figura 1. Reao de cultivares de melancia ao crestamento gomoso nas folhas, pela rea Abaixo da Curva de Progresso de Doena (AACPD), em condies de campo. Braslia, UnB, 2004. Mdias seguidas de mesma letra no diferem entre si pelo Teste de Tukey a 5% de probabilidade. Braslia, UnB, 2004.

RESULTADOS E DISCUSSO
No ensaio desenvolvido em campo, os sintomas foram detectados nas folhas aos seis dias aps a inoculao do patgeno no caule em todos as cultivares. Esse fato demonstrou que ocorre rpida infeco do patgeno quando existem fontes de inculo no plantio sob condies climticas favorveis (Figura 3). A cv. Riviera mostrou-se mais resistente infeco de D. bryoniae nas folhas, diferindo estatisticamente de vrios gentipos aos 74 e 79 DAP (Tabela 1) e apresentando menor valor de

AACPD quando comparado com Rubi e Crimson Sweet (Figura 1). As curvas de progresso da doena indicam visualmente as diferenas das dinmicas de progresso em cada classe de resistncia (Figura 2). Aos 74 DAP, foram mais suscetveis Crimson Sweet, Rubi, Onix e Safira, as quais apresentaram os mais altos nveis de infeco nas folhas e (Tabela 1). Crimson Sweet e Rubi tambm apresentaram os mais altos valores de AACPD, diferindo significativamente de Riviera (Figura 1). As cvs. Sheila, Gergia, Eureka e Savana, apresentaram resposta intermediria, pois no se separaram de Crimson Sweet ou de
947

G. R. Santos e A. C. Caf Filho

Figura 2. Curvas de progresso do crestamento gomoso do caule em cultivares de melancia representativas de diferentes nveis de resistncia. Riviera e Crimson Sweet representam as cultivares mais resistente e suscetvel respectivamente. Braslia, UnB, 2004.

Tabela 2. reas Abaixo da Curva de Progresso de Doena (AACPD) de cultivares de melancia inoculados no caule com isolados de D. bryoniae, em casa de vegetao. Braslia, UnB, 2004.
Gentipo Georgia Safira Crimson Sweet Onix Sheila Eureka Rubi Savana Riviera AACPD* 11,2 a 11,1 a 10,9 a 10,4 a 10,2 a 9,5 ab 9,4 ab 9,0 ab 7,8 b

*Mdias seguidas de mesma letra nas colunas no diferem entre si pelo Teste de Tukey a 5% de probabilidade. Os dados originais foram transformados para x. Os dados representam a mdia de 3 isolados.

Riviera, nem pela rea foliar atacada aos 74 DAP, nem pela AACPD (Tabela 1, Figura 1). De um modo geral, at os 64 DAP, a maioria das cultivares apresentou um nvel semelhante de infeco nas folhas. Esse perodo coincidiu com a formao e crescimento dos frutos. A partir dos 64 DAP houve aumento brusco na percentagem de rea foliar infectada (Figura 2) nos gentipos mais suscetveis (Rubi e Crimson Sweet) em relao queles intermedirios ou resistentes (Riviera e Savana). As plantas deste grupo, principalmente Riviera, em condies de campo, mantiveram baixa percentagem de rea foliar infectada at
948

os 74 DAP, o qual coincide com o perodo da primeira colheita. Esta informao importante para o produtor, pois pode exigir um menor nmero de aplicaes de fungicidas at a primeira colheita, sem prejuzo produo de frutos saudveis a um custo mais baixo, quando comparado com gentipos mais suscetveis. O aumento da doena nesse estdio da cultura j foi observado anteriormente em Crimson Sweet por Santos et al. (2005b), que registraram que a curva de progresso da doena nas folhas aumentou bruscamente, de forma exponencial, a partir de 75 DAP. Segundo os autores,

o aumento progressivo da doena nesta fase relacionou-se com o incio da colheita dos frutos, quando normalmente ocorrem injrias nos ramos e nas folhas que so portas de entrada para o patgeno. De acordo com Svedelius e Unestan (1978), quando o tecido mecanicamente afetado, ocorre exsudao de nutrientes importantes para o processo de infeco de D. bryoniae. Chiu e Walker (1949) verificaram que a germinao dos esporos de D. bryoniae foi estimulada pelos extratos das plantas. Van Steekelenburg (1985) anotou que o maior progresso da doena est associado com o maior desenvolvimento vegetativo da cultura devido densa cobertura das folhas inferiores que reduz a evaporao e prolonga o perodo de molhamento foliar. Corroborando essa observao, Arny e Rowe (1991) constataram que a infeco em folhas e pecolos de pepino por D. bryoniae foi mais influenciada pela durao do molhamento foliar do que pela temperatura. Alm da influncia desses fatores, tambm acredita-se que a movimentao de pessoas na colheita dentro da rea plantada favorece a disseminao do patgeno e, assim, aumenta rapidamente a taxa de progresso da doena. A cv. Riviera manteve menores nveis de doena nas folhas quando comparada com outros gentipos at no ltimo dia da avaliao, aos 89 DAP (Figura 2). Mesmo com nvel de resistncia incompleto, vale salientar que Riviera retardou o incio da fase exponencial da doena (mas no o incio do aparecimento dos sintomas) e a manteve em nveis baixos em pocas importantes como a fase de formao e crescimento de frutos. Contudo, aps a primeira colheita dos frutos (74 DAP), o crestamento tambm aumentou consideravelmente nesta cultivar. Portanto, apesar desta cultivar ter mostrado maior nvel de resistncia que as demais, a resistncia parcial, e a doena pode alcanar ndices elevados ao final do ciclo. Esse resultado concorda com outros autores que comentaram sobre a dificuldade no controle por resistncia, e que nenhum gentipo de melancia comercializado atualmente tem alta resistncia ao patgeno (PUNITHALINGAM; HOLLIDAY, 1972; BLANCARD et al., 1996; SITTERLY; KEINATH, 1996).
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Reao de gentipos de melancia ao crestamento gomoso do caule

Assim, o controle qumico deve continuar como importante componente do manejo da doena em cultivares mais suscetveis e bem aceitos comercialmente. Santos et al. (2005a), estudando o controle qumico da doena em rea de cultivo comercial, iniciaram as aplicaes em Crimson Sweet aos 17 DAP e anotaram aumento da produo em at 16,9 t/ha. Os resultados deste trabalho indicam que o controle poderia ser iniciado mais tardiamente, especialmente nos gentipos mais resistentes (Figura 2), permitindo a reduo do nmero de aplicaes qumicas. Com relao s linhagens estudadas por outros autores, Sowell e Pointer (1962) identificaram o gentipo PI 189225 como fonte de resistncia, embora tenham registrado 38,1% de plantas mortas em um dos ensaios. Posteriormente, Norton e Cosper (1985) confirmaram a resistncia de PI 189225 e comentaram que este gentipo, alm do PI 271778, possibilitaram retrocruzamentos que resultaram no lanamento de gentipos resistentes ao patgeno e antracnose. No Brasil, em um dos ensaios de Dias et al. (1996), o acesso PI 189225 apresentou apenas 16,6% e 41,7% de plantas respectivamente resistentes e medianamente resistentes. Mesmo assim, PI 189225 diferiu significativamente de Crimson Sweet, que foi classificada como altamente suscetvel, mesma classificao encontrada neste trabalho. Desta forma, observa-se falta de estabilidade na resistncia de PI 189225 a D. bryoniae indicando que o material estaria segregando para esta caracterstica. Nos ensaios desenvolvidos em casa de vegetao, com relao infeco mdia de trs isolados de D. bryoniae no caule, apenas a cv. Riviera diferiu estatisticamente de Crimson Sweet (Tabela 2). As cvs. Eureka, Rubi e Savana no se separaram de Riviera. Esses resultados foram semelhantes aos encontrados em campo, com exceo da cv. Rubi, que no ensaio de campo demonstrou alto grau da doena nas folhas (Tabela 2). Todos os isolados foram patognicos a todas cultivares e no houve interao significativa entre cultivares x isolados, demonstrando dessa forma a falta de especificidade entre os
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 3.Temperaturas mxima e mnima (oC), umidade relativa do ar (%) e chuvas (mm) a partir de 37 dias aps o plantio. Braslia, UnB, 2003/2004.

isolados testados. Falta de especificidade entre isolados de D. bryoniae foi relatada por Keinath et al. (1995), quando compararam isolados do patgeno de cucurbitceas obtidos na Carolina do Sul, Flrida e Nova York, e verificaram que dos 19 isolados testados 17 foram patognicos melancia e ao melo Cantaloupe (Cucumis melo). De modo geral esses autores relataram pouca diversidade quanto virulncia. Foi encontrada correlao significativa (r=0,77) entre as AACPDs do ensaio de campo (resistncia das folhas) e de casa de vegetao (resistncia no caule), sugerindo que a metodologia utilizada em condio controlada pode ter valor auxiliar na avaliao de grande nmero de plantas em programas de melhoramento. Entretanto, a seleo final de cultivares resistentes deve ser feita a campo. Os resultados deste trabalho podero ser aplicados imediatamente para o manejo integrado do crestamento gomoso do caule da melancia.

AGRADECIMENTOS
O primeiro autor foi bolsista de doutorado e o segundo bolsista de pesquisa do CNPq. O trabalho tambm recebeu apoio financeiro adicional atravs do Processo CNPq no. 474194/2003-5.

LITERATURA CITADA
ARNY, C.J.; ROWE, R.C. Effects of temperature and duration of surface wetness on spore production and infection of cucumbers by Didymella bryoniae. Phytopathology. v.81, p.206209, 1991.

BALA, G.; HOSEIN, F. Studies on gummy stem blight disease of cucurbits in Trinidad. Tropical Agriculture (Trinidad) v.63, p.195-197, 1986. BLANCARD, D.; LECOQ, H.; PITRAT, M. Enfermedades de las cucurbitceas. INRA, John Wiley & Sons, 301 p, 1996, p.210-211. CAF FILHO, A.C.; SANTOS, G.R. Ocorrncia do crestamento gomoso do caule em melancia no Estado do Tocantins, descrio e ilustrao do agente causal, Didymella bryoniae. Fitopatologia Brasileira, v.29 (Suplemento), p.57, 2004. (Resumo) CHIU, W.F.; WALKER, J.C. Physiology and pathogenicity of the cucurbit black-rot fungus. Journal of Agricultural Research, v.78, p.589615, 1949. COHEN, R. Variability in the reaction of squash (Cucurbita pepo) to inoculation with Sphaerotheca fuliginea and methodology of breeding for resistance. Plant Pathology, v.42, n.4, p.510-516, 1993. DIAS, R.C.S.; QUEIROZ, M.A.; MENEZES, M. Identificao de fontes de resistncia em melancia a Didymella bryoniae. Horticultura Brasileira, Braslia, v.14, n.1, p.15-17, 1996. DUSI, A.N.; TASAKI, S.; VIEIRA, J.V. Metodologia para avaliao de resistncia a Didymella bryoniae em melo. Horticultura Brasileira, Braslia, v.12, n.1, p.43-44, 1994. EVERTS, K.L. First report of benomyl resistance of Didymella bryoniae in Delaware and Maryland. Plant Disease, v.83, p.304, 1999. FIGUEIREDO, M.B.; CARDOSO, R.M.G.; ABRAHO, J. Perdas causadas pelo fungo Mycosphaerella melonis (Pass.) Chiu & J.C. Walker em aboboreira de moita. O Biolgico, So Paulo, v.32, p.203-205, 1964. KEINATH, A.P. Fungicide timing for optimum management of gummy stem blight epidemics on watermelon. Plant Disease, v.79, n.4, p.354-358, 1995. KEINATH, A.P. FARNHAM, M.W.; ZITTER, T.A. Morphological, pathological, and genetic differentiation of Didymella bryoniae and Phoma spp. isolated from cucurbits. Phytopathology, v.85, p.364-69, 1995. KEINATH, A.P.; DUTHIE, I.A. Yield and quality reductions in watermelon due to anthracnose, gummy stem blight and black rot. p.77-90. in: Recent Research Developments in Plant Pathology, vol.2, Research Signpost, Trivandrum, India, 1998. 949

G. R. Santos e A. C. C. Caf Filho MALATHRAKIS, N.E.; VAKALOUNAKIS, D.J. Resistance to benzimidazole fungicides in the gummy stem blight pathogen Didymella bryoniae on cucurbits. Plant Pathology, v.32, p.395-399, 1983. MCGRATH, D.J.; VAWDREY, L.; WALKER, I.O. Resistance to gummy stem blight in muskmelon. HortScience. v.28, p.930-931, 1993. NORTON, J.D.; COSPER, R.D. Breeding watermelons for disease resistance. Phytopathology, v.75, n.10, p.1178, 1985. PUNITHALINGAM, E.; HOLLIDAY, P. Didymella bryoniae . CMI Descriptions of Pathogenic Fungi and Bacteria, n.332, 1972. SANTOS, G.R.; CAF-FILHO, A.C.; REIS, A. Resistncia de Didymella bryoniae a benzimidazis no Brasil. Fitopatologia Brasileira. Brasilia. v.29 (Suplemento), p.60-61, 2004. SANTOS, G.R.; CAF-FILHO, A.C.; SABOYA, L.M.F. Controle qumico do crestamento gomoso do caule em melancia. Fitopatologia Brasileira. Braslia. v.30, n.2, p.155-163, 2005a. SANTOS, G.R.; CAF-FILHO, A.C.; LEO, F.F.; CSAR, M.; FERNANDES, L.E. Progresso do crestamento gomoso e perdas na cultura da melancia. Horticultura Brasileira, Braslia, v.23, n.2, p.230-234, 2005b. SCHENCK, N.C. Watermelon disease incidence in central Florida. Plant Disease Reporter, v.44, p.556-568, 1960. SCHENCK, N.C. Epidemiology of gummy stem blight (Mycosphaerella citrulina) on watermelon: ascospore incidence and disease development. Phytopathology, v.58, p.1420-1422, 1968. SITTERLY, W.R.; KEINATH, A.P. Gummy stem blight. p.27-28. in: Compendium of Cucurbit Diseases , T.A. Zitter, D.L. Hopkins & C.E. Thomas, eds. APS Press, St Paul., 1996. SHANER, G.; FINNEY, R.E. The effect of nitrogen fertilization on the expression of slow mildewing resistance in Knox wheat. Phytopathology , v.67, p.1051-1056, 1977. SOWELL, G.Jr.; POINTER, G.R. Gummy stem blight resistance of introduced watermelons. Plant Disease Report, v.46, n.12, p.883-885, 1962. SUMNER, D.R.; HALL, M.R. Resistance of watermelon cultivars to Fusarium wilt and gummy stem blight. Biological and Cultural Tests. v.8, p.36, 1993. SVEDELIUS, G.; UNESTAM, T. Experimental factors favouring infection of attached cucumber leaves by Didymella bryoniae . Transactions of British Mycological Society, v.71, p.89-97, 1978. VAN STEEKELENBURG, N.A.M. Influence of humidity on incidence of Didymella bryoniae on cucumber leaves and growing points under controlled environmental conditions. Netherlands Journal of Plant Pathology, v.91, p.253-264, 1985. WEHNER, T.C.; St. AMAND, P.C. Field tests for cucumber resistance to gummy stem blight in North Carolina. HortScience. v.28, p.327-329, 1993.

950

Hortic. bras., v. 23, n. 4, out.-dez. 2005

MARIM, B.G.; SILVA, D.J.H.; GUIMARES, M.A.; BELFORT, G. Sistemas de tutoramento e conduo do tomateiro visando produo de frutos para consumo in natura. Horticultura Brasileira, Braslia, v.23, n.4, p.951-955, out-dez 2005.

Sistemas de tutoramento e conduo do tomateiro visando produo de frutos para consumo in natura
1
1

Bruno G. Marim; 2Derly Jos H. da Silva; 2Marcelo de A. Guimares; 3Gabriel Belfort

UFV, Gentica e Melhoramento, 36571-000 ViosaMG; 2UFV, Depto. Fitotecnia; 3UFLA, Gentica e Melhoramento, 37200-000 Lavras-MG; E-mail: bgmarim@yahoo.com.br

RESUMO
Os sistemas de tutoramento e conduo influem no desenvolvimento da planta do tomateiro e na qualidade do fruto produzido. Para avaliar a influncia de trs sistemas de tutoramento e dois de conduo da planta do tomateiro na produo classificada de frutos comercializveis, foram conduzidos dois experimentos, de agosto a dezembro/1999 (exp. 1) e de 2000 (exp. 2) em Viosa (MG). O delineamento foi em blocos ao acaso com trs repeties, no esquema fatorial 3x2, tutoramento e conduo, respectivamente. Avaliaramse os seguintes mtodos de tutoramento: T1, tradicional (V invertido), T2, triangular e T3, vertical e duas formas de conduo, com uma e duas hastes por planta. Independentemente do tratamento, as plantas foram podadas acima do sexto cacho. Observaram-se diferenas entre os sistemas de tutoramento, conduo e entre os anos de cultivo em relao s caractersticas avaliadas, sendo que ocorreu interao entre estes efeitos apenas para as caractersticas produo de frutos comercializveis e produo total. O tutoramento vertical proporcionou aumento na produo de frutos de tamanho grande e diminuio na produo de frutos de tamanho mdio e frutos no comercializveis, quando comparado com os outros mtodos de tutoramento. Independentemente do sistema de tutoramento, o tomateiro cultivado com uma haste produziu mais frutos de tamanho grande, de maior valor comercial, enquanto as plantas conduzidas com duas hastes produziram mais frutos de tamanho mdio e pequeno.

ABSTRACT
Tomato plant staking and training systems for fresh fruit production The main reason for staking and training tomato plants is to keep plants and fruits off the ground to reduce losses and to improve the quality of the production. To evaluate the influence of three plant staking and two training systems of the tomato production for fresh market, two experiments were conducted during the period of August 1999 (exp.1) and 2000 (exp.2) in Viosa, Brazil. The experimental design was a randomized complete block design with three blocks, in a 3 x 2 factorial plant staking and 2 conduction systems. The following staking methods were tested: T1, traditional (two bamboo stakes as an inverted V frame); T2, triangular staking or; T3, vertical staking with polypropylene cord. Plants were conducted with one or two stems per plant. Independent of the treatment, the plants were pruned above the sixth flower cluster. Differences were observed among staking and conduction systems and among the years in relation to the appraised characteristics. There was interaction among training, conduction systems and years for marketable fruits and total fruit production. The vertical staking up provided increase in production of fruits of big size and decrease in production of fruits of medium size and production of not marketable fruits, when compared with the other staking methods. Independently of the conduction system (for two stems), the tomato cultivated with only one stem produced bigger fruits with higher commercial value, while the plants conduced with two stems produced more fruits of medium and small size. Keywords: Lycopersicon esculentum Mill., cultural treatments, classified production, efficient use of assimilates, profitability.

Palavras-chave: Lycopersicon esculentum Mill., tratos culturais, produo classificada, eficincia fotossinttica, rentabilidade.

(Recebido para publicao em 28 de maio de 2004 e aceito em 4 agosto de 2005) cultura do tomateiro uma das principais hortalias cultivadas no Brasil. Sua produo anual de aproximadamente 3,6 milhes de toneladas destinados ao mercado de tomate fresco e para processamento, cultivados em mais de 60 mil ha (AGRIANUAL, 2004). Esto envolvidos, na cultura do tomateiro no Brasil, mais de 10.000 produtores, com aproximadamente 200.000 pessoas trabalhando diretamente na produo desta hortalia (TAVARES, 2003). Segundo pesquisa realizada pelo MINISTRIO DA INTEGRAO NACIONAL (2003) o consumidor brasileiro prioriza, na compra dos produHortic. bras., v. 23, n. 4, out.-dez. 2005

tos hortcolas, a qualidade e a aparncia do produto. No caso do tomate, aspectos como cor, brilho e principalmente o tamanho do fruto tm especial relevncia. Tal fato confirmado pelos preos mais elevados pagos aos frutos de maior tamanho nas Centrais de Abastecimento (CEASAs) espalhadas por todo o Brasil. Uma das formas de melhoria da qualidade e aparncia do tomate produzido a adoo de tcnicas adequadas de manejo da cultura. As principais formas de manejo empregadas na cultura do tomateiro so: tipo de tutoramento, forma de conduo e espaamento. O tipo de tutoramento utilizado, bem como a

forma de conduo, pode alterar a distribuio da radiao solar e a ventilao em torno das plantas (ANDRIOLO, 1999), influenciando a umidade relativa e a concentrao de gs carbnico atmosfrico entre e dentro das fileiras (GEISENBERG; STEWART, 1986). O tipo de tratamento tambm pode influenciar na maior ou menor eficincia de controle de pragas (PICANO et al., 1998) e doenas (BOFF et al., 1992). O tutoramento mais freqentemente utilizado pelos agricultores brasileiros o mtodo tradicional ou V invertido (MAKISHIMA; MIRANDA, 1992; FONTES; SILVA, 2002). Nesse
951

B. G. Marim et al.

Figura 1. Esquema ilustrativo dos sistemas de tutoramento tradicional (T1), triangular (T2) e vertical com fitilho (T3).

tutoramento ocorre a formao de uma cmara mida e aquecida sob o V invertido, sendo esta, um ambiente favorvel ao desenvolvimento de fungos, que ainda ficam livres da ao dos agrotxicos que so aplicados na parte externa das plantas (REBELO, 1993). Tentando solucionar este problema, props-se o tutoramento triangular. Este sistema teoricamente reune as vantagens do mtodo tradicional (estabilidade e no dependncia de mo-de-obra especializada) e evita a formao da cmara mida e aquecida sob o V invertido. Outro mtodo utilizado na cultura do tomateiro o tutoramento vertical, que permite melhorar a distribuio da radiao solar e a ventilao, reduzindo o perodo de molhamento foliar e, por conseguinte, a severidade das doenas (ZAMBOLIM et al., 1989). Alm de tutoramento, a planta do tomateiro necessita de conduo, podendo, desta forma, maximizar a produo e a qualidade do tomate destinado ao mercado de mesa. Como mtodo de conduo considera-se qualquer prtica que altere a arquitetura da planta ao longo de seu desenvolvimento, como por exemplo, a poda apical, retirada de brotaes laterais, raleio de frutos, entre outros. A conduo da planta com uma haste, sem poda apical ou com poda a 1,80 m acima do solo, o mtodo de conduo mais utilizado no pas (OLIVEIRA et al., 1995; LOPES; STRIPARI, 1998; SILVA et al., 1997). No entanto vrios autores tm sugerido a conduo das plantas com duas hastes associado poda apical, devido ao aumento na
952

produtividade proporcionado por estes (FONTES et al., 1987; OLIVEIRA et al., 1995; POERSCHKE et al., 1995;) A poda apical, deixando-se menor nmero de cachos por planta, traz benefcios cultura do tomateiro, tais como: reduo do ciclo, facilidade de execuo dos tratos culturais, aumento no peso mdio dos frutos, reduo e maior segurana na aplicao de agrotxicos (CAMPOS et al., 1987; OLIVEIRA et al., 1995; POERSCHKE et al., 1995). Alm disso, a limitao do nmero de cachos por planta uma prtica recomendada principalmente nos cultivos cujas condies ambientais limitem o crescimento da planta do tomateiro e em conseqncia o nmero de cachos produtivos (OLIVEIRA et al., 1995). Apesar de existirem vrios trabalhos avaliando a influncia dos mtodos de tutoramento (FONTES et al., 1987; SILVA et al., 1997; SANTOS et al., 1999) e de conduo (CAMPOS et al., 1987; OLIVEIRA et al . , 1995; 1996; POERSCHKE et al., 1995) na produo do tomateiro, alguns resultados so bastante contraditrios. Alm disso, poucos so os trabalhos relacionando estes fatores simultaneamente. O presente trabalho teve como objetivo avaliar trs mtodos de tutoramento e dois mtodos de conduo do tomateiro, podado acima do sexto cacho, quanto produo classificada de frutos em dois anos consecutivos de cultivo.

MATERIAL E MTODOS
Os experimentos foram realizados em campo, na Horta da Universidade

Federal de Viosa, de agosto a dezembro de 1999 e 2000, em solo Podzolossolo Vermelho-Amarelo, textura argilosa e topografia plana. A recomendao de adubao foi baseada na 5 Aproximao (Ribeiro et al., 1999). Os experimentos foram conduzidos em delineamento em blocos ao acaso com trs repeties num esquema fatorial 3x2. Os fatores foram constitudos de trs mtodos de tutoramento e dois de conduo da planta do tomateiro e as parcelas constitudas por quatro fileiras de dez plantas, considerando-se teis as doze plantas centrais, sendo seis plantas de cada uma das duas fileiras internas da parcela. Foi utilizada a cultivar Santa Clara, tipo Santa Cruz, cujas mudas foram produzidas em bandejas com 128 clulas preenchidas com substrato comercial. O espaamento utilizado foi de 1,0x0,5 m entre e dentro das fileiras, respectivamente. Na conduo dos experimentos foram utilizadas as tcnicas recomendadas para o cultivo do tomateiro (MAKISHIMA; MIRANDA, 1992; FILGUEIRA, 2000). Os mtodos de tutoramento (Figura 1) foram: T1 - Tutoramento tradicional ou V invertido ou cerca cruzada (FILGUEIRA, 2000). T2 - Tutoramento triangular; para se obter este tratamento as fileiras mpares foram iniciadas imediatamente aps os moures, enquanto as fileiras pares iniciaram a 0,25m destes. De forma, que havia distncia horizontal de 0,25 m entre fileiras adjacentes, dando assim a
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Sistemas de tutoramento e conduo do tomateiro visando produo de frutos para consumo in natura

conformao de um tringulo entre plantas de fileiras contguas. T3 - Tutoramento vertical com fitilho; neste sistema a planta tutorada por fitilho preso a dois fios de arame horizontais e paralelos, o primeiro a 0,10 m e o segundo a 1,8 m em relao ao solo (LOPES; STRIPARI, 1998; FONTES; SILVA, 2002). Os mtodos de conduo avaliados foram uma e duas hastes por planta. Independentemente do sistema de tutoramento e do nmero de hastes por planta; estas foram despontadas mantendo-se seis racimos. O desponte foi efetuado deixando-se trs folhas acima do sexto racimo de cada planta. As colheitas foram feitas em intervalos de sete dias cada, de 30/11 a 29/ 12/1999 e de 21/11 a 27/12/2000, nas quais se avaliaram as seguintes caractersticas: a) produo de frutos de tamanho grande, PFG (t ha-1); b) produo de frutos de tamanho mdio, PFM (t ha-1); c) produo de frutos de tamanho pequeno, PFP (t ha-1); d) produo precoce de frutos de tamanho grande, PPFG (t ha-1), obtida pela soma dos pesos dos frutos desta classe colhidos na primeira e segunda colheita; e) produo precoce de frutos de tamanho mdio, PPFM (t ha-1), obtida soma dos pesos de frutos desta classe colhidos na primeira e segunda colheita; f) produo de frutos comercializveis, PC (t ha-1), obtida pela soma dos pesos dos frutos de tamanho grande, mdio e pequeno; g) produo de frutos no comercializveis, PNC (t ha-1), obtida pela soma dos pesos dos frutos sem classificao comercial; h) produo de frutos com defeitos, PFD (t ha-1), obtida pela soma dos pesos de todos os frutos com defeitos causados por insetos, pssaros, roedores, doenas, danos mecnicos e fisiolgicos e h) produo total, PT (t ha-1), obtida pela soma dos pesos de todos os frutos produzidos. A classificao de frutos de tamanho grande, mdio e pequeno seguiu as normas do MINISTRIO DA AGRICULTURA, PECURIA E ABASTECIMENTO (2002). Foram realizadas anlises de varincia individuais e conjuntas dos experimentos para cada caracterstica (STEEL et al., 1997). Aplicou-se o teste Tukey a
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Anlise conjunta1 dos dados relativos aos anos de 1999 e 2000 de seis caractersticas agronmicas avaliadas em tomateiro cultivado em trs sistemas de tutoramento. Viosa, UFV. 2004.
Tutor T1 T2 T3 C = 2T3(T1+ T2)
1

PFG 41,0 ab 35,8 b 43,6 a 10,5*

PFM 18,7 a 20,5 a 17,1 a -4,9*

PFP 8,4 a 9,1 a 8,2 a -1,0


ns

PPFG 7,1 a 6,0 a 6,6 a 0,1


ns

PNC 3,6 a 4,1 a 2,8 a -2,1*

PFD 12,6 a 15,2 a 14,4 a 1,2


ns

Mdias seguidas de pelo menos uma mesma letra, em cada coluna, no diferem entre si, ao nvel de 5% de probabilidade, pelo teste Tukey; *,nsContraste significativo e no significativo, respectivamente, ao nvel de 5% de probabilidade pelo teste de Scheff; 2T1: tutoramento tradicional; T2: tutoramento triangular; T3: tutoramento vertical com fitilho; 3PFG, PFM e PFP: produo de frutos de tamanho grande, mdio e pequeno, respectivamente; PPFG: produo precoce de frutos de tamanho grande; PNC: produo de frutos no comercializveis e PFD: produo de frutos com defeitos.

5% de probabilidade para comparao entre mdias. Seguiu-se o mtodo de Scheff para comparao de contraste. Utilizou-se, para todas as anlises, o programa computacional SAEG (RIBEIRO JNIOR, 2001).

RESULTADOS E DISCUSSO
Para todas as caractersticas, com exceo de PPFM, a relao entre os quadrados mdios do resduo das anlises de varincias individuais dos experimentos, foi inferior a quatro, permitindo que se procedesse anlise conjunta dos experimentos, como citado por Gomes (1970). Para a caracterstica PPFM, utilizou-se o mtodo proposto por Cochran (1954), visando o ajuste dos graus de liberdade, viabilizando a anlise conjunta dos experimentos. A partir da anlise de varincia conjunta dos experimentos verificou-se que houve interao tripla do tipo Tutoramentos*Condues*Anos significativa para as caractersticas PC e PT e interao Tutoramentos*Anos para PPFM. Para as demais caractersticas no houve interao, sendo assim, as comparaes entre mtodos de tutoramento e conduo, na anlise conjunta dos experimentos, foram realizadas a partir dos valores mdios dos dois anos. Considerando-se apenas os efeitos do fator tutoramento verificou-se, na anlise conjunta dos experimentos, que o mtodo de tutoramento vertical foi o mais produtivo para a caracterstica

PFG, no diferindo do mtodo tradicional (Tabela 1). O tutoramento vertical proporcionou aumento de 6,34% e 21,78% em relao ao tutoramento tradicional e triangular, respectivamente. Tal resultado tem elevada importncia para o produtor, pois os frutos de maior tamanho so aqueles que alcanam maiores preos no mercado para consumo in natura. Com o intuito de comparar o tutoramento vertical frente aos demais mtodos avaliados, realizou-se o contraste = 2T3 (T1+T2). A partir deste, verificou-se que o sistema vertical proporcionou aumento na produo de frutos de tamanho grande, diminuio na produo de frutos de tamanho mdio e de frutos no comerciais (Tabela 1). Alm disso, no houve diferena quanto produo de frutos de tamanho pequeno, produo precoce de frutos de tamanho grande e frutos com defeitos. Estes resultados so concordantes com os encontrados por Santos et al. (1999) que verificaram no haver efeito do mtodo de tutoramento sobre a incidncia de doenas no tomateiro e conseqentemente sobre a produo de frutos com defeitos. A maior insolao e ventilao propiciada cultura do tomateiro pelo mtodo vertical, como relatado por Zambolim et al. (1989), resultou, neste trabalho, em maior produo de frutos grandes. Tal fato pode ser explicado, pois maior insolao possibilita maior interceptao da radiao solar fotossinteticamente ativa pela planta e
953

B. G. Marim et al.

Tabela 2. Estimativas1 (t.ha-1) da produo de frutos comercializveis (PC) e produo total (PT) avaliadas em tomateiro cultivado em trs sistemas de tutoramento e duas formas de conduo, nos anos de 1999 e 2000. Viosa, UFV. 2004.
PC Tutor 1 haste T1 T2 T3
1

PT 2000 1999 2 hastes 67,3 a A 60,9 a A 70,2 a A 1 haste 90,5 a A 80,9 a A 92,5 a A 2 hastes 78,3 a B 91,2 a A 81,3 a B 1 haste 86,8 a A 86,9 a A 86,1 a A 2000 2 hastes 81,4 a A 79,4 a A 84,9 a A 1 haste 70,4 a A 71,0 a A 71,3 a A

1999 2 hastes 61,1 a B 69,4 a A 65,0 a A 73,4 a A 59,9 b B 69,3 ab A

Mdias seguidas de pelo menos uma mesma letra minscula, na vertical, e maisculas, na horizontal, no diferem entre si, ao nvel de 5% de probabilidade, pelo teste Tukey; 2T1: tutoramento tradicional; T2: tutoramento triangular; T3: tutoramento vertical com fitilho.

Tabela 3. Anlise conjunta dos dados relativos a sete1 caractersticas agronmicas avaliadas em tomateiro cultivado em duas formas de conduo nos anos de 1999 e 2000. Viosa, UFV. 2004.
N hastes 1 2
,ns

PFG* 45,8 34,4

PFM* 16,4 21,2

PFP* 7,0 10,1

PPFG* 8,0 5,2

PPFMns 4,0 4,6


1

PNCns 3,0 4,0

PFDns 15,0 13,1

* Significativo e no significativo, respectivamente, ao nvel de 5% de probabilidade pelo teste F; PFG, PFM e PFP: produo de frutos de tamanho grande, mdio e pequeno, respectivamente; PPFG e PPFM: produo precoce de frutos de tamanho grande e mdio, respectivamente; PNC: produo de frutos no comercializveis e PFD: produo de frutos com defeitos.

maior ventilao reduz a umidade relativa do ar e renova a concentrao de gs carbnico na atmosfera adjacente s folhas, resultando, desta forma, em maior eficincia fotossinttica (LOOMIS; AMTHOR, 1999). Esta hiptese reforada observando-se a caracterstica PNC (Tabela 1), na qual o tutoramento vertical possibilitou diminuio na sua produo, ou seja, possivelmente uma maior eficincia fotossinttica pode ter proporcionado maior disponibilizao de fotoassimilados que, direcionados aos frutos, aumentaram o tamanho destes. Para as caractersticas PC e PT foram realizadas as anlises individuais dos experimentos, sendo estas avaliadas dentro de cada nvel do fator conduo (Tabela 2). Verificou-se diferena entre os mtodos de tutoramento apenas para a caracterstica PC, no ano de 1999 e em plantas conduzidas com uma haste. Neste caso, as maiores mdias foram observadas nas parcelas com os tutoramentos tradicional e vertical (Tabela 2). Em relao aos mtodos de conduo (Tabela 3), observou-se que plantas conduzidas com uma haste produziram mais frutos de tamanho grande e com maior precocidade. J as plantas conduzidas com duas hastes foram mais produtivas para as caractersticas PFM e PFP. No houve diferena entre os dois
954

mtodos de conduo quanto s caractersticas PPFM, PNC e PFD. Para a caracterstica PC no ano de 1999 e nas parcelas com o tutoramento tradicional, plantas conduzidas com uma haste produziram mais, quando comparadas com aquelas conduzidas com duas hastes. J naquelas com o mtodo triangular, observou-se maiores mdias para plantas conduzidas com duas hastes (Tabela 2). Para PT, plantas conduzidas com uma haste foram mais produtivas nas parcelas tutoradas com os mtodos tradicional e vertical (Tabela 3) e no diferiram daquelas conduzidas com duas hastes nas parcelas com o mtodo triangular. Em 2000, no houve efeito de conduo em nenhum nvel do fator tutoramento. Estes resultados discordam dos encontrados por Oliveira et al. (1995) que em trabalho realizado em condies (perodo, cultivar, local) bastante semelhantes ao deste, verificaram que no houve efeito para produo de frutos grandes (dimetro maior que 60 mm). Alm disso, verificaram efeito significativo para PC e PT, com menor produo para plantas conduzidas com uma haste. Isso pode ter ocorrido, pois Oliveira et al. (1995) utilizaram espaamento de 1,0x0,6m, enquanto neste trabalho o espaamento adotado foi de 1,0x0,5 m. Possivelmente, no espaamento 0,5 m

entre plantas a conduo das plantas com duas hastes tenha resultado em maior competio por fotoassimilados, com conseqente reduo no peso mdio dos frutos. No tomateiro, o aumento da densidade de plantas resulta em ganhos quantitativos e, principalmente, qualitativos na produo quando associada com prticas de conduo que reduzam a competio por radiao (BORRAZ et al., 1991; STRECK et al., 1998). Diante dos resultados do presente trabalho, conclui-se que o mtodo de tutoramento triangular no proporcionou vantagens produtivas para a cultura do tomateiro. Enquanto isso, o tutoramento vertical, dentre os avaliados, o mais adequado para a produo de frutos para o consumo in natura. Com relao forma de conduo, o cultivo com uma haste, independentemente do mtodo de tutoramento utilizado, proporcionou aumento na produo de frutos grandes. Desta forma, pode-se unir as duas recomendaes, ou seja, utilizar, no espaamento 1,0x0,5 m e plantas conduzidas com seis cachos, o tutoramento vertical com uma haste, pois, estes proporcionam aumento na produo de frutos grandes sem alterao na produo comercial e total, promovendo assim aumento na receita desta cultura.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Sistemas de tutoramento e conduo do tomateiro visando produo de frutos para consumo in natura LOOMIS, R.S.; AMTHOR, J.S. Yield potential, plant assimilatory capacity, and metabolic efficiencies. Crop Science, v.39, p.1584-1596, 1999. LOPES, M.C.; STRIPARI, P.C. A cultura do tomateiro. In: GOTO, R.; TIVELLI, S.W. Produo de hortalias em ambiente protegido: condies subtropicais. So Paulo: Fundao Editora da UNESP, 1998. cap.9, p.257319. MAKISHIMA, N.; MIRANDA, J.E.C. (Ed.) Cultivo do Tomate (Lycopersicon esculentum Mill.) . Braslia: CNPH, 1992. 22 p. (Instrues Tcnicas do CNPH N. 11). MINISTRIO DA AGRICULTURA PECURIA E ABASTECIMENTO - MAPA. Normas de identificao, qualidade, acondicionamento, embalagem e apresentao do tomate - Portaria No 85, publicada no Dirio Oficial da Unio de 18/03/ 2002. MINISTRIO DA INTEGRAO NACIONAL - MIN. Pesquisa em Minas e Rio revela o consumidor de hortifrti. Frutifatos. Out 2003, n.4, p.1230, 2003. OLIVEIRA, V.R.; CAMPOS, J.P.; FONTES, P.C.R.; REIS, F.P. Efeito do nmero de hastes por planta e poda apical na produo classificada de frutos de tomateiro. Cincia e Prtica, Lavras, v.19, n.4, p.414419, 1995. OLIVEIRA, V.R.; FONTES, P.C.R.; CAMPOS, J.P.; REIS, F.P. Qualidade do tomate afetada pelo nmero de ramos por planta e pela poda apical. Revista Ceres, Viosa, v.43, n.247, p.309-318, 1996. PICANO, M.C.; LEITE G.L.D.; GUEDES, R.N.C.; SILVA, E.E.A. Effect of spacing and chemical control on losses and pest attacks on tomato plant with vertical tutoring in Brazil. Crop Protection, v.17, p.447452, 1998. POERSCHKE, P.R.C.; BURIOL, G.A.; STRECK, N.A.; ESTEFANEL, V. Efeito de sistemas de poda sobre o rendimento do tomateiro cultivado em estufa de polietileno. Cincia Rural, Santa Maria, v.25, n.3, p.379-384, 1995. REBELO, J.A. Sistema alternativo de tutoramento para tomateiro. Horticultura Brasileira, Braslia, v.11, n.2, p.161, 1993. RIBEIRO JNIOR, J.I. Anlises estatsticas no SAEG. Viosa: Editora UFV, 2001. 301 p. RIBEIRO, A.C.; GUIMARES, P.T.G.; ALVAREZ, V.; V.H. (Ed.) Recomendaes para o uso de corretivos e fertilizantes em Minas Gerais 5 Aproximao. Viosa: CFSEMG, 1999. 359 p. SANTOS, H.S.; PERIN, W.H.; TITATO, L.G.; VIDA, J.B.; CALLEGARI, O. Avaliao de sistemas de conduo em relao severidade de doenas e produo de tomateiro. Acta Scientiarum, v.21, n.3, p.453457. 1999. SILVA, D.J.H.; SEDIYAMA, M.A.N.; MATA, A.C.; ROCHA, D.M.; PICANO, M.C. Produo de frutos de tomateiro ( Lycopersicon esculentum Mill) em quatro sistemas de cultivo. Revista Ceres, Braslia, v.44, n.252, p.129-141, 1997. STEEL, R.G.D.; TORRIE, J.H.; DICKEY, D.A. Principles and procedures of statistics a biometrical approach. 3. ed. New York: McGraw Hill, 1997. 666 p. STRECK, N.A.; BURIOL, G.A.; ANDRIOLO, J.L.; SANDRI, M.A. Influncia da densidade de plantas e da poda apical drstica na produtividade do tomateiro em estufa de plstico. Pesquisa Agropecuria Brasileira , Braslia, v.33, n.7, p.1105-1112, 1998. TAVARES, C.A.M. Ataque dos vrus. Cultivar Hortalias e Frutas. Dez2002/Jan 2003, p. 26-29, 2003. ZAMBOLIM, L.; VALE, F.X.R.; CRUZ FILHO, J.; CHAVES, G.M. Controle integrado das doenas do tomateiro. In: ENCONTRO NACIONAL DE PRODUO E ABASTECIMENTO DE TOMATE, 1, 1989, Viosa. Anais... Viosa: UFV, 1989. p. 55-76.

LITERATURA CITADA
ANDRIOLO, J.L. Fisiologia das culturas protegidas. 1. ed. Santa Maria: UFSM, 1999. 142 p. ANURIO DA AGRICULTURA BRASILEIRA AGRIANUAL 2004. Campo Grande: FNP Consultoria e Comrcio, 2004. 494 p. BOFF, P.; FONTES, P.C.R.; VALE, F.X.; ZAMBOLIM, L. Controle da Mancha-deEstenflio e da Pinta-Preta do tomateiro em funo do sistema de conduo. Horticultura Brasileira, Braslia, v.10, n.1, p.2527. 1992. BORRAZ, J.C.; CASTILHO, F.S.; ROBLES, P.E. Efectos del despunte y la densidade de poblacion sobre variedades de tomate ( Licopersicum esculentum Mill), em hidroponia bajo invernadero. Revista Chapingo, v.15, n.73/74, p.26-30, 1991. CAMPOS, J.P.; BELFORD, C.C.; GALVO, J.D.; FONTES, P.C.R. Efeito da poda da haste e da populao de plantas sobre a produo do tomateiro. Revista Ceres, Viosa, v.34, n.192, p.198208, 1987. COCHRAN, W.G. The combination of estimates from different experiments. Biometrics. n.10, p.101129. 1954. FILGUEIRA, F.A.R. Novo manual de Olericultura: Agrotecnologia moderna na produo e comercializao de hortalias. 2. ed. Viosa: Editora UFV, 2000. 402 p. FONTES, P.C.R.; NAZAR, R.A.; CAMPOS, J.P. Produo e rentabilidade da cultura do tomateiro, afetadas pela fertilizao e pelo sistema de conduo. Revista Ceres. Viosa, v.34, n.134, p.35565, 1987. FONTES, P.C.R.; SILVA, D.J.H. Produo de tomate de mesa. 1. ed. Viosa: Aprenda Fcil, 2002. 193 p. GEISENBERG, C.; STEWART, K. Field crop management. In: ATHERTON, J.G.; RUDICH, J. (Ed.) The tomato crop. London: Chapman & Hall, 1986. cap.13, p.511557. GOMES, F.P. Curso de estatstica experimental. 4. ed., So Paulo: Livraria Nobel, 1970. 464 p.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

955

COSTA, L.C.B.; CORRA, R.M.; CARDOSO, J.C.W.; PINTO, J.E.B.P.; BERTOLUCCI, S.K.V.; FERRI, P.H. Secagem e fragmentao da matria seca no rendimento e composio do leo essencial de capim-limo. Horticultura Brasileira, Braslia, v.23, n.4, p.956-959, out-dez 2005.

Secagem e fragmentao da matria seca no rendimento e composio do leo essencial de capim-limo


Larissa C. do B. Costa1; Ricardo M. Corra2; Jlio Csar W. Cardoso2; Jos Eduardo B.P. Pinto2; Suzan K.V. Bertolucci2; Pedro H. Ferri3
1

UESC, Depto. Cincias Biolgicas, 45650-000 Ilhus-BA; 2UFLA, Depto. Agricultura, 37200-000 Lavras-MG; 3UFG, Instituto de Qumica, Goinia-GO

RESUMO
Este estudo foi conduzido com objetivo de determinar o tipo de secagem e a fragmentao das folhas de capim-limo para otimizar o rendimento extrativo do leo essencial. Foram estabelecidos 6 tratamentos com 2 tipos de secagem (estufa de ventilao forada a 40C e sala com desumidificador) e 3 tamanhos de fragmentos das folhas secas (pulverizao em moinho, fragmentos com 1 e com 20 cm de comprimento), com 4 repeties. O leo essencial foi extrado por hidrodestilao durante 2 horas. O maior rendimento de leo essencial foi obtido com o material seco na sala com desumidificador, no havendo diferenas significativas para os tamanhos da folha. O componente mais abundante no leo essencial foi o citral que tambm apresentou as maiores concentraes nas folhas secas em desumidificador. Palavras-chave: Cymbopogon citratus, planta medicinal, ps-colheita, secagem, moagem.

ABSTRACT
Yield and composition of essential oil of lemongrass in different drying and fragmentation conditions In this study the drying and fragmentation conditions of lemongrass leaves were determined, to increase the essential oil yield. Four replications of six treatments were studied with 2 drying methodologies (oven-drying at 40C and room temperature using moisture dryer) and 3 fragmentation sizes (powder obtained in mill, 1 cm and 20 cm fragments). The essential oil was extracted in Clevengers modified apparatus during 2 hours. The higher essential oil yield and citral content was obtained with the leaves dried under room temperature using moisture dryer, with no significant differences in the fragmentation sizes. Keywords: Cymbopogon citratus, medicinal plant, post-harvest, drying, miller.

(Recebido para publicao em 17 de fevereiro de 2005 e aceito em 3 de agosto de 2005) ymbopogon citratus (D.C.) Stapf uma espcie originria da ndia e largamente distribuda por vrios pases tropicais, entre eles o Brasil, onde assume diferentes sinonmias conforme a regio onde se encontra: capim-limo (MG), capim-santo (BA), erva-cidreira (SP) e outros como capim-catinga, capim-de-cheiro, capim-cidro, capimcidrilho, capim-cidr e capim-ciri. Pertence famlia Poaceae e se constitui em uma erva perene, que forma touceiras compactas e robustas de at 1,2 m de altura, com rizoma semi-subterrneo. O ch das folhas da espcie tem larga utilizao popular para nervosismo, febre, tosse, dores diversas (dor de cabea, abdominais, reumticas) e alteraes digestivas como dispepsia e flatulncia. Tambm aproveitada com finalidades agronmicas para composio de cercas-vivas e na conteno de encostas para evitar a eroso, mas a sua maior importncia econmica reside na produo do seu leo essencial, rico em citral e largamente utilizado na indstria de alimentos e cosmticos.
956

Em rgos isolados o citral apresentou efeito antiespasmdico, tanto no tecido uterino como no intestinal, entretanto no mostrou atividade sobre a musculatura esqueltica e cardaca (FERREIRA, 1984). Estudos sugerem que a atividade antibacteriana de C. citratus reside principalmente nos componentes - e -citral presentes no leo (ONAWUNMI et al., 1984). Suas atividades antimicrobianas e antifngicas foram comprovadas em 22 espcies de microrganismos, alm da propriedade inseticida, principalmente larvicida, bem como, repelente de insetos (SOUZA et al., 1991). Rocha et al. (2000) estudando o efeito da temperatura de secagem sobre o rendimento e a composio qumica do leo essencial de Cymbopogon winterianus, encontraram os melhores resultados para o tempo de secagem e rendimento de leo na temperatura de 60C e grande variao quantitativa do neral em funo das diferentes temperaturas testadas (30; 40; 50; 60 e 70C). Em Mentha piperita, observou-se que a

elevao da temperatura de secagem de 40 para 60C e depois para 80C provocou uma grande reduo no contedo de leo essencial, alm de afetar tambm a sua composio, diminuindo o contedo de 1,8 cineol e citronelal at 80C e aumentando os contedos de mentol e neomentol at 60C (BLANCO et al., 2002a). Comportamento semelhante de reduo do teor de leo essencial com o aumento da temperatura de secagem tambm foi observado em Rosmarinus officinalis, verificando-se alterao da composio qumica entre 60 e 80C (BLANCO et al., 2002b). Martins (1998) relata que temperaturas superiores a 45C danificam os rgos vegetais e seu contedo, pois causam uma coco das plantas e no uma secagem. A secagem das plantas aromticas e medicinais visa minimizar a perda de princpios ativos e retardar a sua deteriorao em decorrncia da reduo da atividade enzimtica, permitindo a conservao das plantas por um perodo maior para a sua posterior
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Secagem e fragmentao da matria seca no rendimento e composio do leo essencial de capim-limo

comercializao e uso. Alm disso, os processos de secagem afetam sobremaneira o rendimento e a composio qumica das espcies, especialmente as aromticas por possurem substncias muito volteis (VON HERTWIG, 1991). Corra et al. (2004), estudando rendimento de leo essencial sob diferentes mtodos de secagem, observaram que a secagem sobra mista (sol e sombra) e secador solar proporcionaram maior rendimento de leo em comparao secagem em estufa a 35C. Em contrapartida, Rosal et al. (2004) estudando o efeito de diferentes mtodos de secagem no teor de leo essencial de folhas e inflorescncias de basilico (Ocimum basilicum), verificaram que a secagem em estufa a 35 C permitiu maior teor de leo essencial nesta espcie, em comparao com a secagem em desumidificador. O estado de fragmentao do material vegetal tambm tem sua importncia para a otimizao extrativa, pois quanto maior a diviso, mais expostos estaro os princpios ativos. Como os leos essenciais localizam-se em estruturas internas e/ou externas diversas, a fragmentao do material vegetal pode influenciar diretamente no rendimento extrativo. Silva et al. (2004), estudando os teores de leos essenciais de folhas de cidro (Aloysia triphylla), frescas e secas em diferentes tamanhos de fragmentos verificaram que folhas inteiras secas, frescas inteiras e frescas processadas em liquidificador no apresentaram diferenas no teor de leo essencial. Porm as folhas secas trituradas em moinho apresentaram o menor rendimento no ensaio. Os teores e a composio qumica dos constituintes volteis das plantas aromticas sofrem influncia de diversos fatores, dentre os quais destacam-se o mtodo de secagem e o processo extrativo empregado. Desde que toda a comercializao e armazenamento do capim-limo s podem ser realizados com o material seco, elaborou-se este estudo, com o objetivo de determinar o rendimento de leo essencial das folhas de capimlimo submetidas a dois mtodos de secagem e fragmentadas em trs tamanhos.

MATERIAL E MTODOS
O experimento foi conduzido de 29/ 03 a 29/04/2004 em rea experimental
Hortic. bras., v. 23, n. 4, out.-dez. 2005

localizada no municpio de ItumirimMG. Plantas de capim-limo com cerca de 12 meses de idade tiveram suas folhas colhidas pela manh, sendo ento levadas imediatamente ao laboratrio da UFLA para seleo e pesagem. Em seguida, as folhas inteiras foram colocadas em sacos de papel Kraft e levadas aos respectivos tratamentos de secagem: em estufa de circulao forada mantida a 40C e em sala com desumidificador, at peso constante. Aps o perodo de secagem, a matria seca foi fragmentada em trs nveis: pulverizao em moinho de facas utilizando tamis com malha de 20 mesh e cortada em fragmentos com 1 centmetro e com 20 centmetros de comprimento, para a imediata extrao do leo essencial. A extrao do leo essencial das folhas de capim-limo foi realizada pelo processo de hidrodestilao durante 2 horas em aparelho de Clevenger modificado com 40 g de matria seca. Em seguida, o hidrolato foi submetido partio lquido-lquido, em funil de separao, utilizandose 30 ml de diclorometano. Este procedimento foi realizado por trs vezes. A frao orgnica foi reunida e adicionou-se 3 g de sulfato de magnsio anidro para retirar possveis resduos de gua. Aps 30 min de repouso, a soluo foi filtrada por meio de filtrao simples e armazenada temperatura ambiente em vidros escuros parcialmente tampados para permitir a evaporao do solvente temperatura ambiente sob capela de exausto de gases. Em seguida foram determinadas as massas dos leos, a fim de obter os rendimentos extrativos. Amostras do leo foram analisadas em cromatgrafo de gs acoplado a espectrmetro de massa (GC-MS) Shimadzu QP5050A nas seguintes condies: coluna CBP-5 (Shimadzu) preenchida com coluna capilar de slica (30 m x 0,25 mm dimetro interno x 0,25 m, filme composto de fenilmetilpolisiloxano 5%) conectado a um detetor quadruplo operando em modo EI a 70 eV com intervalo de massa entre 40-400 , a razo de 0,5 scan/s; gs carreador: He (1 ml/min); injetor e temperatura de interface a 220C e

240C, respectivamente, com razo de fluxo 1:20. O volume de injeo foi de 0,2 l (20% em CH2Cl2) em fluxo e temperatura de 60C a 246C, com um aumento de 3C/min, aps 10C/min para 270C, mantendo a temperatura final por 5 min. Os componentes foram identificados por comparao com dados de espectro de massa da literatura (ADAMS, 2001) e por base de dados computadorizada usando biblioteca NIST (1998). As concentraes dos compostos foram calculadas a partir das reas dos picos e expressos com valores aferidos em trs anlises. O delineamento experimental adotado foi o de blocos casualizados com 4 repeties, em esquema fatorial 2x3. Os resultados de rendimento foram expressos em g kg-1 de matria seca e analisados pelo software SISVAR para comparao de mdias atravs do teste de Tukey a 5%. A composio qumica dos leos no pde ser comparada estatisticamente pelo teste de Tukey, pois foi analisada somente uma amostra composta formada pelo agrupamento das repeties de cada tratamento.

RESULTADOS E DISCUSSO
O processo de secagem da biomassa de capim-limo reduziu cerca de 5 vezes o peso da matria fresca. A secagem dos fragmentos de 1 e 20 cm em desumidificador proporcionou maior rendimento de leo essencial do que em estufa, ao passo que no estado de p no houve efeito significativo do mtodo de secagem (Tabela 1). Embora outros trabalhos com secagem de capim-limo recomendem o uso de secagem em estufa com temperaturas variando entre 30 e 50C para o maior rendimento e composio qumica do leo (BUGGLE et al., 1999), no presente trabalho, a secagem das folhas em desumidificador, proporcionou maiores rendimentos na quantidade e composio do leo em comparao com o uso da estufa mantida a 40C. O rendimento de leo variou em funo dos diferentes tamanhos de fragmentos da matria seca, apenas quando secos em estufa. De acordo com a Tabela 1, observou-se que a matria seca
957

L. C. B. Costa et al.

Tabela 1. Rendimento mdio de leo essencial (g kg-1 de matria seca) de C. citratus em funo de mtodos de secagem e tamanho dos fragmentos da matria seca. Lavras, UFLA, 2004.
Secagem Estufa Desumidificador Tamanho do Fragmento 20 cm 9,267 13,605 bB aA 1 cm 8,148 14,525 bB aA p * 13,393 aA 13,540 aA

*Mdias seguidas de mesma letra minscula na coluna e maiscula na linha, no diferem entre si a 5% de probabilidade pelo teste Tukey.

Figura 1. Cromatograma do leo essencial de C. citratus.

Tabela 2. Composio qumica mdia (%) dos leos essenciais de C. citratus em funo de mtodos de secagem e fragmentao da matria seca. Gois, UFG, 2004.
Componente 6-metil-5-hepten-2-ona linalol neral geraniol geranial epxido linaloolxido 2-undecanona tridecanona no identificados (citral = neral + geranial Estufa 20 cm t 1,42 30,01 t 39,59 12,39 9,49 t 2,74 69,60 1 cm t 1,14 34,55 1,46 44,50 4,97 1,40 1,17 8,04 79,05 p 1,37 1,49 39,25 1,74 43,80 0,63 1,23 1,09 9,39 83,05 t 1,37 38,36 1,55 46,06 t 1,20 0,87 10,57 84,42 Desumidificador 20 cm 1 cm 1,09 1,74 38,57 1,65 45,44 t 1,39 t 10,12 84,01 p T 1,37 36,66 1,52 45,7 3,61 1,79 1,87 5,21 82,36

reduzida a p proporcionou maior rendimento de leo do que os fragmentos com 1 e 20 cm de comprimento. A localizao dos leos essenciais nas plantas varia de acordo com a famlia botnica a qual pertence, podendo ocorrer em estruturas secretoras especializadas, tais como plos ou tricomas glandulares (Lamiaceae), corpos oleferos (Apiaceae), bolsas lisgenas ou esquizolisgenas (Pinaceae, Rutaceae) ou clulas parenquimticas diferenciadas (Lauraceae, Piperaceae e Poaceae), como o caso do capim-limo (SIMES; SPITZER, 2000; LEWINSOHN et al., 1998). No presente trabalho, provavelmente o desumidificador reduziu a perda de leo destas clulas parenquimticas,
958

contribuindo para um maior rendimento de leo essencial. Possivelmente a menor temperatura no desumidificador e a secagem do material em funo da desidratao do ambiente preservou essas clulas parenquimticas, em comparao com a estufa, que mantm temperatura relativamente alta (40C). A anlise qualitativa do leo essencial de C. citratus, mostra que os componentes majoritrios presentes no leo foram o neral e o geranial (Figura 1). A mistura destes dois ismeros forma o citral, principal constituinte do leo essencial de C. citratus (SOUSA et al., 1991). A composio qumica do leo essencial de C. citratus em funo dos mtodos de secagem e fragmentao

da matria seca encontra-se na Tabela 2. Observa-se que houve variao no contedo de citral em funo do mtodo de secagem e fragmentao da matria seca. Na secagem em desumidificador o contedo de citral foi maior em relao secagem em estufa. Temperaturas menores no desumidificador contriburam para uma menor degradao das clulas oleferas e conseqentemente, preservando os componentes qumicos do leo. No tocante fragmentao, observou-se que na secagem em desumidificador, o contedo de citral foi em mdia 8,25% superior do que na secagem em estufa (Tabela 2). Na secagem em estufa, o contedo de citral variou em funo da fragmentao, sendo que na forma de p, o contedo de citral foi em mdia 19,3% maior que na fragmentao de 20 cm e 5,06% maior em relao ao corte de 1 cm. Porm, para a secagem em desumidificador, o efeito da fragmentao foi menor. A diferena no contedo de citral entre o corte de 20 cm e a reduo a p foi de apenas 2,5%, em comparao s diferenas obtidas na secagem em estufa. Conforme Lewinsohn et al. (1998), o acmulo de citral em C. citratus ocorre em clulas oleferas com paredes celulares lignificadas existentes no mesofilo prximo aos feixes vasculares. A pulverizao do material permitiu um aumento da superfcie de contato do material vegetal no processo de hidrodestilao e portanto uma maior extrao dos leos essenciais contidos nestas estruturas mais profundas. Os compostos volteis so muito sensveis ao processo de secagem. Alteraes na concentrao de compostos volteis durante a secagem podem ser afetadas por vrios fatores como o mtodo de secagem e as caractersticas do produto submetido secagem (VENSKUTONIS, 1997). Na secagem em desumidificador ocorreu a desidratao do material vegetal apenas pela reduo da umidade do ar sem elevao da temperatura do ambiente preservando desta forma, as caractersticas originais da planta. Diante do exposto, pode-se verificar que o desumidificador um aparelho eficienHortic. bras., v. 23, n. 4, out.-dez. 2005

Secagem e fragmentao da matria seca no rendimento e composio do leo essencial de capim-limo

te, de custo reduzido e econmico no uso da energia eltrica em comparao estufa, representando desta forma, uma vantagem do ponto de vista prtico. Vrias pesquisas em ps-colheita de plantas medicinais normalmente preocupam-se apenas com o efeito da temperatura de secagem no rendimento e qualidade do leo essencial (BLANCO et al., 2002a, BLANCO et al., 2002b, MARTINS, 2000, RADNZ et al., 2002, ROCHA et al., 2000, VENSKUTONIS, 1997). Neste estudo, pde-se perceber que o tamanho do fragmento do material vegetal submetido extrao de leos essenciais tambm influencia o rendimento extrativo. Assim, considerando-se a variabilidade da localizao dos leos essenciais nas diferentes famlias de plantas sugere-se a realizao de novos trabalhos levandose em considerao tambm a importante contribuio do tamanho do fragmento de matria seca no rendimento extrativo do leo essencial das plantas medicinais.

LITERATURA CITADA
ADAMS, R.P. Identification of essential oil components by gas chromatography/quadrupole mass sprestroscopy. Allured: Illinois, 2001. 421 p. BLANCO, M.C.S.G.; MING, L.C.; MARQUES, M.O.M.; BOVI, O.A. Drying temperature effects in Peppermint essential oil content and composition. Acta Horticulturae, n.569, p.95-98, 2002a. BLANCO, M.C.S.G.; MING, L.C.; MARQUES, M.O.M.; BOVI, O.A. Drying temperature effects in Rosemary essential oil content and composition. Acta Horticulturae, n.569, p.99-103, 2002b.

BUGGLE, V.; MING, L.C.; MARQUES, M.O.M.; FURTADO, E.; ROCHA, S.F.R. Influence of different drying-temperatures on the amount of essential oils and citral content in Cymbopogon citratus (DC.) Stapf. POACEAE. Acta Horticulturae, n.500, p.71-74, 1999. CORRA JNIOR, C.; MING, L.C.; SCHEFFER, M.C. Cultivo de plantas medicinais, condimentares e aromticas. 2 ed. Jaboticabal: FUNEP, 1994. 162 p. CORRA, R.M.; BERTOLUCCI, S.K.V.; PINTO, J.E.B.P.; REIS, E.S.; ALVES, T.L. Rendimento de leo essencial e caracterizao de folhas de assapeixe submetidas a diferentes mtodos de secagem. Cincia e Agrotecnologia, Lavras, v.28, n.2, p.341-346, 2004. FERREIRA, M.S.C. Estudo farmacolgico do Cymbopogon citratus (D.C.) Stapf. 1984. 93 p. Dissertao (Mestrado) - UFC, Cear. LEWINSOHN, E.; DUDAI, N.; TADMOR, Y.; KATZIR, I.; RAVID, U.; PUTIEVSKY, E., JOEL, D.M. Histochemical localization of citral accumulation in lemongrass leaves (Cymbopogon citratus (DC) Stapf., Poaceae). Annals of Botany, v.81, p.35-39, 1998. MARTINS, E.R.; CASTRO, D.M.; CASTELLANI, D.M.; DIAS, J.E. Plantas Medicinais. Viosa: Editora UFV, 1998. 220 p. MARTINS, P.M. Influncia da temperatura e da velocidade do ar de secagem no teor e na composio qumica do leo essencial de capim-limo (Cymbopogon citratus (D.C.) Stapf.). 2000. 78 f. Dissertao (Mestrado em Engenharia Agrcola) - UFV, Viosa. NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY. PC version of the NIST/ EPA/NIH Mass Spectral Database. U.S. Department of Commerce, Gaithersburg, MD, 1998. ONAWUNMI, G.O.; YISAK, W.A.B.; OGUNLANA, E.O. Antibacterial constituents in the essential oil of Cymbopogon citrates (DC.) Stapf. Journal of Ethnopharmacology, v.12, p.279286, 1984.

