PROJECT REPORT On

AZOOSPERMIA FACTOR MICRODELETIONS IN SPERM & BLOOD OF INFERTILE MALES

Submitted in partial fulfillment for the award of the degree of BACHELOR OF TECHNOLOGY in BIOTECHNOLOGY by

SANDEEP DHALL (10904646)

under the guidance of Dr. KANTHA D. ARUNACHALAM, M.Sc, PhD (CANADA) SRM UNIVERSITY

DEPARTMENT OF BIOTECHNOLOGY SCHOOL OF BIOENGINEERING FACULTY OF ENGINEERING AND TECHNOLOGY SRM UNIVERSITY KATTANKULATHUR 603 203
MAY 2008

CERTIFICATE

Certified

that

the

project

report

entitled

AZOOSPERMIA

FACTOR

MICRODELETIONS IN SPERM & BLOOD OF INFERTILE MALES submitted

by SANDEEP DHALL (10904646) is a record of project work done by him under my supervision. This project has not formed the basis for the award of any degree, diploma, assistantship or fellowship.

INTERNAL GUIDE

HEAD OF THE DEPARTMENT

For the purpose of viva voce

1.

2.

DECLARATION

I do hereby declare that the project report entitled AZOOSPERMIA FACTOR

MICRODELETIONS IN SPERM & BLOOD OF INFERTILE MALES is a record

of original work carried out by me under the supervision of Dr. Rima Dada, Assoc. Professor, Department of Anatomy, All India Institute of Medical Sciences, New Delhi and Dr. Kantha D. Arunachalam, Professor and Head of the Department, Biotechnology, SRM University, Chennai. This project has not been submitted earlier in part or full for the award of any degree, diploma, assistantship or fellowship.

Kattankulathur Date

Sandeep Dhall

ACKNOWLEDGEMENTS
I owe profound sense of gratitude and sincere regards to Dr. Rima Dada (Associate Prof., Dept. of Anatomy, AIIMS) for allowing me to work in her lab and providing all facilities to complete the project. I express my deep regards to her for her able guidance, timely suggestions and instructive supervision. I am thankful to Dr. Rakesh Kumar, Mr. Mukesh Tanwar, Mr. Venkatesh, Mr. Monis Bilal, Mr.Manoj, Mr.Dhananjay and Mr. Dinesh for their invaluable scientific advices, encouragement and keen interest throughout the project. It would have been impossible to complete the project without their guidance and support. The sincere cooperation of the whole lab was invaluable. My special thanks to Dr. Kantha D.Arunachalam(Professor and Head of Department, Biotechnology, SRM University) for her constant support, guidance and help throughout this project. I also wish to convey my sincere thanks to Mr. Sanjeev without whose co-operation this venture would not have been a success. I would like to extend my thanks to all friends who helped me in all the stages of this project work. Last but not the least, I am grateful to all the patients who contributed to the study and were patient and cooperative till the completion of the research.

Sandeep Dhall

Dedicated to my Parents, Shivangi and Siddhant.

I am thankful to God for having bestowed upon me a hurdle free path in fulfilling the project successfully.

LIST OF TABLES

Table No. & Name

Table 1: List of primer sequences and details Table 2: Cycling parameters Table 3: Reports and comparison

Page No.
43 44 53

~i~

LIST OF FIGURES
Figure No. & Name
Figure 1: Sperm Figure 2: ICSI Stages Day 0 Figure 3: Y Chromosome Figure 4: Human Y chromosome showing the 7 deletion intervals

Page No.
01 06 12 14 16 20 24 30 47 47 48 48 49 49 50 50 51 52 55

Figure 5: Schematic representation of Y chromosome Figure 6: Representation of cytological bands and Vergnaud map Figure 7: Representation of Vollrath Map of Y Chromosome Figure 8: Description of Various Regions on Y Chromosome Figure 9: Collected sperm sample Figure 10: Cytoplasmic Droplet Figure 11: TEM Picture showing Abnormal Sperm Morphology Figure 12: Elongated Head and Cytoplasmic Droplet Figure 13: Amourphous Head Figure 14: Elongated & Round Shaped Head & Cytoplasmic Droplet Figure 15: Phenotype of Case 7 Figure 15: Semen photomicrograph with abnormal sperm morphology Figure 16: G banded Metaphase spread Figure 18: Karyotype showing 46, XY chromosomal complement Figure 19: Gel photograph showing absence of 350 bp band

~ii~

LIST OF ABBREVIATIONS

AIIMS: ART: AZF: b/l:

All India Institute of Medical Sciences Assisted Reproductive Techniques Azoospermia Factor Bilateral

CBAVD: Congenital Bilateral Absence of the Vas Deferens CFTR: DAZ: DBY: DFFRY: DMSO: DNA: EDTA: FSH: G: Cystic Fibrosis Transmembrane Conductance Regulator Deleted in Azoospermia Dead Box polypeptide Y Drosophila Fat Facets Related Y Dimethyl Sulfoxide Deoxyribo Nucleic Acid Ethylene Diamine Tetraacetic Acid Follicle Stimulation Hormone Giemsa

hnRNPG: Heterogenous Nuclear Ribonucleoproteins ICSI: Intra Cytoplasmic Sperm Transfer

~iii~

INCIID: MSY: N.A: N.D: NOAZ: NRY: PAR: PCR: PHA: PI: RBC: RPM: RPM: RBMY: SCO: SDS: SI: STD: STS: TEM: UV:

International Council on Infertility Information Dissemination Male Specific Y region Not Available Not Done Non Obstructive Azoospermia Non Recombining Region Pseudoautosomal Region Polymerase Chain Reaction Phytohaemogluttinin Primary Infertility Red Blood Corpuscles Rotations per Minute Rosewell Park Maryland Institute RNA-Binding Motif Sertoli Cell Only Sodium Dodecyl Sulphate Secondary Infertility Sexually Transmitted Diseases Sequence Tagged Sites Transmission Electron Microscope Ultraviolet

~iv~

WHO:

World Health Organization

~v~

CONTENTS

CHAPTER NO.

TITLE

PAGE NO.

LIST OF TABLES LIST OF FIGURES LIST OF ABBREVIATIONS

i ii iii

1. 1.1 1.2 1.3 1.4 2.

INTRODUCTION Genetic Causes of Infertility Male Infertility New Demands Due to Technological Advancements Rationale of Study OBJECTIVES

1 2 3 4 7 8

3. 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 3.10 3.11

REVIEW OF LITERATURE Infertilty Etiology Y Chromosome Y Chromosome and Spermatogenesis Structure and Gene Content of Y Chromosome The Azoospermia Factors AZFa Region and Candidate Genes AZFb Region and Candidate Genes AZFc Region and Candidate Genes Genotype and Phenotype Correlation Chromosomal Abnormalities and Male Infertility

9 9 9 12 15 16 19 21 25 27 30 31

4. 4.1 4.2 4.3 4.4 4.5 4.6 4.7 5.

METHODOLOGY AND TECHNIQUES Cytogenetic Analysis DNA Extraction from Blood Semen Analysis DNA Extraction from Sperm

33 33 35 37 40 41 42 45 46

Quantification of DNA
Polymerase Chain Reaction Gel-Electrophoresis RESULTS

6.

DISCUSSION

56

6.1

Concern of Assisted Reproduction Techniques

58

7.

SUMMARY

60

7.1 7.2

Implication of the Study Long Term Goals

62 63

8.

REFERENCES

9.

APPENDIX

XII

9.1 9.2 9.3

Work Plan Solutions & Reagents For DNA Extraction From Blood Solutions & Reagents For DNA Extraction From Sperm Solutions & Reagents For Cytogenetics

XII XIII XVI

9.4

XVII

1. INTRODUCTION

Infertility primarily refers to the biological inability of a man or a woman to contribute to conception. Infertility may also refer to the state of a woman who is unable to carry a pregnancy to full term. In spite of rapid progress in the discipline of assisted reproductive technology, infertility affects approximately 15% of couples, and remains a serious challenge in the field of medicine. A multi centric study by WHO (1982-1985) found that in 20% of infertile cases, the problem lies predominantly in the male (pure male factor), in 38% female (pure female factor), in 27% in both partners and in the remaining 15% no clear classification of infertility was identified (unexplained infertility). The etiology of impaired sperm production and function could be due to different factors acting at pre-testicular, post-testicular and directly at the testicular level. Amongst most important factors which lead to irreversible partial or complete spermatogenic arrest and infertility are genetic factors. This could be at genetic or chromosomal level.

Figure 1: Sperm

~ 1 ~

It is a problem faced by couples rather than individuals. Among the causes of infertility, about half of them could be traced to the male partner. When efforts to have children are unsuccessful, feelings of helplessness, frustration and despair are common it can be a major life crisis for many couples. They go through enormous emotional crisis and psychological distress, as their friends and peers begin to have children. According to National Family Health Survey Reports (1992-93) the level of infertility in India is 2.5% at national level and varies from 1.4 (Haryana & Assam) to 4.4%(Andhra Pradesh) among different states in India. In India, 18 million couples suffer from infertility, while globally 60 to 80 million couples are diagnosed of infertility each year.

1.1 GENETIC CAUSES OF INFERTILITY

Infertility is either primary, when no pregnancy has ever occurred, or secondary, where there has been a pregnancy, regardless of the outcome. About 6771% and 2933% of patients have primary and secondary infertility, respectively (Mueller and Daling 1989; Thonneau et al 1991; Irvine 1998). Male and female factors both can contribute to infertility. Idiopathic infertility is a condition of couples unable to conceive for more than two years, with no abnormalities seen on repeated investigations of tubes or as regards ovulation, luteal phase, cervical mucus, semen, spermoocyte interaction or intercourse. Among the major causes of infertility, chromosomal abnormalities, microdeletions, cystic fibrosis transmembrane conductance regulator (CFTR) mutations and other genetic factors

~ 2 ~

[follicle stimulation hormone (FSH) receptor mutation] are important (Irvine 1998; Diemer and Desjardins 1999; Egozcue et al 2000; Argreave 2000; Phillip et al 1998). Because immunological factors operate at almost every step in the human reproductive process, antibodies-induced damage to gametes and developing embryos is a major cause of immunological infertility. Besides, life style, environmental factors (Benoff et al 2000; Sharpe 2000), including smoking (Zenzes 2000), can affect gamete and embryo development, leading to sub(in)fertility. A combined cause of infertility is found in about 1030% of couples (Hill et al 1985; Jones and Toner 1993; Thonneau et al 1991). It is, therefore, important to investigate both partners and inappropriate to assume that infertility is exclusively a female or a male problem.

1.2 MALE INFERTLITY

In men, the main causes of infertility are oligozoospermia, asthenozoospermia, teratozoospermia and azoospermia, which account for 2025% of cases (Egozcue et al 2000; Hargreave 2000). There are a number of risk factors such as STD involving N. gonorrhoeae and C. trachomatis. These cause changes in semen quality and chronic infection may lead to a block of the vas deferens or seminal vesicles (Megory et al 1987). Mumps, though rare in adults, can result in azoospermia. Anatomical abnormalities such as varicocele, vesicular damage due to torsion and obstruction of testicular sperm passage can all lead to male infertility. It is however, believed that nonobstructive azoospermia has a strong genetic basis (Hargreave 2000). Male infertility can occur either as an isolated disorder or within the framework of a known complex disorder or syndrome. ~ 3 ~

There is an excess of autosomal abnormalities in men with non-obstructive azoospermia or severe oligozoospermia. Besides, congenital bilateral absence of the vas deferens (CBAVD) associated with the phenotype of CFTR gene mutations cause obstructive azoospermia (Donat et al 1997). There appears to be a world-wide concern over decreasing human sperm concentration but this has been highly controversial. Decreasing sperm counts are attributed to the deleterious effects of environmental contamination by heavy metals and estrogenic chemicals (Benoff et al 2000; Mehta and Anandkumar 1997; Sharpe 2000). To what extent there is a genetic contribution is unclear. It has been reported that in a certain ethnic group, men with a particular haplotype (II) have a lower sperm concentration compared with men with haplotypes (III) and (IV) and, the frequency of haplotype (II) is more common in azoospermic men compared with normal men (Kuroki et al 1999). Based on this, it appears that the genetic contribution towards male fertility on account of a decreased sperm concentration might be significant in some ethnic groups.

