DEVELOPMENT OF RECOMBINANT SUBUNIT VACCINE AND MONOCLONAL ANTIBODY BASED DIAGNOSTIC TEST FOR INFECTIOUS BURSAL DISEASE IN CHICKENS

A THESIS

Submitted by

SATYA NARAYAN PRADHAN

in partial fulfilment for the award of the degree of

DOCTOR OF PHILOSOPHY

FACULTY OF TECHNOLOGY ANNA UNIVERSITY CHENNAI 600 025

DECEMBER 2011

CERTIFICATE

This is to certify that no corrections/suggestions were pointed out by the Indian/foreign Examiners in the thesis titled Development of recombinant subunit vaccine and monoclonal antibody based diagnostic test for infectious bursal disease in chickens submitted by Mr. Satya Narayan Pradhan, Ph.D. Scholar (Reg. No. 2006529715).

Place: Chennai Date: 17.07.2012

(Dr. Usha Antony) SUPERVISOR

iii

ABSTRACT

Infectious bursal disease (IBD) also known as Gumboro disease after the geographical location of the first outbreak in 1962 is an acute, highly contagious disease of young chickens caused by Infectious bursal disease virus (IBDV), characterized by immunosuppression and mortality generally at 3-6 weeks of age. It has contributed significantly in overall losses to poultry industry because of increased mortality due to IBD and other diseases occurring as a result of vaccination failures due to immunosuppressive effect of the disease. Early detection is an indispensable tool, particularly in the absence of any treatment for IBDV. The aim of this work was to develop a simple and reliable detection method and to explore the potential of vaccination as an intervention strategy against IBDV. The major structural protein VP2 of IBD virus was selected as host-protective antigen of immunoprophylactic studies. It contains different independent epitopes responsible for the induction of neutralizing antibody. In this study, we report the efficacy of an immunodominant fragment of VP2 which induces both humoral and cellular immunity against infectious bursal disease. A 366 bp fragment (52- 417 bp) of the VP2 gene from an IBDV field isolate was amplified and cloned and expressed in T7 prokaryotic expression system and purified by immobilized nickel affinity chromatography. The efficacy of 21 kDa rVP252-417 antigen was compared with commercial IBDV

iv

whole virus vaccine strains. Following immunization, the sera from chickens were collected. The anti-rVP252-417 sera showed significantly high reactivity with commercial vaccine (P < 0.0001) and likewise the reactivity of rVP252417

was high against sera raised against commercial vaccine (P < 0.05). Two

weeks after the vaccination, chickens were inoculated with standard challenge strain of IBDV by the intranasal route, observed clinically for 10 days. The subunit vaccine of recombinant VP252-417 conferred protection for 90 100% chickens. In order to facilitate the quantification of antibodies and to screen a large number of serum samples, an ELISA based on this recombinant VP252417

protein was developed. The anti IBDV IgY antibodies present in field

sera were assessed and analyzed. The IgY-ELISA based on recombinant VP252-417 protein recommended the possible use of this protein in the serodiagnosis of IBD. In order to prolong the protective effect induced by protein immunization, the prospect of utilizing DNA vaccines for long-term in vivo antigen expression was explored. The VP252-417 genes fragment was cloned into CMV promoter based DNA vaccine vector pVAX and the in vitro expression of the DNA encoded antigens was confirmed by transfection of CHO cells with the vaccine constructs followed by RT-PCR and western blot analysis with IBDV-antiserum. The in vivo expression was checked by RTPCR analysis of the DNA injected muscle tissue at different intervals post injection. Chickens were vaccinated with plasmid DNA encoding VP252-417 and challenged with IBDV. DNA immunization with plasmids encoding VP252-417 showed a significantly protection of 75%. Despite the initial low

degree of protection compared to that of protein vaccination, the duration of protection was longer in DNA vaccinated chickens. Presently, problems in the immuno-diagnosis are the specificity to detect IBDV antigen, stability of diagnostic lines, cost of assays, time and manpower associated with use of ELISA kit and PCR etc. The possible application of monoclonal antibodies developed against this IBDV protein for the detection of IBDV from any infected samples. Monoclonal antibodies (MAb) were developed against rVP252-417 to achieve the objective of development of antigen based diagnostic kit. Two monoclonal antibodies namely 3A11A2 and 1C7F12 with better sensitivity were selected for validating capture ELISA. Sandwich ELISA was developed with rVP252-417 monoclonals as capture antibody and rabbit anti- rVP252-417 polyclonal as detection antibody and validated against recombinant as well as purified IBDV antigen. The efficiency of sandwich ELISA was analyzed with IBDV infected bursal samples and used uninfected bursal sample as control. The evaluated results of sandwich assay showed 100% sensitivity in the data obtained from experimental test groups.

vi

ACKNOWLEDGEMENT
I immensely thank and express my deep gratitude to my supervisor Dr. Usha Antony, for giving me complete freedom in my work, for her constant guidance, encouragement and support for my Ph.D. I am grateful to Prof. R. B. Narayanan and Prof. C. D. Damodharan for their advice and support. I sincerely thank my doctoral committee members, Dr. Parimal Roy, Professor and Head, Central University Laboratory, Tamil Nadu Veterinary and Animal Sciences University and Dr. B. Nagarajan, Professor and Head, Department of Tumour Microbiology and Biochemistry, Cancer Institute (WIA) Chennai, for their scientific advice and suggestions. I am grateful to my friends Dr. Prince, Dr. Madhumathi, Dr. Vivek, Dr. Sharmila, Dr. Shakti, Dr. Vaishnavi and Mr. Ravikant for their incredible support and encouragement. I sincerely thank my juniors Mr. Arun, Ms. Anugraha, Ms. Jeyaprita, Ms. Aparnaa, Ms. Christiana, Mr. Bhuvanesh and Ms. Gayathri for their kind help and support. I thank my seniors Dr. Muthukumaran and Dr. Pandiaraja for their valuable discussions. My special thanks to my parents, sisters, nephew and nieces for their motivation and support. I thank Department of Biotechnology (DBT) for granting me the fellowships during my research tenure.

SATYA NARAYAN PRADHAN

vii

TABLE OF CONTENTS

CHAPTER NO.

TITLE

PAGE NO.

ABSTRACT LIST OF TABLES LIST OF FIGURES LIST OF SYMBOLS AND ABBREVIATIONS

iii xvii xviii xx

1.

INTRODUCTION 1.1 1.2 1.3 1.4 INTRODUCTION OBJECTIVES OVERVIEW OF THE THESIS REVIEW OF LITERATURE 1.4.1 Etiology 1.4.2 Structure and Molecular Biology of IBD Virus 1.4.3 Physical and Chemical Properties of the Virus 1.4.4 Genome Organization 1.4.5 Viral Proteins 1.4.6 Virus Replication and Transcription 1.4.7 Persistence of Virus in Chicken Tissues 1.4.8 Target Organ 1.4.9 Pathogenesis 1.4.10 Immunology 1.4.11 IBDV Detection Methods

1 1 6 7 9 9

10 10 12 14 15 15 16 18 20

viii

CHAPTER NO.

TITLE

PAGE NO.

1.4.11.1 In situ Hybridization 1.4.11.2 Reverse Transcription and Polymerase Chain Reaction 1.4.11.3 Immunofluroscence 1.4.11.4 Agar Gel Immuno-Diffusion (AGID) 1.4.11.5 Dot Blot Assay 1.4.11.6 Enzyme Linked Immunosorbent Assay (ELISA) 1.4.11.7 Latex Agglutination Test 1.4.11.8 Immunohistochemical Staining 1.4.11.9 Immunochromatographic Assay 1.4.12 IBDV Control Methods

21

23 26

27 28

29 30

31

32 33

2.

MATERIALS AND METHODS 2.1 MATERIALS 2.1.1 Reagents and Chemicals 2.1.2 Culture Media 2.1.3 Bacterial Strains and Plasmids 2.1.4 Expression System Used in this Study 2.1.5 Primers Used for the Amplification and Cloning of Capsid Gene Fragment 2.1.6 Animals 2.1.7 Virus 2.2 BURSAL PROCESSING

40 40 40 41 42 42

44 45 45 45

ix

CHAPTER NO.

TITLE

PAGE NO.

2.3

IN VIVO TITRATION FOR IBDV

CHALLENGE 2.4 EXPERIMENTAL INFECTION IN CHICKENS 2.5 2.6 2.7 PURIFICATION OF IBDV PARTIAL PURIFICATION OF IBDV PRODUCTION OF ANTISERUM AGAINST WHOLE VIRUS 2.8 RECOMBINANT CLONES USED IN THE PRESENT STUDY 2.9 BIO-INFORMATIC ANALYSIS OF CAPSID GENE 2.10 CLONING OF VP2 GENE FRAGMENT 2.10.1 Confirming the Orientation of the Insert 2.10.2 2.11 Sequence Analysis

46

46 46 47

47

47

48 48

49 49

EXPRESSION OF THE RECOMBINANT PROTEINS 49

2.12

PURIFICATION OF RECOMBINANT PROTEINS USING IMMOBILIZED METAL AFFINITY CHROMATOGRAPHY (IMAC) 50

2.13

LARGE-SCALE PRODUCTION OF THE DNA VACCINES 51

2.14

TRANSIENT TRANSFECTION OF CHINESE HAMSTER OVARY (CHO) CELL LINE BY DNA VACCINE CONSTRUCTS 53

2.15

GENERAL MOLECULAR BIOLOGY TECHNIQUES 55

CHAPTER NO.

TITLE

PAGE NO.

2.15.1

Reverse Transcription and Polymerase Chain reaction (RT-PCR) 2.15.1.1 RNA extraction 2.15.1.2 Reverse transcription reaction 2.15.1.3 Polymerase chain reaction of cDNA 57 57 58 59 60 60 61
62

55 55 56

2.15.2 2.15.3 2.15.4 2.15.5 2.15.6 2.15.7 2.15.8 2.15.9 2.15.10 2.16 2.16.1 2.16.2 2.16.3 2.16.4 2.16.5 2.16.6 2.16.7 2.16.8 2.16.9

Agarose Gel Electrophoresis Purification of DNA from Agarose Gel Restriction Digestion Ligation Screening the Clones by Lysate PCR Plasmid DNA Extraction Transformation of E. coli Western Blotting Chicken Sera Samples Immunoreactivity with Field Sera Animals, Immunization and Sera Collection Measurement of Total IgY Direct Binding Assay Splenocyte Proliferation Assay Tissue Distribution DNA Isolation from Different Tissues RT-PCR for Expression of the DNA Vaccines in Immunized Chicken Muscle

SDS-Polyacrylamide Gel Electrophoresis 63 64 66 66 66 67 67 68 68 69 70

IMMUNOLOGICAL STUDIES

70

xi

CHAPTER NO.

TITLE

PAGE NO.

2.17

IMMUNOPROPHYLACTIC STUDIES 2.17.1 Animals for Protection Study and Immunization

71 71 72 72 73 73 73 74 74

2.18

MONOCLONAL ANTIBODY PRODUCTION 2.18.1 2.18.2 2.18.3 2.18.4 2.18.5 2.18.6 2.18.7 Immunization of Mice with rVP252-417 for Hybridoma Preparation of Myeloma Cells and Splenocytes Preparation of Macrophage Feeder Layer Fusion of Cells Cell Viability Test Selection of Hybridoma Analysis of Serum Samples and Monoclones by rVP252-417 Antigen Based ELISA 2.18.8 2.18.9 2.18.10 2.18.11 2.18.13 2.18.14 2.18.15 Expansion of Secretor Clones Cloning under Limited Dilution (Subcloning) Subclass Isotyping of Monoclonal Antibodies Maintenance of Cell-Lines Affinity Measurement of Monoclonal Antibodies Avidity Measurement of Monoclonal Antibodies Production of Polyclonal Antibody against rVP252-417 2.18.12 Cryopreservation of Cells

75 76 76 77 77 77 77 79 81

xii

CHAPTER NO.

TITLE

PAGE NO.

2.18.16

Purification of Monoclonal Antibody 81

2.18.17

Enrichment of mAbs and Polyclonal Antibodies 82

2.18.18

Standardization of IBDV Antigen Capture ELISA 82

2.19

DEVELOPMENT OF RAPID DIPSTICK DIAGNOSTIC ASSAY FOR DETECTION 2.19.1 2.19.2 Preparation of Colloidal Gold 83 84

Preparation of Gold-Antibody Conjugate 84 85

2.20

STATISTICAL ANALYSIS

3.

RESULTS 3.1 CLONING, EXPRESSION, PURIFICATION AND IMMUNOPROPHYLACTIC EFFICACY OF RECOMBINANT VP2 FRAGMENT 3.1.1 Amplification and Analysis of VP252-417 Gene 3.1.2 3.1.3 3.1.4 Cloning of VP252-417 Gene Restriction Profile Analysis Confirming the Orientation of the Insert in pRBVP252-417 3.1.5 Expression of rVP252-417 Fragment Protein 3.1.6 Purification of Recombinant VP252-417 Protein 3.1.7 Antibody Titer of rVP252-417 Protein in Mice

86

86

87 87 89

89

93

96

99

xiii

CHAPTER NO.

TITLE

PAGE NO.

3.1.8 3.1.9

Characterization of rVP252-417 protein Humoral Responses of rVP252-417 in chickens

99

101 101

3.1.9.1 3.1.9.2

Antibody titer in chicken Reactivity with commercial IBDV strains

101 103 106

3.1.9.3 3.1.10 3.1.11

Reactivity with field isolates Cellular Response of rVP252-417 Protection against Virulent IBDV Challenge

107

3.2

CLONING, IN VIVO EXPRESSION AND IMUNOPROPHYLACTIC EFFICACY OF VP2 FRAGMENT (VP252-417) AS DNA VACCINE 3.2.1 Sub Cloning of VP252-417 in pVAX1 Vector 3.2.2 3.2.3 Restriction Digestion Analysis
In Vitro Expression of the DNA

110

110 111

Vaccine Construct in CHO Cell Line 3.2.4

In Vivo Expression of the DNA

111

vaccine Constructs in Chicken Muscle Tissue 3.2.5 Tissue Distribution and Persistence of DNA Vaccine in Immunized Chickens 3.2.6 Immune Response Studies of DNA Vaccine (pVAXVP252-417) in Chickens Antibody titer in chicken 117 115 114

xiv

CHAPTER NO.

TITLE

PAGE NO.

3.2.6.2 Cellular Response of pVAXVP252-417 3.2.7 Protection Studies of pVAXVP252-417 against Virulent IBDV Challenge 3.3 DEVELOPMENT OF MONOCLONAL ANTIBODIES TO RECOMBINANT VP2 FRAGMENT (rVP252-417) 3.3.1 3.3.2 3.3.3 3.3.4 3.3.5 3.3.6 Immunization and Antibody Titre Harvest of Myeloma Cells Harvest of Mouse Feeder Cells Cell Fusion and Hybrid Yield Scale-Up of the Clones Sub-Cloning: Cloning by Limiting Dilution and Derivation of Stable Clones 3.3.7 3.3.8 3.3.9 Selection of Monoclones Characterization of the mAbs Confirmation of mAbs against rVP252-417 in Western Blot 3.3.10 3.3.11 Isotyping of Monoclones Affinity of Anti-VP252-417 Monoclonal Antibodies 3.3.12 Avidity of Anti-VP252-417 Monoclonal Antibodies 3.4 DEVELOPMENT OF SANDWICH ELISA FOR IBDV DETECTION 3.4.1 Optimization of Various Parameters for the Development of Sandwich ELISA 130 130 129 128 127 128 124 125 125 121 121 121 122 122 123 118 117

xv

CHAPTER NO.