RADNZ, L.L.; MELO, E.C.; MARTINS, P.M.; SANTOS, R.H.S.; SANTOS, R.R.; MACHADO, M.C. Secagem de alecrim-pimenta ( Lippia sidoides, Cham.) em secador de leito fixo. Revista Brasileira de Plantas Medicinais, v.5, n.1, p.7982, 2002. ROCHA, S.F.R.; MING, L.C.; MARQUES, M.O.M. Influncia de cinco temperaturas de secagem no rendimento e composio do leo essencial de citronela (Cymbopogon winterianus Jowit). Revista Brasileira de Plantas Medicinais, v.3, n.1, p.73-78, 2000. ROSAL, L.F.; PINTO, J.E.B.P.; BERTOLUCCI, S.K.V.; SOARES, G.A.; BARROS, T.A. Teor de leo essencial de folhas e inflorescncias de basilico sob diferentes mtodos de secagem. In: CONGRESSO DOS PS-GRADUANDOS DA UFLA, 8. 2004, Lavras. Anais... Lavras, 2004. p.23. SILVA, R.; PINTO, J.E.B.P.; BERTOLUCCI, S.K.V.; DINIZ, K.A. Teores de leos essenciais de folhas frescas e secas em diferentes estados de diviso de cidro (Aloysia triphylla (LHrit) Britton)). In: CONGRESSO DOS PSGRADUANDOS DA UFLA, 8. 2004, Lavras. Anais... Lavras, 2004. p.43. SIMES, C.M.O.; SPITZER, V. leos volteis. In: SIMES, C.M.O. et al. Farmacognosia: da planta ao medicamento. 2 ed. Porto Alegre/ Florianpolis: Ed. Universidade/UFRGS/Ed. UFSC, 2000. p.387-416. SOUSA, M.P.; MATOS, M.E.O.; MATOS, F.J.A.; MACHADO, M.I.L.; CRAVEIRO, A.A. Constituintes qumicos ativos de plantas medicinais brasileiras. Fortaleza: Edies UFC, Laboratrio de Produtos Naturais, 1991. 416 p. VENSKUTONIS, P.R. Effect of drying on the volatile constituints of thyme (Thymus vulgaris) And sage (Salvia officinalis L.). Food Chemistry, v.59, n.2, p.219-277, 1997. VON HERTWIG, I.F. Plantas aromticas e medicinais: plantio , colheita , secagem , comercializao. 2 ed. So Paulo: cone, 1991. 414 p.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

959

ALMEIDA, I.P.C.; SILVA, P.S.L.; NEGREIROS, M.Z.; BARBOSA, Z. Baby corn, green ear, and grain yield of corn cultivars. Horticultura Brasileira, Braslia, v.23, n.4, p.960-964, out-dez 2005.

Baby corn, green ear, and grain yield of corn cultivars


Itala Paula de C. Almeida1;2; Paulo Srgio L. e Silva1;3; Maria Z. de Negreiros1; Zenaide Barbosa4
ESAM, C. Postal 137, 59625-900 Mossor-RN; E-mail: paulosergio@esam.br. 4Faculdade Vale do Jaguaribe. Rua Cel. Alexandrino, 563, Centro, 62800-000 Aracati-CE; E-mail: fvj@secrel.com.br; 3bolsista do CNPq (autor correspondente); 2Estudante mestrado da ESAM.
1

ABSTRACT
Most maize cultivars have been developed for grain production. Because superior cultivars may differ in their exploiting purposes, interest has been demonstrated for the evaluation of corn cultivars with regard to their baby corn, green ear, and grain yields production ability. In the present work ten corn cultivars (AG 405, AG 1051, AG 2060, AG 6690, AG 7575, AG 8080, DKB 333 B, DKB 435, DKB 350 and DKB 747) were evaluated in the yield of baby corn, green ears and dry grains. Two experiments were carried out in the same season, in neighboring areas and managed in a similar way, in Mossor, Rio Grande do Norte State, Brazil, in a randomized blocks design with five replicates. Baby corn yield (178,571 plants ha-1) was evaluated in one of the experiments. The other experiment (50,000 plants ha-1) was set to evaluate green ear and dry grain yield. Cultivars DKB 350 and AG 8080 were the most productive in number and weight of marketable unhusked, and husked baby corn ears. Cultivars DKB 435 and AG 8080 were the most productive in number and weight of marketable, unhusked, and husked ears. There were no differences between cultivars for grain yield.

RESUMO
Rendimentos de minimilho, de espigas verdes e de gros de cultivares de milho Desde que a maioria das cultivares de milho foi desenvolvida para produo de gros, existe interesse em se avali-las quanto produo de minimilho e espigas verder pois as cultivares superiores podem diferir, dependendo da finalidade de explorao da cultura. O objetivo do trabalho foi avaliar as produes de minimilho, espigas verdes e de gros de dez cultivares (AG 405, AG 1051, AG 2060, AG 6690, AG 7575, AG 8080, DKB 333 B, DKB 435, DKB 350 e DKB 747) de milho. Dois experimentos, conduzidos na mesma poca, em reas vizinhas e manejados de forma semelhante, foram realizados em Mossor-RN, no delineamento de blocos ao acaso com cinco repeties. Em um deles (178.571 plantas ha-1) avaliou-se a produo de minimilho. No outro (50.000 plantas ha-1), avaliaram-se as produes de espigas verdes e de gros. As cultivares DKB 350 e AG 8080 mostraram-se as mais produtivas em nmero e peso de espigas de minimilho comercializveis, empalhadas e despalhadas. As cultivares DKB 435 e AG 8080 mostraram-se as mais produtivas quanto aos nmeros e pesos de espigas verdes comercializveis, empalhadas e despalhadas. No houve diferena entre cultivares quanto ao rendimento de gros. Palavras-chave: Zea mays L., milho verde.

Keywords: Zea mays L., green corn.

(Recebido para publicao em 18 de fevereiro de 2005 e aceito em 5 de agosto de 2005)

he cultivation of corn (Zea mays L.) for green corn and grain production is one of the most important activities of the Brazilian Northeastern agriculture. Corn ears harvested with a moisture content of the grains between 70 and 80% is called green corn. In the first semester of the year, fruit producing companies without other cropping options successfully explore corn in the areas previously occupied with melon plants, in order to produce green ears, grains, and stubble (aboveground plant parts, without ears), under dryland conditions, and where irrigation is possible. Under these conditions, another option to explore corn would be the production of baby corn. Baby corn consists of the husked ear, harvested two or three days after silk emergence. Baby corn is a profitable crop that allows a diversification of production, aggregation of value, and
960

increased income (PANDEY et al . , 2002). As a product, it is only important in Thailand and a few other countries (PEREIRA FILHO et al., 1998). Because of globalization, other countries have become interested in this crop. Brazil has a promising market because the demand for baby corn is rising and production almost does not exist. There is also a perspective of exportation to other markets, especially those that already import a variety of Brazilian vegetable products. In addition to supplying the growing domestic demand, this product could be included in the export list of agricultural companies, taking advantage of the existing export chain used for fruits, ornamental plants, and other products. Therefore, the evaluation of baby corn production under the conditions of the Brazilian Northeast should be interesting.

There are three reasons to evaluate corn cultivars introduced into the Brazilian Northeast, with regard to their baby corn, green ear, and grain yields. These cultivars are frequently used by growers without being previously evaluated for the Northeastern conditions. Second, these cultivars differ in their green ear and grain yield, and not always the best cultivars for green corn yield are also the best for grain yield (SILVA; PATERNIANI, 1986; SILVA; SILVA, 1991; SILVA et al., 1997; SILVA et al.,1998). Last, specific cultivars for the production of baby corn still do not exist in Brazil, but research works involving cultivars developed for other purposes indicate differences between them (PEREIRA FILHO et al., 1998; CARVALHO, 2002). Apparently, the data upon which the present work was based are pioneer on this subject in the Brazilian Northeast. The objective

Hortic. bras., v. 23, n. 4, out.-dez. 2005

Baby corn, green ear, and grain yield of corn cultivars

of this work was to evaluate the ability of production of baby corn, green ear, and grain yields of ten corn cultivars.

MATERIAL AND METHODS


Corn cultivars produced by the Monsanto company, were evaluated in two experiments carried out under dryland conditions, irrigated by sprinkling as needed: DKB 333B and AG 7575 (single-cross hybrids); DKB 350, AG 8080 and AG 6690 (three-way cross hybrids); DKB 435, DKB 747, AG 2060, AG 405 and AG 1051 (doublecross hybrids). The experiment was sprinkler-irrigated with a 5.6 mm water depth and a one-day watering schedule. The water depth required was calculated considering an effective depth of the root system of 0.40 m. Irrigation time was based on the water retained by the soil at a tension of 0.04 Mpa. Experiment 1: Baby corn yield and other traits The research was carried out at the Rafael Fernandes Experimental Farm, located 20 km away from Mossor, Rio Grande do Norte State (511S latitude, 3720W longitude, and 18 m altitude), from December 2002 to April 2003. The experimental soil was classified as a Podzlico Vermelho-Amarelo Eutrfico. Analysis of this soil presented the following results: pH = 6.7, Ca + Mg = 4.00 cmolc dm-, K = 0.27 cmolc dm-, Na = 0.09 cmolc dm-, Al = 0.04 cmolc dm-, and organic matter = 11.42 g kg-1. The soil was tilled by means of two harrowings and received, at sowing, 30 kg ha-1 N (urea), 60 kg ha-1 P2O5 (single superphosphate), and 30 kg ha-1 K2O (potassium chloride). Half of the nitrogen, all phosphorus, and all potassium were applied as planting fertilization, in furrows located beside and below the seeding furrows. The rest of the nitrogen (30 kg ha-1) was applied, as sidedressing, after weeding. Seeds were planted on 12/20/2002 using two seeds per pit, at 0.80 m 0.07 m row spacing. Thinning was performed 22 days after seeding, leaving one plant per pit (178,571 plants ha-1). Pest control was done by means of three deltamethrin sprays (250 ml ha-1), performed 7; 14 and 24 days after sowing; weed control
Hortic. bras., v. 23, n. 4, out.-dez. 2005

was performed by hoeing 35 days after sowing. A randomized blocks design with five replicates was used. Plots consisted of five plant rows with six meters in length. The usable area consisted of the three central rows eliminating six plants of each end. The evaluated traits were total number and weight of ears; number and weight of marketable unhusked ears; number, weight, length, and diameter of husked ears to be sold fresh or preserved; fresh and dry mass of the above-ground part of the plant, tassels, and roots; leaf area, stalk diameter, plant height, and ear insertion height. The total number and weight of ears were estimated based on the total number of ears harvested from the usable area of the plot. Unhusked ears, free of damage caused by pests or diseases were considered marketable. Husked ears that presented good health, a color varying from pearly white to light yellow, cylindrical shape with a diameter ranging from 0.8 to 1.8 cm and length ranging from 4 to 12 cm were considered marketable. The number of ears to be sold as preserves was also determined (diameter between 1.0 cm and 1.5 cm, and length ranging from 5 to 10 cm). Marketable ear diameter and length were evaluated using a caliper rule. The fresh and dry matter weight of ears, the above-ground part, root system, and tassels were estimated based on 10 ears, five crushed plants, the crushed roots of two plants, and ten tassels, respectively. Leaf area was determined using one plant from each plot, by means of a LICOR 3100 Leaf Area Integrator. Stalk diameter was determined in two plants, by measuring the section located below the ear insertion node with a caliper rule. Plant height (distance from the soil level to the insertion point of the highest leaf) and ear insertion height (distance from the soil level to the ear insertion node), and tassel characteristics were evaluated in the same ten plants selected at random from the usable area of each plot. Experiment 2: Green ear yield, grain yield and other traits This experiment was planted on the same date, in a neighboring area, and

managed in a similar way. Differently from experiment 1, each plot of this experiment consisted of four 6.0 m long rows of plants. The usable area was considered as the space occupied by the two central rows, with the elimination of plants from one pit at each end. One of the usable rows was chosen at random for green ear yield assessment, and the other was used for grain yield assessment. A total of 26 plants per usable row was grown, at a row spacing of 1.0 m x 0.4 m, with two plants per pit (50,000 plants ha-1). The evaluated traits were total number and mass of green ears; number and mass of marketable green ears, either unhusked or husked; fresh and dry mass of the above-ground part of the plant, tassels, and roots; leaf area, stalk diameter, plant height, and ear insertion height; grain yield and its components. The total number and mass of ears were estimated based on the total number of ears harvested from the usable area of the plot. The marketable unhusked ears considered were those free from damage caused by pests or diseases and with a length of 24 cm or longer, and marketable husked ears were those with good health and grain set, presenting a length of 18 cm or longer. The fresh and dry masses of the above-ground part of the plant, tassels, and roots; leaf area, and stalk diameter were evaluated after green ear harvesting. Plant height and ear insertion height were measured after dry ear harvesting. The number of dry ears was estimated based on the ears harvested from the usable area; the number of kernels per ear was obtained from 10 ears selected at random, and the 100-grain weight was estimated based on five samples of 100 kernels. Grain yield was corrected for a moisture content of 15.5% (wet basis).

RESULTS AND DISCUSSION


Experiment 1: Baby corn yield and other traits The baby corn was harvested from 48 to 62 days after sowing, in seven harvest operations. Cultivars AG 405, AG 1051, and AG 2060 showed the most pronounced late behavior. Cultivar DKB 333 B showed the greatest plant height and the greatest fresh mass of the above-ground part,
961

I. P. C. Almeida et al.

Table 1. Means for plant height, ear insertion height, fresh matter of the above-ground part, number of tassel branchings, tassel fresh weight and tassel dry weight of corn cultivars evaluated for baby corn yield. Mossor, ESAM, 2002/20031
Cultivars DKB 333B AG 405 AG 1051 AG 6690 AG 8080 DKB 747 AG 2060 AG 7575 DKB 435 DKB 350 C.V. %
1

Plant height (cm) 191, a 186, ab 184, ab 176, ab 176, ab 160, ab 174, ab 167, ab 176, ab 153, b 9

Fresh weight of Number of tassel Ear height (cm) the above-ground branchings part (kg ha-1) 106, ab 109, ab 112, a 88, bc 82, c 77, c 88, bc 73, c 92, abc 73, c 11 49,250 a 45,036 ab 40,536 ab 43,000 ab 39,928 ab 29,429 b 38,857 ab 32,821 ab 33,893 ab 30,893 ab 24 12, abc 14, a 11, abc 9, c 10, bc 13, ab 12, abc 8, c 11, bc 11, bc 8

Tassel fresh weight (mg) 430, ab 440, ab 390, bc 370, bcd 310, cd 490, a 490, a 290, d 380, bc 360, bcd 15

Tassel dry weight (mg) 210, abc 210, ab 190, bcd 180, cde 160, de 210, abc 240, a 140, e 180, bcd 180, cde 10

Means followed by a common letter do not differ among themselves by Tukey test (P 0.05)

Table 2. Means for the number and weight of marketable unhusked and husked baby corn ears of corn cultivars. Mossor, ESAM, 2002/20031
Cultivars DKB 333B AG 405 AG 1051 AG 6690 AG 8080 DKB 747 AG 2060 AG 7575 DKB 435 DKB 350 C.V. % Unhusked ears Number ha-1 91,505 bcd 80,695 d 87,066 cd 133,691 abc 107,529 bcd 140,723 ab 76,448 d 139,189 ab 141,119 ab 172,393 a 21 kg ha-1 3,627 bc 2,936 c 3,384 bc 4,599 abc 5,672 a 4,844 abc 3,233 bc 4,719 abc 5,008 ab 6,100 a 22 Husked ears Number ha-1 46,718 bc 24,324 c 30,309 c 39,044 bc 53,475 abc 56,564 abc 22,973 c 43,243 bc 68,146 ab 83,765 a 37 kg ha-1 457, b 186, b 323, b 371, b 526, ab 482, b 293, b 403, b 498, ab 877, a 41

Means followed by a common letter do not differ among themselves by Tukey test (P 0.05)

only differing from cultivar DKB 350, which had the shortest height, and from cultivar DKB 747, with respect to fresh mass of the above-ground part (Table 1). The greatest ear insertion height was shown by cultivar AG 1051, which exceeded all cultivars except of cultivars DKB 333 B, AG 405, and DKB 435 (Table 2). High plant densities may cause lodging in some cultivars, in certain environments (BAVEC; BAVEC, 2002), especially with increasing planting density it causes plant height and ear insertion height to increase as well (MODARRES et al., 1998). Since baby corn is generally produced under high planting densities, preference should be given to smallersized cultivars, in order to decrease yield losses, which might happen if lodging
962

occurs before flowering. Cultivars AG 7575 and AG 6690 showed the tassels with the smallest number of branchings and AG 7575 had the smallest fresh and dry masses (Table 1). The tassel functions as a strong sink organ, and may demand an expressive amount of photoassimilates (CHINWUBA et al., 1961). The competition effect for nutrients and carbohydrates between ear and tassel will be so much more severe as will the environments adverse conditions (MAGALHES et al., 1993; GERALDI et al., 1985). In addition, large tassels cause leaf shading (HUNTER et al., 1969). On the other hand, there exist a negative correlation between tassel size and prolificacy (SOUZA JNIOR et al., 1985), which is a very important trait in

cultivars intended for baby corn production. Thus, cultivars with smaller tassels seem to be important for both baby corn and grain production. It is interesting to point out that detasseling provides an increase in the productivity of commercial baby corn ears, regardless of sowing season (CARVALHO et al., 2002) or phosphorus rate applied (SAHOO; PANDA, 2001). However, the effect caused by tassel removal on forage yield varied with cropping season (SAHOO; PANDA, 2001). There were no differences between cultivars with regard to leaf area, stalk diameter, dry mass of the above-ground part of the plant, and fresh and dry masses of the root system. Cultivars DKB 350 and AG 8080 were the most productive with respect to the number and mass of marketable unhusked, and husked baby corn ears (Table 2). It becomes evident, therefore, that depending on the criterion used for yield assessment in baby corn (number or mass of unhusked or husked ears, and so on), cultivars can be different. Yields with a similar magnitude as those observed in the present work for mass of unhusked ears were observed by other authors (CARVALHO, 2002). In relation to husked ears, yields had a similar magnitude as those observed in other experiments (AEKATASNAWAN, 2001), but were lower than those verified in other researches (PEREIRA FILHO et al.,
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Baby corn, green ear, and grain yield of corn cultivars

1998; CARVALHO et al., 2002). Cultivar AG 2060 showed ears with the largest mean diameter, to be sold either fresh or preserved (Table 3). With regard to ear length, the same cultivar and also cultivar AG 6690 yielded the largest ears to be sold fresh. In the case of ears to be sold as preserves, cultivar AG 7575 had high ear length. There were no differences between cultivars with regard to fresh and dry baby corn ear weight. The moisture content for baby corn ears varied from 88% (cultivar AG 405) to 91% (cultivar DKB 350). Other authors obtained a mean value of 89% (YODPET,1979) or a variation from 90% to 95% (CARVALHO, 2002). Experiment 2: Green ear yield, grain yield, and other traits The green ears were harvested from 68 to 76 days after planting date, in four harvesting operations. Cultivars AG 405, AG 1051, AG 8080, DKB 333B, and DKB 435 showed the most pronounced late behavior. There were no differences between cultivars with regard to the total number and weight of green ears. Therefore, the cultivars differed only with respect to their number and weight of marketable ears, either unhusked or husked (Table 4). For these traits, cultivar DKB 747 and AG 8080 proved to be the most productive for number of unhusked marketable ears. Differences between cultivars with regard to traits for green

Table 3. Means for diameter and length of marketable baby corn ears, fresh and preserved, of corn cultivars. Mossor, ESAM, 2002/20031
Cultivars DKB 333B AG 405 AG 1051 AG 6690 AG 8080 DKB 747 AG 2060 AG 7575 DKB 435 DKB 350 C.V., % Ears to be sold fresh Diameter (cm) 1.31, bc 1.37, abc 1.39, abc 1.38, abc 1.33, bc 1.31, bc 1.50, a 1.29, bc 1.26, c 1.42, ab 5 Length (cm) 9.02, abcd 9.34, abc 9.31, abc 9.88, a 8.26, d 8.75, bcd 9.90, a 9.70, ab 8.42, d 8.42, cd 3 Ears to be sold as preserves Diameter (cm) 1.24, bc 1.30, abc 1.32, ab 1.28, abc 1.26, bc 1.24, bc 1.36, a 1.26, bc 1.22, c 1.30, abc 3 Length (cm) 8.76, bc 8.88, ab 8.96, ab 9.20, ab 7.92, de 8.34, de 9.10, ab 9.36, a 8.06, cd 7.76, e 6

Means followed by a common letter do not differ among themselves by Tukey test (P 0.05)

corn yield evaluation were also observed by other authors (SILVA et al., 1997; SILVA et al., 1998). There were no differences between cultivars with regard to leaf area, stalk diameter, fresh and dry masses of the above-ground part of the plant, tassel, and root system, evaluated after the final harvesting of green ears. Among the evaluated traits after harvesting mature ears, there were differences between cultivars only with regard to plant height and ear insertion height, and with regard to weight of 100 grains (Table 4). Cultivars DKB 435 and DKB 747 showed the smallest means for both heights. The greatest mass of 100 grains was shown by cultivar AG 7575. The fact that cultivars differed

with respect to green ear yield but showed the same grain yield could be due to several factors. Cultivars may differ with regard to their green ear cob and straw weights, but their grain at the green corn stage can still show different moisture contents (SILVA; PATERNIANI, 1986). Besides, at the time when green ears are harvested, grain filling is obviously not complete and cultivars may differ with regard to their grain filling rate and duration of the grain filling period (PONELEIT; EGLI, 1979). Finally, ears considered unsuitable for green corn production can be perfectly used for grain production. Cultivar DKB 350 and AG 8080 were the most productive with respect to the number and weight of marketable

Table 4. Means for the number and mass of marketable, unhusked and husked green ears, plant height, and ear insertion height, and 100dry-grain weight of corn cultivars. Mossor, ESAM, 2002/20031
Marketable green ears Cultivars DKB 333B AG 8080 AG 6690 AG 405 DKB 350 AG 1051 AG 2060 AG 7575 DKB 435 DKB 747 C.V., % Unhusked No. ha-1 26,682 bc 39,066 a 37,675 ab 35,817 ab 33,878 abc 24,113 c 32,052 abc 32,104 abc 36,026 ab 39,961 a 16 kg ha-1 6,932 c 10,958 ab 10,659 abc 9,874 abc 8,945 abc 6,998 c 9,317 abc 7,680 bc 8,709 abc 11,630 a 18 Husked No. ha-1 17,430 ab 17,902 ab 27,227 ab 20,876 ab 27,596 ab 15,496 b 23,613 ab 23,415 ab 25,000 ab 32,194 a 30 kg ha-1 2,951 b 3,508 b 4,998 ab 4,098 ab 5,232 ab 3,105 b 4,957 ab 3,629 b 3,798 ab 6,430 a 29 202, a 195, ab 188, ab 188, ab 186, ab 184, ab 183, ab 182, ab 164, b 164, b 9 Plant cm 108, a 90, ab 96, ab 84, ab 89, ab 90, ab 88, ab 94, ab 78, b 74, b 15 36, abc 33, bc 35, abc 40, ab 35, abc 38, abc 37, abc 41, a 32, c 36, abc 10 Heights Ear 100-grain weight (g)

Means followed by a common letter do not differ among themselves by Tukey test (P 0.05).
Hortic. bras., v. 23, n. 4, out.-dez. 2005 963

I. P. C. Almeida et al.

unhusked, and husked baby corn ears. Cultivar DKB 747 and AG 8080 were the most productive with respect to the number and weight of marketable, unhusked, and husked ears. There were no differences between cultivars with respect to grain yield. Therefore, the best cultivars can be different when different corn exploiting purposes are taken into account.

LITERATURE CITED
AEKATASANAWAN, C. Baby corn. In : HALLAUER, A.R. Specialty Corns. 2 ed. Madison, CRC Press LLC, 2001, v.2, cap.9, p.275293. BAVEC, F.; BAVEC, M. Effects of plant population on leaf area index, cob characteristics and grain yield of early maturing maize cultivars. European Journal of Agronomy, v.6, n.2, p.151-159, 2002. CARVALHO, G.S. Caracterizao agronmica e nutricional de milho sob diferentes condies de cultivo para produo de minimilho. 2002. 70 f. (Dissertao de Mestrado em Fitotecnia) - Universidade Federal de Lavras, Lavras. CARVALHO, G.S.; VON PINHO, R.G.; PEREIRA FILHO, I.A. Efeito do tipo de cultivar, despendoamento das plantas e da poca de semeadura na produo de minimilho. Revista Brasileira de Milho e Sorgo. Sete Lagoas, v.1, n.3, p.47 58, 2002. CHINWUBA, P.M.; GROGAN, C.O.; ZUBER, M.S. Interaction of detasseling, sterility and spacing of maize hybrids. Crop Science, v.1, n.2, p.279280, 1961.

GERALDI, I.O.; MIRANDA FILHO, J.B.; VENCOVSKY, R. Estimatives of genetic parameters for tassel characters in maize (Zea mays L.) and breeding perspectives. Maydica, v.30, n.1, p.114, 1985. HUNTER, R.B.; DAYNARD, T.B.; HUME, D.J.; TANNER, J.W.; CURTIS, J.D.; KANNENBERG, L.W. Effect of tassel removal on grain yield of corn (Zea mays L.). Crop Science, v.9, n.4, p.405 406, 1969. MAGALHES, P.C.; GAMA, E.E.G.; MAGNAVACA, R. Efeito de diferentes tipos de despendoamento no comportamento e produo de alguns gentipos de milho . Sete Lagoas: EMBRAPA/CNPMS, 1993. 4 p. (Pesquisa em andamento, 12). MODARRES, A.M.; DIJACK, M.; HAMILTON, R.I; DWYER, L.M.; STEWART, D.M.; MATHER, D.E.; SMITH, D.L. Leafy reducedstature maize hybrid response to plant population density and planting patterns in a short growing season area. Maydica, v.43, n.1, p.227-234, 1998. PANDEY, A.K.; MANI, V.P., PRAKASH, V.; SINGH, R.D.; GUPTA, H.S. Effect of varieties and plant densities on yield, yield attributes and economics of babycorn ( Zea mays ) . Indian Journal of Agronomy, v.47, n.2, p.221-226, 2002. PEREIRA FILHO, I.A.; GAMA, E.E.G.; CRUZ, J.C. Minimilho: efeito de densidade de plantio e cultivares na produo e em algumas caractersticas da planta do milho. In: EMBRAPA. Centro Nacional de Pesquisa de Milho e Sorgo. Sete Lagoas, 1998. 6 p. (EMBRAPA CNPMS. Pesquisa em andamento, 23). PONELEIT, C.G.; EGLI, D.B. Kernel growth rate and duration in maize as affected by plant density and genotype. Crop Science, v.19, n.3, p.385-388, 1979.

SAHOO, S.C.; PANDA, M.M. Effect of phosphorus and detasseling on yield of baby corn (Zea mays L.). Indian Journal of Agricultural Sciences, v.71, n.1, p.21-22, 2001. SILVA, P.S.L.; PATERNIANI, E. Produtividade de milho verde e gros de cultivares de Zea mays L. Cincia e Cultura, So Paulo, v.38, n.4, p.707 712, 1986. SILVA, K.M.B.; SILVA, P.S.L. Produtividade de gros verdes e secos de milho e de caupi. Horticultura Brasileira, Braslia, v.9, n.2, p.87 89, 1991. SILVA, P.S.L.; BARRETO, H.E.P.; SANTOS, M.X. Avaliao de cultivares de milho quanto aos rendimentos de gros verdes e secos. Pesquisa Agropecuria Brasileira, Braslia, v.32, n.1, p.63 69, 1997. SILVA, P.S.L.; SILVA, K.M.B.; SILVA, N.L.; DINIZ FILHO, E.T.; SANTOS, M.X. Rendimentos de gros verdes e secos de cultivares de milho I. Perodo 198590. Revista Ceres, Viosa, v.45, n.257, p.89115, 1998. SOUZA JNIOR, C.L. GERALDI, I.O.; ZINSLY; J.R. Influence of tassel size on the expression of prolificacy in maize (Zea mays L.). Maydica, v.30, n.3, p.321328, 1985. YODPET, C. Studies on sweet corn as potencial young cob corn (Zea mays L.). Laguna, University of the Philippines, Los Banos College,1979. Ph.D. Thesis. 68 p.

964

Hortic. bras., v. 23, n. 4, out.-dez. 2005

ZANO JNIOR, L.A.; LANA, R.M.Q.; S, K.A. Formas de parcelamento e fontes de adubao nitrogenada para produo de couve-da-Malsia. Horticultura Brasileira, Braslia, v.23, n.4, p.965-969, out-dez 2005.

Formas de parcelamento e fontes de adubao nitrogenada para produo de couve-da-Malsia


Luiz Antnio Zano Jnior1; Regina Maria Q. Lana2; Ktia Aparecida de S2
1

UFV, Depto. Solos, 36570-000 Viosa-MG; 2UFU ICIAG; E-mail: luizantoniozanao@yahoo.com

RESUMO
A couve-da-Malsia, Brassica chinensis L. var. parachinensis (Bailey) muito cultivada na China, Austrlia e outros pases do sudeste asitico e foi introduzida no Brasil em 1992. Existem poucas informaes referentes nutrio mineral desta Brssica nas condies brasileiras. O objetivo do presente trabalho foi avaliar o efeito de fontes e parcelamento do nitrognio na produtividade e teores de macro e micronutrientes na parte area desta hortalia. O experimento foi conduzido em casa de vegetao, em vasos de 5 dm3 de volume com 4,8 kg de solo. O delineamento experimental foi em blocos casualizados, em fatorial 2 x 6, com trs repeties. As fontes nitrogenadas, uria e nitrato de clcio, foram avaliadas em diferentes parcelamentos da dose de 105 mg dm-3 de N em trs aplicaes (na semeadura, 15 e 30 dias aps a semeadura), nas seguintes propores: 50%-50%-0%, 0%-50%-50%, 75%-25%-0%, 25%75%-0%, 25%-50%-25% e 33%-33%-33%. As plantas foram colhidas aos 40 dias aps a semeadura. A melhor fonte de nitrognio foi a ntrica (nitrato de clcio), proporcionando maiores produes de massa fresca e seca da parte area, massa seca de razes, produo de folhas por planta e maiores teores de N, Ca e Mn na parte area. Quanto ao parcelamento, os melhores resultados foram obtidos quando se realizou adubao na semeadura seguida de duas coberturas, uma aos 15 e outra aos 30 dias aps a semeadura, nas propores 33%-33%-33% e 25%-50%-25%, para as duas fontes avaliadas.

ABSTRACT
Split forms and sources of nitrogen fertilization for the flowering white cabbage production The flowering white cabbage plant, Brassica chinensis L. var. parachinensis (Bailey) Sinskaja is often cultivated in China, Australia and other southeastern Asian countries and introduced in Brazil in 1992. There is little information regarding the mineral nutrition of this Brassica in the Brazilian conditions. The effect of sources and splitting of nitrogen in the productivity and ratio of macro and micronutrients in the shoot of this vegetable were evaluated. The experiment was carried out in a greenhouse in pots with capacity for 5 dm3. The experimental design was a randomized block design, in a 2 x 6 factorial scheme with three replications. The nitrogen, calcium nitrate and urea sources were evaluated in different splitting for the 105 mg dm-3 of N dose, in the sowing, 15 and 30 days after sowing, in the following ratios: 50%-50%-0%, 0%-50%-50%, 75%-25%0%, 25%-75%-0%, 25%-50%-25% and 33%-33%-33%. The plants were harvested 40 days after sowing. The biggest productions of fresh and dry weight of the shoot, dry matter of root, leaf number and the biggest ratio of N, Ca and Mn in the shoot were reached with the nitric source (calcium nitrate). The best results concerning the splitting were obtained when fertilization took place during the sowing followed by two side dressing applications, one 15 days and another 30 days after sowing, in the proporcions 33%-33%-33% and 25%-50%-25%, for the sources evaluated. Keywords: Brassica chinensis L. var. parachinensis (Bailey) Sinskaja, urea, calcium nitrate, nutrients accumulation.

Palavras-chave: Brassica chinensis L. var. parachinensis (Bailey) Sinskaja, uria, nitrato de clcio, acmulo de nutrientes.

(Recebido para publicao em 23 de agosto de 2004 e aceito em 15 de agosto de 2005) couve-da-Malsia foi introduzida no Brasil, em 1992, por possuir altos teores de vitamina A, a partir de sementes trazidas da Malsia por Dr. Warwick E. Kerr, que adotou esta nomenclatura. Alm disso, de fcil cultivo e de ciclo curto (LEE, 1982; FERREIRA et al., 2002), podendo ser facilmente cultivada em hortas domsticas o ano inteiro, tornando-se uma fonte acessvel de vitamina A. Na literatura existem poucas informaes referentes nutrio mineral de brssicas. Segundo Hori (1965), estas variedades botnicas so grandes extratoras de nutrientes do solo e respondem com alta produtividade em espao de tempo relativamente curto. Para Trani et al. (1994), elas apresentam grande capacidade de resposta ao nitrogHortic. bras., v. 23, n. 4, out.-dez. 2005

nio, verificando-se aumento na produtividade com aplicaes da ordem de at 300 kg ha-1. No entanto, necessrio, entre outros fatores, conhecer as exigncias nutricionais de cada cultivar para se fornecer nutrientes em quantidades adequadas e equilibradas. Sabe-se que a couve-da-Malsia altamente sensvel falta de nitrognio, fsforo, potssio, enxofre (SOUSA, 1997) e boro (MOTA, 2001). Trabalhos realizados com a couve-da-Mlasia na China e Austrlia demonstraram a importncia do nitrognio para a sua produtividade. No Brasil, Zano Jr. et al. (2005) verificaram que a melhor dose de N para a couve-da-Malsia foi de 210 kg ha-1. Segundo More e Morgan (1998), para o cultivo da couve-da-Malsia na Aus-

trlia, recomenda-se a aplicao, no plantio, de 50 m3 ha-1 de esterco bovino; 1,25 a 2,0 t ha-1 de superfosfato simples; 150300 kg ha-1 de nitrato de amnio e cloreto de potssio. Na adubao de cobertura recomendada a aplicao de 150-300 kg ha-1 de nitrato de amnio e cloreto de potssio, uma a trs semanas aps a emergncia. A variao da quantidade verificada em funo da textura do solo. Para Malavolta (1974), quando se estudam aspectos relacionados nutrio das hortalias, deve-se atentar para o fato de que sendo o ciclo delas geralmente curto, essas culturas esto muito sujeitas a distrbios nutricionais, pelo rpido crescimento, intensa produo, alta necessidade de nutrientes e intensa lixiviao de nutrientes no solo.
965

L. A. Zano Jnior et al.

No Brasil, pouco se conhece sobre as exigncias nutricionais da couve-daMlasia. At o momento, as recomendaes de adubao para seu cultivo so feitas, com base naquilo que se conhece para hortalias folhosas como a alface. Como uma folhosa, a adubao nitrogenada e seu manejo so extremamente importantes para o sucesso da cultura, devendo-se ter informaes especficas claras sobre a melhor fonte de nitrognio e o parcelamento mais adequado desta adubao. O objetivo do presente trabalho foi avaliar o efeito de fontes e formas de parcelamento da adubao nitrogenada sobre a produtividade e teores foliares de macro e micronutrientes na parte area das plantas de couve-da-Malsia.

MATERIAL E MTODOS
O experimento foi realizado de maio a julho de 2004, conduzido em casa de vegetao, na Universidade Federal de Uberlndia (MG). As temperaturas mdia mnima e mxima na casa de vegetao, durante o perodo em que o experimento foi conduzido foram, respectivamente, 17C e 26C. A semeadura foi realizada em 09/06/ 2004, diretamente em vasos de 5 dm3, com 4,8 kg de solo mantidos em espaamento de 20 x 20 cm. Foi utilizado solo da camada superficial (0 a 20 cm) de um Latossolo Vermelho distrfico tpico, textura mdia (273 g kg-1 de argila). A anlise do solo apresentou as seguintes caractersticas: pH H 2O (1:2,5) = 4,6; P (Mehlich-1) = 0,2 mg dm-3; K+ (Mehlich1) = 5,4 mg dm-3; Al+3, Ca+2, Mg+2, H+Al, = 6,0; 1,0; 1,0 e 40,0 mmolc dm-3, respectivamente; saturao por bases = 4,22 %, matria orgnica = 12 g kg-1; B, Cu, Fe, Mn, Zn e S-SO4-2 = 0,31; 0,9; 36; 0,3; 0,2 e 6,0 mg dm-3, respectivamente. O experimento foi conduzido em delineamento de blocos casualizados, distribuindo-se os tratamentos em esquema fatorial 2 x 6, com trs repeties. O primeiro fator foram as fontes de nitrognio, sendo ntrica e amdica e o segundo fator constituiu-se dos parcelamentos da aplicao da dose de 105 mg dm-3 de N, o que corresponde a 210 kg ha-1, em diferentes propores, sendo: A) 50% na semeadura, 50% aos
966

15 dias aps a semeadura (DAS) e 0% aos 30 DAS; B) 0% na semeadura, 50% aos 15 DAS e 50% aos 30 DAS; C) 75% na semeadura, 25% aos 15 DAS e 0% aos 30 DAS; D) 25% na semeadura, 75% aos 15 DAS e 0% aos 30 DAS; E) 25% na semeadura, 50% aos 15 DAS e 25% aos 30 DAS e F) 33% na semeadura, 33% aos 15 DAS e 33% aos 30 DAS. Como fonte nitrogenada ntrica utilizou-se o nitrato de clcio e como fonte amdica, a uria. A uria possui 44% de N na forma amdica (NH2), que quando aplicada ao solo, rapidamente hidrolisada e se converte na forma amoniacal e o nitrato de clcio possui 14% de N na forma ntrica e at 1,5 % na forma amoniacal, alm de possuir 1819% de Ca e 0,5-1,5 % de magnsio. O preparo do solo foi feito para cada vaso. A calagem foi realizada para elevar a saturao por bases a 70%, conforme recomendao feita por Ribeiro et al. (1999) para a cultura da alface, aplicando-se uma dose correspondente a 2,0 t ha -1 de calcrio dolomtico calcinado (PRNT 100%). O solo dos vasos foi incubado por 30 dias. A semeadura foi realizada a 1 cm de profundidade, distribuindo-se cinco sementes por vaso. Aps a emergncia, foi realizado o desbaste, deixando-se uma planta por vaso, a mais vigorosa e centralizada. A rega foi feita duas vezes ao dia, utilizando-se 100 ml de gua por rega em cada vaso. Na semeadura, foram aplicados 200 mg dm-3 de P2O5, 30 mg dm-3 de K2O e 1 mg dm-3 de FTE BR-8, com 7% Zn, 2,5% B, 1% Cu, 5% Fe, 10% Mn e 0,1% Mo. Foram realizadas duas coberturas com 25 mg dm-3 de K2O, uma aos 15 e outra aos 30 DAS. A fonte de P2O5 foi o superfosfato triplo e a de K2O o cloreto de potssio. As doses seguiram as recomendaes feitas para a cultura da alface (RIBEIRO et al., 1999). A colheita foi realizada 40 dias aps a semeadura, para avaliao da massa fresca da parte area (MFPA), massa seca da parte area (MSPA), produo de folhas por planta (PF), massa seca de razes (MSR), dimetro do caule (DC), teores dos macronutrientes (N, P, K, Ca, Mg e S) e micronutrientes (B, Cu, Fe, Mn e Zn) na parte area das plantas.

Na colheita, o sistema radicular foi separado da parte area. A produo de folhas foi obtida fazendo-se a contagem das mesmas no momento da avaliao da massa fresca da parte area. O dimetro do caule foi medido com o auxlio de um paqumetro. As razes foram lavadas cuidadosamente at a retirada do solo aderido s mesmas. O excesso de gua foi retirado com o auxlio de papel toalha e em seguida o material (parte area e razes) foi encaminhado para secar em estufa de circulao forada de ar a 70C, at massa constante. A anlise qumica da parte area das plantas, para determinao dos teores de macro e micronutrientes, foi realizada segundo Bataglia et al. (1983). Aps a colheita, foi retirada uma amostra de solo dos vasos, para determinao do pH em gua e teores de Mn e Zn disponveis, segundo metodologia descrita por Silva et al. (1999). Os dados obtidos foram inicialmente submetidos aos testes de normalidade (SHAPIRO-WILK) e homogeneidade (LEVENE), para se determinar, caso necessrio, a transformao a ser adotada. Como as varincias foram homogneas entre os tratamentos e os resduos da anlise da varincia apresentaram distribuio normal, nenhum deles foi transformado. O teste de Tukey a 5% de probabilidade foi utilizado para comparao entre as mdias.

RESULTADOS E DISCUSSO
Considerando os fatores estudados, foi observada interao significativa e efeito significativo independente (P0,05) do parcelamento, apenas para a massa fresca da parte area. No que se refere s fontes, houve efeito significativo para a MSPA; MFPA; MSR; NF; teores foliares de N, Ca, Mn e Zn; pH em gua e teores de Mn e Zn disponveis no solo (Tabelas 1-4). A produo de massa fresca da parte area foi superior quando a dose de 105 mg dm-3 de N foi parcelada nas trs pocas, sendo semeadura, 15 DAS e 30 DAS, nas propores de 25%-50%-25% e 33%-33%-33%. A produo de massa fresca da parte area (produtividade agronmica)
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Formas de parcelamento e fontes de adubao nitrogenada para produo de couve-da-Malsia

alcanada neste experimento foi inferior mxima produo obtida por Zano Jnior et al. (2005) (114,55 g planta-1) com a utilizao de 210 kg ha-1 de N, 30% na semeadura, 35% aos 15 e 35% aos 30 dias e por Ferreira et al. (2002), quando estudaram a mesma variedade em Uberlndia, em condies de campo, com adubao orgnica e mineral em diferentes espaamentos (93 g planta-1), utilizando 70 kg ha-1 de N (42% no plantio e 58% em cobertura, aos 15 DAS). A produo de massa fresca em alguns tratamentos foi semelhante obtida por Dantas (1997), com aplicao de metanol e 80 kg ha-1 de N em vasos mantidos em casa de vegetao (52 g planta-1) e superior produo registrada por Hill (1990), em espaamento 10 x 10 cm, com aplicao de 200 kg ha-1 de N (46 g planta-1), em cultivo realizado em campo na Austrlia. A menor produo de massa fresca da parte area alcanada no presente trabalho, em relao registrada por Zano Jnior, et al. (2005), pode ser explicada pela poca do ano em que os experimentos foram conduzidos. As plantas produzidas neste trabalho foram colhidas cinco dias antecipados, em relao ao trabalho daqueles autores, desenvolvido durante o vero, com temperatura mnima de 21C e mxima de 29C, superiores s ocorridas durante a execuo deste trabalho. Estes resultados indicam o maior desenvolvimento da parte area das plantas em temperaturas mais elevadas e o encurtamento do ciclo em temperaturas mais baixas. Dantas e Arago (2000) verificaram que plantas desta variedade, semeadas em dezembro e agosto, foram fisiologicamente mais eficientes que aquelas produzidas nos outros meses e que plantas produzidas no ms de junho foram as que apresentaram menor crescimento. Pelo que pde ser observado, h necessidade de se realizar uma cobertura nitrogenada aos 15 e uma aos 30 dias aps a semeadura. Estes resultados esto de acordo com os encontrados por Ferreira (2001), que verificou que aos 37 dias aps a semeadura, a ausncia da maioria dos nutrientes na soluo nutritiva, utilizando a tcnica do elemento faltante, reduziu significativamente a produtividade agronmica da couve-daHortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Produo de massa fresca da parte area (MFPA), massa seca da parte area (MSPA), massa seca de razes (MSR), produo de folhas por planta (FP) e dimetro de caule (DC), obtidos com as diferentes fontes e parcelamentos da adubao nitrogenada. Uberlndia, UFU, 2004.
Fonte Parcelamento de N (%) 50 0 Ntrica 75 25 25 33 Mdia 50 0 Amdica 75 25 25 33 Mdia C.V.% 50 50 25 75 50 33 0 50 0 0 25 33 50 50 25 75 50 33 0 50 0 0 25 33 MFPA 64,45 b 64,30 b 61,21 c 70,96 b 78,02 a 80,21 a 69,85 A 45,06 c 49,95 c 56,21 b 56,50 b 65,50 a 68,03 a 56,83 B 14 MSPA (g planta-1) 4,69 4,91 4,19 5,17 5,48 7,83 4,88 A 3,61 3,72 3,88 4,58 4,60 5,26 4,28 B 15 0,53 0,32 0,54 0,50 0,73 0,62 0,54 A 0,20 0,35 0,41 0,42 0,53 0,43 0,39 B 17 MSR PF (n.) 12,00 11,67 12,00 12,00 12,33 12,67 12,11 A 10,00 10,33 11,00 11,33 11,33 12,00 11,00 B 10 DC (mm) 11,6 11,7 12,2 14,9 15,6 16,9 13,8 A 10,4 12,3 13,1 13,4 15,7 16,2 13,5 A 9

Letras minsculas comparam mdias do parcelamento dentro de cada fonte. Letras maisculas comparam mdias entre as fontes. Mdias seguidas da mesma letra no diferem entre si pelo teste de Tukey a 5% de probabilidade.

Tabela 2. Teores de nitrognio (N), fsforo (P), potssio (K), clcio (Ca), magnsio (Mg) e enxofre (S) na parte area das plantas, obtidos com as diferentes fontes e parcelamentos da adubao nitrogenada. Uberlndia, UFU, 2004.
Fonte Ntrica Amdica C.V.% Macronutriente (g kg-1) N 52,29 A 40,95 B 14 P 6,25 A 5,62 A 22 K 17,11 A 17,97 A 17 Ca 30,82 A 23,72 B 13 Mg 8,30 A 7,43 A 16 S 6,38 A 6,29 A 10

Mdias seguidas da mesma letra no diferem entre si pelo teste de Tukey a 5% de probabilidade.

Tabela 3. Teores de boro (B), cobre (Cu), ferro (Fe), mangans (Mn) e Zinco (Zn) na parte area das plantas, obtidos com as diferentes fontes e parcelamentos da adubao nitrogenada. Uberlndia, UFU, 2004.
Fonte Ntrica Amdica C.V.% Micronutriente (mg kg-1) B 128,26 A 126,17 A 17 Cu 7,26 A 7,66 A 12 Fe 161,89 A 175,91 A 9 Mn 119,60 A 78,01 B 10 Zn 79,47 B 90,40 A 14

Mdias seguidas da mesma letra no diferem entre si pelo teste de Tukey a 5% de probabilidade.

Tabela 4. Valores de pH em gua e teores de Mn e Zn no solo, aps a execuo do experimento, obtidos com as diferentes fontes e parcelamentos da adubao nitrogenada. Uberlndia, UFU, 2004.
Fonte Ntrica Amdica C.V.% pH em gua (1:2,5) 5,92 A 5,42 B 4 Mn (mg dm-3) 1,20 B 1,86 A 13 Zn (mg dm-3) 0,83 B 1,13 A 9

Mdias seguidas da mesma letra no diferem entre si pelo teste de Tukey a 5% de probabilidade.
967

L. A. Zano Jnior et al.

Malsia. Estas so as mesmas pocas de parcelamento recomendadas para a alface, segundo Ribeiro et al. (1999). Isso ocorreu porque o nutriente estava disponvel no solo para a planta no perodo e na quantidade em que ela necessitava, em concentraes no to altas para ocorrer lixiviao excessiva ou causar efeito negativo. O maior valor de massa seca de razes foi registrado para o parcelamento da dose de N com aplicao de 25% do N na semeadura e 50% aos 15 DAS e 25% aos 30 DAS para as duas fontes (Tabela 1). Esta produo foi inferior obtida por Sousa (1997) e por Mota (2001), que foram de 2,84 g planta-1 e 0,93 g planta-1, respectivamente. A fonte de maior eficincia na produo de massa seca e fresca da parte area das plantas e de razes foi a ntrica (nitrato de clcio), que propiciou aumento de 23% em relao fonte amdica (uria), indicando, possivelmente, a preferncia da couve-da-Malsia pela absoro do N na forma ntrica (Tabela 1). Segundo Larcher (2000), dentre outros fatores, a espcie/cultivar tem implicaes nos ajustamentos metablicos absoro do amnio e do nitrato. A absoro do on amnio causa grande demanda de esqueletos carbnicos, pois pode servir imediatamente para sntese de aminocidos e compostos que contm N reduzido. Grande consumo dos carboidratos pode ocorrer, se a fotossntese for insuficiente, utilizando o carbono que estaria disponvel para a planta converter em biomassa. Por outro lado, o nitrato quando absorvido reduzido antes de sua assimilao, mas a demanda imediata por carboidratos menor que a do amnio (EPSTEIN, 1975; FERREIRA et al., 1993; LARCHER, 2000). A produo de folhas por planta foi muito semelhante, no influenciado significativamente pelo parcelamento, mas havendo efeito das fontes (Tabela 1). As plantas que receberam aplicao da fonte ntrica produziram 10% a mais de folhas do que as que as que receberam a fonte amdica. O dimetro do caule uma caracterstica avaliada para aceitao da couve-da-Malsia no mercado de hortalias. Segundo Gallacher (1999), um produto
968

de qualidade elevada tem dimetro de caule entre 15 mm e 25 mm. Os resultados obtidos no presente trabalho mostram que as plantas que ficaram includas dentro dessa amplitude foram as que receberam aplicao de N na semeadura e duas coberturas. No houve diferena significativa em relao s fontes. A maior absoro de Ca com aplicao da fonte ntrica explicada pelo fato do nitrato de clcio possuir 18-19% de clcio (Tabela 2). Alm disso, plantas que recebem o N na forma ntrica aumentam a sntese de cidos orgnicos, com conseqente aumento na absoro de ctions, como Ca2+, Mg2+ e K+, para atingir o balano interno de cargas (KIRKYB; KNIGHT, 1977). No existem dados na literatura sobre teores foliares adequados dos nutrientes para couve-da-Malsia. No entanto, os teores foliares de N e Ca obtidos neste trabalho so considerados adequados, segundo Ribeiro et al. (1999), para alface e para Brssicas (repolho e couve-flor). Os maiores teores foliares de zinco obtidos com a fonte amdica podem estar relacionados maior absoro e translocao deste nutriente, em relao aos demais, provavelmente devido acidificao da rizosfera que adubao nitrogenada pode causar, provocada pela absoro do on amnio, formado pela aplicao da uria (FERREIRA et al., 1993). Este fato ficou comprovado com a anlise do solo das parcelas que receberam adubao nitrogenada amdica, onde o pH em gua se encontrava em torno de 5,4 em relao a 5,9, conseguido com a fonte ntrica (Tabela 4). A acidificao da rizosfera, segundo Moraghan e Mascani Jnior (1991), aumenta a eficincia na absoro de micronutrientes metlicos Zn, Mn, Cu e Fe, cuja disponibilidade influenciada pelo pH. Os teores de Zn e Mn no solo, significativamente maiores nas parcelas que receberam a aplicao da uria, comprovam sua maior disponibilidade com o pH baixo (Tabela 4). Os teores foliares de Zn com a aplicao da fonte amdica foram significativamente maiores que a aplicao da fonte ntrica. Os teores foliares de Mn foram maiores com a aplicao da fonte ntrica, apesar deste elemento estar disponvel

em maior quantidade no solo, com a fonte amdica. Isto pode ser explicado em parte, pela competio entre estes ctions NH4+ e Mn2+, pois a presena do amnio na soluo diminuiu a absoro do Mn. Este fato tambm foi verificado por Fernandes et al. (2002) trabalhando com alface e diferentes fontes de nutrientes em cultivo hidropnico. As maiores produes de massa fresca e massa seca da parte area, massa seca de razes e os maiores teores foliares de N e Ca e Mn na parte area foram alcanadas com a fonte ntrica. Os maiores teores foliares de Zn, menores teores disponveis de Mn e Zn no solo e menores valores de pH do solo em gua foram obtidos com a fonte amdica. O nitrato de clcio mostrou ser uma fonte nitrogenada mais vivel em relao a uria, apesar do custo relativo maior, pois proporcionou efeito alcalino no substrato e forneceu maiores quantidades de N s plantas, proporcionando maior produo de massa fresca e seca da parte area, massa seca de razes e produo de folhas por planta. Quanto ao parcelamento, melhores resultados para produo foram obtidos com as propores 33%-33%-33% e 25%-50%-25%, para nitrato de clcio e uria, parcelados na semeadura, 15 e 30 dias aps a semeadura.

AGRADECIMENTOS
Os autores agradecem Prof. Dr. Marli A. Ranal pela reviso crtica e pelas valiosas sugestes, importantes na elaborao deste artigo.

LITERATURA CITADA
BATAGLIA, O.C.; FURLANI, A.M.C.; TEIXEIRA, J.P.F.; FURLANI, P.R.; GALLO, J.R. Mtodos de anlise qumica de plantas. Campinas: Instituto Agronmico, 1983. 48 p. (Boletim Tcnico, 78). DANTAS, B.F.; ARAGO, C.A. Efeito de pocas de semeadura na produo de mudas de couve-da-Malsia ( Brassica chinensis var. parachinensis). Cultura Agronmica, Ilha Solteira, v.9, n.1, p.91-100, 2000. EPSTEIN, E. Nutrio mineral das plantas: princpios e perspectivas. So Paulo:USP, 1975. 344 p. FERNANDES, A.A.; MARTINEZ, H.E.P.; PEREIRA, P.R.G.; FONSECA, M.C.M. Produtividade, acmulo de nitrato e estado nutricional de cultivares de alface, em hidroponia, em funo de fontes de nutrientes. Horticultura Brasileira, Braslia, v.20, n.2, p.195-200, 2002. FERREIRA, M.E.; CASTELLANE, P.D.; CRUZ, Hortic. bras., v. 23, n. 4, out.-dez. 2005

Formas de parcelamento e fontes de adubao nitrogenada para produo de couve-da-Malsia M.C.P. Nutrio e adubao de hortalias . Piracicaba: POTAFOS, 1993. 487 p. FERREIRA, R.N. Produtividade da couve-daMalsia (Brassica chinensis var. parachinensis (Bailey) Sinskaja) submetida a estresse nutricional ao longo o ciclo. 2001. 33 p. (Monografia graduao), Universidade Federal de Uberlndia, Uberlndia. FERREIRA, W.R.; RANAL, M.A.; FILGUEIRA, F.A.R. Fertilizantes e espaamento entre plantas na produtividade da couve-da-Malsia. Horticultura Brasileira, Braslia, v.20, n.4, p.635-640, 2002. GALLACHER, D. Chinese flowering cabbage. Queensland, mai. 1999. Disponvel em: <http:// www.ahs.cqu.edu.au/info/science/psg/AsianVeg/ ChinFlCabb.html>. Acesso em: 20 out. 2003. HILL, T.R. The effect of nitrogenous fertilizer and plant spacing on the yield of three Chinese vegetables - Kai lan, Tsoi sum and Pak choi. Scientia Horticulturae, v.45, p.11-20, 1990. HORI, Y. Tcnica de cultivo e adubao de hortalias. Tokyo: Nippon Ryuan, 1965. 64 p. Original japons. KIRKBY, E.A.; KNIGHT, A.H. Influence of the level of nitrate nutrition on ion uptake and assimilation, organic acid accumulation, and cation-anion balance in whole tomato plants. Plant Physiology, v.60, p.349-353, 1977. LARCHER, W. Ecofisiologia vegetal. Traduo de: Carlos Henrique Britto de Assis Prado. 2. Ed. So Carlos: Rima Artes e Textos, 2000. 531 p. LEE, S.H. Vegetable crops growing in China. Scientia Horticulturae, v.17, p.201-209, 1982. MALAVOLTA, E. Nutrio mineral e adubao de plantas cultivadas. So Paulo: Pioneira, 1974. p.190-224. MOORE, S.; MORGAN, W. Chinese flowering cabbage. The New Rural Industries. Ed.: K.W. Hyde. Canberra, Rural Industries Research and Development Corporation: 178-181, 1998. MORAGHAN, J.T.; MASCAGNI JR., H.J. Environmental and soil factors affecting micronutrient deficiencies and toxicities. In: MORTVEDT, J.J.; COX, F.R.; SHUMAN, L.M.; WELCH, R.M. (Ed.) Micronutrients in agriculture. 2.ed. Madison: SSSA, 1991. p.371-425. MOTA, G.M.F. Cultivo de Brassica chinensis var. parachinensis (Bailey) Sinskaja na ausncia de micronutrientes. 2001. 36 p. (Monografia graduao), Universidade Federal de Uberlndia, Uberlndia. RIBEIRO, A.C.; GUIMARES, P.T.G.; ALVAREZ V., V.H. Recomendaes para o uso de corretivos e fertilizantes em Minas Gerais: 5a aproximao. Comisso de Fertilidade do Solo do Estado de Minas Gerais. Viosa: UFV, 1999. 359 p. SOUSA, E.R. Efeito da nutrio mineral na produtividade de couve-da-Malsia (Brassica chinensis var. parachinensis (Bailey) Sinskaja). 1997. 29 f. (Monografia graduao) - Universidade Federal de Uberlndia, Uberlndia. TRANI, P.E.; GRANJA, N.P.; BASSO, L.C.; DIAS, D.C.F.S., MINAMI, K. Produo e acmulo de nitrato pela rcula afetados por doses de nitrognio, Horticultura Brasileira, Braslia, v.12, n.1, p. 25-29, 1994. ZANO JNIOR, L.A.; LANA, R.M.Q.; RANAL, M.A. Doses de nitrognio na produo de couve-da-Malsia. Horticultura Brasileira, Braslia, v.23, n.1, p.76-80, 2005.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

969

CARNELOSSI, M.A.G.; YAGUIU, P.; REINOSO, A.C.L.; ALMEIDA, G.R.O.; LIRA, M.L.; SILVA, F.G.; JALALI, V.R.R. Determinao das etapas do processamento mnimo de quiabo. Horticultura Brasileira, Braslia, v.23, n.4, p.970-975, out-dez 2005.

Determinao das etapas do processamento mnimo de quiabo


Marcelo Augusto G. Carnelossi; Paula Yaguiu; Anita Caroline L. Reinoso; Glucia Regina de O. Almeida; Moema L. Lira; Gabriel Francisco da Silva; Vahideh R.R. Jalali
UFS, Depto. Eng. Qumica, Av. Marechal Rondon, s/n, Campus Universitrio, Jardim Rosa Elze, 49100-000 So Cristvo-SE; E-mail: carnelossi@ufs.br

RESUMO
Este trabalho teve como objetivo estabelecer um fluxograma operacional para o processamento mnimo de quiabo, produto muito consumido e produzido em diversos estados brasileiros. Para isso, foram avaliados dois modelos de fluxograma. Os procedimentos ideais para cada etapa do processamento mnimo foram determinados utilizando os seguintes parmetros: tipos de corte, concentrao do sanitizante, enxge (tratamento com cido), tempo de centrifugao e tipo de embalagem (PEAD a vcuo e bandejas de poliestireno recobertas com filme de PVC, armazenadas em cmara fria (52C) por oito dias). Com base na anlise sensorial, quiabo cortado em rodelas com aproximadamente 2 cm de espessura mostrou-se o mais aceito. Dentre as concentraes de sanitizantes avaliadas, o tratamento com concentraes de 100 mg L-1 de cloro ativo durante 10 minutos, mostrou eficincia significativa na reduo de coliformes totais, aerbios mesfilos e fungos e leveduras. A utilizao do cido ctrico (1%) durante o enxge mostrou-se eficiente na retirada da mucilagem do produto e verificou-se ainda que o tempo para centrifugao de quiabo deve ser de 10 minutos. A embalagem de PEAD a vcuo foi a que melhor preservou a qualidade dos produtos. Para o processamento mnimo de quiabo deve ser utilizado o seguinte fluxograma: recepo, seleo, lavagem, corte, sanitizao, enxge com cido, centrifugao, embalagem e armazenamento. Palavras-Chave: Abelmoschus esculentus (L.) Moench, sanitizao, centrifugao, embalagens, conservao.

ABSTRACT
Determination of the stages of minimum processing of okra This work aimed to establish an operational flowchart for the minimum processing of okra, a product much consumed and produced in diverse Brazilian States. In this work two models of flowchart were evaluated. The ideal procedures for each stage of the minimum processing were determined by utilization of the following parameters: types of cut, concentration of the rinse (treatment with acid), time of centrifugation and type of the packing (PEAD the recovered polystyrene vacuum and trays with film of PVC, stored in cold chamber (52C) during eight days). On the basis of the sensorial evaluation, okra cuts with approximately 2 cm of thickness were more accepted. Among the concentrations of sanitization products, the treatment with concentrations of 100 mg L-1 of active chlorine during 10 minutes showed significant efficiency in the reduction of total coliforms, mesophiles aerobic, molds and yeast. The citric acid (1%) used during rinses, revealed themselves efficient in the withdrawal of the mucilaginous juice of immature pods. The time for okra centrifugation must be of 10 minutes. The PEAD packing with vacuum preserved the better quality of the minimum processing product. For the minimum processing of okra the following flowchart must be used: reception, selection, washing, cut, sanitization, rinse with acid, centrifugation, packing and storage. Keywords: Abelmoschus esculentus (L.) Moench, sanitization, centrifugation, packaging, storage.

(Recebido para publicao em 1 de maro de 2005 e aceito em 3 de agosto de 2005)

quiabo (Abelmoschus esculentus (L.) Moench), originrio da frica, pertencente famlia Malvaceae tradicionalmente cultivado em regies tropicais. O cultivo dessa hortalia bastante difundido na regio nordeste do Brasil, por possuir um clima bastante favorvel para o seu desenvolvimento (SILVA, 2004). A comercializao de quiabo feita, geralmente utilizando-se frutos in natura. Alguns trabalhos tm sido realizados de forma a desenvolver processos de secagem e determinar as propriedades fsicas do quiabo (ADOM et al., 1996; AKAR; AYDIN, 2005). No entanto, pesquisas relativas ao processamento mnimo dessa hortalia ainda so inexistentes, o que faz desse trabalho um marco no desenvolvimento de tecnologia, apresentando uma
970

nova forma de comercializao e agregao de valor a esses produtos. Em geral, hortalias minimamente processadas, segundo Moretti (2004), so tecidos vegetais que foram danificados de maneira proposital e que devem ser mantidos na forma fresca e com qualidade por perodos prolongados de tempo, pois esse processo acarreta vrias alteraes fsicas e fisiolgicas que afetam a viabilidade e a qualidade dos produtos. Vrios aspectos devem ser considerados quando se trabalha com produtos minimamente processados. Os processos metablicos relacionados aos estresses sofridos pelos tecidos vegetais como a induo do metabolismo de compostos fenlicos, o escurecimento enzimtico e a formao de anaerobiose

conduzem, na maioria das vezes, a alteraes sensoriais importantes (MORETTI, 2004). Cantwell (1992) e Vitti et al. (2003) citam que a injria mecnica causada pelo corte ou descascamento um dos maiores obstculos para a conservao dos produtos minimamente processados, apresentando aumento da taxa respiratria na ordem de 3 a 5 vezes, quando comparado aos rgos intactos. Assim, o armazenamento do produto em baixas temperaturas torna-se imprescindvel, desde o preparo at a comercializao, visando a reduo da respirao e preservao da qualidade e da vida de prateleira do produto pr-processado (VITTI et al., 2003). A utilizao de embalagens e de temperaturas adequadas pode manter o proHortic. bras., v. 23, n. 4, out.-dez. 2005

Determinao das etapas do processamento mnimo de quiabo

duto livre de microorganismos patognicos, com maior manuteno da sua qualidade e uma maior vida de prateleira. As embalagens atuam como barreira protetora, minimizando a perda de gua, reduzindo a taxa respiratria durante o armazenamento, bem como facilitando o transporte, manipulao e a venda dos mesmos (CARNELOSSI et al., 2002). A escolha da embalagem para os minimamente processados depende de fatores como a permeabilidade da embalagem a gases, o tipo de produto e sua taxa respiratria, temperatura de armazenamento dentre outros, visando o aumento do tempo de vida de prateleira (SCHLIMME; ROONEY, 1994). O objetivo do trabalho foi estabelecer o fluxograma para o processamento mnimo do quiabo, levando-se em considerao o tipo de corte, a concentrao do sanitizante, tratamento com cido para a reduo da mucilagem, tempo de centrifugao, tipo de embalagem e temperatura de armazenamento.