1.3

NEW

DEMANDS

DUE

TO

TECHNOLOGICAL

ADVANCEMENTS
With the advent of Assisted Reproductive Procreation techniques like Intra cytoplasmic sperm transfer(ICSI) there is renewed interest in the genetic causes of infertility as genetically abnormal sperms are now also able to fertilize oocyte(by IVF/ICSI) and elicit full development potential of new embryo. According to study conducted by Serebrovska (2006) out of total users of ICSI 3.2 to 14%

~ 4 ~

have AZF deletions. Thus these cases would be infertile. It has also been found that there is an increasing incidence of major and minor congenital malformations in babies conceived through ART which may be due to genetic abnormalities in sperm which may be at cytogenetic or gene level. Moreover DNA microdeletions are promutagenic and once the paternal genome is expressed after 3-4 cell divisions (after day 3) it can induce mutations in rest of the genome. Thus knowledge of genetic aetiology is important as it not only provides a diagnosis in infertile cases but also aids in providing comprehensive genetic counseling as most adapted therapeutics to such couples.

1.3.1 ASSISTED REPRODUCTIVE TECHNIQUES

Techniques involving oocyteretrieval and ejaculated sperm: Gamete Intra-Fallopian transfer (GIFT), Peritoneal Oocyte Sperm Transfer (POST) Zygote Intra-fallopian Transfer (ZIFT) In Vitro Fertilization (IVF) Tubal Embryo Transfer (TET) Techniques including sperm retrieval: Testicular Sperm Aspiration (TESA) Per-cutaneous Epididymal Sperm Aspiration (PESA) Microsurgical Epididymal sperm Aspiration (MESA) Non-Scalpel Vasal Sperm Aspiration (NSVSA) For injection: Intra-CytoplasmicSperm Injection (ICSI), Artificial insemination (AI) ~ 5 ~

1.3.2 INTRACYTOPLASMIC SPERM INJECTION (ICSI)

Intracytoplasmic sperm injection (ICSI) is a laboratory procedure developed to help infertile couples undergoing in vitro fertilization (IVF) due to male factor infertility. ICSI, a form of micromanipulation, involves the injection of a single sperm directly into the cytoplasm of a mature egg (oocyte) using a glass needle (pipette).This process increases the likelihood of fertilization when there are abnormalities in the number, quality, or function of the sperm. ICSI is generally unsuccessful when used to treat fertilization failures that are primarily due to poor egg quality. Figure 2: ICSI Stages Day 0

The procedure is done under a microscope using multiple micromanipulation devices (micromanipulators, microinjectors and micropipettes). A holding pipette (on the left of picture) stablizes the mature oocyte. From the opposite site a thin, hollow needle is pierced through the oolemma and into the inner part of the oocyte. It is loaded with a single sperm that will be released into the oocyte. The pictured oocyte has an extruded polar body at about 12 o'clock indicating its ~ 6 ~

maturity. After the procedure, the oocyte will be placed into cell culture and checked on the following day for signs of fertilization.

1.4 RATIONALE OF THE STUDY

Till date numerous studies have focused on the analysis of AZF microdeletions from blood of men with Non Obstructive Azoospermia (NOAZ) or oligozoospermia but to the best of our knowledge very few studies and none from India have focused on AZF microdeletions of sperms of infertile men. As blood is mesodermal in origin it may not exactly reflect the same genetic anomaly as sperms which are endodermal in origin. Therefore it was planned to compare if the germ cell genome harboured similar microdeletions (same loci, frequency) as genomic DNA isolated from blood. It is very important because it is the genetic integrity of sperms which is important for procreation. Thus in this era of Assisted Reproductive Techniques when a large number of infertile couples opt for ICSI etc Yq microdeletion analysis of gametes is a better diagnostic and prognostic indicator. This study thus will help to decide if Yq screening should be restricted to blood (if results are similar) or should be done in semen also, especially in cases opting for Assisted Reproductive Techniques (ART). Thus the present study is intended to provide not only a better aetiology or diagnosis of infertility in a large number of cases still classified as idiopathic but to also help in providing comprehensive counseling to such men who are opting for Assisted Reproductive techniques

~ 7 ~

(ART) about the chances of the offspring iatrogenically inheriting the same genetic anomaly with the same or much more severe phenotypic defect.

2. AIMS AND OBJECTIVES

To compare the status of Yq microdeletion in genomic DNA isolated from blood and sperms in infertile men. This will be achieved by analyzing: AZF microdeletions in DNA isolated from blood AZF microdeletions in DNA isolated from sperms

~ 8 ~

3. REVIEW OF LITERATURE

3.1 INFERTILITY
Infertility is defined as the state in which a couple wanting a child cannot conceive after 12 months of regular unprotected intercourse (Mueller and Daling 1989; Thonneau et al 1991). The International Council on Infertility Information Dissemination (INCIID) considers a couple to be infertile if: They have not conceived after 12 months of unprotected intercourse or after 6 months if the woman is over 35 years of age.

There is incapability to carry a pregnancy to term. 3.1.1 Primary vs. secondary

Couples with primary infertility have never been able to conceive, while, on the other hand, secondary infertility is difficulty conceiving after already having conceived and carried a normal pregnancy. Technically, secondary infertility is not present if there has been a change of partners.

3.2 ETIOLOGY
~ 9 ~

Recently the focus has shifted on to genetic causes which have been found to be important irreversible cause of partial or complete spermatogenic arrest. In at least 15 to 20% of infertile males infertility is due to genetic causes (Engel et al, 2004). Sperm DNA damage has been proposed as one of the most important cause of male infertility (Sun & Zhou, 2006). Infertile men with normal sperm count may have sperms with DNA damage and fragmentation and this condition is promutagenic. Sperms are produced by a complex differentiation process which is under control by cascade of developmental genes. Mutations, numerical or structural abnormalities of not only sex chromosomes but also of autosomes have been reported as to be the causes of male infertility(Serebrovska et al, 2006) e.g. Klinefelter syndrome, CFTR mutation and AZF(Azoospermia Factor) mutation. Probability for the transmission of CFTR mutation to the next generation is 50% and in case of Klinefelter mosaics probability may reach upto 70%, but in case of AZF deletions transmission to male child generated with ICSI is 100%. Thus the genetic changes associated with male infertility must be taken into account, while planning for any Artificial Reproductive Technique (ART) Spermatogenesis is a complex process and it is subject to the influence of many genes; the molecular mechanisms involved are beginning to be understood (Diemer and Desjardins 1999; Egozcue et al 2000; Hargreave 2000). It is estimated that about 2,000 genes regulate spermatogenesis, most of these being present on the autosomes, with approximately 30 genes on the Y chromosome (Hargreave 2000). While autosomal genes that regulate spermatogenesis are concerned with regulation of metabolic process in other cells in the body as well ~ 10 ~

as in spermatogenic cells, Y genes are not essential for general body function except with regard to vital male reproductive processes (Hargreave 2000). Thanks to developments in molecular genetics over the past decades, a significant proportion of idiopathic male infertility in otherwise-healthy males is now known to be genetic in origin. Despite intense efforts, only a few human spermatogenic genes have been identified but their precise function remains unknown. Genetic factors involved in male infertility are manifested as chromosomal disorders, monogenic disorders, multi-factorial disorders and endocrine disorders of genetic origin (Diemer and Desjardins 1999; Egozcue et al 2000). Microdeletions of the Y chromosome that remove associated fertility genes have received attention of late (Chandley 1998; Vogt et al 1996).

3.3 Y CHROMOSOME
Y chromosome is a group G acrocentric chromosome, with pseudoautosomal region(PAR) on both arms, non recombining region(NRY) or Male specific Y region (MSY) occupying 95% of the Y chromosome. NRY has been studied using deletion mapping and Y chromosome has been divided into 7 deletion intervals. In mice, more than 300 genes necessary for normal spermatogenesis have been identified (Escalier et al, 2006). In man it has been found that genes essential for spermatogenesis are located on intervals 5, 6(on Yq) and has been called Azoospermia Factor (AZF) (Tiepolo and Zuffardi, 1976). This locus has further been divided into 3 regions AZFa, AZFb, AZFc.

~ 11 ~

Figure 3: Y Chromosome

The main candidate in AZFb is the RBMY (RNA-binding motif) gene family whose expression is restricted to the testis. RBMY consists of approximately 30 copies of genes and pseudogenes found on both arms of the Y chromosome, but it is suggested that functional genes are clustered at the Yq in the AZFb region. The main candidate gene in AZFc is the DAZ (Deleted in Azoospermia) cluster, a set of genes transcribed in the adult testis and expressed exclusively in germ cells. RBM and DAZ genes families encode RNA binding proteins with similar structures related to hnRNPG family of proteins (heterogenous nuclear

~ 12 ~

ribonucleoproteins) involved in RNA metabolism, including packaging of RNA, transporting to cytoplasm and splicing. The physical size of these regions has been estimated to be 1-3 Mb for AZFa and AZFb and 3 Mb for AZFc. Thus these AZF genes have been found to code for RNA binding proteins and may be involved in regulation of gene expression, RNA metabolism, packaging and transport to cytoplasm and RNA splicing. About 10% infertile men with 46 XY karyotype have been found to harbour microdeletions of the Azoospermia Factor (AZF) loci on long arm of Y chromosome (Yq). Recently in a study conducted by Song N H et al(2006) out of 21 infertile males studied 4.8% were found to have deletions in AZFa loci, 9.5% in AZFb loci and 76.2% in AZFc loci. Deletion of these loci have been found to result in spermatogenic arrest and result in azoospermia, oligozoospermia and varied testis histological profile ranging from Sertoli Cell Only (SCO), to hypospermatogenesis, to maturation arrest (Dada et al, 2006). Vogt and his associates(1996) correlated genotype with the phenotype and found that deletions at AZFa loci resulted in complete absence of germ cells, AZFb deletions resulted in maturational arrest at spermatocyte stage and AZFc deletions showed a more variable phenotype ranging from SCO to hypospermatogenesis. Pao-Lin Kuo et al (2003) have reported that the decreased transcriptional levels of RBMY1 and DAZ in patients with spermatogenic failure may reflect the generalized loss of germ cells. Y chromosome abnormalities are now recognized as the most important genetic etiology of idiopathic infertility.

~ 13 ~

The relatively high frequency of de novo Y deletions points to the fact that the Y chromosome is susceptible to spontaneous loss of genetic material. The instability of the Y chromosome may be related to the high frequency of repetitive elements clustered along the length of the chromosome, and deletions may occur through aberrant recombination events (between areas of homologous or similar sequence repeats between the X and Y chromosomes, or by chromosome unbalanced sister chromatid exchange) or by slippage during DNA replication. Also as majority of Y chromosome (95% NRY) does not undergo recombination, hence deleterious events and mutations tend to accumulate on this chromosome. Figure 4: Human Y chromosome showing the 7 deletion intervals and the Azoospermia Factor loci on deletion interval 5+6 on Yq and Sex Determining Region on deletion interval 1 on Yp

~ 14 ~

3.4 Y Chromosome and Spermatogenesis

THE Y chromosome is not essential for life and until recently most regions of it were assumed to be functionally inert. Sex determination (controlled by the SRY gene)( Sinclair et al 1990) has long been viewed as the sole function related to the Y chromosome (Burgoyne et al 1998), but this theory changed in recent years when another important function (the control of spermatogenesis) (Tiepolo and Zuffardi, 1976) was discovered and many genes were mapped to the Y chromosome. Spermatogenesis is a long and complex process requiring about 70 days and involving an elaborate succession of distinct cell types (Clermont 1996, Dym 1994) generated by mitotic and meiotic divisions. In the initial stages, spermatogonia divide via mitoses, giving rise to primary spermatocytes, which in turn undergo the first meiotic division leading to secondary spermatocytes. Through the second meiosis these cells produce haploid cells (round spermatids), which elongate during the spermiogenesis process (elongated spermatids) and finally differentiate into mature spermatozoa, by condensation of the chromatin, substitution of histones with protamines, and formation of the acrosome and the other sperm components. However, our knowledge of the mechanisms regulating spermatogenesis is still poor, and only recently has research focused on the identification of genes specifically involved in its regulation.

~ 15 ~

3.5 Structure and Gene Content of Y Chromosome

The Y chromosome is the smallest human chromosome and consists of a short (Yp) and a long (Yq) arm. The pseudoautosomal regions (PARs), which pair with the X chromosome during meiosis, are located at both ends. The region outside the PARs that does not recombine is called the non recombining region of the Y chromosome (NRY) (Fig. 5). This part consists of several repetitive sequences that may be homologs to regions on the X chromosome or Y-specific.