TITLE

PAGE NO.

3.4.2

Sensitivity of the Sandwich ELISA Using Recombinant VP252-417 and Purified IBDV Antigen 131

3.4.3

Determination of the Titers of Anti-VP252-417 Polyclonal Antibodies 133 134

3.5

SUMMARY

4.

DISCUSSION 4.1 SUBUNIT PROTEIN VACCINE (VP252-417) 4.2 VP2 SUBUNIT DNA VACCINE (VP252-417) 4.3 DEVELOPMENT OF VP2 MONOCLONAL ANTIBODIES FOR ANTIGEN DETECTION 4.4 DEVELOPMENT OF PROTOTYPE ANTIGEN BASED IMMUNO-DIAGNOSTICS FOR INFECTIOUS BURSAL DISEASE

137

137

143

146

149

5.

CONCLUSION 5.1 CHARACTERIZATION OF RECOMBINANT VP252-417 AND IMMUNE RESPONSE STUDIES IN CHICKEN 5.2 CHARACTERIZATION OF RECOMBINANT VP252-417 AS DNA VACCINE 5.3 DEVELOPMENT OF MONOCLONAL ANTIBODY FOR THE DETECTION OF IBDV

152

152

153

153

xvi

CHAPTER NO.

TITLE

PAGE NO.

5.4

FUTURE DIRECTIONS 5.4.1 Part I Bimodal Vaccine (Combination of rVP252-417 and pVAXVP252-417 5.4.2 Part II Development of monoclonal antibody using immunodominant region of VP3

155

155

155

APPENDIX 1

GENOTYPES OF BACTERIAL STRAINS 156

APPENDIX 2

VECTOR MAP OF pRSET

157

APPENDIX 3

VECTOR MAP OF pVAX1

158

REFERENCES

159

LIST OF PUBLICATIONS

191

VITAE

192

xvii

LIST OF TABLES

TABLE NO.

TITLE

PAGE NO.

2.1

Primers Used for Cloning the Capsid Gene Fragment 44

3.1

The Antigenic Determinants Identified in 122 aa Region by BcePRED and IEDB 89

3.2

BLASTN Analysis of 366 bp of VP2 Gene Fragment 92

3.3

BLASTP Analysis of the Deduced Amino Acid of 366 bp 93

3.4

Protection Efficacy of rVP252-417Protein Vaccine after Virus Challenge in Immunized Chickens 109 116
In Vivo Tissue Distribution of pVAXVP252-417

3.5 3.6

Protection Efficacy of rVP252-417 DNA Vaccine after Virus Challenge in Immunized Chickens 120 128 Affinity of Anti-VP252-417 Monoclonal Antibodies Avidity Index of mAbs with rVP252-417 and purified IBDV Antigen Monoclonal Antibodies 129

3.7 3.8

xviii

LIST OF FIGURES

FIGURE NO.

TITLE

PAGE NO.

1.1

Structure and Genome Organization of Infectious Bursal Disease Virus 11 88

3.1 3.2

Amplification and Cloning of VP2 Gene Fragment Confirmation of the Insert and its Orientation in the Recombinant Plasmid, pRBVP252-417

90

3.3

Nucleotide and the Deduced Amino Acid Sequence of 366 bp N-terminal Region of VP2 Protein 91

3.4

Expression of Recombinant VP2 Fragment Protein and its Confirmation by Western Blotting 95

3.5

Purification of Recombinant VP252-417 Protein by IMAC and Gel-Elution 97 Immunoblot Analysis of Purified Recombinant VP252-417 Protein 98

3.6

3.7

Determination of Antibody Titre and the Specificity of Mouse Anti-rVP252-417 Sera 100 102 104 105 107 112

3.8 3.9 3.10 3.11 3.12 3.13

Humoral Responces of rVP252-417 in Chickens Reactivity with Commercial IBDV Strains Reactivity with field isolates and commercial strains Splenocyte Proliferation Assay in Chickens Cloning of VP252-417 in pVAX1 Plasmid
In Vitro Expression of pVAXVP252-417 Construct in

CHO Cell Line 3.14 Expression of the DNA Vaccine Constructs in Muscle Tissue

113

114

xix

FIGURE NO.

TITLE

PAGE NO.

3.15

Tissue Distribution Analyses for pVAXVP252-417 DNA in Immunized Chickens 116 Measurement of Antibody Titer for Recombinant DNA Vaccine in Chickens 119

3.16

3.17

Splenocyte Proliferation Assay in Chicken Immunized with DNA Vaccine 119 123

3.18 3.19

Primary Screening of Hybrids Secondary Screening of Hybrids from 24 Well Plates

124

3.20

Screening of the Clones Secreting Monoclonal Antibody for rVP252-417, Partially purified and purified IBDV 125 126

3.21 3.22

Reactivity of mAbs against rVP252-417 in ELISA Reactivity of Monoclonal Antibodies against rVP252-417 using ELISA

126

3.23

Western Blot Analysis of Hybridoma Culture Supernatant against rVP252-417 127 131

3.24 3.25

Sandwich ELISA with rVP252-417 and Purified IBDV Capture Assay with Different Amounts of rVP252-417 Antigens

132

3.26

Capture Assay with Different Amounts of Purified IBDV Antigen 133 134 135

3.27 3.28

Reactivity of Rabbit rVP252-417 Polyclonal Antibody Dipstick Prototype Device

xx

LIST OF SYMBOLS AND ABBREVIATIONS

SYMBOLS g L Alpha Beta Gamma Mu microgram microlitre

ABBREVIATIONS AC-ELISA Ag-Ab ALP ANOVA APC APS ATP BCA BCIP BF BLAST BME bp BSA CBB CD4 CHO cDNA CEF Antigen-Capture ELISA Antigen-Antibody Alkaline Phosphatase Analysis of Variance Antigen Presenting Cells Ammonium Persulphate Adenosine Triphosphate Bicinchoninic acid 5- bromo 4-chloro 3-indolyl phosphate Bursa of Fabricius Basic local alignment search tool -mercaptoethanol base pairs Bovine Serum Albumin Coomassie Brilliant Blue Cluster of Differentiation Chinese Hamster Ovary Complementary DNA Chicken Embryo Fibroblast

xxi

CEP ConA cpm dbEST dsRNA DEPC DMSO DNA dNTP DTT EDTA ELISA EM EST FCS FITC
GAPDH

Conformational Epitope Concanavalin A Counts per minute Database of EST sequences double stranded RNA Diethyl Pyrocarbonate Dimethyl Sulphoxide Deoxyribonucleic acid Deoxynucleotide triphosphate Dithiothreitol Ethylene Diamine Tetra Acetic Acid Enzyme linked immunosorbent assay Electron Microscopy Expressed Sequence Tag Fetal Calf Serum Fluorescein Isothiocyanate Glyceraldehydes-3-phospate dehydrogenase Hours (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) Horse Radish Peroxidase Infectious Bursal Disease Infectious Bursal Disease Virsus Immunochromatographic Test Immunoglobulin Gamma Immunoglobulin Interleukin Immobilized Metal Affinity Chromatography Iscoves modified Dulbeccos medium Identified Positive Iso-propyl -thiogalactopyranoside

h
HEPES

HRP IBD IBDV ICT Ig IgG IL IMAC IMDM IP IPTG

xxii

IFN Kb kDa LB LPS mAb MDA min mg mL mm mM MilliQ mRNA MTT

Interferon Kilobase Kilodaltons Luria-Bertani Broth Lipopolysaccharide Monoclonal Antibody Maternally Derived Antibodies Minutes milligram millilitre millimetre millimolar Triple distilled water messenger RNA Tetrazolium (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide

NBT NC ng NK OD ORF PABA PBMC PBS PBST PC PCR PDB PEG

Nitroblue tetrazolium Nitrocellulose membrane nanogram Natural Killer cells Optical Density Open Reading Frame Para Amino Benzoic Acid Peripheral Blood Mononuclear Cell Phosphate Buffered Saline PBS with 0.05% Tween-20 Peptide Conjugate Polymerase Chain Reaction Protein Data Bank Polyethylene Glycol

xxiii

PI pm PMSF pNPP RdRp RNA RNAP rpm RPMI RT-PCR SAN

Post Inoculation picomole Phenyl Methyl-Sulfonyl Fluosride p-Nitrophenyl Phosphate, disodium salt RNA-dependent RNA polymerase Ribonucleic Acid RNA Polymerase Rotations per minute Rosewell Park Memorial Institute Reverse Transcriptase Polymerase Chain Reaction Specific Antibody Negative Sodium-dodecyl-sulphate polyacrylamide gel Standard Error Mean Stimulation Index Specific Pathogen Free Sample Solubilization Buffer Thermus aquaticus Tris Borate EDTA Tris EDTA N,N,N ,N - Tetramethylethylene diamine Transforming Growth Factor T helper cells Toll Like Receptor Tetramethyl benzidine T regulatory cells Tris (hydroxymethyl) aminoethanes Viral Neutralization Viral Protein Variant IBDV Very Virulent IBDV

SDS-PAGE SEM SI SPF SSB Taq TBE TE TEMED TGFTh TLR TMB T reg/ Tr Tris VN VP2 v IBDV vv IBDV -

CHAPTER 1 INTRODUCTION

1.1

INTRODUCTION Poultry industry comprises one of the most rapidly growing food-

producing sectors in the world and keeps expanding with an increase in population. The production and consumption of eggs and poultry meat has been increasing worldwide over the last three decades as the consumption of eggs has doubled and that of chicken meat has tripled (Jordan and Pattison 2001). Indian poultry industry is booming and emerging as the world's 2nd largest market, growing at a phenomenal rate of 12 to 15% every year. The poultry industry in India is constantly on the rise with increasing ease of modern techniques and changing from live bird to fresh chilled and frozen product market. However, such a marked growth in poultry production has created a situation where the birds have become more susceptible to disease causing agents of diverse origin. These disease conditions have caused considerable economic downfall to poultry industry and have repeatedly threatened the progress made in recent years. Several viral diseases have plagued the industry in the past two decades resulting in serious losses. There are about twenty known viruses infecting chickens, out of which some are highly virulent and responsible for huge economic losses. Infectious bursal disease (IBD) also known as Gumboro disease after the geographical location of the first outbreak in 1962 (Cosgrove et al 1962) is an acute, highly contagious disease of young chickens caused by

Infectious Bursal Disease Virus (IBDV), characterized by immunosuppression and mortality generally at 3-6 weeks of age. It has contributed significantly in overall loss to poultry industry because of increased mortality due to IBD and other diseases occurring because of vaccination failures due to

immunosuppressive effect of the disease. IBDV replicates in the lymphocytes of the bursa of Fabricius, which is responsible for an immunosuppressive disease that may cause death or impaired growth in young chicken. IBDV is a member of the Birnaviridae family (Brown et al 1986), the genome of which consists of two segments of double stranded RNA designated A and B (Dobos et al 1979). IBDV consists of four structural proteins, among which VP2 has been identified as the main host-protective antigen that carries major neutralizing epitopes, have serotype, and strain specificity (Azad et al 1987; Becht et al 1988; Fahey et al 1989; Reddy et al 1992). To date, two antigenically distinct serotypes (I and II) and several antigenic subtype of serotype I of IBDV have been identified by cross neutralization assays using polyclonal sera (Jackwood et al 1982). The protection of chicks from IBD is complicated by the presence of several antigenic subtypes. Hence, vaccination with one antigenic subtype will not ensure protection against a heterologous subtype. Therefore, it is important to identify not only the virus but also the antigenic subtypes of IBDV. Since its emergence in 1962 in United States, this virus continues to have the greatest impact on poultry industry even today (Lukert and Saif 1991). In United States, all pathogenic viruses produce classical Gumboro disease lesion such as enlargement of bursae, hemorrhage or transudation in bursae and mortality. Instead, the variant viruses cause an extremely rapid atrophy of bursae and are immunosuppressive. Immunosuppression enhances the susceptibility of chicks to other infection and interferes with vaccination against other diseases of chicken (Okoye et al 1984). Until 1984, IBDV

strains were of low virulence causing less than two per cent specific mortality (Van den Berg et al 2000) and the disease was controlled satisfactorily by vaccination. But, from 1986 onwards, vaccination failures were described in different parts of the world. In 1987/1988, vvIBDV (very virulent) strains capable of causing 30 to 70 percent mortalities in broilers and layers were isolated in Holland, Belgium and UK (Van den Berg and Meulemans 1991). Since then, outbreaks of vvIBDV have occurred in most European countries as well as Africa, Japan, China and South East Asia. vvIBDV were able to break through the maternal as well as active immunity induced mainly by classical or mild IBDV vaccines. Poultry chicks are the only bird species known to develop clinical disease and distinct lesions when exposed to IBDV. However, Mcfrran et al (1980) have also isolated a number of strains of IBDV from fowl, turkey and duck. Greenfield et al (1986) stated that Japanese quails were refractory to IBD infection. They showed no bursal change and did not form precipitating antibodies. IBDV is not vertically transmitted i.e. no transmission from parent to one day old chick through the egg. Horizontal transmission through infected feces, contaminated equipment (especially footwear) or other organic material is the most likely route of spread. It has been demonstrated that the Lesser Mealworm (Alphitobius diaperinus) could act as a vector carrying IBDV from one cycle to the next. The symptoms of IBDV infected chicks are nonspecific which includes depression, whitish diarrhoea, anorexia, prostration, and death (Chettle et al 1989). Older chickens may show milder disease symptoms, but all age groups subsequently experience a transient immunosuppression (Sharma et al 2000).