MATERIAL E MTODOS
O experimento foi desenvolvido no laboratrio de tecnologia de alimentos da UFS. O quiabo utilizado foi adquirido na Associao de Produtores Orgnicos do Agreste (ASPOAGRE), localizada no municpio de Itabaiana (SE), onde foram transportados em sacolas plsticas para o laboratrio e mantidos em temperatura ambiente (25C). Os fluxogramas avaliados foram a) Recepo Seleo Lavagem Sanitizao Corte Embalagem e b) Recepo Seleo Lavagem Corte Sanitizao Enxge Centrifugao Embalagem. Tendo em vista a semelhana das etapas inicias entre os dois fluxogramas, a recepo, a seleo e lavagem foram realizadas da mesma forma para todo material. A recepo do quiabo foi realizada colocando-se os frutos em caixas plsticas em ambiente refrigerado (12C) por aproximadamente duas horas. Aps esse perodo os frutos foram retirados da refrigerao e submetidos seleo e lavagem. Durante a seleo foram escolhidos os frutos que se apresentavam ntegros e sem injurias mecnicas. A lavagem foi realizada utilizanHortic. bras., v. 23, n. 4, out.-dez. 2005

do-se gua corrente para retirada da sujidade. Aps a lavagem, para o fluxograma A, os frutos foram submetidos sanitizao e posteriormente aos cortes, e para o fluxograma B, os frutos foram submetidos ao corte. O corte dos frutos foi realizado manualmente com o auxlio de facas de ao inox, afiadas e previamente higienizadas em soluo de cloro (100 mg L-1). Os quiabos foram cortados de trs formas, rodelas de aproximadamente 2 cm, picados em cubos com 0,5 cm3 e cortados longitudinalmente em 10 cm. Para a etapa da sanitizao, amostras de quiabo, tanto inteiras quanto cortadas, foram imersas em solues de cloro ativo de marca comercial Sumaveg (Diversey-Lever), com concentraes de 50 mg L-1, 100 mg L-1 e 150 mg L-1, por 10 min. Durante as etapas de sanitizao e corte, nove amostras de 25 g foram retiradas para serem submetidas anlise microbiolgica, de forma a determinar bactrias aerbias mesfilas, coliformes totais, bolores e leveduras. Para o fluxograma A, aps a sanitizao, o produto foi cortado e embalado em bandejas de poliestireno recobertas com filme PVC. Para o fluxograma B, aps a etapa da sanitizao, os quiabos cortados foram enxaguados em solues contendo quatro nveis de cido ctrico (0,5; 1,0; 1,5 e 2,0%) por 10 minutos. Enxge sem cido foi utilizado como controle (3 mg L-1 de cloro ativo), visando a retirada do excesso de mucilagem aderido no quiabo. Testes de centrifugao foram realizados em centrfuga industrial, com velocidade angular de 1290xg, por perodos de 2; 3; 5; 7 e 10 min. Amostras de 200 g foram armazenadas em dois tipos de embalagem: bandejas de poliestireno recobertas com PVC e em embalagens de polietileno de alta densidade (PEAD) a vcuo, e armazenadas a temperatura de 5C2oC, por oito dias. A cada dois dias, foram realizadas anlises dos teores de vitamina C, acidez total, pH e colorao (intensidade de escurecimento) do produto armazenado. Os teores de vitamina C foram determinados utilizando a metodologia

proposta pela American Official Analysis of Chemistry (AOAC, 39.051) (CARNELOSSI et al., 2002). O pH foi determinado em pHmetro digital da marca Schott em 50 ml de soluo obtida pela homogeneizao e filtragem de 5,0 g da amostra em gua destilada. A acidez total (AT) foi determinada utilizando-se 10 ml da soluo utilizada para a determinao do pH, adicionando-se o indicador fenolftalena a 1%, e titulado com NaOH (0,1 N). A AT foi expressa em % de cido ctrico. O ndice de escurecimento do produto foi acompanhado utilizando-se um colormetro (Minolta CR-10), calibrado com a cor branca. Para as medies, foram retiradas 3 rodelas de quiabo de cada repetio, e as leituras foram realizadas na parte interna e externa do produto. Os parmetros obtidos, L, que indica luminosidade (claro/escuro); a, que indica a cromaticidade no eixo da cor verde (-) para vermelha (+); e b, que indica a cromaticidade no eixo da cor azul (-) para amarela (+), foram utilizados para calcular o ndice de escurecimento (IE) de acordo com Palou et al. (1999): IE= [I100(x-0,31)I/0,172], em que, x=(a + 1,75L)/(5,645L+a3,012b). A anlise sensorial foi realizada utilizando o Teste de Aceitabilidade, com escala hednica de 9 pontos (9 = gostei extremamente, 5 = indiferente e 1 = desgostei extremamente). Foram entrevistadas 30 pessoas no treinadas que avaliaram o produto quanto preferncia em relao ao tipo de corte apresentado. A microbiota contaminante dos produtos foi avaliada por meio da determinao da contagem padro de bactrias aerbias mesfilas, bolores e leveduras e a presena de coliformes totais, segundo a metodologia proposta por Vanderzant e Splittstoesser (1992). As anlises foram efetuadas em pores de 25 g do material vegetal homogeneizado com 225 ml de gua peptonada a 0,1%. A contagem padro de aerbios mesfilos foi feita em gar Padro para Contagem (PCA), aps incubao a 3032C por 24 a 48 h. Coliformes totais foram determinados pela tcnica do Nmero Mais Provvel (NMP), utilizando-se Caldo Lauril Sulfato Triptose para
971

M. A. G. Carnelossi et al.

Tabela 1. Anlises microbiolgicas do quiabo minimamente processado submetida a diferentes tratamentos de corte e sanitizao. So Cristvo (SE), UFS, 2004.
Amostra Matria prima Inteiro s/sanit. Inteiro 50ppm Inteiro 100ppm Inteiro 150ppm Cortado s/sanit. Cortado 50ppm Cortado 100ppm Cortado 150ppm
1 4

Bactrias aerbias mesfilas 6.5X10


4

Bolores e leveduras 1.9X10 4.3X104 8.1X10 4.4X10 * 5.1X10 * * *

Coliformes totais > 110 > 110 15 2.8 3.5 5.3 5.3 9.3 9.3

6.4X104 3.3X104 3X10 3X104 4.9X10 3X10 * 4.3X10

fatorial 2x5 (dois tipos de embalagem e 5 perodos de avaliao). Foram utilizadas 3 repeties com aproximadamente 200 g do produto em cada embalagem. Os resultados foram submetidos anlise de varincia pelo teste F e comparao de mdias pelo teste Tukey (5%), com o auxlio do software Assistat (Assistncia Estatstica), verso 7.2 beta.

RESULTADOS E DISCUSSO
Por meio de anlises microbiolgicas, observou-se que a concentrao de 50 mg L-1 mostrou-se eficiente no controle dos coliformes totais, reduzindo-se os valores de 120 NMP g-1 ml-1 da matria-prima para 5,3 NMP g-1 ml-1 no produto cortado e sanitizado (Tabela 1). Para o controle dos fungos, leveduras, bactrias aerbias e mesfilas, a concentrao de 100 mg L-1 foi mais eficiente, apresentando valores abaixo do limite de contagem. Nas amostras sanitizadas inteiras e depois cortadas (fluxograma A), observou-se que, apesar da concentrao de 50 a 100 mg L-1 de cloro ter apresentado eficincia no controle dos microorganismos, a manipulao (corte) do produto aps a sanitizao ocasionou uma recontaminao da amostra, inviabilizando, dessa forma, a utilizao desse fluxograma. De acordo com Pilon (2003), a lavagem de hortalias com 50 mg L-1 de cloro livre na gua reduz significativamente a contagem total de aerbios mesfilos, enquanto que os coliformes fecais mostraram-se mais sensveis ao cloro no sendo detectados aps lavagem com 10, 20 e 50 mg L-1. Os resultados obtidos por meio do teste de aceitabilidade determinaram que o corte no formato de rodelas (2 cm) foi o mais aceito, apresentando nota mdia de 6,9, correspondente ao termo da escala hednica gostei moderadamente. Os cortes no formato longitudinal e picado no diferiram estatisticamente entre si, apresentando notas 5,7 (indiferente) e 6,1 (gostei ligeiramente), respectivamente. A utilizao de 1% de cido ctrico na etapa de enxge (Figura 1A), associado centrifugao por 10 min, mostrou-se ideal para a retirada do excesso de gua e de mucilagem. Observou-se tambm que, para o tratamento controHortic. bras., v. 23, n. 4, out.-dez. 2005

valores na ordem de 10 a 10 UFC/g na contagem padro. *inferior ao limite (<2,5x10)

Figura 1. Diferena de peso (A) de quiabo minimamente processado tratado com diferentes concentraes de cido ctrico no enxge e centrifugados por 10 minutos, e teores de vitamina C (B) do quiabo embalado a vcuo e em bandejas com PVC, armazenados a 52C por 8 dias. As barras representam o erro padro da mdia. So Cristvo (SE), UFS, 2004.

o teste presuntivo e Caldo Bile Verde Brilhante, para o confirmativo. A contagem de bolores e leveduras, foi realizada inoculando-se 0,1 ml de cada amostra em 15 a 20ml do meio de cul972

tura gar Batata Dextrose Acidificado (PDA). As placas foram incubadas em estufa a 25C por 5 dias. O delineamento experimental foi inteiramente ao acaso, em esquema

Determinao das etapas do processamento mnimo de quiabo

le, a diferena de peso foi menor do que a da concentrao de 0,5% (Figura 1A). Isso se deve ao fato de que o tempo de centrifugao utilizado para essa amostra, 20 min, no foi suficiente para a retirada do excesso de gua e mucilagem aderida ao produto. A mucilagem encontrada no quiabo classificada como polissacardica-cida associada com protenas (AMAYAFARFAN et al., 2003), podendo, se no removida, servir de substrato para o crescimento de microrganismos durante o armazenamento, causando a depreciao do produto. Pineli (2004) cita que o cido ctrico o principal cido orgnico de frutas e vegetais, atuando sinergisticamente com cidos ascrbico e eritrbico e seus sais neutros. capaz de complexar prooxidantes, como o cobre do centro ativo da polifenoloxidase, inativando-os. Aps o segundo dia de armazenamento, observou-se que os teores de vitamina C (Figura 1B) apresentaram reduo de aproximadamente 45%, quando comparados ao quiabo antes do processamento, nas duas embalagens testadas. Esse acentuado decrscimo pode ter sido ocasionado pelo aumento na taxa do metabolismo, causado pela injria mecnica (corte) da hortalia, que provoca a oxidao de vrios compostos, dentre eles, a vitamina C. (CARNELOSSI et al., 2002). Aps esse perodo, verificou-se estabilizao dos teores de vitamina C. Isso pode ser explicado devido reduo do metabolismo, influenciado pela utilizao da embalagem e pelo armazenamento em baixa temperatura (5oC), como ocorre em diversos produtos minimamente processados (CARNELOSSI et al., 2002). Quando embalados com PVC, verificou-se um decrscimo do teor de vitamina C, comparado com a embalagem a vcuo o que pode, provavelmente, estar associado alta permeabilidade do filme, que no capaz de reter o metabolismo do produto. De acordo com Pilon (2003), a vitamina C a mais instvel das vitaminas por ser sensvel aos agentes fsico-qumicos como a luz, oxignio e o calor. Klein (1987) cita que a perda de sua estabilidade pode ser conseqncia de vrios fatores, como o rompimento ceHortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 2. Teores de Acidez Titulvel (A) e variao do pH (B) do quiabo embalado a vcuo e em bandejas com PVC, armazenados a 52C. As barras representam o erro padro da mdia. So Cristvo (SE), UFS, 2004.

lular por dano ao tecido, corte ou moedura. Em todos os tratamentos, verificouse uma queda brusca no segundo dia de armazenamento no teor de acidez titulvel (AT) (Figura 2A), aps o qual manteve-se constante at o final do experimento, para as duas embalagens testadas. O controle da atmosfera atravs da utilizao de embalagens e a diminuio da temperatura de armazenamento podem, possivelmente, ter ocasionado a diminuio na taxa de degradao do substrato (acares) e, consequentemente, uma provvel reduo do valor da acidez. Quanto aos valores do pH (Figura 2B), observados durante o perodo de armazenamento, notou-se comportamento inversamente proporcional acidez, apresentando aumento acentuado no tempo 2 e estabilizao at o oitavo

dia. Esse resultado pode estar relacionado, com a estabilizao metablica do produto, em virtude da utilizao da embalagem e do armazenamento em baixa temperatura. A intensidade de escurecimento (IE) indicou que a embalagem a vcuo foi eficiente em evitar o escurecimento, tanto na parte interna quanto na parte externa do quiabo (Figuras 3A e 3B). Para a embalagem de PVC, observou-se que a maior permeabilidade da mesma ao oxignio pode ter provocado o escurecimento do produto, pois o mesmo utilizado pela enzima polifenoloxidase (PPO) para oxidao de compostos fenlicos (WHITAKER; LEE, 1995). Em couve minimamente processada, Carnelossi et al. (2002) mostraram que o escurecimento pode estar diretamente relacionado com a atividade da enzima polifenoloxidase, que oxida
973

M. A. G. Carnelossi et al.

xograma: Recepo Seleo Lavagem Corte (rodelas de 2 cm) Sanitizao (100 mg L-1 de cloro ativo) Enxge (cido ctrico 1%) Centrifugao (10 min) Embalagem (PEAD a vcuo) Armazenamento (5C).

AGRADECIMENTOS
Os autores expressam seus agradecimentos ao CNPq (Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico), pelo auxlio financeiro concedido para a realizao do trabalho, EMDAGRO e a ASPOAGRE pelo fornecimento do material utilizado nos experimentos.

LITERATURA CITADA
ADOM, K.K.; DZOGBEFIA, V.P.; ELLIS, W.O.; SIMPSON, B.K. Solar drying of okra effects of selected package materials on storage stability. Food Research International, v.29, n.7, p.589-593. 1996. AKAR, R.; AYDIN, C. Some physical properties of gumbo fruit varieties. Journal of Food Engineering, n.66, p.387-393, 2005. AMAYA-FARFAN, J.; SILVA, V.S.N.; SOUZA, A.S.; PACHECO, M.T.B. Caracterizao qumica parcial da mucilagem do quiabo (Hibiscus esculentus L.) In: SIMPSIO LATINO-AMERICANO DE CINCIA DE ALIMENTOS, 5, 2003, Campinas. Anais...Campinas-SP: UNICAMP, 2003. CANTWELL, M. Postharvest handling systems: minimally processed fruits and vegetables. In: KADER, A.A. (Ed.). Phostharvest technology of horticultural crops. 2ed. Daves: Univ. California, Division of horticulture and natural resources, 1992. p.277-81. CARNELOSSI, M.A.G.; SILVA, E.O.; CAMPOS, R.S.; SOARES, N.F.F.; MINIM, V.P.R.; PUSCHMANN, R. Conservao de folhas de couve minimamente processadas. Revista Brasileira de Produtos Agroindustriais. UFPB. Campina Grande, v.4, n.2, 2002, p.149-155. COUTURE, R., CANTWELL, M.I., KE, D., SALTVEIT JUNIOR., M.E. Physiological attributes related to quality attributes and storage life of minimally processed lettuce. HortScience, v.28, n.7, p.723-5, 1993. GOUPY, P., AMIOT, M.J., RICHARD-FORGET, F., DUPRAT, F., AUBERT, S., NICOLAS, J. Enzymatic browning of model solutions and apple phenolic extracts by apple polyphenoloxidase. Journal of Food Science, v.60, n.3, p.497-501. 1995. HOWARD, L.R., GRIFFIN, L.E., LEE, Y. Steam treatment of minimally processed carrots sticks to control surface discoloration. Journal of Food Science, v.59, n.2, p.356-8. 1994. KLEIN, B.P. Nutritional consequences of minimal processing of fruits and vegetables. Journal of Food Quality, v.10, p.179-93, 1987. Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 3. Intensidade de escurecimento (IE) da parte interna (A) e da parte externa (B), de quiabo embalado a vcuo e em bandejas com PVC, armazenados a 52C. As barras representam o erro padro da mdia. So Cristvo (SE), UFS, 2004.

compostos fenlicos produzindo uma colorao escura nos tecidos minimamente processados tais como observado em alface e repolho (COUTURE et al., 1993; HOWARD et al., 1994). Moretti et al. (2002) citam que os danos mecnicos (corte) causados durante o processamento podem aumentar a concentrao de dixido de carbono, etileno e de gua livre, causar alteraes no sabor e aroma, alm de aumentar a atividade de enzimas relacionadas ao escurecimento enzimtico, como a fenilalanina amnia liase (PAL) e a polifenoloxidase (PPO). Para Goupy et al. (1995), a intensidade do escurecimento enzimtico depende de
974

vrios fatores, principalmente do contedo de compostos fenlicos e do tipo de PPO presente na clula, ou ambos. Couture et al. (1993) observaram, em alface minimamente processada, que o aumento da intensidade de escurecimento com o tempo de armazenamento, pode ser devido ao aumento na atividade da enzima fenilalanina amnia liase (PAL), responsvel pela sntese de compostos fenlicos, e tambm pelo aumento na sntese de etileno, o qual estimula a atividade da PAL e PPO. De acordo com os resultados obtidos, determinou-se que o processamento mnimo do quiabo deve seguir o seguinte flu-

Determinao das etapas do processamento mnimo de quiabo MORETTI, C.L.; ARAJO, A.L.; MAROUELLI, W.A.; SILVA, W.L.C. Respiratory activity and browning of minimally processed sweet potatoes. Horticultura Brasileira, Braslia, v.20, n.3, p.497500, 2002. MORETTI, C.L. Panorama do processamento mnimo de hortalias. In: ENCONTRO NACIONAL SOBRE PROCESSAMENTO MNIMO DE FRUTAS E HORTALIAS, 3, 2004, Viosa. Anais... Viosa: UFV, 2004. p.1-8. PALOU, E.; LPES-MALO, A.; BARBOSACNOVAS, G.V.; WELTI-CHAVES, J.; SWANSON, B.G. Polyphenoloxidase activity and color of blanched and high hydrostatic pressure treated banana puree. Journal of Food Science. v.64, n.1, p.42-45, 1999. PILON, L. Estabelecimento da til de hortalias minimamente processadas sob atmosfera modificada e refrigerao. 2003. 111 f. (Tese mestrado) USP, ESALQ, Piracicaba. PINELI, L.L.O. Processamento mnimo de batata. In: ENCONTRO NACIONAL SOBRE PROCESSAMENTO MNIMO DE FRUTAS E HORTALIAS, 3, 2004, Viosa. Anais... Viosa: UFV, 2004. p.71-81. SCHLIMME, D.V., ROONEY, M.L. Packing of minimally processed fruits and vegetables. In: WILEY, R.C.(Ed.). Minimally processed refrigerated fruits & vegetables . London: Chapman & Hall. 1994. p.135-82. SILVA, C.V. Melhoramento Gentico do Quiabeiro . Disponvel em: <http://www.ufv.br/dbg/ bioano01/div11.htm>. Consultado em: 09 ago. 2004. VANDERZANT, C; SPLITTSTOESSER, D.F. Compendium of Methods for the Microbiological Examination of Foods. American Public Health Association, Washington, 1992. VITTI, M.C.D.; KLUGE, R.A.; YAMAMOTTO, L.K.; JACOMINO, A.P. Comportamento da beterraba minimamente processada em diferentes espessuras de corte. Horticultura Brasileira , Braslia, v.21, n.4, p.623-626, 2003. WHITAKER, J.R., LEE, C.Y. Recent advances in chemistry of enzymatic browning: an overview. In : LEE, C.Y., WHITAKER, J.R. (Eds.). Enzymatic browing and its prevention. Washington, D.C., ACS, 1995. p.2-7.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

975

RESENDE, G.M.; ALVARENGA, M.A.R.; YURI, J.E.; MOTA, J. H.; SOUZA, R.J.; RODRIGUES JNIOR, J.C. Produtividade e qualidade ps-colheita da alface americana em funo de doses de nitrognio e molibdnio. Horticultura Brasileira, Braslia, v.23, n.4, p.976-981, out-dez 2005.

Produtividade e qualidade ps-colheita da alface americana em funo de doses de nitrognio e molibdnio


Geraldo M. de Resende1; Marco Antnio R. Alvarenga2; Jony E. Yuri2; Jos Hortncio Mota3; Rovilson Jos de Souza2; Juarez C. Rodrigues Jnior4
Embrapa Semi-rido, C. Postal 23, 56300-000 Petrolina-PE.; 2UFLA. Depto. Agricultura, C. Postal 37, 37200-000 Lavras-MG; 3Centro Universitrio de Dourados, Depto. Cincias Agrrias, C. Postal 533, 79804-970, Dourados-MS; 4Agromax, R. Tiradentes, 12, 37750-000 Machado-MG
1

RESUMO
O trabalho foi conduzido no municpio de Trs Pontas (MG), de outubro a dezembro de 2002, para avaliar a influncia de doses de nitrognio e molibdnio nas caractersticas produtivas e qualidade ps-colheita da alface americana (Lactuca sativa L.). Utilizou-se o delineamento de blocos ao acaso em arranjo fatorial 4 x 5, compreendendo quatro doses de nitrognio em cobertura adicionais dose aplicada pelo produtor de 60 kg/ha de N (0; 60; 120 e 180 kg/ha) e cinco doses de molibdnio via foliar (0,0; 35,1; 70,2; 105,3 e 140,4 g/ha) e trs repeties. O maior peso fresco total foi obtido com a dose de 86,9 kg/ha de nitrognio em cobertura e 87,4 g/ha de molibdnio. Com relao ao peso fresco comercial a dose de 89,1 kg/ha de nitrognio em cobertura propiciou a maior resposta, sendo para molibdnio a mxima produtividade alcanada com a dose de 94,2 g/ha. As doses de 85,3 kg/ha de nitrognio em cobertura e 72,9 g/ha de molibdnio proporcionaram a maior circunferncia de cabea comercial. No se observou efeito significativo dos tratamentos para comprimento do caule e na conservao ps-colheita. As doses de 89,9 kg/ha de N em cobertura e 77,2 g/ha de Mo em pulverizao foliar propiciaram a maior porcentagem de matria seca.

ABSTRACT
Yield and postharvest quality of summer growing crisphead lettuce as affected by doses of nitrogen and molybdenum The influence of nitrogen and molybdenum doses was evaluated on the productive characteristics and postharvest quality of crisphead lettuce (Lactuca sativa L.), at Trs Pontas, Minas Gerais State, Brazil, from October to December 2002. A randomized complete block design in a 4 x 5 factorial arrangement with three replications was used. The factorial consisted of four doses of nitrogen (0; 60; 120 and 180 kg/ha) in top dressing, in addition to the usual farmers doses (60 kg/ha), and five doses of molybdenum in foliar application (0.0; 35.1; 70.2; 105.3, and 140.4 g/ha). The highest total fresh weight was obtained with the doses of 86.9 kg/ha of nitrogen in top dressing and 87.4 g/ha of molybdenum. Highest commercial fresh weight was obtained using the doses of 89.1 g/ha of nitrogen in top dressing, while the doses of 94.2 g/ha of molybdenum resulted in the highest yield. The doses of 85.3 kg/ha of nitrogen in top dressing and 72.9 g/ha of molybdenum were the best for highest commercial head circumference. There was no significant effect of the treatments on stem length and post-harvest conservation. The highest percentage of dry matter was obtained with the doses of 89.9 kg/ha of N in top dressing and 77.2 g/ha of Mo in foliar spray. Keywords: Lactuca sativa L., fresh weight, nutrition, storage.

Palavras-chave: Lactuca sativa L., massa fresca, nutrio, armazenamento.

(Recebido para publicao em 21 de maro de 2005 e aceito em 5 de agosto de 2005) alface americana, tipo repolhuda Crisphead lettuce, vem adquirindo importncia crescente, principalmente, na regio de Lavras. O plantio deste tipo de alface visa, principalmente, atender as redes fast food , como a MacDonalds, com mais de 30 produtores em diversos municpios do sul de Minas Gerais, cultivando cerca de 1800 ha por ano, totalizando aproximadamente 10500 toneladas desta folhosa (YURI, 2000). Sua larga adaptao s condies climticas diversas, a possibilidade de cultivos sucessivos no mesmo ano, a baixa suscetibilidade a pragas e doenas e a comercializao segura, fazem desta cultura a preferida pelos olericultores (RICCI, 1993), que a cultivam em condies de campo a cu
976

aberto, em cultivo protegido (estufas) ou em hidroponia (soluo nutritiva). A adubao constitui uma das prticas agrcolas mais caras e de maior retorno econmico, resultando em maiores rendimentos e em produtos mais uniformes e de maior valor comercial (RICCI et al., 1995). Sendo a alface uma cultura composta basicamente por folhas, esta responde muito adubao nitrogenada. A deficincia de nitrognio retarda o crescimento da planta e induz ausncia ou m formao da cabea, as folhas mais velhas tornam-se amareladas e desprendem-se com facilidade. Entretanto, quando aplicado em demasia, em adubao de cobertura, no ltimo tero do ciclo, as cultivares que formam cabea

apresentam menor firmeza, o que poder ser prejudicial comercializao (GARCIA et al., 1982). Nos sistemas biolgicos o molibdnio constituinte de pelo menos cinco enzimas catalisadoras de reaes. Trs destas enzimas (redutase do nitrato, nitrogenase e oxidase do sulfito) so encontradas em plantas (GUPTA; LIPSETT, 1981). A funo mais importante do molibdnio nas plantas est relacionada com o metabolismo do nitrognio. A redutase do nitrato ou nitratoredutase uma flavoprotena que possui Mo como grupo prosttico e cuja sntese induzida pela presena de Mo e NO3- no meio (MALAVOLTA, 1980). Esta enzima catalisa a reduo biolgica do NO-3 a NO-2, que o primeiro pasHortic. bras., v. 23, n. 4, out.-dez. 2005

Produtividade e qualidade ps-colheita da alface americana em funo de doses de nitrognio e molibdnio

so para a incorporao do nitrognio, como NH2, em protenas (DECHEN et al., 1991). Por outro lado, evita o acmulo de NO-3 em plantas alimentcias e forragens, impedindo a combinao do mesmo com a hemoglobina do sangue e a produo de metahemoglobina que, por no funcionar como transportadora de O2, causa deficincia de oxignio em pessoas e animais (MALAVOLTA, 1980; OLIVEIRA, 1980). A deficincia de molibdnio em brssicas tambm est associada a uma acumulao de nitratos nas folhas (NOGUEIRA et al., 1983). No Brasil observa-se a necessidade de maiores pesquisas sobre doses de fertilizantes a serem utilizadas, adequadas s diferentes cultivares, regies e pocas de plantio. Alm disto, na ansiedade de obter maior produtividade, o olericultor aplica em excesso, elementos minerais, resultando muitas vezes em distrbios nutricionais nas plantas, alm de acarretar aumento do custo de produtividade. A aplicao de nitrognio via solo aliada aplicao de molibdnio via foliar, pode ser uma prtica que venha a melhorar a fertilizao desta cultura, com o uso mais racional do nitrognio, e por uma maior atividade da enzima redutase do nitrato, atravs do uso da adubao molbdica. O objetivo deste trabalho foi avaliar os efeitos de doses de nitrognio em cobertura e molibdnio via foliar nas caractersticas produtivas e qualidade ps-colheita no comportamento da alface americana em cultivo de vero.

MATERIAL E MTODOS
O experimento foi conduzido no municpio de Trs Pontas, sul de Minas Gerais, na Fazenda Carapua II do produtor Jos Cludio Nogueira, altitude de 870 m, situado a 212200" de longitude sul e 453045' de longitude oeste, em um Latossolo Vermelho Distrofrrico de textura argilosa. O clima da regio caracterizado por temperatura mdia anual variando de 15,8C no ms mais frio, a 22,1C no ms mais quente; a precipitao mdia anual de 1.529,7 mm e a umidade relativa do ar de 76,2%. A anlise do solo
Hortic. bras., v. 23, n. 4, out.-dez. 2005

onde foi instalado o experimento apresentou as seguintes caractersticas qumicas: K = 70,0 mg dm-3; P = 78,0 mg dm-3; Ca = 4,1 cmolc dm-3; Mg = 0,8 cmolc dm-3; Al = 0,0 cmolc dm-3; H+Al = 2,3 cmolc dm-3; Zn = 0,8 mg dm-3; Fe = 25,0 mg dm-3; Mn = 14,2 mg dm-3; Cu = 1,0 mg dm-3; B = 0,3 mg dm-3; pH em H2 0 = 6,0 e matria orgnica = 2,4 dag kg-1. O delineamento experimental foi de blocos ao acaso no esquema fatorial 4 x 5, compreendendo quatro doses de nitrognio em cobertura adicionais a dose aplicada pelo produtor de 60 kg/ha de nitrognio (0; 60; 120 e 180 kg/ha) e cinco doses de molibdnio via foliar (0,0; 35,1; 70,2; 105,3 e 140,4 g/ha) e trs repeties, perfazendo um total de 20 tratamentos. A uria foi utilizado como adubo nitrogenado e como fonte de molibdnio o molibdato de sdio. A uria foi aplicada em cobertura aos 10; 20 e 30 dias aps o transplante em 40, 30 e 30%, respectivamente, da dose avaliada. As doses em cobertura de uria por parcela por planta foram previamente diludas em gua pura, aplicando-se 10 ml da soluo, lateralmente a cada planta. O molibdato de sdio foi aplicado aos 21 dias aps o transplante atravs de pulverizador costal manual capacidade de 4 L em mxima presso, gastando-se 300 L de calda/ha. O preparo do solo constou de arao, gradagem e levantamento dos canteiros a 0,20 m de altura. As mudas foram obtidas em bandejas multicelulares de 288 clulas cada uma, preenchidas com substrato comercial (Plantmax), sendo o transplante feito aos 25 dias aps o semeio, utilizando-se a cultivar Raider que apresenta um ciclo de 48 a 50 dias aps o transplante, com peso mdio de planta entre 700 e 1200 g, folhas de colorao verde-clara mais duras e boa tolerncia ao pendoamento (YURI, 2000). As parcelas experimentais constituram-se de canteiros com quatro linhas de 2,1 m de comprimento espaadas de 0,30 m, sendo entre plantas de 0,35 m. As linhas centrais formaram a rea til, retirando-se duas plantas em cada extremidade. Foi instalada, em toda a rea, uma estrutura de proteo, constituda de tneis altos com 2,0 m de altura, cobrindo dois canteiros por tnel, constitudo de tubos de ferro galvanizados,

coberta com filme plstico transparente de baixa densidade, aditivado com antiUV, de 100 micras de espessura, sendo os canteiros revestidos com filme plstico preto mulching, de 4 m de largura e 35 micras de espessura. A adubao bsica de plantio, de acordo com anlise do solo, foi de 1500 kg/ha de formulado 02-16-08 e 1000 kg/ ha de superfosfato simples. Aps os adubos serem incorporados ao solo, instalou-se em cada canteiro duas linhas de tubo gotejador, com emissores espaados a cada 30 cm e com vazo de 1,5 L/ h. As adubaes de cobertura foram realizadas atravs de fertirrigaes dirias, totalizando 30 kg/ha de N e 60 kg de K, utilizando como fontes uria e cloreto de potssio (COMISSO..., 1999). A cultura foi mantida no limpo por meio de capinas manuais, quando necessrias, e o controle fitossanitrio adotado foi o mtodo padro utilizado pelo produtor, com pulverizaes semanais com produtos base de oxicloreto de cobre, iprodione, procimidone e piretrides. O transplante das mudas foi realizado em 28/10/2002. A colheita foi feita em 09/12/2002, quando as plantas apresentaram-se completamente desenvolvidas sendo avaliadas a massa fresca total e comercial (g/planta); circunferncia e comprimento do caule da parte comercial em cm (cabea), percentagem de matria seca da parte comercial. Para o peso da matria seca da parte comercial, as amostras ( 300 g) foram lavadas em gua corrente e destilada e secas em estufa com circulao forada de ar, a 6570C, at peso constante. Os dados de percentagem de matria seca foram transformados em arco-seno P / 100 . A conservao ps-colheita foi avaliada utilizando-se amostra de duas cabeas comerciais de alface, avaliadas aos 7; 14; 21 e 28 dias, em cmara frigorfica a 5 2C e umidade relativa em torno de 90%, atravs de notas (nota 1= cabeas comerciais extremamente deterioradas; nota 2= cabeas comerciais deterioradas; nota 3= cabeas comerciais moderadamente deterioradas; nota 4= cabeas comerciais levemente deterioradas e nota 5= cabeas comerciais sem deteriorao), sendo utilizados trs avaliadores e obtida a mdia das notas.
977

G. M. Resende et al.

Figura 1. Massa fresca total (MFT) e comercial (MFC) de alface americana em funo de doses de nitrognio em cobertura. Trs Pontas (MG), UFLA, 2002.

Figura 2. Massa fresca total (MFT) e comercial (MFC) de alface americana em funo de doses de molibdnio. Trs Pontas (MG), UFLA, 2002.

Os dados coletados foram submetidos anlise de varincia e regresso com base no modelo polinomial ao nvel de 5% de probabilidade.

RESULTADOS E DISCUSSO
Houve efeito significativo e independente para doses de nitrognio e de molibdnio para peso da massa fresca total e comercial da parte area. Com relao ao peso fresco total, os dados relativos a doses de nitrognio foram ajustados a um modelo quadrtico, no qual a dose de 86,9 kg/ha de nitrognio em cobertura propiciou o maior rendimento, com 763,2 g/planta de massa
978

fresca (Figura 1). Levando-se em considerao que o produtor utilizou 30,0 e 30,0 kg/ha de N, respectivamente, no plantio e em fertirrigaes dirias, totalizando 60,0 kg/ha, durante o ciclo da cultura, pode-se inferir serem estas doses, em funo dos resultados obtidos, insuficientes para se alcanar a mxima produtividade de massa fresca total por planta, que foi alcanada na sua totalidade com 146,9 kg/ha de nitrognio, ou seja, 144,8% superior dose utilizada pelo produtor. Estes resultados esto prximos aos encontrados por Thompson e Doerge (1996a) que encontraram para alface lisa, a mxima produtividade quando utilizaram 165,0 kg/

ha de nitrognio. Furtado (2001), em plantio de agosto, no encontrou diferenas significativas entre tratamentos, avaliando doses acima de 148,0 kg/ha de nitrognio. Comparando os dados obtidos no presente experimento com trabalhos realizados por McPharlin et al. (1995) na Austrlia, utilizando 0,0 a 550,0 kg/ha de N, verifica-se que a dose correspondente mxima produo de massa fresca foi inferior a dose de 288,0 e 344 kg/ha de N encontrada por estes autores, em dois anos de estudo. Deve-se salientar ainda que, o mdio teor de matria orgnica, 2,1 dag/kg, do solo utilizado no presente experimento provavelmente contribuiu para uma menor resposta adubao nitrogenada. Segundo Thompson e Doerge (1996b), nos Estados Unidos, os agricultores utilizam doses que variam de 224,0 a 370,0 kg/ha. Quanto aplicao de molibdnio tambm ajustou-se um modelo quadrtico, no qual a dose de 87,4 g/ha de molibdnio promoveu o maior ganho em termos de rendimento de massa fresca total com 768,4 g/planta (Figura 2). Tambm em plantio de vero, Yuri et al. (2004a), constataram efeito quadrtico no qual a dose de 235,0 g/ha de molibdnio proporcionou a maior produtividade total por planta, 15,2% superior testemunha sem aplicao. Com relao massa fresca comercial, os dados relativos a doses de nitrognio foram ajustados a um modelo quadrtico, no qual a dose de 89,1 kg/ ha de nitrognio em cobertura propiciou a maior resposta, com 450,1 g/planta de massa fresca comercial (Figura 1). Levando-se em considerao que o produtor utilizou um total 60,0 kg/ha de N, a necessidade para se obter a mxima produtividade comercial foi de 149,1 kg/ ha de nitrognio. Furtado (2001) no encontrou diferenas significativas, avaliando doses acima 148,0 kg/ha de nitrognio. Este resultado inferior dose de 168,0 kg/ha de N para mxima produtividade de alface americana, informado por Mcpharlin et al. (1995), relatando diferentes autores, para as condies do Arizona, tanto em cultivos na primavera como no outono. Assim como est prximo dose de 155 kg/ha de N, encontrados por Tei et al. (2000), para alface tipo lisa e Butterhead.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produtividade e qualidade ps-colheita da alface americana em funo de doses de nitrognio e molibdnio

Pela Figura 2 observa-se para doses de molibdnio, um efeito quadrtico com ponto de mxima produtividade de massa fresca comercial na dose de 94,2 g/ha (445,8 g/planta). Com o incremento das doses de molibdnio em funo das pocas de aplicao, Yuri et al. (2004a), verificaram efeitos quadrticos para peso fresco comercial, tendo a dose de 212,0 g/ha de molibdnio proporcionado o maior rendimento quando aplicado aos 21 dias aps o transplante. Resultados positivos da aplicao de molibdnio na cultura da alface so relatados por Fontes et al. (1982) e Zito et al. (1994), que observaram aumento mdio de 31,0% e 24,1%, na produo comercial de alface com a aplicao de molibdnio. A circunferncia da parte comercial (cabea) uma das principais caractersticas para a alface americana, considerando a preferncia do consumidor para a aquisio do produto (BUENO, 1998). Assim como para as caractersticas anteriores, para a circunferncia da cabea comercial, os fatores estudados apresentaram efeitos independentes. Ajustou-se um modelo quadrtico com ponto de mxima circunferncia para a dose de 85,3 kg/ha de nitrognio em cobertura (Figura 3), que proporcionou uma circunferncia de 37,5 cm, pouco inferior variao encontrada por Yuri (2000) sob condies de vero, para diferentes cultivares, entre 40,1 a 42,9 cm. Resultados estes similares aos relatados por Kalil (1992), Alves (1996) e Bueno (1998), que observaram significativo incremento da circunferncia da cabea comercial com aumento das doses de nitrognio. Quando se refere a doses de molibdnio, constata-se um efeito significativo no qual a dose de 72,9 g/ha (Figura 4), proporcionada pelo modelo quadrtico ajustado equao de regresso, alcanou a maior circunferncia da cabea. Yuri et al. (2004a), relatam a dose de 220,0 g/ha de molibdnio como a que promoveu a maior circunferncia da cabea comercial, sendo as melhores pocas de aplicao aos 14 e 21 dias, que no mostraram diferenas significativas entre si. Uma resposta diferencial entre espcies disponibilidade de molibdnio tem sido relatada por
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Tabela 1. Equaes de regresso para circunferncia da cabea comercial (cm) e teor de matria seca (%) em funo das doses de nitrognio (N) adicionais em cobertura e de molibdnio (Mo). Trs Pontas (MG), UFLA, 2002.
Caractersticas Equaes de regresso R = 0,98 R = 0,98 R = 0,80 R = 0,68 (N) Y = 36,5163 + 0,022827X - 0,0001338* * X Circunferncia da cabea (Mo) Y = 36,2340 + 0,033387X - 0,0002290* * X Teor de matria seca1
1

(N) Y = 10,2509 + 0,007765X - 0,0000432* * X (Mo) Y = 10,1054 + 0,013418X - 0,0000869* * X

Dados transformados em arco-seno P / 100 .

** Significativo ao nvel de 1% pelo teste de F.

Malavolta e Kliemann (1985), sendo que h uma alta resposta em alface, assim como em brcolos, beterraba, couve-flor, espinafre e repolho. No se observou efeitos significativos dos tratamentos para comprimento do caule. Menores comprimentos de caule so desejveis para a alface americana, principalmente quando destinada indstria de beneficiamento, devendo ser bastante reduzido, proporcionando menores perdas durante o processamento. O caule excessivamente comprido acarreta menor compacidade da cabea e dificulta o beneficiamento, afetando a qualidade final do produto (YURI et al., 2002; RESENDE et al., 2003b). Na prtica, caules at 6,0 cm seriam os mais adequados, sendo aceitveis at o patamar de 9,0 cm e inaceitveis ou menos recomendados para processamento acima disto. Neste contexto, as doses de nitrognio apresentaram uma variao entre 7,2 e 7,4 cm e as doses de molibdnio entre 7,0 e 7,4 cm, prximos ao nvel adequado e dentro do limite aceitvel. Salienta-se que h uma tendncia da alface americana em condies de cultivo de vero apresentar maiores comprimentos de caule comparativamente ao cultivo de inverno onde esta se mostra perfeitamente adaptada. Resultados semelhantes para doses de molibdnio foram encontrados por Yuri et al. (2004a), que no constataram efeitos significativos para comprimento do caule. Dados no concordantes foram obtidos por Bueno (1998) que verificou um aumento linear no comprimento do caule com o incremento das doses de nitrognio. Para o teor de matria seca da parte comercial, a anlise de varincia reve-

lou diferenas significativas, tanto para doses de nitrognio como para doses de molibdnio, agindo de forma independente (Tabela 1). Estimou-se que a dose de 89,9 kg/ha de N em cobertura adicional a dose aplicada pelo produtor de 60,0 kg/ha, propiciaria o maior retorno em termos de porcentagem de matria seca da planta (Tabela 1). Este resultado similar aos encontrados por Alves (1996) e Fontes et al. (1997), que obtiveram efeito positivo para a matria seca da alface cultivar Regina 440 e Brasil 202, em resposta adio de nitrognio. Todavia, Furtado (2001), utilizando a mesma cultivar, obteve um efeito linear negativo como o incremento das doses de nitrognio. A conservao ps-colheita das cabeas comerciais avaliada em cmara frigorfica aos 7, 14; 21 e 28 dias aps a colheita, no evidenciaram diferenas significativas entre doses de nitrognio e molibdnio. Aos sete dias aps a colheita as cabeas comerciais apresentavam-se perfeitas, sem deteriorao (nota 5,0). J aos 14 dias verificaram-se para doses de nitrognio em cobertura e molibdnio notas mdias de 3,7 e 3,8, notas estas prximas a 4,0 que caracterizam cabeas comerciais levemente deterioradas. Obteve-se aos 21 dias aps a colheita, notas de e 3,1 e 3,0 (moderadamente deterioradas), respectivamente, para nitrognio e molibdnio. Cerca de 28 dias aps a colheita as cabeas j se apresentavam deterioradas, obtendo notas mdias de 2,0 e 2,1, respectivamente, para doses de nitrognio em cobertura e molibdnio. Est uma caracterstica de grande importncia em alface americana visto que o produto final processado e armazenado em cmaras frigorficas para posterior distri979

G. M. Resende et al.

buio. Portanto, uma maior conservao do produto aps sua colheita desejvel e de considervel relevncia. No foram encontrados relatos na literatura de uma possvel contribuio do nitrognio e do molibdnio em aumentar a conservao da alface americana. No entanto, h relatos de pequeno efeito na perda de peso pela adio de nitrognio (POULSEN et al., 1994), assim como efeitos no significativos (SANCHEZ et al., 1988) e de melhor conservao ps-colheita com a utilizao de adubao com outros nutrientes como silcio e boro (RESENDE et al. 2003a; YURI et al., 2003 e 2004b). A durao do ciclo vegetativo da semeadura colheita, correspondeu a 67 dias, enquanto Furtado (2001) encontrou para o transplante no final de agosto, 73 dias de ciclo cultural. Segundo Whitaker e Ryder (1974), a temperatura o fator ambiental que mais influencia na formao de cabea uma vez que est relacionada com o pendoamento. A origem Mediterrnea da alface explica este comportamento, j que nesta regio as temperaturas mdias oscilam entre 10 e 20C (LINDQUIVIST, 1960 ). Segundo Jackson et al. (1996), a alface americana requer, como temperatura ideal para o desenvolvimento, 23C durante o dia e 7C noite. Temperaturas muito elevadas podem provocar queima das bordas, formar cabeas pouco compactas, e tambm contribuir para ocorrer deficincia de clcio, conhecido como tip-burn. No presente experimento no se observou qualquer ocorrncia de tipturn. No entanto, a maior precocidade que ocorre no vero, contribuiu para a formao de cabeas menos compactas, o que foi visualmente detectado, assim como pode-se verificar um maior comprimento do caule, comparativamente a poca de melhor adaptao da cultura que no inverno. Pelos resultados obtidos pode-se concluir que as doses de nitrognio em cobertura e de molibdnio foliar influenciaram positivamente o peso fresco total, comercial e a circunferncia da cabea comercial, no sendo observado efeito significativo sobre o comprimento do caule e a conservao ps-colheita da alface americana.
980

LITERATURA CITADA
ALVES, D.R.B.A. Efeito de adubao nitrogenada via fertirrigao e aplicao de forma convencional na produo de alface (Lactuca sativa L.) em estufa. 1996. 76 f. Dissertao (Mestrado em Fitotecnia) - Universidade Estadual Paulista, Botucatu, SP. BUENO, C.R. Efeito da adubao nitrogenada em cobertura via fertirrigao por gotejamento para a cultura da alface tipo americana em ambiente protegido. 1998. 54 f. Dissertao (Mestrado em Fitotecnia) - Universidade Federal de Lavras, Lavras, MG. COMISSO DE FERTILIDADE DE SOLO DO ESTADO DE MINAS GERAIS Recomendaes para o uso de corretivos e fertilizantes em Minas Gerais: 5 Aproximao: Viosa, 1999. 359 p. DECHEN, A.R.; HAAG, H.P.; CARMELLO, Q.A.C. Funes de micronutrientes nas plantas. In: FERREIRA, M.E.; CRUZ. M.C.P. (Ed.). Micronutrientes na agricultura. Piracicaba: POTAFOS/CNPq, 1991. p.65-78. FONTES, P.C.R.; PEREIRA, P.R.G.; CONDE, R.M. Critical chlrophill, total nitrogen, and nitratenitrogen in leaves associated to maximum lettuce yield. Journal of Plant Nutrition, v.20, n.9, p.10611068, 1997. FONTES, R.R.; LIMA, J.A.; TORRES, A.C.; CARRIJO, O.A. Efeito da aplicao de Mg, B, Zn e Mo na produo de alface. Pesquisa Agropecuria Brasileira, Braslia, v.17, n.2, p.171175, 1982. FURTADO, S.C. Nitrognio e fsforo na produtividade e nutrio mineral de alface americana cultivada em sucesso ao feijo aps o pousio da rea. 2001. 78 f. Dissertao (Mestrado em Fitotecnia) - Universidade Federal de Lavras, Lavras, MG. GARCIA, L.L.C.; HAAG, H.P.; NETO, V.D. Nutrio mineral de hortalias-Deficincias de macronutrientes em alface (Lactuca sativa L.), cv. Brasil 48 e Clauses Aurlia. Anais da Escola Superior de Agricultura Luiz de Queiroz, Piracicaba, v.39, n.1, p.349-362, 1982. GUPTA, U.C.; LIPSETT, J. Molybdenum in soils, plants, and animals. Advances in Agronomy, v.34, p.73-115, 1981. JACKSON, L.; MAYBERRY, K.; LAEMMLEN, F.; KOIKE, S.; SCHLUBACK, K. Iceberg lettuce production in California. Disponvel em: <http// www.vegetablecrops.ucdavis>. Acesso em: 24 out. 1999. KALIL, A.J.B. Comparao entre adubao nitrogenada via fertirrigao por gotejamento e a aplicao convencional na produtividade da alface (Lactuca sativa L.). 1992. 60 f. Dissertao (Mestrado em Engenharia Agrcola) - Universidade Federal de Viosa, Viosa, MG. LINDQUIVIST, K. On the origin of cultivated lettuce. Hereditas, n.46, p.319-350, 1960. MALAVOLTA, E. Elementos de nutrio mineral de plantas. So Paulo: Agronmica Ceres, 1980. 251 p. MALAVOLTA, E.; KLIEMANN, H.J. Desordens nutricionais no cerrado. Piracicaba: POTAFOS, 1985. 136 p.

McPHARLIN, I.R.; AYLMORE, P.M.; JEFFERY, R.C. Nitrogen requirements of lettuce under sprinkler irrigation and trickle fertigation on a spearwood sand. Journal of Plant Nutrition, New York, v.18, n.2, p.219-241, 1995. NOGUEIRA, F.D.; FAQUIN, V.; PAULA, M.B. Solos, calagem e adubao para brssicas. Informe Agropecurio, Belo Horizonte, v.9, n.98, p.2129, 1983. OLIVEIRA, J.P. Efeitos de alumnio e de micronutrientes no feijoeiro (Phaseolus vulgaris L.). 1980. 196 f. Tese (Doutorado em Fitotecnia) - Escola Superior de Agricultura Luiz de Queiroz, Piracicaba, SP. POULSEN, N.; SORENSEN, J.N.; JOHANSEN, A.S. Influence on growth conditions on the value of crisphead lettuce. 2. Weight losses during storage as affected by nitrogen, plant age and cooling system. Plant Foods for Humam Nutrition, v.46, n.1, p.13-18, 1994. RESENDE, G.M.; YURI, J.E.; MOTA, J.H.; FREITAS, S.A.C.; RODRIGUES JNIOR, J.C.; SOUZA, R.J.; CARVALHO, J.G. Adubao foliar com silcio em alface americana (Lactuca sativa L.) em cultivo de vero. In: CONGRESSO BRASILEIRO DE OLERICULTURA, 43., 2003, Recife, PE. Horticultura Brasileira, Braslia, v.20, n.2, p.374, 2003a. Suplemento 1. RESENDE, G.M.; YURI, J.E.; MOTA, J.H.; SOUZA, R.J.; FREITAS, S.A.C.; RODRIGUES JNIOR, J.C. Efeitos de tipos de bandejas e idade de transplantio de mudas sobre o desenvolvimento e produtividade de alface americana. Horticultura Brasileira, Braslia, v.21, n.3, p.562567, 2003b. RICCI, M.S.F. Crescimento e teores de nutrientes em cultivares de alface (Lactuca sativa L.) adubados com vermicomposto. 1993. 101 f. Dissertao (Mestrado em Solos e Nutrio de Plantas) - Universidade Federal de Viosa, Viosa, MG. RICCI, M.S.F.; CASALI, V.W.D.; CARDOSO, A.A.; RUIZ, H.A. Teores de nutrientes em duas cultivares de alface adubadas com composto orgnico. Pesquisa Agropecuria Brasileira , Braslia, v.30, n.8, p.1035-1039, 1995. SANCHEZ, C.A.; BURDINE, V.L.; GUZMAN, V.L.; HALL, C.B. Yield, quality, and leaf nutrient composition of crisphead lettuce as affect by N, P, and K on histosols. Proceedings Florida Horticultural Society, v.101, n.1/3, p.346-350, 1988. TEI, F.; BENINCASA, P.; GUIDUCCI, M. Effect of nitrogen availability on growth and nitrogen uptake in lettuce. Acta Horticulturae, n.533, p.385392, 2000. THOMPSON, T.L.; DOERGE, T.A. Nitrogen and water interactions in subsurface trickle-irrigated leaf lettuce: I. Plant response. Soil Science Society of American Journal, v.60, n.1, p.163-168, 1996a. THOMPSON, T.L.; DOERGE, T.A. Nitrogen and water interactions in subsurface trickle-irrigated leaf lettuce: II. Agronomic, economic, and environmental outcomes. Soil Science Society of American Journal, v.60, n.1, p.168-173, 1996b. WHITAKER, T.W.; RYDER, J.E. Lettuce production in the United States. Washington: USDA, 1974. 43 p. (USDA. Washington Agriculture Handbook, 221) Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produtividade e qualidade ps-colheita da alface americana em funo de doses de nitrognio e molibdnio

YURI, J.E. Avaliao de cultivares de alface americana em duas pocas de plantio e dois locais do Sul de Minas Gerais. 2000. 51 f. Dissertao (Mestrado em Fitotecnia) - Universidade Federal de Lavras, Lavras, MG. YURI, J.E.; RESENDE, G.M.; MOTA, J.H.; FREITAS, S.A.C.; RODRIGUES JUNIOR, J.C.; SOUZA, R.J.; CARVALHO, J.G. Resposta da alface americana (Lactuca sativa L.) a doses e pocas de aplicao silicato de potssio em cultivo de inverno. In: CONGRESSO BRASILEIRO DE OLERICULTURA, 43., 2003, Recife, PE. Horticultura Brasileira, Braslia, v.20, n.2, p.372, 2003b. Suplemento 1.

YURI, J.E.; RESENDE, G.M.; MOTA, J.H.; GONALVES, L.D.; SOUZA, R.J. Doses e pocas de aplicao de molibdnio na produo e qualidade de alface. Horticultura Brasileira, Braslia, v.22, n.3, p.589-592, 2004a. YURI, J.E.; RESENDE, G.M.; MOTA, J.H.; RODRIGUES JNIOR, J.C.; SOUZA, R.J.; CARVALHO, J.G. Comportamento de alface americana em funo do uso de doses e pocas de aplicao de boro em cultivo de inverno. Horticultura Brasileira, Braslia, v.22, n.3, p.593-596, 2004b.

YURI, J.E.; SOUZA, R.J.; FREITAS, S.A.C.; RODRIGUES JNIOR, J.C.; MOTA, J.H. Comportamento de cultivares de alface tipo americana em Boa Esperana. Horticultura Brasileira , Braslia, v.20, n.2, p.229-232, 2002. ZITO, R.K.; FRONZA, V.; MARTINEZ, H.E.P.; PEREIRA, P.R.G.; FONTES, P.C.R. Fontes de nutrientes, relaes nitrato:amnio e molibdnio, em alface (Lactuca sativa L.) produzida em meio hidropnico. Revista Ceres, Viosa, v.41, n.236, p.419-430, 1994.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

981

MADEIRA, N.R.; TEIXEIRA, J.B.; ARIMURA, C.T.; JUNQUEIRA, C.S. Influncia da concentrao de BAP e AG3 no desenvolvimento in vitro de mandioquinha-salsa. Horticultura Brasileira, Braslia, v.23, n.4, p.982-985, out-dez 2005.

Influncia da concentrao de BAP e AG3 no desenvolvimento in vitro de mandioquinha-salsa


Nuno R. Madeira1; Joo B. Teixeira2; Clia T. Arimura3; Cristina S. Junqueira2
1

Embrapa Hortalias, C.Postal 218, 70359-970 Braslia-DF; 2Embrapa Recursos Genticos e Biotecnologia, Parque Estao Biolgica, 70770-900 Braslia-DF; 3UEMG - Campus Ituiutaba, C..Postal 431, 38302-192 Ituiutaba-MG

RESUMO
Foram realizados dois experimentos com o objetivo de avaliar o efeito das concentraes de BAP e de AG3 no desenvolvimento in vitro de mandioquinha-salsa. Foram avaliadas as concentraes de 0,0; 0,2 e 0,4 mg L-1 de BAP e de 0,0; 0,125 e 0,250 mg L-1 de AG3 no desenvolvimento de pices caulinares com cerca de 2 mm das cultivares Amarela de Senador Amaral e Amarela Comum. A interao cultivares x concentrao de BAP no foi significativa para nenhuma das caractersticas avaliadas (P>0,0617). O aumento na concentrao de BAP reduziu a formao de calos; entretanto, promoveu proporcionalmente reduo no desenvolvimento da parte area. A concentrao de BAP que apresentou os melhores resultados foi em torno de 0,3 mg L-1 de BAP, conciliando dimetro de calo relativamente reduzido e bom desenvolvimento da parte area, cerca de 4,5 brotos com altura mdia de 43 mm. A interao cultivares x concentrao de AG3 no foi significativa para nenhuma das caractersticas avaliadas (P>0,4310). O aumento na concentrao de AG3 promoveu elevao significativa na altura mdia e mxima das brotaes e aumento no tamanho de calos. Nos dois experimentos, observou-se maior nmero de brotaes na cultivar Amarela Comum. Palavras-chave: Arracacia xanthorrhiza, benzilaminopurina, cido giberlico.

ABSTRACT
Influence of BAP and GA3 concentration on the in vitro development of arracacha Two experiments were carried out to evaluate the effect of BAP and GA3 concentrations on the in vitro arracacha development. The concentrations tested were 0.0; 0.2 and 0.4 mg L-1 of BAP and 0.0; 0.125 and 0.250 mg L-1 of GA3 in the shoot tips with about 2 mm of arracacha, cultivars Amarela de Senador Amaral and Amarela Comum. The interaction of cultivars x BAP concentration was not significant for any one of the evaluated variables (P>0,0617). The increase in the BAP concentration reduced the callus formation; however, promoted larger reduction in the shoot development. The best BAP concentration was around 0.3 mg L-1, with relatively reduced callus diameter and good development of shoot, with a mean of 4.5 shoots and a height of 43 mm. The interaction of cultivars x GA3 concentration was not significant for any one of the studied variables (P>0,4310). The increase in the GA3 concentration promoted the improvement in the mean and maximum height of the shoots and in callus size. More shoots were observed for Amarela Comum cultivar in both trials. Keywords: Arracacia xanthorrhiza , 6-benzilaminopurine, gibberellic acid.

(Recebido para publicao em 7 de junho de 2004 e aceito em 31 de julho de 2005) micropropagao in vitro pode ser til na produo de plantas com alta qualidade sanitria, isentas de vrus, alm de ser uma ferramenta importante para a manuteno e o intercmbio de germoplasma (HERMANN, 1997; ASSIS, 1999; FLETCHER; FLETCHER, 2001). Alguns trabalhos j foram realizados na rea de micropropagao de mandioquinha-salsa no Brasil e no exterior (PESSOA et al., 1994; LUZ et al., 1997). Castillo (1991), Cevallos e Castillo (1991) e Duque (1993) recomendam para o cultivo in vitro de mandioquinhasalsa o meio bsico MS (MURASHIGE; SKOOG, 1962) adicionado de 3% de sacarose e de 0,25 mg L-1 de AG3. Castillo (1991) verificou rpida formao de calos durante a micropropagao de pices caulinares,
982

aspecto no desejado por ser promotor de modificaes genticas e por exaurir os nutrientes em detrimento da formao de folhas e razes (GRATTAPAGLIA; MACHADO, 1990). Para minimizar este problema, recomenda subcultivos in vitro, formando plntulas normais. Senna Neto (1990), trabalhando com o clone BGH 5746, comumente chamado de Amarela de Caranda ou Amarela Comum, avaliou diferentes meios de cultivo e concentraes de fitorreguladores com a finalidade de induzir a diferenciao de pices caulinares com dois primrdios foliares de mandioquinha-salsa. Concluiu que os meios MS, Knudson e White no foram eficientes, havendo paralisao do crescimento e desenvolvimento de plantas. Nos meios MS e White o crescimento foi muito lento e irregular, com ausncia de folhas expandidas e presena de

folhas afiladas (pontiagudas). 0,01 e 0,02 mg L-1 de cido naftaleno actico (ANA) e 0,6, 1,0 e 1,4 mg L-1 de 6benzilaminopurina (BAP) no meio de Gamborg promoveram desenvolvimento lento e irregular. Os melhores resultados para o desenvolvimento do sistema radicular e da parte area foram obtidos com o meio de Gamborg suplementado de 0,02 mg L-1 de ANA + 0,1- 0,2 mg L-1 de BAP. Luz (1993), visando obter plantas de mandioquinha-salsa a partir da cultura de meristemas e de sua micropropagao, obteve melhor desenvolvimento com a combinao de 0,1 mg L-1 de ANA + 0,2 mg L-1 de BAP acrescido ao meio de cultivo B5 (GAMBORG, 1968). Na fase de multiplicao, os melhores resultados foram obtidos em meio de cultura B5 acrescido de 0,1 e 0,2 mg L-1 de BAP.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Influncia da concentrao de BAP e AG3 no desenvolvimento in vitro de mandioquinha-salsa

Este trabalho objetivou avaliar o efeito das concentraes de BAP e de AG3, de modo a tornar mais eficiente o protocolo de micropropagao in vitro de mandioquinha-salsa.

MATERIAL E MTODOS
Foram realizados dois experimentos relativos cultura de tecidos de mandioquinha-salsa. No primeiro, realizado no laboratrio de cultura de tecidos da Embrapa Recursos Genticos e Bioteconologia (Cenargen) em maroabril de 2002, estudaram-se diferentes concentraes de 6-benzilaminopurina (BAP); no segundo, realizado no laboratrio de cultura de tecidos da Embrapa Hortalias em setembro-outubro de 2002, foram avaliadas diferentes concentraes de cido giberlico (AG3). O meio de cultura utilizado foi o B5 (GAMBORG, 1968), acrescido de 0,1 mg L-1 de cido naftalenoactico (ANA), com base nos resultados positivos obtidos por Senna Neto (1990) e Luz (1993). No primeiro experimento, foram avaliadas as concentraes de 0; 0,2 e 0,4 mg L-1 de BAP. No segundo, a partir dos resultados obtidos no primeiro experimento, fixando-se a concentrao de BAP em 0,3 mg L-1, foram avaliadas as concentraes de 0; 0,125 e 0,250 mg L-1 de AG3. Para todos os meios, adicionaram-se sacarose a 3% e gar a 0,7%. Os experimentos foram implantados em um fatorial 2 x 3, representando duas cultivares (Amarela de Senador Amaral e Amarela Comum) e trs concentraes de BAP no primeiro experimento e de AG3 no segundo experimento, dispostos no delineamento experimental inteiramente casualizado com quatro repeties. A desinfestao do material oriundo do campo foi feita inicialmente na sala de preparo, por imerso em lcool 70% e gua destilada. Em seguida, na sala de transferncia em capela de fluxo laminar, realizou-se a imerso em soluo de hipoclorito de sdio a 1,25% por 10 minutos, seguida por trs enxges em gua autoclavada. Os explantes utilizados foram pices caulinares com cerca de 2 mm extrados de plantas matrizes vigorosas com seis meses, sem sintomas visuais de doenas e cultivados individualmente em tubos de ensaio, utilizando-se cerca de 15 ml de meio autoclavado por tubo.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 1. Altura mdia e mxima das brotaes ( A ) e nmero de brotos e dimetro de calos ( B ) em funo da concentrao de BAP. Braslia, Embrapa RecursosGenticos e Biotecnologia, 2002.