Figure 5: Schematic representation of Y chromosome

The Yp and the proximal part of Yq consist of euchromatin, while the distal part of the long arm is made of heterochromatin, and this region may vary in length to constitute about one-half to two-thirds of Yq (Fig.5). Therefore, the Y chromosome long arm may be cytogenetically divided in an euchromatic proximal region (Yq11, subdivided into Yq11.1, 11.21, 11.22, and 11.23) and a heterochromatic distal region (Yq12), whereas the euchromatic short arm is called Yp11 (Fig. 2a). The absence of meiotic recombination within most parts of the Y

~ 16 ~

chromosome has hindered the construction of a linkage map of the chromosome. Therefore, Y chromosome mapping has been based on naturally occurring deletions. The initial Vergnaud interval map (Vergnaud et al 1986) divided the Y chromosome into seven intervals (Fig. 2b): the short arm and the centromere contain intervals 14, distal to proximal; the euchromatic part of Yq is represented by intervals 5 and 6, proximal to distal; the heterochromatic region is defined as interval 7. Deletion interval 5 corresponds approximately to Yq11.21 through the middle part of Yq11.22, and deletion interval 6 corresponds to the middle part of Yq11.22Yq11.23. On this basis, Vollrath et al. further divided the seven-interval map in 43 subintervals. Initial attempts to draw a physical map of the Y chromosome led to the isolation of overlapping yeast artificial chromosome (YAC) contigs (Jones 1994, Affara 1996). More recent efforts in sequencing came from a systematic approach within the Human Genome Project. With the major contribution of the two leading centers involved in this project (Washington University and Whitehead Institute), nearly 40% of the euchromatic region of the Y chromosome (about 13 Mb out of the estimated 35 Mb) have been sequenced, and more than 40 contigs have been isolated (data updated at the end of June 2000; official site

www.ncbi.nlm.nih.gov/genome). Even if only half of them have been physically mapped to date, a finished sequence of the entire Y chromosome will be available in the near future. Together with this sequence map, more than 300 sequence-tagged sites (STSs) have been generated and mapped. STSs are known sequences of genomic DNA

~ 17 ~

that can be amplified by PCR. These STSs may be specific for a gene or may overlap anonymous regions of the Y chromosome, and their use in Y deletion screening will be discussed in Section VII. Many genes on the Y chromosome have been identified only recently, and perhaps novel genes will be described once sequencing has been completed; so far, more than 30 genes and gene families are known. As summarized by Yen (Yen, 1999), these genes can be classified into three groups on the basis of their location on the Y, their copy number, and their pattern of expression: 1) pseudoautosomal genes (such as ASMTL, MIC2, and IL9R): their sequences are identical on the Y and X chromosomes and, with few exceptions, they are expressed in different tissues; 2) genes located within X-Y homologous regions on the NRY (such as USP9Y, DBY, and UTY): these have homolog on the X chromosome encoding for proteins with very high amino acid identity. These genes are ubiquitously expressed, although some have testis specific transcripts in addition to ubiquitous transcripts; 3) Y-specific gene families (such as DAZ, CDY, and TSPY); these are multicopy genes, widely distributed on the Y chromosome or clustered within a small region, and they are expressed only in the testis. One exception to this classification is SRY, the gene that determines testis development: it is Y-specific, but it is in single copy and has a different pattern of expression, limited to the genital ridge and in fetal and adult Sertoli cells and germ cells (Koopman 1999, Jeske 1995, Salas-Cortes 1999).

~ 18 ~

3.6 THE AZOOSPERMIA FACTORS

Tiepolo and Zuffardi in 1976 were the first to hypothesize a correlation between Y chromosome deletions and male infertility. These authors examined the karyotype of 1,170 men; in six sterile males with azoospermia they observed large deletions including the entire heterochromatic region (Yq12) and an undefined amount of the adjacent euchromatic part (Yq11). In two cases they demonstrated that the fathers of the patients with deletions carried a normal Y chromosome, indicating that these mutations were de novo events. This suggested that the deletions were the cause of the azoospermia and they postulated that a genetic factor located in Yq11 was important for male germ cell development. This gene or gene cluster was defined as azoospermia factor (AZF).

However the genetic complexity of the AZF YAC-based mapping,these analyses permitted the detection of interstitial submicroscopic deletions not visible at the cytogenetic level and detectable only by STS-PCR or Southern hybridization. Such deletions are called microdeletions. Molecular mapping analyses on patients with microdeletions have complicated the original hypothesis of a single locus for spermatogenesis on Yq, suggesting that three non overlapping regions in deletion intervals 5 and 6 may be deleted in infertile men. These spermatogenesis loci are termed AZFa, AZFb, and AZFc (Vogt et al 1996) from proximal to distal Yq.

Furthermore, a fourth region (AZFd) has been proposed between AZFb and AZFc (Kent-First et al 1996), but this finding must be confirmed. According to Vogt et

~ 19 ~

al. (Vogt et al 1997) (Fig. 2c), AZFa is located at the proximal portion of deletion interval 5 (subinterval 5C), AZFb spans from the distal portion of deletion interval

Figure 6: Representation of cytological bands and Vergnaud map of Y chromosome

Cytological Bands

Vergnaud Map

~ 20 ~

5 to the proximal end of deletion interval 6 (subinterval 5O6B), and AZFc is located at the distal part of deletion interval 6 (subintervals 6C6E). Several genes located in AZF regions are expressed in the testis and could therefore be viewed as AZF candidate genes. However, based on studies of infertile patients, only a few genes can actually be considered responsible for the AZF phenotype.

The first AZF-candidate gene was isolated in 1993 from a region subsequently shown to correspond to AZFb. Two years later the second AZF-candidate gene was identified from the AZFc region. Both genes have been quite well studied both at the molecular level and in terms of deletions in infertile patients. The structure of AZFa and its gene content have only recently been described, and analyses of this region in infertile males suggested that two genes may be considered AZFa-candidate. However, it should be noted that recent findings of many genes or gene families outside the proposed AZF regions (Lahn and Page ,1997) suggest that even this classification may be an oversimplified picture.

3.7 AZFa Region and Candidate Genes

The most recent data suggest that more than one gene may be responsible for the AZFa phenotype. However, the characterization of the critical interval is still under way, and the structure and gene constitution of this region have only recently been described (Lahn 1997, Mazeyrat 1998, Sargent and Sun 1999, Foresta 1997).This region contains three genes and has a syntenic homology with the mouse DSxrb interval (Mazeyrat et al 1998) located on the Y chromosome short arm, deletion of which causes a severe spermatogenic impairment (Sutcliffe, ~ 21 ~

Darling and Burgoyne,1991) very similar to that observed in patients with the AZFa deletion. The first gene identified in AZFa and subsequently shown to be absent in infertile patients was DFFRY (Drosophila fat facets related Y) (Mazeyrat and Brown, 1998) recently renamed USP9Y (ubiquitin specific protease 9, Y chromosome). This gene differs substantially from the other AZF candidate genes DAZ and RBMY: it does not encode for an RNA-binding protein, but seems to function as a C-terminal ubiquitin hydrolase; it is a single copy gene, it has an X-homologous gene that escapes X-inactivation, and it is ubiquitously expressed in a wide range of tissues, rather than testis specific (Lahn, 1997,Brown 1998) Furthermore, a nine-residue peptide derived from USP9Y has been shown to represent a new minor histocompatibility antigen (H-Y antigen) presented by HLA-A1 and involved in graft rejection (Vogt et al 2000). USP9Y occupies less than half of the AZFa interval (Sargent 1999), while the majority of infertile males carrying AZFa deletions show the absence of this entire interval (Vogt 1996 and 1997, Kent-First 1999, Mazeyrat 1998, Ferlin 1999, Najmabadi 1996, Foresta 1997, 1998). These findings suggested that other gene(s) in this region may be responsible, either singly or in combination with USP9Y, for the spermatogenic disruption observed in AZFa-deleted patients. In fact, comparative mapping studies showed that two further X-Y homologous genes are located both in the Sxrb interval and in AZFa, suggesting a possible role in spermatogenesis: DBY (dead box on the Y) and UTY (ubiquitous TPR motif on the Y). More recently, a novel expressed sequence (AZFaT1) was mapped to this

~ 22 ~

region. All such genes appear to be ubiquitously expressed, therefore differing from their mouse homologs, since mouse Dby, for example, is expressed in several tissues and Dffry is testis specific. Initial studies on patients with deletions clearly limited to AZFa suggested that deficiency of USP9Y or AZFaT1 or both cause male infertility and that the additional loss of DBY may make the phenotype worse. Substantial proof for USP9Y as a spermatogenesis gene has been recently published, since a 4-bp deletion leading to a truncated protein was discovered in an azoospermic man. An extensive deletion and expression analysis of deletion intervals 5 C/D in highly selected infertile patients allowed us to assemble a refined map of AZFa and to demonstrate that DBY may represent the major spermatogenesis gene of this region (Foresta et al 1997). It is more frequently deleted than USP9Y, and it shows a testis-specific transcript in addition to ubiquitous transcripts. The role for this gene in human spermatogenesis is further supported by the significant homology of DBY with the mouse protein PL10, which is testis-specific and expressed only in germ cells. DBY consists of 17 exons and encodes for a putative ATP-dependent RNA helicase, as it belongs to the DEAD box proteins (Linder et al 1989, Chuang 1998). However, its specific function in male germ cell development is still unknown.

~ 23 ~

Figure 7: Representation of Vollrath Map of Y Chromosome

Vollrath Map

~ 24 ~

3.8 AZFb Region and Candidate Genes

A detailed sequence and gene map of AZFb is still not available and only nonoverlapping YAC and BAC clones have been described. Even if the AZFb interval, as usually defined, spans the subintervals 5O6B, the precise boundaries can differ and its exact extension is unclear. This depends on different deletion events between individuals and differences in screening procedures.

Microdeletions can remove AZFb alone, parts of AZFb, or also include flanking regions (e.g., AZFc). The extent of deletions will obviously affect which genes are removed: for example, deletions may remove the block SMCY-XKRY-CDY2, or the block PRYTTY2 if they extend proximally or distally, respectively. To date, two genes have been mapped to subintervals 5O6B: EIF1AY (translationinitiation factor 1A, Y isoform) and RBMY (RNA binding motif on the Y). EIF1AY encodes a Y isoform of eIF-1A, an essential translation initiation factor, which has an X homolog and is ubiquitously expressed. Its role in spermatogenesis is completely unknown, and no deletion specifically removing this gene has been reported. Therefore, it is not considered an AZFb-candidate gene. However, EIF1AY possesses abundant testis-specific transcripts in addition to ubiquitous transcripts, suggesting that this gene may contribute to the AZFb phenotype. RBMY was the first among the AZF candidate genes to be identified and was cloned using patient DNA with a deletion in the proximal region of interval 6 (Ma et al 1993). Initially, two similar cDNAs were isolated and named YRRM1 and 2 (Y-specific RNA recognition motif) as they were predicted to encode a protein with an RNA-binding motif. Subsequently it was shown that, in

~ 25 ~

fact, there is a family of 2050 genes and pseudogenes spread over both arms of the Y chromosome, including a cluster within the AZFb region (Prosser 1996, Elliott 1997), and YRRM was renamed RBMY gene family. Such copies belong to at least six subfamilies (Chai 1994,1998), but RBMY-I is the only actively transcribed gene, and the most functional copies are located on interval 6B, thus making it a major candidate for the AZFb region. RBMY is present as multiple copies in all eutherian (placental) mammals (Delbridge et al 1997) and has an active X-borne homolog recently discovered both in humans and marsupials (Delbridge and Mazeyrat, 1999). It has been proposed that RBMX retained a widespread function while RBMY evolved a male-specific function in spermatogenesis. The RBMY proteins consist of a single RNA-binding domain of the RRM (RNA recognition motif) type at the N terminus and an auxiliary C-terminal domain containing four 37-amino acid (aa) repeats. This domain is known as the SRGY box, since it contains a serinearginine-glycinetyrosine sequence. The gene consists of 12 exons, and the 37residue repeats are encoded by single exons (exons 710), which show more than 85% homology between their nucleotide sequences (Najmabadi et al 1996). Consistent with a role in spermatogenesis, the RBMY genes are expressed only in the germline in the testis (spermatogonia, spermatocytes, and round spermatids). The actual function of RBMY in male germ cell development is not clear; it is a nuclear protein with dynamic modulations in its spatial location in the various spermatogenic cells, suggesting that it possesses different functions related to premRNA splicing (Elliott 1998). RBMY is considered the major AZFb candidate

~ 26 ~

gene given its testis specificity, its absence in a fraction of infertile patients, and its homology with the mouse Rbm, deletion of which causes male sterility (Elliott 1996, Laval and Reijo 1995, Mahadevaiah 1998). However, the multicopy nature of this gene has complicated attempts to prove its role in human spermatogenesis, as detrimental mutations in patients have not yet been identified.