In India, the first IBD outbreak was in Uttar Pradesh in 1971 (Mohanty et al 1971). Jayaramiah and Mallick et al (1974) followed it with the virus isolation. Ever since its appearance in India, IBD has remained a major threat to poultry industry in almost all the states. However, the severity of IBD was realized only when severe outbreaks occurred in Maharashtra (Ajinkya et al 1980), Bihar (Chauhan et al 1980), Andhra Pradesh (Verma et al 1981) and in Tamil Nadu (Purushothaman et al 1988) with high mortality range of 20 90%. Due to a sharp decline in poultry production all over the world by repeated IBDV outbreaks, much emphasis has been given to early detection of IBDV. Already established methods of observation like clinical symptoms and histopathology have long been replaced by number of molecular technologies that include PCR and immunological detection methods. Some commercial detection kits, based on in-situ hybridization, PCR (PrimerDesign genesig Kit) and immunodetection are also available (SBIO IBD+ELISA test, FlockChek* IBD-XR IDEXX ELISA kit, Anigen Rapid IBDV Ag test kit,). Viral antigens can be demonstrated by the agar-gel precipitin assay or by the antigen-capture enzyme-linked immunosorbent assay (AC-ELISA). With some restrictions, AC-ELISA allows the identification of vvIBDV (Eterradossi et al 1998, Islam et al 2001). RT-PCR in combination with restriction enzyme analysis allows the rapid identification of vvIBDV (Lin et al 1993, Jackwood and Jackwood 1994, Zierenberg et al 2001). Nucleotide sequencing of RT-PCR products is widely used for further characterization of IBDV strains (Sapats and Ignjatovic 2000, Zierenberg et al 2000, Islam et al 2001, Liu et al 2002, Viswas et al 2002). Most RT-PCR protocols are based on VP2 nucleotide sequences. Previous studies have shown that the IBDV virion is an effective immunogen, though such antiserum has the limitation of involving a labor-

intensive process for virus propagation and purification. The bacterial expression system overcomes these obstacles and the protein is readily purified through simple purification processes. Thus, it can be utilized for over-expression of viral proteins for raising antibody that can be used in immunodetection methods. Although good management practices, meticulous sanitation, use of non-specific immune-stimulants and early detection are currently used to counter the disease, these methods are not sufficient to eradicate the disease. One of the important prophylactic measures against viral diseases is the use of vaccines. Viral vaccines prevent or modify the severity of infection in the individual host and interrupt or reduce the transmission of the pathogens to other susceptible hosts. Therefore, vaccination is inevitable and mandatory under high infection pressure. In the light of this, an effective vaccine against IBDV would be highly desirable. Thus, there is a strong demand for a cost effective and simple vaccine giving sufficient protection against IBDV outbreaks, an approach that has been so useful in controlling viral and bacterial diseases in other animals including man. At present, the disease is controlled by the combined use of live virus and inactivated oil emulsion vaccines. However, these vaccines are not always safe, as they may not contain the required immunogens present in the variant strains prevailing in that area. The study of virus at molecular level is therefore an essential prerequisite for formulating a suitable vaccine, particularly with local isolates recovered from field cases. Most of the successful viral vaccines make use of the prominent envelope proteins or major nucleocapsid proteins. Proteins playing important role in initial steps of infection represent the major targets for effective vaccine development. A number of experimental recombinant IBD vaccines have been developed which used fowl poxvirus (Bayliss et al 1991, Shaw and

Davison 2000), herpesvirus of turkey (Darteil et al 1995), fowl adenovirus (Sheppard et al 1998, Francois et al 2001), Mareks disease virus (Tsukamoto et al 2002) and Semliki forest virus (Phenix et al 2001) as the vector. In-vitro expressed VP2 (Vakharia et al 1993, Vakharia et al 1994, Pitcovski et al 1996, Dybing and Jackwood 1998, Wang et al 2000, Yehuda et al 2000) or in-vitro generated virus-like particles (VLP) of IBDV (Hu et al 1999, Kibenge et al 1999) have been found to be immunogenic. DNA vaccines also have been developed for IBDV (Fodor et al 1999, Chang et al 2001, Chang et al 2003). However, none of these vaccines has so far been commercialized. 1.2 OBJECTIVES In view of the above considerations, the present study was conceived with the goal of developing, therefore, carried out with following objectives, towards the goal of developing simple and reliable methods of diagnosis and prevention of IBDV infection. Towards achieving this goal, the following objectives were formulated, i. Cloning, characterization and assessment of

immunoprophylactic efficacy of the N-terminal region of capsid protein of IBDV in chickens. ii. Cloning, characterization and assessment of

immunoprophylactic efficacy of the N-terminal region of capsid protein of IBDV as DNA vaccine in chickens. iii. Generation and characterization of monoclonal antibodies against recombinant IBDV capsid protein fragment and development of a sandwich ELISA based method for detection of IBDV.

1.3

OVERVIEW OF THE THESIS The first part of the dissertation attempted to develop an enhanced

vaccine suitable for field application against IBDV in chickens by incorporating regions specific from indigenous field isolates. In India, only live attenuated vaccines, either imported (Nobilis strain (live vaccine) by Intervet International Ltd, Netherlands) or locally made (Live intermediate strain of IBDV by Ventri biological Ltd, Pune and Indovax Pvt. Ltd, Hissar, India) are mainly in use and appear to be efficient in protecting the chickens as there are not many reports of outbreak in the vaccinated chickens from India. However, there is always a possibility of reversion to virulence in case of live vaccines and accidental wrong inactivation poses a threat of disease incidence in the field. Both these drawbacks can be overcome by the use of highly immunogenic recombinant protein. VP2 of IBDV is a well-known major host protective virus antigen, and contains at least three neutralizing epitopes, which determine the virus virulence (Eterradossi et al 1998, Pitcovski et al 1998, Chai et al 2001). Although there are attenuated IBDV vaccines available

commercially, there are no recombinant vaccines till date in market. Hence the first objective of the current study attempts to develop an efficient recombinant protein/DNA subunit vaccine for IBDV strains endemic in India. An epitopic fragment of 366 bp from the VP2 N-terminal region of IBDV was amplified, cloned in T7 promoter based pRSET-B vector and expressed as a 21 kDa fusion protein with N-terminal six-histidine residues. The immunoreactivity of the recombinant capsid protein with the sera from infected and vaccinated chickens in the western blotting showed that Nterminal region is immunodominant. The recombinant VP2 fragment was then compared with commercial vaccine for immunoprophylactic efficacy. All vaccination experiments presented here with purified recombinant proteins and commercial vaccines were administered through intramuscular

route in chickens. The subsequent challenge with IBDV was carried out through oral and intraocular route. Further, the VP2 fragment was cloned in CMV promoter based pVAX DNA vaccine vector and was studied for protection efficacy, which was the second objective of the dissertation. The DNA was purified using endotoxin free plasmid purification kit. Prior to immunization, the in vitro and
in vivo expression of the DNA vaccines in CHO cell lines and chicken muscle

tissue respectively were confirmed by RT-PCR and western blot analysis. Subsequently, the chickens were immunized with the DNA vaccines via intramuscular injection. Protective response was studied following IBDV challenge as described earlier. The third objective of the dissertation deals with development of diagnostics for IBDV. Currently a limited number of diagnostic tests exist worldwide for the diagnosis of IBDV infection in chickens like indirect immunofluorescence assay, virus isolation, serum neutralization test, polymerase chain reaction and ELISA. However, there are no sero-specific indigenous kits for IBDV susceptible endemic areas in India. The serological assay in which virus-specific IgY is measured in serum samples, is critical to identify the acute stage of the infection in chickens. Hence, there is a need to develop a more sero-specific assay that will detect IBDV strains in local areas with high sensitivity. Also, the serological assay must use a well defined and characterized viral protein for reproducibility and accuracy in detection. ELISAs based on even the truncated recombinant proteins are reported to be efficient in the diagnosis of diseases (Hirata et al 2002, Fukumoto et al 2003, Boonchit et al 2004). Therefore in the present study, an ELISA based antigen detection assay in bursal infection caused by IBDV was developed using monoclonal and polyclonal antibody raised against rVP252-417. The assay was standardized using rVP252-417 and purified IBDV with different combination of antibodies. Monoclonal antibodies were used to develop dipstick method for rapid detection of antigen.

The

present

study

demonstrated

the

consistency

of

immunodetection in field samples, which can be improved by carrying out antigen based detection methods. Furthermore, vaccination with recombinant viral proteins can induce protection against IBDV infection and further this protection can be extended to a longer period by DNA immunization. 1.4 1.4.1 REVIEW OF LITERATURE Etiology Infectious bursal disease virus (IBDV) is the etiological agent of an immuno-suppressive disease of young chickens of 3 to 6 weeks of age. IBDV is a member of the family Birnaviridae (Muller et al 1979) and is a type-III virus in the Baltimore classification. This family has three designated genera namely Aquabirnavirus which includes infectious pancreatic necrosis virus that infects fish, molluscs, crustaceans; Infectious bursal disease virus that infects birds belongs to Avibirnavirus; and lastely Entomobirnavirus which includes Drosophila X virus that infects birds and insects (Leong et al 2000). Viruses in this family have genome that consists of two segments of double stranded RNA (dsRNA), hence the name Birnaviridae (Muller et al 1979, Macdonald et al 1980). Before the reorganisation of Birnaviridae family and before there was adequate information on its morphology and physiochemical characteristics, IBDV was placed at times in the Picornaviridae (Cho et al 1969, Lunger et al 1972) or Reoviridae families (Koester et al 1972, Pattison et al 1975). IBDV is highly contagious and is transmitted by fecal-oral route, especially from feces-contaminated fomites, feed and water. 1.4.2 Structure and Molecular Biology of IBD Virus Infectious bursal disease virus is single-shelled nonenveloped viron with icosahedral dsRNA genome (segments A and B) that is packaged into a single virus particle, approximately 70 nm in diameter, exhibiting levo symmetry with triangulation number of T = 13 (Caston et al 2001, Coulibaly

10

et al 2005). The viron composed of 32 capsomeres. The genomic packing density of IBDV is approximately 10 bp/100 nm3 (Luque et al 2009). Buoyant density of complete IBDV particles in the cesium chloride gradient ranges from 1.31 1.34 g/mL (Todd and McNulty 1979). IBDV can package more than one complete genome copy. Moreover, multiploid IBDV particles propagate with higher efficiency than haploid virions. Five viral particles designated VP1, VP2, VP3, VP4 and VP5 are recognized in IBDV. 1.4.3 Physical and Chemical Properties of the Virus Infectious bursal disease virus is resistance to ether and chloroform and is unaffected at pH 2, but gets inactivated at pH 12. The infectivity of the virus markedly reduced by exposure to 0.5% formalin for 6 h (Benton et al 1967). The exposure to 1% phenol for one hr inactivated the virus and the infectivity was reduced by exposure to 1% formalin for one hour (Cho and Edgar 1969). It is also resistant to heat, UV irradiation and photodynamic in-activation, whereas its naked RNA makes it sensitive to Actinomycin D (Petek et al 1973). Landgraf et al (1967) found that virus sustained 60oC but not 70oC for 30 mins, and 0.5% chloramines killed the virus after 10 mins. Alexander and Chettle (1998) detected a biphasic drop in infectivity of the virus in bursal homogenates at 70o, 75o, and 80oC with initial rapid drop followed in the second phase with a gradual decline. IBD virus is very stable and therefore, persisted in poultry houses after cleaning and disinfection (Kibenge et al 1988) 1.4.4 Genome Organization Infectious bursal disease virus is a bi-segmented double-stranded (ds) RNA virus belonging to the family of Birnaviridae (Dobos et al 1979, MacDonald and Gower 1981). Muller et al (1979) stated that double stranded RNA has sedimentation coefficient of 14S and a buoyant density of 1.62 g/mL. The larger segment A contains two partially overlapping open reading frames (ORFs). The first, smaller ORF encodes a nonstructural

11

protein VP5, whereas the second ORF encodes a 108-kDa precursor polyprotein, that is self-cleaved to produce VPX (48 kDa), VP3 (32 kDa), and VP4 (28 kDa) (Lukert et al 1991). Chevalier et al (2002) showed that in the mature virions, VPX is processed into VP2 (41 kDa). VP2 and VP3 are the major structural proteins of the IBDV virion. The smaller segment B encodes VP1, a 90 kDa RNA-dependent RNA polymerase (Lukert et al 1991).

Figure 1.1

Structure and Genome Organization of Infectious Bursal Disease Virus (a) Structure of infectious bursal disease virus (adapted from www.expasy.org) (b) Genome organization of Infectious bursal disease virus (Courtesy: www.expasy.org)

12 1.4.5 Viral Proteins

IBDVs bisegmented double-stranded RNA genome encodes an RNA dependent RNA polymerase, VP1; two major structural proteins, namely VP2 and VP3; a viral protease, VP4; and a nonstructural protein, VP5 (Xiaojuan et al 2008). Segment B encodes a 90 kDa protein designated VP1 (Lukert et al 1991). This represents the RNA-dependent RNA polymerase (RdRp) as it contains motifs that are typical for the RdRp of plus-strand RNA viruses. Ursula et al (2004) demonstrated that, unlike Hepatitis C Virus and many other RNA viruses, the polymerase activity of VP1 in IBDV appeared to be strictly dependent on the 3 terminal sequences of genomic segments A and B and like other polymerases, metal ion co-ordination is important in the polymerization reaction. VP1 forms complexes with the capsid protein VP3, leading to efficient encapsidation into Virus-Like Particles (Eleuterio et al 1999) VP2 and VP3 are two major structural proteins of IBDV, constituting 51 and 40% of the viral proteins, respectively (Lukert et al 1991). Segment A encodes a 110 kDa polyprotein, which is cleaved autocatalytically to give pVP2, VP3 and VP4. The 48 kDa VP2 precursor matured to yield the structural protein VP2 (40 kDa). Kibenge et al (1997) showed that the

cellular proteases are not required for this maturation process. Since VP2 does not accumulate intracellularly, as the other viral proteins do, post-translational modification of pVP2 into VP2 probably occurs during or after virus assembly (Muller and Becht 1982). Both constituents of the proteinaceous capsid of IBDV. It has been suggested that the external surface might be built of trimeric subunits formed by VP2 and that the inner surface might be built of trimeric subunits formed by VP3. The VP2 protein has been identified as the major host-protective immunogen of IBDV and contains major epitopes

13

responsible for eliciting neutralizing antibodies (Becht et al 1988, Azad et al 1991, Heine and Boyle 1993). VP3, a 32 kDa size protein and the second most abundant protein in IBDV consists of 257 amino acids (aa). It was shown that the proteins carboxy terminus exhibits several functions. A domain causing selfinteraction is located between aa 224 and 247 (Luque et al 2009). Moreover, VP3 was found to interact with VP1 via its 10 C-terminal amino acids (Tacken et al 2002) and to bind to the viral dsRNA, forming ribonucleoprotein complexes (Luque et al 2009). During heterologous expression in insect cells, VP3 was found to colocalize with pVP2 but not with the mature form of VP2. VP3-pVP2 binding was observed to result in the formation of virus-like particles (Ona et al 2004). VP3 is believed to act as a scaffolding protein for pVP2, and the protein is thought to be a key organizer in birnavirus morphogenesis (Maraver et al 2003). The viral protease, VP4, is responsible for this self-processing of the polyprotein, but the exact locations of the cleavage sites are unknown (Azad et al 1987, Jagadish et al 1988). VP4 has often been described as a minor virion component because it was detected in purified virions prepared by a variety of methods (Kibenge et al 1988). However, Granzow et al (1997) showed that VP4 is not a constituent of mature virions but that its presence in virion preparations was due to contaminating VP4-containing type II tubules. In addition to the large ORF, segment A also contains a second ORF, preceding and partially overlapping the polyprotein gene, which encodes VP5 (17 kDa). This non-structural protein has only been detected in IBDV-infected cells (Mundt et al 1995). VP5 proved to be non-essential for IBDV replication (Mundt et al 1997) but plays a role in virus pathogenesis (Yao et al 1998), although its exact function is still unknown.

14

1.4.6

Virus Replication and Transcription The replication cycle of IBDV has not been completely elucidated.