Estes foram mantidos em salas de crescimento a 252C com 14 horas de fotoperodo e iluminao fluorescente com intensidade luminosa de 110 mol m-2 s-1. As taxas de contaminao e de regenerao, o nmero e altura de brotos, o nmero de razes e o dimetro dos calos foram avaliados aps quatro semanas. Efetuaram-se anlises de varincia e testes de mdia Tukey para cultivares e anlises de regresso para concentraes de BAP e AG3.

RESULTADOS E DISCUSSO
A interao cultivares x concentrao de BAP no foi significativa para

nenhuma das caractersticas avaliadas (P>0,0617). No foram observadas diferenas significativas com relao taxa de contaminao, cujo valor mdio neste experimento foi de 8,4%. A ausncia de BAP levou formao de plantas estioladas, com poucas brotaes. medida que se elevou a concentrao de BAP, observou-se a formao de plantas com menor altura (Figura 1A), porm com maior nmero de brotaes (Figura 1B). Na cultivar Amarela Comum (AC), foram obtidos 4,1 brotos, significativamente superior aos 3,2 brotos obtidos com a cultivar Amarela de Senador Amaral (ASA). O comportamento das
983

N. R. Madeira et al.

Figura 2. Altura mdia e mxima das brotaes em funo da concentrao de AG3. Braslia, Embrapa Hortalias, 2002.

duas cultivares foi semelhante nas demais caractersticas avaliadas: taxa de sobrevivncia (96,7% em AC e 99,0% em ASA), dimetro de calos (19,9 mm em AC e 18,9 mm em ASA), altura mdia de brotos (55,4 mm em AC e 54,8 mm em ASA), altura mxima de brotos (78,8 mm em AC e 73,2 mm em ASA) e nmero de razes (0,2 em AC e 0,3 em ASA). O aumento na concentrao de BAP reduziu o tamanho dos calos formados na parte basal das plantas (Figura 1B). Um calo basal de tamanho excessivo indesejvel por ser potencial promotor de modificaes genticas e por exaurir os nutrientes do meio de cultura em detrimento da formao de folhas e razes (CASTILLO, 1991). As concentraes de BAP utilizadas, recomendadas por Senna Neto (1990) e Luz (1993), levaram produo de plantas com elevado tamanho de calo na parte basal. Aumentando-se a concentrao de BAP, reduziu-se este efeito. Por outro lado, no se pode elevar muito sua concentrao, por inibir o desenvolvimento da parte area (Figura 1A). Portanto, buscou-se o balano ideal para concentrao de BAP, isto , um ponto intermedirio que combinasse o bom desenvolvimento da parte area, em tamanho e nmero de brotos, com menor tamanho do calo basal. Concentraes em torno de 0,3 mg L-1 de BAP foram as que proporcionaram o melhor desenvolvimento para as trs caractersticas consideradas. O modelo
984

linear ajustado, considerando o intervalo estudado, apresentou elevado coeficiente de determinao para as trs caractersticas morfolgicas avaliadas (tamanho do calo basal, r2>0,997; nmero de brotos, r2>0,950; e tamanho de brotos, r2>0,940). No segundo experimento, a interao cultivares x concentrao de AG3 no foi significativa para nenhuma das caractersticas avaliadas (P>0,4310). A taxa de contaminao mdia foi de 7,3% neste segundo experimento, no havendo diferenas significativas entre os tratamentos. O aumento na concentrao de AG3 promoveu elevao na altura mdia e mxima das brotaes (Figura 2), sem aumentar o tamanho do calo basal, demonstrando o efeito benfico promovido por este regulador de crescimento no desenvolvimento in vitro de mandioquinha-salsa, em concordncia com Castillo (1991), Cevallos e Castillo (1991) e Duque (1993) que trabalharam com o meio MS. Por outro lado, Senna Neto (1991) e Luz (1993) concluram que o meio B5 era superior ao meio MS, possivelmente pela menor concentrao de sais. No entanto, Senna Neto (1991) e Luz (1993) no avaliaram o uso de cido giberlico adicionado ao meio B5. Este trabalho vem, portanto, confirmar o efeito benfico do AG3 adicionado ao meio B5, considerando o intervalo que

vai de 0 a 0,25 mg L-1, semelhana do que foi verificado no meio MS. A cultivar Amarela Comum apresentou tamanho de calo basal de 7,6 mm e 3,5 brotos, significativamente maior que na cv. Amarela de Senador Amaral, onde o tamanho mdio de calo foi de 6,3 mm e o nmero mdio de brotos foi de 2,7. Quanto s demais caractersticas avaliadas, o comportamento foi semelhante nas duas cultivares: taxa de sobrevivncia (90,0% em AC e 84,2% em ASA), altura mdia de brotos (17,1 mm em AC e 17,2 mm em ASA) e altura mxima de brotos (26,0 mm em AC e 25,9 mm em ASA). No foi observada formao de razes em nenhuma planta. Com a avaliao conjunta dos dois experimentos, concluiu-se que os melhores resultados foram obtidos com concentraes em torno de 0,3 mg L-1 de BAP e com 0,25 mg L-1 de AG3 adicionado ao meio B5. O estabelecimento de um protocolo eficiente de produo de mudas de mandioquinha-salsa com alta qualidade sanitria e fisiolgica a partir da cultura de tecidos ser til na obteno de plantas com elevado potencial produtivo. Esta tcnica pode minimizar problemas decorrentes da perda de vigor que vem ocorrendo no campo aps ciclos sucessivos de cultivo dos materiais tradicionalmente cultivados nas principais regies produtoras, provavelmente pelo acmulo de patgenos degenerativos, especialmente vrus.

LITERATURA CITADA
ASSIS, M. Novas tecnologias na propagao de batata. Informe Agropecurio, Belo Horizonte, v.20, n.197, p.30-33, 1999b. CASTILLO, R. Manejo e conservao de germoplasma de tuberosas andinas. Informe final de consultoria para el Centro Internacional de la Papa (CIP). CIP: Quito, 1991. 7 p. CEVALLOS, A.; CASTILLO, R. Respuesta de ocho lineas de zanahoria blanca ( Arracacia xanthorrhiza B.) a la introduccion in vitro. In: REUNION NACIONAL SOBRE RECURSOS FITOGENETICOS, 1., 1991, Quito. Memorias... Quito: INIAP, 1991. p.109-115. DUQUE, L.M Compilacion de los medios de cultivo in vitro de raices y tuberculos andinos en el CIP. [Zanahoria blanca]. Quito: CIP, 1993. 2 p. FLETCHER, P.J.; FLETCHER, J.D. In vitro virus elimination in three Andean root crops: Oca (Oxalis tuberosa), ulluco (Ullucus tuberosus Caldas) and arracacha (Arracacia xanthorrhiza). NewZealand Journal of Crop and Horticultural Science, Auckland, v.29, n.1, p.23-27, 2001.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

Influncia da concentrao de BAP e AG3 no desenvolvimento in vitro de mandioquinha-salsa GAMBORG, O.L.; MILLER, R.A.; OJIMA, K. Nutrient requirements of suspension cultures of soybean root cells. Experimental Cell research, n.50, p.151-158, 1968. GRATTAPAGLIA, P.; MACHADO, M.A. Micropropagao In: Torres, A.C.; Caldas, L.S. Tcnicas e aplicaes da cultura de tecidos de plantas. Braslia: ABCTP/Embrapa Hortalias, 1990. p.99-169. HERMANN, M. Arracacha ( Arracacia xanthorrhiza Bancroft) Andean roots and tubers: Ahipa, arracacha, maca and yacon. Promoting the conservation and use of underutilized and neglected crops. 21. Gatersleben, Germany e Rome, Italy: IPGRI, 1997. p.75-172. LUZ, J.M.Q. Obteno in vitro de plantas de mandioquinha-salsa (Arracacia xanthorrhiza Bancroft) via cultura de meristemas. 1993. 52 f. (Tese mestrado em Fitotecnia) - ESAL, Lavras. LUZ, J.M.Q.; PASQUAL, M.; SOUZA, R.J. Cultura de tecidos e biotecnologia em mandioquinhasalsa. Informe Agropecurio, Belo Horizonte, v.19, n.190, p.18-21, 1997. MURASHIGE, T.; SKOOG, F. A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiologia Plantarum, v.15, p.473-497, 1962. PESSOA, A.C.S.; VIEIRA, R.C.; ESQUIBEL, M.A. Introduction and histogenesis of calli from petiole explants of Peruvian carrot (Arracacia xanthorrhiza Bancroft) Arquivos de Biologia e Tecnologia, v.37, n.2, p.231-246, 1994. SENNA NETO, N. Micropropagao de mandioquinha-salsa (Arracacia xanthorrhiza Bancroft). 1990. 53 f. Dissertao (Mestrado em Fitotecnia) UFV, Viosa.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

985

CARVALHO, L.A.; TESSARIOLI NETO, J. Produtividade de tomate em ambiente protegido, em funo do espaamento e nmero de ramos por planta. Horticultura Brasileira, Braslia, v.23, n.4, p.986-989, out-dez 2005.

Produtividade de tomate em ambiente protegido, em funo do espaamento e nmero de ramos por planta1
La A. de Carvalho1; Joo Tessarioli Neto2
1 Centro de Cincias Agrrias e Ambientais, UFBA, 44380.000 Cruz das Almas-BA; E-mail:lacarval@ufba.br; 2ESALQ/USP, Depto. de Produo Vegetal, C. Postal 09, 13418-900 Piracicaba-SP (in memoriam)

RESUMO
Avaliou-se o efeito do espaamento e do nmero de ramos por planta na produo de hbridos de tomate, cultivados em substrato, sob ambiente protegido. O experimento foi conduzido de maro a outubro. Utilizou-se o delineamento em blocos casualizados, em esquema fatorial 4X2X2, sendo quatro hbridos (Andra, Dbora Max, Carmen e Diana), dois espaamentos entre plantas (0,30 e 0,45 m) e duas condues (um e dois ramos por planta), com quatro repeties. Foram determinados o nmero de frutos comercializveis (frutos planta-1), produo total comercializvel (t ha-1), massa mdia do fruto comercializvel (g fruto), produo de frutos grande, mdios e pequenos (t ha-1). Os resultados mostraram que o manejo mais indicado foi o espaamento de 0,30 m entre plantas conduzidas com uma haste, sendo que o hbrido Dbora Max apresentou o maior potencial produtivo.

ABSTRACT
Yield of tomato under protected environment in relation to spacing and number of branches per plant The effects of plant spacing and number of branches per plant were investigated in the production of tomatoes when different hybrids were grown in a substratum under protected environment. The work was conducted from March to October. High tomato yield under protected environment depends on the proper management. The experiment followed a randomized blocks design, in a factorial arrangement of 4x2x2, with four hybrids (Andra, Debora Max, Carmen and Diana), two spacings between plants (0.30 and 0.45m) and two conduction systems (1 and 2 branches per plant). The treatments were replicated four times. The following parameters were studied: marketable yield (fruits plant-1), total marketable yield (t ha-1), average weight of marketable fruit (g) and yield of big, medium, and small fruits (t ha-1). According to the results the spacing of 0.30 m between plants and one branch per plant were the best combinations with the hybrid Debora Max showing the highest potential yield. Keywords: Lycopersicon esculentum Mill., yield, conduction, plant density.

Palavras-chave: Lycopersicon esculentum Mill., rendimento, conduo, densidade populacional.

(Recebido para publicao em 4 de outubro de 2004 e aceito em 31 de agosto de 2005) cultivo em ambiente protegido de tomate tem se expandido nos ltimos anos, principalmente, nas regies Sul e Sudeste do Brasil e esta tcnica propicia ao tomateiro um incremento na produo, podendo ser de 4 a 15 vezes superiores quelas obtidas em campo (MARTINS, 1992). O uso intensivo do solo com uma espcie e a sua salinizao em ambiente protegido, vem gradativamente sinalizando para o cultivo sem solo, especialmente em sacos plsticos, contendo substrato apropriado. Este sistema permite um manejo mais adequado tanto da gua como de nutrientes. Segundo Andriolo et al. (1997), as plantas cultivadas em substrato proporcionalmente fixam mais matria seca nos frutos, sendo, portanto mais eficientes em termos de rendimento, obtendo-se inclusive a mesma pro1

duo com menor rea foliar, o que possibilita a utilizao de maior densidade de plantas, com melhor arejamento e menor risco de molstias. A elevada produtividade obtida em plantios adensados ocorre devido ao aumento da interceptao da luz fotossinteticamente ativa e da fotossntese no dossel, que estimula o crescimento da cultura e aumenta o total de assimilados disponveis para os frutos ( P A P A D O P O U L O S ; PARARAJASINGHAM, 1997). No tomateiro, alm do adensamento, o nmero de plantas por unidade de rea, o nmero de frutos colhidos por plantas e a massa mdia dos frutos esto diretamente relacionados produtividade ( P A P A D O P O U L O S ; PARARAJASINGHAM, 1997; STRECK et al., 1998). Apesar de ocorrer

um aumento na produo do tomateiro com o adensamento de plantas, a massa mdia do fruto decresce (STRECK et al., 1996; PAPADOPOULOS; PARARAJASINGHAM, 1997; CAMARGOS, 1998; STRECK et al. 1998; CAMARGOS et al., 2000), e depende da poca do ano (MARTINS, 1992; STRECK et al., 1996) e do hbrido utilizado (SCHMIDT et al., 2000; LOGENDRA et al., 2001). A produo e a massa mdia de tomate comercial, tambm so influenciadas pela densidade de plantas e pelo nmero de ramos por planta. Quanto maior o adensamento e o nmero de ramos por planta menor ser a produo total comercial, a produo de frutos grandes e a massa mdia dos frutos grande e mdio, e maior ser a produo de frutos mdio e pequeno (OLIVEIRA et

Parte da tese de doutorado do primeiro autor Hortic. bras., v. 23, n. 4, out.-dez. 2005

986

Produtividade de tomate em ambiente protegido, em funo do espaamento e nmero de ramos por planta

al., 1995; CAMARGOS, 1998). J Seleguini et al. (2002) verificaram que apenas na produo de frutos mdios houve um aumento linear da produtividade com o aumento da densidade. Este efeito da densidade de plantas na produo e massa mdia de tomate classificado ocorre porque em condies de adensamento as plantas competem mais por luz e direcionam um maior gasto de energia aos processos de crescimento celular e menor translocao de acares para os frutos, resultando numa diminuio do dimetro do fruto (BORRAZ et al., 1991). Alm da exigncia do mercado consumidor quanto massa mdia dos frutos para o consumo in natura, que segundo Martins (1992) e Fayad et al. (2001) do tipo grande para o tipo Santa Cruz e do tipo mdio para o tipo Salada. Campos et al. (1987) e Oliveira (1993) reportaram que existe uma correlao positiva entre o maior tamanho do fruto e a ocorrncia de rachadura, o que torna o fruto muito grande no comercivel. Diante do exposto, o presente trabalho teve por objetivo avaliar a produo comercial total e em diversas classes, de quatro hbridos de tomate, quando submetidos a dois espaamentos e conduzidos com um ou dois ramos, no cultivo em ambiente protegido e substrato.

Tabela 1. Cronograma de fertirrigao com Kristalon do tomateiro estaqueado. Piracicaba, ESALQ, 2002.
Perodo (dias) 1-15 16-45 Estdio da planta Estabelecimento Crescimento Kristalon (N-P-K) Amarelo (13-40-13) Branco (15-5-30) Nitrato de Clcio Nitrato de Magnsio lquido 46-75 At a 1 Florao Laranja (6-12-36) Nitrato de Clcio Nitrato de Magnsio lquido 76-Final Produo Laranja (6-12-36) Nitrato de Clcio Dose (g L-1) 0,3 0,5-0,7 0,3 0,2 0,3-0,5 0,6-0,8 0,2 0,9-1,1 0,2-0,4

MATERIAL E MTODOS
O experimento foi conduzido em ambiente protegido de maro a outubro, em rea experimental da ESALQ, em Piracicaba (SP). A casa de vegetao seguiu o modelo arco, com rea de 196 m2 (7 x 28), coberta com plstico transparente de 150 e as partes frontais e laterais com telado tipo clarite. Os hbridos Andra, Dbora Max, Carmen e Diana, foram semeados em 08/03/2001, em bandejas de poliestireno expandido contendo 128 clulas e preenchida com o substrato Plantmax. Adubou-se semanalmente com 1 g L-1 de Plant Prod 2020-20. Aps 28 dias as mudas, apresentando 4-5 folhas definitivas foram transplantadas. O delineamento experimental foi em blocos ao acaso, com quatro repeties, em um esquema fatorial 4x2x2, onde o
Hortic. bras., v. 23, n. 4, out.-dez. 2005

primeiro fator foi constitudo por quatro hbridos (Andra, Carmen, Dbora Max e Diana), o segundo pelo nmero de ramos (um e dois) e o terceiro por dois espaamentos (0,30 e 0,45 cm entre plantas). Cada parcela experimental foi composta por oito e doze plantas, de acordo com o espaamento, dispostas em fileira dupla numa rea de 3,06 m2, sendo que todas as plantas foram consideradas teis. A conduo foi feita em fileiras duplas, sendo as plantas distribudas sobre canteiros distanciados de 1,10 m entre si. O espaamento entre as duas linhas dentro do canteiro foi de 0,60 m e entre as plantas nas linhas de 0,30 e 0,45 m. O cultivo foi realizado em sacos contendo 15 L de substrato comercial (Rendmax Estufa), na densidade de duas e trs plantas por saco. Na casa de vegetao os sacos foram colocados sobre os canteiros que foram revestidos com filme de polietileno preto de baixa densidade. O sistema de irrigao utilizado foi, o de gotejamento e as fertirrigaes dirias foram feitas com Kristalon, segundo as recomendaes da Hydro Fertilizantes para a cultura do tomate (Tabela 1). A poda apical foi feita acima da terceira folha emitida aps o sexto e quinto rcimos da haste principal e secundria, respectivamente. Em todos os hbridos, o desbaste dos frutos foi feito deixando-se quatro frutos por rcimo ao longo das hastes e nos racimos das extremidades apenas trs. O controle fitossanitrio foi curativo, medida que apareciam os primeiros sintomas das doenas e pragas, segundo as recomendaes para a cultura do tomate descritas por Lopes e Santos (1994). Para o controle da larva

minadora (Liriomyza sp.), broca pequena (Neuleucinodes elegantalis) e traa ( Tuta absoluta e/ou Phthorimaea operculella), aplicou-se semanalmente Decis 25. Para o controle das doenas fngicas, aplicou-se Oxicloreto de cobre e o Benomil, em intervalos de quinze dias. Aos 100 dias aps o transplante (DAT), ocorreu o aparecimento de sintomas tpicos de odio ( Erysiphe cichoracearum), isto , p branco e fino na superfcie de cima e de baixo das folhas mais velhas (FILGUEIRA, 2000; LOPES; SANTOS,1994). Os frutos foram colhidos a partir do momento em que apresentaram o pice com colorao avermelhada at totalmente vermelhos, porm firmes. As colheitas foram realizadas a intervalos mdios de cinco dias, no perodo de 19/ 06 a 02/10, dependendo dos tratamentos. As plantas conduzidas com um ramo e espaadas a 0,30 e 0,45 m tiveram o ciclo de 167 e 158 dias, respectivamente, enquanto que as plantas com dois ramos, independente do espaamento, tiveram o ciclo de 180 dias. Os frutos foram classificados segundo o dimetro transversal, em: oblongos; grandes (>60 mm); mdios (<60mm e >50 mm) e pequenos (<50 mm e >40); redondoachatados; Para Carmen e Diana foram classificados em: grande (>80 mm); mdio (<80 mm e >65 mm) e pequeno (<65 mm e >50 mm) e midos (>50 mm). Frutos com defeitos no foram considerados comercializveis (CEAGESP, 1998). Como no existe recomendao para os frutos do hbrido Andra (tipo Italiano), os mesmos foram classificados, devido ao seu formato, como frutos oblongos (tipo Santa Cruz).
987

L. A. Carvalho e J. Tessarioli Neto

Tabela 2. Caractersticas do produto comercial de quatro hbridos de tomate cultivado em tnel de polietileno e substrato, em funo do espaamento e nmero de ramos por planta. Piracicaba, ESALQ, 2002.
Hbridos Espaamento (m) 0,30 22,08 Ba 28,01 Aa 25,00 ABa 24,38 ABa 24,87 a 65,11 Ba 98,78 Aa 115,03 Aa 110,63 Aa 97,39 a 75,92 Ca 92,64 Ba 120,78 Ab 118,20 Ab 101,88 b 0,45 22,36 Ba 28,61 Aa 26,46 Aa 26,67 Aa 26,03 a 47,10 Bb 65,06 Bb 89,52 Ab 89,36 Ab 72,77 b 81,17 Ba 89,05 Ba 134,27 Aa 132,37 Aa 109,22 a N de Ramos 1 CV(%) 10,33 16,39 Bb 21,12 Ab 20,33 ABb 19,88 ABb 14,43 b C.V. (%) 14,08 44,51 Cb 71,73 Bb 97,78 Aa 89,85 ABb 75,96 b C.V. (%) 6,51 83,52 Ca 101,68 Ba 149,24 Aa 140,61 Aa 118,76 a 73,57 Bb 80,00 Bb 105,81 Ab 109,96 Ab 92,33 b 78,55 C 90,84 B 127,52 A 125,29 A 67,70 Ba 95,15 Aa 106,77 Aa 110,15 Aa 94,19 a 56,10 C 81,94 B 102,28 A 100,00 A 28,06 Ba 35,50 Aa 31,13 Ba 31,17 Ba 31,47 a 22,22 C 28,31 A 25,73 B 25,53 B 2 Mdia

N de frutos (frutos.planta-1) Andra Dbora Max Carmen Diana Mdia Andra Dbora Max Carmen Diana Mdia Andra Dbora Max Carmen Diana Mdia

Os efeitos e interaes foram avaliados pelo teste F. Havendo diferena significativa para um determinado fator estudado, as mdias dos tratamentos foram comparadas pelo teste de Tukey, ao nvel de 5% de probabilidade.

RESULTADOS E DISCUSSO
A anlise de varincia para os hbridos estudados mostrou no haver interao entre o espaamento e o nmero de ramos por planta para nmero de frutos por planta, produo e massa mdia comercial. O espaamento no afetou o nmero de frutos e devido ao aumento na produo de biomassa ocasionado pelo maior nmero de plantas por rea, maiores produes (97,39 t ha-1) foram obtidas na maior densidade (Tabela 2). Com a ocorrncia da maior produo de biomassa provvel que a interceptao de luz fotossinteticamente ativa e da fotossntese no dossel tenha aumentado a produo de fotoassimilados que foram disponibilizados para os frutos ( P A P A D O P O U L O S ; PARARAJASINGHAM, 1997). Os resultados do presente trabalho concordam com os obtidos por vrios autores (STRECK et al., 1996; P A P A D O P O U L O S ; PARARAJASINGHAM, 1997; STRECK et al. 1998; CAMARGOS, 1998; CAMARGOS et al., 2000). O peso mdio do fruto foi grandemente influenciado pelo hbrido utilizado. As cultivares hbridas Carmen e Diana apresentaram maior massa mdia comercial na menor densidade e Andra e Dbora Max no foram afetados, provavelmente, devido melhor arquitetura da planta que proporcionou uma menor competio interplanta pela luz e intraplanta pelos fotoassimilados ( P A P A D O P O U L O S ; PARARAJASINGHAM, 1997). O numero de ramos por planta afetou o nmero de frutos por planta, a massa mdia e a produo comercial. Independentemente dos hbridos as plantas conduzidas com dois ramos apresentaram maior nmero de frutos por planta e a menor massa mdia comercial de frutos (Tabela 2). Com exceo de Carmen que no diferiu quanto
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produtividade (t ha-1)

Massa mdia (g.fruto)

Mdias seguidas pela mesma letra maiscula na coluna e minscula na linha, para cada caracterstica, no diferem entre si pelo teste de Tukey (5% P).

Tabela 3. Produtividade classificada (t ha-1) do tomateiro cultivado em tnel de polietileno e substrato, em funo de hbrido, espaamento e nmero de ramos por planta. Piracicaba, ESALQ, 2002.
Hbridos Grande Andra Dbora Max Carmen Diana Mdia Mdio Andra Dbora Max Carmen Diana Mdia Pequeno Andra Dbora Max Carmen Diana Mdia 44,67 Ca 15,65 Da 55,08 Ba 66,61 Aa 45,51 a 20,44 Ba 54,63 Aa 58,17 Aa 43,27 Ba 44,13 a 0,00 Ba 28,47 Aa 1,77 Ba 0,75 Ba 7,75 a Espaamento (m) 0,30 0,45 C.V.(%) 69,83 1,02 Ba 14,38 Ab 5,98 Ba 2,27 Ba 5,91 a 20,86 Ba 39,12 Ab 50,72 Aa 49,79 Aa 40,12 a 25,22 Bb 11,60 Ca 32,83 ABb 37,31 Ab 26,74 b 1,02 Ba 30,31 Aa 7,75 Ba 2,54 Ba 10,40 a 21,92 Ba 36,23 Bb 69,63 Aa 58,01 Aa 46,45 a 21,57 ABb 5,19 Cb 20,39 Bb 29,30 Ab 19,11 b 0,00 Ba 12,55 Ab 0,00 Bb 0,48 Ba 3,26 b 19,38 Ca 57,54 Aa 39,26 ABb 35,05 Bb 37,81 b 48,32 Ba 22,06 Ca 67,52 Aa 74,62 Aa 53,13 a 34,95 C 13,63 D 43,95 B 51,96 A 20,65 B 46,88 A 54,45 A 46,53 A 0,51 B 24,43 A 3,88 B 1,51 B N de Ramos 1 2 Mdia

C.V. (%) 28,00

C.V. (%)14,02

Mdias seguidas pela mesma letra maiscula na coluna e minscula na linha para cada classe, no diferem entre si pelo teste de Tukey (5% P).

Avaliou-se o nmero de frutos comercializvel (frutos planta-1), produo total comercializvel (t ha-1), massa
988

mdia de fruto comercializvel (g fruto), produo de frutos grande, mdios e pequenos (t ha-1).

Produtividade de tomate em ambiente protegido, em funo do espaamento e nmero de ramos por planta

produo comercial os demais hbridos diferiram e apresentaram valores mdios superiores nas plantas conduzidas com dois ramos. O aumento no nmero de frutos e na produo comercial e a reduo na massa mdia das plantas com dois ramos foram devido ao maior nmero de inflorescncias produtivas e maior competio entre inflorescncias pelos fotoassimilados, respectivamente. Tais resultados foram tambm relatados por Oliveira (1993) e Oliveira et al. (1995) em campo e Poerschke et al. (1995) em estufa de polietileno. Houve interao entre hbridos, espaamento e nmero de ramos por planta para a produo de fruto grande (Tabela 3). O hbrido Dbora Max apresentou maior produo de fruto grande nas plantas conduzidas com um ramo e espaadas a 0,30 m e Carmen, apesar de no ter diferido de Andra e Diana apresentou maiores produes nas plantas com um ramo. Quanto produo de fruto mdio, a cultivar Dbora Max apresentou maior produo na maior densidade e nas plantas conduzidas com dois ramos, porm no diferiu significativamente de Carmen e Diana. Apesar dos hbridos do tipo salada no apresentarem diferenas com relao ao espaamento, a cultivar Carmen apresentou maior produo de frutos mdios quando o espaamento adotado foi de 30 cm. O aumento da produo de frutos mdios com a diminuio do espaamento entre plantas observado no hbrido Dbora Max j foi observado em outros hbridos por vrios autores (CAMARGOS, 1998; STRECK et al. 1998; CAMARGOS et al., 2000). O nmero de ramos por planta no afetou a produo de frutos mdios de Andra. Carmen e Diana, que apresentaram valores mdios superiores nas plantas conduzidas com um ramo, provavelmente devido a menor competio intraplanta pelos fotoassimilados. exceo do espaamento para Dbora Max, maior produo de fruto pequeno foi obtida na maior densidade e nas plantas conduzidas com dois ramos (Tabela 3). Esse efeito pode ter sido ocasionado pelo maior gasto de energia em processos de crescimento celular

pela planta e menor translocao de acares para os frutos, resultando num menor dimetro do fruto, conforme citao de Borraz et al. (1991). Na maior densidade e nas plantas conduzidas com um ramo os hbridos do tipo Salada diferiram ente si, sendo que o hbrido Diana apresentou maior produo de fruto pequeno. A menor produo de frutos pequenos na maior densidade e nas plantas conduzidas com dois ramos no hbrido Carmen, confirma a sua superioridade em relao ao Diana. Nas condies que em que foi realizado o experimento, conclui-se que o espaamento entre plantas de 0,30 m e a conduo com uma haste o mais indicado para o cultivo do tomate em ambiente protegido e em substrato; sendo o hbrido Dbora Max o que apresentou o maior potencial produtivo.

AGRADECIMENTOS
Ao Prof. Dr. Joo Tessarioli Neto (In memoriam), pela orientao e amizade. EUCATEX, pela doao do Rendmax-Estufa e a TOOPSEED, pela doao das sementes.

LITERATURA CITADA
ANDRIOLO, J.L.; DUARTE, T.S.; LUDKE, L.; SKREBSKY, E.C. Crescimento e desenvolvimento do tomateiro cultivado em substrato com fertirrigao. Horticultura Brasileira, Braslia, v.15, n.1, p.28-32, 1997. BORRAZ, C.J.; CASTILHO, S.F.; ROBELES, E.P. Efectos del despunte y la densidad de poblacion sobre dos variedades de jitomate (Lycopersicon esculentum, Mill), en hidropona bajo invernadero. Chapingo, v.14, n.73/74, p.26-30, 1991. CAMARGOS, M.I. Produo e qualidade de tomate longa vida em estufa, em funo do espaamento e do nmero de cachos por planta. Viosa: UFV, 1998. 68 f. Dissertao (Mestrado) Universidade Federal de Viosa, Viosa. CAMARGOS, M.I.; FONTES, P.C.R.; CARDOSO, A.A.; CARNICELLI, J.H.A. Produo de tomate longa vida em estufa, influenciada por espaamento e nmero de cachos por planta. Horticultura Brasileira, Braslia v.18, p.563-564, jul., 2000. Suplemento. CAMPOS, J.P.; BRLFORT, C.C.; GALVO, J.D.; FONTES, P.C.R. Efeito da poda de haste e da populao de plantas sobre a produo do tomateiro. Revista Ceres, v.34, n.191, p.198-208, 1987. CEAGESP. Classificao do tomate. So Paulo: CQH/CEAGESP. 1998. 8 p. (folder).

FAYAD, J.A.; FONTES, P.C.R.; CARDOSO, A.A.; FINGER, F.L.; FERREIRA, F.A. Crescimento e produo do tomateiro cultivado sob condies de campo e de ambiente protegido. Horticultura Brasileira, Braslia, v.19, n.3, p.365370, 2001. FILGUEIRA, F.A.R. Novo manual de olericultura: agrotecnologia moderna na produo e comercializao de hortalias. Viosa: UFV, 2000. 402 p. LOGENDRA, L.S.; GIANFAGNA, T.J.; SPECCA, D.R.; JANES, H.W. Greenhouse tomato limited cluster production systems: Crop management practices affect yield. HortScience, v.36, n.5, p.893-896. 2001. LOPES, C.A.; SANTOS, J.R.M. Doenas do tomateiro. Braslia: EMBRAPA, SPI, 1994. 67p. LOPES, C.A.; SANTOS, J.R.M. dos. Doenas do tomateiro. Braslia: EMBRAPA, SPI, 1994. 67 p. MARTINS, G. Uso de casa de vegetao com cobertura plstica na tomaticultura de vero. 1992. 65 f. Tese (Doutorado) Faculdade de Cincias Agrrias e Veterinrias, Universidade Estadual Paulista Jlio de Mesquita Filho, Jaboticabal. OLIVEIRA, V.R. Nmero de ramos por planta, poda apical e poca de plantio influenciando a produo e a qualidade dos frutos de tomateiro (Lycopersicon esculentum Mill.). 1993. 114 f. Tese (Doutorado) Universidade Federal de Viosa, Viosa. OLIVEIRA, V.R.; CAMPOS, J.P.; FONTES, P.C.R.; REIS, F.P. Efeito do numero de hastes por planta e poda apical na produo classificada de frutos de tomateiro (Lycopersicon esculentum Mill.). Cincia e Prtica, v.19, n.4, p.414-419, 1995. ORTOLANI, A.A.; CAMARGO, M.B.P. Influncia dos fatores climticos na produo. In: CASTRO P.R.C.; FERREIRA, S.; YAMADA, T. (Ed.). Ecofisiologia da produo agrcola. Piracicaba: ABPPF, 1987. p.71-81. PAPADOPOULOS, A.P.; PARARAJASINGHAM, S. The influence of plant spacing on light interception and use in greenhouse tomato (Lycopersicon esculentum Mill.): A review. Scientia Horticulturae, v.69, p.1-29, 1997. POERSCHKE, P.R.C.; BURIOL, G. A.; STRECK, N.A.; ESTEFANEL, V. Efeito de sistemas de poda sobre o rendimento do tomateiro cultivado em estufa de polietileno. Cincia Rural, Santa Maria, v.25, n.3, p.379-384, 1995. SCHMIDT, D.; SANTOS, O.S.; BONNECARRRE, A.G.; PILAU, F.G. Potencial produtivo de tomate cultivado com alta densidade em hidroponia. Horticultura Brasileira , Braslia, v.18, p.273-274, jul., 2000. Suplemento. SELEGUINI, A.; SENO, S.; ZIZAS, G.B. Influncia do espaamento entre plantas e nmero de cachos por plantas na cultura do tomateiro, em condies de ambiente protegido. Horticultura Brasileira, Braslia, v.20, n.2, Jul., p. 25-28, 2002. Suplemento. STRECK, N.A.; BURIOL, G.A.; SCHNEIDER, F.M. Efeito da densidade de plantas sobre a produtividade do tomateiro cultivado em estufa de plstico. Pesquisa Agropecuria Brasileira , Braslia, v.31, n.2, p.105-112, 1996. STERCK, N.A.; BURIOL, G.A.; ANDRIOLO, J.L.; SANDRI, M.A. Influncia da densidade de plantas e da poda apical drstica na produtividade do tomateiro em estufa de plstico. Pesquisa Agropecuria Brasileira , Braslia v.33, n.7. p.1105-1112, jul.1998.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

989

SILVA, J.B.; VIEIRA, R.D.; CECLIO FILHO, A.B. Superao de dormncia em sementes de beterraba por meio de imerso em gua corrente. Horticultura Brasileira, Braslia, v.23, n.4, p.990-992, out-dez 2005.

Superao de dormncia em sementes de beterraba por meio de imerso em gua corrente


Josu B. da Silva1; Roberval D. Vieira2; Arthur B. Ceclio Filho2
2

UNESP, FCAV, 14844-900 Jaboticabal-SP; 1Doutorando em Prod. e Tecnol. de Sementes. E-mail: jbsilva@fcav.unesp.br;

RESUMO
A presena de inibidores de germinao no fruto da beterraba pode comprometer o estande da cultura. O presente trabalho objetivou avaliar a interferncia do perodo de imerso em gua corrente no desempenho fisiolgico das sementes de beterraba. Para tanto, sementes da cultivar Top Tall Early Wonder foram submetidas ao de gua corrente durante 0 (testemunha), 1; 1,5; 2; 3; 4; 5 e 6 horas, secadas e avaliadas pelo teste de germinao. A lavagem por duas horas foi suficiente para aumentar a germinao das sementes.

ABSTRACT
Overcoming beetroot seeds dormancy through immersion in running water The presence of germination inhibitors in the fruit of beetroot can reduce the stand of crop. The present work aimed to evaluate the interference of immersion period in running water in the physiological performance of the beetroot seeds. Seeds from cultivar Top Tall Early Wonder were submitted to the action of running water during 0 (control), 1; 1,5; 2; 3; 4; 5 and 6 hours, dried and physiologically evaluated using germination test. Washing the seeds during two hours was enough to increase the germination. Keywords: Beta vulgaris L., inhibitors, germination.

Palavras-chave: Beta vulgaris L., inibidores, germinao.

(Recebido para publicao em 4 de novembro de 2004 e aceito em 16 de setembro de 2005)

a beterraba (Beta vulgaris L.), a estrutura tecnologicamente denominada de semente, normalmente multigrmica, apresentando de dois a cinco aqunios formados pela juno de vrias unidades florais, constituindo um espesso pericarpo corticoso. Cada aqunio contm um vulo que originar uma semente botnica. Quando semeado, cada aqunio origina de trs a cinco plntulas (MCDONALD; COPELAND, 1997; GEORGE, 1999; FILGUEIRA, 2000). A germinao deficiente resulta em estandes inadequados no campo (DURRANT; PAYNE, 1983). A m germinao, alm de ser resultante da restrio mecnica do pericarpo (MORRIS et al., 1985), tem sido tambm atribuda ao de substncias inibidoras da germinao (SLIWINSKA et al., 1999) que, segundo Lexander (1978), so os cidos abscsico, oxlico, vanlico, sinpico, ferlico, poxibenzico, p-oxinamico, p-cumrico e phidroxibenzico (denominados compostos fenlicos), amnia, sais inorgnicos e cis4-ciclohexano-1,2-dicarboximida. Esses compostos competem com o embrio por oxignio (HEYDECKER et al., 1971; RICHARD et al., 1989) e podem promover, ainda, limitaes na absoro de gua por meio da reduo do potencial hdrico (KHAN et al., 1983).
990

Os efeitos positivos da remoo do pericarpo sobre a geminao das sementes, utilizando tcnicas de frico e polimento (MORRIS et al., 1984; MORRIS et al. 1985), no foram confirmados por Richard et al. (1989) e Duan e Burris (1997), pois, segundo esses autores, esse procedimento no elimina completamente a membrana presente na superfcie das sementes, capaz de dificultar a lixiviao de compostos fenlicos envolvidos com restries na quantidade de oxignio disponvel ao embrio. O uso de cidos em baixa concentrao e de reguladores de crescimento tambm tm sido usados com o propsito de melhorar a germinao de sementes de beterraba. Entretanto, estas metodologias tornam-se impraticveis quando se trabalha com grandes volumes de sementes. A imerso das sementes em gua corrente outro mtodo que, alm de mais simples, tem apresentado bons resultados. Silva et al. (2002) verificaram aumento na taxa e na velocidade de germinao de sementes de beterraba por meio da utilizao desta tcnica. A tcnica de lavagem das sementes pode, de acordo com Khan et al. (1983), anular os efeitos dos inibidores ou reduzir a

concentrao destes na semente (SLIWINSKA et al., 1999), favorecendo o estabelecimento da cultura em campo (DURRANT et al., 1988). O perodo de lavagem das sementes um fator de grande importncia na germinao das sementes de beterraba (SOBRAL et al., 1987). Embora existam trabalhos que recomendam duas horas (BRASIL, 1992) de lavagem, esta metodologia requer a execuo de novos trabalhos, pois os dados obtidos na literatura (CUDDY, 1958; KLITGARD, 1978; BASU; DHAR, 1979; KHAN et al., 1983; LONDGEN, citado por Lexander, 1983) so conflitantes. Assim, o trabalho objetivou verificar a interferncia do perodo de imerso em gua corrente, no desempenho fisiolgico das sementes de beterraba.

MATERIAL E MTODOS
A experimentao, realizada em laboratrio da UNESP (Cmpus de Jaboticabal, SP), utilizou sete lotes de sementes de beterraba, cultivar Top Tall Early Wonder mantidos hermeticamente embalados at o incio da conduo dos testes. Uma vez abertas as embalagens, amostras de sementes de cada lote foram submetidas imerso em gua
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Superao de dormncia em sementes de beterraba por meio de imerso em gua corrente

corrente, durante 0 (testemunha), 1; 1,5; 2; 3; 4; 5 e 6 horas, tratadas com fungicida Thiram (0,2%) e postas a secar em temperatura no controlada do ambiente. Os tratamentos foram avaliados pelo teste de germinao a 20oC (BRASIL, 1992), com 50 sementes por repetio, em caixas plsticas contendo duas folhas sobrepostas de papel de filtro umedecido com gua deionizada na proporo de trs vezes o peso do papel no hidratado. O delineamento experimental utilizado foi de blocos ao acaso, e as mdias dos perodos comparadas pelo Teste de Tukey, a 5% de probabilidade. Procedeu-se ao estudo da regresso polinomial para perodos de imerso das sementes.

Tabela 1. Valores mdios de germinao (%) de sementes de beterraba aps diferentes perodos de imerso em gua corrente. Jaboticabal, UNESP, 2004.
Perodo de imerso (horas) 0,0 1,0 1,5 2,0 3,0 4,0 5,0 6,0 Teste F DMS Tukey (5%) CV (%) Germinao (%) 79bc 81bc 83bc 92a 85ab 80bc 77bc 75c 4,94* * 8,97 6,88

Mdias seguidas de letras distintas diferem entre si, ao nvel de 5% de probabilidade, pelo Teste de Tukey. ** p < 0,01

RESULTADOS E DISCUSSO
Houve diferena significativa entre lotes para a porcentagem de germinao de sementes de beterraba, retratando que as condies diferenciadas do cultivo (fatores ambientais e de manejo cultural) possam modificar a concentrao de inibidores e/ou outras caractersticas do pericarpo que influenciam a germinao. A quantidade de inibidores pode ser reduzida quando a planta-me submetida a chuvas e irrigaes freqentes por asperso (BATTLE; WHITTINGTON, 1969) ou quando a colheita efetuada quando as sementes esto em plena maturidade fisiolgica (SLIWINSKA et al., 1999). Houve efeito significativo do perodo de imerso das sementes sobre o percentual de germinao. Entretanto, no foi possvel obter ajuste das mdias equao polinomial. Com exceo dos perodos de zero, cinco e seis horas de imerso, todos os tratamentos proporcionaram germinao de sementes considerada mnima esperada para a cultura da beterraba (Tabela 1), que, segundo Filgueira (2000), de 80%. A maior porcentagem de germinao (92%) foi obtida quando se procedeu imerso das sementes por duas horas, sem, contudo, diferir-se do percentual obtido com trs horas de imerso (85%). O perodo de duas horas aumentou o percentual de germinao da semente de beterraba em relao ausncia de imerso, em aproximadamente 16%.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

No obstante Cuddy (1958) e Klitgard (1978) terem citado o perodo de quatro horas como o mais adequado para esse procedimento, Khan et al. (1983) tambm observaram que o perodo de duas horas, em relao aos de 0; 8 e 24 horas, foi o que permitiu aumento no percentual de germinao das sementes, resultado compartilhado por Londgen, citado por Lexander (1983). Embora Basu e Dhar (1979) no tenham encontrado diferena com o prolongamento do perodo de duas para at 24 horas de imerso, os resultados da Tabela 1 evidenciaram que a continuidade da imerso, procedimento que aumentou o percentual de germinao das sementes no trabalho de Khan et al. (1983), no possibilitou resultado semelhante nessa pesquisa, mas trouxe prejuzos fisiolgicos, principalmente a partir de quatro horas, reduzindo significativamente a porcentagem de germinao. provvel que a melhora no desempenho das sementes aps os tratamentos tenha sido conseqncia do menor teor de inibidores no tecido que envolve as sementes, apesar de no ter sido feita a quantificao desses compostos. Na pesquisa de Morris et al. (1984), a ausncia de diferena entre a testemunha (sementes no imersas) e os perodos de 1; 6; 18 e 24 horas de imerso ocorreu porque os autores trabalharam com sementes descorticadas e, portanto, sem inibidores ou com quantidade mnima. Esses resultados deixam claro que as sementes dessa espcie e cultivar respondem imerso em gua corrente e

que de relevante importncia faz-la em adequado perodo, sob pena de prejudicar a germinao.

LITERATURA CITADA
BASU, R.N.; DHAR, N. Seed treatment for mantaining vigour, viability and productivity of sugar beet ( Be ta vulgaris L.). Seed Science Research, v.7, n.2, p.225-233, 1979. BATTLE, J.P.; WHITTINGTON, W.J. The influence of genetic and environmental factor on the germination of sugar beet. Journal of Agricultural Science, v,73, p.329-335, 1969. BRASIL. Ministrio da agricultura e Reforma Agrria. Secretaria Nacional de Defesa Agropecuria. Regras para anlise de sementes. Brasilia, 1992. 365 p. CUDDY, T.F. Studies on the germination of sugar beet seed. Annual Meeting of the Association of Official Seed Analysts, v.49, p.98-102, 1958. DUAN, X.; BURRIS, J.S. Film coating impairs leaching of germination inhibitors in sugar beet seed. Crop Science, v.37, n.2, p.515-520, 1997. DURRANT, M.J.; PAYNE, P.A. The use of water and some inorganic salt solutions to advance sugar beet seed. I. Laboratory studies. Annals of Applyed Biology, v.103, n.3, p.507-515, 1983. DURRANT, M.J.; PAYNE, P.A.; PRINCE, J.W.F.; FLETCHER, R. Thiram steep seed treatment to control Phoma betae and improve the establishment of the sugar-beet plant stand. Crop Protection, v.7, p.319-926, 1988. FILGUEIRA, F.A.R. Novo manual de olericultura: agrotecnologia moderna na produo e comercializao de hortalias. Viosa: UFV, 2000. 402 p. GEORGE, R.A.T. Vegetable seed production. 2ed. Cambridge: University, 1999. 328 p. HAMPTON, J.G., TEKRONY, D.M. Controlled deterioration test. In: HAMPTON, J.G., TEKRONY, D.M. (Eds.). Handbook of vigour test methods: ISTA. 1995. p.70-78. HEYDECKER, W.; CHETAM, R.S.; HEYDECKER, J.C. Water relations of beet root seed germination. II. Effects of the ovary cap and of the endogenous inhibitors. Annals of Botany, v.35, p.31-42, 1971. 991

J. B. Silva et al. KHAN, A.A.; PECK, N.H.; TAYLOR, A.G.; SAMIMY, C. Osmoconditioning of beet seeds to improve emergence and yield in cold soil. Agronomy Journal, v.75, n.5, p.788-794, 1983. KLITGARD, K. Report of the germination committee working group on germination methods of Beta vulgaris. Seed Science and Technology, Zrich, v.6, n.1, p.215-224, 1978. LEXANDER, K. Seed composition in connection with germination and bolting of Beta vulgaris L. (sugar beet). In: HEBBLETHWAITE, P.D. Seed Production. London: Butterworths. 1978. p.271-291. LEXANDER, K. Composicion de la semilla en relacion al poder germinativo y florescimiento em Beta vulgaris L. (Remolacha azucarera). In: HEBBLETHWAITE, P.D. Produccin Moderna de Semillas. Montevideo, Hemisfrio Sur, 1983. t.1, p.327-351. McDONALD, M.B.; COPELAND, L.O. Seed production: principles and practices. New York: Chapman & Hall, 1997. p.637-638. MORRIS, P.C.; GRIERSON, D.; WHITTINGTON, W.J. Endogenous inhibitors and germination of Beta vulgaris. Journal of Experimental Botany, v.35, n.156, p.994-1002, 1984. MORRIS, P.C.; GRIERSON, D.; WHITTINGTON, W.J. The influence of fruit estruture on germination of sugar beet (Beta vulgaris). Seed Science and Technology, v.13, n.1, p.41-51, 1985. RICHARD, G.; RAYMOND, P.; CORBINEAU, F.; PRADET, A. Effect of the pericarp on sugar beet (Beta vulgaris L.) seed germination: study of the metabolism. Seed Science and Technology, v.17, n.3, p.485-497, 1989. SILVA, J.B.; VIEIRA, R.D.; CECLIO-FILHO, A.B. Efeito da pr-lavagem na germinao de sementes de beterraba. In: CONGRESSO BRASILEIRO DE OLERICULTURA, 42., 2002, Uberlndia. Anais... Uberlndia: Horticultura Brasileira, v.20, n.2, (158), 2002. (Suplemento 2. CD ROM) SLIWINSKA, E.; JING, H.C; JOB, C; JOB, D.; BERGERVOET, J.H.W.; BINO, R.J.; GROOT, S.P.C. Effect of harvest time and soaking treatment on cell cycle activity in sugarbeet seeds. Seed Science Research, v.9, n.1, p.91-99, 1999. SOBRAL, L.S.; IRIGON, D.L.; PORTO, M.P. Teste de germinao em sementes poligrmicas de beterraba aucareira (Beta vulgaris L.). Revista Brasileira de Sementes, Braslia, v.9, n.3, p.3944, 1987.

992

Hortic. bras., v. 23, n. 4, out.-dez. 2005

PINELI, L.L.O.; MORETTI,C.L.; ALMEIDA, G.C.; NASCIMENTO, A.B.G.; ONUKI, A.C.A. Associao de atmosfera modificada e antioxidantes reduz o escurecimento de batatas gata minimamente processadas. Horticultura Brasileira, Braslia, v.23, n.4, p.993-999, out-dez 2005.

Associao de atmosfera modificada e antioxidantes reduz o escurecimento de batatas gata minimamente processadas
Lvia L.O. Pineli1; Celso L. Moretti2; Gustavo C. Almeida3; Aline B.G. Nascimento4; Ana Ceclia A. Onuki4
2 Embrapa Hortalias, C. Postal 218, 70359-970 Braslia-DF; E mail: celso@cnph.embrapa.br; 3UFLA, 37200-000 Lavras-MG; 4Faculdade da Terra de Braslia, 72610-300 Braslia-DF; 1Programa de Mestrado do Depto. Nutrio da UnB, 70910-900 Braslia-DF

RESUMO
O escurecimento enzimtico da batata minimamente processada reduz o valor comercial do produto. O objetivo deste trabalho foi avaliar alteraes qumicas e fsicas em batatas gata minimamente processadas embaladas sob atmosfera modificada em associao com antioxidantes. Batatas gata foram minimamente processadas como mini batatas e tratadas por imerso em solues antioxidantes de cido ctrico a 2%, cido eritrbico a 3%, combinao de cido ctrico a 2% e cido eritrbico a 3%, e combinao de cido ctrico a 3% e cido eritrbico a 5% embaladas em filmes de nylon multicamadas. Os trs primeiros tratamentos foram embalados sob atmosfera modificada passiva enquanto no ltimo tratamento aplicou-se atmosfera modificada ativa com 10% CO2, 2% O2, 88% N2. Observou-se que o tratamento com aplicao de antioxidantes em associao com atmosfera modificada ativa apresentou ndice de escurecimento 24% menor e atividade enzimtica da PPO e da POD 92% e 73% menor, respectivamente, que a mdia dos demais tratamentos no nono dia de observao. Houve elevao nos teores de vitamina C total, observado principalmente em tratamentos que utilizaram cido eritrrbico. Observou-se uma correlao entre a degradao do amido e o aumento nos teores de acares solveis totais e da vitamina C total em alguns tratamentos. O tratamento com aplicao de antioxidantes em associao com atmosfera modificada ativa foi o mais efetivo na manuteno dos atributos de qualidade de batatas minimamente processadas. Palavras-chave: Solanum tuberosum L., processamento mnimo, alteraes metablicas.

ABSTRACT
Association of modified atmospheres and antioxidants reduce browning of minimally processed potatoes Enzymatic browning of minimally processed potatoes reduces the final price of the product. The present work was carried out aiming to evaluate chemical and physical characteristics in fresh-cut gata potatoes stored under modified atmospheres and treated with antioxidants. Potatoes gata were minimally processed as baby potatoes and treated with antioxidants solutions as follows: citric acid (2%), eritrorbic acid (3%), combination of citric acid (2%) and eritrorbic acid (3%), and stored under passive modified atmosphere. A fourth treatment consisting of the combination of citric acid (3%) and eritrorbic acid (5%), in association with active modified atmosphere (10% CO2, 2% O2, 88% N2) was set up. Baby potatoes treated with citric acid (3%) and eritrorbic acid (5%), in association with active modified atmosphere, had a browning index that was 24% lower than the average of the other 3 treatments at the end of the experiment. Similarly, polyphenoloxidase and peroxidase activity were 92 and 73% lower, respectively, in the treatment where antioxidants and active modified atmosphere were combined than the average of the other three treatments at the ninth day of storage. There was an increase in total vitamin C content, mainly in treatments where eritrorbic acid was applied. Combination of antioxidants and active modified atmosphere showed the best maintenance of quality attributes for fresh-cut potatoes. Keywords: Solanum tuberosum L., minimal processing, metabolic changes.

(Recebido para publicao em 17 de julho de 2004 e aceito em 30 de agosto de 2005) m dos desafios ao processamento mnimo de batatas a suscetibilidade dos tubrculos ao escurecimento enzimtico oriundo de reaes catalisadas por enzimas sendo a polifenoloxidase (PPO) a mais importante. Tais reaes ocorrem quando h ruptura da clula, embora possam tambm ocorrer no tecido intacto de frutas e hortalias (ARAJO, 2003). Os fatores mais importantes na evoluo da taxa do escurecimento enzimtico provocado so a concentrao de PPO ativa e de compostos fenlicos, o pH, a temperatura e o oxignio disponvel no tecido. O pH timo da PPO varia com a fonte da enzima e com o substrato. Na maioria dos casos situa-se entre 6 e 7 e
Hortic. bras., v. 23, n. 4, out.-dez. 2005

seu ajuste para valores inferiores a 4 possibilita o controle do escurecimento enzimtico, desde que se considerem os aspectos sensoriais do produto (LAURILA et al, 1998a, 1998b). A peroxidase (POD) tambm pode causar o escurecimento em hortalias minimamente processadas. A POD contm um grupo heme e est relacionada com processos de cicatrizao como, por exemplo, a lignificao (CANTOS et al., 2002). Em condies ideais, batatas inteiras descascadas podem ser estocadas sem agentes inibidores de escurecimento por sete dias (AHVENAINEN et al., 1998), o que no possvel para batatas em fatias (LAURILA et al., 1998a). Vrios mto-

dos para prevenir o escurecimento enzimtico podem ser aplicados em batatas. Muitos inibidores de escurecimento so conhecidos, mas apenas alguns so potencialmente alternativos ao uso de sulfito. Os sulfitos, apesar de possurem diversas vantagens tcnicas, provocam a corroso de equipamentos, a diminuio do valor nutricional, a perda de firmeza e a formao de sabores e odores desagradveis (off-flavors) nos produtos aos quais aplicado. Adicionalmente, o uso de sulfitos est cada mais associado a diversos malefcios sade (MCEVILY et al., 1991). Dentre os antioxidantes mais pesquisados destacam-se os cidos c993

L. L. O. Pineli et al.

Figura 1. ndice de escurecimento de batatas gata minimamente processadas armazenadas a 5C com aplicao de antioxidantes e embalagem sob atmosfera modificada ativa e passiva. Embrapa Hortalias, Braslia, DF, 2004. AM = atmosfera modificada. MF = Matria fresca. Barras verticais representam o desvio-padro da mdia. Braslia, Embrapa Hortalias, 2004.

trico, ascrbico e eritrrbico. Sua acessibilidade no mercado, como ingredientes j em amplo uso na indstria alimentcia, aponta-os como opes para a indstria de batatas minimamente processadas. O custo do cido eritrrbico, cinco vezes inferior ao de seu ismero, cido ascrbico, justifica seu uso neste trabalho, de forma isolada ou em combinao com o cido ctrico. A aplicao de atmosfera modificada ativa ou passiva, com baixas concentraes de O2 e altas de CO2 tambm contribui para o controle do escurecimento e outros processos degradativos, uma vez que reduz a velocidade dos processos aerbicos e implica baixa disponibilidade de O2 para a atividade da PPO. Apesar da existncia de diversos estudos enfocando o controle de escurecimento enzimtico em produtos hortcolas, existe uma lacuna na literatura no que diz respeito adoo de tcnicas combinadas para reduo dessa desordem em cultivares de hortalias nacionais com potencial de aproveitamento para o processamento mnimo. O objetivo deste trabalho foi caracterizar fsica e quimicamente batatas gata minimamente processadas submetidas a diferentes tratamentos com antioxidantes e atmosfera modificada.
994

MATERIAL E MTODOS
Material vegetal Batatas ( Solanum tuberosum L.) gata da classificao primeirinha (dimetro entre 40 e 60 mm) foram adquiridas na Ceasa de Braslia, levadas ao Laboratrio de Ps-Colheita da Embrapa Hortalias, selecionadas, classificadas e lavadas em gua potvel; Processamento mnimo Tubrculos foram descascados por abraso em mquina processadora (modelo PCED, Siemsem Ltda.) por 180 segundos em tambor revestido com lixa de 60 mesh e 36 segundos no segundo tambor revestido com lixa de 100 mesh. As batatas descascadas foram enxaguadas em gua potvel, sanitizadas em gua com 150 ppm de cloro ativo por 5 minutos, imersas em solues antioxidantes por 3 minutos e centrifugadas, por 7 minutos, a 800 g. Tratamento com antioxidantes As solues antioxidantes usadas foram 2% de cido ctrico; 3% de cido eritrbico; 2% de cido ctrico + 3% de cido eritrbico; e 5% de cido eritrbico + 3% de cido ctrico.

Embalagem e armazenamento O material foi posteriormente embalado em filme plstico de nylon multicamadas em seladora industrial (Selovac 200B, So Paulo, SP) em pores de 200 gramas, e armazenado sob refrigerao a 5C por 9 dias. Os trs primeiros tratamentos foram embalados sob atmosfera modificada passiva enquanto o ltimo tratamento foi embalado sob atmosfera modificada ativa, pela utilizao da mistura 10% CO2, 2% O2, 88% N2. Anlises qumicas e fsicas A cada 3 dias os tubrculos minimamente processados foram avaliados quanto s seguintes variveis: ndice de escurecimento . O ndice de escurecimento foi determinado por meio de um colormetro Minolta Color Reader CR 200b (sistema L*a*b*), e calculado a partir da frmula: IE = [100 (X - 0,31)] / 0,172; X = (a + 1,75.L) / (5,645.L+ a - 3,021.b) Atividade enzimtica da polifenoloxidase e peroxidase. A atividade das enzimas polifenoloxidase e peroxidase foi determinada segundo o mtodo descrito por Flurkey e Jen (1978), sendo o extrato lido a 395 nm para POP e a 470 nm para POD. Acares solveis totais. Determinados pelo mtodo fenol-sulfrico descrito por Dubois et al. (1956). Teor de amido. Determinao feita a partir de adaptao realizada no mtodo de Ranganna (1986), com extrao de acares por soluo de etanol (80%) a quente, em 3 estgios, e hidrlise cida do resduo, tambm em 3 estgios, com cido perclrico (52%), com posterior determinao dos acares pelo mtodo fenol-sulfrico. Teor de vitamina C total. A vitamina C total foi quantificada de acordo com metodologia descrita por Terada et al. (1978), modificado por Nunes et al. (1995). O delineamento experimental foi inteiramente casualizado, com 16 tratamentos provenientes de um fatorial 4x4 (4 combinaes de antioxidantes e 4 tempos de armazenagem), com 3 repeties. A unidade experimental considerada correspondeu a uma embalagem de 200 gramas. Os dados foram submetidos anlise de varincia e as mdias
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Associao de atmosfera modificada e antioxidantes reduz o escurecimento de batatas gata minimamente processadas

foram comparadas pelo teste da diferena mnima significativa (p0,05).

RESULTADOS E DISCUSSO
ndice de escurecimento (IE) O tratamento com cido ctrico a 2% combinado com cido eritrrbico a 3% apresentou melhor controle do escurecimento do que os tratamentos aplicados isoladamente at o terceiro dia de armazenamento (Figura 1). No nono dia, os IE dos tratamentos sob atmosfera modificada passiva estavam muito prximos e mostravam aumento do escurecimento das batatas de aproximadamente 10,5% em relao aos valores iniciais. O tratamento com atmosfera modificada ativa, em associao aos antioxidantes combinados, apresentou ndice de escurecimento 6,2% menor do que a mdia dos IE dos demais tratamentos logo aps o processamento mnimo, indicando uma diferena significativa no controle do escurecimento nas primeiras horas aps a injria aos tubrculos. No se observou elevao do IE para o tratamento sob atmosfera modificada ativa e ao final do experimento, verificou-se que o IE desse tratamento era aproximadamente 24% menor do que os demais tratamentos (Figura 1). Diversos trabalhos avaliaram os efeitos das embalagens e de diferentes atmosferas no escurecimento de batatas minimamente processadas (GUNES; LEE, 1997; LAURILA et al., 1998a), e na composio nutricional (AHVENAINEN et al., 1998; TUDELA et al., 2002, 2003). Gunes & Lee (1997) demonstraram que modificao ativa da atmosfera na embalagem foi necessria para estender a vida de prateleira de batatas, porm, a atmosfera modificada por si s no foi capaz de evitar o escurecimento. Os resultados confirmam a necessidade do tratamento por imerso com soluo de agentes inibidores do escurecimento em batatas minimamente processadas. Quando se estudou a modificao da atmosfera, observou-se que a de 100% N2, em sacos de poliolefina multicamada, com alta permeabilidade, foi a mais eficaz. Solues de N-acetil-L-cistena (1%), cido pentactico dietilenotriamina (DTPA) (1%), e cido eritrrbico (5%)
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 2. Atividade enzimtica da polifenoloxidase (PPO) (a) e peroxidase (POD) (b) de batatas gata minimamente processadas armazenadas a 5C com aplicao de antioxidantes e embalagem sob atmosfera modificada ativa e passiva. Embrapa Hortalias, Braslia, DF, 2004. AM = atmosfera modificada. MF = Matria fresca. Barras verticais representam o desvio-padro da mdia. Braslia, Embrapa Hortalias, 2004.