3.9 AZFc Region and Candidate Genes

In an attempt to correlate severe spermatogenic defects with frequent and consistent de novo microdeletions of the Y chromosome, Reijo and colleagues cloned a novel gene from the distal portion of deletion interval 6 shown to be deleted in men with azoospermia. This gene was named DAZ (deleted in azoospermia) and was originally thought to be single copy, whereas it is now clear that it is a member of a multigene family with more than one copy on the Y chromosome, clustered in the AZFc region (Saxena 1996, Glaser 1998, Yen 1998). Therefore, DAZ was renamed DAZ gene family. The exact number of genes in the family is still not clear, although at least three copies have been described by Southern blotting or restriction mapping (Reijo 1995, Yen 1997,1998), and seven copies, representing either active genes or pseudogenes, may be seen by fiber- fluorescent in situ hybridization .The structure of the DAZ gene is somewhat similar to that of RMBY. DAZ encodes a protein with a single RNA binding domain at the N terminus and a C-terminal domain containing an internally repeated sequence of 24 aa, the so called DAZ repeats. The DAZ transcription unit appears to contain at least 16 exons and to

~ 27 ~

span about 42kb.Exon 1 consists of the initiator codon, exons 25 encode the RNA-binding domain, and each of exons 7a7 g encodes a single DAZ repeat. The number of DAZ transcripts is unclear, since RT-PCR studies showed that each individual carries two or more species of DAZ transcripts, which differ in both the copy number and the order of the DAZ repeats. Such DAZ transcripts could have derived from the same gene through alternative splicing or from different DAZ genes. Like RBMY, DAZ is transcribed and translated into proteins only in male germ cells (Menke 1997, Habermann 1998, Ferlin 1999, Lee 1998), even if a discrepancy exists between the findings of Pages group (expression mainly in spermatogonia) and that of Vogts group (detection of DAZ proteins in late spermatids and sperm tails). DAZ is found on the Y chromosome only in humans, Old World monkeys, and apes (Saxena 1996, Cooke 1996, Gromoll 1999, Carani 1997). In all other mammals it is represented as an autosomally located, single copy gene (Cooke 1996, Houston 1998, Reijo 1996, Maiwald 1996). DAZ was acquired by the Y chromosome from an autosomal homolog DAZL1 located on chromosome 3p24 and with a single DAZ repeat (Shan 1996, Yen 1996, Seboun 1997, Chai 1997). A complete DAZL1 copy was transposed to the Y chromosome, a 2.4-kb genomic sequence encompassing exons 7 and 8 was tandemly repeated, and, finally, the whole transcription unit was amplified, giving rise to a multicopy gene family. Although DAZ is not the only gene present in the distal Yq interval 6, its high prevalence of deletions in infertile men makes it the major AZFc candidate. This possibility is further strengthened by the high homology of DAZ with a

~ 28 ~

Drosophila male infertility gene, boule, mutation of which causes spermatogenic arrest (Eberhart 1996, Burgoyne 1996). Furthermore more recent proof of the spermatogenic role of the DAZ gene product arises from the observation that a human DAZ transgene is capable of partially rescuing the sterile phenotype of a mouse knockout for the homologous gene Dazl (Slee et al 1999). However, most difficulties in understanding the biological function of DAZ and the genotype-phenotype relation probably arise from the multicopy nature of this gene. Like RBMY, deletions of DAZ in infertile patients are generally screened by PCR on genomic DNA extracted from peripheral leukocytes. Therefore, only deletions removing the whole of the DAZ gene cluster can be detected, and intragenic deletions or deletions not involving all the DAZ copies, as well as de novo point mutations in affected patients, have yet to be discovered. Therefore, there is still no definitive proof for a requirement of DAZ in spermatogenesis. Although a sequence map of AZFc is not yet available, several genes other than DAZ have been mapped to this region: CDY1 (chromodomain Y 1), BPY2 (basic proteinY 2), PRY (PTA-BL related Y), and TTY2 (testis transcript Y 2). The function of these genes is unknown, but they share similar characteristics: they are in multiple copies on the Y chromosome, they are expressed in the testis only, and they are Y specific. In particular, three PRY and TTY2 genes have been identified in the proximal part of AZFc by restriction mapping, and therefore they are probably not involved in the spermatogenic disruption observed in patients with deletion limited to DAZ. Two CDY1 genes map in the AZFc region, one within the

~ 29 ~

DAZ cluster and the other one at the distal end. This finding is intriguing since at least one CDY1copy in invariably absent in patients with DAZ deletion. Therefore, CDY1 can be considered an AZFc-candidate gene, but deletions removing this gene specifically should be identified in patients to confirm this hypothesis. No mapping and deletion data are available for BPY2, which, therefore, is not included at present among the AZFc candidate genes.

3.10 GENOTYPE AND PHENOTYPE CORRELATION

Deletions removing the entire AZFa or AZFb regions (_complete_ deletions) are associated with Sertoli Cell only syndrome (SCOS) and spermatogenic arrest, respectively (Krausz et al., 2000; Kamp et al., 2001). Partial deletions of these regions or complete or partial AZFc deletions are associated with a variable phenotype ranging from hypospermatogenesis (oligozoospermia) to SCOS. Figure 8: Description of Various Regions on Y Chromosome

~ 30 ~

A possible explanation for such a variable phenotype is a progressive regression of the germinal epithelium over time which has been reported in patients with AZFc deletions (Warchol et al., 2000; Calogero et al., 2001). An alternative explanation for the variable phenotype is related to influences of the genetic background and environmental factors in different individuals. In two studies of the Danish population complete hormonal analysis was available in all patients (Krausz et al., 2001a; Frydelund-Larsen et al., 2002). The relatively high level of Inhibin B, found in the group of men with AZF deletions presenting SCOS by Foresta et al. (2002) may be related to the different biopsy procedures used in the studies. Fine needle biopsy used by Foresta et al. may lead to overlooking of areas of spermatocytic arrest or to a false overrepresentation of SCOS.

3.11 Chromosomal Abnormalities and Male Infertility

Kjessler (1974) and Chandley (1979), after a large karyotypic survey of subfertile males, proposed the first possible association between the chromosomal abnormalities and male infertility. The 47, XXY karyotype variant of Klinefelters syndrome, is the most common chromosomal disorder associated with male infertility. 11% of the azoospermic and 0.7% of the oligospermic men have this condition Bielanska et al. 2000; Bhasin et al. 2000). Cytogenetic abnormalities have been observed to be more frequent among infertile men than in the general population (Shi and Martin 2001).Chromosomal abnormalities are common in infertile men, for example in those who are 47, XXY or have Klinefelters syndrome (Egozcue et al 2000). Besides numerical abnormalities, structural ~ 31 ~

abnormalities also lead to phenotypic male reproductive disorder or may predispose to severe congenital abnormality when gametes are formed (Diemer and Desjardins 1999). In one survey of infertile men (n = 9766), the incidence of chromosomal abnormalities was 58% and of these, sex chromosomal abnormalities accounted for 42% and autosomal abnormalities, 15% (Johnson 1998). The incidence of these abnormalities is quite low in normal male population (Van-Assche et al 1996). Unfortunately, such a documented data from across the Indian population is not available.

~ 32 ~

4. METHODOLOGY AND TECHNIQUES

For this study 15 men (with severe oligozoospermia i.e. with sperm count less than 5 million/ml) and 15 fertile men (age matched) as controls were included. These cases were referred from Andrology clinic (Urology Department) of AIIMS and ART Centre of Army Research and Referral hospital. A detailed family, reproductive, sexual, occupational and medical history was collected from the patient. After informed consent 5ml of blood and semen was collected from each case. Genomic DNA was isolated from both blood and semen according to protocols given below. Institute ethical clearance was also obtained prior to the study.

4.1 CYTOGENETIC ANALYSIS: (Rooney and Czepulkowski, 1994)

Prior to molecular analysis, cytogenetic analysis was done to negate the presence of any structural or numerical cytogenetic abnormality as only those cases which were cytogenetically normal were included in the study. For this lymphocyte cultures were setup and chromosomes were analyzed by G banding. 4.1.1 Procedure 1. 5 ml of heparinised blood was drawn and kept in an upright position at 37 C for 30 min to separate plasma from red blood cells. ~ 33 ~

2. Then, the plasma and the settled lymphocytes (Plasma Lymphocyte Suspension) in the Buffy coat were tapped and mixed together. 3. The needle was bent at the right angles and 0.5 ml of PLS was transferred into a sterile culture vial containing 5ml of media RPMI 1640 and 0.2 ml of Phytohaemogluttinin (PHA). 4. The culture was incubated for 72 hours at 37 C. After 70 hours of incubation 0.1 ml (0.2%) of Colcemid was added to the cultures. At 72 hours the samples were washed for removing colcemid. 5. The vials were centrifuged at a speed of 1000 rpm for 10 minutes. The supernatant was discarded and freshly prepared prewarmed hypotonic solution (0.56% KCl) was added and incubated for 20-25 min. at 37 C. 6. The cell suspension was centrifuged again and after discarding the supernatant, freshly prepared chilled Carnoys fixative (methanol: acetic acid, 3:1) was added to the cell pellet slowly. 7. At least three washes of fixative were given till the pellet obtained was pale. Two drops of cell suspension were dropped from a height on a clean wet slide.

4.1.2 G banding and Karyotyping: (Sumner 1982)

1. The 3 days old matured unstained chromosome preparations were flooded with 0.25% Trypsin for 10-15 seconds, then the slides were rinsed in phosphate buffer saline.

~ 34 ~

2.

The slides were stained in 2% Giemsa stain for 5-7 minutes, thereafter they were washed in distilled water.

3.

Metaphases were captured and analysed using cytovision software (ZEISS microscope) classified according to ISCN 1995.

4.1.3 Karyotyping: The normal human karyotype is composed of SEVEN

groups of chromosomes (A - G) plus the sex chromosomes (X and Y). The chromosomes were grouped according to size, position of the centromere and the characteristic banding pattern. The first seven groups are called the autosomes while the larger X and smaller Y chromosomes are called the sex chromosomes.

4.2 DNA EXTRACTION FROM BLOOD (Sambrook et al. 1989)

Total genomic DNA was also extracted from peripheral blood. 4.2.1 Procedure 1. 5 ml of blood stored in EDTA vaccutainers was incubated in 10 ml of lysis buffer (sucrose-hypotonic medium, MgCl2-chelating agent, Triton X 100detergent). It was used since it digested the RBCs and separated them from lymphocytes. 2. Tubes were mixed well for some time and kept in ice for 10 minutes. 3. They were centrifuged for 15 minutes at 4000 RPM. Supernatant was discarded and pellet was given another wash with lysis buffer. The procedure was repeated till the pellet became white.

~ 35 ~

4. The pellet was dissolved in 2 ml of DNA suspension buffer. 20 l of Proteinase K (breaks down proteins) of 40g/ml stock was also added along with 0.5 ml of 20% SDS. Incubate at 37C overnight. 5. Added 5 ml of equilibrated phenol (pH 8) and 5 ml of chloroform: isoamylalcohol(24:1) (the two layers, one aqueous and other organic layer was formed). 6. The tubes were centrifuged at 6000 RPM for 12 minutes. DNA was suspended in aqueous solution and proteins were precipitated in organic layer. 7. Upper viscous layer was transferred with a cut tip i.e. spooled into a fresh falcon tube. DNA was precipitated by adding 100% ethanol and 1/10th the volume of sodium acetate. 8. DNA was transferred into 1.5 ml of eppendorf and washed twice with 70% ethanol twice. The DNA was air-dried at 37C and was then allowed to dissolve in 100 l of TE buffer (Tris EDTA buffer) pH 8.

~ 36 ~

4.3 SEMEN ANALYSIS: (WHO - 1999) 4.3.1 Sample collection and investigation
Samples were collected by masturbation with a sexual abstinence of 72 hours to not more than 120 hours into a clean, wide-mouthed glass or plastic container. The name of the patient, period of abstinence, date and time of collection were recorded on the form. The sample was protected from extremes of temperature (not less than 200C and not more than 40C). 4.3.1.i Macroscopic examination: Macroscopic examination was made for colour, liquefaction, viscosity, volume and pH. 4.3.1.ii Microscopic examination: During microscopic investigation of the samples, estimates of motility and concentration of spermatozoa was performed and presence of cells other than spermatozoa and agglutination of spermatozoa was determined. The categories used for classifying sperm motility are defined as: a) Grade A: rapid and linear progressive motility referred as excellent and good. b) Grade B: slow or sluggish linear or non-linear movement referred as weak or moderate. c) Grade C: non-progressive motility. d) Grade D: immotile.