The entire process consists of several steps. Attachment to the host cells is the first step, followed by entry into the host cell. Once inside the cell, virion particles are disassembled and the nucleic acids are released. Subsequent steps include replication, transcription and translation. Finally, viral particles are assembled, and the matured virions are released from the host cell (Marsh and Helenius 1989). IBDV field isolates mainly infect and destroy actively dividing IgM-bearing B cells in the bursa of Fabricius (BF) and other locations (Hirai et al 1981, Rodenberg et al 1994). Glycoprotein VP2 trimers from IBDV constitute the external surface of the mature virus capsid, containing the antigenic regions responsible for elicitation of neutralizing antibodies (Fahey et al 1989, Birghan et al 2000). Based on the atomic structure of the viral particles the external domain of the VP2 trimers exists as protrusions on the capsid surface and is believed to be responsible for receptor binding (Coulibaly et al 2005). That glycoprotein VP2, responsible for the recognition of corresponding receptor, has been certificated in Vero cells on the molecular level (Yip et al 2007). Like other non-enveloped animal viruses, IBDV seems to be internalized by receptor-mediated endocytosis. After cell entry, birnavirus may directly proceed to initiate transcription and replication without uncoating, since the RdRp remains transcriptionally active without any proteolytic pre-treatment or degradation of the capsid of the virus particles (Spies et al 1987). It was demonstrated that baculovirus-expressed wild-type VP1 acts as an RdRp on IBDV-specific RNA templates as it contains motifs that are typical for the RdRp of plus-strand RNA viruses and depends on the 3 non-coding region of plus-strand RNAs transcribed from IBDV segments A and B for its polymerase activity (Ursula et al 2004).

15

During capsid assembly, VP2 is synthesized as a protein precursor, called pVP2, whose 71-residue C-terminal end is proteolytically processed. The conformational flexibility of pVP2 is due to an amphipathic -helix

located at its C-terminal end. VP3, the other IBDV major structural protein that accomplishes numerous roles during the viral cycle, acts as a scaffolding protein required for assembly control. The progressive trimming of VP2 Cterminal domain controls the oligomerization of capsid protein. The coordination of these molecular events leads to the assembly of the viral capsid (Daniel et al 2007). The VP5 protein reported to be involved in the cytopathogenicity of IBDV and promotes virion release from infected cells (Yongping et al 2009). 1.4.7 Persistence of Virus in Chicken Tissues IBDV was reported to persist in the chicken for a few days but the lesions could be seen for at least 10 weeks, the longest interval evaluated in that study (Winterfield et al 1972). Chickens were inoculated with an attenuated cell culture adapted virus at one day of age, the virus could be detected in the homogenate of BF, spleen, thymus, liver, kidney and the lungs for up to 14 days after post-inoculation (Skeeles et al 1979a, Skeeles et al 1979b). In an another study it was documented that variant IBDV was detected in virus-inoculated commercial broilers for up to 6 weeks and infectious virus was recovered from all organs at 4 weeks post inoculation (PI) (Elankumaran et al 2002). This was the first report that mentions that IBDV can be detected up to six weeks in the bursa. 1.4.8 Target Organ The target organ for pathogenic serotype 1 is the bursa of fabricius (BF). The BF reaches the maximum development between 3-6 weeks of age and at this time chickens are most susceptible to the disease. The IBDV

16

infection results in high mortality during the acute stage of the disease or in B cell deficiency after recovery from infection (Becht 1980, Kaufer and Weiss 1980). Chickens infected with IBDV when older than 12 weeks do not show clinical signs (Becht 1980). The bursectomized chickens survive the IBDV infections which is lethal for normal chicken (Kaufer and Weiss 1980). High concentrations of antigens and high infectivity titers were found in BF of infected chickens, whereas only traces of antigen and low virus titers were detected in the thymus, spleen (Kaufer and Weiss 1980) and peripheral blood (Burkhardt and Muller 1987, Mundt et al 2003). In vitro infection studies have shown that IBDV replicates in the population of proliferating B cells (Muller 1986, Skeeles et al 1979b) but not in very immature lymphobalsts or competent B cells (Becht 1980). 1.4.9 Pathogenesis Pathogenesis is defined as the method used by the virus to cause injury to the host with mortality, disease or immuno-suppression as a consequence (van den Berg et al 2000). The injuries can be evaluated at the level of whole animal, the organ and the cell. IBDV usually infects young chickens between 3-6 weeks of age and causes a clinical disease, while subclinically infecting older birds. The outcome of IBDV infection is dependent on the strain and amount of the infecting virus, the age and breed of the birds, route of inoculation and presence or absence of neutralizing antibodies (Muller et al 2003). Sequential studies of tissues from orally infected chickens using immuno-fluorescence detected the viral antigen in macrophages and lymphoid cells in the cecum at 4 h post-inoculation (PI) and in the lymphoid cells of duodenum and jejunum at 5 h PI (Muller et al 1979). The virus reaches the liver at 5 h PI and enters the bloodstream from where it is distributed to other organs; the bursal infection is followed by viremia. The virus persists in the

17

bursa of experimentally inoculated SPF chickens up to 3 weeks of age but the presence of maternal antibodies in the commercial chicken decreases the duration of its existence in bursa (Abdel-Alim and Saif 2001a). Various studies have shown that the variant and classic viruses exhibit similar pathology but differ from each other with respect to their pathogenicity and immunogenicity (Hassan et al 1996). Variant viruses were reported to induce bursal atrophy with minimal or no immune response in contrast to the classic viruses which induce a severe inflammatory response (Sharma et al 1989). However, it was noticed subsequently that variant viruses are not homogenous as a group as thought previously (Hassan et al 1996). Host systems used to propagate the virus have a profound effect on the pathogenicity of the virus isolates. Significant differences occurred in the pathogenicity and immunogenicity of the virus propagated in BF or in the blue grates monkey-70 (BGM-70) cells. However, the antigenicity of the viruses propagated in BF or the BGM-70 cells were not significantly different (Hassan et al 1996, Hassan and Saif 1996). Some strains of IBDV can adapt to CEF while others are refractory to grow in it. The SAL strain was adapted and passaged successfully in CEF cells while IN strain was unable to grow in CEF (Hassan et al 1996, Hassan and Saif 1996). The back passage of either IN or SAL in SPF chickens maintained or increased the virulence of both viruses (Hassan et al 1996, Hassan and Saif, 1996). Wild type viruses from B lymphocytes of BF were reported to be different than those grown in chicken embryo fibroblast (CEF). Differentiating B lymphocytes in the BF provide the optimal micro-environment for highly efficient virus replication; CEF and other cells seem to lack that environment (Lange et al 1987).

18

1.4.10

Immunology The IBDV is ubiquitous in commercial chickens environment and

chickens acquire the infection orally or by inhalation. The virus is transferred from the gut to other tissues by phagocytic cells like macrophages. In macrophages of the gut associated tissues it could be detected as early as 4 hours after oral inoculation using immunofluorescence (Muller et al 1979). The virus then reaches the bursa via the blood where the most extensive virus replication occurs. By 13 hours post-inoculation most follicles are positive for virus and by 16 hours post-inoculation a second and pronounced viremia occurs accompanied by secondary replication in other organs resulting in disease and death (Van den Berg et al 2000). The target organs for the virus are the IgM+ bearing B cells. During the acute phase of the disease the bursa undergoes atrophy as the bursal follicles get depleted of B cells. Virus replication causes extensive damage to lymphoid cells in medullary and cortical regions of the follicle. Apoptosis of the neighboring B cells augments the destruction of the bursal morphology. By this time an ample amount of viral antigen can be detected in other organs (Granzow et al 1997, Kim et al 1999). Maternally derived antibodies (MDA) protect chickens against subclinical disease and immunosuppression (Giambrone and Clay 1986). The MDA is known to protect the chickens for 3 weeks of age (Lasher and Davis 1997). T cells are resistant to infection by IBDV (Hirai et al 1979). During the acute phase of the disease lesions appear in the thymus which is quickly overcome within a few days (Sharma et al 2000). A profound influx of T cells is reported in and around the site of virus replication. The infiltrated T cells could be detected from one to twelfth weeks post-inoculation, although the viral antigen disappears by the third weeks. The IBDV induced cytotoxic T cell limit the spread of the virus by destroying the cells expressing the viral

19

antigen and thus can initiate the recovery process. At the same time IBDVinduced T cells might enhance the viral lesions by producing inflammatory cytokines. T helper cells produce inflammatory cytokines like IFN- which activates the macrophages to produce nitric oxide (NO) (Sharma et al 2000). Both humoral and cellular arms of the immune system are compromised during the IBDV infection due to lysis of the B cells and altered antigenpresenting cells. The IBDV causes a transient inhibition of in vitro proliferative activity of T cells to mitogens. The virus stimulates the macrophages to produce T cell cytokine like IFN- to produce nitric oxide (NO) and other cytokines with anti-proliferative activity. IBD did not affect natural killer cells levels in chickens (Sharma et al 2000).The NO production after IBD virus infection exerts antiviral effect since the immune-suppressed chickens that failed to induce NO had more severe disease and higher degree of virus replication. But it does not seem to correlate with the hemorrhagic lesions which result from the reaction of host-factors and the determinants responsible for virus virulence and virus clearance (Poonia and Charan 2005). The IBDV induced damage to humoral immunity is reversible. Antibody production correlates with the morphologic restoration of the bursal follicles. Mitogenic response of T cells returned to the normal levels. During the course of mitogenic inhibition, T cells of infected chicken also failed to secrete IL-2 upon in vitro stimulation (Sharma and Fredericksen 1987). Intra bursal T cells and T-cell-mediated responses play significant role in viral clearance and promoting recovery from infection. They defend the host cell by reducing the viral burden but at the same time produce inflammatory cytokines and nitric oxide inducing factor that enhance tissues destruction and also delay the recovery process (Rautenschlein et al 2002). Intrabursal T cells were activated by in vitro stimulation with IBDV. The activated cells had increased surface expression of chicken MHC class II molecule, Ia and IL-2 receptor CD25. In addition, these cells have an up regulated IFN- gene

20

expression (Kim et al 2000). Splenocytes exposed to IBDV produced nitric oxide inducing factor (IFN- ) (Rautenschlein et al 2002). Intrabursal T cells inhibited the mitogenic response of normal splenocytes by 90%. This bursal T cell-induced mitogen inhibition was found to be dose-dependent and not MHC-restricted (Kim and Sharma 2000). In contrast to the bursal T cells, the splenocytes from IBDV exposed chickens did not have suppressive activity. Mitogenic inhibition by bursal T cells is mediated by soluble factors, the nature of which is still unknown (Rautenschlein et al 2002). Chickens that survive the disease, clear the virus and recover from its pathologic effects (Sharma et al 2000). It has been shown that the more virulent the virus the stronger is the suppression of the humoral and cell mediated immunity. Virulent virus also produced a detectable NO production in serum. Humoral immunity is the primary mechanism of the protective immune response. Infection with IBDV results in the formation of antibodies to the group and serotype specific antigens (Jackwood et al 1985). Field exposure or vaccination results in VN titers higher than 1:1000. But weak responses are obtained in chickens immunized with purified viral polypeptides (Fahey et al 1985), since viral protein conformation is important in eliciting a high VN antibody response (Azad et al 1987). Antibody production is stimulated at the primary site of viral replication in gut associated tissue and they can be detected as soon as 3 days PI. These antibodies prevent the spread of the virus to other tissues. Due to the rapid onset of antibodies, the necrotic foci that form in the bursa of fabricius stop expanding and are completely eliminated (Becht, 1980). 1.4.11 IBDV Detection Methods Because of the severe impact of IBDV on the poultry industry and also the environment, much effort has been directed towards disease management and control. A basic requirement to prevent outbreaks is

21

detection at an early stage. In addition to the traditional observation of grossand clinical signs and morphological pathology using light and electron microscopy, histopathology and histochemistry, a whole array of molecular technologies has been developed for the detection of IBDV. Besides, the use of in situ hybridization techniques, polymerase chain reaction (PCR) and immunological detection methods have been developed for the detection of IBDV. A large number of commercial detection kits based on in situ hybridization, PCR and immune-detection, are also available. The IBDV diagnosis can be broadly classified into two types, antigen based and antibody based, which utilize antigen-antibody reaction or nucleic acid detection. To date a lot of DNA and protein based diagnostic techniques are available that can detect the virus at early stage of infection. Some of these diagnostic tests for the detection of IBDV infection are discussed in detail under each section. 1.4.11.1 In situ Hybridization
In situ hybridization methods have been developed for almost all

the viral diseases of poultry. A molecular clone representing 445 base pairs at the 3' end of genome segment B was used as radio labeled probe to detect viral RNA from cell culture and from chicken bursa and spleen tissue specimens (Jackwood et al 1989). Following this, series of 32P-labeled randomly primed cDNA probes were tested against the vaccine strains, as well as field-origin strain of IBDV (Davis and Boyel 1990). Henderson and Jackwood (1990) demonstrated that the hybridization assay is more sensitive than the agar-gel precipitin (AGP) and immunofluorescence (IF) assay which can detect IBDV for a longer period of time, post-infection. Jackwood (1990) prepared a radiolabeled cDNA probe using both the segments of doublestranded genomic infectious bursal disease virus (IBDV) RNA as template, which was specific for viral RNA and detected approximately 10 ng of IBDV RNA.

22

The cDNA clones STC-243, located on genome segment A, and STC-119, located on genome segment B, were used to prepare nonradioactive probes. Probes were labeled with digoxigenin and detected the homologous STC virus and also heterologous viruses in bursal tissue sections (Jackwood et al 1992). The digoxigenin labeled cDNA probe synthesized from the VP4 region of a virulent field isolate of IBDV could detect four serologic subtypes of IBDV and the test was rapid, reproducible, and sensitive (Hathcock and Giambrone 1992). Liu et al (2000) developed an in situ hybridization (ISH) test with a 491 bp cDNA fragment derived from the VP2 gene of IBDV. The digoxigenin-labeled 491 bp nested PCR product was used as probe for ISH to detect and localize IBDV RNA in bursae of Fabricius from chickens both experimentally infected as well as commercially reared. The cDNA of 448 base pairs in length located near the VP2/VP4 junction in IBDV STC strain was used as a biotin labelled probe in a dot-blot hybridization assay to detect IBDV. The probe detected four subtypes of IBDV serotype 1 and a serotype 2 IBDV isolate (Jackwood et al 1990). Lee (1992) developed four biotin-labeled probes which detected both serotype l and serotype 2 IBDV, with one probe was highly sensitive detected as little as 0.04 ng of IBDV RNA. However the probes were specific and did not crossreact with nucleic acids extracted from mockinfected cells or from seven unrelated avian viruses. Xue and Lim (2001) established biotin-streptavidin system to directly visualize IBDV-binding cells in cell culture or in fresh tissues. This method can be employed for the expressional cloning of IBDV receptor and can be applied to studies on other avian viruses. Apart from the bursa the IBDV RNA positive cells were observed in tissues of thymus, spleen, proventriculus, and cecal tonsil. One drawback is that it requires trained personnel to prepare the sections and to identify the positive hybridization signals.