+ cido ctrico (1%) usadas para tratamento de batatas em palitos, seguindose estocagem em atmosfera modificada a 1 e 6C, foram eficazes no retardamento do escurecimento enzimtico. Os resultados obtidos no presente experimento para o tratamento com atmosfera mo-

dificada ativa associada aos cidos ctrico e eritrrbico esto em concordncia com Cacace et al. (2002), que observaram que todos os tratamentos foram fortemente afetados pela temperatura de armazenamento. Segundo os autores, o tratamento com cido ctrico e eritrrbico
995

L. L. O. Pineli et al.

Figura 3: Teores de acares solveis totais (a) e amido (b) de batatas gata minimamente processadas armazenadas a 5C com aplicao de antioxidantes e embalagem sob atmosfera modificada ativa e passiva. Embrapa Hortalias, Braslia, DF, 2004. AM = atmosfera modificada. MF = Matria fresca. Barras verticais representam o desvio-padro da mdia. Braslia, Embrapa Hortalias, 2004.

foi o nico a ser comparado favoravelmente com batatas frescas preparadas, aps 14 dias a 1C ou 7 dias a 6C. Atividade enzimtica No foi verificada diferena significativa na atividade da PPO para os tratamentos sob atmosfera modificada passiva logo aps o processamento mnimo (Figura 2a). Os tratamentos armazenados sob atmosfera modificada passiva no apresentavam diferenas estatsticas quanto ati996

vidade da PPO logo aps o processamento mnimo e assim permaneceram durante o perodo experimental. A combinao de cido ctrico a 2% e cido eritrrbico a 3% teve a atividade da enzima ampliada em 18,6%, do terceiro para o sexto dia, apresentando a maior atividade da PPO no nono dia de armazenamento (39,6 UE.g-1 min-1). Por outro lado, o tratamento que reunia a combinao de dois antioxidantes sob

atmosfera modificada ativa foi o mais eficaz na inibio da atividade da PPO, que se apresentava 2,3 e 1,9 vezes menor do que a mdia dos demais tratamentos, no dia do processamento e aps 9 dias de armazenamento, respectivamente (Figura 2a). A atividade da POD no dia do processamento foi maior em batatas tratadas com 3% de cido eritrrbico (365,04 UE .g-1 min-1), e menor em batatas armazenadas sob atmosfera modificada ativa (111,14 UE g-1 min-1) (Figura 2b). O tratamento com 2% de cido ctrico e o tratamento com 3% de cido eritrrbico apresentaram aumento na atividade da POD at o sexto dia de armazenagem com posterior reduo. Batatas tratadas com antioxidantes combinados em atmosfera modificada passiva ou ativa apresentaram controle da atividade da POD j a partir do terceiro dia (Figura 2b). Observou-se ainda, que a atividade da POD era 2,8 e 1,7 vezes menor no tratamento sob atmosfera ativa em relao media dos demais tratamentos no dia do processamento e aps 9 dias de armazenamento, respectivamente. Cantos et al. (2002) avaliaram o efeito do processamento mnimo sobre a atividade das enzimas PPO, POD e fenilalanina amnia liase (PAL) e nos compostos fenlicos, em cinco cultivares de batatas. No encontraram correlao significativa entre o grau ou taxa de escurecimento e quaisquer das variveis investigadas. Entretanto, o aumento da atividade da POD, verificada pela sntese de isoperoxidases identificadas por eletroforese, confirmou a induo da atividade desta enzima como fenmeno comum no reino vegetal em resposta a situaes de estresse, como injrias mecnicas. Os autores sugerem que para melhor compreenso dos fatores limitantes do desenvolvimento do escurecimento em batatas minimamente processadas, estudos adicionais de outros aspectos importantes (estabilidade de membrana, composio lipdica, teor de clcio, atividade de proteases, prticas agronmicas) so necessrios. Semelhante ausncia de correlao foi encontrada entre grau de escurecimento e atividade enzimtica de mas durante o armazenamento a 0C (COSETENG; LEE, 1987).
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Associao de atmosfera modificada e antioxidantes reduz o escurecimento de batatas gata minimamente processadas

Os resultados observados nas Figuras 1 e 2 mostram que o tratamento onde houve combinao de antioxidantes em atmosfera modificada ativa foi o mais eficaz no controle do escurecimento e da atividade das enzimas PPO e POD, o que se traduziu em manuteno da cor original do produto. A combinao dos antioxidantes cidos pode ter contribudo para o abaixamento do pH do meio, reduzindo a atividade das enzimas associadas com o escurecimento enzimtico. Esses resultados permitem inferir que tais tratamentos podem tornar vivel a produo e comercializao de batatas minimamente processadas quando o aspecto visual colocado em perspectiva. Acares Solveis Totais e Amido Batatas tratadas com 2% de cido ctrico apresentaram, ao final de nove dias, aumento de 12,5% no contedo de acares solveis totais, enquanto nos tubrculos tratados com 3% de cido eritrrbico foi verificada uma reduo de 12,7% no nono dia em comparao com os valores iniciais. Observou-se, ainda, em batatas tratadas com combinao de antioxidantes sob atmosfera modificada passiva um aumento de aproximadamente 17,0% no sexto dia, com subseqente retorno aos patamares iniciais (Figura 3a). A maior concentrao de acares solveis totais foi encontrada nas batatas armazenadas sob atmosfera modificada ativa, com valor inicial de 14,84g kg-1 MF, que se reduziu, at o ltimo dia de avaliao, em aproximadamente 40,0%, igualando-se aos demais tratamentos. No nono dia de armazenamento observou-se que batatas tratadas com 2% de cido ctrico possuam o maior teor de acares solveis totais, nico que no sofreu imerso em cido eritrrbico. O teor de amido avaliado nas batatas minimamente processadas sofreu aumento ou manuteno de seus valores dependendo do tratamento em questo (Figura 3b). Segundo Borgstrom (1946), os teores de amido encontrados na matria fresca de batata variam de 90 a 180 g kg-1 MF sendo influenciados por variveis como cultivar, poca do ano, temperatura e tempo de armazenamento, entre outros (NOURIAN et al., 2003).
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 4. Vitamina C total de batatas gata minimamente processadas armazenadas a 5C com aplicao de antioxidantes e embalagem sob atmosfera modificada ativa e passiva. Embrapa Hortalias, Braslia, DF, 2004. AM = atmosfera modificada. MF = Matria fresca. Barras verticais representam o desvio-padro da mdia. Braslia, Embrapa Hortalias, 2004.

Os valores encontrados no dia do processamento so semelhantes aos valores citados pelo autor. A converso de amido em acares parece ser reversvel (ISHERWOOD, 1973). Entretanto, o aumento nos teores de amido encontrados no presente experimento parece estar mais relacionado com a perda dgua sofrida pelos tubrculos, constatada pela umidade superficial crescente do produto aps a centrifugao e durante o armazenamento. De acordo com Nourian et al. (2003), a degradao do amido ocorre rapidamente com a diminuio da temperatura, enquanto a variao dos acares totais e redutores est diretamente relacionada com o tempo de armazenamento. As condies de baixa temperatura resultam em acmulo de ATP no tecido de batata e acarretam a ativao da via alternativa, conhecida como alternativa oxidse, que diminui os nveis de ATP e, simultaneamente, incrementa as concentraes de sacarose, provavelmente via fosforilase (ISHERWOOD, 1973). A sacarose torna-se o substrato da invertase cida vacuolar, que originar o acmulo de acares redutores (DUPLESSIS et al.,

1996). A induo do acmulo de acares pelo frio estaria ainda relacionada com a deteriorao das membranas dos amiloplastos (OHAD et al., 1971), favorecendo a ao da enzima amidofosforilase sobre o amido (FONTES; FINGER, 2000). A inibio da converso do amido em acares pela presena de CO2 j foi observada, assim como o aumento na sntese de amido e mudanas na atividade metablica aps a injria aos tubrculos (SMITH, 1977). Isto poderia explicar, parcialmente, o maior teor de amido em batatas armazenadas sob atmosfera modificada ativa, com 10% de CO 2 e 2% de O 2 no dia do processamento, em comparao aos demais tratamentos, embalados sob atmosfera modificada passiva. De acordo com Pressey (1969), a atividade da sacarose sintetase, importante enzima envolvida na sntese do amido, maior em tubrculos jovens de batata, em que se incluem fisiologicamente tubrculos da classificao primeirinha. Apesar da provvel distoro provocada pela perda de gua, pode-se perceber um processo de degradao do amido nas batatas submetidas ao tratamento com 2% de ci997

L. L. O. Pineli et al.

do ctrico, evidenciando aps o terceiro dia uma degradao aparente de 21,0%. O tratamento sob atmosfera modificada ativa indicou reduo nos teores de amido do sexto ao nono dia, com alterao de 20,7%. Os demais tratamentos no apresentaram degradao de amido, mas estabilizao ou acmulo, podendo estar relacionado com ocorrncia de maior perda dgua, ou menor degradao do amido nestas condies, de forma que no seja capaz de sobrepor o efeito da desidratao em nenhum dos tempos avaliados ou com processos de sntese de amido, conforme discutido. A maior degradao do amido em batatas tratadas com cido ctrico est em consonncia com o crescimento do teor de acares solveis totais verificado para este tratamento, sendo possvel estabelecer correlaes similares entre os resultados das Figuras 3a e 3b para o tratamento com cido eritrrbico 3%. Batatas submetidas ao armazenamento sob atmosfera modificada ativa tiveram aumento no teor de amido at o sexto dia, a partir do qual se observou reduo de 20,2% at o nono dia. Sugere-se para melhor avaliao desta varivel a determinao do teor de amido sobre a matria seca ao longo do armazenamento, ou, alternativamente, o acompanhamento da matria seca do produto, ou determinao da perda dgua por mtodos gravimtricos, o que possibilitaria uma associao com os resultados indicados na Figura 3b. Vitamina C Total O teor de vitamina C total tambm foi influenciado pela adio de antioxidantes aos tubrculos (Figura 4). O cido eritrrbico ismero do cido ascrbico e pode ter causado alguma distoro na anlise de vitamina C total. Observa-se que a curva com menor concentrao de vitamina C total a dos tubrculos tratados com 2% de cido ctrico, nica que no sofreu imerso em cido eritrrbico. Alm disso, a adio de antioxidantes pode prevenir a oxidao da vitamina C presente naturalmente na batata. De acordo com Davey et al. (2000), batatas apresentam teores de vitamina C que variam entre 100 e 300 mg kg-1 MF. Estes valores podem variar de acor998

do com a cultivar, com as prticas agrcolas, colheita e condies de armazenamento. O teor de vitamina C encontrado neste experimento em batatas intactas da cultivar gata, classificao primeirinha, foi de 220,9 mg kg-1 MF, dentro do intervalo proposto pelo autor. Os valores encontrados em batatas minimamente processadas, tratadas com antioxidantes, situaram-se acima deste intervalo. Verificou-se que no dia do processamento todos os tratamentos diferiam entre si, sendo que batatas armazenadas sob atmosfera modificada ativa apresentavam o maior teor de vitamina C (587,14 mg Kg-1 MF), seguindo-se o tratamento com combinao de antioxidantes armazenado sob atmosfera passiva (524,07 mg kg-1 MF), tratamento com 3% de cido eritrrbico (437,76 mg kg-1 MF) e 2% de cido ctrico (323,55 mg kg-1 MF). Batatas tratadas com a combinao de antioxidantes e armazenadas sob atmosfera modificada ativa sofreram reduo nos teores de vitamina C total ao terceiro dia de armazenamento, com posterior acmulo at o nono dia. Os tratamentos com antioxidantes isolados, 2% de cido ctrico e 3% de cido eritrrbico, tambm apresentaram acmulo de vitamina C com o tempo, com aumento de at 16,0% em seus teores (Figura 4). O tratamento onde se combinou os antioxidantes sob atmosfera modificada passiva foi o nico que apresentou diminuio da vitamina C total (14,5%), mas ainda assim permaneceu com valor 2,3 vezes superior ao das batatas intactas. Batatas minimamente processadas so capazes de reter, total ou parcialmente, seu teor inicial de vitamina C, considerando que as perdas decorrentes de processos de oxidao so compensadas pelo aumento na biossntese de cido ascrbico (TUDELA et al., 2002). Esse aumento pode estar correlacionado com a maior atividade da enzima Lgalactono-g-lactona dehidrogenase (GLDH) em tecidos de batata injuriados, a qual catalisa o passo final da biossntese de cido ascrbico (OBA et al., 1994) e poderia ser resultado da maior necessidade de poder antioxidante em nvel celular para fazer frente ao

estresse provocado pelo processamento mnimo (TUDELA et al., 2003). Alm disso, o aumento da atividade respiratria provocado pelo processamento mnimo leva degradao do amido, com acmulo de glicose, substrato requerido no processo de sntese de ascorbato (NOCTOR; FOYER, 1998). Prasanna et al. (2000) observaram que o pico respiratrio ou climatrico em mas durante o amadurecimento coincide com seu teor mximo de cido ascrbico, o que refora uma possvel correlao entre degradao do amido, aumento dos acares totais e sntese de ascorbato. Comportamento semelhante foi observado para tubrculos tratados com 2% de cido ctrico, que a partir do terceiro dia de armazenamento apresentou reduo nos teores de amido e aumento nos teores de acares solveis totais e na vitamina C total, simultaneamente (Figuras 3 e 4). O teor de vitamina C em um alimento deve incluir os teores de cido ascrbico e deidroascrbico, uma vez esta ltima forma pode ser facilmente convertida na primeira no organismo humano. O cido deidroascrbico pode ser oxidado irreversivelmente a cido dicetogulnico, sem qualquer atividade de vitamina C (PARVIAINEN; NYYSSONEN, 1992), o que significaria na prtica a perda de valor nutricional. A oxidao do ascorbato pela ascorbato oxidase aumenta em condies de estresse, exposio a patgenos, altas temperaturas, ons metlicos e agentes qumicos (LEE; KADER, 2000). Portanto, o teor de vitamina C em batatas minimamente processadas resultante de processos biossintticos e degradativos que ocorrem simultaneamente. No estudo apresentado, deve-se considerar a possibilidade da ocorrncia de sntese de ascorbato em resposta ao estresse oxidativo e ao efeito da aplicao de antioxidantes na determinao da vitamina C total. Vale ressaltar que o mtodo empregado para anlise desta varivel refere-se a materiais com teores baixos de vitamina C (50-400 mg kg-1 MF), no sendo adequado para fontes mais ricas do nutriente. Como alguns tratamentos ultrapassaram os valores recomendados, outros mtodos devem
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Associao de atmosfera modificada e antioxidantes reduz o escurecimento de batatas gata minimamente processadas

ser utilizados para confirmao dos resultados mais elevados. A utilizao da tcnica de cromatrografia lquida de alto eficincia (TUDELA et al., 2002) para determinao de cido ascrbico e cido deidroascrbico seria interessante para elucidao das possveis interferncias causadas pelos antioxidantes e para acompanhamento mais rigoroso dos processos biossintticos e degradativos que envolvem o ascorbato nos tubrculos de batata. Tudela et al. (2003) estudaram o efeito do processamento mnimo, com subseqente armazenamento sob refrigerao, a 4C, de batatas da cultivar Manon, sob diferentes atmosferas (ar, ar + 20% de CO2, 100% N2, e embalagem a vcuo), na atividade da enzima L-galactono- g-lactona dehidrogenase e no teor de Vitamina C. A embalagem a vcuo provou ser a melhor condio de embalagem, tendo evitado o escurecimento e retido 89,0% da Vitamina C, seguido das atmosferas 100% N2 (78,0% reteno) e 20% CO2 + ar (63,0% de reteno). Em outra srie de experimentos conduzida com batatas gata e Monalisa minimamente processadas sob vcuo parcial e diferentes temperaturas de armazenamento (dados no publicados), verificou-se a eficcia deste tipo de embalagem na reteno da vitamina C, tendo sido observado acmulo entre 49,0 e 58,4% deste nutriente ao fim dos nove dias de avaliao. Todavia, a perda de firmeza, o encharcamento da embalagem e o desenvolvimento de processos anaerbios levando a odores desagradveis comprometeram a aceitao do produto, o que levou rejeio da utilizao de vcuo nas embalagens.

AGRADECIMENTOS
Os autores agradecem o apoio financeiro recebido do projeto PRODETAB (ACORDO BIRD / EMBRAPA - Projeto 019) e ADF Agropecuria do Distrito Federal.

LITERATURA CITADA
AHVENAINEN, R.T.; HURME. E.U., HGG, M.; SKYTT, E.H., LAURILA. E.K. Shelf life of pre-peeled potato cultivated, stored, processed by various methods. Journal of Food Protection, v.61, p.591-600, 1998.

ARAJO, J.M. Qumica de Alimentos Teoria e Prtica 3a.edio. Viosa: Editora UFV, 2003. BORGSTROM, G. Principles of Food Science 2a. ed. Connecticut: Food and Nutrition Press, 1946. CACACE, J.E.; DELAQUIS, P.J.; MAZZA, G. Effect of chemical inhibitors and storage temperature on the quality of fresh-cut potatoes J. Food Quality, v.25, n.3, p.181-196, 2002. CANTOS, E.; TUDELA, J.A.; GIL, M.I.; ESPN, J.C. Phenolic compounds and related enzymes are not rate-limiting in browning development of fresh-cut potatoes. J. Agric. Food Chem., v.50, p.3015-3023, 2002. COSETENG, M.Y.; LEE, C.Y. Changes in apple polypnehnoloxidase and polyphenol concentrations in relation to degree of browning. J. Food Science, v.52, n.4, p.985-989, 1987. DAVEY, M.W.; MONTAGU, M.V.; INZ, D.; SANMARTIM, M.; KANELLIS, A.; SMIRNOFF, N.; BENZIE, I.J.J.; STRAIN, J.J.; FAVEL, D.; FLETCHER, J. Plant ascorbic acid: chemistry, function, metabolism, bioavailability and effects of processing. J. Sci. Food Agric., v.80, p.825-860, 2000. DUBOIS, M.; GILLES, K.A.; HAMILTON, J.K.; REBERS, P.A. & SMITH, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. v. 28, p.350-356, 1956. DUPLESSIS, P.M.; MARANGONI, A.G.; YADA, R.Y. A mechanism for low temperature induced sugar accumulation in stored potato tubers: the potential role of alternative pathway and invertase. American Potato Journal, v.73, p.97-100, 1996. FLURKEY, W.H.; JEN, J. Peroxidase and polyphenoloxidase activities in developing peaches. J. Food Science, v.43, p.1826-1828, 1978. FONTES, P.C.R.; FINGER, F.L. Ps-colheita do tubrculo de batata. 1a. ed. Viosa: Editora UFV, 2000, 46 p. GUNES, G.; LEE, C.Y. Colour of minimally processed potatoes as affected by modified atmosphere and ant browning agents. J. Food Science, v.62, p.572-575,582, 1997. ISHERWOOD, F.A. Starch-sugar interconversion in Solanum tuberosum. Phytochemistry, v.12, p.2579-2591, 1973. LAURILA, E.; HURME, E.; AHVENAINEN, R. The shelf life of sliced raw potatoes of various cultivar varieties-substitution of bisulfites. J. Food Protection, v.61, n.10, p.1363-1386, 1998a. LAURILA, E.; KERVINEN, R.; AHVENAINEN, R. The inhibition of enzymatic browning in minimally processed vegetables and fruits. Review article. Post Harvest News and Information. (1998b). Disponvel em <http:// hort.cabweb.org> Acesso em: 10 jun. 2003. LEE, S.K.; KADER, A.A. Preharvest and Postharvest factors influencing vitamin C content of horticultural crops. Postharvest Biology and Technology, v.20, p.207-220, 2000. MCEVILY, A.J.; Iyengar, R.; Otwell, W.S. Sulfite alternative prevents shrimp melanosis. Food Technology, v.45, p.80-86, 1991.

NOCTOR, G; FOYER, CH. Ascorbate and glutathione: keeping active oxygen under control. Annu. Rev. Plant. Physiol. Mol. Biol., v.49, p.249279, 1998. NOURIAN, F; RAMASWAMY, HS; KUSHALAPPA, AC. Kinetics of quality change associated with potatoes stored at different temperatures. Lebensm.-Wiss. U.-Technol., v.36, p.4965, 2003. NUNES, M.C.N.; BRECHT, J.K.; MORAIS, A.M.M.B.; SARGENT, S.A. Physical and chemical quality characteristics of strawberries after storage are reduced by a short delay to cooking. Postharvest Biology and Technology, v.6, p.17-28, 1995. OBA, K. FUKUI, M.; IMAI, Y.; IRYAMA, S.; NOGAMI, K. L-Galactono-- lactone dehydrogenase: partial characterization, induction of activity and role in the synthesis of ascorbic acid in wounded white potato tuber tissue. Plant Cell. Physiology, v.35, p.473-478, 1994. OHAD, I.; FRIEDBERG, I.; NEMAN, Z.; SCRAMM, M. Biogenesis and degradation of starch. the fate of amyloplast membrane during maturation and storage of potato tubers. Plant Physiology, v.47, p.465-477, 1971. PARVIAINEN, M.T.; NYYSSONEM, K. Ascorbic acid. In: LEENHEER, A.P.D; LAMBERT, W.E. NELIS, H (Eds) Modern Chromatografic Annalysis of Vitamins. New York: Marcel Dekker, 1992. PRASANNA, K.N.V., RAO, D.V.S. KRISHNAMURTHY, S., Effect of storage temperature on ripening and quality of custard apple (Annona squamosa L.) fruits. J. Hortic. Sci. Biotech., v.75, p.546-550, 2000. PRESSEY, R. Role of invertase in accumulation of sugars in cold-stored potatoes. American Potato Journal, v.46, p.291-297, 1969. RANGANNA, S. Handbook of analysis and quality control for fruits and vegetables products. Tata Mcgraw Publishers, New Delhi, 1986, 107 p. SMITH, O. Potatoes: production , storing , processing. 2a. edio. Westpot,:Avi. Publishing, 1977. 286 p. TERADA, M.; WATANABE, Y.; KUNITOMA, M.; HAYASHI, E. Differential rapid analysis ascorbic acid and ascorbic acid 2-sulfate by dinitrophenilhydrazine method. Annals of Biochemistry, v.4, p.604-8, 1979. TUDELA, J.A.; ESPN, J.C.; GIL, M.I. Vitamin C retention in fresh-cut potatoes. Postharvest Biology and Technology, v.26, p.75-84, 2002. TUDELA, J.A.; HERNNDEZ, J.A.; GIL, M.I.; ESPN, J.C. L-galactono-g- lactone dehydrogenase activity and vitamin C content in fresh-cut potatoes stored under controlled atmospheres. J. Agric. Food Chem., v.51, p.42964302, 2003.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

999

KARASAWA, M.; RODRIGUES, R.; SUDR, C.P.; SILVA, M.P.; RIVA, E.M.; AMARAL JNIOR, A.T. Aplicao de mtodos de agrupamento na quantificao da divergncia gentica entre acessos de tomateiro. Horticultura Brasileira, Braslia, v.23, n.4, p.1000-1005, out-dez 2005.

Aplicao de mtodos de agrupamento na quantificao da divergncia gentica entre acessos de tomateiro1


Mina Karasawa; Rosana Rodrigues; Cludia P. Sudr; Marlon P. da Silva; Elaine M. Riva; Antnio T. do Amaral Jnior
2

UENF/CCTA/LMGV, Av. Alberto Lamego, 2000, Parque Califrnia, 28013-600, Campos dos Goytacazes-RJ; E-mail: rosana@uenf.br

RESUMO
A quantificao da divergncia gentica entre acessos de bancos de germoplasma baseada em descritores permite a indicao de potenciais genitores a serem utilizados em programas de melhoramento, entre outros resultados de interesse para o melhorista. Para estudos de divergncia gentica, a anlise multivariada, incluindo os mtodos de aglomerao, tem sido amplamente empregada. Este trabalho teve como objetivos caracterizar e quantificar a divergncia gentica entre acessos de tomateiro, por meio de mtodos de agrupamento. O experimento foi conduzido em 2001, em Campos dos Goytacazes, RJ., em condies de campo. Utilizou-se o delineamento experimental de blocos casualizados com 70 acessos, trs repeties e 16 plantas por parcela. Vinte descritores de caracterizao e cinco de avaliao foram considerados. Houve diferena significativa entre os acessos para nmero total, peso total, nmero mdio, e peso mdio de frutos; comprimento e dimetro do fruto; nmero de dias para germinao; nmero de dias para frutificao; nmero de flores por inflorescncia; teor de slidos solveis; nmero de lculos e nmero de dias para florescimento, indicando a presena de variabilidade entre os acessos. O agrupamento pelo Mtodo Hierrquico do Vizinho Mais Prximo, detectou a formao de dois grupos, baseado no nmero de dias para germinao. O grupo 1 reuniu os acessos com germinao em 10 dias e o grupo 2 foi composto pelos acessos que germinaram em sete dias. O subagrupamento dos grupos 1 e 2 permitiu a deteco de sete subgrupos no grupo 1 e cinco subgrupos no grupo 2. O Mtodo de Otimizao de Tocher possibilitou a formao de dez grupos, concordantes com os subgrupos obtidos pelo mtodo do Vizinho mais Prximo. Palavras-chave: Lycopersicon esculentum, anlise multivariada, caracterizao de germoplasma, recursos genticos, pr-melhoramento.

ABSTRACT
Cluster analysis in quantifying genetic divergence in tomato accessions The quantification of the genetic divergence among accessions in a germplasm bank, based on descriptors for characterization, allows us to indicate promising parentals that can be used in breeding programs. In order to study the genetic divergence, multivariate analysis, including cluster methods has been used. The genetic divergence among tomato accessions was characterized and quantified, using cluster analysis. The experiment was carried out in 2001, in Rio de Janeiro State, Brazil, in field conditions. A randomized block design was used, with 70 accessions, three replications and 16 plants per plot. Twenty characterization and five evaluation descriptors were considered. There was significant difference among accessions for total number of fruits, total weight of fruits, mean number of fruits, mean weight of fruits, fruit length, fruit diameter, number of days for germination, days for fruit set, number of flowers per inflorescence, solid solubles, number of locules and days for flowering indicating the presence of genetic variability among accessions. Nearest neighbor method detected two groups, based on number of days for germination. Group 1 was formed by accessions with germination in 10 days while group 2 included accessions that germinated in seven days. Subgrouping from groups 1 and 2 detected seven and five subgroups for each group, respectively. Based on Tocher Method, ten groups were formed with agreement between Tocher and Nearest Neighbor.

Keywords: Lycopersicon esculentum , multivariate analysis, germplasm characterization, genetic resources, pre-breeding.

(Recebido para publicao em 1 de abril de 2005 e aceito em 16 de setembro de 2005) estudo da diversidade gentica entre acessos de bancos de germoplasma fornece informaes de potenciais genitores a serem utilizados em programas de melhoramento, alm do fato de que a prpria caracterizao dos acessos possibilita a identificao de duplicatas e o intercmbio de germoplasma entre pesquisadores. A forma preditiva de determinar a divergncia gentica apresenta como principal vantagem o fato de no ser necessria a obteno prvia de combinaes

hbridas, como ocorre em dialelos (COIMBRA et al., 2001). O conhecimento do grau de variabilidade gentica, por meio dos estudos de divergncia, torna-se vantajosa no processo de identificao de novas fontes de genes de interesse (AMARAL JNIOR; THIBAUT, 1999). Outra vantgem o fato de que, por meio da diversidade gentica, pode-se indicar progenitores geneticamente distantes para cruzamentos onde se procure obter o efeito hetertico na gerao hbri-

da e maior probabilidade de recuperao de segregantes superiores em geraes avanadas (AMARAL JNIOR; THIBAUT, 1999; CRUZ; REGAZZI, 2001). Para estudos de divergncia gentica, a tcnica de anlise multivariada (componentes principais, variveis cannicas e mtodos de aglomerao) tem sido empregada tanto para caractersticas expressas por variveis quantitativas quanto qualitativas, as quais so comumente utilizadas em caracteriza-

Parte da tese apresentada pela primeira autora para obteno do ttulo de Doutor em Produo Vegetal na UENF em 2005 Hortic. bras., v. 23, n. 4, out.-dez. 2005

1000

Aplicao de mtodos de agrupamento na quantificao da divergncia gentica entre acessos de tomateiro

es/avaliaes em bancos de germoplasma. O critrio utilizado para a escolha do mtodo multivariado depende do conjunto de dados, da anlise a ser realizada e qual a preciso requerida (CRUZ; REGAZZI, 2001). A variabilidade gentica existente no gnero Lycopersicon tem possibilitado o desenvolvimento de cultivares que atendem s mais diversas demandas do mercado de tomate para processamento e para consumo in natura (AGRIANUAL, 2002). No entanto, anos de cultivo e seleo por melhoristas tm reduzido os nveis de variao nos germoplamas elite. Esta premissa verdadeira para plantas autgamas, as quais possuem base gentica mais estreita. Por exemplo, um estudo do polimorfismo de diversas variedades de tomate demonstrou que existem menos de 5% de variao gentica disponvel em cruzamentos compatveis com variedades locais e espcies silvestres (MILLER; TANKSLEY, 1990). A maioria das variedades elite so mais semelhantes do que as novas fontes de germoplasmas que esto sendo exploradas (FULTON et al., 1997). Estudos com tomate (Lycopersicum esculentum L.) e pimento (Capsicum annuum L.), utilizando as tcnicas de anlise multivariada para quantificar a divergncia gentica, apresentaram concordncia satisfatria entre as combinaes divergentes e os hbridos superiores (MALUF et al., 1983; MIRANDA et al., 1988). Trabalhando com Capsicum spp., Sudr et al. (2005) demonstraram ser possvel quantificar a divergncia gentica com base em caracteres morfoagronmicos. Estudos da dissimilaridade de 34 acessos de tomateiro, utilizando as caractersticas da fase vegetativa e de produo permitiram, pelo mtodo de Tocher, verificar a consistncia dos grupos formados, gerando 12 classes diferentes. Os dois primeiros componentes principais foram suficientes para explicar cerca de 86% da variao total disponvel entre os acessos. As caractersticas menos importantes foram nmero de folhas definitivas e dimetro do hipoctilo (MARIM et al., 2002). No Brasil, a caracterizao morfolgica de Lycopersicon spp. foi
Hortic. bras., v. 23, n. 4, out.-dez. 2005

realizada pela Embrapa Hortalias por meio de 38 descritores do IPGRI, contemplando caracteres da planta e do fruto. As informaes provenientes da caracterizao foram lanadas em bancos de dados computadorizados (Professional File System), os quais tm permitido a recuperao de qualquer conjunto de informaes de modo simples e eficiente (CARVALHO et al., 1999). Este trabalho teve como objetivos caracterizar 70 acessos que compem o Banco de Germoplasma de Lycopersicon esculentum da Universidade Estadual do Norte Fluminense Darcy Ribeiro, utilizando 27 descritores do IPGRI (International Plant Genetic Resources Institute), e quantificar a divergncia gentica entre os mesmos, por meio de mtodos de agrupamento.

MATERIAL E MTODOS
A pesquisa foi desenvolvida na UENF, localizada a 21 45 de latitude sul, 41 18 de longitude oeste e 11 metros de altitude, no municpio de Campos dos Goytacazes, norte do Estado do Rio de Janeiro, durante o ano de 2001. Os acessos de tomateiro (Lycopersicon esculentum L.) do Banco de Germoplasma da UENF, utilizados neste trabalho, foram cedidos pela Empresa de Pesquisa Agropecuria do Estado do Rio de Janeiro (PESAGRORIO), como parte do Banco Ativo de Germoplama (BAG) de tomateiro mantido pela referida instituio na Estao Experimental de Itagua. A semeadura foi realizada em bandejas de plstico, e, aps a germinao, as plntulas foram transferidas para bandejas de poliestireno com 128 clulas, contendo substrato para a produo de mudas. As plantas no estdio de trs a quatro folhas verdadeiras, foram transplantadas para o campo. Utilizou-se o delineamento experimental em blocos casualizados contendo 70 acessos, trs repeties e 16 plantas por parcela. O plantio foi estabelecido em fileiras duplas, espaadas de 1,2 m entre linhas e 0,50 m entre plantas. Tratos culturais recomendados para a cultura foram realizados de acordo com Filgueira (2000).

Com base na recomendao do IPGRI (1996), os descritores de caracterizao utilizados foram peso total e peso mdio dos frutos; nmero total e nmero mdio de frutos; dimetro e comprimento dos frutos, e nmero de lculos por fruto. O descritor nmero de dias para germinao, apesar de no constar na lista do IPGRI, foi includo na caracterizao. Como descritores de avaliao foram considerados: nmero de dias para o florescimento; nmero de dias para frutificao; nmero de flores por inflorescncia; e teor de slidos solveis (medido em Brix, com auxlio de refratmetro). Realizou-se a anlise de varincia univariada e, para o estudo da divergncia gentica entre os acessos, foram empregadas as Anlises Multivariadas por meio de Mtodos de Agrupamento. Para tanto, foi utilizada a Distncia Generalizada de Mahalanobis como medida de dissimilaridade e, para a obteno dos grupos, utilizou-se o Mtodo Hierrquico do Vizinho Mais Prximo e o Mtodo de Otimizao de Tocher. As anlises foram conduzidas utilizando-se os recursos computacionais do programa GENES (CRUZ, 2001), seguindo-se os modelos descritos por Cruz e Regazzi (2001).

RESULTADOS E DISCUSSO
As anlises de varincias univariadas revelaram diferenas significativas entre as mdias dos acessos em nvel de 1% de probabilidade, pelo teste F, para nmero total de frutos (NTF), peso total de frutos (PTF), nmero mdio de frutos (NMF), peso mdio de frutos (PMF), comprimento do fruto (COM), dimetro do fruto (DIA), nmero de dias para germinao (DGE), nmero de dias para frutificao (DFR), nmero de flores por inflorescncia (NFI), teor de slidos solveis (TSS) e nmero de lculos por fruto (LOC). Nmero de dias para o florescimento (DFL) apresentou diferena significativa em nvel de 5% de probabilidade pelo teste F. Estes resultados indicam, para todas as caractersticas, a presena de variabilidade entre os acessos. A anlise de agrupamento pelo Mtodo Hierrquico do Vizinho Mais Pr1001

M. Karasawa et al.

Figura 1. Dendrograma de dissimilaridades genticas entre 70 gentipos de tomateiro, obtido pelo mtodo Hierrquico do Vizinho mais Prximo, com base em 12 caractersticas quantitativas. Campos dos Goytacazes, UENF, 2001.

ximo, baseada na distncia generalizada de Mahalanobis, subjetiva e pode gerar alguma dificuldade na tomada de deciso quanto ao nmero de grupos gerados, pois no h um critrio definido para determin-los, e qualquer inferncia rgida sobre este nmero pode no ser produtiva. Por outro lado, a fcil interpretao e simplicidade so importantes nas anlises dos dados. Alguns pesquisadores sugerem o estabelecimento de um exame visual de pontos onde ocorram altas mudanas de nveis, possibilitando a delimitao dos grupos (CRUZ, 1990). Realizando-se o corte do dendrograma (Figura 1) considerando 55% de dissimilaridade, detectou-se a formao de dois grupos. No grupo 1, esto os acessos com germinao em 10 dias e, no grupo 2, os acessos com sete dias para germinar. A tcnica de agrupamento minimiza a variabilidade dentro do grupo. Entretanto, se a estimativa de distncia entre pares de indivduos dentro do grupo
1002

de elevada magnitude, justifica-se o subagrupamento (ABREU et al., 2004). Com a finalidade de se obter maiores informaes a respeito dos acessos, distribudos conforme o nmero de dias para germinao, realizaram-se novas anlises de agrupamento dentro de cada grupo, com corte aproximado de 55%, proporcionando a obteno de novos subgrupos (Figuras 2 e 3). Observa-se no dendrograma obtido para o grupo 1 (Figura 2), a formao de sete subgrupos (1.1, 1.2, 1.3, 1.4, 1.5, 1.6 e 1.7). O subgrupo 1.1 registrou o maior nmero de acessos, perfazendo um total de 34 gentipos, os quais produziram frutos de tamanho pequeno a intermedirio, bi e multiloculados, com variao entre 06 e 52 frutos, peso mdio de 11 a 65 g, dimetro de 25 a 56 mm e 61 a 114 dias para frutificao. O subgrupo 1.2 foi representado apenas pelo acesso UENF211, que produziu uma mdia de 08 frutos multiloculados, com tamanho de 31 mm de comprimento e 51 de dimetro, com

peso mdio aproximado de 45 g e dimetro de 51,16 mm. O acesso UENF154 formou o subgrupo 1.3, produzindo uma mdia de 44 frutos triloculados, redondos, de tamanho pequeno, com peso mdio de 24,38 g, 46,52 mm de dimetro e frutificao em 107 dias. Apenas o acesso UENF196 constituiu o subgrupo 1.4, com mdia de 06 frutos de tamanho intermedirio, multiloculados, peso mdio de 75,03 g, dimetro de 57,69 mm e frutificao em 102 dias. O subgrupo 1.5 constituiu-se pelo acesso UENF197, que produziu frutos multiloculados, de tamanho intermedirio, com peso mdio de 89 g, e dimetro de 60,84 mm. O subgrupo 1.6 foi composto pelo acesso UENF157, o qual produziu em mdia 21 frutos biloculados, de tamanho pequeno, apresentando peso mdio de 27,40 g, dimetro de 36,90 mm e 97 dias para frutificao. O acesso UENF165 ficou isolado no subgrupo 1.7, revelando elevada produo mdia de frutos (70 frutos), biloculados, de tamanho pequeno, com baixo peso mdio (9,86 g), dimetro de 29,66 mm e frutificao em 98 dias. No grupo 2 (Figura 3), formaram-se cinco subgrupos (2.1, 2.2, 2.3, 2.4 e 2.5). O subgrupo 2.1 constituiu-se pelo maior nmero de acessos, totalizando 26 gentipos, os quais apresentaram uma ampla faixa na produo mdia de frutos, compreendendo valores entre 13 a 75 frutos bi e multiloculados, de tamanho pequeno, com dimetro variando de 26 a 49 mm e frutificao entre 91 a 107 dias. Dentro do subgrupo 2.2, o acesso UENF161, nico representante, produziu frutos multiloculares, de tamanho intermedirio, com 50,8 mm de dimetro e frutificao em 105 dias. O acesso UENF210, presente no subgrupo 2.3, produziu 107 frutos de tamanho pequeno, multiloculados, com dimetro mdio de 46,61 mm e 103 dias para frutificao. Representado pelo acesso UENF155, o subgrupo 2.4 teve produo de frutos pequenos, triloculados, com dimetro de 25,72 mm e 92 dias para frutificao. No subgrupo 2.5, comHortic. bras., v. 23, n. 4, out.-dez. 2005

Aplicao de mtodos de agrupamento na quantificao da divergncia gentica entre acessos de tomateiro

posto pelo acesso UENF208, registrouse a produo de frutos pequenos, multiloculados, com dimetro chegando a 47 mm e frutificao em 108 dias. Conforme Abreu et al. (2002), acessos alocados nos ltimos grupos, quando comparados com os primeiros grupos, revelam maior divergncia, sendo possvel sua utilizao em programas de cruzamentos entre grupos mais produtivos. A anlise de agrupamentos pelo Mtodo de Otimizao de Tocher possibilitou a formao de onze grupos. O grupo I englobou o maior nmero de gentipos, totalizando 30 acessos, com germinao em 10 dias, produo entre 09 e 52 frutos bi e multiloculados, peso mdio de 11 a 53 g e dimetro de 25 a 55 mm. O grupo II foi representado por 22 acessos, os quais tiveram germinao com sete dias, nmero total de frutos variando entre 13 e 74 frutos, bi, tri e multiloculados, peso mdio de 13 a 41 g e 36 a 49 mm de dimetro. O grupo III foi composto pelos acessos UENF201, UENF202 e UENF160, que germinaram com sete dias, produziram de 44 a 61 frutos com fentipo biloculado, com 10 a 13 g de peso mdio e dimetro de 26 a 33 mm. Os acessos UENF178, UENF180, UENF197 e UENF196, do grupo IV, germinaram com 10 dias, produziram frutos com peso mdio variando entre 37 a 89 g, multiloculados e com 47 a 61 mm de dimetro. O grupo V foi composto pelos acessos UENF161, UENF210 e UENF208, que apresentaram sete dias para germinao, frutos multiloculados, com peso mdio de 25 a 52 g e dimetro variando entre 47,40 e 52,63 mm. O grupo VI constituiu-se pelos acessos UENF211 e UENF224, representando os gentipos que germinaram com 10 dias, de frutos multiloculados e que produziram, respectivamente, 08 e 11 frutos por planta, com peso de 44,88 e 64,62 g e dimetro de 51,16 e 55,98 mm. Os acessos UENF154 e UENF179, que compem o grupo VII, germinaram com 10 dias, produziram 44 e 17 frutos biloculados com peso mdio de 24,38 e 34,17 g e 46,52 e 42,38 mm de dimetro, respectivamente.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 2. Dendrograma de dissimilaridades genticas entre 40 gentipos de tomateiro com 10 dias para germinao, obtido pelo mtodo Hierrquico do Vizinho mais Prximo, com base em 11 caractersticas quantitativas. Campos dos Goytacazes, UENF, 2001.

Figura 3. Dendrograma de dissimilaridades genticas entre 30 gentipos de tomateiro com sete dias para germinao, obtido pelo mtodo Hierrquico do Vizinho mais Prximo, com base em 11 caractersticas quantitativas. Campos dos Goytacazes, UENF, 2001.

O acesso UENF157 nico componente do grupo VIII germinou com 10 dias, produziu em mdia 21 frutos triloculados por planta, com peso mdio de 27,40 g e 36,90 mm de dimetro. O acesso UENF165 apresentou-se no grupo IX, expressando germinao com 10 dias, produo mdia de 70 frutos biloculares, com peso mdio de 9,86 g e dimetro de 26,96 mm. O grupo X, composto pelo acesso UENF215, germinou com oito dias, produziu em mdia 22 frutos por planta, com 39 mm de comprimento, 47 mm de dimetro e quatro lculos. O acesso UENF155, representante do grupo XI, teve germinao com sete

dias, produo mdia de 90 frutos biloculados, com peso mdio de 7,56 g e dimetro de 25,72 mm. Comparando-se a formao dos grupos pelos mtodos Vizinho Mais Prximo (Figura 1) e Tocher (Tabela 1), observa-se que o grupo I do Vizinho Mais Prximo, obtido pelo agrupamento dos acessos que apresentaram 10 dias para germinao, envolve os grupos I, IV, VI, VII, VIII e IX, gerados pelo mtodo de Tocher. Por outro lado, o grupo II, referente aos acessos com germinao obtida em sete dias, envolve os demais grupos obtidos pelo mtodo de Tocher, quais sejam: II, III, V e X. Analisando-se os subgrupos obtidos pelo mtodo do Vizinho Mais Prximo,
1003

M. Karasawa et al.

Tabela 1. Grupos estabelecidos pelo Mtodo de Otimizao de Tocher, com base em 12 caractersticas quantitativas avaliadas em 70 gentipos de tomateiro. Campos dos Goytacazes, UENF, 2001.
Grupos Acessos UENF104, UENF168, UENF188, UENF221, UENF174, UENF182, UENF222, UENF159, UENF166, UENF206, UENF175, UENF216, UENF156, UENF140, UENF187, UENF217, UENF209, UENF218, UENF200, UENF225, UENF163, UENF223, UENF181, UENF191, UENF170, UENF184, UENF213, UENF190, UENF210b, UENF198 UENF172, UENF219, UENF158, UENF204, UENF176, UENF205, UENF199, UENF214, UENF203, UENF193, UENF164, UENF167, UENF171, UENF186, UENF212, UENF162, UENF185, UENF195, UENF194, UENF169, UENF173, UENF177 UENF201, UENF202, UENF160 UENF178, UENF180, UENF197, UENF196 UENF161,UENF210, UENF208 UENF211, UENF224 UENF154, UENF179 UENF157 UENF165 UENF215 UENF155

Janeiro (PESAGRO-RIO) pela cesso das sementes dos acessos utilizados neste trabalho e FAPERJ pela concesso da bolsa para a primeira autora do trabalho.

LITERATURA CITADA
ABREU, F.B.; MARIM, B.G.; MANDELLI, M.S.; GUIMARES, M.A.; BELFORT, G.; SILVA, D.J.H. Divergncia gentica entre acessos de tomateiro do Banco de Germoplasma de Hortalias da UFV, baseada em descritores de fruto. Horticultura Brasileira, Braslia, v.20, n.2, jul.2002. Suplemento 2. CD-ROM. Trabalho apresentado no 42 Congresso Brasileiro de Olericultura, 2002. ABREU, F.B. LEAL, N.R.; RODRIGUES, R.; AMARAL JR., A.T; SILVA, D.J.H. Divergncia gentica entre acessos de feijo-de-vagem de crescimento indeterminado. Horticultura Brasileira, Braslia, v.22, n.3, p.547552, 2004. AGRIANUAL 2002: Anurio da Agricultura Brasileira. So Paulo: FNP Consultoria & Comrcio, 2002. AMARAL JNIOR, A.T.; THIBAUT, J.T.L. Anlise multivariada na avaliao da diversidade em recursos genticos vegetais. Campos dos Goytacazes - Universidade Estadual do Norte Fluminense - UENF, CCTA, 55 p., 1999. CARVALHO, S.I.C.; PESSOA, H.B.S.V.; GIORDANO, L.B. Multiplicao, caracterizao e conservao da coleo de germoplasma de tomate (Lycopersicon spp.) da EMBRAPA HORTALIAS. In: Simpsio de Recursos Genticos para Amrica Latina e Caribe, 3., 1999, Londrina. Anais..., Londrina: Sirgealc. 1999. COIMBRA, R.R., MIRANDA, G.V., MOREIRA, G.R., SILVA, D.J.H., CRUZ, C.D., CARNEIRO, P.C.S., SOUZA, L.V., GUIMARES, L.J.M., MARCASSO, R.C., CANIATO, F.F. Divergncia gentica de cultivares de milho baseada em descritores qualitativos. In: Simpsio de Recursos Genticos para Amrica Latina e Caribe, 3., 2001, Londrina. Anais..., Londrina: Sirgealc. 2001. p. 401-402. CRUZ, C.D.; REGAZZI, A.J. Modelos biomtricos aplicados ao melhoramento Gentico. Viosa: UFV, 390 p., 2001. CRUZ, C.D. Aplicao de algumas tcnicas multivariadas no melhoramento de plantas. 1990. 188 f. (Tese de Doutorado em Gentica e Melhoramento de Plantas) - Escola Superior de Agricultura Luiz de Queiroz, Universidade de So Paulo, Piracicaba. CRUZ, C.D. Programa Genes; verso windows; aplicativo computacional em gentica e estatstica. Viosa: UFV, 2001. 648 p. FILGUEIRA, F.A.R. Novo Manual de Olericultura: Agrotecnologia moderna na reproduo e comercializao de hortalias. Viosa: UFV, 2000; 402 p. FULTON, T.M.; NELSON, J.C.; TANSKLEY, S.D. Introgression and DNA marker analysis of Lycopersicon peruvianum, a wild relative of the cultivated tomato, into Lycopersicon esculentum, followed through three successive backcross generations. Theoretical Applied Genetic, v.95, n.5-6, p.895-902, 1997. Hortic. bras., v. 23, n. 4, out.-dez. 2005

II III IV V VI VII VIII IX X XI

formados de acordo com 10 ou sete dias para germinao, e o mtodo de Tocher, observa-se elevada semelhana na formao de grupos. Visualiza-se, pela Figura 2 e Tabela 1, que o subgrupo 1.1 compreende os grupos I e VI de Tocher, envolvendo tambm os acessos UENF178 e UENF180 do grupo IV. Os subgrupos 1.2 e 1.4 correspondem, respectivamente, aos acessos UENF197 e UENF196 (Figura 2), remanescentes do grupo IV (Tabela 1). J os acessos UENF154 e UENF157 do grupo VII de Tocher (Tabela 1) foram configurados nos subgrupos 1.3 e 1.5, respectivamente. Completando os resultados envolvendo acessos com 10 dias para germinao, verificou-se que os subgrupos 1.6 e 1.7, do Vizinho Mais Prximo (Figura 2), compreendem os respectivos grupos VIII e IX, presentes no mtodo de Tocher (Tabela 1). Com relao ao subgrupo envolvendo acessos que apresentaram sete dias para germinao (Figura 3), registrouse elevada similaridade em relao aos dados obtidos por Tocher (Tabela 1), sendo que o subgrupo 2.1 envolveu os grupos II e III, enquanto o grupo X foi representado pelo subgrupo 2.4. Os acessos UENF161, UENF210 e UENF208, presentes no grupo V (Tabela 1), apresentaram-se isolados nos
1004

resultados expressos pela anlise do Vizinho Mais Prximo, conferindo a formao dos respectivos subgrupos 2.2, 2.3 e 2.5 (Figura 2). Os dados obtidos revelaram elevada concordncia na formao de grupos entre os acessos estudados, tanto pelo mtodo de Tocher quanto pelo Vizinho Mais Prximo. Concordncia entre mtodos de agrupamento foi verificada para pimentas e pimentes (SUDR et al., 2005), e feijo de vagem (ABREU et al., 2004). O mtodo do Vizinho Mais Prximo possibilitou a formao de grupos, de acordo com o nmero de dias para germinao. Considerando-se que a anlise multivariada possibilita a predio da heterose, alguns cruzamentos podem ser sugeridos, seguindo-se o princpio de se cruzar os acessos mais distantes e com melhores caractersticas agronmicas (SUDR et al., 2005). Com base nos resultados obtidos neste trabalho, recomendam-se os cruzamentos entre os acessos UENF155 x UENF175 e UENF 155 x UENF222.

AGRADECIMENTOS
Os autores agradecem a Dra. Maria Luza de Arajo da Empresa de Pesquisa Agropecuria do Estado do Rio de

Aplicao de mtodos de agrupamento na quantificao da divergncia gentica entre acessos de tomateiro IPGRI. Decriptors for Tomato (Lycopersicon spp.) Roma: Italy, 1996. 44 p. MALUF, W.R.; FERREIRA, P.E. Anlise multivariada da divergncia gentica em feijode-vagem (Phaseolus vulgaris L.). Horticultura Brasileira, Braslia, v.1, n.2, p.31-34. 1983. MARIM, B.G.; ABREU, F.B.; SILVA, D.J.H.; SAMPAIO JNIOR, J.D.; GUIMARES, M.A.; LUCA, C.A.C. Dissimilaridade entre acessos de tomateiro do Banco de Germoplasma de Hortalias da UFV, utilizando caractersticas da fase vegetativa e de produo. Horticultura Brasileira, Braslia, v.20, n.2, jul. 2002. Suplemento 2. CD-ROM. Trabalho apresentado no 42 Congresso Brasileiro de Olericultura, 2002. MILLER, J.; TANKSLEY, S. RFLP analysis of phylogenetic relationships and genetic variation in the genus Lycopersicon. Theoretical Applied Genetics, v.80, p.437-448, 1990. MIRANDA, J.E.C., COSTA, C.P., CRUZ, C.D. Correlaes genotpica, fenotpica e de ambiente entre caracteres de fruto e planta de pimento. Revista Brasileira de Gentica, Ribeiro Preto, v.11, n.2, p.457-458, 1988. SUDR, C.P.; RODRIGUES, R.; RIVA, E.M.; KARASAWA, M.; AMARAL JNIOR, A.T. Divergncia gentica entre acessos de pimenta e pimento utilizando tcnicas multivariadas. Horticultura Brasileira, Braslia, v.23, n.1, p.2227, 2005.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

1005

pgina do horticultor
HABER, L.L.; LUZ, J.M.Q.; ARVATI DRO, L.F.; SANTOS, J.E. Diferentes concentraes de soluo nutritiva para o cultivo de Mentha Piperita e Melissa Officinalis. Horticultura Brasileira, Braslia, v.23, n.4, p.1006-1009, out-dez 2005.

Diferentes concentraes de soluo nutritiva para o cultivo de Mentha piperita e Melissa officinalis
Lenita L. Haber1; Jos Magno Q. Luz1; Luiz Fernando Arvati Dro1; Jos Eduardo Santos2
UFU, ICA, C. Postal 593, 38400-902 Uberlndia-MG; E-mail: jmagno@ufu.com.br; lenitahaber@yahoo.com.br; nandoadoro@yahoo.com.br; 2ILES, ULBRA, Itumbiara-GO
1

RESUMO
Avaliou-se o desenvolvimento das espcies de plantas medicinais, aromticas e condimentares Mentha piperita (hortel-pimenta) e Melissa officinalis (melissa) em diversas concentraes de soluo nutritiva em sistema hidropnico NFT. Os experimentos foram implementados em ambiente protegido sendo as espcies semeadas em espuma fenlica com dimenses de 2,5x2,5x3 cm, com 3 sementes por cubo, irrigadas diariamente com gua at a germinao e, posteriormente com soluo nutritiva diluda em 50%. Aps 15 dias para a melissa e 16 dias para a hortel-pimenta, as mudas foram transferidas para as bancadas de desenvolvimento onde receberam soluo nutritiva diluda em 75% por 12 dias, sendo as mudas posteriormente transplantadas para as bancadas de cultivo onde foram submetidas s concentraes da soluo nutritiva at o momento da colheita. O delineamento experimental utilizado foi inteiramente casualizado, em esquema de parcelas subdivididas. As concentraes da soluo nutritiva (I 50%, II 75%, III 100%, IV 125%) foram sorteadas nas parcelas e nas subparcelas avaliando-se o efeito da posio das plantas nos perfis hidropnicos (I - inicial, II - intermediria e III - final), totalizando 12 tratamentos, para cada espcie. Cada posio continha 5 conjuntos de plantas sendo utilizadas 3 repeties por tratamento. Foram avaliados a altura das plantas, nmero de folhas e brotos, peso fresco e seco, tanto da parte area quanto de raiz. Com relao posio das plantas nos perfis, foi observada interao significativa entre os tratamentos para nmero de folhas e peso seco para menta e melissa, respectivamente, onde a posio inicial revelou ser o melhor tratamento. Ainda para melissa foi observada diferena significativa entre as posies para altura das plantas, peso fresco de raiz e peso fresco e seco de folhas, com a posio inicial tendo os maiores valores, apesar de no diferir significativamente da posio mediana. Palavras-chave: Mentha piperita, Melissa officinalis, nutrio de plantas, hidroponia.

ABSTRACT
Mentha piperita (peppermint) and Melissa officinalis (balm) development in different concentrations of nutritive solution The development of two medicinal, aromatic and condimentar species, Mentha piperita (peppermint) and Melissa officinalis (balm) was evaluated in different concentrations of nutritive solution in a NFT hidroponic system of cultivation. Three seeds of these two species were sowed on a fenolical spume (2,5x2,5x3 cm), and irrigated daily with water up to the germination and later with a nutrient solution diluted to 50%. After a period of 15 and 16 days for balm and peppermint, respectively, seedlings were transferred to the development workbenches made with polypropylene channels and received the nutrient solution diluted to 75% during 12 days. After this period, plants were transferred to cultivation on workbenches with different concentrations of nutritive solution until the harvest. The experimental design was conducted completely randomized on split-splot scheme, the concentration of nutrient solution being (I - 50%, II - 75%, III 100%, IV - 125%) located on the plot and the position of plants in the channels (I - initial, II - intermediary, III - final) on the subplot with a total of three replications per treatment. A total of five plants was used in each position. The evaluated variables were plant height, number of leaves and buds, fresh and dry weight of leaves and roots. Analyzing the position of plants in the channels it was possible to observe significant interaction between treatments and in the number and leaves dry weight of balm and peppermint, respectively, the initial position being the best treatment in terms of plant growth. For balm were observed significant differences between the positions of plants in the channels in relation to plant height, root fresh weight and leaves fresh and dry weight, with the initial position having the higher values, despite of having no significant differences when compared with the intermediary position. Keywords: Mentha piperita, Melissa officinalis, plants nutrion, hidropony.

(Recebido para publicao em 14 de fevereiro de 2005 e aceito em 3 de agosto de 2005) cultivo hidropnico de plantas no Brasil tem crescido nos ltimos anos. No entanto, esta tcnica ainda pouco conhecida por parte dos agricultores tradicionais, dificultando a adoo deste sistema de produo. Entretanto, sabe-se que a tcnica de cultivo hidropnico bastante promissora (JESUS FILHO, 2000) e dever se expandir nos prximos anos.
1006

Os produtores de cultivos hidropnicos vm buscando novas alternativas para uso em hidroponia, sendo as hortalias folhosas e as espcies condimentares, aromticas e medicinais boa opo, principalmente em funo da demanda do mercado consumidor por produtos livres de agrotxicos. O cultivo hidropnico sob cultivo protegido reduz muito o uso de agrotxico oferecendo um produto de melhor qualidade para o

pblico consumidor. A crescente exigncia dos principais mercados por produtos de boa qualidade e de origem certificada, produzidos sem agresses ao ambiente, vm oferecendo vantagens adicionais para o uso de hidroponia, principalmente quando se cultivam plantas de interesse farmacutico. Segundo Maranca (1986) o gnero Mentha, comumente conhecido como
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Diferentes concentraes de soluo nutritiva para o cultivo de Mentha piperita e Melissa officinalis

hortels, compreende espcies com ao medicinal, sendo conhecidas, principalmente, pelo sabor caracterstico e aroma refrescante. Mentha piperita Linn., conhecida popularmente por hortel-pimenta uma erva vivaz ou perene, com caule ramificado, contendo folhas opostas pecioladas ovais e com margem serrilhada, apresentando cor verde mais escura na face superior da folha e mais plida na inferior. Matos (1998) cita essa espcie como produtora de leo essencial rico em mentol, mentona e mentofurano, sendo estes compostos mais abundantes nas folhas. O leo tem propriedades antiespasmdica, antiinflamatria, antilcera e antiviral, sendo de grande importncia econmica na indstria farmacutica. Alm do uso farmacutico, que exige matria prima de boa qualidade (SCHILCHER, 1988), o mentol destaca-se como matria prima importante na indstria de tabaco e de produtos destinados higiene bucal e confeito. Plantas cultivadas em soluo nutritiva podero apresentar rendimento de leo essencial at cinco vezes superior aos encontrados em plantas conduzidas em cultivos convencionais. O teor de mentol encontrado nas plantas oriundas do cultivo hidropnico superior ao encontrado em plantas cultivadas em solo, evidenciando que a maior ou menor disponibilidade de determinados nutrientes pode alterar rotas bioqumicas especficas, que, por sua vez, iro produzir componentes do leo essencial em propores diferentes, resultando em leos com qualidades distintas (MAIA, 1998). Mairapetyan (1984 apud MAIA, 1998) mostrou que possvel a produo de at cinco vezes mais leo essencial em cultivos com soluo nutritiva do que na mesma rea de solo, obtendo-se leo com at 60% de mentol, enquanto as plantas cultivadas em solo produziram leo com apenas 49% de mentol. Conhecida popularmente por melissa e/ou erva-cidreira verdadeira, Melissa officinalis L., uma planta herbcea anual, de caule ramificado a partir da base, formando touceiras de 40 a 60 cm de dimetro. As folhas grandes (5 a 8 cm) so pecioladas, de forma oval, serrilhadas nas pontas, com nervura saHortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 1. Posio das plantas no perfil hidropnico. Uberlndia, UFU, 2002.

liente e reticuladas na face inferior (CORRA JUNIOR et al., 1991). De acordo com Tekel et al. (1997), as folhas secas de melissa so utilizadas para ch e condimento. O leo essencial das folhas largamente utilizado pela indstria farmacutica, por possuir atividade antioxidativa, antibitica, antifngica, antibacteriana e sedativa. Objetivou-se com o presente trabalho avaliar o desenvolvimento da hortelpimenta e da melissa em diferentes concentraes da soluo nutritiva proposta por Furlani et al. (1999).

MATERIAL E MTODOS
Os experimentos foram instalados na Universidade Federal de Uberlndia, de 21/08/20 a 01/11/2002, em um tnel de vegetao de 5,5x21x3,5 m, com cobertura superior de filme plstico agrcola com espessura de 150 micras. Lateralmente o tnel era fechado com tela de sombreamento de 50%. O delineamento utilizado para cada experimento foi o inteiramente casualizado em esquema em parcelas subdivididas. Avaliou-se nas parcelas o efeito das concentraes da soluo nutritiva (I - 50%; II - 75%; III - 100%; IV - 125%) utilizadas durante a fase de crescimento e nas sub-parcelas o efeito da posio da planta no perfil hidropnico (I - inicial; II - intermediria e III final). A posio inicial do

canal correspondia a parte mais prxima da entrada da soluo nutritiva (Figura 1). Foram utilizadas trs repeties e cinco plantas em cada posio com um total de 12 parcelas e 36 sub-parcelas. Utilizou-se a soluo nutritiva (g/ 1000 L de soluo), proposta por Furlani et al. (1999): nitrato de clcio, 750; nitrato de potssio, 500; fosfato monoamnio (MAP), 150; sulfato de magnsio, 400; sulfato de cobre, 0,15; sulfato de zinco, 0,50; sulfato de mangans, 1,50; cido brico, 1,50; molibdato de sdio, 0,15 e tenso-Fe (FeEDDHMA-6% Fe.), 30. As duas espcies foram semeadas em placas de espuma fenlica e irrigadas com a soluo nutritiva diluda em 50%. Aos 26 dias aps a semeadura, as mudas foram transferidas para a bancada de desenvolvimento sendo utilizada, nesta fase, soluo nutritiva diluda em 75%. As mudas permaneceram na bancada de desenvolvimento por um perodo de 12 dias, quando foram transferidas para as bancadas de crescimento, e submetidas irrigao com as quatro concentraes de soluo nutritiva. O ponto de colheita das plantas foi determinado em funo do tamanho comercial. Neste estdio foram avaliadas as caractersticas de altura de plantas, nmero de folhas, nmero de brotos, massa fresca e seca da parte area e raiz. Os resultados obtidos foram submetidos anlise estatstica de varincia e poste1007

L. L. Haber et al.

Figura 2. Crescimento das plantas de Mentha piperita nas diferentes concentraes da soluo nutritiva proposta por Furlani et al. (1999). Uberlndia, UFU, 2002.

Tabela 1. Mdias das caractersticas avaliadas para a M. officinalis, submetidas a diferentes concentraes da soluo nutritiva proposta por Furlani et al. (1999). Uberlndia, UFU, 2002.
Altura (cm) Inicial Intermediria Final Mdia CV (%) 31,66 a 31,43 a 27,64 b 30,24 8,138 PFR (g) 81,12 a 76,58 a 59,73 b 72,48 16,292 PFPA (g) 84,73 a 71,87 ab 62,50 b 73,03 16,900 PSPA (g) 3,66 a 3,36 ab 2,81 b 3,28 16,395

PFR Peso fresco da raiz; PFPA Peso fresco da parte area; PSPA Peso seco da parte area; *Mdias seguidas por letras distintas, na coluna, diferem entre si pelo teste de Tukey a 5% de probabilidade.

Tabela 2. Interao entre concentrao da soluo nutritiva e posio das plantas nos canais, para peso seco da raiz de plantas de melissa. Uberlndia, UFU, 2002.
Posio Inicial Intermediria Final Mdia (g) Concentrao (%) 50 12,69 a 10,56 ab 7,67 b 10,30 75 14,78 a 8,63 b 13,91 a 27,32 100 13,11 a 11,96 ab 8,50 b 11,19 125 11,76 a 9,97 a 8,83 a 10,19

*Mdias seguidas por letras distintas, na coluna, diferem entre si pelo teste de Tukey (Pd 0,05).

riormente anlise de regresso para as concentraes da soluo nutritiva e teste de Tukey para as posies nos canais, com auxlio do programa SANEST (ZONTA; MACHADO, 1984).

RESULTADOS E DISCUSSO
Hortel-pimenta Foram observadas diferenas estatisticamente significativas entre as concentraes da soluo nutritiva no que se refere altura das plantas (Figura 2), com aumento significativo da altura
1008

quando utilizaram-se concentraes de 75 e 100% (mximo em 85,61%), decrescendo a partir deste ponto. A concentrao de 125% resultou em menor altura. Para alfavaca e cebolinha, nas mesmas concentraes da soluo nutritiva utilizada neste trabalho, Santos et al. (2002a; 2002b) observaram que as concentraes de 50 e 125% proporcionaram a menor altura de plantas e a menor produo de matria fresca de folhas, respectivamente, com concentraes extremas interferindo de maneira negativa.