~ 37 ~

4.3.2 Motility, Viability, Count and Morphological Assay

4.3.2.i Procedure 1. For determining motility, 10-15 l of semen was placed on a clean slide and was covered with a cover slip. 2. The preparation was examined at 100X to see whether sperms are having rapid and linear motility (normal), or are having slow and sluggish movement, or some kind of non-progressive motility. 3. To study the viability Eosin nigrosin was used for staining. 0.5% (W/V) solution in physiological saline 10-15 l of fresh semen with one drop of 0.5% eosin nigrosin solution was mixed on a microscope slide and covered with cover slip. After 1-2 minutes, preparation was observed at 100X under bright light or phase contrast. Unstained (live) and stained (dead) spermatozoa were counted. 4. To study the morphological parameters, smear was prepared and was stained with giemsa stain. The observation for the structure of head, midpiece and tail of the spermatozoa were evaluated under oil immersion in 100X objective. A minimum of 200 sperms were screened for morphological abnormalities of head, midpiece and tail. 5. To study the sperm count, after adding 950 l of diluent to 50 l of liquefied sample a drop was transferred to haemocytometer which was then covered with a cover slip. ~ 38 ~

6. This was then allowed to stand in a moist chamber for 5 minutes. Finally the cell sediment was counted under light microscope at 100X. The procedure for counting is that the central square of the grid in an improved neubauer chamber containing 25 large squares, each with 16 smaller squares, for samples containing less than 10 spermatozoa per square, the whole grid, i.e. 25 squares were counted, for samples containing 10-40 spermatozoa per square, 10 squares were assessed and for samples containing more than 40 spermatozoa per square, 5 squares were analyzed. If a spermatozoa lies on the line dividing two adjacent squares, it should be counted only if it is on the upper or left side of the square being assessed. To determine the concentration of spermatozoa in the original sample in millions/ml, number of spermatozoa was multiplied by appropriate dilution factors given above. 7. The semen sample of the patients was next processed for Transmission Electron Microscopy (TEM) and photographs were captured to confirm the status of the sperms.

4.3.3 Hormonal assessment:

Serum FSH, LH and testosterone levels were measured in cases and controls by employing radio-immuno technique and were provided from Urology

Department.(Fossa et al., 1977).

~ 39 ~

4.4 DNA EXTRACTION FROM SPERM :( Lench et al. 1988)

Total genomic DNA was extracted from 0.2 ml of semen. 4.4.1 Procedure 1. After centrifugation for 10 min at 6000 RPM at room temperature, seminal plasma was removed & pellet was washed twice with isotonic saline solution (0.11M Sod. Citrate, 0.11 M Sod acetate) 2. The pellet was suspended in 0.4 ml of spermatozoa medium (10 mM TrisHCl pH 7.4, 10 mM EDTA, 2% SDS, 51mM NaCl (EDTA is a chelating agent, SDS is a detergent and NaCl acts as precipitant agent). 3. Proteinase K (digests proteins associated with DNA and plasma membranes) in a final concentration of 150 g/ml and 0.1 ml of 20 mM dithiothreitol was added in 10 mM Sodium acetate and then incubated for 20 hours at room temperature. 4. After incubation, DNA was extracted by sequential addition of one volume of phenol-isoamyl alcohol, phenol/chloroform (1:1) and chloroform / diethyl ether (1:1). Chloroform was used so as to precipitate proteins and DNA was obtained in aqueous phase of phenol. 5. DNA in the aqueous phase was precipitated by addition of cold ethanol, recovered by centrifugation, washed twice with 70% ethanol, air dried and was dissolved finally in Tris EDTA buffer.

~ 40 ~

4.5 QUANTIFICATION OF DNA

4.5.1 Procedure 1. DNA was quantified by using a UV spectrophotometer. 2. 5l of DNA was dissolved in 995l of distilled water and quantity was estimated by optical density at 260 nm and 280 nm. Ratio of optical densities obtained at 260nm and 280nm was measured to check the purity of DNA obtained and to negate any contamination with proteins, which may interfere with the PCR. 3. The 1 ml cuvette used was of quartz. The formula for DNA quantification used was:

260 x dilution factor x 50=quantity of DNA in g/ ml or ng/l

Following this PCR for microdeletion screening was done to determine presence of AZF microdeletion according to guidelines of Simoni et al. 1999

~ 41 ~

4.6 POLYMERASE CHAIN REACTION (Simoni et al., 2004)

Polymerase chain reaction is a method for amplifying a DNA sequence in large amounts, using a heat-stable polymerase and suitable primers to direct the amplification of the desired region of DNA. The steps involved in a PCR are:

Denaturation: DNA fragments are heated at high temperatures, which reduce the DNA double helix to single strands. These strands become accessible to primers.

Annealing: The reaction mixture is cooled down. Primers anneal to the complementary regions in the DNA template strands, and double strands are formed again between primers and complementary sequences.

Extension: The DNA polymerase synthesises a complementary strand. The enzyme reads the opposing strand sequence and extends the primers by adding nucleotides in the order in which they can pair. The whole process is repeated over and over.

Primers: Primers are short DNA or RNA fragments annealed to a singledstranded DNA and to which further nucleotides can be added by DNA polymerase.

DNA samples from semen of infertile males (as well as from fertile males as controls and DNA from blood of fertile females used as negative control) were used for PCR microdeletion analysis. Analysis was done for any deletion on interval 5 & 6 on Y chromosome and a locus on Yp as internal control.

~ 42 ~

Primer sets (as prescribed by European Academy of Andrology) spanning AZF loci were used. For AZFa locus was (sY86); for AZFb locus was (sY127) and for AZFc locus was (sY254). Primer used for SRY region on Yp (control) was (sY14). Though in guidelines two STS are used for a particular locus as this aids in reconfirming the diagnostic accuracy as most deletions are continuous, recent studies have shown that use of one polymorphic marker is also equally reliable for diagnostic purpose. Table 1: Primer sequences and all details

Y DNA marker (STS)

sY 86 (Yq) F:GTGACACACAGACTATGCTTC R:ACACACAGAGGGACAACCCT sY 127 (Yq) F:GGCTCACAAACGAAAAGAAA R:CGCAGGCAGTAATAAGGGA sY 254 (Yq) F:GGGTGTTACCAGAAGGCAAA R:GAACCGTATCTACCAAAGCAGC sY 14 (Yp) F:GAATATTCCCGCTCTCCGGA R:GCTGGTGCTCCATTCTTGAG

PCR Sequence product length

Gene or locus

320 bp

AZF a

274 bp

AZF b

350 bp

AZF c (DAZ)

472 bp

SRY

~ 43 ~

Table 2: The cycling parameters that were used are Initial denaturation at Amplification Denaturation at Annealing at Extension at A final extension step at 95C 35 cycles 95C for 1 min 56C for 30 sec 72C for 1 min 72C for 7 min

~ 44 ~

4.7 GEL-ELECTROPHORESIS
4.7.1 Procedure 1. 10 l aliquot of the PCR amplified products was loaded with 3 l of Bromophenol blue + Xylene cyanol dye and electrophoresed through 1.8% Agarose gel. 2. With each gel a DNA marker puc19 Msp1 digest was loaded to compare the exact position of the amplified products. 3. The gel was observed under UV transilluminator and captured using Gel Documentation System. A sequence tagged sequence (STS) was considered absent only after 3 amplification failures in the presence of successful amplification of internal control (SRY).The PCR was repeated in deleted cases by lowering the annealing temperature (1 to 2C) and by increasing the template DNA concentration and using DMSO.

~ 45 ~

5. RESULTS
In the present study 15 infertile males with idiopathic infertility were screened for the presence of Yq microdeletions. Semen analysis was done for each case to determine spermatogenic status and also cytogenetic analysis was done to identify the presence of any gross abnormality. It was ensured that patients selected for the study are cytogenetically normal. Mean sperm count of the patients selected for the study was found to be 5.12 millions/ml. PCR was run and successful amplification of SRY gene confirmed good quality of DNA used in PCR reactions. The PCR amplification product sizes for AZFa AZFb and AZFc genes using the above mentioned primers are 320, 274 and 350 bp. A DNA ladder was run along with the samples on the gel. Blood and semen samples of all 15 controls showed bands of appropriate size for all 3 markers, on the other hand no amplification was observed in DNA sample of female and blank (water) also showed no band, thus negating the possibility of any contamination. Bands of appropriate sizes were seen in blood samples of 14 infertile males but in Case no. 4 blood sample as shown in table 3 showed absence of sY127 STS (i.e. no band of 274bp). In this case semen also had similar deletions. Case no. 7 with primary infertility as shown in figure 19 showed micro-deletion of sY254 sequence tagged site in the DNA sample collected from his semen. But no deletion was found in DNA isolated from blood. So in this case AZFc was

~ 46 ~

found to be deleted in DNA isolated from sperms inspite of its presence in DNA isolated from blood. This deletion was further confirmed by seeing amplification failure in this sample by lowering annealing temperature and increasing DNA concentration and using 2% DMSO (dimethyl sulfoxide). Figure 9: Collected sperm sample

Figure 10: Cytoplasmic Droplet

~ 47 ~

Figure 11: TEM Picture showing Abnormal Sperm Morphology

Figure 12: Elongated Head and Cytoplasmic Droplet

~ 48 ~

Figure 13: Amourphous Head

Figure 14: Elongated and Round Shaped Head and Cytoplasmic Droplet

~ 49 ~

Figure 15: Phenotype of Case 7 Tall male with small gonads

Figure 16:Semen photomicrograph showing abnormal morphology

The TEM photographs as shown in figure 10-14 and the sperm analysis shows many abnormalities.

~ 50 ~

Figure 17: G banded Metaphase spread

~ 51 ~

Figure 18: Karyotype showing 46, XY chromosomal complement

~ 52 ~

Table 3: Reports and comparison

Case no.

Patient diagno sis

Sperm count (Million /ml)

Testic ular pheno type

Testicular FNAC

FSH (mIu /ml)

Karyoty pe

STS deleted

STS deleted

(Blood) (semen )

PI

Oligo (7.46) Oligo

b/l small b/l small

Maturation Arrest Left testisoccasional spermatozoa seen Right testis- no aspiration done

O.3

46, XY

--

--

13.52

46, XY ---

PI

(10.0)

PI

Oligo (2.0)

Small Hypospermat atropic ogenesis b/l small Do not show spermatozoa

20.02

46, XY

--

--

PI

Oligo (2.0)

18.77

46, XY

sY127

sY127

PI

Oligo (6.0)

Small N.D. atropic b/l small b/l small N.D.

4.6

46, XY

--

--

SI

Oligo (4.0)

4.64

46, XY

--

--

PI

Oligo 10.0

Sertoli cells only

28.17

46, XY

--

sY254

~ 53 ~

SI

Oligo (0.1)

Rt-10 ml Lt -12 ml

Right TestisBrisk Spermatogene sis Left TestisHypospermat ogenesis

N.A.

46, XY

--

--

PI

Oligo (2.0) Oligo

Rt-14 ml Lt -15 ml Rt-13 ml Lt -16 ml

N.D.

5.81

46, XY

--

--

10

PI

(10.0)

N.D.

4.9

46, XY

--

--

Oligo 11 PI (3.0)

Rt-14 ml Lt -14 ml

N.D.

3.81

46, XY

--

--

Oligo 12 SI (1-2 sperm only)

Rt-16 ml Lt -15 ml b/l small

N.D.

7.83

46, XY

--

--

Oligo 13 PI (Less than 10.0)

N.D.

10.6

46, XY

--

--

14

PI

Oligo (10.0)

b/l small

Shows normal spermatogene sis

4.69

46, XY

--

--

~ 54 ~

15

PI

Oligo (0.2)

Rt-14 ml Lt -15 ml

Asp. From Lt Testes shows blood only

17.40

46, XY

--

--

Figure 19: Gel photograph showing absence of 350 bp band in lane 4 i.e. in semen sample of case 7 though in the blood sample of the same case 350 bp band is present. Lane 1 is water (blank) and lane 7 is DNA sample from fertile male. In figure b refers to blood sample and s refers to semen sample. DNA for this electrophoresis was obtained after PCR using primers specific for sY254 STS i.e. AZFc gene locus.