23

1.4.11.2 Reverse Transcription and Polymerase Chain Reaction The advent of Polymerase Chain Reaction (PCR) has made the diagnosis of almost all the diseases very easy. Due to its high specificity, sensitivity and the time taken to perform this test, PCR has been the most preferred test to detect the poultry diseases. PCR is the amplification of a fragment of DNA that lies between two regions of a known sequence by the use of two oligonucleotides as primers for a series of synthetic reactions that are catalyzed by DNA polymerase enzyme (Mullis and Faloona 1987). Wu et al (1992) developed the first PCR test for the detection IBDV. A set of primers that specify a 150-base-pair segment of IBDV genome were used to distinguish the IBDV from other infections in chicks. The PCR could detect 2 femtograms of IBDV RNA. Denatured double stranded (ds) RNA for reverse transcription produce high yield of cDNA. As part of the analysis, the nature of cDNA produced in two preparations was examined by PCR amplification, which showed that heat denaturation at 65oC of dsRNA in the presence of DMSO is superior to denaturation without DMSO (Biao and Frederick, 1994). Akin et al (1998) demonstrated that dsRNA extracted by the proteinase K digestion method is more suitable than that by acid-guanidiumphenol-chloroform (AGPC) method for the amplification of longer fragments of IBDV cDNA by PCR. Lee et al (1994) developed a protocol based on single-tube, noninterrupted RT-PCR for the detection of IBDV using a primer set framing a region within the gene coding for IBDV VP2 protein to amplify a 318 bp fragment of the IBDV genome. The amplified product was detected with three strains of IBDV and even detected the bursal-tissue specimens from commercially reared chickens. RT-PCR with two pairs of primers amplifying virus specific sequences from the VP2 and VP3 genes yielding products of 365 bp and 320 bp respectively was used for identification of Israeli isolates

24

of IBDV. The system was applied to tissue culture and to long frozen bursa of Fabricius from infected chickens (Stram et al 1994). Two pairs of primers were designed to amplify 309 and 520 bp of segment A genes that partially code for the IBDV proteins VP2 and VP3, respectively. Thus, an amplification assay was developed to detect IBDV gene sequences in clinical samples, infected cell cultures and chicken embryo (Tham et al 1995). Wu et al (1997) performed quantitative competitive PCR (QC-PCR) amplification to measure complementary DNA (cDNA) and RNA levels of IBDV, using a competitor, a deletion mutant of the wild type IBDV cDNA. The assay could measure IBDV cDNA levels ranging from l g to 45 fg and RNA levels ranging from 9 g to 45 fg. A rapid and sensitive protocol for the detection of IBDV RNA in the bursa of Fabricius was developed by Liu et al (1998), where four primers from the sequence of a hypervariable region in VP2 genes were selected to amplify a 643 bp product from IBDV RNA by RT-PCR and was reamplified and double checked by a nested PCR amplifying a 491-bp cDNA. The sensitivity of nested PCR was at least 100 times greater than RT-PCR as determined by dilution of the bursal homogenate. Moody et al (1999) demonstrated that the course of IBDV infection in chickens can be monitored by Measuring the IBDV RNA in blood by multiplex real-time quantitative RT-PCR. Cardoso et al (2000) confirmed the passage of classical IBDV on chicken embryo related (CER) cell monolayers by RT-PCR. They concluded that it was possible to detect the viral RNA in infected cell culture from 6 h post inoculation. Abdel-Alim and Saif (2001) investigated persistence of IBDV or its RNA in BF of infected and vaccinated SPF chicks and of infected and vaccinated commercial broiler chicks that had maternally derived antibodies. They found positive results with RT-PCR from day 7 to 28 days PI with the amplified product size 743 bp. A sensitive and specific based multiplex polymerase chain reaction (mPCR) was developed and optimized

25

for the simultaneous detection and differentiation of avian reovirus (ARV), avian adenovirus group I (AAV-I), infectious bursal disease virus (IBDV), and chicken anemia virus (CAV) (Caterina et al 2004). Rapid identification of viral strain with quantification of virus genome was carried out with a real-time RT-PCR assay utilizing dual-labeled fluorescent probes binding to VP4 sequence that are specific to the classical (Cl), variant (V) and very virulent (vv) strains of IBDV. The assay was highly sensitive and could detect as little as 3 102 to 3 103 copies of viral template (Peters et al 2005). Kusk et al (2005) developed a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains. Vaccination effects failed, when the vaccinated flocks were exposed to a different antigenic subtype, which reinforces the importance of identification of new IBDV variants. The presence of one or more nucleotide mutations were able to detect by real-time RT-PCR using probes designed for two epitope regions of VP2, so that it can be a useful tool to assist in the development of more effective vaccination strategies (Mickael and Jackwood 2005). Li et al (2007) used specific set of primers for IBDV virulent strain DK01 and vaccine strain D78 to quantify and detect IBDV in infected bursa of Fabricius (BF) and cloacal swabs simultaneously in dually infected chickens using quantitative real time RT-PCR with SYBR green dye. Aini et al (2008) compared the SYBR Green I real-time PCR, enzyme-linked immunosorbent assay ELISA and conventional agarose detection methods in detecting specific IBDV PCR, found that real-time PCR was the most sensitive method for IBDV detection. Wang et al (2009) developed a real-time RT-PCR with VP5 gene of IBDV as the target binding region detected and quantified IBDV in cell lines and concluded that DF-1 cell line may be a more suitable continuous cell line

26

for the propagation of IBDV compared to CEF. Xu et al (2009) established a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) method rapid detection of IBDV using four primers specific to the conserved region of VP3 gene. Ghorashi et al (2011) combined real-time RT-PCR and high resolution melt (HRM) curve analysis to differentiate between classical vaccines/isolates and variants IBDV strains, which developed into a robust technique for genotyping IBDV isolates/strains. 1.4.11.3 Immunofluroscence Fluorescent antibody detection of IBDV in fresh bursal tissue impression smears is also a reliable method of detection (Meulemans et al 1977, Muller 1979). The viral antigen was detected in chickens inoculated with the Sk-1 strain until post-inoculation days 5 or 6 by the fluorescent antibody test (Ide 1975). Cells infected with double-stranded RNA (dsRNA) containing viruses i.e. reovirus, infectious pancreatic necrosis virus, and

IBDV showed bright fluorescence with anti-dsRNA (Macdonald 1980). In the field surveys, immunofluorescence was a more sensitive method of demonstrating infection than direct electron microscopy and virus isolation and gave a good correlation with histopathological diagnosis of IBD (Allan et al 1984). The fluorescence observed in the normal tissue sample is compared with the fluorescence observed in the infected tissue sample. This assay method is rapid, requires less than 3 hours to detect the infection. However, the final specimen has a limited life span, since fluorescence fades relatively quickly. The only disadvantages are that it requires a fluorescent microscope and adequately trained personnel to distinguish the fluorescing IBDV infected cells.

27

1.4.11.4

Agar Gel Immuno-Diffusion (AGID) Precipitation of antigen-antibody complexes from solution has been

used since the 1920s for the quantification of antigens and antibodies. Reactions in gels were first utilized for immunochemical studies in the mid1940s, when Oudin introduced one-dimensional, simple immunodiffusion in tubes containing agar gel. Gel methods have significantly higher sensitivity and greater resolving power than techniques with no support medium. In addition, the actual gels may be photographed and stored, since the insoluble immunoprecipitates formed at equivalence become trapped in the gel matrix (Johnson 1986). Agar gel diffusion test (AGDT) or Agar gel immunodiffusion (AGID) or Agar gel precipitation test (AGPT) is the most common, economical and simple test for detection of IBDV specific antibodies in serum, or viral antigen in bursal tissue. The test has been widely used over a long period of time throughout the world as it is easily adaptable to any laboratory condition. Kosters and Geissler (1971) performed AGDT using bursal homogenates from the infected chicken to detect IBDV. Ulbrich and Zureck (1977) followed the same technique and could detect precipitation antigen in bursal tissue between 32 hours and five days after experimental infection in four-week-old chicks. Kosters (1971) reported precipitating bursal antigen by immunodiffusion at one to five days after infecting chickens of one to four weeks of age. Faragher (1972) determined optimal conditions of immunodiffusion reactants associated with IBD and found them similar to those required by other avian systems. He found that precipitating antigen was organ specific, being detected only in the bursa of the infected chickens.

28

Many scientists detecting IBDV in the IBD suspects chickens bursal samples using standard IBD antibodies by AGPT, AGID or AGDT (Ajinkya et al 1980, Okoye and Uzoukwu 1984, Ganesan et al 1990, Nachimuthu et al. 1993, Thevathasan and Jaywardana 1997, Saif 2000). Beside bursal suspension IBDV infected chorio-allantoic membrane suspensions, chicken embryo fibroblast cell cultures and liver homogenates were also showed IBDV presence by AGID (Kulkarni et al 1983, Joshi and Shakya 1996, Kumar et al 2000). Monoclonal antibody (mAbs) based AGDT was used for detection of IBDV antigen (Snyder et al 1992, Umapathi et al 2002) 1.4.11.5 Dot Blot Assay The dot blot assay is based on antigen antibody interaction where, the protein samples are dotted onto the Nitrocellulose membrane directly without processing them like in Western blot assay. The extent of viral infection can be determined from the intensity of the dot. The dot blot assay is a good alternative to the ELISA and the IFAT in the serodiagnosis. Cruz-Coy et al (1993) used monoclonal antibody (mAb) developed against a variant subtype of IBDV, to recognize all six serologic subtypes of IBDV and three untyped IBDV by dot blot method. Zhang Chunjie (1994) established a sandwich Dot-blot method for detecting IBDV, which showed 100 times higher sensitivity than that of AGP. Later, kumar et al (1996) also showed that dot blot is rapid and more sensitive than AGPT in detecting IBDV. Gowri et al (1996) standardized the Avidin-biotin dot blot method to detect IBDV antigen in bursal sample. Moreover Anil et al (2002) reported that dot blot was as equally sensitive as 1 step PCR. Chances of false-positive results are less with the immunodot method, which detects the available protein copies actually present in the sample. The test is very simple and may be used by

29

farmers without any sophisticated equipments. If the antiserum is very specific, dot blot can be a practical alternative to PCR. 1.4.11.6 Enzyme Linked Immunosorbent Assay (ELISA) ELISAs are in use for the detection of antibodies to IBD. It describes the demonstration of class specific immunglobulin responses during IBD infection. Howie and Thorsen (1981) showed ELISA as a precise, sensitive and reproducible means of measuring IBDV antibodies in chicken and turkey sera. Viral antigen preparation was crucial to the precision of the ELISA test. Purified virus prepared from high titer seed virus was less non specific than that from low titer of seed virus in an ELISA (Tsukamoto et al 1990). Immunologic studies involving IBDV have suggested that VP2 contains a conformationally dependent neutralizing epitope which could be used to distinguish serotypes. A 944-bp portion of the VP2 gene of IBDV expressed in baculovirus was used as an antigen in an ELISA, could detect IBDV neutralizing antibodies from specific-pathogen-free chickens sera infected with IBDV strains (Jackwood et al 1996). Deng et al (2007) found out that VP3 consists of antigenic epitopes which could react with IBDV antibodies. Wang et al (2008) showed that recombinant VP3 expressed in
E.coli used as antigen in detecting the field chicken sera was comparable to

the ELISA based commercial kit. Singh et al (2010) made a comparison of four indirect ELISA viz., a commercial IDEXX-ELISA kit, VP2 and or VP3 antigen based ELISAs and a whole virus ELISA and concluded that IDEXX-ELISA, VP3-ELISA and VP2-ELISA had similar and relatively better performance when compared to whole virus antigen-ELISA. Peptides prepared for the predicted antigenic determinants on the VP2 and VP3 protein were used as antigens in ELISA, an alternative to whole viral antigen to detect anti-IBDV antibodies in the chicken sera. Saravanan et al (2004) synthesized two Multiple antigenic peptides (MAPs) for the

30

predicted antigenic determinants on the VP2 protein, which could specifically detect anti-IBDV antibodies in the chicken sera when coated with 5 ng/ml on the ELISA plate, whereas the coating amount of purified IBDV whole viral antigen was 500 ng/ml, indicating the high efficiency of MAPs. ELISA is the most widely used assay to detect viruses in humans and other animals. Different protocols have been described for the detection of IBDV using an antigen-capture enzyme-linked immunosorbent assay (AC-ELISA). Kwang et al (1987) detected IBDV antigen prepared from the cloacal bursa using AC-ELISA. Two neutralizing monoclonal antibodies (MCAs), R63 and B69, were used in AC-ELISA to verify the presence of IBDV in infected bursal tissues (Snyder et al 1988). AC-ELISA based on different neutralizing mouse monoclonal antibodies (Mabs) was used to study Polish IBDVs isolated from two epidemics on the turn of 70/80s (early IBDV) and in the 90s (recent IBDV) and were compared to the Faragher 52/70 (F52/70) reference strain of European classical serotype 1 IBDV and to the 89/163 (typical) and 91/168 (atypical) French very virulent (vv) IBDV isolates (Eterradossi et al 1997). Antibodies raised and purified against the VP3 antigenic determinant MAPs were used to detect native virus in ELISA (Saravanan et al 2004). The assay is rapid and can be used to determine the total amount of antigen by comparing the readings with a standard curve obtained with known amounts of pure antigen. This assay is very simple as it does not require antigen purification and is highly specific. 1.4.11.7 Latex Agglutination Test Latex agglutination test have been routinely used for clinical diagnosis of various pathogens like Corynebacterium diphtheriae (Toma et al 1997), Clostridium difficile (Staneck et al 1996), Streptococcus pnemoniae

31

(Garcia et al 1999). The latex agglutination is a simple, rapid and cost-effective test and thus quite applicable in developing countries. It can be conveniently used in a hatchery for screening a large number of chicken samples, as it does not require trained personnel or instruments like the radioactive detectors and microscopes. The test can be performed in 30 minutes and spot detection can be done with naked eye. A monoclonal antibody (mAb) to infectious bursal disease virus (IBDV) bound polystyrene latex microspheres agglutinated with extracts of bursae and sera from chickens infected with all strains or isolates of IBDV tested. (Nakamura et al 1993a). Later Nakamura et al (1993b) performed a competitive agglutination test using the polystyrene latex bound monoclonal antibody to detect the serum antibody titer against IBDV. The titer of antibody specific to IBDV was measured by latex agglutination-inhibition (LI) test was rapid and an easy technique for measuring IBDV VP2-specific antibody, which titer level eventually used to correlated with protection of chicken from IBDV (Nakamura et al 1994). Nachimuthu et al (1995) reported that there was no statistically significant difference in detecting IBDV antigen from different organs by reverse passive haemagglutination test (RPHA), latex agglutination (LAT) and agar gel immunodiffusion (AGID). However LAT was recommended because of cost and speed of obtaining results. 1.4.11.8 Immunohistochemical Staining For immunohistochemical staining field samples need to be fixed in Davidsons fixative and stored till assay. The immunochemical tests with monoclonal antibodies are easy and rapid to perform with necessary equipments or a laboratory designed for histopathological analysis. Reading the reactions requires only the use of a light microscope and minimal training for the determination of positive reaction.