Resultados semelhantes a estes foram observados tambm na cultura da alface, onde constatou-se que o peso fresco da alface foi menor nos extremos de condutividade eltrica (PEREIRA, 2002). Estes resultados evidenciam que concentraes extremas (maior e menor concentrao) influenciam negativamente o desenvolvimento, possivelmente pela variao da presso osmtica da soluo, que influencia na absoro de nutrientes. Somente para nmero de folhas foi observada interao significativa entre a posio das plantas nos canais de cultivo e as concentraes da soluo, com diferena significativa apenas na concentrao de 50%, com a posio mediana apresentando plantas com menor nmero mdio de folhas. Estes resultados ocorreram, provavelmente devido a um sombreamento ocasionado pelas plantas de Melissa officinalis, afetando as plantas de hortel-pimenta. Para as demais caractersticas (peso fresco e seco de raiz, peso fresco e seco de folhas, e nmero de brotos) no foi observada diferena estatstica significativa entre os tratamentos. Melissa Para as caractersticas altura de plantas, peso fresco e seco da parte area e da raiz, houve influncia da posio no canal de cultivo. Em nenhuma das caractersticas avaliadas ocorreu influncia das concentraes da soluo nutritiva, entretanto houve interao dessa com a posio da planta no canal de cultivo para peso seco da raiz. Analisando as caractersticas altura de plantas, peso fresco de raiz e peso fresco e seco da parte area, observouse diferena significativa entre as posies das plantas nos canais de cultivo (Tabela 1), com melhor desempenho das plantas cultivadas na posio inicial, as quais diferiram significativamente das plantas cultivadas na posio final. Esses resultados refletem uma melhor absoro de nutrientes da soluo nutritiva, pelas plantas localizadas no incio dos canais. Quanto interao entre as concentraes da soluo nutritiva e a posio das plantas nos canais de cultivo para a matria seca da raiz (Tabela 2), foram observadas nas concentraes de 50 e
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Diferentes concentraes de soluo nutritiva para o cultivo de Mentha piperita e Melissa officinalis

100%, diferenas significativas entre as posies inicial e final, com maior produo de matria seca na posio inicial, sendo que na concentrao de 75% a posio intermediria apresentou a menor produo de matria seca, diferindo significativamente das demais. Na concentrao 125% no houve diferena entre as posies, provavelmente pelo fato desse tratamento possuir maior concentrao de nutrientes, reduzindo a competio entre plantas ao longo dos canais. Estes resultados podem ser explicados de maneira semelhante aos observados para as caractersticas altura de plantas, peso fresco e seco da parte area, e peso fresco de raiz. No foi observada diferena estatisticamente significativa entre as diferentes concentraes para a varivel desenvolvimento das plantas. Schmidt et al. (2001), avaliando o desempenho de diferentes concentraes de solues nutritivas para o cultivo da alface, verificaram que no ocorreram diferenas significativas entre as concentraes de 50 e 100% das solues de Castellane e Arajo (1995) e Furlani (1995) no cultivo da alface. No cultivo da alfavaca, realizado nas mesmas condies deste trabalho, Santos et al. (2002b) observaram diferena entre as concentraes da soluo nutritiva, sendo que a melhor concentrao para altura de plantas foi de 100%. Maior nmero de folhas foi obtido na concentrao de 75%, sendo que o maior peso seco de folhas foi observado na concentrao de 125%, concluindo que as plantas tiveram um bom

desenvolvimento em todas as concentraes. Baseando-se nos resultados encontrados conclui-se que o cultivo de Melissa officinalis em sistema hidropnico - NFT pode ser feito com a soluo de Furlani et al. (1999), na concentrao de 100% com ponto de colheita antecipado em relao ao campo, porm com a altura da planta reduzida a 30 cm. O cultivo de Mentha piperita pode ser feito com a soluo de Furlani et al. (1999), na concentrao reduzida a 85%, com reduo do ciclo da cultura em 20 dias, quando comparado s condies de campo. Concentraes extremas, como 50 e 125% da referida soluo interferem negativamente no crescimento de plantas de Mentha piperita, no sendo recomendadas para o seu cultivo.

LITERATURA CITADA
CORRA JUNIOR, C.; MING, L.C.; SCHEFFER, M.C. Cultivo de plantas medicinais, condimentares e aromticas. Curitiba: EMATERPARANA, 1991. 151 p. FURLANI, P.R.; SILVEIRA, L.C.P.; BOLONHEZI, D.; FAQUIM, V. Cultivo hidropnico de plantas. Campinas: Instituto Agronmico, 1999. 52 p. (Boletim tcnico 180). JESUS FILHO, J.D. Hidroponia de plantas aromticas, condimentares e medicinais. So Paulo: Vdeo Par, 2000. 27 p. (Manual tcnico). MAIA, N.B. Produo e qualidade do leo essencial de duas espcies de menta cultivadas em solues nutritivas. 1998. 105 f. Tese (Doutorado) - Escola Superior de Agricultura Luis de Queiroz, Universidade Estadual de So Paulo, Piracicaba.

MARANCA, G. Plantas aromticas na alimentao. So Paulo: Nobel, 1986. MATOS, F.J.A. Farmcias vivas: sistema de utilizao de plantas medicinais projetado para pequenas comunidades. 3ed. Fortaleza: EUFC, 1998. 2201 p. PEREIRA, C. Incidncia de queima de bordos em alface cultivada em sistema hidropnico - NFT. 2002. 88 f. Dissertao (Mestrado) - Faculdade de Agronomia e Medicina Veterinria, Universidade de Braslia, Braslia. SANTOS, J.E.; LUZ, J.M.Q.; HABER, L.L.; FURLANI, P.R.; BATISTA, A.M.; MARTINS, S.T. Diferentes concentraes de soluo nutritiva para a cultura da cebolinha (Allium fistulosum) em sistema de cultivo hidropnico. Horticultura Brasileira, Braslia, v.20, n.2, Suplemento 1, p. 300, Julho, 2002a. SANTOS, J.E.; LUZ, J.M.Q.; HABER, L.L.; FURLANI, P.R.; BATISTA, A.M.; MARTINS, S.T.; SILVA, A.P.P. Diferentes concentraes de soluo nutritiva para a cultura de alfavaca ( Ocimum basilicum ) em sistema de cultivo hidropnico. Horticultura Brasileira, Braslia, v.20, n.2, Suplemento 1, p.358, Julho, 2002b. SCHMIDT, D.; SANTOS, O.S.; BONNECARRRE, R.A.G., MARIANI, O.A. MANFRON, P.A. Desempenho de solues nutritivas e cultivares de alface em hidroponia. Horticultura Brasileira, Braslia, v.19, n.2, p.122126, Julho, 2001. SCHILCHER, H. Quality requirements and quality standards for medicinal, aromatic and spices plants. In: International Symposium on heavy metals and pesticides residues in medicinal, aromatic and spice plants, Novi Sad, 1985. Acta Horticulturae, v.249, p.33-44, 1989. TEKEL, J.; HOLL, M.; VAVERKOV, S.; SVAJDLENKA, E. Determination of uracil herbicide residues and componentes of essential oil in Melissa officinalis L. In its main development phases. Journal of Essential Oil Research, v.9, p.63-66, 1997. ZONTA, E.P.; MACHADO, A.A. SANEST Sistema de anlise estatstica para microcomputadores. Instituto Agronmico de Campinas SEI n 066060, 1984.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

1009

RESENDE, G.M.; COSTA, N.D. Produtividade e armazenamento de cebola, cv. Alfa Tropical, cultivada em diferentes espaamentos. Horticultura Brasileira, Braslia, v.23, n.4, p.1010-1014, out-dez 2005.

Produtividade e armazenamento de cebola cv. Alfa Tropical cultivada em diferentes espaamentos


Geraldo M. de Resende; Nivaldo Duarte Costa
Embrapa Semi-rido, C. Postal 23, 56300-970 Petrolina-PE; E-mail: gmilanez@cpatsa.embrapa.br

RESUMO
Com o objetivo de avaliar o efeito de diferentes espaamentos entrelinhas e entre plantas sobre as caractersticas produtivas e o armazenamento de bulbos de cebola, conduziu-se um experimento de setembro de 1999 a maro de 2000, em Petrolina. O delineamento experimental utilizado foi de blocos ao acaso, no esquema fatorial 2x3, compreendendo dois espaamentos entrelinhas (0,10 e 0,15 m) e trs espaamentos entre plantas (0,10, 0,20 e 0,30 m), sendo utilizada a cultivar Alfa Tropical com quatro repeties. Foram encontradas redues lineares na produtividade comercial com o aumento do espaamento entre plantas, tendo o espaamento com 0,10 m propiciado os maiores rendimentos. Uma reduo gradativa na produo de bulbos no comerciais foi verificada medida que se aumentou o espaamento entrelinhas e plantas. A massa fresca dos bulbos aumentou linearmente medida que se aumentaram os espaamentos entrelinhas e entre plantas. Foi verificada maior porcentagem de bulbos pequenos e mdios nos menores espaamentos. medida que se incrementou o espaamento entre plantas ocorreu maior perda de massa fresca dos bulbos de cebola at 60 dias de armazenamento. Pelos resultados obtidos em funo das diferentes caractersticas avaliadas, recomenda-se os espaamentos de 0,10 ou 0,15 m entrelinhas e 0,10 m entre plantas como os mais adequados para o cultivo da cebola cultivar Alfa Tropical, nas condies do Vale do So Francisco, para plantio no segundo semestre do ano. Palavras-chave: Allium cepa, rendimento, densidade de plantio, perda de massa fresca de bulbos.

ABSTRACT
Yield and storage of onion, cv. Alfa Tropical, under different planting spacings The effect of different plant spacing was evaluated on yield and storage characteristics of onion bulbs. The experiment was carried out from September 1999 to March 2000, in Pernambuco State, Brazil, in a randomized complete block design, in a 2 x 3 factorial scheme, with four replications. The cultivar Alfa Tropical was planted at 0.10 and 0.15 m row spacing and at 0.10; 0.15 and 0.30 m plant spacing. A linear reduction was found for commercial yield when plant spacing increased, the highest yield being obtained with 0.10 m spacing. A linear reduction in noncommercial bulbs was found as the spacing between rows and between plants was increased. Bulbs fresh weight increased linearly as the spacing between rows and between plants increased. Larger percentage of small and medium bulbs was obtained in the narrowest spacing. As spacing between plants increased, a larger lose of onion bulb weight was found up to 60 days of storage. According to the results, the spacing 0.10 x 0.10 m or 0,15 x 0.10 m are recommended as the more adapted for the cultivation of onion cultivar Alfa Tropical, in the So Francisco Valley conditions, for the summer season planting.

Keywords: Allium cepa, yield, fresh mass of bulb, planting density, bulb mass fresh loss.

(Recebido para publicao em 11 de maro de 2005 e aceito em 3 de agosto de 2005)

produo mundial de cebola (Allium cepa L.), em 2004, foi de 53,59 milhes de t, cultivadas em uma rea 3,07 milhes de ha, o que proporcionou uma produtividade mdia de 17,46 t ha-1 (FAO, 2005). No Brasil, a cebola ocupa o terceiro lugar em importncia econmica entre as hortalias (SOUZA; RESENDE, 2002). A produtividade mdia foi de 17,88 t ha-1 em 2004, sendo que nos estados de PE e BA, maiores produtores do Nordeste, a produtividade mdia foi de 21,16 e 24,25 t ha-1, respectivamente (IBGE, 2005). A cebola planta de dias longos quanto formao de bulbos, e as cultivares designadas de dias curtos no so, particularmente, plantas de dias curtos; simplesmente exigem menos horas de luz para bulbificarem (MELO; RIBEI1010

RO, 1990). A formao de bulbos est relacionada com a interao entre a temperatura e o fotoperodo. Nesta interao o fator mais importante o fotoperodo e o mesmo determina os limites de adaptao de cultivares (GALMARINI, 1997). Em plantas conduzidas sob condies ideais, a bulbificao acelerada com alta densidade de plantas (RABINOWITCH; BREWSTER, 1990). Estudando os espaamentos de 10 x 15 cm e 20 x 15 cm, Viegas DAbreu (1996), verificou que a maior produtividade foi obtida no menor espaamento (10 x 15 cm), e que a maior massa fresca do bulbo (145,7 g bulbo-1) foi verificada no maior espaamento comparado aos 118 g bulbo-1 obtido com 10 x 15 cm.

A produtividade comercial aumentou e a massa fresca do bulbo diminuiu quando o nmero de linhas por canteiro passou de duas para quatro e o espaamento entre plantas reduziu de 21,9 para 7,6 cm. A maior porcentagem de bulbos pequenos e mdios foi verificada nos menores espaamentos (STOFFELLA, 1996). Kanton et al. (2002) observaram aumento na produtividade com o incremento da densidade de plantio (37,04 para 156,25 plantas/m2), assim como menor altura de planta e massa fresca do bulbo, relatando que densidades acima de 76,92 plantas por metro quadrado como as que proporcionam maiores produtividades de bulbos comerciais. Lopes et al. (2004), avaliando a influncia da densidade de plantas sobre a produtividade
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produtividade e armazenamento de cebola, cv. Alfa Tropical, cultivada em diferentes espaamentos

em trs espaamentos (0,20; 0,30 e 0,40 m x 0,08 m), constataram que no menor espaamento (0,20 x 0,08 m) foi obtida a maior produtividade comercial e menor dimetro do bulbo. O incremento na densidade de plantio proporcionando aumento na produtividade total e reduo do tamanho do bulbo tambm relatado por outros autores (BREWSTER; SALTER, 1980; HARTRIDGE-ESH; BENNET, 1980; MCGEARY, 1985). Por outro lado, Sabota e Downes (1981) no observaram diferenas significativas na produtividade quando compararam duas populaes de plantas (192.940 e 257.320 plantas ha-1), na cultivar Texas Grano. Da mesma forma, avaliando duas densidades de plantio (7,5 cm entre plantas e 12,5 e 15,0 cm entrelinhas), Aujla e Madan (1992) no encontraram diferenas na produtividade e na altura da planta. Entretanto, o maior espaamento aumentou o nmero de folhas e o dimetro transversal do bulbo. A regio Nordeste, representada pelos estados de Pernambuco e Bahia, privilegiada pelas suas condies climticas, pratica a semeadura de janeiro a dezembro, com maior concentrao de plantio nos meses de janeiro a maro, possibilitando escalonamento de plantio e produo com oferta em diferentes perodos. No entanto, comparativamente ao primeiro semestre ocorrem menores produtividades no segundo semestre. Todavia, com o lanamento da cultivar Alfa Tropical recomendada para plantio de vero e no segundo semestre na regio, sob condies de temperatura elevada e fotoperodo crescente (COSTA et al., 2002), vislumbra-se uma nova era para a cebolicultura no Nordeste, pela possibilidade de maior produo na entressafra, e possivelmente viabilizando a substituio da importao do produto (MENDONA, 2001). Procurando fornecer maiores informaes tcnicas sobre o cultivo da cebola Alfa Tropical no segundo semestre do ano, no presente trabalho avaliou-se o efeito de diferentes espaamentos sobre as caractersticas produtivas e de armazenamento dos bulbos, nas condies do Vale do So Francisco.

MATERIAL E MTODOS
O experimento foi conduzido de setembro de 1999 a maro de 2000, na Embrapa Semi-rido em Petrolina, a 9o
Hortic. bras., v. 23, n. 4, out.-dez. 2005

24' de latitude Sul e 40o 29' de longitude Oeste, e 365,5 m de altitude. O solo classificado como Latossolo Vermelho Amarelo Distrfico apresentou pH (H2O) = 6,1; Ca = 2,1 cmolc/dm3; Mg = 0,7 cmolc/dm3; Na = 0,01 cmolc dm-3; K = 0,28 cmolc dm-3; Al = 0,05 cmolc dm-3, P(Mehlich) = 7,2 mg dm-3 e M.O. = 6,9 g kg-1. O delineamento experimental utilizado foi de blocos ao acaso, em esquema fatorial 2x3, compreendendo dois espaamentos entrelinhas (0,10 e 0,15 m) e trs espaamentos entre plantas (0,10; 0,20 e 0,30 m) com quatro repeties. A unidade experimental constituiu-se de um canteiro de 3,0 m de comprimento por 1,2 m de largura, sendo utilizada como rea til 1,8 m2 (3,0 x 0,6 m). A adubao de plantio foi realizada com 600 kg ha-1 da frmula NPK 6-24-12, baseada no resultado da anlise do solo. Foram aplicados em cobertura 200 kg ha-1 de uria e 50 kg ha-1 de cloreto de potssio, parcelados aos 15 e 30 dias aps o transplante. Foi utilizada a cultivar Alfa Tropical, desenvolvida pela Embrapa Hortalias, recomendada para plantio de vero, sendo a semeadura feita em 24/09/ 1999 e o transplante efetuado 30 dias aps. O preparo do solo constou de arao, gradagem e levantamento dos canteiros a 0,20 m de altura. A cultura foi mantida no limpo atravs de capinas manuais. A irrigao por microasperso foi realizada trs vezes por semana, com lminas em torno de 10 mm, baseada na evaporao do tanque classe A, e suspensas 20 dias antes da colheita. Os demais tratos fitossanitrios foram realizados de acordo com as recomendaes para a cultura da cebola. A colheita foi realizada em 100 dias aps a semeadura quando 70% das plantas estavam estaladas, com sinais avanados de senescncia, como amarelecimento e seca das folhas. A cura foi realizada ao sol por trs dias e 12 dias sombra em galpo ventilado. Foram avaliadas a produtividade comercial de bulbos (bulbos perfeitos e com dimetro transversal >35 mm) e refugos (bulbos com dimetro <35 mm) expressos em t ha-1, aos 15 dias aps a cura. A massa fresca de bulbo (g bulbo-1)

foi determinada dividindo-se o peso de bulbos comerciais aps a cura pelo nmero de bulbos. Aps o perodo de cura, os bulbos foram armazenados temperatura ambiente e realizadas pesagens aos 20; 40 e 60 dias (temperatura e umidade relativa mdias no perodo de 27,2C e 74%, respectivamente), sendo os valores comparados queles obtidos ao final da cura (15 dias aps colheita). Os valores foram transformados em porcentagem de perda de massa fresca. A classificao de bulbos comerciais segundo o dimetro transversal (mm) foi feita de acordo com Brasil (1995) em classe 2 (>35 at 50 mm de dimetro); classe 3 (>50 at 70 mm); classe 4 (>70 ate 90 mm) e classe 5 (>90 mm);, sendo os resultados expressos em porcentagem. Segundo a metodologia descrita por Pimentel Gomes (2000), os dados coletados foram submetidos anlise de varincia e as mdias comparadas pelo teste de Tukey, ao nvel de 5% de probabilidade, e regresso polinomial. Os dados de porcentagem foram transformados em arco-seno P / 100 para efeitos de anlise, sendo apresentados nos resultados as mdias originais.

RESULTADOS E DISCUSSO
Efeitos significativos para espaamentos entrelinhas e entre plantas, assim como para a interao foram obtidos para produtividade comercial. Verificou-se redues lineares na produtividade dos espaamentos entre linhas com o aumento do espaamento entre plantas (Figura 1). Desdobrandose a interao em funo do espaamento entre linhas observou-se maior produtividade mdia (47,05 t ha-1) do espaamento 0,10 m entrelinhas comparativamente ao espaamento de 0,15 m (41,11 t ha-1) nos diferentes espaamentos entre plantas. A populao de plantas ideal a ser empregada aquela suficiente para atingir o ndice de rea foliar timo a fim de interceptar o mximo de radiao solar til fotossntese e ao mesmo tempo maximizar a frao da matria seca alocada s partes vegetativas e produtivas (HAO; PAPADOPOULOS, 1999), diminuindo as presses de competio
1011

G. M. Resende e N. D. Costa

Figura 1. Produtividade comercial de bulbos de cebola, cv. Alfa Tropical, nos espaamentos 0,10 e 0,15 m entrelinhas em funo dos espaamentos entre plantas. Petrolina, Embrapa Semi-rido, 1999/2000.

Figura 2. Refugos (produtividade no comercial) de bulbos de cebola, cv. Alfa Tropical, nos espaamentos 0,10 e 0,15 m entrelinhas em funo dos espaamentos entre plantas. Petrolina-PE, Embrapa Semi-rido, 1999/2000.

interplantas. Os resultados obtidos confirmam as observaes de que as cebolas respondem especialmente variao no espaamento entre plantas (FILGUEIRA, 1982; MELO et al., 1988). A produtividade da cebola tambm aumentou medida que se diminuiu distncia entrelinhas, fato tambm relatado por diversos autores em diferentes pocas (MANGUAL-CRESPO et al., 1979; LOPES, 1987; STOFFELLA, 1996; BOFF et al., 1998). Resultados similares foram obtidos no que se refere produo de refugo (bulbos no comerciais), ou seja, verificou-se uma reduo linear gradativa na produo de bulbos no comerciais medida que se aumentou o
1012

espaamento entre plantas (Figura 2). Desdobrando-se a interao em funo do espaamento entre linhas observouse que o espaamento de 0,10 m entrelinhas apresentou maior produo mdia de refugos (2,52 t ha-1) comparativamente ao espaamento de 0,15 m (1,40 t ha-1). Estes resultados mostram relao inversa entre o aumento ou reduo do espaamento entrelinhas e entre plantas na produtividade de bulbos de cebola. Em baixas populaes se produz, geralmente, baixos rendimentos e alta porcentagem de bulbos mdios e grandes. Em cultivos com densidades maiores que a tima, apesar de maior produtividade tem-se bulbos pequenos e desuniformes de menor qualidade comercial (refugos),

comparativamente ao cultivo em densidade adequada. Notou-se para massa fresca do bulbo efeito significativo da interao dos fatores. Foi verificado que a massa fresca do bulbo aumentou linearmente medida que se aumentaram os espaamentos entre plantas. Este incremento foi da ordem de 34,9% e 55,91%, respectivamente, para os espaamentos de 0,10 e 0,15 m entrelinhas (Figura 3). No que se refere aos espaamentos entrelinhas constatou-se bulbos com maiores mdias de massa fresca no espaamento de 0,15 m (102,57 g bulbo-1) comparativamente ao espaamento de 0,10 m (85,88 g bulbo-1), dentro dos espaamentos entre plantas. Salienta-se que a maior massa fresca do bulbo foi obtida tanto com o aumento do espaamento entre plantas quanto com o espaamento entrelinhas, o que, est relacionado maior rea de explorao das razes e menor competio interplantas por gua, luz e nutrientes. O incremento da densidade, reduzindo o dimetro e a massa fresca do bulbo relatada por Lopes (1987) e Lopes et al. (2004). A diminuio da massa fresca do bulbo com o incremento da densidade de plantio foi tambm observada por outros autores (GALMARINI; GASPERA, 1995; STOFFELLA, 1996; LIPINSKI et al., 2002; KANTON et al., 2002). Segundo Souza e Resende (2002), o mercado consumidor nacional prefere bulbos de tamanho mdio com pesos de 80 a 100 gramas e dimetro transversal de 40 a 80 mm, que se enquadram perfeitamente dentro das faixas de tamanho de bulbo obtidas no presente estudo. A classificao de bulbos de cebola foi influenciada pela interao entre os fatores (Tabela 1). No que se refere classificao de bulbos classe 2, constatou-se para os espaamentos de 0,10 e 0,15 m entrelinhas redues lineares deste tipo de bulbo com o aumento do espaamento entre plantas, que so menores comparativamente s demais classes. Com relao ao desdobramento da interao no sentido do espaamento entrelinhas verificou-se que o espaamento de 0,10 apresentou maior nmero de bulbos mdios nesta classe dentro dos diferentes espaamentos
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Produtividade e armazenamento de cebola, cv. Alfa Tropical, cultivada em diferentes espaamentos

(33,45%) quando comparado ao espaamento de 0,15 m (23,12%). Resultados inversos foram verificados para a classe 3 (bulbos de tamanho intermedirio), pois, ocorreram aumentos lineares com o incremento do espaamentos entre plantas. Desdobrando-se a interao, no se observou para os maiores espaamentos entre plantas (0,20 e 0,30 m) diferenas significativas dentro dos espaamentos de 0,10 e 0,15 m entrelinhas; fato este que s foi verificado quando da utilizao do menor espaamento entre plantas (0,10 m), que proporcionou maior percentagem de bulbos desta classe no espaamento de 0,10 m entre linhas (54,43%) comparativamente a 0,15 m entrelinhas (49,20%). Para a classe 4, composta de bulbos de maior tamanho, registrou-se efeitos semelhantes (Tabela 1) aos anteriores ocorrendo aumentos lineares com o incremento do espaamentos entre plantas. No entanto, desdobrando-se em funo dos espaamentos entrelinhas as maiores percentagens mdias de bulbos desta classe foram obtidas no espaamento de 0,15 m entrelinhas (24,14%) comparado ao espaamento de 0,10 m (10,82%). Estes resultados demonstram o efeito da densidade de plantio como fator determinante na produo de cebola ao mesmo tempo que corroboram com os obtidos por Viegas DAbreu (1996), que obteve maior tamanho de bulbo no maior espaamento, assim como os obtidos por Stoffella (1996) que verificou maior porcentagem de bulbos pequenos e mdios nos menores espaamentos, e Rumpel e Felczynski (2000) que encontraram reduo na produo de bulbos maiores com o incremento da densidade de plantio. As presses exercidas pela populao de plantas afetam de modo marcante o desenvolvimento da cebola. Os resultados obtidos no presente trabalho evidenciaram uma relao inversa entre a densidade de plantio e o tamanho do bulbo. De forma geral, altas densidades produzem maior nmero bulbos por rea, mas com menor massa fresca e consequentemente menor produtividade comercial; fato este atribudo principalmente s presses de competio interplantas. Quando a densidade de
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 3. Massa fresca do bulbo de cebola, cv. Alfa Tropical, nos espaamentos 0,10 e 0,15 m entrelinhas em funo dos espaamentos entre plantas. Petrolina-PE, Embrapa Semirido, 1999/2000.

Tabela 1. Equaes de regresso para classificao de bulbos de cebola, cv. Alfa Tropical, em classes (%), segundo o dimetro transversal nos espaamentos 0,10 e 0,15 m entrelinhas em funo dos espaamentos 0,10; 020 e 0,30 m entre plantas. Petrolina-PE, Embrapa Semirido, 1999/2000.
Classes classe 2 classe 3 classe 4 Equaes de regresso Y (0,10 m) = 49,9067 - 72,8530* * X Y (0,15 m) = 59,9518 - 156,0420* * X Y (0,10 m) = 41,2463 + 31,4903* * X Y (0,15 m) = 32,0498 + 62,4829* * X Y (0,10 m) = 5,8051 + 67,0393* * X Y (0,15 m) = 11,4103 + 90,1114* * X R = 0,95 R = 0,95 R = 0,90 R = 0,85 R = 0,94 R = 0,93

** Significativo ao nvel de 1% de probabilidade pelo teste de F.; 1classe 2: >35 at 50 mm de dimetro; classe 3: >50 at 70 mm e classe 4: >70 ate 90 mm.

plantas aumenta por unidade de rea, atinge-se um ponto no qual as plantas competem por fatores essenciais de crescimento, como nutrientes, luz e gua. A perda de peso aos 20; 40 e 60 dias aps cura (DAC) apresentou efeitos significativos apenas para o espaamento entre plantas, no se constatando efeito significativo para o espaamento entrelinhas e nem para a interao dos fatores. Para perda de peso aos 20 (Y = 7,5386 + 12,8168**X; R2 = 0,99), 40 (Y =17,7093 + 10,8710**X; R2 = 0,92) e 60 (Y = 16,0176+ 32,4786**X; R2 = 0,99) dias aps cura, verificou-se aumentos lineares evidenciando maiores perdas de peso com o incremento dos espaamentos. Pelos coeficientes angulares das equaes de regresso, estimase esta perda de massa em 1,28, 1,09 e 3,25% para cada aumento do espaamento entre plantas (0,10 m) para

20, 40 e 60 DAC. Inferiu-se por estes resultados, que a maior perda ocorreu em espaamentos maiores, que determinaram maior tamanho de bulbos, com conseqente maior teor de gua nos bulbos. Calbo et al. (1980) observaram perdas de 30% a 100% em bulbos de cebola Baia Periforme armazenadas at 70 dias, a granel e rstias em diferentes recipientes, assim como Resende et al. (2004) informam para a cultivar Texas Grano 502 PPR que o espaamento de 0,30 x 0,15 m foi o que promoveu maior percentagem de perda de peso de bulbos (43,16%), sob as condies do Vale do So Francisco, armazenadas at 60 dias aps a cura. Pelos resultados obtidos em funo das diferentes caractersticas avaliadas, recomenda-se os espaamentos de 0,10 x 0,15 m entrelinhas e 0,10 m entre plantas como os mais adequados para o cul1013

G. M. Resende e N. D. Costa

tivo da cebola cultivar Alfa Tropical, nas condies do Vale do So Francisco, para plantio no segundo semestre do ano.

LITERATURA CITADA
AUJLA, T.S.; MADAN, P.S. Response of onion (Allium cepa) to irrigation, nitrogen fertilizer and row spacing on deep sandy-loam in subtropical monsoon region. Indian Journal of Agricultural Science, v.62, n.2, p.129-134, 1992. BOFF, P., HENRI, S.; GONALVES, P.A.S. Influncia da densidade de plantas na ocorrncia de doenas foliares e produo de bulbos de cebola. Fitopatologia Brasileira, Braslia, v.23, n.4, p.448452, 1998. BRASIL. Ministrio da Agricultura, Abastecimento e Reforma Agrria. Portaria n.529 de 18 ago. 1995. Dirio Oficial da Repblica Federativa do Brasil, Braslia, 1 set.1995, Seo1, p.13513. BREWSTER, J.L., SALTER, P.J. The effect of plant spacing on the yield and bolting of two cultivars of overwintered bulb onions. Journal of Horticultural Science, v.55, n.2, p.97-102, 1980. CALBO, A.G.; CORDEIRO, C.M.T.; GUALBERTO, A.G. Efeito do acondicionamento sobre o comportamento fisiolgico e conservao de duas cultivares de cebola (Allium cepa) no Vale do So Francisco. Revista de Olericultura, Braslia, v.18, p.86-99, 1980. COSTA, N.D.; LEITE, D.L.; SANTOS, C.A.F.; CANDEIA, J.A.; VIDIGAL, S.M. Cultivares de cebola. Informe Agropecurio, Belo Horizonte, v.23, n.218, p.20-27, 2002. FAO. Agricultural production, primary crops. Disponvel em <http://www.fao.org>. Acesso em: 26 jan. 2005. FILGUEIRA, F.A.R. Manual de Olericultura: cultura e comercializao de hortalias. 2. ed., So Paulo: Agronmica Ceres, 1982. v.2, 357 p. HAO, X.; PAPADOPOULOS, A.P. Effects of supplemental lighting and cover materials on growth, photosynthesis, biomass partitioning, early yield and quality of greenhouse cucumber. Scientia Horticulturae, v.80, n.1-2, p.1-18, 1999.

GALMARINI, C.R. Caracteristicas botanicas y fisiologicas. In: Manual del cultivo de la cebolla. GALMARINI, C.R. (ed.). San Juan: INTA, 1997. 128 p. GALMARINI, C.R.; GASPERA, P.G. Efecto de la epoca de transplante y la densidad de plantacion en el cultivo de cebolla tipo Valenciana. Horticultura Argentina, v.14, n.37. p.23-29, 1995. HARTRIDGE-ESH, K.A.; BENNET, J.P. Effects of seed weight plant density and spacing on yield response of onion. Journal of Horticultural Science, v.55, n.3, p.247-252, 1980. INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATSTICA - IBGE. Produo Agrcola Municipal . Disponvel em <http:// www.sidra.ibge.gov.br>. Acesso em: 26 jan. 2005. KANTON, R.A.L; ABBEY, L.; HILLA, R.G.; TABIL, M.A.; JAN, N.D. Density affects plant development and yield of bulb onion (Allium cepa L.) in Northern Ghana. Journal Vegetable Crop Production, v.8, n.2, p.5-25, 2002. LIPINSKI, V.M., GAVIOLA, S.; GAVIOLA, J.C. Efecto de la densidad de plantacin sobre el rendimiento de cebolla cv. Cobriza Inta con riego por goteo. Agricultura Tcnica, v.62,n.4, p.574582, 2002. LOPES, J.F. Effects of planting dates and spacing on several characteristics of short day onion varieties grown in South Texas. 1987. 111 f. (Tese doutorado) - Texas University, Texas. LOPES, M.C.; CZEPAK, M.P.; SIRTOLI, L.F. Avaliao de diferentes espaamentos na produtividade de trs cultivares de cebola. Horticultura Brasileira, Braslia, v.22, n.2, julho 2004, Suplemento 2. CD-ROM. Trabalho apresentado no 44 Congresso Brasileiro de Olericultura, 2004. MANGUAL-CRESPO, G.; RAMIREZ, C.T.; ORENGO, E. Effect of plant spacing and fertilizer levels on yield and dry bulb weight of onion cv. Texas Grano 502. Journal of Agriculture of the University of Puerto Rico, v.63, n.4, p.417-422, 1979. MCGEARY, D.F. The effect of plant density on shape, size, uniformity, soluble solids content and yield of onions suitable for pickling. Journal Horticultural Science, v.60, n.1, p.83-87, 1985.

MELO, P.C.T.; RIBEIRO, A. Produo de sementes de cebola: cultivares de polinizao aberta e hbridos. ln: CASTELLANE; P.D.; NICOLOSI, W.M.; HASEGAWA, M. Produo de sementes de hortalias. Jaboticabal: FCAV/FUNEP, 1990. p.l5-59. MELO, P.C.T.; RIBEIRO, A.; CHURATA-MASCA, M.G.C. Sistemas de produo, cultivares de cebola e seu desenvolvimento para as condies brasileiras. In: SEMINRIO NACIONAL DE CEBOLA, 3, 1988, Piedade-SP. Anais... Jaboticabal: FUNEP, 1988. p.27-61. MENDONA, J.L. Cultivar de cebola de vero. Disponvel em: <http//www.snagricultura.org.br>. Acesso em: 29 ago. 2001. PIMENTEL GOMES, F. Curso de estatstica experimental. 14.ed. So Paulo: Nobel, 2000. 477 p. RABINOWITCH, H.D.; BREWSTER, J.L. Onions and Allied Crops. Boca Raton: CRC Press, 1990. 273 p. RESENDE, G.M.; COSTA, N.D.; ALVARENGA, M.A.R. Caractersticas produtivas e conservao ps-colheita da cebola (Allium Cepa L.) cv. Texas Grano PRR em diferentes espaamentos de plantio. Horticultura Brasileira, Braslia, v.22, n.2, julho 2004, Suplemento 2. CD-ROM. Trabalho apresentado no 44 Congresso Brasileiro de Olericultura, 2004. RUMPEL, J.; FELCZYNSKI, K. Effect of plant density on yield and bulb size of direct sown onions. Acta Horticulturae , n.533, p.179-186, 2000. SABOTA, C.M.; DOWNES, J.D. Onion growth and yield in relation to transplant, pruning, size, spacing and depth of planting. Hortscience, v.16, n.4, p.533-535, 1981. SOUZA, R.J., RESENDE, G.M. Cultura da cebola. Lavras: UFLA, 2002. 115 p. (Textos Acadmicos - Olericultura, 21). STOFFELLA, P.J. Planting arrangement and density of transplants influence sweet Spanish onion yields and bulb size. Hortscience, v.31, n.7, p.1129-1130, 1996. VIEGAS DABREU, D.A. Effect of nitrogen and spacing on bulb splitting in onion cv. Bombay Red. TVIS Newsletter, v.1, n.2, p.26, 1996.

1014

Hortic. bras., v. 23, n. 4, out.-dez. 2005

EKLUND, C.R.B.; CAETANO, L.C.S.; SHIMOYA, A.; FERREIRA, J.M.; GOMES, J.M.R. Desempenho de gentipos de tomateiro sob cultivo protegido. Horticultura Brasileira, Braslia, v.23, n.4, p.1015-1017, out-dez 2005.

Desempenho de gentipos de tomateiro sob cultivo protegido


Ctia Regina B. Eklund1; Luiz Carlos S. Caetano2; Aldo Shimoya1; Jos Mrcio Ferreira2; Jakeline M.R. Gomes2
1

Bolsista FAPERJ/Pesagro-Rio; 2Pesagro-Rio/EEC, C. Postal 114331, 28080-000 Campos dos Goytacazes-RJ; E-mail: eklunderb@yahoo.com.br

RESUMO
Com o objetivo de avaliar o desempenho dos gentipos de tomate cultivados sob cultivo protegido nas condies do Norte Fluminense, foi conduzido um experimento na Estao Experimental de Campos, Pesagro-Rio, de maio a setembro de 2001. O delineamento experimental utilizado foi de blocos casualizados com sete tratamentos (cinco cultivares hbridas: Bonus, Cronos, Erika, Pegasus, Vitara e duas cultivares de polinizao aberta: Santa Clara e Santa Cruz), com quatro repeties. Vitara se destacou por apresentar frutos com maior nmero de lculos (5,25), comprimento (53,67 mm), dimetro (69,79 mm) e peso mdio (147,35 g).

ABSTRACT
Performance of tomato genotypes grown under protected cultivation The performance of seven tomato genotypes was evaluated under protected cultivation in an experiment conducted in the North Fluminense region, Rio de Janeiro State, Brazil, from May to September 2001. The experimental design was a randomized complete block with seven treatments (five hybrids: Bonus, Cronos, Erika, Pegasus, Vitara and two cultivars: Santa Clara and Santa Cruz), with four replications. Vitara hybrid produced fruits with highest number of locules (5,25), length (53,67), diameter (69,75 mm) and average weight (147,35 g). Keywords: Lycopersicon esculentum, yield, fruit quality, greenhouse.

Palavras-chave: Lycopersicon esculentum, produtividade, qualidade de fruto, estufa.

(Recebido para publicao em 8 de setembro de 2004 e aceito em 3 de agosto de 2005) produo do tomate, bem como de outras hortalias, no apresenta abastecimento regular ao longo do ano devido diminuio na oferta do produto durante os perodos em que as condies climticas so menos favorveis, principalmente alta temperatura e umidade (AMBRSIO; NAGAI, 1991; MARTINS, 1991). Quando o tomateiro exposto a temperaturas extremas, ocorrem baixa produtividade e qualidade dos frutos (MINAMI; HAAG, 1989; GOTO, 1995; REGHIN, 1996). A umidade do solo outro fator limitante para sua produo, pois a umidade relativa do ar depende em parte da evaporao da gua do solo, a qual associada presena de gua livre nos rgos areos da planta, provoca o aparecimento de doenas, cujo controle fica muito mais difcil de ser alcanado (GOTO, 1995). Uma das alternativas para se superar as limitaes de origem ambiental a produo sob cultivo protegido, produzindo frutos de melhor qualidade. O cultivo protegido permite total ou parcial controle da velocidade do vento, umidade relativa, temperatura ambiente, proteo contra chuvas pesadas (MARTINS, 2000); reduz o uso de agrotxicos, alm de fortalecer os conceitos de qualidade total,
Hortic. bras., v. 23, n. 4, out.-dez. 2005

competitividade por melhores produtos no mercado, oferta programada e produtos diferenciados (FONTES,1999). O tomateiro apresenta pleno desenvolvimento nesta modalidade de cultivo, com incrementos de produo que variam de 17 a 77% ou at 5 a 8 vezes superior queles obtidos em campo aberto (MARTINS et al., 1992). Quando se associa gentipos com alto potencial produtivo e manejo de condies ambientais favorveis obtmse elevados ndices de produtividade, proporcionando aumentos de produo de 25 a 40% devido maturao precoce, melhor uniformidade, maior vigor inicial e desenvolvimento, melhor qualidade de frutos, resistncia a doenas e capacidade de adaptao mais ampla (MELLO et al., 1988). O objetivo do experimento foi avaliar o desempenho de sete gentipos de tomate, conduzidos sob cultivo protegido na regio de Campos dos Goytacazes, norte do Estado do Rio de Janeiro.

MATERIAL E MTODOS
O trabalho constituiu-se de um experimento conduzido em ambiente protegido (casa-de-vegetao) na Estao

Experimental da Pesagro-Rio, em Campos dos Goytacazes, RJ entre maio e setembro de 2001, em solo classificado como Cambissolo. O delineamento experimental utilizado foi de blocos casualizados com quatro repeties e sete tratamentos representados por cinco hbridos de tomate (Lycopersicum esculentum L.), Bonus, Cronos, Erika, Pegasus, Vitara e duas cultivares Santa Clara e Santa Cruz. Os gentipos apresentam crescimento indeterminado, com excees do Vitara e Pegasus e fruto tipo caqui, com excees dos hbridos Cronos e rika, que so do tipo salada. A semeadura foi feita em 20/04/2001 em bandejas de isopor com 128 clulas, empregando-se como substrato o Plantmax e transplantadas em 14/05/ 2001, no espaamento de 0,8 m entre fileiras e 0,5 m entre plantas, sendo cada parcela experimental composta por uma linha de 6,0 m de comprimento totalizando 12 plantas, sendo oito plantas centrais utilizadas como teis. O solo onde foi conduzido o experimento apresentou as seguintes caractersticas qumicas e fsicas: pH(gua) = 6,3; S-SO4 = 105 mg/dm3; P = 231 mg/dm3; K = 13,0 mmolc/dm3; Ca = 63,1 mmolc/ dm3; Mg = 41,1 mmol c/dm 3; Al = 0 mmolc/dm3; H+Al = 15,3 mmolc/dm3;
1015

C. R. B. Eklund et al.

Tabela 1. Mdias das caractersticas nmero de lculos (NDL), espessura da polpa (EDP), comprimento dos frutos (CFR), dimetro do frutos (DFR), relao comprimento/dimetro de fruto (RCD), produo total de frutos (PTF), nmero total de frutos por ha (NTF), nmero de frutos comerciais por ha (NFC), peso mdio de frutos comerciais (PFC) e produo de frutos comerciais (PCO) obtidas de dados de sete gentipos de tomate. Campos dos Goytacazes, PESAGRO, 2001.
Gentipo Bonus Cronos Erika Pegasus Sta Clara Sta Cruz Vitara C.V. (%)

NDL 2,25c 4,00ab 3,25bc 3,25bc 2,25c 2,50c 5,25a 19,5

EDP (mm) CFR (mm) DFR (mm) 0,625a 0,575a 0,625a 0,650a 0,675a 0,625a 0,600a 10,7 51,43ab 44,44c 48,69bc 45,77c 50,63ab 54,42 a 53,67a 3,9 51,04f 57,69cd 63,45b 59,06c 54,9de 53,23ef 69,79a 2,7

RCD 1,01a 0,77c 0,76c 0,77c 0,92b 1,02a 0,76c 2,0

PTF (t/ha) 56,98a 45,79a 58,12a 68,58a 54,63a 54,88a 65,55a 18,7

NTF 843750,a 543750,c 559375,bc 775781,ab 709375,abc 772656,ab 497656,c 14,5

NFC 574219,a 371094,bc 339844,bc 487500,ab 420313,ab 439844,ab 247656,c 17,9

PFC (g) 74,57c 86,83c 111,32 b 92,53 bc 87,46 c 84,48 c 147,35 a 10,4

PCO (t/ha) 42,81 a 32,24 a 38,14 a 45,16 a 36,63 a 35,77 a 36,81 a 20,4

Mdias seguidas pela mesma letra na mesma coluna no diferem entre si, pelo teste de Tukey a 5% de probabilidade.

Na = 1,5 mmolc/dm3; C = 32,9 g/dm3; MO = 56,7 g/dm3; CTC = 134,0 mmolc/ dm3; SB = 118,7 mmolc/dm3; V = 89 %; Saturao Al = 0%; Saturao de Na = 1%; Fe = 270,0 mg/dm3; Cu = 2,8 mg/ dm3; Zn = 19,4 mg/dm3; Mn = 49,0 mg/ dm3; B = 0,54 mg/dm3; Areia = 56%; Argila = 16%; e Silte = 28%. A adubao de plantio foi realizada com 15 t/ha de esterco de curral curtido, 200 kg/ha de K2O, 500 kg/ha de P2O5. Em cobertura aplicaram-se 679 kg/ha de uria, parcelada em cinco vezes, de 20 em 20 dias a partir de 28/05/2001, via gua de irrigao por gotejamento. O tutoramento foi feito com fitilho amarrado no colo das plantas, enrolado ao redor das mesmas e a outra extremidade da fita amarrada ao arame disposto na horizontal a 1,80 m de altura. As plantas foram conduzidas com uma haste principal, eliminando-se todas as brotaes laterais. Estas sofreram poda apical aps a emisso do oitavo cacho. Os parmetros de produo avaliados a partir da primeira colheita, que se iniciou dois meses aps o transplantio, foram: comprimento do fruto (mm), dimetro do fruto (mm), relao comprimento/dimetro do fruto, produo total de frutos (t/ha), nmero total de frutos por hectare, nmero de frutos comerciais por hectare, peso mdio de frutos (g), produo de frutos comerciais (t/ ha), espessura da polpa (mm) e nmero de lculos. Para espessura e nmero de lculos foram amostradas ao acaso, cinco frutos por parcela, onde estes foram seccionados na parte mediana para avaliaes. Para comprimento (C), dimetro (D) e relao comprimento/dime1016

tro do fruto (C/D), retirou-se ao acaso 10 frutos por parcela, medindo-se com um paqumetro o comprimento e o dimetro destes frutos (mm). Pela relao comprimento/dimetro avaliou-se o formato dos frutos produzidos: C/D<1; C/ D=1 e C/D>1 correspondendo, respectivamente, s formas achatada, redonda e oblonga (ARAJO,1997). Os dados coletados foram submetidos analise de varincia e as mdias comparadas pelo teste de Tukey a 5% de probabilidade.

RESULTADOS E DISCUSSO
Na Tabela 1 so apresentadas as 10 caractersticas do tomate avaliadas no presente trabalho. Com exceo da espessura da polpa, produo total de frutos e produo de frutos comerciais, os gentipos de tomate apresentaram diferenas significativas para as outras caractersticas estudadas. Para a relao comprimento/dimetro do fruto (RCD), apenas os gentipos Bonus e Santa Cruz apresentaram mdias superiores a 1, indicando formato oblongo. Para os demais gentipos, os frutos foram de formato achatado (C/D<1). O hbrido Vitara se destacou por apresentar os maiores valores para as mdias das seguintes caractersticas: nmero de lculos (NDL), comprimento do fruto (CFR), dimetro do fruto (DFR) e peso mdio de frutos comerciais (PFC), contudo, foi o gentipo que apresentou o menor nmero total de frutos produzidos (NTF) e nmero de frutos comerciais (NFC) com cerca de 50% de frutos no comerciais. Embora os gentipos no tenham apresentado diferenas significativas para produtividade total de frutos e produtivi-

dade de frutos comerciais, deve-se destacar os gentipos Pegasus e Bonus por apresentarem mdias superiores a 56,9 t/ ha (produtividade total de frutos) e 42,8 t/ ha (produtividade de frutos comerciais). O gentipo Bonus apresentou a menor mdia de peso mdio de frutos comerciais, podendo este resultado ser atribudo ao alto nmero de frutos produzidos. Em complemento, o mesmo hbrido apresentou elevada produo de frutos comerciais e, conseqentemente, menor nmero de frutos no comerciais. J o gentipo Pegasus, em relao ao Bonus, apresentou uma capacidade inferior de produzir unidades de frutos totais e comerciais, entretanto, esta foi compensada pela alta produo total de frutos (PTF). Comparando-se os resultados de produtividade com os nveis de produtividade (90 a 150 t/ha) de frutos utilizando as novas cultivares hbridas de crescimento indeterminado, em cultura tutorada e acima de 150 t/ha em estufa, relatadas por Filgueira (2000), deduz-se que as produtividades dos gentipos no presente trabalho foram baixas. Isso se atribui deficincia de irrigao causada por problemas mecnicos, que impediu a manifestao do potencial produtivo, principalmente dos hbridos. Os resultados so, entretanto, um importante indicativo para o cultivo protegido do tomateiro na regio onde foi conduzido o experimento

LITERATURA CITADA
AMBRSIO, L.A.; NAGAI, H. Sazonalizao dos preos das classes de tomate, no atacado, em So Paulo, nos perodos de 1983/1986 e 1987/1990. In CONGRESSO BRASILEIRO DE OLERICULTURA, 31, 1991, Belo Horizonte. Anais... SOB. Horticultura Brasileira, v.9, n.1, p.30, 1991.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

Desempenho de gentipos de tomateiro sob cultivo protegido ARAJO, M.L. Interaes intra-loco e inter-locos alcobaa, crinson e high pigment sobre caractersticas de qualidade e de produo de frutos do tomateiro. 1997. 131 f. (Tese doutorado) - UFLA, Lavras FILGUEIRA, F.A.R. Novo Manual de Olericultura: agrotecnologia moderna na produo e comercializao de hortalias. Viosa: UFV, 2000. 402 p. FONTES, P.C.R. Produo de hortalias em ambiente protegido: uma tcnica a ser aprendida. Informe Agropecurio, Belo Horizonte, v.20, n.200/ 201, p.1-2, 1999. GOTO, R. Manejo nutricional no cultivo de hortalias em estufas. In: ENCONTRO DE HORTALIAS, 9; ENCONTRO DE PLASTICULTURA DA REGIO SUL, 6, 1994, Maring. Palestras e trabalhos. Maring: Universidade Estadual de Maring, 1995. p.11-18. MARTINS, G. Produo de tomate em ambiente protegido. In: ENCONTRO NACIONAL DE PRODUO E ABASTECIMENTO DE TOMATE, 2, 1991, Jaboticabal. Anais... Jaboticabal: UNESP, FUNEP, 1991. p.219-30. MARTINS, G.; CASTELLANE, P.D.; VOLPE, C.A.; BANZATTO, C.A. Uso da casa de vegetao com cobertura plstica na tomaticultura de vero. Desenvolvimento e produo. Horticultura Brasileira, Braslia, v.10, n.1, p.60, 1992. MARTINS, G. Cultivo em ambiente protegido O desafio da plasticultura. In: Novo Manual de Olericultura: agrotecnologia moderna na produo e comercializao de hortalias. Viosa: UFV, 2000. p.135-148. MELLO, P.C.T.; MIRANDA, J.E.C. COSTA, C.P. Possibilidades e limitaes do uso de hbridos F1 de tomate. Horticultura Brasileira, Braslia, v.6, n.2, p.5-6, 1988. MINAMI, R.; HAAG, H.P. O tomateiro. 2. Ed. Campinas: Fundao Cargill, 1989. 397 p. REGHIN, M.Y. Fisiologia do desenvolvimento das hortalias em ambiente protegido. Botucatu: UNESP.FCA, 1996. 14 p. (Mimeografado).

Hortic. bras., v. 23, n. 4, out.-dez. 2005

1017

FERREIRA, M.D.; FRANCO, A.T.O.; TAVARES, M. Tcnicas de colheita para tomate de mesa. Horticultura Brasileira, Braslia, v.23, n.4, p.1018-1021, out-dez 2005.

Tcnicas de colheita para tomate de mesa1


Marcos David Ferreira2; Andr T.O. Franco3; Marcelo Tavares4
UNICAMP, Fac. Eng. Agrcola, C. Postal 6011, 13083-875 Campinas-SP; E-mail: marcos.ferreira@agr.unicamp.br; 3/UNICAMP, Fac. Eng. Alimentos, C. Postal 6121, 13081-970 Campinas-SP; 4/UFU, Fac. Matemtica, Bairro Sta. Mnica, 38408-100 Uberlndia-MG
2/

RESUMO
Comparou-se a qualidade de frutos provenientes de colheita utilizando cestas de bambu e sacolas de lona plstica em campos de produo na regio de Mogi-Guau, SP. Utilizou-se como testemunha frutos no submetidos ao manuseio. O delineamento utilizado foi inteiramente casualizado em esquema fatorial (sistemas de colheita x dias aps a colheita) com trs repeties. Foram observados o tempo de colheita, incidncia de danos fsicos (%) originados no campo e/ou no processo de colheita, perda de masa (%) durante o armazenamento, e a qualidade visual aps armazenamento por 21 dias a temperatura ambiente (23oC). O tempo necessrio para realizar a colheita no mesmo nmero de plantas utilizando-se cesta de bambu foi superior em 20%, em relao sacola plstica. A incidncia de danos fsicos (%) e perda de massa (%), apesar de maiores nos frutos colhidos com sacola, no foram significativamente diferentes dos colhidos com cestas de bambus. Observou-se maior perda de massa (%) durante o armazenamento nos frutos colhidos utilizando-se sacolas de lonas plsticas. Aps armazenamento por 21 dias, frutos colhidos com sacola plstica apresentavam maiores perdas do que aqueles colhidos utilizando-se cestas de bambu, principalmente devido a danos fsicos e podrides. Palavras-chave: Lycopersicon esculentum, cestas de bambu, sacolas plsticas, danos fsicos, qualidade dos frutos.

ABSTRACT
Harvesting methods for fresh market tomatoes Quality of tomato fruits harvested using traditional bamboo baskets was compared to fruits harvested using harvest bags in the Mogi Guau region, So Paulo State, Brazil. Fruits not submitted to handling were used as control. The trial was totally randomized (harvest system x days after harvest) in a factorial design. The observed data were time spent for each harvest operation, mechanical injury (%) caused either in the field or/and in the process of harvesting, weight loss (%) during storage and final quality of fruits after storage for 21 days at room temperature (23C). The time necessary for the harvest with bamboo baskets was 20% higher than using plastic bags. The results showed that weight loss (%) and injury incidence (%) using harvesting bags were higher than the harvest using bamboo baskets. Weight loss (%) was higher in fruits harvested with plastic bags during storage. After storage during 21 days, tomatoes harvested using plastic bag showed higher losses than fruits picked using bamboo baskets due to mainly mechanical injury and diseases.

Keywords: Lycopersicon esculentum, bamboo basket, harvesting bags, mechanical injury, fruit quality.

(Recebido para publicao em 25 de junho de 2004 e aceito em 31 de julho de 2005) produo anual brasileira de tomate representa 3% de toda a produo mundial, colocando o pas em nono lugar em toneladas produzidas (FNP CONSULTORIA & COMRCIO, 2001). Em 2001, de acordo com a Companhia de Entrepostos e Armazns Gerais de So Paulo (CEAGESP), o volume comercializado de tomate para consumo foi de 152 mil t, com preo mdio de US$ 0,28/kg (FNP CONSULTORIA & COMRCIO, 2001). Aps a colheita, o tomate apresenta-se como um fruto altamente perecvel. O fruto maduro possui vida mdia de prateleira de uma semana, com perdas variando entre 25 e 50%, enquanto o fruto parcialmente maduro apresenta vida til de at duas semanas, com 20 a 40% de perdas ps-colheita (BARRET REINA, 1990). Mukai e Kimura (1986) tambm observaram em estudo que as perdas em tomate varia1

ram de 0 a 50% dependendo do tipo de varejo e da poca do ano. As perdas so maiores na poca chuvosa. Por sua vez, Tsunechiro et al., (1994) relatam que no mercado varejista em So Paulo as perdas variaram de 14% em 1976 para 11,8% em 1991. Lana et al. (1999) relatam que as perdas de tomates ocorridas em uma rede de supermercados variam de 5 a 25%. A grande maioria deve-se a perdas por dano mecnico (55,6%) e tambm por dano fisiolgico (4,6%). As perdas ps-colheita em frutas e hortalias so causadas principalmente por injrias mecnicas, como, manuseio e transportes inadequados, armazenamento imprprio, e grande tempo de exposio no varejo (CEAGESP, 2002). Injria mecnica pode ser causada por mais de um tipo de fora: impacto, compresso e vibrao (BRUSEWITZ et al., 1991;

VERGANO et al., 1991). Os impactos ocorrem na queda do fruto (GARCIA et al., 1988). A compresso ocorre no contato entre frutos, por exemplo, embalagens lotadas de frutos (BANKS et al., 1991) ou tambm durante a colheita, devido presso dos dedos. A vibrao decorre de repetitivos impactos em baixa freqncia entre frutos (MANESS et al., 1992), ocorrendo geralmente durante o transporte, causando alta porcentagem de perdas (JONES et al., 1991). Hortalias e frutas reagem diferentemente aos danos fsicos (DELWICHE et al., 1989). Sommer et al., (1960) relatam que peras so muito mais sensveis ao impacto do que s vibraes. Outros frutos como morangos e mas, so mais sensveis compresso (HOLT; SCHOORL, 1976; HOLT; SCHOORL, 1982). Danos fisiolgicos e patolgicos se do principalmente, na fase de produ-

Parte do projeto de pesquisa UNIMAC (Unidade Mecnica de Auxlio Colheita) financiado pela FAPESP. Hortic. bras., v. 23, n. 4, out.-dez. 2005

1018

Tcnicas de colheita para tomate de mesa

o, transporte e armazenamento. As injrias causadas por impactos, compresses, vibraes, cortes e rachaduras esto relacionadas com alteraes fisiolgicas, metablicas, de aroma, sabor e qualidade em diferentes produtos hortcolas, tais como, mas, pepinos, batatas e tomates (MORETTI; SARGENT, 2000). A grande incidncia de danos fsicos em tomate acontece durante a colheita, aumentando durante o transporte e beneficiamento (FERREIRA et al., 2003). Silva e Calbo (1991) avaliaram a colheita de tomate empregando diversos acessrios e concluram que a sacola de colheita usada em outros pases (Estados Unidos e Canad) possibilitou maior rendimento e menores danos aos frutos, com menor impacto. No entanto, no Brasil, a colheita de tomates para consumo in natura realizada utilizando-se cestas de bambu e transferindo os frutos para caixas plsticas. Alguns produtores, em busca de uma maior rapidez para o processo de colheita utilizam sacolas de colheita confeccionadas com lona plstica originalmente usada para laranja, podendo ser uma alternativa para colheita do tomate. Porm, o efeito desta modificao no processo na qualidade final dos frutos de tomate nas nossas condies de cultivo ainda desconhecido. O objetivo deste trabalho foi avaliar tcnicas de colheita utilizando-se cesta de bambu e sacola de lona plstica, na qualidade de tomate cv. Dbora.

MATERIAL E MTODOS
Foram utilizados frutos de tomate, cultivar Dbora (Sakata seeds) colhidos em propriedade rural, situada no municpio de Estiva Gerbi (SP), coordenadas geogrficas 46o 53 W e 22o 19 S, com temperatura mdia anual de 19,6oC e precipitao anual de 1565 mm. O cultivo foi em Latossolo Vermelho Amarelo em sistema tradicional de plantio, conduzida em estaca de bambu, com o uso de irrigao por sulcos, utilizando-se espaamento entre linhas de 1,00 m e entre plantas de 0,50 m. Frutos foram colhidos primeiramente em cesta de bambu, com dimenses externas de 40 cm de comprimento, 25 cm
Hortic. bras., v. 23, n. 4, out.-dez. 2005

de altura e 20 cm de largura e aps seu enchimento foram transferidos para caixa plstica com dimenses de 55 cm de comprimento, 30 cm de altura e 35 cm de largura, posicionada no carreador principal de plantio. Em outra situao, a colheita foi realizada utilizando-se sacolas de lona plstica (utilizadas para colheita de laranja), com dimenses externas de 65 cm de comprimento e 55 cm de largura. Em seguida, os frutos foram transferidos para caixas plsticas, semelhante s do sistema de colheita em cestas de bambu. O tempo gasto para colheita foi mensurado nas duas situaes utilizando-se cronmetros de preciso. Em cada caixa nos dois sistemas mencionados foi retirada amostra de 40 frutos no estdio salada (CEAGESP, 2000). A testemunha correspondia a frutos (40) retirados diretamente da planta, sem passar pelo manuseio descrito anteriormente. Foram retiradas amostras de 3 caixas, sendo cada caixa uma repetio em um total de 120 frutos por tratamento. Estes frutos foram transportados cuidadosamente em embalagens de papelo, envoltos individualmente em espuma para o laboratrio da UNICAMP e armazenados temperatura ambiente (23oC) por 21 dias. Foram avaliados os danos fsicos (%) baseando-se nas Normas e Padres de Classificao (CEAGESP, 2000) identificando os em duas categorias: antes e durante a colheita. As injrias mecnicas anteriores colheita foram caracterizadas como: derivadas de abraso com as estacas de bambu e fios de amarrio, ataque de insetos e distrbios fisiolgicos e nutricionais; as injrias mecnicas causadas na colheita foram identificadas como: derivadas de compresso do fruto contra a cesta de colheita e/ou caixa plstica, impacto do fruto quando em queda na caixa plstica e/ou cesta de colheita, marcas de unhas ou dedos e compresso do pednculo do fruto contra superfcie externa de outro fruto. O dimetro transversal do fruto foi mensurado utilizandose paqumetro digital. Para mensurao da rea externa referente ao dano fsico, estas foram delimitadas utilizando-se caneta marcador para retroprojetor de cor pre-

ta. Aps a delimitao das reas referentes a danos fsicos, as marcaes foram transferidas para papel de seda e individualizadas por fruto. Para mensurar estas reas utilizou um planmetro (KEUFFEL & ESSER Co). As reas mensuradas foram comparadas superfcie total do fruto, considerando este com uma esfera (MOHSENIN, 1986) e utilizando-se a seguinte frmula: rea Externa do fruto = 4 x 3,1415 x R2 (R=raio) sendo o resultado expresso em porcentagem. Utilizou-se a mesma metodologia em duas categorias (antes e durante a colheita) em todos os tratamentos. A perda de massa (%) foi avaliada a cada quatro dias utilizando a relao entre a diferena da massa inicial e final. Aps 21 dias de armazenamento, os frutos foram avaliados quanto aparncia encontrada, baseando-se em uma escala de 0-5, considerando (0) fruto apropriado para consumo; (1) descarte por dano fsico externo superficial; (2) descarte por dano fsico externo grave; (3) descarte por dano fsico e podrido associada (4) descarte por podrido; (5) descarte por perda de gua (seco) ou por queima do sol. Considerou-se frutos apropriados para consumo aqueles que no apresentavam nenhum dano externo e/ou podrides ou danos fsicos externos leves inferiores a 10%. Tomates foram descartados devido a danos fsicos externos leves e graves, quando a incidncia foi superior a 10%, sendo que a presena de injrias graves era fator de excluso principal. Considerou-se podrides causadas por fungos e/ou bactrias em qualquer nvel. Tomates secos e/ou queimados de sol, eram aqueles que demonstravam queimaduras e/ou perda de gua excessiva. O delineamento utilizado foi inteiramente casualizado em esquema fatorial (sistemas de colheitas x dias aps a colheita). O teste estatstico realizado para avaliao da qualidade aps armazenamento foi o da diferena de propores (BUSSAB; MORETTIN, 2002), em nvel de 5% de probabilidade. Os resultados mdios obtidos para danos fsicos foram comparadas pelo teste Tukey ao nvel de 5% de probabilidade e para perda de massa foram realizadas anlises de regresso no desdobramento da interao dentro de cada sistema de colheita.
1019

M. D. Ferreira et al.

Tabela 1. Avaliao para danos fsicos (%) em frutos de tomate cultivar Dbora, em diferentes tcnicas de colheita (cesta e sacola plstica) comparadas a testemunha. Campinas, UNICAMP, 2003.
Tcnica de colheita Testemunha Cesta Sacola Dano fsico (%) 1,27 b 3,55* a 3,99 a

* Mdias seguidas pela mesma letra no diferem significativamente pelo teste de Tukey a 5% de probabilidade

Tabela 2. Avaliao de descarte de frutos aps 21 dias de armazenamento, baseado em escala 0-5, considerando (0) fruto apropriado para consumo; (1) descarte por dano fsico externo superficial; (2) descarte por dano fsico externo grave (3) descarte por dano fsico e podrido associadas (4) descarte por podrido; (5) descarte por perda de gua (seco) ou por queima do sol. Campinas, UNICAMP, 2003.
Tcnica de colheita Testemunha Cesta Sacola Test. x Cest. Test. x Sac. Cesta x Sac. Escala de notas (%) 0 62,50 28,34 17,50 s* s s 1 0 5 5 s s n.s 2 5,00 42,50 40,00 s. s n.s. 3 7,50 3,33 8,33 n.s. n.s. n.s. 4 20,00 15,00 26,67 n.s. n.s s 5 5,00 5,83 2,50 n.s. n.s. n.s. Total descarte (%) 37,50 71,66 82,50 s s n.s

Figura 1. Modelos ajustados para a perda de massa, em porcentagem, (y) em funo dos perodos de armazenamento, em dias, (x) dentro de cada sistema de colheita. Campinas, UNICAMP, 2003.