~ 55 ~

6. DISCUSSION

Yq microdeletions are the most common genetic causes of the male infertility, though recent studies have also shown increase in cytogenetic abnormalities with decline in semen quality. Also postulated is the fact that azoospermic patients are generally associated with cytogenetic abnormalities in sex chromosomes and oligozoospermic patients associated with abnormalities in autosomes (Hasle et al,1995). However still in large no. of cases etiology cant be defined. In such cases screening for Yq microdeletions is necessary. Yq microdeletions have been reported in 2.7 to 55.5% of infertile men with percentage varying with different studies.(Simoni et al,1999; Krausz et al,2006; Dada et al,2006). In general, about 15% azoospermic and 5-10% oligozoospermic men show Y chromosome microdeletions. Semen analysis, clinical findings and cytogenetic analysis alone can not help in prediction of Y chromosome microdeletions especially in such cases. In the present study, molecular analysis of DNA isolated from blood and semen of 15 infertile men was planned. In our study, 13 out of 15 cases didnt show any deletion at all. Only 1 case i.e Case no. 4 as seen in table 3 showed similar microdeletions in both blood and semen samples for AZFb locus(sY 127). But Case no.7 as shown in figure 19 (i.e.1 out of 15 i.e. 6.67%) showed AZFc (sY254 DAZ gene) deletion in DNA isolated from semen though the same deletion was found to be absent in blood. AZFc deletion in the patient was ~ 56 ~

associated with bilaterally small testes, oligozoospermia (sperm count: 10.0 million/ml) along with Sertoli Cell Only histology of the testes with elevated FSH levels (25.17 mIU/ml). So in our preliminary study 13.34% of infertile cases showed Yq microdeletions in DNA isolated from sperms but only 6.67% of infertile cases showed such deletions in DNA isolated from blood. Thus out of 2 patients showing such deletions only 1 (i.e. 50%) showed discrepancy in deletions observed in samples collected from blood and semen. Though in the study by Komori et al (2001) didnt find any difference in the status of Yq microdeletion in blood and semen samples. But this preliminary study shows that there is the possibility that a particular microdeletion found in DNA isolated from semen is absent in DNA isolated from blood. This discrepancy has been shown for AZFc locus however it does not exclude the presence of similar cases for some different loci. More specifically, the incidences of sex chromosomal and autosomal abnormalities in infertile men were observed by Bhasin et al. (2000) to be 15 times and 6 times higher respectively, than in the general population. They also showed that ~4% of infertile males had sex-chromosomal abnormalities, while ~1% had autosomal abnormalities. Deletions in AZFa and in AZFb cause azoospermia in two thirds of all cases, and more rarely severe oligozoospermia. Therefore, the phenotype associated with such deletions seems to be more severe than that observed in AZFc-deleted patients, even if in some cases an AZFb

~ 57 ~

deletion (above all not including RBMY) may be associated with moderate oligozoospermia. The testicular histology of AZFa patients with azoospermia always shows Sertoli cell-only, while in patients with severe oligozoospermia it resembles severe hypospermatogenesis, i.e., no maturation arrest is seen.

6.1 The concern of assisted reproduction techniques:

ICSI is the direct introduction of a spermatozoon into an oocyte to achieve fertilization and pregnancy when the number of spermatozoa in the ejaculate is very low or even absent. In the latter case, ICSI can be performed using spermatozoa obtained from the epididymis or directly extracted from testicular tissue. Furthermore, techniques of spermatid injection into oocytes may be performed and first term pregnancies have been achieved in humans. Despite the worldwide diffusion of ICSI in recent years, the possible risks that might ensue from its indiscriminate use have been considered only recently. These concerns arose especially with the recent advances in genetically determined male infertility. The explosive growth of assisted reproduction techniques and, in particular, of intracytoplasmic sperm injection (ICSI) has contributed to the development of such research. The study of Y chromosome microdeletions is particularly important because of the potential for transmission of genetic abnor malities to the offspring, as these techniques bypass the physiological mechanisms related to fertilization. ICSI arouses more fears of the transmission of genetic abnormalities to offspring than other forms of assisted reproduction techniques because it bypasses all the

~ 58 ~

physiological mechanisms related to fertilization, which need an active motile spermatozoon to undergo normal capacitation and acrosome reaction and to start all mechanisms required to penetrate the oocyte. By bypassing these steps, ICSI allows an altered spermatozoon to fertilize an oocyte, thus increasing the risk of genetic defects in the offspring. In other words, a genetic defect giving rise to abnormal spermatogenesis that can be surmounted by ICSI could be trans mitted to the children produced. The concerns are most remarkable for male infertility related to Y chromosome microdeletions, since Y-deleted patients are strong candidates for ICSI, as in most cases spermatozoa or spermatids suitable for the procedure can be recovered from semen or the testis, but all male offspring will invariably inherit the deleted Y chromosome from the father. Mulhall et al. first reported the fertilization and pregnancy achieved utilizing ICSI with testicular spermatozoa from azoospermic patients presenting deletions in the DAZ region, suggesting that Y-deleted spermatozoa are fully competent for fertilization. Subsequently, the same group reported the birth via ICSI of male offspring from an AZFc deleted man (Page et al,1999 ), and other authors reported similar findings (Jiang et al,1998). Following Mendelian expectations, all the boys inherited their fathers deleted Y chromosome. These observations provide a concrete foundation for alerting couples to the likelihood of transmitting infertility-causing Y deletions by ICSI. Furthermore, since Y microdeletions are the most common molecularly defined causes of spermatogenic failure, one might expect that significant numbers of Y-deleted boys will be fathered through ICSI.

~ 59 ~

7. SUMMARY
In the past decades several studies have been undertaken on the Yq microdeletions spanning AZF loci as means of explaining idiopathic cases of male infertility (specially oligozoospermia and Non Obstructive Azoospermia). However majority of these studies have focused on DNA isolated from blood of infertile males. But as we know it is sperm which is actually responsible for male fertility, the present research was carried out with a view to look into the probability of some differences observed in the DNA collected from semen from that collected from blood. This becomes specially important in wake of the fact that germ cells (sperms) are of different embryonic origin (endodermal as compared to mesodermal origin of blood) and thus it is possible that AZF deletions in blood may not reflect AZF deletions in sperm. Therefore it is important that this comparison between Yq status of blood and semen is done. As germ cells are iatrogenically transmitted via Assisted Reproductive Techniques (ART) and Intra Cytoplasmic Sperm Transfer (ICSI), this study is even more important and relevant in the present scenario. It has also come into the notice recently that in countries like Denmark where the techniques of ART had come earlier, the infertile population has actually doubled thus casting a shadow on the utility of such techniques. With the advent of ART, the other major fact that has forced the scientific community to take genetic impairment in spermatic genome as a serious cause of male infertility is that it not only leads to the transmission to male offspring of spermatogenic impairment, but that these

~ 60 ~

offspring may also be born with a secondary, larger deletion with worsening of phenotype and genital ambiguity. Thus it is very important to understand if Yq status of sperms and blood is similar or different, whether the deletions found in DNA obtained from sperm are presented in similar manner as that obtained from blood. Of greater concern is the possibility that additional unknown genetic problems may be present in infertile men whom nature has deemed unable to reproduce until now. Obviously, after extensive counseling, the couple must make the final decision about further treatment, but important ethical considerations arise since severe male infertility has now become a hereditary disorder. The clinician should be aware that the use of such techniques may lead to an increase in the number of infertile subjects in future populations. The primary rationale of medically assisted reproduction is the opportunity for parents to have a healthy baby, and a mandatory condition for achieving this goal is that the genetic characteristics of the gametes must be normal. From this preliminary study (and ongoing study in our laboratory) we can conclude that AZF microdeletion analysis from sperms is a better diagnostic and prognostic indicator in infertile men and can provide the information necessary to counsel these cases effectively, particularly with regard to the birth of infertile male offspring who may have the same or secondary, larger deletions with more severe testicular phenotype. This might enable the generations to come to take full advantages of latest techniques like ICSI without actually increasing the infertile population. ~ 61 ~

7.1 IMPLICATION OF THE STUDY

Microdeletions of the Y chromosome represent an important cause of male infertility and the most frequent genetic etiology of severe testiculopathy. Such findings are fundamental both for a careful diagnosis of male infertility and for its treatment, and Y chromosome screening is now a reality in the major andrological and infertility centers. The actual consequence of inheriting a Y deletion is still not clear, and we will have to wait until babies with the Y deletion conceived by IVF/ICSI become adult. The detection of a deletion in an infertile man provides a proper diagnosis of the disease, allows the clinician to avoid empirical, unnecessary, and often expensive treatments to improve fertility (e.g., hormonal treatments), and has important ethical consequences if the patient is a candidate for assisted reproduction techniques. Furthermore, it is now clear that a molecular diagnostic test of Y chromosome microdeletions should be at least performed in all men with a sperm concentration of less that 5 million/ml, regardless of the presence of other apparent concomitant causes of testicular damage, such as varicocele or cryptorchidism. The identification of the actual role played by the AZF candidate genes in spermatogenesis will provide significant advances to our understanding of the biology of spermatogenesis, as well as the analysis of novel Y-chromosomal genes with a potential role in male germ cell development will clarify other important features of this important chromosome.

~ 62 ~

7.2 LONG TERM GOALS:

To carry out the study further for detecting mosaicism in blood and semen in case of other genes also besides AZFc. To study about the causes of deletions specifically in spermatogenic genome, whether environmental factors play any role or not. Understanding the basic biological function of AZF genes and to find out if other genes are also responsible for male infertility. Development of better diagnostic and therapeutic methods. Use of molecular knowledge in clinical practice Expansion of current knowledge of spermatogenesis

~ 63 ~

8.

RERENCES

Affara N, Bishop C, Brown W, Cooke H, Davey P, Ellis N, Graves JM, Jones M, Mitchell M, Rappold G, Tyler-Smith C, Yen P, Lau Y-FC 1996.Report of the Second International Workshop on YChromosome Mapping 1995. Cytogenet Cell Genet, 73:3372 Agarwal A & Sharma R.K 1996.Role of reactive oxygen species in male infertility. Urology, 48 (6) 835-850 Bhasin S,Mallidis C, Ma KL 2000.The genetic basis of infertility in men. Baillieres Best Pract Res Clin Endocrinol Metab, 14: 363-388. Bielanska M, Tan SL, Ao A 2000. Fluorescence in-situ hybridization of sex chromosomes in spermatozoa spare preimplantation embryos of a Klinefelter 46, XY/47,XXY male. Hum Reprod, 15: 440-444. Bafaluy MPB, Silva PF, Enriquez JA 2002. The thankless task of playing genetics with mammalian mitochondrial DNA: a 30-year review.Mitochondrion, 2:3 25. Benoff S, Jacob A and Hurley I R 2000 Male infertility and environmental exposure to lead and cadmium; Hum. Reprod.6, 107121 Brown GM, Furlong RA, Sargent CA, Erickson RP, Longepied G, Mitchell M, Jones MH, Hargreave TB, Cooke HJ, Affara NA 1998. Characterisation of the coding sequence and fine mapping of the human DFFRY gene and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum Mol Genet 7:97107 Burgoyne PS 1996. Fruit(less) flies provide a clue. Nature 381, 740741 Calogero, A. E., Garofalo, M. R., Barone, N., Palma, A. D., Vicari, E., Romeo, R., Tumino, S. & DAgata, R .2001. Spontaneous regression over time of the germinal epithelium in a Y chromosome- microdeleted patient. Human Reproduction 16, 18451848. Carani C, Gromoll J, Brinkworth MH, Simoni M, Weinbauer GF, Nieschlag E 1997. cynDAZLA: a cynomolgus monkey homologue of the human autosomal DAZ gene. Mol Hum Reprod 3,479483 Cavelier L, Erikson I, Tammi M, et al 2001. mtDNA mutations in maternally inherited diabetes: associated with Alzheimers and Parkinsons disease. Hereditas.; 135;65 70.

~I~

Chai NN, Salido EC,Yen PH 1997. Multiple functional copies of the RBM gene family,a spermatogenesis candidate on the human Y chromosome. Genomics 45:355361 Chai NN, Zhou H, Hernandez J, Najmabadi H, Bhasin S, Yen PH 1998. Structure and organization of the RBMY genes on the human Y chromosome: transposition and amplification of an ancestral autosomal hnRNPG gene. Genomics 49:283289 Chai NN, Phillips A,Fernandez A, YenPH 1997.Aputative human male infertility gene DAZLA: genomic structure and methylation status. Mol Hum Reprod 3:705708 Chandley A C 1998. Chromosome anomalies and Y chromosome microdeletions as causal factors in male infertility; Hum. Reprod. 13 4550 Chuang RY, Weaver PL, Liu Z, Chang TH 1997.Requirement of the DEAD box protein Ded1p for messenger RNA translation. Science 275:14681471 Cooke HJ, Lee M, Kerr S, Ruggiu M 1996. A murine homologue of the human DAZ gene is autosomal and expressed only in male and female gonads. Hum Mol Genet :513516 Cui XF, Xing JP, Sun JH, Zhang Z, Wang 2005.XY Analysis of Yq microdeletions in idiopathic infertile males with azoospermia and oligospermia in Shaanxi Province Zhonghua Nan Ke Xue. Mar;11(3):185-8. Dada R, Gupta NP, Kucheria K 2006.Cytogenetic and molecular analysis of male infertility: Y chromosome deletion during nonobstructive azoospermia and severe oligozoospermia. Cell Biochem Biophys.;44(1):171-7. Dada R, Gupta NP, Kucheria K 2004.Yq microdeletions--azoospermia factor candidate genes and spermatogenic arrest. J Biomol Tech. Sep;15(3):176-83. Dada R, Gupta NP, Kucheria K 2003. Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia, J Biosci. Mar 28(2):163-8 Delbridge ML, Harry JL, Toder R, ONeill RJ, Ma K, Chandley AC, Graves JA 1997. A human candidate spermatogenesis gene, RBM1, is conserved and amplified on the marsupial Y chromosome. Nat Genet 15:131136 Delbridge ML, Lingenfelter PA, Disteche CM, Graves JA 1999.The candidate spermatogenesis gene RBMY has a homologue on the human X chromosome. Nat Genet 22:223224