32

A monoclonal antibody that binds with all the strains of IBDV was used for immunohistochemical detection and localization of IBDV in formalin-fixed paraffin-embedded sections of the bursa of Fabricius of experimentally and naturally infected chickens (Cruz-Coy et al 1993). Dolz et al (2005) carried out immunohistochemical studies of those bursal tissues to determine possible emergence of IBDV isolates with modified antigenic or virulent properties. Hamoud et al (2007) fount out the optimal fixation conditions for immunohistochemical detection of IBDV, which were 10% formalin concentration, pH 7.0, and temperature of 4 degrees C, where maximum intensity of immunostaining was observed. The major limitation of this technique is that it requires the use of skilled technicians to prepare and process the samples for immunohistology. 1.4.11.9 Immunochromatographic Assay The immunochromatographic assay is an alternative rapid-detection method for easy visualization of antigenantibody reactions. The results can be directly observed with the naked eye and is, thus, more convenient when performing bioassays in the field. Zhang et al (2005) developed a rapid diagnostic strip for chicken infectious bursal disease (IBD) based on membrane chromatography using high-affinity monoclonal antibodies directed to chicken IBDV. The diagnostic strip had high specificity for detection of chicken IBDV antigen and recognized a variety of the virus isolates, including virulent and attenuated strains, with no cross-reactivity to other viruses. Wang et al (2008) used disperse dyes (DADISPERSE NAVY BLUE SP) as an immunoassay chromogenic marker, in analyzing antibody against IBDV (anti-IBDV). Recently Nurulfiza et al (2011) developed an immunochromatographic assay using colloidal gold-antibody conjugate to detect IBDV in chickens. The results showed that the test strip was more sensitive than the commercial

33

enzyme-linked immunosorbent assay because it could detect a dilution factor up to 120,000 (250 ELISA units) for positive samples. 1.4.12 IBDV Control Methods IBDV is highly infectious and very resistant to inactivation. Therefore, despite strict hygienic measures, vaccination is inevitable under high infection pressure and mandatory to protect chickens against infection during the first weeks after hatch. Mostly two types of vaccine are available for the control of IBD. These are live attenuated vaccines, or inactivated oilemulsion adjuvanted vaccines. The most popular strategy for IBD vaccination is hen hyperimmunization (Sharma and Rosenberger 1987). Poultry integrators use live IBDV vaccines and two or more inactivated vaccines in replacement pullets and hens in order to hyper-immunize hens. Passive immunity to IBDV is then transferred to broiler progeny providing some level of early protection against field challenge. Some companies rely on passive immunity only for broiler protection and do not use any live vaccines in progeny (Fussell 1995). In addition to passive immunity, live IBDV vaccines are also given in an effort to gain active immunity against IBDV (Giambrone 1995, McMurray 1995, Putnam 1995). Live IBDV vaccines are administered either in ovo or at hatching, and in the field through booster vaccinations. Live Delaware variant and classic combinations are often recommended (Miller Heins 1995). The timing of live IBD vaccine administration in broiler progeny, usually depending upon antibody titer levels as measured by ELISA or other techniques (Ather 1993). Day-old chicks with maternally derived IBD antibodies were inoculated with IBD oil emulsion, showed 90 per cent survival when challenged at seven weeks of age (Wyeth and Chettle 1990). Age of

34

vaccination is an important aspect of protection against IBDV infection. Chicks administered with inactivated IBD oil emulsion vaccine at seven days old were fully protected compare to the chicks administered at 10, 14 or 28 days old, with a partial protection (Wyeth et al 1992). Chicks of 3 to 6 weeks age groups are mostly susceptible to IBDV. Considering the age factor in the susceptibility of chicks to IBDV, Kembi et al (1995) recommend the ocular route as the most effective for vaccination compared to the oral and intramuscular route, as the Post-intra ocular vaccination seroconversion was observed at the age of 6 weeks in 70% of the birds which increased to 80% during the two following weeks. Tsukamoto et al (1995) suggested that serological determination of the optimum vaccination time for each flock is required to effectively control highly virulent IBDV in the field. The optimum vaccination timing could be approximated by titrating the maternal IBDV antibodies of 1-day-old chicks by an enzyme-linked immunosorbent assay or by an agar gel precipitin test. The immune system in birds begins to develop early during embryogenesis and various immune reactions have been induced in the late stage chicken embryos. Therefore attempts on ovo vaccination as an alternative approach to post-hatch vaccination of chickens, were explored. Negash et al (2004) reported that compared to post-hatch vaccination, in ovo vaccination stimulates both the innate and adaptive immune responses with the advantage that because of the prenatal immunization, in ovo vaccinated chicks have developed an appreciable degree of protection by the time of hatch. Vaccines along with many immunomodulators are used for enhancement of immunity in humans and animals for a long time. Hung et al (2009) reported that Gingyo-san (GGS), a traditional Chinese medical formula enhanced cell-mediated immunity and augmented the effects of IBD

35

vaccination in strengthening subsequent anti-viral responses. Similarily, polysaccharide-containing extracellular fractions (EFs) of the edible mushroom Pleurotus ostreatus increased the level of IBD antibodies when used in combination with BIAVAC and BIAROMVAC vaccine (Selegean et al 2009). There was significant increase in mitogenic stimulated lymphocyte proliferation and antibody levels of chicks immunized with IBD vaccine emulsified with an extract from Momordica cochinchinensis seed (Selegean et al 2009). Amakye-Anim et al (2000) reported that IBDV vaccine immunized chicks supplementated with ascorbic acid (AA) to their diet did not show any clinical signs or mortality when challenged with IBDV. Hung et al (2010) revealed that the dietary supplementation with recombinant porcine lactoferrin (rPLF) led to significant increase in serum IgG and IBD-specific antibody titers, and also enhanced the expression of IFN-gamma and IL-12 in chicken T lymphocytes. Passive hyperimmune therapy (PHT) is another alternative to standard vaccination. Passive immunization with antibodies derived from blood is widely used to prevent or treat infections like measles, hepatitis A, hepatitis B, tetanus, varicella, rabies, and vaccinia etc. Eterradossi et al (1997) showed that SPF chicks are passively protected from IBDV when hatched from the eggs injected with semi purified egg-yolk anti IBDV immunoglobulins. Malik et al (2006) recovered 92% IBD virus infected birds, when injected with purified anti IBDV antibodies. In recent years, because of the advances in recombinant technology, different innovative strategies have been reported for IBDV vaccines. Recombinant protein and DNA based vaccines have been developed (Shaw and Davison 2000, Wang et al 2000, Chang et al 2003). These vaccines are free of the disadvantages associated with currently used live attenuated vaccines. The recombinant vaccines are made by inserting the genes for

36

IBDV capsid proteins in the genome of a suitable vector. Specifically VP2 gene is used, as it is the host protective antigen of IBDV. It contains epitopes responsible for the induction of neutralizing antibody. Recombinant VP2 expressed in systems such as Escherichia coli, Pichia pastoris, baculo virus, fowl pox virus etc. were used as sub unit vaccine, showed protection when challenged with IBDV. The entire sequence of Segment A encoding VP2, VP4, and VP3 in that order cloned into the Escherichia coli expression vector pET21a under the T7 promoter. Chicks immunized with purified recombinant IBDV by intra muscular injection induced anti-IBDV antibodies and were protected when challenged with the Gep 5 isolate of IBDV (Rogel et al 2003). Recombinant VP2 as subunit vaccine and live induced bacteria expressing VP2 as vaccine conferred protection of 90-100% and 85.7% respectively for chicks challenged with virulent IBDV (Rong et al 2005). Wang et al (2007) explored the mimotope vaccine approach against IBDV, by synthesizing an artificial gene designated as 5epis consisting of the five mimotopes arranged in tandem (F1-F7-B34-2B1-2G8) with four GGGS spacers, and cloned into a prokaryotic expression plasmid pET28b. The multi-mimotope protein r5EPIS gave 100% protection and promised to be a novel subunit vaccine candidate for IBDV. VP2 was produced in a highly immunogenic form by expression in the yeast Saccharomyces cerevisiae. The recombinant protein, formulated as an oil-emulsion vaccine, induced antibodies and protected the immunized chicks against a challenge infection with virulent IBDV (Fahey et al 1991). Another yeast expression system is the facultative methylotropic yeast Pichia
pastoris which utilizes methanol. Large scale production of VP2 was achieved

with the cloning of VP2 gene into a Pichia pastoris expression system, which gave protection against IBDV as an efficient and cost effective sub unit

37

vaccine (Pitcovski et al 2003).

Pichia pastoris expressed VP2 and

hypervariable region of the VP2 gene gave fully and partial protection respectively (Villegas et al 2008). VP2 protein fused with interleukin - 2 expressed in Pichia pastoris elicited the secretion of both IgG1 and IgG2a and showed a protection of 85% in the challenge experiments (Wang et al 2010). IBDV structural proteins (VP2, VP3 and VP4) were introduced into the baculovirus expression system, which inoculated into susceptible chickens induced virus-neutralizing antibodies and conferred up to 79% protection aginst IBDV challenge. Specific-pathogen-free hens vaccinated with a single dose of the same subunit vaccine produced virus-neutralizing antibodies that were capable of passively protecting the progeny from infection with variant IBDV (Vakharia et al 1993, Vakharia et al 1994). Pitcovski et al (1996) showed recombinant VP2 expressed in insect cells as a high potential subunit vaccine, protecting chicks from high pathogen IBDV. This was further confirmed by Yehuda et al (2000), when baculovirus expressed VP2 induced antibodies similar to commercial vaccine and the antibodies were also transferred to their offspring and were detected in the blood of the progeny for at least 20 days after hatching. Booster dose with recombinant baculovirus VP2 increased the survival to 100% when challenged with IBDV (Ouyang et al 2010). The development of recombinant vaccinia viruses for the expression and delivery of vaccine antigens to mammalian species soon led to the realization that other host-specific viruses would also be suitable vectors for vaccine delivery. A number of viruses of poultry are being developed as potential vaccine vectors. Poxviruses, herpesviruses and adenoviruses appear to be the most attractive candidate vector viruses.

38

rFPV-VP2,

fowlpox

virus

recombinant

expressing VP2

vaccinated in chicks provided protection against mortality induced by the homologous IBDV strain or a highly virulent strain (Heine and Boyle 1993). Replication-competent herpesvirus vectors are prospective vaccine vehicles having a potential for long-term induction of both humoral and cellular protective immunity against pathogens in animals. Tsukamoto et al (2002) demonstrate that the amount of VP2 antigen expressed in the herpesvirus (HVT) vector was correlated with the vaccine efficacy against lethal IBDV challenge. rHVT-pecVP2, which expressed the VP2 antigen approximately four times more than did rHVT-cmvVP2 in vitro, induced complete protection against a lethal IBDV challenge in chickens, whereas rHVT-cmvVP2 induced 58% protection. Huang et al (2004) devised a recombinant Newcastle disease virus (NDV) vector using reverse genetics approach to express the host protective immunogen VP2, which on vaccinated generated antibody responses against both NDV and IBDV and provided 90% protection against NDV and IBDV. Cao et al (2005) developed a fusion protein of VP2 and T4 phage surface capsid protein using T4 bacteriophage surface protein display system which gave a 100% protection against vvIBDV strain when immunized to SPF chickens. The adeno-associated virus (AAV) is a replication-defective virus member of the family Parvoviridae that has been successfully used for gene delivery in humans and other species. Perozo et al (2008) evaluated the protection efficacy of an avian adeno-associated virus (AAAV) expressing the VP2 protein (rAAAV-VP2) against IBDV-virulent challenge, which induced protective immunity in 80% of the challenged birds. Since the introduction of edible plant-based vaccines by Mason et al (1992), several laboratories have used transgenic plants for expression of viral and bacterial antigens. Transgenic lines of Arabidopsis thaliana expressing recombinant VP2 were developed and could able to induced antibody response against IBDV in orally-fed chickens (Wu et al 2010). Similarly SPF chicks orally vaccinated with transgenic rice seeds expressing VP2 protein

39

produced neutralizing antibodies against IBDV and were protected when challenged with a highly virulent IBDV strain (Wu et al 2007). DNA vaccination, the delivery of plasmid DNA encoding immunogens by direct inoculation, offers the potential for further advancements in the production of effective vaccines. A plasmid DNA carrying VP2, VP4, and VP3 genes of IBDV Immunized twice or three times could conferred protection for 50100 or 80100% of chicks, respectively (Chang et al 2001). Cytokines are natural modulators of the immune system that offer the potential for further improving the protective immune response of conventional vaccines against avian pathogens of economic importance. Immune cytokines, such as the chicken IL-2 (chiIL-2) gene incorporated into vaccination regimens currently being used by the poultry industry, could, potentially, act as natural vaccine enhancing molecules. VP2 gene cloned in a bicistronic vector along with chicken interleukin-2 (chiIL-2) as an adjuvant. An in vivo challenge study of bicistronic DNA vaccine expressing IBDV-VP2 and chicken IL-2 together showed effective protection compared to IBDVVP2 and chiIL-2 injected separately against a lethal IBD infection in chickens (Kumar et al 2009). Good health management and excellent farm management are still required to prevent diseases in the chicks. Unfortunately, many of these management techniques can only be adopted by the intensive and some of the semi-intensive farms having enough trained personnel. Excluding meticulous sanitation and first-rate management practices, sufficient control measures against IBDV are required. Therefore, a cheap and simple vaccine giving sufficient protection against IBDV outbreaks would be highly desirable for poultry farming.

40

CHAPTER 2 MATERIALS AND METHODS

2.1 2.1.1

MATERIALS Reagents and Chemicals Chemicals of analytical grade were purchased from Sigma

Chemical Company, St. Louis, USA and the components required for preparing the bacterial growth media were bought from HiMedia, Mumbai, India. Antibiotics like ampicillin were purchased from Ranbaxy, Delhi, India and kanamycin from HiMedia, Mumbai, India. Reverse transcriptase enzyme, ribonuclease inhibitor, restriction enzymes, vent DNA polymerase and T4 DNA ligase were obtained from New England Biolabs, Beverly, MA, USA and taq polymerase was from Genecraft, Ldinghausen, Germay and Genei, Bangalore, India. Oligonucleotide primers for PCR were synthesized from Microsynth, Balgach, Switzerland. DNA molecular weight markers and protein molecular weight markers were obtained from Fermentas (Fermentas, MD, USA). Trizol reagent for RNA extraction was obtained from Gibco BRL, Life Technologies, Carlsbad, CA, USA. For large-scale purification of

plasmids Gigaprep kits were purchased from Qiagen, Germany. For endotoxin assay, E-toxate kit (Limulus amebocyte lysate assay, Sigma, USA) was used. The chelating sepharose for purification of histidine tagged recombinant protein, Q sepharose and Hibond nitrocellulose membranes for Western blotting were procured from Amersham Pharmacia Biotech, Piscataway, NJ, USA.