RESULTADOS E DISCUSSO
O tempo necessrio para realizar a colheita no mesmo nmero de plantas utilizando-se cesta de bambu foi de
1020

2013", superior em 20%, em relao a sacola plstica (1551"). Porm, este menor tempo de colheita no interferiu positivamente na qualidade final do fruto. Silva e Calbo (1991) em avaliao de diferentes mtodos de colheita para

tomate de mesa, tambm encontraram maior rendimento com o uso da sacola de colheita, todavia com menores danos fsicos aos frutos. Observou-se maior incidncia de danos fsicos, ainda que no significativo, em tomates colhidos com sacola de lona plstica (3,99%), quando comparados queles colhidos com cestas de bambu (3,55%) (Tabela 1). Os tomates colhidos sem esse manuseio (testemunha) apresentaram 1,27% de danos fsicos. Esses frutos apresentavam danos fsicos relacionados ao ataque de insetos, e estacas de bambu, demonstrando que as perdas j iniciam no campo e aumentam na etapa de colheita, como tambm foi observado por Sanches (2002) em bananas. Hung e Prussia (1989) tambm relatam que a incidncia de danos fsicos est relacionada ao tipo e intensidade do manuseio utilizado. De acordo com Schoorl e Holt, (1982), os danos fsicos causados por impacto e compresso so os que mais influenciam na qualidade dos frutos de tomate. Na colheita de tomates, o ponto crtico para incidncia em danos fsicos ocorreu principalmente quando do impacto do fruto em queda na caixa plstica e/ou cesta de colheita e a compresso do fruto contra a superfcie externa da cesta ou sacola plstica. Altura e velocidade de queda, enchimento das caixas, cestas e sacolas plsticas, so fatores que ocasionaram danos aos frutos. Treinamento de funcionrios e utilizao de equipamento adequado podem modificar a situao encontrada. Observa-se perda de massa (Figura 1) crescente durante o armazenamento, porm significativamente maior em tomates colhidos com sacola e cesta de bambu em relao testemunha. A qualidade dos frutos no final de 21 dias de armazenamento foi comprometida principalmente em frutos colhidos com sacola (82,5% de descarte) quando comparada com colheita utilizando cesta de bambu (71,66%), provavelmente devido a maiores danos fsicos associados a podrides. A testemunha apresentou 37,5% de frutos descartados aps armazenamento. Os danos fsicos graves provenientes da etapa de colheita foram as principais cauHortic. bras., v. 23, n. 4, out.-dez. 2005

Tcnicas de colheita para tomate de mesa

sas de descarte, principalmente para frutos colhidos com cesta (42,5%) e sacola (40%) (Tabela 2). Silva e Calbo (1991) relataram que frutos colhidos com sacola plstica apresentaram menores danos quando comparados a outros mtodos, como por exemplo, a colheita com a utilizao de cestas. Uma razo para isto deve-se ao uso de sacolas de colheita com estrutura de sustentao, o que proporciona menor fora de compresso, pois maiores foras de compresso causam maiores perdas (BANKS et al., 1991). A colheita utilizando-se sacolas plsticas foi realizada em menor tempo, todavia com maiores perdas e reduo na qualidade final do produto. A colheita utilizandose sacolas plsticas sem sustentao no se mostrou adequada, influenciando negativamente na qualidade final dos frutos aps o armazenamento. Essas maiores perdas podem estar relacionadas a uma maior fora de compresso entre os frutos. Observa-se que mtodos alternativos de colheita devem ser estudados visto que neste experimento causaram grande reduo na qualidade final do produto, alm disso, deve haver maior preocupao com os frutos antes da colheita, o que tambm responsvel por elevadas perdas.

AGRADECIMENTOS
Os autores agradecem FAPESP e ao proprietrio e funcionrios da empresa MALLMANN, Mogi-Guau (SP).

LITERATURA CITADA
BANKS, N.K.; BORTON, C.A.; JOSEPH, M. Compression bruising test for bananas. Journal of Science Food Agriculture, v.56, p.223-226, 1991.

BARRETT REINA, L.C. Conservao Ps-colheita de Tomate (Lycopersicon esculentum. Mill) da Cultivar Gigante Kada Submetido a Choque a Frio e Armazenamento com Filme de PVC. 1990. 114 f. Dissertao (mestrado em Cincia dos Alimentos) - Faculdade de Cincia dos Alimentos, Escola Superior de Agricultura de Lavras, Lavras. BUSSAB, W.O.; MORETTIN, P. Estatstica bsica. 5a edio, So Paulo. Saraiva, 2002. 321 p. BRUSEWITZ, G.H.; McCOLLUM; T.G.; ZHANG, X. Impact bruise resistance of peaches. Transactions of the ASAE, v.34, n.3, p.962-965, 1991. CEAGESP. Classificao de Tomate. So PauloSP, Programa Horti&Fruti, 2000. 3p. CEAGESP. Diga no ao desperdcio. Disponvel Em: <http://www.ceagesp.com.br>. Acesso em: 15 jul. 2002. DELWICHE, M.J.; TANG, S; MELHSCHAU, J.J. An impact force response fruit firmness sorter. Transactions of the ASAE, v.32, n.1, p.321-326, 1989. FERREIRA, M.D., FRANCO, T.O.A., KASPER, R.F., NOGUEIRA, M.F.M., CHIUMARELLI, M. Avaliao da qualidade do tomate de mesa, cv. Romana em diferentes etapas na ps-colheita. Resumo Expandido. CD Anais. Horticultura Brasileira, v.21, n.2. 4 p., Julho 2003. FNP Consultoria & Comrcio. Anurio da Agricultura Brasileira - AGRIANUAL 2002. So Paulo:FNP, 2001, 536 p. GARCIA, C., RUIZ, M.; CHEN, P. Impact parameters related to bruising in selected fruits. American Society of Agricultural Engineers Meeting, no. 88-607, 16 p. 1988. HOLT, J.E; SCHOORL, D. Bruising and energy dissipation in apples. Journal of Texture Studies, v.7, p.421-432, 1976. HOLT, J.E; SCHOORL, D. Strawberry bruising and energy dissipation. Journal of Texture Studies, v.13, p.349-357, 1982. HUNG, Y.C.; PRUSSIA, S.E. Effect of maturity and storage time on the bruise susceptibility of peaches (cv. Red Globe). Transactions of the ASAE, v.32, n.4, p.377-1382, 1989. JONES, C.S.; HOLT, J.E.; SCHOORL, D. Model to predict damage to horticultural produce during transport. Agriculture Engineering Research, v.50, p.259-272, 1991.

LANA, M.M.; MOITA, A.W.; NASCIMENTO, E.F.; SOUZA, G.S.; MELO, M.F. Quantificao e caracterizao das perdas ps-colheita de tomate no varejo. Horticultura Brasileira, Braslia, v.17, n.3, p.295, 1999. MANESS, N.O.; BRUSEWITZ, G.H.; McCOLLUM, T.G. Impact bruise resistance comparison among peach cultivars. HortScience, v.27, n.9, p.1008-1011, 1992. MOHSENIN, N.N. Physical properties of plant and animal materials. Vol. I. New York:Gordon Beach Science Publishers,1986, 841 p. MORETTI, C.L.; SARGENT, S.A. Alterao de sabor e aroma em tomates causada por impacto. Scientia Agrcola, Piracicaba, v.57, n.3, p.385-388, 2000. MUKAI, M.K.; KIMURA, S. Investigao das prticas ps-colheita e desenvolvimento de um mtodo para anlise de perdas de produtos hortcolas. Viosa: CENTREINAR, 1986. SANCHES, J. Qualidade ps-colheita de bananas (Musa cavendishii) nanico, atravs da classificao de defeitos fsicos , embalagens e tecnologia do frio. 2002. 82 f. Dissertao (Mestrado em Tecnologia Ps-Colheita) Faculdade de Engenharia Agrcola, Universidade Estadual de Campinas. SCHOORL, D.; HOLT, J.E. Impact bruising in 3 apple pack arrangements. Journal Agricultural Engineering Research, v.27, p.507-512, 1982. SILVA, J.L.O.; CALBO, A.G. Comparao entre mtodos de colheita de tomate. Horticultura Brasileira, Braslia, v.9, p.58, 1991. SOMMER, N.F.; MITCHELL, F.G.; GUILLOU, R.; LUVISI, D.A. Fresh fruit temperature and transit injury. Proceedings American Society for Horticultural Science, v.76, p.156-162, 1960. TSUNECHIRO, A.; UENO, L.H.; PONTARELLI, C.T.G. Avaliao econmica das perdas de hortalias e frutas no mercado varejista da cidade de So Paulo, 1991/1992, Agricultura em So Paulo, SP, v.41, n. 2, p. 1-15, 1994. VERGANO, P.J.; TESTIN, R.F.; NEWAL JR., W.C. Peach bruising: susceptibility to impact vibration, and compression abuse. American Society of Agricultural Engineers, v.34, n.5, p.2110-2116, 1991.

Hortic. bras., v. 23, n. 4, out.-dez. 2005

1021

economia e extenso rural


NEGRELLE, R.R.B.; ELPO, E.R.S.; RCKER, N.G.A. Anlise prospectiva do agronegcio gengibre no estado do Paran. Horticultura Brasileira, Braslia, v.23, n.4, p.1022-1028, out-dez 2005.

Anlise prospectiva do agronegcio gengibre no estado do Paran1


Raquel R.B. Negrelle2; Eliane R.S. Elpo3; Neusa G.A. Rcker 4
UFPR, C. Postal 19023, 81531-970 Curitiba-PR; E-mail: negrelle@ufpr.br; 3UFPR, R. Padre Camargo, 280, 7 andar, Alto da Glria, 80060-240 Curitiba-PR; E-mail: erselpo@ufpr.br; 4Secretaria de Estado da Agricultura e do Abastecimento do Paran, R. dos Funcionrios, 1559, Cabral, 80035-050 Curitiba-PR; E-mail: neusagar@pr.gov.br
2

RESUMO
Apresentam-se resultados de estudo prospectivo da cadeia produtiva do gengibre no estado do Paran (Brasil), englobando panorama mundial, brasileiro e paranaense de produo e comercializao; caracterizao da comunidade produtora agrcola paranaense; identificao, caracterizao e deteco dos principais pontos de estrangulamento de outros nveis da cadeia produtiva.

ABSTRACT
Prospective analysis of the ginger agrobusiness in Paran State, Brazil A prospective analysis of the ginger trade chain in Paran State (Brazil) is presented, including an overview of the production and commercialization at both international and national levels as well as the characterization of the agricultural community and of the others levels of the trade chain in Paran State, and the main strangulation points at these levels. Keywords: Zingiber officinale Roscoe, production chain, marketing.

Palavras-chave: Zingiber officinale Roscoe, cadeia de produo, comercializao.

(Recebido para publicao em 5 de outubro de 2004 e aceito em 2 de setembro de 2005) rizoma de gengibre amplamente comercializado em funo de seu emprego na medicina popular (excitante, estomacal e carminativo), na alimentao, industrial, especialmente como matria-prima para fabricao de bebidas, perfumes e produtos de confeitaria como pes, bolos, biscoitos e gelias (CORRA JUNIOR et al., 1994; TROPICAL, 2000; INFORMAES, 2002). Vrias propriedades do gengibre foram comprovadas em experimentos cientficos, citando-se as atividades antiinflamatria, antiemtica e antinausea, antimutagnica, antilcera, hipoglicmica, antibacteriana, entre outras (YOSHIKAWA et al., 1994; ONTENGCO et al., 1995; LONIEWSKI et al., 1998; WHO, 1999; UTPALENDU et al., 1999). Includo no grupo especiarias, o gengibre representa atualmente o 3 lugar das plantas medicinais, aromticas e condimentares mais produzidas no Paran (PARAN, 2003). Apesar desta importncia econmica no contexto regional, h carncia de informaes sistematizadas sobre esta cadeia produti1

va, em especial, no que se refere ao sistema operacional de comercializao, que de acordo com as queixas dos produtores, tem causado prejuzos ao agronegcio gengibre. As rpidas mudanas que esto ocorrendo em todos os setores da sociedade, em especial nos mbitos poltico, econmico e tecnolgico, impem crescente complexidade ao processo de planejamento das organizaes que atuam no agronegcio. Por outro lado, a abertura econmica e o acesso informao e a produtos de todas as partes do mundo tornam o consumidor mais exigente. O estabelecimento de estratgias que atendam aos interesses dos consumidores requer que os (demais) agentes das cadeias produtivas apresentem eficincia, qualidade e que se coordenem entre si para garantir, tambm, menor preo, uma vez que a competitividade dos produtos de origem agropecuria est sendo definida pelas instncias fora da porteira. O estudo das cadeias produtivas procura levantar os pontos crticos, atuais e potenciais, que impedem o alcance desses objetivos, assim como

identificar oportunidades e nichos de mercado para os produtos da cadeia (IAPAR, 2003). Realizou-se o estudo prospectivo da cadeia produtiva do gengibre no estado do Paran, aqui apresentado e que engloba: a) Panorama do volume de produo agrcola mundial, brasileira e paranaense de gengibre; b) Caracterizao da comunidade produtora agrcola do litoral paranaense de gengibre; c) Identificao e caracterizao de outros nveis da cadeia produtiva do gengibre do litoral paranaense; Deteco dos principais pontos de estrangulamento nos diferentes nveis da cadeia produtiva no litoral do Paran.

MATERIAL E MTODOS
Realizou-se pesquisa exploratriodescritiva baseada em levantamento bibliogrfico e documental, alm de visitas tcnicas e entrevistas abertas (2000 a 2002). Neste processo, vrias instituies foram contatadas, citando-se especialmente a Secretaria de Agricultura e Abastecimento do Estado do Paran

Parte da tese de Doutorado em Agronomia, Produo Vegetal PELA UFPR do segundo autor. Hortic. bras., v. 23, n. 4, out.-dez. 2005

1022

Anlise prospectiva do agronegcio gengibre no estado do Paran

(SEAB/PR), que disponibilizou informaes estatsticas referentes aos municpios produtores, rea, produo e valor bruto da produo; a Empresa Paranaense de Assistncia Tcnica e Extenso Rural (EMATER/PR) e o Instituto Agronmico do Paran (IAPAR/ PR), onde se obteve informaes complementares relativas aos diversos segmentos e agentes econmicos que compem esta cadeia produtiva. O universo de tcnicos entrevistados nestas instituies correspondeu a 10 pessoas, representando 6 Ncleos Regionais da SEAB/PR e englobando 32 municpios paranaenses. Adicionalmente, foram efetuadas visitas tcnicas e entrevistas abertas a 9 produtores de Morretes, principal regio produtora de gengibre no Paran. Estes produtores foram selecionados aleatoriamente a partir de cadastro junto EMATER, buscando-se representantes de cada uma das trs classes de propriedades (pequenas, mdias e grandes) agrcolas, segundo critrios desse cadastro. Neste processo, buscou-se identificar junto aos produtores, o fluxo de comercializao do produto agrcola gengibre in natura. Paralelamente, procedeu-se entrevistas com 3 representantes de pequenas indstrias familiares em Morretes, aleatoriamente selecionados dentre os 34 registrados em cadastro existente na EMATER. Foram tambm entrevistados 3 representantes do setor gerencial da comercializao de produtos in natura na regio metropolitana de Curitiba, vinculados Central de Abastecimento do Paran (CEASA-PR). Neste mesmo local, foram entrevistados locatrios de boxes de comercializao de produtos in natura (n=3) e produtores que comercializam seus produtos no ptio (pedras) (n= 3). De forma complementar, procedeuse entrevistas com representantes de distintos setores referendados pela CEASA (2002), como receptores do produto por ela comercializado em Curitiba, a saber: supermercados (n= 4), feiras-livres (n= 2) e Mercado Municipal (n= 2). O setor supermercadista foi representado pelos seguintes estabelecimentos: Carrefour (n= 1), Companhia BraHortic. bras., v. 23, n. 4, out.-dez. 2005

sileira de Distribuio (CBD) (n= 1) e Sonae Distribuio Brasil (n=2). A seleo destes foi efetuada com base nos dados da Associao Brasileira de Supermercados (ABRAS) (2000), dados que representam as trs maiores empresas deste setor, por faturamento bruto em nvel nacional. Todas as principais feiras-livres, promovidas semanalmente em Curitiba, foram visitadas, identificando-se e selecionando-se as bancas que procediam as vendas de gengibre in natura, para avaliao no contexto desta pesquisa (n=2) . Igualmente, todas as bancas inseridas no Mercado Municipal que comercializavam o gengibre in natura foram tambm identificadas e avaliadas (n=2). As informaes estatsticas referente ao comportamento do comrcio exterior do gengibre, disponibilizadas em Brasil (2004), foram consideradas como parmetros comprobatrios dos indicadores, US$ FOB e Peso Lquido (kg) na anlise da exportao e importao brasileira da mercadoria gengibre.

RESULTADOS E DISCUSSO
Cenrio mundial O gengibre tem sido utilizado no oriente h mais de 2.000 anos, havendo referncias de que nos sculos XII a XIV era to popular na Europa quanto a pimentado-reino. Antes do descobrimento da Amrica j era largamente utilizado pelos rabes, como expectorante e afrodisaco, sendo difundido por toda a sia tropical, da China ndia. Foi introduzido na Amrica logo aps o descobrimento, sendo que os primeiros relatos comentam que inicialmente foi cultivado no Mxico, sendo em seguida levado s Antilhas, principalmente Jamaica, a qual em 1.547, chegou a exportar cerca de 1.100 t para a Europa (LISSA, 1996). De acordo com a FAO, citada nos estudos de Herbs e Spices (2003), o prognstico do agronegcio gengibre promissor, em funo do aumento da rea, produo e produtividade nos principais pases produtores. Neste contexto est incluso o Brasil, sem contudo ter sido nominada a sua participao nas informaes estatsticas disponibilizadas.

Com referncia aos indicadores econmicos, a rea mundial ocupada com gengibre apresentou variao de 3,7% entre 1999 e 2001, passando de 310.100 ha para 321.732 ha. J o volume ofertado nesse perodo mostrou variao positiva maior que a da rea (7,7%), com mdia de 800.775 t. A Nigria destacase em nvel mundial pela extenso da rea cultivada com gengibre, embora em termos de volume produzido seja superada pela ndia e China. O aumento de rea ocorrido entre 1999 e 2001 deveuse, principalmente, alta demanda domstica como dos mercados internacionais (HERBS; SPICES, 2003). O comrcio internacional dos rizomas de gengibre feito sob 3 formas bsicas: gengibre in natura, em conserva ou cristalizado e seco. Do rizoma imaturo, tenro e menos pungente, colhido em torno de 6 meses, preparada a conserva (em salmoura ou xarope de acar) ou o gengibre cristalizado. O gengibre seco preparado a partir do rizoma colhido aps completado o seu estgio de maturao. Este gengibre seco comercializado em peas ntegras, laminado ou ainda em p. Esta ltima forma utilizada em menor volume dado que o processo de moagem geralmente realizado no pas importador (TAVEIRA MAGALHES et al., 1997). Registra-se tambm a comercializao de produtos derivados do gengibre, como o leo essencial e oleoresina. O leo essencial produzido, principalmente, na ndia e na China e, em menor escala, na Austrlia, Jamaica e Indonsia (INTERNATIONAL TRADE CENTRE, 1986; PURSEGLOVE et al., 1981). O valor mundial do comrcio de gengibre chega a cerca de US$ 185 milhes, excluindo-se o leo e a oleoresina. Apesar de maior produtor, a participao da ndia neste mercado mundial pequena, correspondendo a apenas 6%. A China, por sua vez, tem liderado este mercado. Entretanto, no que tange ao comrcio de oleoresina e leo, aproximadamente 50% proveniente da ndia. Os preos do gengibre no mercado mundial variam grandemente de acordo sua origem e limpeza. O preo de importao do gengibre seco geralmente
1023

R. R. B. Negrelle et al.

Figura 1. Evoluo da exportao brasileira de gengibre, 1999 a 2003. Fonte de dados: Brasil (2003).

Figura 2. Evoluo da importao brasileira de gengibre, 1999 a 2003. Fonte de dados: Brasil (2003).

est entre US$ 700 e US$ 1350/t. O gengibre jamaicano tem um nicho particular, sendo vendido no mercado europeu a preos que variam entre US$ 5000 e US$ 6000/t. O preo do leo varia de acordo com sua concentrao e pureza. O leo de origem chinesa vendido por US$ 22 a US$ 30/kg, o de origem chinesa a US$ 40 a US$ 50/kg e o proveniente de Sri Lanka chega a US$ 70/kg, preo que tem se elevado ultimamente. A oleoresina cotada entre US$ 40 e US$ 50/kg (CROP PROFILE, 2003). Cenrio nacional No Brasil, acredita-se que a introduo do gengibre deu-se durante a invaso holandesa, em funo da permuta de plantas econmicas existentes entre os dois pases naquela poca (LISSA, 1996). Esta cultura iniciou-se no Rio de Janeiro, espalhando-se para So Paulo, Paran e, mais recentemente, para Santa Catarina (SANTOS, 2000), principalmente nas regies litorneas.
1024

Embora o Brasil seja considerado, um dos grandes fornecedores mundiais de gengibre, sua produo pequena comparativamente a outras culturas, envolvendo relativamente um conjunto pequeno de agricultores (SANTOS, 2000). A produtividade mdia brasileira tem sido registrada em torno de 20 t/ ha, cifra bastante inferior obtida nos principais produtores mundiais (60 t/ha) (RCKER, 1993). Esta diferena, segundo a autora, estaria atrelada variabilidade das condies de solo e clima de cada regio produtora, tratos culturais, diversificao e rotao de culturas, tecnologia apropriada, mo-de-obra treinada e organizao do setor produtivo. H carncia de informaes no tocante evoluo da produo brasileira. Segundo Rcker (2002), a produo de gengibre no Brasil em 1999 esteve em torno de 10 mil t. No foram encontrados registros das produes dos anos

subseqentes. O gengibre brasileiro geralmente comercializado no estado in natura e se destina essencialmente exportao (70% a 80%), principalmente para Estados Unidos, Reino Unido, Holanda e Canad.Os rizomas que no atingem a qualidade tipo exportao so destinados ao mercado regional. De 73 t em 1972, a exportao de gengibre alcanou 3.800 t em 1985, estabilizando-se e voltando a crescer a partir de 1993 (6.721 t em 1994), com o preo mdio a US$ 1,04/kg em 1995 (TAVEIRA MAGALHES et al., 1997). Registra-se, em 1998, cifra recorde de exportao ultrapassando US$ FOB 7.0 milhes, mas seguido por um expressivo decrscimo, em 2002, cujo valor correspondeu quase metade do comercializado em 1998 (vide NURIN/BANCO DO BRASIL, 2003; BRASIL, 2004). O aumento de 31,3% no volume exportado de gengibre de 1995 a 1998 pode ser justificado pela maior demanda no mercado importador, alm de melhor preo oferecido ao produto brasileiro em detrimento ao oferecido pelos outros pases produtores, muito embora, no perodo seguinte a queda ao redor de 17% est relacionada falta de qualidade do produto brasileiro frente aos oferecidos por outros pases, segundo informaes de produtores do litoral paranaense e de tcnicos da SEABPR (Figura 1). A evoluo da importao brasileira de gengibre apresenta um movimento pendular, na medida em que as foras de mercado determinam a oferta e a demanda. Durante o perodo de 1996 a 2003, o menor volume importado foi de 2000, que correspondeu a 22,0 mil kg. A partir de 2001, os preos mdios negociados no comrcio exterior tendem a diminuir, competindo com os preos mdios praticados no mercado interno brasileiro. Com esta mudana, mesmo penalizando a Balana Comercial Brasileira, a importao de gengibre, em 2003, atingiu um volume de 56,7 mil kg lquido (Figura 2). Cenrio estadual A cultura de gengibre foi introduzida por famlias de japoneses no litoral paranaense h aproximadamente 25 anos (EPAGRI, 1998). Entretanto, torHortic. bras., v. 23, n. 4, out.-dez. 2005

Anlise prospectiva do agronegcio gengibre no estado do Paran

nou-se efetivamente comercial somente na ltima dcada, aps introduo de variedade de rizomas gigantes (TAVEIRA MAGALHES et al., 1997). Atualmente, o Estado do Paran desponta como o maior produtor nacional de gengibre (rizomas in natura) totalizando 3.945 t/ano, em uma rea aproximada de 201 ha, distribuda em 26 municpios. A safra 2001/02 contabilizou R$ 3.3 milhes, correspondendo a 19,14% do Valor Bruto da Produo (VBP) do Grupo Especiarias e 0,017% do VBP estadual (PARAN, 2003). A maior parte da rea produtora de gengibre no Paran (97%) est concentrada no litoral paranaense, restrita aos municpios de Morretes, Guaraqueaba, Antonina, Paranagu e Guaratuba, todos pertencentes ao Ncleo Regional (NR) de Paranagu (PARAN, 2003). Os cinco municpios produtores de gengibre que pertencem ao Ncleo Regional de Paranagu ocuparam uma rea aproximada de 194 ha, com produo mdia de 3.880 t na safra 2001/02. Morretes, principal municpio paranaense produtor de gengibre, ocupa aproximadamente 60% da rea cultivada e participa com 54% do total da produo do Ncleo Regional (PARAN, 2003). A anlise das informaes estatsticas referentes a rea ocupada e volume de produo de gengibre, safras 1990/ 91 a 2001/02, indicam um comportamento sazonal atrelado s variaes da oferta e demanda do mercado externo (PARAN, 2003) (Figura 3/A-B). A safra 1997/98 foi recorde em termos de produo de gengibre, principalmente em funo do que foi produzido no ncleo regional de Paranagu. Assim como citado para o comrcio brasileiro de gengibre, vrios fatores podem estar associados a este recorde estadual como, por exemplo, a demanda do mercado importador, alm do melhor preo pago ao produto em relao a outros pases produtores. As safras subseqentes no mantiveram este patamar de produo. Como j anteriormente mencionado, entre os fatores apontados pelos produtores, cita-se o desestmulo em funo da dependncia de atravessadores que, por sua vez,
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Figura 3. Evoluo da rea (A) e da produo (B) de gengibre, Estado do Paran, Safras 1990/91 a 2001/02. Fonte de dados: Paran (2003).

tendem a forar a venda do produto por preos mais reduzidos. Outro agravante seria a inaceitabilidade deste produto frente a um mercado mais exigente em termos de aparncia e ausncia de fungos, substncias qumicas txicas e acompanhamento de laudo fitossanitrio comprobatrio desta qualidade. Desta forma, atualmente, h um nmero bem menor de produtores devido ao prejuzo na comercializao da safra 2001/02, face ao cumprimento de contratos de exportao e, segundo Rcker (2002), a produo agrcola do gengibre ainda pode ser considerada uma atividade lucrativa, desde que seja implementado um sistema agro-industrial de manejo e beneficiamento adequado deste produto, sem uso abusivo de insumos agrcolas e sem uso de agrotxicos. Assim, potencializar-se-ia a aceitao do gengibre paranaense pelo mercado consumidor regional e terceiros pases.

Segundo Santos (2000), a comercializao para o mercado externo do gengibre produzido em Morretes foi iniciada h cerca de 20 anos, mediante a Cooperativa Agrcola de Cotia. Este mercado externo realizado por empresas exportadoras localizadas no Paran (Antonina, Morretes e Curitiba), So Paulo (So Paulo, Santos, Indaiatuba, Atibaia e Jales), Minas Gerais (Belo Horizonte) e Santa Catarina (Itaja). A maioria destas empresas que exportam o gengibre do municpio de Morretes tem um funcionrio que inspeciona a embalagem do produto nas propriedades de produo. As empresas de maior porte possuem, geralmente, um representante que acompanha a carga no porto de destino. Comunidade produtora agrcola O sistema de produo paranaense de gengibre, em especial no municpio de Morretes, realizado por pequenos (rea da cultura de 0,2 a 0,3 ha), mdios
1025

R. R. B. Negrelle et al.

Figura 4. Distribuio da Comercializao do Gengibre, Morretes, 2001. Fonte: Pesquisa de campo, 2001.

(rea da cultura de 0,3 a 1 ha) e grandes produtores (at no mximo 10 ha). Essas propriedades, em sua maioria, possuem atividade olercola, englobando a cultura de gengibre e de outras hortalias, como chuchu, berinjela, alface, pepino, abobrinha, entre outras; caracterizando este municpio como um importante fornecedor de hortalias para a Regio Metropolitana de Curitiba. Em Morretes foram observadas trs situaes quanto ao custeio do cultivo: o produtor arca com os custos, os produtores so financiados pelas empresas exportadoras, tendo o produtor venda garantida do produto, e o cultivo realizado com financiamento bancrio. Mo-de-obra empregada Santos (2000) salienta que no municpio de Morretes, o setor agrcola o grande gerador de empregos, principalmente nas atividades de colheita, preparo e limpeza, classificao e embalagem do produto in natura. Salienta, ainda, que entre dois mil e quinhentos a trs mil empregos (a grande maioria temporrios) so gerados durante o perodo que envolve a colheita do gengibre. Fora o perodo da colheita, cerca de mil e quinhentas pessoas trabalham durante todo o ciclo da lavoura, que de um ano. Nas pequenas propriedades, toda a famlia trabalha no cultivo. Porm, durante a colheita, estes pequenos produtores contratam entre quinze e vinte empre1026

gados. As propriedades maiores tm entre doze e quinze empregados registrados e durante a colheita so temporariamente contratados entre sessenta e oitenta pessoas. Estes trabalhadores recebem uma diria, em mdia, de R$10, podendo chegar at a R$ 15, no caso de mo-de-obra mais especializada. A renda dos trabalhadores gasta praticamente toda no municpio, determinando que os resultados das safras de gengibre sejam refletidos no comrcio local. Terminada a colheita do gengibre, parte dos trabalhadores continua no preparo do novo plantio, o restante vai para a colheita e o plantio de hortalias. Isso mantm a grande maioria dos trabalhadores rurais empregados, praticamente, o ano todo (IAPAR, 2000/01). Tecnologia empregada Observou-se em Morretes um modelo tecnolgico em transformao, onde coexistem as agriculturas tradicionais da banana e da mandioca, de baixa produtividade, e sistemas de produo tecnificados, visando o mercado, com mdio e alto nveis tecnolgicos e alta produtividade, conforme detalhado em Marchioro (2002). Entre os tecnificados, cita particularmente o cultivo do gengibre. De acordo com EPAGRI (1998), os produtores de gengibre possuem equipamentos agrcolas como cultivador motorizado, trator equipado com arado

e grade de disco, escarificador, carreta, pulverizador, conjunto de irrigao, pulverizadores costais, lavadores de gengibre, contentores de plstico para transporte e colheita da produo, entre outros. Evidenciou-se que os processos de beneficiamento do gengibre ps-colheita no municpio de Morretes esto afetos ao tipo de produto final comercializado, a saber: rizomas in natura. Desta forma, aps a colheita o rizoma geralmente submetida lavagem e limpeza manual, secagem natural, classificao, acondicionamento (embalagem) e transporte. Origem e destino da produo agrcola Cerca de 70% a 90 % da produo de Morretes destina-se exportao do produto in natura. Do restante desta produo, parte utilizada localmente, em forma de rizomas-semente ou encaminhada para processamento industrial, e parte encaminhada CEASA-PR, com sede em Curitiba, para comercializao in natura tanto nos boxes, por comerciantes locais, como nas pedras. Pequenas indstrias familiares No Paran no h registro de processamento do gengibre em nvel industrial, exceto o realizado por pequenas indstrias familiares localizadas em Morretes. Segundo tcnico da EMATER, em 2003, registraram-se 34 indstrias caseiras que processavam parte da colheita de gengibre neste municpio. Estas indstrias produzem principalmente balas, conservas e gelia de gengibre. Estes produtos so vendidos localmente, em outras cidades do litoral e, tambm, em feiras-livres e alguns supermercados de Curitiba. Segundo Santos (2000), o nmero destas indstrias em anos passados chegou a 150. Esta diminuio em relao ao observado atualmente pode ser um reflexo da prpria diminuio da produo local. A Resoluo n.23, de 15/03/2000 da Secretaria de Vigilncia Sanitria (BRASIL, 2000), que regulamenta o registro de produtos alimentcios, dispensa da obrigatoriedade de registro as indstrias que processam balas, doces e conservas. Entretanto, a Resoluo RDC n.275, de 21/10/2002, da Secretaria de Vigilncia Sanitria (BRASIL, 2002) recomenda aos estabelecimentos produHortic. bras., v. 23, n. 4, out.-dez. 2005

Anlise prospectiva do agronegcio gengibre no estado do Paran

tores de alimentos a aplicao do regulamento tcnico de procedimentos operacionais padronizados e verificao das boas prticas de fabricao. A pesquisa de campo realizada em Morretes revelou total ausncia de controle de qualidade nestas pequenas indstrias processadoras, tanto por parte da ANVISA local quanto de rgos extensionistas rurais e dos prprios proprietrios. Comercializao do gengibre in natura A CEASA-PR o principal polo receptor e de comercializao de gengibre in natura na Regio Metropolitana de Curitiba. Conforme dados obtidos da Diviso Tcnica Econmica da CEASA-PR (2002), a comercializao do gengibre in natura pela CEASA de Curitiba correspondeu a um volume aproximado de 200 t, no perodo de 2000 a 2001, com preo mdio por kg de R$ 0,90 a R$ 0,67, respectivamente. Deste volume comercializado neste perodo, 79,1% a 79,5% referiam-se ao produto procedente do municpio de Morretes. Os principais receptores do produto ofertado na CEASA-PR so supermercadistas, feirantes e comerciantes do Mercado Municipal de Curitiba (Figura 4). Segundo a Secretaria Municipal de Abastecimento de Curitiba (SMAB), no perodo de 2000 a 2001, as feiras-livres movimentaram cerca de 42,8% da comercializao anual do gengibre in natura e o Mercado Municipal de Curitiba 20,0% (PARAN, 2002). Limitaes e pontos de estrangulamento da cadeia produtiva de gengibre de Morretes Produo agrcola Geralmente o cultivo de gengibre est inserido na regio de ocorrncia da Floresta Ombrfila Densa (Floresta Atlntica), com severas restries de uso e ocupao impostas pelo IBAMA e Instituto Ambiental do Paran (IAP). Portanto, antes de iniciar o plantio, o produtor deve entrar em contato com estas instituies para obter o devido licenciamento ambiental. A cultura do gengibre tradicional no municpio de Morretes caracterizada pelo uso excessivo de agrotxicos, o que
Hortic. bras., v. 23, n. 4, out.-dez. 2005

potencializa o risco de dano ambiental prximo a regies de preservao ambiental e rios. H uma tendncia do mercado mundial, grande alvo da produo do municpio de Morretes, dar preferncia ao gengibre orgnico (SANTOS, 2000), visto que o uso inadequado de agrotxicos na agricultura poder trazer srios prejuzos segurana do trabalhador rural envolvido em sua aplicao, sade do consumidor e ao equilbrio do meio ambiente. A incidncia de pragas (principalmente lagarta-rosca, nematides e doenas Phyllosticta sp, Rhizoctonia solani, Fusarium oxysporum) compromete seriamente a produo de gengibre. O controle destas ou a reduo de seus efeitos tem sido conseguido, em parte, com a rotao de culturas e o emprego de rizomas-semente sadios. Outra grande dificuldade da cultura no municpio, segundo Santos (2000), a descapitalizao do produtor, que contraiu muitas dvidas com os bancos no incio da dcada de 90 e, em torno de 70 produtores, securitizaram suas dvidas. Com isso, h o impedimento ao acesso a novos crditos e, desta forma, comprometendo a produo, bem como a qualidade do produto. Comercializao De modo geral, os produtores de gengibre de Morretes se mostram insatisfeitos com o mercado externo. No h garantia de preo, nem existncia de um contrato estabelecido entre o agricultor e o comprador, determinando em muitos casos atraso ou mesmo a falta de pagamento pelo produto. Esta situao passa a configurar-se em desestimulo continuidade do plantio desta cultura, reforada pelo alto custo de produo (em mdia R$ 18.000,00/ha). Outro entrave relativo comercializao, considerado por alguns produtores como principal problema, a excessiva produo de gengibre no Brasil, dificultando a venda. Entretanto, as cifras de importao de gengibre desmentem este fato. Alguns outros produtores consideram como fator negativo na comercializao do produto brasileiro os baixos preos ofertados pela China, um dos grandes produtores mundiais. Entre outros fatores tambm apontados pelos produtores foi a alegao dos

atravessadores de que o produto paranaense deixa a desejar no aspecto qualidade com a presena de fungos e ausncia de controle sanitrio comprobatrio. imprescindvel que se diga que a comercializao est diretamente relacionada com a qualidade e preo. O produtor busca minimizar custos e obter o melhor preo para o seu produto, para potencializar a insero do produto no mercado e aumentar sua lucratividade, enquanto que o comprador espera obter a melhor qualidade possvel aliada a menores preos. um ciclo vicioso, que nem sempre considera o consumidor final como dependente direto do resultado deste processo. Controle de qualidade Observou-se uma grande carncia quanto ao controle higinico-sanitrio do sistema de produo como um todo, especialmente no beneficiamento pscolheita, por parte dos produtores. Conseqentemente, o produto final apresenta srio comprometimento de qualidade frente ao mercado consumidor regional e terceiros pases, especialmente no que concerne aos padres microbiolgicos referenciados como adequado em Brasil, 2001. A falta de qualidade que muitas vezes se iniciou na produo acaba persistindo no setor secundrio. A maioria das pequenas indstrias no aplica controle de qualidade ao produto, operando em situao bastante precria, bem como o descumprimento da Resoluo RDC n.275 (BRASIL, 2002), por parte da fiscalizao. Este tipo de situao demonstra descaso com a sade da populao consumidora destes produtos. Os comerciantes e produtores que comercializam na CEASA-PR consideram como critrios de avaliao de qualidade do rizoma de gengibre: tamanho, brilho, ausncia de terra aderida superfcie do rizoma, ausncia de brotamento e quebra. Entretanto, no fazem exigncia quanto certificao ou laudo tcnico que identifique a qualidade sanitria do produto comercializado. A grande maioria destes comerciantes mostrou desconhecer as orientaes e normatizaes legais sobre este aspecto e as implicaes da falta de qualidade na sade do consu1027

R. R. B. Negrelle et al.

midor. Estes apenas mencionam, ocasionalmente, as conseqncias do uso de agrotxicos. Tambm o consumidor pouco exigente, dado que compra produtos sem qualquer garantia de procedncia qualificada, mantendo assim a problemtica. Nos estabelecimentos de comercializao foram identificados problemas, na qualidade do produto comercializado, como os de origem nos manipuladores e na inexistncia de laudo laboratorial atestando o controle de qualidade do produto in natura adquirido do setor primrio, associados falta de qualidade sanitria evidenciada em algumas amostras comercializadas de gengibre in natura.

AGRADECIMENTOS
Aos agentes econmicos (produtores agrcolas, donos e funcionrios de empresas e demais envolvidos), que integram a cadeia produtiva do gengibre em Morretes, pelas informaes prestadas. Aos tcnicos da SEAB/PR, em especial a Sr. Gilka Andretta, ao Sr. Baltazar Henrique dos Santos e ao Sr. Rodrigo Aquino de Paula, pelas contribuies prestadas.

LITERATURA CITADA
BRASIL. Ministrio do Desenvolvimento Indstria e Comrcio Exterior. Secretaria de Comrcio Exterior - SECEX. Sistema Alice. Gengibre. Disponvel em: <http://www. aliceweb.desenvolvimentogovbr/consulta_nova/ resultadoConsulta.asp>. Acesso em: 30 jan. 2004. BRASIL. Ministrio da Sade. Secretaria de Vigilncia Sanitria. Resoluo n.23, de 15 mar. 2000. Dispe sobre o Manual de Procedimentos Bsicos para Registro e Dispensa da Obrigatoriedade de Registro de Produtos Pertinentes rea de Alimentos. Dirio Oficial da Unio, 16 mar. 2000. BRASIL. Ministrio da Sade. Secretaria de Vigilncia Sanitria. Resoluo - RDC n.12, de 02 jan. 2001. Regulamento tcnico sobre padres microbiolgicos para alimentos. Dirio Oficial, 10 jan. 2001.

BRASIL. Ministrio da Sade. Secretaria de Vigilncia Sanitria. Resoluo - RDC n.275, de 21 out. 2002. Regulamento tcnico de Procedimentos Operacionais Padronizados aplicados aos Estabelecimentos Produtores/Industrializadores de Alimentos e a Lista de Verificao das Boas prticas de Fabricao em Estabelecimentos Produtores/ Industrializadores de Alimentos. Dirio Oficial da Unio, 06 nov. 2002. CEASA/PR. CENTRAL DE ABASTECIMENTO DO PARAN S/A. Diviso Tcnica Econmica. Dados referentes evoluo da comercializao e procedncia do gengibre na CEASA de Curitiba - ano 2000/2001, Curitiba, 2002. CORRA JUNIOR; MING, L.C.; SCHEFFER, M.C. Cultivo de plantas medicinais, condimentares e aromticas. 2.ed. Jaboticabal: FUNEP, 1994. 151 p. CROP PROFILE. Ginger. Disponvel em: <http:/ /www.spicestat.org/ginger.html>. Acesso em: 20 nov. 2003. EPAGRI. EMPRESA DE PESQUISA AGROPECURIA E EXTENSO RURAL DE SANTA CATARINA S.A. Normas tcnicas da cultura do gengibre. Litoral Catarinense e Litoral Paranaense. Florianpolis: EPAGRI/EMATERPR/IAPAR, 1998. 26 p. (EPAGRI. Sistemas de Produo, 30). HERBS & SPICES. Important Spice. Ginger. Disponvel em: <http:// www.foodmarketexchange.com/datacenter/ product/herb/herb/detail/dc_pi_hs_herb0903.htm>. Acesso em: 20 nov.2003. IAPAR. INSTITUTO AGRONMICO DO PARAN. Cadeias produtivas. Por que fazer. Disponvel em: <http://www.pr.gov.br/cadeias / porque.html>. Acesso em: 20 nov.2003. INFORMAES Agrcolas. Disponvel em: <htpp://www.morretes.pr.gov.br>. Acesso em: 27 mai. 2002. IAPAR/Morretes. INSTITUTO AGRONMICO DO PARAN. Consultas tcnicas, Morretes, 2000/2001. INTERNATIONAL TRADE CENTRE UNCTAD/WTO. Essential oils and oleoresins: a study of selected producers and major markets. Genebra, p.26, 1986. LISSA, S.L. Cultura do Gengibre. Curitiba: EMATER/PR, 1996. 12 p. LONIEWSKI, I. Antiemetic activity of ginger rhizome extract (Zingiber officinale Roscoe) and eleuterococ root extract ( Eleuthrococcus senticosus Maxin). Herba Polonica, v.44, n.1, p.39-44, 1998. MARCHIORO, N.P.X. Mudana tcnica e a sustentabilidade agrrios: o caso de Morretes. In: NEGRELLE, R. R. B.; LIMA, R. E. Meio Ambiente e desenvolvimento no litoral do Paran: subsdios ao. Curitiba: NIMAD/UFPR, 2002, p.217-237.

NURIN. NCLEO REGIONAL DE APOIO A NEGCIOS INTERNACIONAIS. Dados obtidos junto ao Branco do Brasil. Curitiba, novembro, 2003. ONTENGCO, D.C.; DAYAP, L.A.; CAPAL, T.V. Screening for the antibacterial activity of essential oils from some Philippineplants. Acta Manilana. v.43, p.19-23, 1995. PARAN. Secretaria de Estado da Agricultura e do Abastecimento do Paran - SEAB. Departamento de Economia Rural - DERAL. rea, produo e valor bruto da produo de gengibre no Estado do Paran, Safra 01/02. Curitiba, 2003. PARAN. Secretaria Municipal do Abastecimento de Curitiba. Diviso de conjuntura econmica e controle estatstico. Dados obtidos da comercializao de gengibre. Curitiba, PR, 2002. PURSEGLOVE, J.W. Spices . v.2, London: Longman, p.447-531, 1981. (Tropical Agricultural Series). RCKER, N.G.A. Anlise econmica da cultura do gengibre. In: Secretaria de Estado de Agricultura e do Abastecimento/Departamento de Economia Rural, Curitiba, 1993. 21 p. RCKER, N.G.A. Gengibre. In: Informativo dirio DERAL, SEAB/PR, ano III, n 872, 10 abr. 2002. SANTOS, J.A. Aspectos scio-econmicos da cultura do gengibre no municpio de Morretes Paran, Curitiba, 2000. 55 f. Monografia (Graduao) - Universidade Federal do Paran, Curitiba. TAVEIRA MAGALHES, M. Gengibre (Zingiber officinale Roscoe) Brasileiro: aspectos gerais, leo essencial e oleoresina. Parte 1 - aspectos gerais, leo essencial. Cincia e Tecnologia de Alimentos, Campinas, v.17, n.1, p.64-69, 1997. TROPICAL Ginger. Disponvel em: <http:// www.ginger.com.br/ginger 1p.htm>. Acesso em: 26 set. 2000. UTPALENDU, J.; CHATTOPADHYAY, R.N.; PRASAD, S.B. Preliminary studies on antiinflammatory activity of Zingiber officinale Roscoe, Vitex negundo Linn. and Tinospora cordifolia (Willid) Miers in albino rats. Indian Journal of Pharmacology, v.31, n.3. p.232-233, 1999. WHO. WORLD HEALTH ORGANIZATION. Monographs on selected medicinal plants. v.1. Geneva, p.277-287, 1999. YOSHIKAWA, M. Stomachic principles in ginger. III. An anti-ulcer principle, 6-gingesulfonic acid, and three monoacyldigalactosylglycerols, gingerglycolipids A, B and C, from Zingiberis Rhizoma originating in Taiwan. Chinese Pharmacological Bulletin, v.42, n.6, p.1226-1230, 1994.

1028

Hortic. bras., v. 23, n. 4, out.-dez. 2005

VILELA, N.J.; MAKISHIMA, N.; OLIVEIRA, V.R.; COSTA, N.D.; MADAIL, J.C.M; CAMARGO FILHO, W.; BOEING, G.; MELO, P.C.T. Desafios e oportunidades para o agronegcio de cebola no Brasil. Horticultura Brasileira, Braslia, v.23, n.4, p.1029-1033, out-dez 2005.

Desafios e oportunidades para o agronegcio da cebola no Brasil


Nirlene J. Vilela1; Nozomu Makishima1; Valter R. Oliveira1; Nivaldo D. Costa2; Joo Carlos M. Madail3; Waldemar P. Camargo Filho4; Guido Boeing5; Paulo Csar T. de Melo6
Embrapa Hortalias, C. Postal 218, 70359-970 Braslia-DF; 2Embrapa Semi rido, C. Postal 23, 56300-970 Petrolina-PE; 3Embrapa Clima Temperado, C. Postal 403, 96001-970 Pelotas-RS; 4Instituto de Economia Agrcola, Av. Miguel Stefano, 3.900, 04301-903 So Paulo-SP; 5Instituto CEPA, C. Postal 1587, 88034-001 Florianpolis-SC; 6USP-ESALQ, Depto. de Produo Vegetal, C.Postal 9, 13418900 Piracicaba-SP; E-mails:nirlene@cnph.embrapa.br; nozomu@cnph.embrapa.br; ndcosta@cpatsa.embrapa.br; valter@cnph.embrapa.br; madail@cpact.embrapa.br; camargofilho@iea-sp.gov.br; guido@cepa.com.br; pctmelo@esalq.usp.br
1

RESUMO
Este trabalho teve por objetivo descrever alguns aspectos socioeconmicos relacionados cebola no Brasil e detectar os principais desafios e oportunidades que o produto apresenta para o agronegcio. A cultura, de carter tipicamente familiar (88%), gera cerca de 250 mil empregos somente no setor de produo. O consumo estvel em 85 mil t por ms. A consolidao do Mercosul e a conseqente importao de cebola da Argentina somada produo nacional tem causado excesso de oferta em alguns meses, gerando perdas e conseqentes prejuzos para os produtores. O setor produtivo brasileiro necessita elevar o nvel tecnolgico para alcanar maior eficincia tcnica e econmica. No entanto, necessrio que as regies produtoras do Brasil e da Argentina tenham estabilidade de produo e que a quantidade ofertada seja suficiente para atender s necessidades de abastecimento em determinados perodos do ano, sem causar desequilbio no mercado. Palavras-chave: Alium cepa, agronegcio, competitividade, mercado, produo, importao.

ABSTRACT
The challenges and the oportunities for the onion agribusiness The main objective of this work was to describe some socieconomic aspects of the onion production in Brazil and to detect the principal challenges and opportunities for the onion agribusiness. The onion cultivation in Brazil is a family activity (88%), generating about 250 thousand jobs directly involved in the production. The onion consumption in Brazil is nearly 85 thousand t per month. With the consolidation of the MERCOSUL, the onion import from Argentina and the national production has caused excess of supply in some months, generating losses and consequent damages for the producers. The Brazilian productive sector needs to improve the technological level of the onion production to reach greater technical and economic efficiency. However, it is necessary that Brazilian and Argentinian producers look for a better production forecast to avoid excess of supply during some periods of the year. Keywords: Allium cepa , agribusiness, competitiveness, commercialization, production, importation.

(Recebido para publicao em 4 de novembro de 2004 e aceito em 14 de setembro de 2005) o Brasil, como geradora de empregos e renda na agricultura, a cultura da cebola uma atividade de elevada importncia socioeconmica. Em razo de no existir uma poltica comercial restritiva entre os pases do MERCOSUL, as entradas livres e intempestivas do produto estrangeiro, em detrimento das atividades produtivas do Brasil transferem-se para uma preocupao social mais ampla. Neste aspecto, a realizao de estudos de natureza exploratria sobre a situao do mercado da cebola no Brasil nos ltimos anos pode ser til e necessria para subsidiar polticas setoriais e novas estratgias de produo e comercializao. As informaes obtidas podero auxiliar os agentes do agronegcio, instituies de pesquisa e desenvolvimento e formuladores de poltica setorial nas tomadas de deciso para redirecionar a cebolicultura brasileira, com vistas a elevar as condies de competitividade do produto.
Hortic. bras., v. 23, n. 4, out.-dez. 2005

O objetivo deste trabalho foi elaborar uma anlise descritiva da situao de mercado da cebola no Brasil nos ltimos trs anos e, especificamente, detectar desafios e oportunidades para o agronegcio da cebola no Brasil.

MATERIAL E MTODOS
O trabalho foi elaborado com base na sistematizao e anlises das informaes obtidas em reunies tcnicas para identificao de sistemas de produo predominantes nas principais regies produtoras do Pas, realizadas com a participao dos agentes do agronegcio de cebola em SC, SP e PEBA, (VILELA et al., 2002). Adicionalmente, utilizaram-se os relatrios dos encontros intitulados Seminrio Nacional de Cebola Seminrio de Cebola do MERCOSUL, promovidos pelo agronegcio de cebola do Brasil e do MERCOSUL para escalonamento de

oferta dos anos de 1999-2003 e as informaes obtidas de fontes oficiais (IBGE e MDIC) e de outros trabalhos publicados. Os resultados foram descritos com base na sistematizao e anlise das informaes, acerca da situao estrutural da produo e do comportamento de mercado (KING, 1967; KERBY, 1992).

RESULTADOS E DISCUSSO
No mbito da agricultura brasileira, a cebola destaca-se como uma cultura de elevada importncia socioeconmica. No aspecto de gerao de emprego e renda, estima-se que a cadeia produtiva gere mais de 250 mil empregos diretos s no setor da produo (SAASP, 1997). De acordo com censo agropecurio de 1996 (IBGE, 2002), so mais de 102 mil produtores envolvidos na explorao econmica da cebola. A cultura de carter tipicamente familiar (88%) res1029

N. J. Vilela et al.

Tabela 1. Calendrio de colheita e comercializao de cebola no Brasil, 2003.


Estados/indicaes Santa Catarina Colheita Comercializao Rio Grande do Sul Colheita Comercializao Paran Colheita Comercializao So Paulo Colheita Comercializao Pernambuco e Bahia Colheita Comercializao Minas Gerais Colheita Comercializao X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X Meses 1 2 3 4 5 6 7 8 9 10 11 12

Fonte: ANACE,2003

ponsvel pela sobrevivncia no campo de um grande nmero de pequenos produtores que tm a cebola como nica fonte de renda (VILELA et al., 2002). Uma das caractersticas marcantes do setor produtivo que, mesmo nas mdias e grandes propriedades, o sistema de produo em parceria, ou seja, o empresrio fornece a terra, capital, mquinas e insumos, enquanto as famlias parceiras entram com mo-de-obra para o cultivo, tratos culturais e colheita. Maior parte (65,8%) dos produtores de cebola est concentrada nos extratos de rea menores que 20 ha e so responsveis por 51,7% da produo nacional (IBGE, 2002). Direes da cadeia produtiva No mbito da cadeia produtiva, foram observados dois cenrios. No segmento da produo, a preocupao com a competio externa colocou o atendimento s exigncias do mercado como o principal centro de ateno do agronegcio da cebola. Neste aspecto, os produtores procuram por produto com maior competitividade em qualidade, custos e preos, optando por cultivares que garantam maior produtividade, apresentem maior grau de resistncia s doenas e forneam produtos comerciais com alto padro de qualidade
1030

e maior produtividade. Estas preferncias incluem cultivares de polinizao aberta ou hbridas que proporcionem uma colheita uniforme, exatamente dentro da poca programada. Adicionalmente, estas cultivares ou hbridos devem exibir padro comercial similar ao do produto importado, especialmente quanto uniformidade no tamanho do bulbo, cor, reteno de escamas e sabor. Ademais, percebe-se clara avidez por tecnologias para produo de cultivares de cebola menos pungentes (tipos doces ou suaves), mais adequadas para consumo fresco em saladas e tipos mais apropriados industrializao (flocos e p) e, tambm, cultivares adequadas para cultivo em sistemas orgnicos, como forma de agregar maior valor ao produto nacional (VILELA et al., 2002). No segmento dos consumidores, observam-se preferncias pela tima qualidade do produto, diversificao de tipos varietais (tipos mais e tipos menos pungentes), produtos diferenciados (produo em sistemas orgnicos e agroecolgicos), disposio dos produtos classificados e com melhor conservao ps-colheita. Nas observaes de Boeing (2002), os consumidores preferem cebolas com bulbos globulares com casca de colorao avermelhada semelhante cor do pinho.

Diante destas exigncias, as instituies de pesquisa pblicas e privadas vm ajustando suas atividades para atender s demandas dos produtores e dos consumidores, procurando desenvolver cultivares com as caractersticas que atendam s tendncias atuais do mercado. Distribuio das safras e preos de mercado Em decorrncia das exigncias da cultura quanto ao fotoperodo e temperatura, as cultivares regionais so diferenciadas. Na BA e PE, as cultivares predominantes so as importadas claras precoces e as da srie IPA, com resistncia conservao de 30 a 45 dias aps a colheita. Em SP, na safra do cedo, as cebolas produzidas so as claras precoces e, nas semeaduras tardias, as baias periformes. Em MG, GO e DF, predominam cultivares claras precoces e a baia periforme. Em SC, as cultivares mais plantadas so as crioulas de casca escura, pungentes e com armazenamento ps-colheita, que pode se estender por at 6 meses, e as cultivares baias periformes precoces. No RS, os produtores cultivam tradicionalmente cebolas do grupo baia periforme, cuja semente produzida no prprio estado. Desta forma, a oferta de cebola se distribui durante o ano todo (Tabela 1).
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Desafios e oportunidades para o agronegcio de cebola no Brasil

Tabela 2. Programao da oferta de cebola em mil toneladas, 2003.


Ms JAN FEV MAR ABR MAI JUN JUL AGO SET OUT NOV DEZ Total 1,00 17,50 50,00 0,45 4,40 17,60 220,00 6,40 16,00 65,60 RS 16,50 15,00 SC 39,60 55,00 55,00 39,60 8,35 9,25 26,84 26,23 54,64 45,79 37,05 30,52 9,09 239,24 PR 18,00 19,20 6,00 SP MG 3,45 2,40 3,30 1,47 2,18 5,45 9,22 10,40 10,25 5,69 4,44 4,10 62,36 BA/PE 3,50 3,00 4,50 19,09 25,32 23,34 20,15 16,00 14,10 16,50 14,00 12,00 171,50 32,40 2,00 6,00 13,00 11,40 GO Brasil 81,05 94,60 68,80 62,60 51,10 68,63 66,90 81,04 70,14 59,70 60,76 76,22 841,09 150,000 ARG 4,00 9,00 16,50 28,50 34,50 27,00 19,50 7,50 3,50 MERCOSUL 85,05 103,60 85,30 90,66 85,60 95,63 86,40 88,54 73,64 59,69 60,76 76,22 991,09

Fonte: ANACE, 2003.

Desde 1989, com o objetivo de organizar a produo e a comercializao da cebola no Brasil, os agentes do agronegcio do Brasil e da Argentina (Associaes Regionais de Produtores, Associao Nacional de Produtores de Cebola-ANACE, comerciantes de cebola e de insumos para a cultura, pesquisadores, extensionistas) vm realizando, anualmente, o Seminrio Nacional da Cebola, quando registra-se um acordo para a consolidao de safras e a oferta anual dos dois pases para o mercado brasileiro. Para 2003 foi programada a oferta de 841 mil t de cebola brasileira e de 150 mil t de cebola argentina (Tabela 2). Entretanto, de acordo com o IBGE (2004) a produo naquele ano foi de, aproximadamente, 1.187mil t, superando a oferta interna (841.099 t) em aproximadamente 346 mil t. Os grandes Estados produtores como SC, SP e BA aumentaram a rea plantada e a produo em relao ao ano anterior. Alm disso, outros Estados de menor expresso econmica na cebolicultura, como o caso de GO e MG vm investindo na cultura e formando novos plos ceboleiros. Por outro lado, elevada a elasticidade-preo da oferta da cebola, caracterstica econmica determinante no processo de produo e comercializao que expressa a sensibilidade da produo s variaes de preos. As variaes de preos so estacionais e ocorrem com certa freqncia, o que pode ser resultado do
Hortic. bras., v. 23, n. 4, out.-dez. 2005

efeito da teoria da teia de aranha: em determinada poca do ano, o preo alto e a produo baixa, e no ano seguinte, o produtor, estimulado pela alta do preo, aumenta a produo; o aumento da oferta tende a gerar queda dos preos. Isso pode ser observado no perodo de 1998 a 2003, o preo mdio de cebola no mercado atacadista foi de R$ 479,22 por tonelada. A variao bianual dos preos mostrou pouca diferena entre os anos pares e mpares. Os preos maiores ocorreram em anos com final par (de maro a julho, ficaram acima da mdia), enquanto nos anos mpares, a ocorrncia de preos acima da mdia foi menor. A diferena da mdia entre anos pares e mpares foi de 25%. O principal mercado atacadista no Brasil a Ceagesp (Companhia de Entrepostos e Armazns Gerais do Estado de SP), que comercializou em 2003, um volume de 92.379 t de cebola nacional (76%) e importada (24%). Situao do consumo O consumo da cebola no Brasil apresentou tendncia de aumento de produtos processados ao final da dcada de 1990 e incio do sculo 21. Em razo do aumento da populao urbana e da maior participao da mulher no mercado de trabalho, as famlias passaram a fazer maior nmero de refeies fora do domiclio. Apesar da reduo do consumo domiciliar de bulbos de 6,5 kg/ hab/ano em 1987 para 3,5 kg/hab/ano em 2003 (IBGE, 2004), vem aumentando o consumo de cebola processada com

pasta de alho e sal, purs e catchup e cebolas desidratadas. O consumo institucional (setor de refeies coletivas) evoluiu no perodo de 1998/2002 em 37% (BRASIL, 2002) e, em levantamento recente realizado por Cabrera Filho (2004) relata que o consumo mdio de cebola no Brasil situa-se em torno de 85 e 90 mil t/ms. importante ressaltar que o IBGE pesquisa o consumo familiar no mbito dos domicilios. Para formar uma ideia sobre a quantidade consumida em todos os segmentos do consumo, alm das unidades familiares deve-se pesquisar o consumo das agroindstrias e o chamado consumo institucional (setores de refeies coletivas representados pelas lojas de comidas prontas, restaurantes, merenda escolar, hospitais e outros). Importaes brasileiras para o abastecimento nacional As importaes brasileiras aumentaram nos ltimos anos. Uma das razes que pode explicar este crescimento a boa aparncia da cebola argentina, associada a sua boa conservao ps-colheita. Isto contribui para que os consumidores optem pelo produto importado, o que implica na transferncia de valor agregado para o pas vizinho (CAMARGO FILHO, 1999). De acordo com Porter (1993) a principal vantagem competitiva entre as naes consiste em aumentar sucessivamente a produtividade dos fatores e diferenciar os produtos em excelncia de qualidade.
1031

N. J. Vilela et al.

Tabela 3. Comportamento do mercado de cebolas frescas em 2003.


* Oferta A JAN FEV MAR ABR MAI JUN JUL AGO SET OUT NOV DEZ TOTAL 81.050, 94.600, 68.800, 62.160, 51.100, 68.632, 66.905, 81.038, 70.145, 59.691, 60.760, 76.218, 841.099, Importao B 3.925, 9.285, 37.757, 45.922, 44.662, 12.879, 10.810, 5.345, 1.335, 344, 111, 302, 172.677, Estoque C= A+ B 84.975, 103.885, 106.557, 108.082, 95.762, 81.511, 77.715, 86.383, 71.480, 60.035, 60.871, 76.520, 1.013.776, * * Consumo D 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 85.000, 1.020.000, Suficincia estoques E= D - C -25, 18.885, 21.557, 23.082, 10.762, -3.489, -7.285, 1.383, -13.520, -24.965, -24.129, -8.480, -6.224, Exportao F 30,7 0,6 0 0,3 0,5 0,3 0 194,5 422 248,7 1,1 1,7 900,4 Suprimento do mercado = (E - F) -55,7 18.828,7 40.385,7 63.467,4 74.228,9 70.739,6 63.454,6 64.643,1 50.701,1 25.487,4 1.357,3 -7.124,4

Fonte: BRASIL. Ministrio do Desenvolvimento da Indstria e Comrcio (2004a, 2004b); ANACE (2003) *Programada; **estimado

Tabela 4. Sistemas predominantes e custos de produo de cebola no Brasil.


Principais produtores Santa Catarina Sistemas de produo predominantes - Cultivo mnimo com microtrator (15.000 t/ha) - Cultivo mnimo com trator (25.000 t/ha) - Cultivo mnimo com trator (35.000 t/ha) - Sistema agroecolgico (10 t/ha) So Paulo Petrolina-PE Juazeiro-BA Rio Grande do Sul Plantio direto (36 t/ha) Transplante (25 t/ha) Transplante (20tha) Custos de produo (R$) 3.981,12 6.475,36 8.194,94 3.256,00 7.754,38 4.519,96 3.699,00

Fonte: Vilela et al., 2002.