~ II ~

Diemer T and Desjardins 1999.Developmental and genetic disorders in spermatogenesis; Hum. Reprod. 5 120140 Donat R, McNeill A S, Fitzpatrick D R and Hargreave T B 1997.The incidence of cystic fibrosis gene mutations in patients with congenital bilateral absence of the vas deferens in Scotland; Br. J. Urol. 79 7477 Eberhart CG, Maines JZ, Wasserman SA 1996.Meiotic cell cycle requirement for a fly homologue of human deleted in azoospermia. Nature 381:783785 Egozcue S, Blanco J, Vendrell J M, Garcia F, Veiga A, Aran B, Barri P N, Vidal F and Egozcue J 2000. Human male infertility: chromosome anomalies meiotic disorders, abnormal spermatozoa and recurrent abortion; Hum. Reprod. 6 93105 Engel W, Adham IM, Nayernia K, Neesen J. Genetic causes of male infertility. Verh Dtsch Ges Pathol. 2004;88: 30-5. Elliott DJ, Millar MR, Oghene K, Ross A, Kiesewetter F, Pryor J, McIntyre M, Hargreave TB, Saunders PT, Vogt PH, Chandley AC, CookeH 1997. Expression of RBM in the nuclei of human germ cells is dependent on a critical region of the Y chromosome long arm. Proc Natl Acad Sci USA 94:38483853 Elliott DJ, Oghene K, Makarov G, Makarova O, Hargreave TB, Chandley AC, Eperon IC, Cooke HJ 1998.Dynamic changes in the subnuclear organisation of pre-mRNA splicing proteins and RBM during human germ cell development. J Cell Sci 111:12551265 Elliott DJ, Ma K, Kerr SM, Thakrar R, Speed R, Chandley AC, Cooke H 1996.An RBM homologue maps to the mouse Y chromosome and is expressed in germ cells. Hum Mol Genet 5:869874 Escalier D 2006.Animal models: candidate genes for human male infertility Gynecol Obstet Fertil. Aug 22 Ferlin A,Moro E, Garolla A, Foresta C 1999.Human male infertility and Y chromosome deletions: role of the AZF-candidate genes DAZ, RBM and DFFRY. Hum Reprod 14:17101716 Ferlin A, Moro E, Onisto M, Toscano E, Bettella A, Foresta C 1999. Absence of testicular DAZ gene expression in idiopathic severe testiculopathies. Hum Reprod 14:22862292 Frydelund-Larsen, L., Krausz, C., Leffers, H., Andersson, A.M., Carlsen, E., Bangsboell, S. et al. 2002.Inhibin B: a marker for the functional state of the

~ III ~

eminiferous epithelium in patients with azoospermia factor C microdeletions. Journal of Clinical Endocrinology and Metabolism 87, 56185624.

Foresta C,Bettella, A., Moro, E., Rossato, M., Merico, M., Garolla, A. & Ferlin, A 2002. Inhibin B plasma concentrations in infertile patients with DAZ gene deletions treated with FSH. European Journal of Endocrinology 146, 801 806. Foresta C, Ferlin A,Moro Deletion and expression analysis of AZFa-genes on the human Y chromosome revealed a major role for DBY in male infertility. Hum Mol Genet 9:11611169 Foresta C, Ferlin A, Garolla A, Rossato M, Barbaux S, De Bortoli A 1997. Ychromosome deletions in idiopathic severe testiculopathies. J Clin Endocrinol Metab 82:10751080 Foresta C, Ferlin A, Garolla A, Moro E, Pistorello M, Barbaux S, Rossato M 1998 High frequency of well-defined Y-chromosome deletions in idiopathic Sertoli cell-only syndrome. Hum Reprod 13:302307 Glaser B, Yen PH, Schempp W., 1998, Fibre-fluorescence in situ hybridization unravels apparently seven DAZ genes or pseudogenes clustered within a Ychromosome region frequently deleted in azoospermic males. Chromosome Res 6:481486 Graeber MB, Muller U.1998.Recent developments in the molecular genetics of mitochondrial disorder. J Neurol Sci. 153:251 263. Gromoll J, Weinbauer GF, Skaletsky H, Schlatt S, Rocchietti- March M, Page DC, Nieschlag E., 1999, The old world monkey DAZ (deleted in azoospermia) gene yields insights into the evolution of the DAZ gene cluster on the human Y chromosome. Hum Mol Genet 8:20172024 Habermann B, Mi HF, Edelmann A, Bohring C, Backert IT, Kiesewetter F, Aumuller G, Vogt PH., 1998, DAZ (deleted in azoospermia) genes encode proteins located in human late spermatids and in sperm tails. Hum Reprod 13:363369 Hargreave T B., 2000, Genetic basis of male fertility,Br. Med. Bull. 56 650671 Hanna MG, Nelson IP, Morghan Hughes JA, Wood NW 1998, MELAS: a new disease associated mitochondrial DNA mutation and evidence for further genetic heterogeneity. J Neurol Neurosurg Psychiatry; 65:512 517

~ IV ~

Hopps CV, Mielnik A, Goldstein M, Palermo GD,Rosenwaks Z, Schlegel PN 2003.Detection of sperm in men with Y chromosome microdeletions of the AZFa, AZFb and AZFc regions.Hum Reprod. Aug; 18(8):1660-5. Houston DW, Zhang J, Maines JZ, Wasserman SA, King ML 1998 A Xenopus DAZ-like gene encodes an RNA component of germ plasm and is a functional homologue of Drosophila boule. Development 125:171180 Irvine D S 1998.Epidemiology and etiology of male infertility; Hum. Reprod. 13 3344 Jones MH, Khwaja OS, Briggs H, Lambson B, Davey PM, Chalmers J, Zhou CY, Walker EM, Zhang Y, Todd C, Ferguson-Smith MA, Affara NA 1994.A set of ninety-seven overlapping yeast artificial chromosome clones spanning the human Y chromosome euchromatin. Genomics 24:266275 Kamp, C., Huellen, K., Fernandes, S., Sousa, M., Schlegel, P. N., Mielnik, A. et al. 2001.High deletion frequency of the complete AZFa sequence in men with Sertoli-cell-only syndrome. Molecular Human Reproduction 7, 987994. Kent-First M, Muallem A, Shultz J, Pryor J, Roberts K, Nolten W, Meisner L, Chandley A, Gouchy G, Jorgensen L, Havighurst T, Grosch J 1999. Defining regions of the Y-chromosome responsible for male infertility and identification of a fourth AZF region (AZFd) by Y-chromosome microdeletion detection. Mol Reprod Dev 53: 2741 Koopman P 1999. Sry and Sox9: mammalian testis-determining genes. Cell Mol Life Sci 55:839856 Krausz C, Degl'Innocenti S, 2006.Y chromosome and male infertility: update. Front Biosci. 2006 Sep 1;11: 3049-61. Krausz, C., Quintana-Murci,L. & McElreavey, K. 2000. Prognostic value of Y deletion analysis: what is the clinical prognostic value of Y chromosome microdeletion analysis? Human Reproduction 15, 14311434. Krausz, C., Rajpert-De Meyts, E., Frydelund-Larsen, L., Quintana-Murci, L., cElreavey, K. & Skakkebaek, N. E. 2001a.Double-blind Y chromosome microdeletion analysis in men with known sperm parameters and reproductive hormone profiles: microdeletions are specific for spermatogenic failure.Journal of Clinical Endocrinology and Metabolism 86, 26382642. Kuroki Y,Iwamoto T and Lee J 1999. Spermatogenic ability is different among males in different Y chromosome lineage; Hum.Genet. 44 289292

~V~

Jiang MC, Lien YR, Chen SU, Ko TM, Ho HN, Yang YS 1998 Transmission of de novo mutations of the deleted in azoospermia genes from a severely oligozoospermic male to a son via intracytoplasmic sperm injection. Fertil Steril 71:10291032 Jeske YW, Bowles J, Greenfield A, Koopman P 1995 Expression of a linear Sry transcript in the mouse genital ridge. Nat Genet 10:480482 Lahn BT,Page DC 1997.Functional coherence of the human Y chromosome. Science 278:675680 Laval SH, Glenister PH, Rasberry C, Thornton CE, Mahadevaiah SK, Cooke HJ, Burgoyne PS, Cattanach BM 1995.Y chromosome short arm-Sxr recombination in XSxr/Y males causes deletion of Rbm and XY female sex reversal. Proc Natl Acad Sci USA 92: 1040310407 Lee JH, Lee DR,Yoon SJ, Chai YG, Roh SI, Yoon HS 1998. Expression of DAZ (deleted in azoospermia) , DAZL1 (DAZ-like) and protamine-2 in testis and its application for diagnosis of spermatogenesis in non-obstructive azoospermia. Mol Hum Reprod 4: 827834 Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen PJ, Nishi K, Schnier J, lonimski PP 1989. Birth of the D-E-A-D box (letter). Nature 337:121122 Ma K, Inglis JD, Sharkey A, Bickmore WA, Hill RE, Prosser EJ, Speed RM, Thomson EJ, Jobling M, Taylor K, Wolfe J, Cooke HJ, Hargreave TB, Chandley AC 1993.A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell 75:12871295 Mahadevaiah SK, Odorisio T, Elliott DJ, Rattigan A, Szot M, Laval SH, Washburn LL, McCarrey JR, Cattanach BM, Lovell- Badge R, Burgoyne PS 1998. Mouse homologues of the human AZF candidate gene RBM are expressed in spermatogonia and spermatids, and map to a Y chromosome deletion interval associated with a high incidence of sperm abnormalities.HumMol Genet 7:715 727 Maiwald R, Luche RM, Epstein CJ 1996. Isolation of a mouse homolog of the humanDAZ(deleted in azoospermia) gene.Mamm Genome 7:628 Mazeyrat S, Saut N, Sargent CA, Grimmond S, Longepied G, Ehrmann IE, Ellis PS, Greenfield A, Affara NA, Mitchell MJ 1998. The mouse Y chromosome interval necessary for spermatogonial proliferation is gene dense with syntenic homology to the human AZFa region. Hum Mol Genet 7:1713 1724

~ VI ~

Mazeyrat S, Saut N, Mattei MG, Mitchell MJ 1999. RBMY evolved on the Y chromosome from a ubiquitously transcribed X-Y identical gene. Nat Genet 22:224226 Mazeyrat S, Saut N, Sargent CA, Grimmond S, Longepied G, Ehrmann IE, Ellis PS, Greenfield A, Affara NA, Mitchell MJ 1998. The mouse Y chromosome interval necessary for spermatogonial proliferation is gene dense with syntenic homology to the human AZFa region. Hum Mol Genet 7:1713 1724 Megory E, Zuckerman H, Shoham Z and Lunenfeld B 1987. Infection and male fertility; Obstet. Gynecol. Survey 42 283290 Mehta R H and Anand Kumar T C 1997.Declining semen quality in Bangaloreans: a preliminary report; Curr. Sci. 72 621622 Menke DB, Mutter GL, Page DC 1997.Expression of DAZ, an azoospermia factor candidate, in human spermatogonia. Am J Hum Genet 60:2372341 Mueller B A and Daling J R 1989.Epidemiology of infertility. Extent of the problem-risk factors and associated social changes; in Controversies in reproductive endocrinology and infertility (ed.) M R Soules (New York: Elsevier) pp 113 Mulhall JP, Reijo R, Alagappan R, Brown L, Page D, Carson R, Oates RD 1997.Azoospermic men with deletion of the DAZ gene cluster are capable of completing spermatogenesis: fertilization, normal embryonic development and pregnancy occur when retrieved testicular spermatozoa are used for intracytoplasmic sperm injection. Hum Reprod 12:503508 Najmabadi H, Huang V, Yen P, Subbarao MN, Bhasin D, Banaag L, Naseeruddin S, de Kretser DM, Baker HW, McLachlan RI, Loveland KA, Bhasin S 1996.Substantial prevalence of microdeletions of the Y-chromosome in infertile men with idiopathic azoospermia and oligozoospermia detected using a sequencetagged site-based mapping strategy. J Clin Endocrinol Metab 81: 1347 1352 Najmabadi H, Chai N, Kapali A, Subbarao MN, Bhasin D, Woodhouse E, Yen P, Bhasin S 1996.Genomic structure of a Y-specific ribonucleic acid binding motif-containing gene: a putative candidate for a subset of male infertility. J Clin Endocrinol Metab 81: 21592164 Nomiyama T, Tanaka Y, Hattori N, Nishimaki K, Nagasaka K, Kawamori R, Ohata S 2002.Accumulation of somatic mutation in mitochondrial DNA extracted from peripheral blood cells in diabetic patients. Diabetologia.; 45:1577 1583 ~ VII ~