41

The Maxisorp microtitre plates for carrying out Enzyme Linked Immunosorbent Assay were purchased from NUNC, Roskilde, Denmark. The immunological reagents and secondary conjugates were also procured from Sigma, St.Louis, USA and Bangalore Genei, India. Rabbit anti-chicken IgY ALP conjugate was obtained from Chromous Biotech, Bangalore, India. Mouse anti-histidine monoclonal antibody was obtained from Sigma, St.Louis, USA. For cell culture and splenocyte proliferation assay, 96-well flat bottom sterile tissue culture plates and tissue culture flasks from NUNC, Roskilde, Denmark were used. RPMI, IMDM and fetal calf bovine sera were obtained from Gibco BRL, USA. For hybridoma HT and HAT were procured from Invitrogen, USA. Polyethylene glycol (PEG), for fusion was obtained from Sigma, St.Louis, USA Live, tissue culture adapted (intermediate strain) IBD vaccine manufactured by BAIF Laboratories, Pune, India and live intermediate strain (Georgia) of IBD vaccine manufactured by Indovax, Hissar, India were used for molecular studies. 2.1.2 Culture Media Luria Bertani (LB) broth was used for the propagation of DH5 and BL21 (DE3) strains. The LB broth was prepared by dissolving 10 g of tryptone, 3 g of yeast extract and 5 g of sodium chloride in 1 litre of distilled water and the pH was adjusted to 7.27.4 with 1 N NaOH. In the above composition, sodium chloride was left for LBON broth (LB omitted sodium chloride) for GJ1158 strain. To prepare solid medium, 2% agar was added to the LB or LBON broth. Media was supplemented with 100 g mL-1 of ampicillin or 50 mg mL-1 of kanamycin wherever required.

42

2.1.3

Bacterial Strains and Plasmids DH5 and BL21 (DE3) strains of E. coli were obtained from

Invitrogen, CA, USA. GJ1158 strain of E. coli was obtained from Genei, Bangalore, India. Genotypes of the E. coli strains that were used in this study are given in Appendix 1. T7 expression vector pRSET B and DNA vaccine vector pVAX1 was purchased from Invitrogen, CA, USA. The map and the restriction sites present in the MCS of pRSET B and pVAX1 are shown in Appendix 2 and Appendix 3 respectively. 2.1.4 Expression System Used in this Study The recombinant clones were expressed in pRSET plasmid system based on T7 RNA polymerase (Studier and Moffat 1986). T7 promoter is highly specific for T7 RNA Polymerase and the transcription by T7 polymerase is selective and 5 times faster than E. coli RNA polymerase thus leading to higher expression of genes cloned under T7 promoter. The metalbinding domain (six-tagged histidine moieties) at the N-terminal end forms a fusion peptide and has a high affinity for the divalent ions (nickel, copper and cobalt) and facilitates purification of the protein using immobilized metal affinity columns (IMAC) (Crowe et al 1995). The pRSETB vector used for cloning in this study offers T7 promoter for high-level expression T7 gene-10 sequence to provide protein stability N-terminal 6-histidine tag for rapid purification with nickel resin and detection with an anti-histidine antibody N-terminal X-press epitope for protein detection with the Anti X-press antibody Enterokinase cleavage site for removal of fusion tag.

43

The T7 expression hosts used in this study are BL21 (DE3), BL21 (pLysS) and GJ1158. BL21 strain contains a chromosomal copy of T7 RNA polymerase gene under the control of lac UV5 (DE3 lysogen) promoter which can be induced by isopropyl-thio-galactoside (IPTG). T7 RNAP is expressed upon induction and transcribes the gene of interest, hence expression of genes under the control of T7 promoter in the plasmid can be induced with the gratuitous inducer IPTG (Calbiochem, Merck, Germany) at 1 mM final concentration. Further, BL21 (DE3) being a lon protease deficient strain protects the expressed heterologous proteins from proteolytic cleavage. Another genetically engineered strain of BL21 (DE3) was developed called GJ1158 (Bhandari et al 1997). This strain (GJ1158) carries a single chromosomally integrated copy of the gene for phage T7 RNA polymerase under transcriptional control of the cis-regulatory elements of the osmoresponsive proU operon. Plasmids that have been constructed to obtain overproduction of individual target gene products in strain BL21 (DE3) (by addition of IPTG as an inducer) can directly be transformed into GJ1158. Induction of Pro-U by NaCl drives the transcription of the T7 RNA polymerase gene, which in turn switches on the expression of the genes under the control of T7 promoter in the recombinant plasmid. The NaCl induction regimen was also shown to be associated with a decreased propensity for sequestration of overexpressed target proteins within insoluble inclusion bodies The use of NaCl as an inexpensive inducer in large-scale expression cultures and increased stability makes GJ1158 a very suitable expression host. BL21 (DE3) host was induced with 1mM IPTG for 3 hours, while GJ1158 host was induced with sterile NaCl to a final concentration of 0.3M. In case of BL21(pLysS) strains, the native plasmid contains a chloramphenicol resistance marker and it produces small amounts of

44

lysozyme which prevents leaky expression of genes under the control of T7 promoter in the uninduced condition and this is especially important in case of certain toxic proteins. 2.1.5 Primers Used for the Amplification and Cloning of Capsid Gene Fragment Two sets of primers flanked with different restriction sites were used to clone in pRSETB and pVAX vectors. T7 promoter forward and reverse primers were also used along with the insert specific primers to find out the orientation of the capsid gene fragment in the recombinant vector, pRBVP252-417 and to sequence the pRBVP252-417. The sequences of the primers and the corresponding annealing temperatures used in PCR are given in Table 2.1. Table 2.1 Primers Used for Cloning the Capsid Gene Fragment

Primer pRBVP252-417 (Forward) pRBVP252-417 (Reverse) pVAXVP252-417 (Forward) pVAXVP252-417 (Reverse) T7 Promoter (Forward) T7 Promoter (Terminal)

Sequence (5 3) GGAAGATCTAGCCTTCTG ATG CCA ACA ACC GG CCCAAGCTTATCTGTCAG TTCACTCAGGC CCCAAGCTTAATATGGTC CTTCTGATGCCAACAACC CCGGAATTCCTA(ATG)6 TTACCTCCTTATGGCCCG TAATACGACTCACTATAGG TGCTAGTTATTGCTCAGCGG

Length 32 29 36 48 19 20

Annealing Temperature 54oC 54oC 54oC 54oC 54oC 54oC

45

2.1.6

Animals One day old specific-antibody negative (SAN) Leghorn chickens

were procured from Poultry Research Centre, Tamilnadu Veterinary and Animal Science University, Chennai. Six weeks old inbred BALB/c mice and four months old albino female rabbits were purchased from Kings Institute, Chennai. Animals were moved to the laboratory on the day of the experiment and maintained under standard conditions with food and water at the animal house facilities of Centre for Biotechnology, Anna University, Chennai, India. Animals were handled in accordance with institutional guidelines, and the Institutional Animal Ethics Committee (IAEC) approved the use of animals for this study. 2.1.7 Virus IBDV - infected bursal samples were obtained from Department of Microbiology, Madras Veterinary College, Chennai, India. All the procedures followed were in accordance with the guidelines issued by Department of Public Health, Government of TamilNadu, India, for dealing with animal subjects. The Institutional Review Board at the Centre for Biotechnology, Anna University, Chennai, India also approved the protocols. 2.2 BURSAL PROCESSING Bursal sample was made into a 50% (W/V) suspension with sterile PBS and homogenized using mortar and pestle. The bursal suspension was followed with three cycles of slow freezing and rapid thawing. After centrifugation at 5000 rpm for 20 min at 4oC, the supernatant fluid was added with equal volume of ice cold chloroform and then re-centrifuged at 12000 rpm for 20 min at 4oC. The clear aqueous phase was collected and filtered through a 0.4 m filter. The filtrate was then treated with ampicillin

46

and kanamycin (amount of antibiotics depended on the volume of the supernatant) and incubated at 37oC for 1 h. The prepared sample was then stored at -80oC for infectivity studies. 2.3
IN VIVO TITRATION FOR IBDV CHALLENGE

In order to ensure a constant and reproducible challenge pressure, chickens were challenged by intra-ocular and anal route. To determine the amount of virus required for the desired challenge pressure of approximately 90% mortality, a virus stock was prepared and titrated in vivo. SAN chickens aged 3-4 weeks were challenged with different dilutions of IBDV made in sterile saline. Mortality was recorded and dead chickens were tested for the presence of IBDV. IBDV challenge after vaccination was performed identically. 2.4 EXPERIMENTAL INFECTION IN CHICKENS Chickens were infected with IBDV infected bursal homogenate by intraocular or anal route. Control animals were administrated with phosphate buffer saline. Three days after inoculation, the animals from experimental and control groups are sacrificed. The target tissues were removed and stored separately at 80oC for further studies. 2.5 PURIFICATION OF IBDV IBDV was purified from the homogenate of bursae. The pooled suspension of homogenised bursae samples were mechanically lysed by three freeze-thaw cycles and centrifuged at 8000 g for 30 min at 4oC. The supernatant was collected and ultracentrifuge at 100000 g at 4oC for 1 h. The supernatant was discarded and the pellet resuspended in 500 L of NTE buffer (0.2 M NaCl, 0.02 m Tris-HCl and 0.02 M EDTA, pH 8) supplemented

47

with 1mM phenyl methyl sulfonyl fluoride (PMSF). This suspension was layered over the top of a 20-60% (w/v) continuous sucrose gradient and centrifuged at 100000 g for 1 h. After centrifugation, the viral band was removed with a pipette. The fraction was diluted in NTE buffer and centrifuged at 100,000 g for 1h. The final pellet was then resuspended in 200 L of NTE buffer and stored at -80oC. 2.6 PARTIAL PURIFICATION OF IBDV The pooled bursal samples homogenised in NTE buffer, were frozen and thawed 3 times and the resultant lysate was centrifuged at 5000 g for 10 min. The pellet was discarded and the supernatant was filtered through 0.4 m filter and the filtrate was centrifuged at 8000 g for 10 min. The resulting supernatant was again centrifuged at 70000 g for 1 h and used as the partially purified viral sample. All the centrifugation steps were carried out at 4oC. 2.7 PRODUCTION OF ANTISERUM AGAINST WHOLE VIRUS Purified IBDV was used to produce antibodies in mice. Three Swiss albino inbred mice were immunized with IBDV by intra-peritoneal injection once every two weeks over a six-week period. Antigen (20 g) was mixed with equal volume of Freunds complete adjuvant (Sigma, USA) for the first injection. Subsequent injections were done with 20 g antigen in Freunds incomplete adjuvant (Sigma, USA). Eight days after the final dose, mice were exsanguinated and antisera collected. 2.8 RECOMBINANT CLONES USED IN THE PRESENT STUDY A gene fragment between 52-417 base pairs of VP2, the IBDV structural genes encoding the capsid protein was chosen for cloning into T7

48

expression vector pRSET B and for the mammalian expression vector pVAX. The pRSET B containing the fragment of VP2 gene for expressing the recombinant protein is designated as pRBVP252-417. Similarly DNA vaccine construct encoding the VP2 fragment is designated as pVAXVP252-417. 2.9 BIO-INFORMATIC ANALYSIS OF CAPSID GENE The antigenic determinants or epitopes present on the partial fragment of VP2 protein were analyzed using the bioinformatics tools BcePRED (Saha et al 2004) and IEDB (Peters et al 2005) which utilized the physiochemical properties of protein like hydrophilicity, flexibility and surface probability to locate these antigenic determinants. 2.10 CLONING OF VP2 GENE FRAGMENT Total RNA was extracted from infected bursa according to the manufacturer protocols as described in common methods. The cDNA was used for the amplification of 366 bp capsid gene fragment. The amplified 366 bp fragment was cloned into pRSET B, a T7 expression vector in between Bgl II and Hind III site. The restricted vector and the PCR product were ligated using T4 DNA Ligase. The recombinant product (named as pRBVP252-417) was transformed into DH5 strain of E. coli. The

transformants were screened for the presence of the insert by PCR using insert specific primers. Plasmid was extracted from the positive transformants and was double digested using the flanking restriction enzymes (Bgl II and Hind III) to confirm the insert. The orientation of the insert was analyzed by PCR using different combinations of T7 primers and insert specific primers and was further confirmed by nucleotide sequencing. Similarly the amplified 366 bp fragment was cloned into a mammalian expression vector, pVAX in between Hind III and Eco RI site.

49

2.10.1

Confirming the Orientation of the Insert The orientation of the capsid gene insert in the recombinant

plasmid, pRBVP252-417 was analyzed by PCR using different combinations of T7 primers and insert specific primers. The sizes of the PCR products obtained were compared with pRSET B map to find out the orientation of the insert and it was further confirmed by sequencing the pRBVP252-417 using T7 forward and terminal primers according to the procedure recommended by Applied Biosystems (ABI PRISM) in Microsynth, Balgach, Switzerland. The pVAXVP252-417 was also sequenced for orientation confirmation. The nucleotide sequence of the 366 bp was deposited into GenBank under the accession no. FJ848772. 2.10.2 Sequence Analysis The nucleotide sequence of 366 bp and its deduced

amino acid sequence were analyzed by BLAST (Altschul et al 1990), which is available on the worldwide website of NCBI, MD, USA

(http://www.ncbi.nlm.nih.gov/BLAST). The percentage homology of the 366 bp and its deduced amino acid sequence with the other isolates of IBDV was calculated. 2.11 EXPRESSION OF THE RECOMBINANT PROTEIN Briefly the following protocol was used for expression of the recombinant protein (LBON was supplemented with 100 g/mL of ampicillin). i. E. coli strain of GJ1158 was transformed with pRBVP252-417 construct.

50

ii.

A single colony of fresh transformant was inoculated into 3 mL LBON and grown overnight at 37oC in water bath shaker.

iii.

200 L of the overnight culture was inoculated into 200 mL LBON in 1000 mL conical flask and grown at 37oC with 150 rpm shaking, till OD600 of the culture reached 0.6.

iv.

NaCl was added to a final concentration of 0.3 M and the culture was grown for 3 h at 37oC with 150 rpm shaking.

The culture was centrifuged at 10000 g for 5 min. The supernatant was discarded and the bacterial pellet containing the recombinant protein was stored at -20oC until further use. 2.12 PURIFICATION OF RECOMBINANT PROTEINS USING IMMOBILIZED METAL AFFINITY CHROMATOGRAPHY (IMAC) Each recombinant protein was expressed with 6 histidine residues as an N-terminal fusion peptide. The metal binding domain in the fusion peptide allows simple one step purification of recombinant protein by IMAC. The recombinant proteins was expressed as inclusion bodies, hence the proteins were purified under denaturing conditions (8 M urea). Briefly the following protocol was adopted for purification: i. Cells were harvested by centrifugation at 10,000 g after induction with NaCl for 3 h. ii. The cell pellet was solubilised with binding buffer (0.1M Phosphate buffer pH 8.0, 0.01 M Tris pH 7.5 and 8 M urea) overnight at 4oC on a rocker.

51

iii.

The column was equilibrated with 3 column volumes binding buffer (pH 8.0). Samples were applied to the column (5 mg protein /ml of Ni-NTA column), allowed to bind to the NiCl2 charged Ni-NTA column (Pharmacia, USA).

iv.

Column was washed with solubilisation buffer (pH 7.5), followed by elution with increasing concentrations of imidazole (10-150 mM) to remove all contaminating proteins.

v.