A cebola fresca ou refrigerada foi o principal tipo importado pelo Brasil (99%). Nos ltimos anos, as importaes de alguns tipos, como cebola seca, foram reduzidas. Outras, tais como echalotes e conservas no esto constando da pauta de importaes de cebolas. A proposta da Argentina de lanar 150 mil t de cebola fresca no mercado brasileiro em 2003 realizou-se com um acrscimo de 21,4 mil t. Em adio s excessivas importaes da Argentina (171,4 mil t) o Brasil ainda importou mais de 1,2 mil t de outros pases. Em 2003, o Brasil importou cebola fresca desnecessria e intempestivamente durante o ano inteiro, no somente da Argentina como planejado, mas tambm de outros pases. A excessiva quantidade importada, somada aos estoques de SC, RS e PR, que so comercializados na mesma poca de
1032

maior entrada do produto estrangeiro, ultrapassam as reais necessidades de abastecimento do mercado, resultando em perdas para a cebolicultura brasileira. A ocorrncia deste fato pode ser explicada pela falta de um planejamento sistemtico da produo: planta-se demais e perde-se muito, seja por deficincia de armazenagem, seja pelo comportamento de mercado no processo de expurgo da carga excedente. Subtraindo da produo interna de 1.187 mil t (IBGE,2004) as necessidades de consumo de 1.020 mil t conforme tabela 3 e as exportaes de 900,4 t, o resultado um excedente de produo equivalente a 166,2 t. Este resultado evidencia que a importao de cebola fresca desncessria, uma vez que a safra brasileira foi mais do que suficiente para suprir o mercado nacional. Entretanto, por fora de acor-

do com o MERCOSUL, foi planejado um espao de 150 mil t no mercado brasileiro para a produo argentina, porm a Argentina destinou ao Brasil 171.436 t que, somadas s importaes de outros pases, totalizaram 172.677 t importadas. Considerando a oferta programada do Brasil (841.099 t) mais as importaes realizadas (172.677 t) menos as exportaes (900,4 t), observa-se um dficit operacional no mercado (-7.124 t). Quando se correlaciona o excedente da produo oferta programada, consumo e exportaes, verifica-se que as importaes representaram uma parcela de 51% no total excedente. No Brasil ocorrem situaes em que a cebola, como nica fonte de renda dos produtores, precisa ser comercializada imediatamente aps a colheita, at mesmo sem cura, para recuperar o escasso capital de giro e sustentar a sobrevivncia da famlia. Sem cura, a cebola, alm da aparncia no-atrativa, fica mais exposta s deterioraes. Alm dos bulbos mal curados, verifica-se ainda o apodrecimento por falta de ambiente adequado ao armazenamento, bulbos atacados por pragas e doenas, manuseio e transporte feito sem cuidados, m aparncia visual dos bulbos (desuniformes, descascados ou com cascas muito finas). Em algumas regies, como NE e SE so utilizadas cultivares inadequadas que no apresentam resistncia ao armazenamento. Pelo fato desHortic. bras., v. 23, n. 4, out.-dez. 2005

Desafios e oportunidades para o agronegcio de cebola no Brasil

tas cultivares de cebola possurem baixo teor de slidos solveis totais na sua composio, imediatamente aps serem colhidas e curadas, necessitam ser comercializadas, gerando um grande fluxo de cebola de baixa qualidade no comrcio. Esta situao traz, consequentemente, quedas de preos, reduzindo a rentabilidade da cultura e elevando os nveis de perdas. Assim, no segundo semestre, observam-se quedas de preo por excesso de oferta, em razo da impossibilidade de armazenamento. No primeiro semestre, o escoamento dos estoques armazenados da cebola de ciclo tardio confrontase com os da cebola importada. No Brasil, a caracterstica marcante da oferta de cebola a estacionalidade da produo. Levando-se em conta o nvel da tecnologia adotado pelos produtores e as condies de clima, muitas vezes desfavorveis cultura, as mdias de produtividade so baixas, variando de 15 a 17 t/ha. De acordo com Vilela et al. (2002), os custos mdios operacionais da cebola variam de acordo com o nvel tecnolgico da cultura (Tabela 4). De acordo com Tosi (2003), na Argentina, o custo mdio operacional total da cebola, em 2003, foi de U$ 1.465,02, ou seja, R$ 2.809,59, para o nvel de produtividade de 1200 bolsas de 25 kg. A produtividade mdia da cebola Argentina, confirmada por Galmarini (2004) varia entre de 26 a 28 t/ha, levando-se em conta as cultivares de dia curto, intemedirio e longo. Para o caso das cultivares de dia longo tipo Valencianas, que ocupam 80% da rea plantada a produtividade mdia situa-se em torno de 33 t/ha. Diante das condies produtivas do Brasil, factvel esperar um cenrio favorvel para a Argentina (BARBERO; CASTELLANO; LUCARENA, 2000). Na Argentina existe maior integrao dos setores produtivos com o governo. Alm disso, o solo frtil necessita de pouca adubao, principalmente de fsforo e potssio, o que contribui para a reduo dos custos operacionais. Na produo de cebola, outro fator que explica as vantagens da Argentina em relao ao Brasil o clima que favorece os ganhos de produtividade e a qualidade dos bulbos (CAMARGO FILHO, 2000). As situaes de produo e comercializao permitem a concluso de que a permanncia da cebola do BraHortic. bras., v. 23, n. 4, out.-dez. 2005

sil ou da Argentina no mercado brasileiro passa pela questo da competitividade. Apesar da produtividade mdia da cebola brasileira ser mais baixa ,quando comparada da Argentina e os custos de produo mais elevados, novas fronteiras de produo esto surgindo em So Gotardo (MG), Cristalina (GO) e Chapada Diamantina (BA). Nesses novos polos predominam lavouras de grande extenso, mecanizadas, operando com elevado nvel tecnolgico. A produtividade mdia desses locais tem sido superior a 50 t/ha e qualidade comparvel do similar importado. Na regio de Irec (BA), a cultura da cebola vem evoluindo de forma considervel nos ltimos anos. Os produtores de Irec vm adotando tecnologia de produo superior da tradicional zona do submdio So Francisco (PEBA). Conseqentemente, as mdias de produtividade obtidas tm sido superiores a 25 t/ha. Estas novas fronteiras de produo tm contribudo, de forma significativa, para as mudanas no cenrio da comercializao de cebola do pas e, diretamente, so tambm responsveis pela fragilidade dos pequenos produtores tecnologicamente menos eficientes. Na situao de desarticulao apresentada pelo mercado da cebola fresca, em razo de excesso de produo e excesso de importaes, torna-se necessria a racionalizao da produo (reduo de rea mdia plantada nas regies e elevao do nvel tecnolgico dos sistemas) para que sejam gerados ganhos de produtividade com capacidade de diluir custos e, ao mesmo tempo, elevar a qualidade da cebola nacional. A vantagem competitiva do produto da Argentina no mercado brasileiro deve se manter enquanto o pas vizinho cuidar da qualidade e da apresentao da cebola que exporta, a menos que o Brasil, e em particular os estados do Sul, invistam mais em tecnologias, com vistas a alcanar maior eficincia tcnica e econmica dos atuais sistemas produtivos. Outra alternativa diversificar a oferta de variedades, procurando diferenciar o produto em relao ao concorrente, como a produo de cebola tipo doce ou em sistemas orgnicos ou agroecolgicos. Nos estados do NE, onde o clima apresenta condies favorveis, a produo de cebola tipo salada (cebola doce) com vistas s exportaes para os Estados Unidos e Europa, pode

tornar-se uma alternativa rentvel para os produtores.

LITERATURA CITADA
ANACE. Escalonamento mensal da oferta de cebola para 2003: em toneladas. In: SEMINRIO NACIONAL DE CEBOLA, 15; SEMINRIO DE CEBOLA DO MERCOSUL, 16, 2003, Petrolina. Anais... Petrolina: Embrapa Semi-rido, 2003. BARBERO, A.; CASTELLANO, A.; LUCANERA, G. Situao actual y perpectivas del cultivo de cebolla en el Valle Bonaerense del Rio Colorado. In: REUNIN ANUAL DE LA AAEA, 29., 1998, La Plata. Trabajos y comunicaciones... Buenos Aires: AEEA, 2000. BOEING, G. Fatores que afetam a qualidade da cebola na agricultura familiar catarinense. Florianpolis: Instituto Cepa, 2002. 88 p. BRASIL. Ministrio do Desenvolvimento da Indstria e Comrcio. Importao brasileira, 07031019: outras cebolas frescas ou refrigeradas. Disponvel em: <http://aliceweb.desenvolvimento.gov.br>. Acesso em: 22 jan. 2004a. BRASIL. Ministrio do Desenvolvimento da Indstria e Comrcio. Exportao brasileira, 07031019: outras cebolas frescas ou refrigeradas. Disponvel em: <http://aliceweb.desenvolvimento.gov.br>. Acesso em: 22 jan. 2004b. BRASIL. Ministrio da Integrao Nacional. Refeies coletivas: um segmento que apresenta oportunidades para o produtor. Frutifatos, Braslia, DF. Edio 3. p.2-10, 2002. CABRERA FILHO, J. Relatrio da produo de cebola no Brasil: 2004. So Paulo: Secretaria da Agricultura e Abastecimento. 2004. 5 p. (Documento). CAMARGO FILHO, W.P. Produo e mercado de cebola no MERCOSUL: 1990-98. Informaes Econmicas, So Paulo, v.29, n.4, p.19-30, 1999. CAMARGO FILHO, W.P. Alteraes no mercado de cebola com o MERCOSUL: Informaes Econmicas, So Paulo, v.32, n.14, p.41-49, 2000. GALMARINI, C. Rendimiento da cebolla en Argentina. INTA. Crgalmarini@mendoza.inta.gov.ar (comunicao via E-mail em 03/11/2004). IBGE. Censo Agropecurio:1996.Nmero de informantes por extratos de reas. Disponvel em: <http:/ /www.sidra.ibge.gov.br>. Acesso em: 20 dez. 2002. IBGE. Produo agrcola municipal de cebola. Disponvel em: <http://www.ibge.gov.br>. Acesso em: 09 fev. 2004. IBGE. Pesquisa de oramento familiar-2003. Disponvel em: <http://www.ibge.gov.br>. Acesso em: 18 abr. 2004. KERBY, J.K. Essencial of marketing management. Chicago: South-Western Publishung Company, 1992. 696 p. KING, R.W. Anlise quantitativa em administrao mercadolgica. So Paulo: USP, 1967 682 p. PORTER, M.E. A vantagem competitiva s das Naes. Rio de Janeiro: campus,1993. 897 p. SAASP. Repensando a agricultura paulista. So Paulo, 1997. 43 p. TOSI, J.C. INTA Balcarce: suplemento econmico n. 25: costo operativo de cebolla. Disponvel em: <http:/ /www.inta.gov.ar/balcarce/info/documentos/econo/ suple/25/cebolla.htm> Acesso em: 09 dez. 2003. VILELA, N.J.; MAKISHIMA, N.; VIEIRA, R.C.M.T.; CAMARGO FILHO, W.P.; MADAIL, J.C.M.; COSTA, N.D.; BOEING, G.; VIVALDI, L.F.; WERNER, H. Identificao de sistemas de produo de cebola nos principais Estados produtores: relatrio final de pesquisa - subprojeto 13.2001.86507. Braslia: Embrapa Hortalias, 2002.

1033

Errata

No artigo Efeito da sacarose, cinetina, isopentenil adenina e zeatina no desenvolvimento de embries de Heliconia rostrata in vitro, publicado no v.23, n.3, julho a setembro de 2005, p. 789-792, retifica-se o nome de um dos autores, constante da pgina 789. Onde se l: Fernanda D. Duval, leia-se: Fernanda G. Duval.

1034

Hortic. bras., v. 23, n. 4, out.-dez. 2005

ndice dos autores do v.23, 2005 (O numero da pgina em negrito indica o primeiro autor)
Abboud, A.C.S. ...................... 117, 281 Almeida, D.L. ................................ 184 Almeida, G.C. ................................. 993 Almeida, G.R.O. ............................. 970 Almeida, I.P.C. ............................... 960 Alvarenga, A.A. ............................. 846 Alvarenga, M.A.R. ......................... 976 Alves, A.U. ....................................... 19 Alves, D.S. ....................................... 28 Alves, R.E. ..................................... 793 Amaral Jnior, A.T. ....... 22, 123, 1000 Amaral, C.L.F. ................................ 911 Amaro Filho, J. .............................. 718 Andrade Jnior, V.C. ...................... 899 Andrade, F.V. .................................... 90 Andreuccetti, C. ............ 148, 324, 940 Andriolo, J.L. ................................. 931 Anti, G.R. ........................................ 271 Aquino, L.A. ......................... 100, 266 Arago, F.A.D. ............................... 789 Arajo, J.S.P .................................... 05 Arajo, M.G.................................... 143 Arie F. Blank .................................. 780 Arimura, C.T. ................................. 982 Arrigoni-Blank, M.F. ..................... 780 vila, A.C. ..................................... 904 Bacarin, M.A. ................................. 799 Banzatto, D.A. ................................ 743 Baptista, G.C. ................................... 38 Barbieri, V.H.B. .............................. 826 Barbosa, J.C. ............................ 51, 311 Barbosa, J.A. .................................. 925 Barbosa, L.J.N. ...................... 128, 768 Barbosa, Z. ..................................... 960 Barros Jnior, A.P. ... 233, 285, 290, 712 Barros, A.F.F. ................................. 789 Barros, G.T. .................................... 931 Baptista, G.C. ................................... 38 Batista, J.A. .................................... 841 Belfort, G. ....................................... 960 Beraldo, M.R.B.S. .......................... 143 Bergamin, L.G. ............................... 311 Bernardi, A.C.C. ............................. 920 Bertolucci, S.K.V. ................. 735, 956 Bervald, C.M.P. .............................. 799 Bezerra Neto, F. ........ 90, 133, 189, 233, 285, 290, 712, 754, 773
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Biscegli, C.I. ................................... 793 Blat, S.F. ........................................... 72 Blumer, L. ...................................... 881 Boeing, G. ..................................... 1029 Boff, P. ............................................ 875 Boiteux, L.S. ................. 105, 815, 819 Bordallo, P.N. ................................. 123 Bortolotto, O.C. .............................. 931 Botelho, R. ..................................... 805 Botrel, T.A. ..................................... 316 Braz, L.T. ........................................ 743 Braz, M.S.S. ................................... 915 Brito, C.H. ...................................... 826 Caetano, L.C.S. ............................ 1015 Caf Filho, A.C. .................... 228, 945 Caliman, F.R.B. ..................... 255, 893 Cmara, M.J.T. ...................... 233, 712 Camargo Filho, W.P. .................... 1029 Camargo, M.S. ............................... 271 Campos, R.S. .................................. 215 Caizares, K.A.L. ............................ 09 Cantarella, H. ................................. 726 Cardoso, A.A. ................................. 255 Cardoso, A.D. ................................. 911 Cardoso, A.I.I. ............... 198,.785, 837 Cardoso, F.B. .................................. 138 Cardoso, J.C. .................................. 169 Cardoso, J.C.W. .............................. 956 Cardoso, M.O. ................................ 128 Cardoso, A.I.I. ....................... 198, 731 Carmello, Q.A.C. ........................... 271 Carmo, M.G.F. ............... 117, 281, 915 Carneiro, C.R. ................................ 754 Carnelossi, M.A.G. ................ 215, 970 Carrijo, O.A. ........................... 57, 105 Carvalho, A.M. .............. 250, 805, 851 Carvalho, J.G. ................................. 174 Carvalho, L.A. ................................ 986 Carvalho, W. .................................. 819 Caseiro, R.F. ................................... 887 Castro, A.C.R. ................................ 699 Castro, E.M. ................................... 846 Castro, M.R.S. ....................... 100, 266 Catelan, F. ....................................... 853 Ceclio Filho, A.B. .. 763, 831, 853, 990 Csar, M. ........................................ 228

Charchar, J.M. ................................ 851 Corra, P.C. .................................... 722 Corra, R.M. ................................... 956 Costa, A.S. ...................................... 699 Costa, C.A. ....................................... 28 Costa, C.L. ..................................... 929 Costa, C.P. ............................... 72, 158 Costa, F.A. ...................................... 773 Costa, F.B. ...................................... 112 Costa, L.C.B. .................................. 956 Costa, M.R. .................................... 221 Costa, N.D. ................ 707, 1010, 1029 Cruz, C.D. ........................................ 44 Cruz, M.C.P. .................... 51, 311, 758 Dantas, A.C.M. ................................. 86 Debarba, J.F. ................................... 875 Deleito, C.S.R. ....................... 117, 281 Derbyshire, M.T.V.C. ..................... 221 Deuner, S. ....................................... 799 Dias, E.N. ................................ 94, 275 Dias, R.C.S ..................................... 179 Domingues, R.J. ............................. 749 Dro, L.F.A. ................................. 1006 Duarte, J.M. .................................... 826 Duarte, R.P.F. ................................. 299 Dusi, A.N. ....................................... 929 Duval, F.D. ..................................... 789 Eklund, C.R.B. ............................. 1015 Elpo, E.R.S. .................................. 1022 Espnola Sobrinho, J. ............ 133, 773 Fabbrin, E.G. .................................... 48 Faquin, V. ....................................... 735 Farias, M.F. .................................... 740 Fernandes, L.A. ................................ 28 Fernandes, L.E. .............................. 228 Fernandes, M.C.A. ................. 117, 281 Ferreira, J.M. ................................ 1015 Ferreira, L.S. .................................. 799 Ferreira, M.D. ..... 148, 324, 1018, 940 Ferreira, M.E. .................. 51, 311, 758 Ferreira, M.R. ................................. 749 Ferri, P.H. ....................................... 956 Filgueiras, H.A.C. .......................... 793 Finger, F.L. .............................. 81, 722 Fiorini, C.V.A. ................................ 299 Fiorini, I.V.A. ................................. 299
1035

Firme, L.P. ...................................... 722 Florio, F.C.A. ................................. 899 Foltran, D.E. ................................... 935 Fonseca, L.N. ................................. 904 Fonseca, M.E.N. ........... 815, 819, 851 Fontes, P.C.R. .................. 94,.255, 275 Fontes, S.M. ................................... 780 Fortes, G.R.L. ................................... 86 Frana, R.B. ..................................... 86 Franco, A.T.O. .............................. 1018 Franzin, S.M. .................................. 193 Freitas, D.F. .................................... 112 Freitas, K.K.C. ...................... 285, 290 Furtado, E.L. .................................. 198 Gabriel, A.P.C. ............................... 123 Gaia, J.M.D. ................................... 221 Galvo, H.L. ..................................... 81 Garcia Jnior, O. ............................ 749 Garcia, D.C. ................................... 193 Giordano, L.B. .............. 105, 815, 819 Godoi, R.S. ..................................... 931 Godoy, A.R. .................................... 785 Godoy, M.C. ................................... 837 Gois, V.A .......................................... 15 Gomes Jnior, J. ............................. 112 Gomes, A.M.A. .............................. 108 Gomes, J.M.R. ............................. 1015 Gomes, L.A.A. ............................... 299 Gomes, L.S. .................................... 826 Gomes, T.M. ................................... 316 Gonalves, K.S. ............................... 05 Goto, R. ............................................ 09 Graa, R.N. ..................................... 275 Grangeiro. L.C. .............................. 763 Grosso, C.R.F. ................................ 841 Guerra, J.G.M. ................................ 184 Guimares, M.A. ............................ 951 Gutierrez, A.S.D. ............................ 324 Haber, L.L. ................................... 1006 Haim, P.G. ....................................... 920 Henz, G.P. ........................ 61, 138, 881 Honrio, S.L. .................................. 940 Inoue-Nagata, A.K. ............... 815, 904 Israel, M. ........................................ 169 Ito, S.C.S. ....................................... 718 Jacoby, C.F.S. ................................. 294 Jalali, V.R.R. ................................... 970 Junqueira, A.M.R. ......... 250,.805, 810 Junqueira, C.S. ............................... 982
1036

Junqueira, R.M. .............................. 184 Karasawa, M. ........................ 22, 1000 Kumakawa, M.K. ........................... 940 Ladeira, I.R. .......................... 100, 266 Lana, R.M.Q. ........................... 76, 965 Leo, F.F. ........................................ 228 Leito, M.M.V.B.R. .............. 133, 773 Leite, G.L.D. ..................................... 28 Levien, S.L.A. ................................ 242 Licursi, V. ....................................... 299 Lima Jnior, E.C. ........................... 846 Lima Sobrinho, R.R. ...................... 735 Lima, J.S.S. ........................... 285, 290 Lima, M.A.C. ................................. 793 Lira, M.L. ....................................... 970 Loges, V. ......................................... 699 Lopes, C.A. .................................... 320 Lopes, J.C. ...................................... 143 Lopes, N.F. ..................................... 799 Luz, G.L. ......................................... 931 Luz, J.M.Q. ......................... 826, 1006 Machado, C.M.M. .......................... 851 Madail, J.C.M. ............................. 1029 Madeira, D.M. ................................ 899 Madeira, N.R. ................................. 982 Makishima, N. .............................. 1029 Maluf, W.R. .................................... 299 Mantovani, J.R. .............................. 758 Mapeli, N.C. ..................................... 32 Marcos Filho, J. ............................. 887 Mariano, R.L.R. ............................. 108 Marim, B.G. .................................... 951 Marouelli, W.A. ...................... 57, 320 Martins, C.S. .................................. 221 Martins, E.R. .................................... 28 Martins, M.I.E.G. ........................... 853 Mathias, M.L. ................................. 940 Matos, C.S.M. ................................ 899 Matsumoto, S.N. ............................ 911 Medeiros, J.F. ................ 202, 260, 773 Medeiros, P.H. ................................ 112 Medeiros, S.L.P. ............................... 48 Mello, S.C. ..................................... 271 Melo Filho, P.A. ............................. 929 Melo, H.C. ...................................... 846 Melo, P.C.T. ......................... 154, 1029 Mendona Jnior, C.F ...................... 15 Mendona, F.V.S .............................. 15 Mendona, M.C. ............................ 780

Menezes, J.B. ............ 15, 90, 112, 754 Menezes, N.L. ................................ 193 Mesquita Filho, M.V. ....................... 68 Miranda, J.E.C. ................................ 44 Miranda, N.O. ....................... 242, 260 Mizobutsi, G.P .................................. 81 Modolo, V.A. .................................. 316 Monte, M.B.M. .............................. 920 Morais, M.S. .................................. 128 Morais, O.M. .................................. 911 Moreira, G.R. ......................... 255, 893 Moretti, C.L. ................................... 993 Mota, J.H. .............. 174, 238, 870, 976 Mota, M.G.C. .................................. 221 Mota, W.F. ...................................... 722 Moura, M.C.C.L. ............................ 206 Moura, M.F..................................... 915 Moura, M.L. ..................................... 81 Muniz, M.F.B. ................................ 703 Nagata, T. ....................................... 904 Napoleo, R.L. ................................. 28 Nascimento, A.B.G......................... 993 Nascimento, J.T ............................... 19 Nascimento, W.M. ...........44, 211, 703 Negreiros, M.Z. .... 133, 189, 202, 233, 285, 290, 712,754,773 960 Negrelle, R.R.B. ........................... 1022 Neves, L.L.M. ................................ 722 Noce, R. .......................................... 238 Nogueira, D.H. ............................... 915 Nunes , G.H.S .... 15, 90, 112, 133, 718 Nunes, U.R. .................................... 899 Olinik, J.R. ..................................... 294 Oliveira Jnior, A.C. ...................... 735 Oliveira, A.P. ......... 19, 128, 768, 915 227 Oliveira, A.S. .................................. 780 Oliveira, B.C. ................................... 05 Oliveira, C.D. ................................. 743 Oliveira, E.Q. ........ 233, 285, 290, 712 Oliveira, F.L. .................................. 184 Oliveira, M.R.T. ............................. 915 Oliveira, R.F. .................................. 316 Oliveira, R.P. .................................. 294 Oliveira, S.A. ................................. 810 Oliveira, T.S. ......................... 242, 260 Oliveira, V.R. ....................... 221, 1029 Onuki, A.C.A. ................................ 993 Otto, R.F. ........................................ 294 Oviedo, V.R.S. ................................ 785

Hortic. bras., v. 23, n. 4, out.-dez. 2005

Padovan, M.P. ................................ 184 Papa, G. ............................................. 38 Passos, F.A. ........................... 841, 935 Paulus, D. ......................................... 48 Paulus, E. .......................................... 48 Peixoto, J.R. ................................... 881 Pereira, C. ....................................... 810 Pereira, E.W.L. ................................. 90 Pereira, F.H.F. ....................... 100, 266 Pereira, J.E.S. ................................... 86 Pereira, M.G. .................................. 123 Pereira, P.R.G. ....................... 100, 266 Pereira, R.S. ................................... 703 Pereira, W.E. .................................. 768 Peternelli, L.A. ............................... 893 Picano, M.C. ................................. 893 Pimenta, F.L. .................................. 899 Pineli, L.L.O. ................................. 993 Pinto, J.E.B.P. ................ 735, 846, 956 Pizetta, L.C. ...................................... 51 Polidoro, J.C. .................................... 05 Poltronieri, M.C. ............................ 221 Puiatti, M. .............................. 100, 266 Purquerio, L.F.V. ............................ 831 Puschmann, R. ............................... 215 Queiroga, R.C.F. ........... 133, 189, 754 Queirz, M.A. ....................... 179, 206 Ramos, P.A.S. ................................. 911 Ramos, S.J. ....................................... 28 Ranal, M.A. ...................................... 76 Reghin, M.Y. .................................. 294 Reifschneider, F.J.B. ........................ 61 Reinoso, A.C.L. .............................. 970 Reis, A. ........................................... 250 Resende, F.V. .................................. 851 Resende, G.M. ...... 174, 238, 707, 976, 1010, 870 Resende, R.O. ................................ 929 Rezende, B.L.A. ............................. 853 Ribas, R.G.T. .................................. 184 Ribeiro, D.G. .................................. 789 Ribeiro, I.J.A. ................................. 935 Ribeiro, L.G. ................................... 143 Ribeiro, R.L.D. ........................ 05, 184

Riffel. C. ........................................... 48 Riva, E.M. ............................. 22, 1000 Rocha, J.M.M. ................................ 718 Rocha, R.C.C. ....................... 133, 189 Rocha, R.H.C. ....................... 133, 189 Rodrigues Jnior, J.C. ........... 174, 976 Rodrigues, J.D .................................. 09 Rodrigues, R.......................... 22, 1000 Rossetto, C.A.V. ............................. 915 Rcker, N.G.A. ............................. 1022 S, K.A. .......................................... 965 Saad, J.C.C. .................................... 740 Sala, F.C. ................................. 72, 158 Sales Jnior, R. ............................... 718 Salviano, A.M. ............................... 718 Santana, D.G. .................................. 826 Santos Jnior, J.J. ............................. 90 Santos, G.R. ........................... 228, 945 Santos, J.E. ................................... 1006 Santos, O.S. ............................. 48, 193 Sedyama, T. .................................... 911 Shimoya, A. .................................. 1015 Silva, C.A. ...................................... 260 Silva, D.J.H. ................ 94, 206, 255, 893, 722, 951 Silva, E. .......................................... 875 Silva, E.O. ............................. 215, 290 Silva, G.F. ....................................... 970 Silva, G.G. ....................................... 915 Silva, H.R. ............................... 68, 819 Silva, I.F. .......................................... 19 Silva, J.B. ....................................... 990 Silva, J.B.C............ 105, 250, 815, 851 Silva, J.E.L. ........................... 128, 768 Silva, M.C.C. ................................. 202 Silva, M.P. .................................... 1000 Silva, P.S.L. .................................... 960 Silva, W.L.C. .................................. 320 Silva-Mann, R. ............................... 780 Silveira, E.B. .................................. 108 Silveira, L.M. ........ 233, 285, 290, 712 Simes, A.N. .................................. 112 Singh, R.P. ...................................... 904 Siqueira, J.M. ................................... 32

Soares, A. ....................................... 915 Soares, A.M. ................................... 846 Sousa, V.F. ...................................... 202 Souza, A.F. ....................................... 68 Souza, A.P. ....................................... 19 Souza, E.R. ..................................... 242 Souza, F.F. ...................................... 179 Souza, G.L.F.M. ............................. 754 Souza, P.A ............................... 15, 754 Souza, R.J. ............ 174, 238, 976, 870, Souza, R.M. .................................... 881 Stringheta, P.C. ............................... 255 Sudr, C.P. ............................. 22, 1000 Tanada-Palmu, P.S. ........................ 841 Tavares, M. .......... 148, 324, 1018, 940 Teixeira, J.B. .................................. 982 Teixeira, M.C.F. ............................. 699 Tessarioli Neto, J. ........................... 986 Tivelli, S.W. .......................... 726, 935 Tfoli, J.G. ...................................... 749 Torres, A.C. .................................... 789 Torres, S.B. ............................ 303, 307 Trani, P.E. ...................... 726, 841, 935 Trevizan, L.R.P. ................................ 38 Vencovsky, R. ................................... 72 Verruma-Bernardi, M.R. ................ 920 Viana, A.E.S. .................................. 911 Viegas, E.C. .................................... 915 Vieira, J.V. ............... 44, 250, 805, 851 Vieira, M.C. ...................................... 32 Vieira, R.D ..................................... 990 Vilas Bas, R.L. ............................... 09 Vilela, N.J. ........................... 154, 1029 Werneck, C.G. ................................ 920 Werner, H. ...................................... 875 Witter, M.H. ................................... 931 Yaguiu, P. ........................................ 970 Yuri, J.E. ........ 174, 238, 976, 870, 899 Zano Jnior, L.A. .................. 76, 965 Zanatta, E.R. ................................... 799 Zarate, N.A.H. .................................. 32 Zatarim, M. .................................... 198 Zerbini, F.M. .................................. 206 Zolnier, S. ......................................... 57

Hortic. bras., v. 23, n. 4, out.-dez. 2005

1037

ndice analtico dos artigos publicados no volume 23, 2005


Abbora (Cucurbita moschata) Sphaerotheca fuliginea, produto lcteo fermentado, doena, odio .................................................................... 198 ZYMV, resistncia ........................................................... 206 Flores, qualidade de sementes, polinizao manual ....... 731 Alface (Lactuca sativa) Produo de folhas, taxa de crescimento, sombreamento, temperatura ambiente, luminosidade .............................. 133 Biosslidos, resduos, metais pesados, lodo de esgoto ... 143 Bremia lactucae, Thielaviopsis basicola, mosaico da alface, resistncia gentica, alface crespa vermelha ....... 158 Rendimento, nutrio, qualidade, dose de potssio, poca de aplicao ...................................................................... 174 Sombreamento, taxa de crescimento, indicadores econmicos, temperatura, luminosidade ....................................... 189 Qualidade fisiolgica, sementes, mudas ......................... 193 Produo, qualidade de razes, densidade populacional, consrcio .......................................................................... 233 Desempenho agroeconmico, consrcio ......................... 285 Composio qumica, consrcio, densidade populacional 290 Melhoramento, linhagens, nematide das galhas, florescimento precoce ...................................................... 299 Dixido de carbono, fertirrigao, matria seca ............. 316 Desempenho agronmico, consorcio, densidade populacional ..................................................................... 712 Ps-colheita, fertilizantes minerais, fertilizante orgnico 754 Nitrognio, crescimento ................................................... 758 DRIS, anlise foliar de nutrientes, balano nutricional, produo, queima de bordos, hidroponia ........................ 810 Rentabilidade, eficincia agroeconmica, consrcio ..... 853 Rendimento, competio de cultivares ........................... 870 Coberturas de solo, produo .......................................... 899 Massa fresca, nutrio, armazenamento, nitrognio, molibdnio ....................................................................... 976 Estilbita, anlise sensorial, teste de ordenao, zelita .. 920 Fertirrigao, hidroponia, salinidade ............................... 931 Alho (Allium sativum) Tendncia, produo, preos ........................................... 238 Afdeos, Neotoxoptera formosana .................................. 929 Banco de germoplasma, produtividade ........................... 935 Cinnamomum zeilanicum Breym, Arachis hypogaea L . 915 Agronegcio, competitividade, mercado, produo, importao ...................................................................... 1029 Batata (Solanum tuberosum) Micropropagao, crescimento, tipo de explante, multiplicao in vitro, nmero de gemas ....................................... 86 Controle qumico, indutor de resistncia, BTH, requeima .... 749 Refrigerao, acares, temperatura de armazenamento .... 799
1038

Vrus Y da batata, reao em cadeia da polimerase, potyvrus, RT-PCR .......................................................... 904 Processamento mnimo, alteraes metablicas, antioxidante ..................................................................... 993 Batata-doce(Ipomoea batatas) Sulfato de amonio, produtividade, teor de N .................. 726 Adubao fosfatada, ramas por cova, produo de razes ..... 768 Produtividade, formato de raiz, insetos de solo .............. 911 Nutrio mineral, produo, glicose, uria amido .......... 925 Beterraba (Beta vulgaris) Inibidores, germinao .................................................... 990 Brcolos (Brassica oleracea L. var. italica) Micronutriente, diagnose foliar, produtividade, boro, solo arenoso ............................................................................... 51 Recobrimento, biofilme, pectina, gelatina, vigor de sementes ........................................................................... 841 Cebola (Allium cepa) Frigorificao de bulbos, produo de sementes, rendimento, potencial de sementes ................................................. 294 Rendimento, densidade de plantio, perda de peso de bulbos ............................................................................... 707 Rendimento, densidade de plantio, armazenamento, massa fresca de bulbos .................................................. 1010 Botrytis squamosa, tombamento, adubo orgnico, produo de mudas, composto termfilo ........................ 875 Priming, incubao, germinao, vigor, secagem de sementes ........................................................................... 887 Cenoura (Daucus carota) Melhoramento, qualidade fisiolgica, germinao, caracterstica de semente ............................................................... 44 Oxisolo, micronutriente, boro ........................................... 68 Produo, qualidade de razes, densidade populacional, consrcio .......................................................................... 233 Resistncia a doenas, produtividade, cultivo orgnico, cultivo convencional florescimento, queima das folhas . 250 Composio qumica, consrcio, densidade populacional .... 290 Desempenho agronmico, sistemas consorciados .......... 712 Interao gentipo x ambiente, estabilidade fenotpica . 743 Sistemas de cultivo, teste de comparao pareada, teste de ordenao, preferncia do consumidor, anlise sensorial 805 Cultivar, cenourete, processamento mnimo ................... 851 Coentro (Coriandrum sativum) Desempenho agroeconmico, consrcio ......................... 285 Germinao, sementes, vigor, pureza, microrganismos, termo-inibio, cultivares ................................................ 703 Couve (Brassica oleraceae cv. Acephala) Taxa respiratria, etileno, polifenol oxidase, vitamina C, conservao, processamento mnimo .............................. 215
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Couve-da-Malsia (Brassica chinensis L. var. parachinensis (Bailey) Tsoi sum, adubao nitrogenada .................................... 76 Parcelamento, uria, nitrato de clcio, acmulo de nutrientes .......................................................................... 965 Couve-flor (Brassica oleracea var. botrytis) Micronutriente, diagnose foliar, produtividade, boro, solo arenoso ............................................................................... 51 Bandeja, volume de clula, idade de transplantio ........... 837 Feijo-de-vagem (Phaseolus vulgaris) Nutrio, rendimento, qualidade, solo arenoso, teor de fsforo .............................................................................. 128 Hortalias Caixa K, transporte, ps-colheita, absoro de gua, fungos, embalagem .......................................................... 138 Citrullus lanatus, Cucumis melo, Lycopersicon esculentum, Solanum melongena, estabelecimento de plntulas, termoinibio, condicionamento osmtico, germinao, temperatura baixa, sementes ......................................................... 211 Mandioquinha-salsa (Arracacia xanthorrhiza) Embalagens, preos, comercializao ............................... 61 Danos mecnicos, leses, respirao, deteriorao ........ 881 benzilaminopurina, cido giberlico ............................... 982 Maxixe (Cucumis anguria) Cyclanthera pedata, hortalia no-convencional, sistema de conduo, tutoramento, espaamento ........................... 28 Potencial fisiolgico, vigor, deteriorao de sementes ... 307 Melancia (Citrullus lanatus) Anlise multivariada, agrupamento, variveis cannicas, divergncia gentica ........................................................ 179 Epidemiologia, controle, crestamento gomoso ............... 228 Nutrio de plantas, crescimento, macronutriente .......... 763 Didymella bryoniae, crestamento gomoso do caule ....... 945 Melo (Cucumis melo) Ps-colheita, qualidade, armazenamento, refrigerao .... 15 Qualidade, produtividade, armazenamento ....................... 90 Conservao, injria pelo frio, qualidade ps-colheita, armazenamento, refrigerao, poca de colheita ............ 112 Plasticultura, salinidade, irrigao, cobertura do solo .... 202 Variabilidade espacial, slidos solveis totais, firmeza de polpa, qualidade de fruto ............................................ 242 Geoestatstica, manejo localizado ................................... 260 Slidos solveis totais, firmeza de polpa, fertilizantes orgnicos, anlise de custo .............................................. 718 Filme de polietileno, manejo de irrigao, produtividade, slidos solveis totais ...................................................... 773 Absciso peduncular, comportamento respiratrio, firmeza, tomografia de ressonncia magntica, 1-metilciclopropeno .. 793 Nutrio de plantas, hidroponia, nitrognio, qualidade de frutos ................................................................................. 831 Milho (Zea mays) Capacidade combinatria, efeito recproco, anlise diallica, caracteres agronmicos, protena total ............ 123
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Comprimento e dimetro de espiga, profundidade de gros, espaamento .......................................................... 826 Milho verde, minimilho ................................................... 960 Pepino (Cucumis sativus) Nutrio, CO2, irrigao, enxertia ..................................... 09 Potencial fisiolgico, vigor, soluo salina, envelhecimento de sementes ........................................................ 303 Endogamia, produo, melhoramento ............................. 785 Pimenta (Capsicum spp.) Germoplasma, variveis cannicas, mtodo de Tocher, projeo das distncias no plano, recursos genticos, tcnica multivariada ........................................................... 22 Resistncia gentica, odio ................................................ 72 Pimenta-do-reino ((Piper nigrum L..) Germoplasma, isozimas, melhoramento gentico .......... 221 Pimento (Capsicum annuum) Germoplasma, variveis cannicas, mtodo de Tocher, projeo das distncias no plano, recursos genticos, tcnica multivariada ........................................................... 22 Estufa, anlise de crescimento, matria seca, ambiente protegido ............................................................................ 94 Resistncia gentica, odio ................................................ 72 Xanthomonas axonopodis, antibiose, epidemiologia, controle, biofertilizante, mancha bacteriana ................... 117 Absoro, ambiente protegido, nitrognio, potssio, fertirrigao, nutrio de plantas ..................................... 275 Xanthomonas euvesicatoria, antibiose, biofertilizante ... 281 Planta Medicinais Chamomilla recutita, Asteraceae, planta medicinal, leo essencial, biomassa, nitrognio, fsforo, captulo floral .. 32 Mentha x villosa, plantas medicinais, hidroponia, substrato ... 48 Lychnophora pimaster, nutrio mineral, nutrio orgnica, planta medicinal, leo essencial, arnica, calagem .......... 735 Melissa officinalis, substrato, intervalo de colheita, altura de corte ............................................................................. 780 Mikania glomerata, guaco, fotoperodo, clorofila, condutncia estomtica, anatomia foliar ......................... 846 Zingiber officinale, cadeia de produo, comercializao, gengibre .......................................................................... 1022 Cinnamomum zeilanicum, Arachis hypogaea, toxicidade de leos essenciais ................................................................ 915 Mentha piperita, nutrio de plantas, hidroponia, concentrao de soluo nutritiva ............................................. 1006 Melissa officinalis, nutrio de plantas, hidroponia, concentrao de soluo nutritiva ................................. 1006 Cymbopogon citratus, ps-colheita, secagem, moagem, leo essencial, capim limo ............................................. 956 Plantas ornamentais (Orchidaceae) espcies, levantamento, nativas, biodiversidade, cultivo ..................................................... 169 (Aster ericoides), nutrio, estufa ................................... 271 (Zingiberales, Araceae), flores de corte, classificao de inflorescncias, ponto de colheita, embalagem .............. 699
1039

Dendranthema grandiflora, anlise de crescimento, tenso de gua no substrato, crisntemo ......................... 740 Heliconia rostrata, cultura de embries, micropropagao, cultura de tecidos, sacarose, cinetina, isopentenil adenina, zeatina .............................................................................. 789 Pupunha (Bactris gasipaes) Adubao orgnica, adubao mineral, esterco bovino, palmito ................................................................................ 19 Quiabo (Abelmoschus esculentus) Carboidratos, vitamina C ................................................. 722 Sanitizao, centrifugao, embalagem, conservao, processamento mnimo .................................................... 970 Rabanete (Raphanus sativus) Agroecologia, horticultura orgnica, consrcio, crotalria .... 184 Rentabilidade, eficincia agroeconmica, consrcio ..... 853 Repolho (Brassica oleracea var. capitata) Micronutriente, diagnose foliar, produtividade, boro, solo arenoso ............................................................................... 51 Populao, nitrato, qualidade, espaamento, caracterstica qualitativa ......................................................................... 100 Agroecologia, horticultura orgnica, consrcio, crotalria .... 184 Populao, fertilizao nitrogenada, produo, espaamento ............................................................................ 266 Vermicomposto de esterco de bovino, boro, adubo orgnico ............................................................................ 311 Tomate (Lycopersicon esculentum) Ralstonia solanacearum, resistncia sistmica adquirida, murcha bacteriana, acibenzolar S-methyl ......................... 05 Resduos de pesticidas, metabolismo, cultivo protegido, acefato, metamidofs ......................................................... 38

Condutividade eltrica, potencial matricial, potencial osmtico, tensimetro, sistema radicular, substrato, cultivo sem solo .............................................................................. 57 Etileno, respirao, acares solveis, oxidase do ACC, poligalacturonase, amadurecimento do fruto .................... 81 Colorao, firmeza, pegamento de fruto, slidos solveis, tolerncia ao calor ............................................................ 105 Pectobacterium carotovorum, controle biolgico, controle integrado, Rhodotorula sp., Pseudomonas sp., fluorescente, clcio, podrido mole ....................................................... 108 Danos fsicos, padres de qualidade, custo do tomate, consumo in natura, consumidor ...................................... 148 Cultivar, manejo cultural, qualidades nutracuticas, processamento .................................................................. 154 Temperatura, umidade relativa do ar, luminosidade, rendimento ....................................................................... 255 Ralstonia solanacearum, patgeno de solo, turno de rega .... 320 Comercializao, classificao, perdas ps-colheita, embalagem ....................................................................... 324 Mosca-branca, geminivrus ............................................. 815 Colormetro, pigmentos, carotenides ............................ 819 Tuta absoluta, recursos genticos, variabilidade gentica, melhoramento de plantas ................................................. 893 Escovas, beneficiamento, classificao, normas, dimetros de frutos ............................................................................ 940 Tratos culturais, produo classificada, eficincia fotossinttica, rentabilidade, tutoramento ....................... 951 Produtividade, qualidade de fruto, estufa ...................... 1015 Anlise multivariada, caracterizao de germoplasma, recursos genticos, pr-melhoramento .......................... 1000 Rendimento, conduo, densidade populacional ............ 986 Cestas de bambu, sacolas plsticas, danos fsicos, qualidade dos frutos, tcnica de colheita ....................................... 1018

1040

Hortic. bras., v. 23, n. 4, out.-dez. 2005

Agradecimento aos revisores ad hocs que colaboraram com a revista de janeiro de 2004 a outubro de 2005
Adailson Pereira de Souza ................................... UFPB - PB Adalberto Caf Filho ............................................. UnB - DF Ado de Siqueira Ferreira .................................. UFOP - MG Ademar Pereira de Oliveira ................................. UFPB - PB Aderson Soares de Andrade Jr. ..... Embrapa Meio Norte - PI Adilson Tonietto ........................................... FEPAGRO - RS Adriana Antonieta N. Rizzo .......... UNESP Araraquara SP Adriana Ramos .................................................... Ilhus - BA Adriano do Nascimento Simes ....................... Viosa - MG Agostinho Dirceu Didonet ..... Embrapa Arroz e Feijo - GO Aike A. Kretzschmar ........................................ UDESC - SC Ailton Reis .................................... Embrapa Hortalias - DF Alberto C. de Campos Bernardi .. Embrapa Pecuria Sudeste - SP Aldi Fernando Frana de Souza ........................... UFG - GO Alexandre Augusto Nienow ...................................UPF - RS Alexandre Couto RodriguesEmbrapa Clima Temperado - RS Alexandre Pio Viana ............................................ UENF - RJ Alice Maria Quezado Soares Durval .. Embrapa Hortalias - DF Aloisio Costa Sampaio .......................... UNESP Bauru SP lvaro Luiz Mafra ............................................ UDESC - SC Amauri Alves de Alvarenga ............................... UFLA - MG Amauri Bogo ..................................................... UDESC - SC Ana Cristina P. P. de Carvalho ... Embrapa Agroind. Tropical - CE Ana Maria Conte e Castro ......................... UNIOESTE - PR Anclio Ricardo de Oliveira Gondim .............. Viosa - MG Andr Nunes Loula Trres .............................. EPAGRI - SC Andra Maria Andr Gomes ................................ UFPE - PE Angela Maria Ladeira .................. Instituto de Botnica - SP Angela Maria Soares .......................................... UFLA - MG ngelo Pedro Jacomino ......................... ESALQ - USP - SP Antonieta Nassif SalomoEmbrapa Recursos Genticos - DF Antnio Carlos Gomes ................... Embrapa Cerrados - DF Antnio Hlio J. ..... Hrtica Consultoria e Treinamento - SP Antnio Ismael Incio Cardoso ......... UNESP Botucatu - SP Antonio Nolla ....................................................... Toledo -PR Antonio Rafael Teixeira Filho ............... Embrapa Sede - DF Arione da Silva Pereira ..... Embrapa Clima Temperado - RS Arlindo Leal Boica Junior ............. UNESP Jaboticabal - SP Artur Ferreira Lima Neto .............. Embrapa Hortalicas - DF Auri Brackmam ................................................... UFSM - RS Barbara Janet Teruel de Medeiros ............... UNICAMP - SP Beatriz Marti Emygdio ......................... Embrapa Trigo - RS Bernard A. L. Nicolaud ..................................... UFRGS - RS Bernardo Ueno .................. Embrapa Clima Temperado - RS Carlos Alberto Arago ....................................... UNEB - BA Carlos Alberto da Silva Oliveira ........................... UnB - DF
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Carlos Alberto Escapim ........................................ UEM - PR Carlos Alberto Simes do Carmo ................. INCAPER - ES Carlos Machado dos Santos ................................. UFU - MG Carlos R. F. Grosso ...................................... UNICAMP - SP Carlos Roberto Bueno .......................................... INPA - AM Carmen Ilse Pinheiro Jobim ........................ FEPAGRO - RS Carmen Silvia Vieira Janeiro Neves ...................... UEL - PR Carolina Fernandes ........................ UNESP Jaboticabal - SP Cassandro Vidal T. do Amarante ...................... UDESC - SC Ceclia Helena S. P. Ritzinger .. Embrapa Mandioca e Frut. - BA Clia Regina lvares Maltha .............................. UFV - MG Celma Domingos de Azevedo ..................... PESAGRO - RJ Celso Trindade ................................. So Joo Del Rei - MG Charles de Araujo ................................................. UFV - MG Charles Martins de Oliveira ............ Embrapa Cerrados - DF Cirino Corra Jnior ...................................... EMATER - PR Clara Oliveira Goedert ... Embrapa Recursos Genticos - DF Cludia Arajo Marco ..................................... Fortaleza - CE Claudia Petry ........................................................... UPF - RS Cludia Pombo Sudr .......................................... UENF - RJ Cludia Renata F. Martins ..................................... UnB - DF Cludia Silva da Costa Ribeiro .... Embrapa Hortalias - DF Cleber D. de G. Maciel ...................... UNESP Botucatu - SP Cosme Damio Cruz .............................................. UFV - DF Dalmo Lopes de Siqueira .................................... UFV - MG Daniela Biaggioni Lopes ............ Embrapa Semi-rido - PE Davi Teodoro Junghans ..... Embrapa Mandioca e Frut. - BA Dbora Cristina Santiago ....................................... UEL - PR Demstenes M. P. de Azevedo ........ Embrapa Algodo - PB Denise Viani Caser ................................................... IEA - SP Derly J. H. da Silva .............................................. UFV - MG Dilermando Perecin ....................... UNESP Jaboticabal - SP Domingos Fornasier Filho ............. UNESP Jaboticabal - SP Douglas Lau ......................................................... UFV - MG Eduardo Euclydes de Lima e Borges .................. UFV - MG Egon J. Meurer .......................................... Porto Alegre - RS Eliemar Campostrine ........................................... UENF - RJ Ernani L. Agnes ................................................... UFV - MG Fernanda A. Londero Backes ...................... Canoinhas SC Fernando Arago ....... Embrapa Agroindstria Tropical - CE Fernando Campos MendonaEmbrapa Pecuria Sudeste - SP Fernando Csar Sala .............................. ESALQ - USP - SP Fernando Cezar Juliatti ........................................ UFU - MG Fernando Frana de Souza .................................... UFG - GO Fernando Luiz Finger .......................................... UFV - MG Fernando Mesquita Lara ................ UNESP Jaboticabal - SP
1041

Flvia R. A. Patricio ......................... Instituto Biolgico - SP Flvio de Frana Souza .................. Embrapa Rondnia - RO Francisco A. Passos ................................................ IAC - SP Francisco C. Maia Chaves ... Embrapa Amazonia Ocidental - AM Francisco Carlos Krzyzanowski ............. Embrapa Soja - PR Francisco Ferraz Laranjeira ..... Embrapa Mandioca e Frut. - BA Francisco Hevilsio Freire Pereira ...................... UFV - MG Francisco L. A. Cmara ..................... UNESP Botucatu - SP Francisco Vilela Resende .............. Embrapa Hortalias - DF Frederico Dimas Fleig ...................................... UDESC - SC Geni L. Villas Boas ....................... Embrapa Hortalias - DF Geraldo Milanez de Resende ...... Embrapa Semi-rido - PE Germano Leo Demolin Leite .......................... UFMG - MG Gerson R. L. Fortes .... Embrapa Rec. Gen.e Biotecnologia - DF Gilberto Martins ..................................................... UEL - PR Gilmar Paulo Henz ....................... Embrapa Hortalias - DF Gilmar Schafer .................. Embrapa Clima Temperado - RS Glauber Henrique de Souza Nunes ................... ESAM - RN Glauco E. P. CortezCentro Universtario Moura Lacerda - SP Hayde Siqueira Santos ..................... UNESP Botucatu - SP Helcio Costa .................................................. INCAPER - ES Hlio Grassi Filho .............................. UNESP Botucatu - SP Heloisa Filgueiras ..... Embrapa Agroindustria Tropical - CE Herminia E. Prieto Martinez ............................... UFV - MG Hideaki W. Takahashi ........................................... UEL - MG Humberto Silva Santos ......................................... UEM - PR Iniberto amerschmidt ..................................... EMATER - PR Isabel Cristina Bezerra .................. Embrapa Hortalias - DF Itamar Ferreira de Souza .................................... UFLA- MG Itamar Rosa Teixeira ........................................ Ipameri - GO Ivo Ribeiro da Silva ............................................. UFV - MG Jairo Augusto Campos Arajo ....... UNESP Jaboticabal - SP Jairo Vidal Vieira .......................... Embrapa Hortalias - DF Jean Carlos Cardoso . Fund. Shunji Nishimura de Tecnologia - SP Jean Kleber Mattos ................................................ UnB - DF Jesus G. Tfoli ................................... Instituto Biolgico -SP Joo A. Wordell Filho ...................................... EPAGRI - SC Joo Bosco Carvalho da Silva ...... Embrapa Hortalias - DF Joo Carlos Bespalhok Filho ............................... UFPR - PR Joo Carlos Soares de Mello ...... Univ. Federal Fluminense - RJ Joo Ito Bergonci .............................................. UFRGS - RS Joo Tavares Filho ................................................. UEL - PR Joaquim Gonalves de Pdua ........... EPAMIG Caldas - MG Jony Eishi Yuri ................................................... UFLA - MG Jorge Luiz Martins ............................................... UFPel - RS Jos Abramo Marchese ...................... UNESP Botucatu - SP Jos Alberto Caram de Souza Dias ........................ IAC - SP Jos Antnio Azevedo EspindolaEmbrapa Agrobiologia - RJ Jos Biasi .......................................................... EPAGRI - PR Jos Cambraia ...................................................... UFV - MG
1042

Jos de Barros. de Frana Neto .............. Embrapa Soja - PR Jos Eduardo B. P. Pinto .................................... UFLA - MG Jos Ernani Schwemgber .. Embrapa Clima Temperado - RS Jos Fernando Durigan .................. UNESP Jaboticabal - SP Jos Ferreira da Silva ........................................ UFAM - AM Jos Flvio Lopes .......................... Embrapa Hortalicas - DF Jos Francismar de Medeiros ............................ ESAM - RN Jos Garcia ............................................................ UFG - GO Jos Geraldo Baumgartner ............ UNESP Jaboticabal - SP Jos Guilherme Marinho GuerraEmbrapa Agrobiologia - RJ Jos Maria D. Gaia .. Univ. Federal Rural da Amaznia - PA Jos Maria Pinto .......................... Embrapa Semi rido - PE Jos Orestes M. Carvalho .............. Embrapa Rondnia - RO Jos Polese Soares Novo ........................................ IAC - SP Jos Ricardo Peixoto .............................................. UnB - DF Jos Roberto de Oliveira ...................................... UFV - MG Jos Roberto Pinto de Souza ................................. UEL - PR Jos Roberto Vicente ............................................... IEA - SP Jos Ronaldo Magalhes ....... Embrapa Gado de Leite - MG Jos Tadeu Jorge .......................................... UNICAMP - SP Jos Wellington dos Santos ............. Embrapa Algodo - PB Josivan Barbosa Menezes .................................. ESAM - RN Jozeneida Lcia Pimenta de Aguiar Embrapa Cerrados - DF Julio Marcos Filho ................................. ESALQ - USP - SP Jurandi Gonalves de Oliveira ............................ UENF - RJ Juscelino Antnio Azevedo ............ Embrapa Cerrados - DF Juvenil Enrique Cares ............................................ UnB - DF Keigo Minami ........................................ ESALQ - USP - SP Larcio Antonio Gonalves Jacovine .................. UFV - MG Lzaro Eustquio Pereira Peres ............. ESALQ - USP - SP Leo Pires Ferreira.................................... Embrapa Soja - PR Leonardo Collier ............................................ UNITINS -TO Lcia Sadayo Assiri Takahashi .............................. UEL - PR Luciana M. de Carvalho Embrapa Tabuleiros Costeiros - SE Ludwig H. Pfennig ............................................. UFLA - MG Luis Vitor Silva do Sacramento ..... UNESP Araraquara SP Luiz Antonio Augusto Gomes ........................... UFLA - MG Luiz Antnio Biasi ............................................... UFPR - PR Luiz Carlos Prezotti ...................................... INCAPER - ES Luiz Carlos S. Caetano ................................ PESAGRO - RJ Luiz Eduardo Bassau Blum ................................... UnB - DF Luiz Eduardo Corra Antunes .. Embrapa Clima Temperado - RS Luiz Pedro Barrueto Cid Embrapa Recursos Genticos - DF Madelaine Venson ............................ EPAMIG Viosa MG Magali Ferreira Grando .......................................... UPF - RS Magno A. Patto Ramalho................................... UFLA - MG Manoel Teixeira de Castro Neto . Embrapa Mandioca e Frut.- BA Manoel Vicente Mesquita Filho ... Embrapa Hortalias - DF Manoel Xavier dos Santos .... Embrapa Milho e Sorgo - MG Marcelo Antoniol Fontes ............ Alellyx Applied Genomics
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Marcelo Carnier Dorneles ..................... ESALQ - USP - SP Marcelo Murad Magalhes ................................ UFLA - MG Marcelo Tavares ................................................... UFU - MG Mrcia Maria Castro .......................... UNESP Botucatu - SP Marco Eustquio de S ................ UNESP Ilha Solteira - SP Marcos Antonio Bacarin ...................................... UFPel - RS Marcos David Ferreira ................................. UNICAMP - SP Marcos Eduardo Paron ...................... UNESP Botucatu - SP Marcus Vincius de Miranda Martins ................. Braslia-DF Maria Aico Watanabe ............ Embrapa Meio Ambiente - SP Maria Amlia Gava Fero ............................ INCAPER - ES Maria Anita G. da Silva ............................. Porto Alegre - RS Maria Auxiliadora Colho de Lima .. Embrapa Semi-rido - PE Maria de Ftima Arrigoni Blank ............................. UFS -SE Maria do Carmo de Salvo Soares Novo .................. IAC -SP Maria do Carmo M. D. Pavani ...... UNESP Jaboticabal - SP Maria Helena T. Mascarenhas . EPAMIG Sete Lagoas - MG Maria Urbana C. Nunes ...... Embrapa Tabuleiros Costeiros - SE Maria Zuleide de Negreiros ............................... ESAM - RN Mariana Zatarim ................................ UNESP Botucatu - SP Mariane Carvalho Vidal ................ Embrapa Hortalias - DF Marina Castelo Branco ................. Embrapa Hortalias - DF Marinalva Woods Pedrosa ................................... UFV - MG Mrio Csar Lopes ..................................... UNIOESTE - PR Mario Puiatti ........................................................ UFV - MG Marley Marico Utumi .................... Embrapa Rondnia - RO Marli Ranal .......................................................... UFU - MG Marta Simone Mendona Freitas ........................ UENF - RJ Martin Homechin ................................................... UEL - PR Maurcio Ventura ................................................... UEL - PR Max Jos de A. Faria Jnior ........ UNESP Ilha Solteira - SP Messias Gonzaga Pereira ..................................... UENF - RJ Miran Josefina Baptista ............... Embrapa Hortalias - DF Moacil Alves de Souza ........................................ UFV - MG Mnica Sartori de Camargo ....... Santa Brbara deste - SP Monique Ines Segeren ................................... Holambra - SP Nand Kumar Fageria .............. Embrapa Arroz e Feijo - GO Natan Fontoura da Silva ....................................... UFG - GO Nei Peixoto .............................................. UEG Ipameri - GO Nerinia Dalfollo Ribeiro ................................... UFSM - RS Nilson Borlina Maia ............................................... IAC - SP Nilton Luiz de Souza ......................... UNESP Botucatu - SP Nilton Nlio Cometti .... Escola Agrotcnica Fed.de Colatina - ES Nirlene J. Vilela ............................ Embrapa Hortalias - DF Nivaldo Duarte da Costa ............. Embrapa Semi-rido - PE Nuno Rodrigo Madeira ................. Embrapa Hortalias - DF Og de Souza ......................................................... UFV - MG Omar Cruz Rocha ........................... Embrapa Cerrados - DF Onkar Dev Dhingra .............................................. UFV - MG Orivaldo Jos Saggin Jr.Embrapa Microbiologia do Solo - RJ
Hortic. bras., v. 23, n. 4, out.-dez. 2005

Osmar Alves Lameira ..... Embrapa Amaznia Oriental - PA Osmar Carrijo ................................ Embrapa Hortalias - DF Ossami Furumoto .......................... Embrapa Hortalias - DF Paulo R. R. Chagas ...... Centro de Pesquisa Mokiti Okada - SP Paulo Antnio de Souza Gonalves ................ EPAGRI - SC Paulo Ernesto Meissner Filho ... Embrapa Mandioca e Frut.- BA Paulo Roberto Beskow ...................................UFSCAR - SP Paulo Srgio Koch .............................. Sementes Sakata - SP Paulo Srgio Rabelo de Oliveira ................... UNIMAR - SP Pedro Boff ........................................................ EPAGRI - SC Pedro Henrique Monnerat ................................... UENF - RJ Pedro Milanez de Rezende ................................ UFLA - MG Raimundo Nonato Tvora Costa ........................... UFC - CE Raquel R. B. Negrelle .......................................... UFPR - PR Ravi Dalt Charma ........................... Embrapa Cerrados - DF Regina Maria Quinto Lana ................................ UFU - MG Ricardo Enrique B. Smith .................................... UENF - RJ Ricardo Henrique Silva Santos ............................ UFV - MG Ricardo Tadeu de Faria .......................................... UEL - PR Rita de Cssia S. Dias ................. Embrapa Semi-rido - PE Roberto Cleiton F. de Queiroga ......................... ESAM - RN Roberto Ferreira da Silva ..................................... UENF - RJ Roberto Lyra Villas Bas ................... UNESP Botucatu - SP Roberto Pedroso de Oliveira ... Embrapa Clima Temperado - RS Roberval Dailton. Vieira .................... UNESP Botucatu - SP Robinson Luiz Contiero .................................. Cascavel - PR Rogrio Lopes Vieites ........................ UNESP Botucatu - SP Ronaldo do Nascimento ....................................... UFPel - RS Ronan Gualberto ............................................ UNIMAR - SP Ronessa Bartolomeu de Souza ..... Embrapa Hortalias - DF Rosana Fernandes Otto ....................................... UEPG - PR Rosana Rodrigues ................................................ UENF - RJ Rovilson J. de Souza .......................................... UFLA - MG Rubens Alves de Oliveira .................................... UFV - MG Rui Pereira Leite Jr. ........................................... IAPAR - PR Rui Sales Jnior ................................................. ESAM - RN Rui Scaramella Furiatti ....................................... UEPG - PR Rumy Goto ......................................... UNESP Botucatu - SP Sally Ferreira Blat .................................. ESALQ - USP - SP Salvador Barros Torres ................................. EMPARN - RN Sebastio Alberto de Oliveira ................................ UnB - DF Sebastio Wilson Tivelli ......................................... IAC - SP Srgio Werne Paulino Chaves ........................ Mossor - RN Shizuo Seno .................................. UNESP Ilha Solteira - SP Sieglinde Brune ............................. Embrapa Hortalicas - DF Silvaldo Felipe da Silveira ................................... UENF - RJ Silvano Bianco ............................... UNESP Jaboticabal - SP Silvio Lopes Teixeira ........................................... UENF - RJ Silvio Lus Rafaeli Neto ................................... UDESC - SC Silvio Moure Ccero .............................. ESALQ - USP - SP
1043

Silvio Tavares ......................................... ESALQ - USP - SP Simon Swen Cheng ......... Embrapa Amaznia Oriental - PA Sissi Kawai Marcos ............................................ Franca - SP Solange G. Canniati Brazaca ................. ESALQ - USP - SP Suzana Lucy Nixdorf ............................................. UEL - PR Sylvio Luis Honrio .................................... UNICAMP - SP Tnia Beatriz G.A. Morselli ................................ UFPel RS Telma Nair Santana Pereira ................................. UENF - RJ Valdivina Lcia Vidal ................... AGENCIARURAL - GO Valria Aparecida Modolo ...................................... IAC - SP Valesca Pandolfi ..................................... ESALQ - USP - SP Valter Rodrigues Oliveira ............. Embrapa Hortalias - DF

Vera Lucia Bobrowski ......................................... UFPel - RS Vicente Wagner Dias Casali ................................ UFV - MG Vivian Loges .......................... Jaboato dos Guararapes - PE Wagner Bettiol ....