Page DC, Silber S, Brown LG 1999.Men with infertility caused by AZFc deletion can produce sons by intracytoplasmic sperm injection, but are likely to transmit the deletion and infertility. Hum Reprod 14:17221726 Phillip M, Arbelle J C, Segev Y and Parvari R 1998.Male hypogonadism due to a mutation in the gene for the b-subunit of follicle stimulating hormone; N. Engl. J. Med. 338 17291732 Prosser J, Inglis JD, Condie A, Ma K, Kerr S, Thakrar R, Taylor K, Cameron JM, Cooke HJ 1996.Degeneracy in human multicopy RBM (YRRM), a candidate spermatogenesis gene. Mamm Genome 7:835842 Rao L, Babu A, Kanakavalli M, Padmalatha V, Singh A, Singh PK, Deenadayal M, Singh L 2004.Chromosomal abnormalities and y chromosome microdeletions in infertile men with varicocele and idiopathic infertility of South Indian origin.J Androl. Jan-Feb;25(1):147-53. Reijo R, Seligman J, Dinulos MB, Jaffe T, Brown LG, Disteche CM, Page DC 1996.Mouse autosomal homolog of DAZ, a candidate male sterility gene in humans, is expressed in male germ cells before and after puberty. Genomics 35:346352 Reijo R, Lee TY, Salo P, Alagappan R, Brown LG, Rosenberg M, Rozen S, Jaffe T, Straus D, Hovatta O, de la Chapelle A, Silber S, Page DC 1995. Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet 10:383393 Salas-Cortes L, Jaubert F, Barbaux S, Nessmann C, Bono MR, Fellous M, McElreavey K, Rosemblatt M 1999.The human SRY protein is present in fetal and adult Sertoli cells and germ cells. Int J Dev Biol 43:135140 Sargent CA, Boucher CA, Kirsch S, Brown G, Weiss B, Trundley, Burgoyne P, Saut N, Durand C, Levy N, Terriou P, Hargreave T, Cooke H, Mitchell M, Rappold GA, AffaraNA 1999.The critical region of overlap defining the AZFa male infertility interval of proximal Yq contains three transcribed sequences. J Med Genet 36:670677 Sargent CA, Boucher CA, Kirsch S, Brown G, Weiss B, Trundley A, Burgoyne P, Saut N, Durand C, Levy N, Terriou P, Hargreave T, Cooke H, Mitchell M, Rappold GA, AffaraNA1999.The critical region of overlap defining the AZFa male infertility interval of proximal Yq contains three transcribed sequences. J Med Genet 36:670677 Saxena R, Brown LG, Hawkins T, Alagappan RK, Skaletsky H, Reeve MP, Reijo R, Rozen S, Dinulos MB, Disteche CM, Page DC1996.The DAZ gene ~ VIII ~

cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nat Genet 14:292299 Shi Q, Martin RH 2001. Aneuploidy in human spermatozoa: FISH analysis in men with constitutional chromosomal abnormalities, and in infertile men. Reproduction, 121: 655-66. Seboun E, Barbaux S, Bourgeron T, Nishi S, Agulnik A, Egashira M, Nikkawa N, Bishop C, Fellous M, McElreavey K, KasaharaM 1997.Gene sequence, localization, and evolutionary conservation of DAZLA, a candidate male sterility gene. Genomics 41:227235 Serebrovska ZA, Serebrovskaya TV, Pyle RL, Di Pietro ML 2006. Transmission of male infertility and intracytoplasmic sperm injection, Fiziol Zh.;52(3):110-8 Shan Z, Hirschmann P, Seebacher T, Edelmann A, Jauch A, Morell J, Urbitsch P, Vogt PH 1996.A SPGY copy homologous to the mouse gene Dazla and the Drosophila gene boule is autosomal and expressed only in the human male gonad. Hum Mol Genet 5:2005 2011 Slee R, Grimes B, Speed RM, Taggart M, Maguire SM, Ross A, McGill NI, Saunders PT, Cooke HJ 1999.A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype. Proc Natl Acad Sci USA 96:80408045 Song NH,Wu HF,Zhang W,Hua LX,Zhou ZM,Feng NH,Zhang J, Qiao D, Zhang JX. 2006. Detection of Y chromosome microdeletions in patients with severe oligozoospermia and azoospermia, Zhonghua Yi Xue Za Zhi. May 30;86(20):1376-80. Spira A 1986. Epidemiology of human reproduction; Hum. Reprod. 1 111115 Spiropoulos J, Turnbull DM, Chinnery PF 2002. Can mitochondrial DNA mutations cause sperm dysfunction? Mol Hum Reprod.; 8:719 721. Sun C, Skaletsky H, Birren B, Devon K, Tang Z, Silber S, Oates R, Page DC 1999. An azoospermic man with a de novo point mutation in the Y-chromosomal gene USP9Y. Nat Genet 23:429432 Sun J, Zhou AF 2006.Damage to and protection of sperm DNA Zhonghua Nan Ke Xue. Jul;12(7):639-42, 646 Sutcliffe MJ, Darling SM, Burgoyne PS 1991. Spermatogenesis in XY, XYSxra and XOSxra mice: a quantitative analysis of spermatogenesis throughout puberty. Mol Reprod Dev 30:8189

~ IX ~

Thonneau P, Marchard S, Tallec A, Ferial M L, Ducot B, Lansac J, Lopes P, Tabaste J M and Spira A 1991. Incidence and main courses of infertility in a resident population (1,850,000) of three French regions (19881989); Hum. Reprod. 6 811816 Tuerlings JH, Golde RJ, Oudakker AR, Yntema HG, Kermer JA 2002. Familial oligoasthenoteratozoospermia: evidence of autosomal dominant inheritance with sex-limited expression. Fertil Steril.;77:415 418. Van-Assche E, Bonduelle M, Tournaye H, Joris H, Verheyen G, Devroey P, Van Steirteghem A and Liebaers I 1996. Cytogenetics of infertile men; Hum. Reprod. 11 124 Vergnaud G, Page DC, Simmler MC, Brown L, Rouyer F, Noel B, Botstein D, de la Chapelle A, Weissenbach J 1986. A deletion map of the human Y chromosome based on DNA hybridization. Am J Hum Genet 38:109124 Vogt MHJ, de Paus RA, Voogt PJ, Willemze R, Falkenburg JHF 2000. DFFRY codes for a new human male-specific minor transplantation antigen involved in bone marrow graft rejection. Blood 95:11001105 Vogt PH, Affara N, Davey P, Hammer M, Jobling MA, Lau YF, Mitchell M, Schempp W, Tyler-Smith C, Williams G, Yen P, Rappold GA 1997. Report of the Third International Workshop on Y Chromosome Mapping 1997. Cytogenet Cell Genet 79:120 Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farah S, Ramos C, Hartmann M, Hartschuh W, Meschede D, Behre HM, Castel A, Nieschlag E, Weidner W, Grone HJ, Jung A, Engel W, Haidl G 1996. Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 5:933943 Vollrath D, Foote S, Hilton A, Brown LG, Beer-Romero P, Bogan JS, Page DC 1992. The human Y chromosome: a 43-interval map based on naturally occurring deletions. Science 258:5259 Wallace DC 1999. Mitochondrial diseases in man and mouse. Science.283:1482 488 Warchol, J. B., Jankowska, A., Stecewicz, D., Ciesielski, M. & Wasko, R. 2000.Analysis of the seminiferous tubules of patients with deletion of DAZ gene. Archives of Perinatal Medicine 6, 1016. Wong J, Blanco P, Affara NA 1999. An exon map of the AZFc male infertility region of the human Y chromosome. Mamm Genome 10:5761

~X~

Yen PH 1999.Advances in Y chromosome mapping. Curr Opin Obstet Gynecol 11:275281 Yen PH, Chai NN, Salido EC 1996. The human autosomal gene DAZLA: testis specificity and a candidate for male infertility. Hum Mol Genet 5:20132017 Yen PH 1998. A long-range restriction map of deletion interval 6 of the human Y chromosome: a region frequently deleted in azoospermic males. Genomics 54:5 12 Yen PH, Chai NN, Salido EC 1997.The human DAZ genes, a putative male infertility factor on the Y chromosome, are highly polymorphic in the DAZ repeat regions .MammGenome 8:756759

~ XI ~

APPENDIX
WORK PLAN

Patient

Semen Sample

Blood Sample

AZF Microdeletion Analysis

Motility Chromosome Analysis

AZF Microdeletion Analysis

DNA Extraction

Viability

Culture

DNA Extraction

Quantification of DNA

Count

G- Banding

Quantification of DNA

PCR Analysis

Morphology

Karyotyping

PCR Analysis

Comparision

~ XII ~

SOLUTIONS AND REAGENTS FOR DNA EXTRACTION FROM BLOOD

A) Ammonium Acetate (4M) Dissolve 154.16gm (MW 77.08)

Ammonium Acetate in dH20 and make upto 500ml. Store at 4OC

B)

Ethidium Bromide 0.5g/ml in TBE buffer

C)

Gel Loading Buffer 0.05% Bromophenol Blue 4% Sucrose 0.1M EDTA 0.5%SDS 50 mg 20 gm 1.46 gm 250 mg

Dissolve EDTA in 25 ml of dH20 by adjusting the pH to 8 with 5N NaOH and add Bromophenol blue. Once dissolved add sucrose and Finally SDS. Adjust the final volume to 50 ml and stir at 80OC to make the solution viscous. 1 volume of gel loading solution is optimal to 1-4 volumes of sample.

~ XIII ~

D)

Phosphate Buffered Saline (PBS) (pH 7.2) Solution A: 0.2M NaH2PO4.2H2O 31.202g/l H20 Solution B: 0.2M Na2HPO4.H20 35.5g/l H20 Solution C: 0.163M NaCl 8.5g/l H20

Mix 140 ml of solutionA,360ml of solution B and adjust the pH to 7.2 using either solution A or B. Add 500 ml of solution B to this mixture for 1000 ml of PBS.

E)

Proteinase K solution Dissolve 100mg Proteinase K in 10 ml d H20 Aliquot into 200l in microfuge tubes and store at 20OC

F)

Red Cell Lysis Buffer (RCLB): Tris MgCl2 NaCl 10mM 5mM 10mM 1.2116g 1.0165g 0.5844g

Dissolve in 950 ml of d H20, adjust pH to 7.6 with 1N HCl, make final volume to 1 litre with dH20 . Filter using Whatman No.1 filter paper and store at 4OC

~ XIV ~

G)

10X TBE buffer 0.045M TRIS 0.001M EDTA 0.045M Boric Acid 54.52g 3.722g 27.82g

H)

TE Buffer 1mM TRIS 0.1mM EDTA 121.16mg 37.224mg

Dissolve in 950ml dH2O adjust the pH to 7.5 make final volume of 1 liter with dH2O

I)

White Cell Lysis Buffer (WCLB) 10mM TRIS 10mMEDTA 50mM NaCl 0.2%SDS 1.2116g 3.7224g 2.922g 2g

Dissolve in 950ml dH2O adjust the pH to 8 with 1N HCl and make final volume to 1 litre with dH2O filter using Whatman No.1 filter paper.

~ XV ~

SOLUTIONS AND REAGENTS FOR DNA EXTRACTION FROM SPERM

A) Isotonic saline solution 3.234 gm of sodium citrate and 0.91 gm sodium acetate in 100 ml of purified water B) Spermatozoa medium 1 ml of Tris HCl (10mM)(pH-8.0), 2 ml of EDTA (10mM)(pH-8.0), 2% SDS and 0.298 gm of NaCl (51mM). C) Proteinase K solution (150g/ml) Dissolve 100mg Proteinase K in 10 ml d H20 Aliquot into 200l in microfuge tubes and store at 20OC D) DTT Solution Dissolve O.31 gm DTT and 0.082 gm of sodium acetate in 100 ml of purified water

~ XVI ~

SOLUTIONS AND REAGENTS FOR CYTOGENETICS

Colcemid Working Solution Dissolve 10mg of Colcemid in 250ml of distilled water. Sterilized by filtration and stored at 40C. RPMI 1640 RPMI 1640 Fetal Calf Serum, Penicillin/Streptomycin solution Stored at 4OC Fixative 3:1::Methanol : Acetic Acid. To be prepared just before use. Hypotonic Solution 0.075M KCl 2.8g KCl dissolved in 500ml dH2O PhytoHaemAgglutinin Working Solution Phytohaemagglutinin M form rehydrated with 10 ml sterile distilled water. Stored at 4OC. 100 ml 20 ml 1ml

~ XVII ~