The protein was eluted at 500 mM imidazole concentration. The purity of the protein was checked on SDS-PAGE. After purification the sample was dialysed against 0.1X PBS and then concentrated by vacuum concentrator. The concentration of each purified recombinant protein was estimated by Lowry method and stored at 80oC in aliquots till further use.

2.13

LARGE-SCALE PRODUCTION OF THE DNA VACCINES The recombinant E. coli containing the DNA vaccine plasmid

pVAXVP252-417 was grown in LB broth media supplemented with 50 g/mL of kanamycin. A single colony of the recombinant E. coli was grown in 50 mL at 37oC with shaking for 8 h. This growing culture was used to inoculate the 2.5 liters medium. The cells were grown at 37C for 1216 h with vigorous shaking for 16 h. Subsequently, cells were harvested and used for extraction of the plasmid using QIAGEN EndoFree plasmid purification Giga kit as per manufacturers instructions. Briefly the following protocol was used for largescale isolation of plasmid DNA as per the instructions manual (QIAGEN, Germany).

52

i.

Harvesting of bacteria: E.coli cells from 2.5 litre culture were pelleted by centrifugation at 6000 g for 15 min at 4C. All the media was removed carefully.

ii.

Cell resuspension: 125 mL of Buffer P1 (50 mM TrisCl, 10 mM EDTA, 100 g/mL RNase A) was added to the pellet and resuspended until the suspension was homogeneous and no cell clumps were visible.

iii.

Cell lysis: The bacterial cells were lysed by adding 125 mL of Buffer P2 (200 mM NaOH, 1% SDS (w/v)). The solution was mixed gently but thoroughly until a homogeneous lysate was obtained and incubated at 25oC for 5 min.

iv.

Neutralisation: The above lysis mix was neutralised by adding 125 mL chilled Buffer P3 (3.0 M potassium acetate), mixed gently but thoroughly until white, fluffy material was formed and the lysate was no longer viscous.

v.

Filtration: This lysate was poured into the QIAfilter Mega-Giga Cartridge and incubated at 25oC for 10 min and filtered by vacuum pump. 50 mL of Buffer FWB2 (1 M potassium acetate) was loaded to the QIAfilter Cartridge and gently stirred and filtered again.

vi.

Endotoxin removal: QIAGEN Endotoxin Removal Buffer was added to the filtered lysate, mixed by inverting the bottle approximately 10 times, and incubated on ice for 30 min to remove endotoxin.

vii. Equilibration: QIAGEN-tip 10,000 was equilibrated by applying Buffer QBT (750 mM NaCl; 50 mM MOPS, 15% isopropanol 0.15% Triton X-100) and column was allowed to empty by gravity flow.

53

viii. Loading the lysate: The incubated filtrate obtained from step 6 was poured over the resin and allowed to enter the resin by gravity flow. ix. Wash: QIAGEN-tip was washed with a total of 600 mL Buffer QC (1.0 M NaCl, 50 mM MOPS, 15% isopropanol). x. Plasmid elution: Plasmid DNA was eluted with 100 mL Buffer QN (1.25 M NaCl, 50 mM TrisCl, 15% isopropanol). xi. Plasmid precipitation: DNA was precipitated by adding 70 mL (0.7 volumes) at 25oC isopropanol to the eluted DNA, mixed and centrifuged immediately at 15000 g for 30 min at 4C. Supernatant was carefully decanted. xii. Washing precipitate: The precipitated DNA was washed with 10 mL of endotoxin-free 70% ethanol to remove the salt contamination and centrifuged at 15,000 g for 10 min. Supernatant was carefully decanted without disturbing the pellet. The pellet was air-dried for 20 min. The dried pellet was resuspended in endotoxin-free buffer TE. The DNA was checked by restriction digestion and PCR using gene specific primers for the presence of insert. The concentration and purity of DNA was assessed by checking the ratio of absorption at 260 and 280 nm. The plasmid DNA was stored in -20oC till the vaccination study. 2.14 TRANSIENT TRANSFECTION OF CHINESE HAMSTER OVARY (CHO) CELL LINE BY DNA VACCINE

CONSTRUCTS The CHO cell line cryopreserved and maintained by the Tissue Culture Laboratory, Centre for Biotechnology, Anna University, was used for

54

the transient transfection of DNA vaccine constructs (pVAXVP252-417) to check for expression. CHO cells were transiently transfected using Lipofectamine reagent (GibcoBRL/Life Technologies, Gaithersberg, MD) as described by the manufacturer. i. In a six-well or 35 mm tissue culture plate, ~ 2x 105 cells were seeded per well in 2 mL of DMEM medium containing 10% FBS and supplemented with 50 g/mL gentamicin. ii. The cells were incubated at 37oC in a CO2 incubator until they were 70-80% confluent. This usually took around 18-24 h. iii. The following solutions were prepared in sterile 2 mL eppendorfs. iv. Solution A: For each transfection, 2 g DNA (plasmid)

was diluted in 375 L serum-free DMEM medium without gentamicin Solution B: For each transfection, 12 L

LIPOFECTAMINE reagent was diluted in 375 L serumfree medium. v. The above two solutions were mixed gently and incubated at 25oC for 15-45 min. vi. vii. The cells were washed once with 2 mL serum-free medium. For each transfection, 750 L serum-free medium was added to each tube containing the lipid-DNA complexes, mixed gently and overlaid on the washed cells. viii. The cells were incubated for 6 h at 37oC in a CO2 incubator. ix. 1.5 mL medium with 20% FBS was added after removing the transfection mixture.

55

x.

Medium was replaced every 18-24 h following start of transfection.

xi.

The cell extracts were assayed for gene expression by RT-PCR, 48 h after the start of transfection.

The

transfected cells were harvested after 48 h time point. Total

RNA and protein was extracted from cells by using TRIzol and the RNA was converted into cDNA using MMLV Reverse Transcriptase (Genei, Bangalore) by standard protocols. The cDNA was checked for the presence of message level of each gene in the transfected CHO cell by doing PCR with gene specific forward and reverse primers. The protein was subjected to western blot analysis with anti-IBDV and anti-VP252-417 antibodies. 2.15 GENERAL MOLECULAR BIOLOGY TECHNIQUES Molecular biology methods such as plasmid DNA preparation, agarose gel electrophoresis and SDS-PAGE, transformation, PCR, RT-PCR and western blotting used in this study are described in the following pages. 2.15.1 Reverse (RT-PCR) 2.15.1.1 RNA extraction Isolation of RNA was carried out with adequate precautions to eliminate RNase activity. All glasswares and plasticwares were treated with DEPC (diethyl pyrocarbonate), which inactivates RNase by covalent modification. All the glasswares, plasticwares and solutions were autoclaved at 121o C for 20 mins and baked at 80oC for three hours. Gloves were used for performing all the experiments. RNA was isolated by using TRIzol Reagent as per manufacturers protocol. Briefly, Transcription and Polymerase Chain Reaction

56

i.

The media was removed from the culture plate wells and cells were washed with 1 mL of PBS.

ii.

To each well of 6 well culture plate, 1 mL of TRIzol reagent was added. Cell lysate was incubated for 5 min at room temperature. For bursal samples, 50 mg of bursal tissue was homogenised in 1 mL TRIzol with a glass homogeniser. All the centrifugation steps mentioned here were carried out at 12000 g.

iii.

200 L of chloroform was added to this and kept at 4oC for 20 min. The content was centrifuged at 4oC for 20 min.

iv.

The RNA in the aqueous phase was precipitated by 0.7 volume of isopropanol for 30 min at -20oC and centrifuged for 30 min at 4oC.

v.

The pellet was washed with 0.5 mL of 70% ethanol and it was dried till the ethanol evaporates.

vi.

The dried pellet was resuspended in 10 L of DEPC treated H2O.

vii. The concentration was estimated by taking the absorbance at 260 nm. 2.15.1.2 Reverse transcription reaction Reverse transcription reaction was carried out as follows: Synthetic oligonucleotides (Synergy Scientific, Switzerland) corresponding to the 5 and 3 conserved ends of the VP252-417 were used for cDNA synthesis. dsRNA was boiled for 5 min and immediately transferred to ice, 40 pmol of each primer was added and incubated at 25C for 15 min. The reverse transcription was performed at 42C for 60 min using 200 units of Murine Malonyl Reverse Transcriptase (MMLV-RT) lacking RNase-H activity (New England Biolab);

57

40 units of RNAsine, and 10 mM dNTPs in a 20 L reaction. The reverse transcriptase was inactivated by heating the reaction for 5 min at 95C. The cDNA synthesized was further used for PCR. 2.15.1.3 Polymerase chain reaction of cDNA For PCR reaction, 10 L of cDNA mixture prepared as described earlier was added to a PCR reaction mixture consisting of 5 units of Taq polymerase (New England Biolabs, Ipswich, US), 10 L of 10X Taq Buffer, and 25 pmol of each primers and 10 L 2.0 mM dNTPs in a final volume of 100 L. The reaction mixture was placed in a PCR thermal cycler for cyclic reactions. The PCR reaction was set up as per the nature of primer (Table 2.1) and size of amplified product. The PCR products were run on 1.2% agarose gels stained with ethidium bromide and photographed by gel documentation system. PCR conditions used for amplification: Step 1 - Initial denaturation: 95C, 5 min Step 2 - Denaturation : 95C, 1 min Step 3 - Annealing: 54C, 1 min Step 4 - Extension: 72C, 1 min Step 5 - Cycling from step 2 to 4 for 30 more times. Step 6 - Final extension: 72C, 10 min Step 7 - End 2.15.2 Agarose Gel Electrophoresis Horizontal submerged gels were used to separate the DNA fragments (Sambrook et al 1989). 0.5X Tris-Borate EDTA buffer of pH 8.3

58

(44.5 mM Tris, 44.5 mM Boric acid and 1 mM EDTA) was used. The electrophoresis was performed at constant 100 volts at room temperature. The gel loading buffer contained 0.2% Orange-G in 50% glycerol and TBE. 1% agarose gels were employed for checking plasmids and their restriction digestion products, whereas for checking the PCR product 1.2% gels were used. Gels were stained with 0.5 g/mL of ethidium bromide, viewed under UV transilluminator (Fotodyne, Hartland, WI, USA). 100 bp ladder and 1Kb ladder (Fermentas, MD, USA) were used as molecular weight markers. Photographs were taken with gel documentation unit, (Bio-Rad, CA, USA) using UV light filter to visualise ethidium bromide stained bands. 2.15.3 Purification of DNA from Agarose Gel Amplified gene products from various geographical locations were gel purified individually using Qiaquick gel extraction kit (Qiagen, Hilden, Germany) as described below: i. The expected amplified gene product was excised using a sterile scalpel blade from the agarose gel. ii. Binding buffer, thrice the weight of the excised gel piece, was added and incubated at 50C until the gel melts completely. iii. Equal volume of isopropanol of the gel weight was added and mixed well. iv. The contents were then transferred to the column and centrifuged at 13000 rpm for 1 min and the filtrate was discarded. v. Column was washed with the wash buffer in the ratio 1:4 (wash buffer : ethanol) and centrifuged at 13000 rpm for 1 min and the filtrate was discarded.

59

vi.

The empty column was centrifuged again at 13000 rpm for 1 min to remove the excess alcohol.

vii. The column was then placed in a new collecting tube and 30 L of sterile water was added and incubated for 1 min and centrifuged at viii. 13000 rpm for 1 min. ix. The filtrate containing the purified PCR gene product was analyzed in 1.2% agarose gel and quantified. 2.15.4 Restriction Digestion The restriction digestions were performed using enzymes from New England Biolabs, USA, and in the manufacturer-recommended buffers. i. Restriction enzyme digestions were carried out as follows: DNA (3-4 g) Buffer (10 X) Enzyme (2-3 units/ g of DNA) BSA (10 X) ii. 2 L 2 L 1 L 2 L

Total volume was made upto 20 L with triple distilled water and incubated for 34 h at 37C.

iii.

The completion of digestion was monitored by agarose gel (1%) electrophoresis.

iv.

When double digestions were performed, the most appropriate buffer as recommended by the manufacturer was used. Simultaneously the efficiency of each enzyme was verified separately in the selected buffer using control DNA. For

60

cloning pRBVP252-417 restriction enzyme Bgl II and Hind III were used, while cloning pVAXVP252-417 restriction enzyme Hind III and Eco RI were used. 2.15.5 Ligation Ligation of digested vector and insert DNA was performed as follows. The ligation mixture consisted of 10X Ligation buffer Vector (~50 ng) Insert (20-50 ng) T4 DNA ligase (10 Weiss units) 2 L 2 L 6 L 1 L L with distilled

The total reaction volume was made up to 20

water and ligation was performed for 16 h at 16C and after completion stored at -20C till use. The ligation mixture was transformed into E. coli host DH5 . The positive clones were further confirmed by restriction digestion and lysate PCR using gene-specific primers to check for the presence of insert. 2.15.6 Screening the Clones by Lysate PCR For screening the recombinant clones, a small portion of freshly grown transformant-positive colony was picked using a sterile toothpick and resuspended in 100 L of 0.1X TE (1 mM Tris and 1 mM EDTA). The cells were lysed by boiling for 10 min, snap-chilled on ice, centrifuged at 12,000 g for 10 min and 1 L of the supernatant was used as template for PCR

(Sambrook et al 1989). VP252-417 specific primers were used in lysate PCR. A direct analysis of the lysate PCR will reveal the possible presence of the gene

61

insert. The clones were selected based upon the insert site and archived for further analysis. 2.15.7 Plasmid DNA Extraction i. Plasmid DNA extraction from recombinant E. coli was based on the method of Birnboim and Doly (1979). All the centrifugation steps in this procedure were performed in a microfuge at 12000 g. ii. A 3 mL overnight grown culture of plasmid bearing E.coli was centrifuged for 5 min and the supernatant was discarded. The residual medium was removed by brief centrifugation followed by aspiration. iii. The cell pellet was resuspended in 200 L of TE buffer (50 mM Tris-HCl, pH 8.0 and 10 mM EDTA) by vigorous vortexing and incubated at 25oC for 5 min. iv. RNase was added to a final concentration of 0.5 g/mL to the 200 L cell suspension and mixed by pipetting and incubated at 37oC for 30 min. v. Freshly prepared 200 L of alkaline-SDS (1% SDS in 0.2 N NaOH) was added, the tube was gently inverted 3-4 times and placed on ice. After 5 min, 200 L of potassium acetate solution (3.2 M pH 5.2) was added, mixed by gentle inversion, and centrifuged for 15 min at 4oC. vi. The supernatant was carefully transferred into a fresh tube. The sample was extracted once with equal volume of Tris buffered phenol: chloroform: isoamyl alcohol (25:24:1) and once with equal volume of chloroform: isoamyl alcohol (24:1).

62

vii. The plasmid DNA in the aqueous phase was precipitated by adding 2.5 volumes for 30 min at 4oC. viii. The supernatant was discarded and the pellet was washed using 0.5 mL of 70% ethanol by centrifugation at 4oC for 10 min. The pellet was dried under a light source and resuspended in 30 L of double distilled water or TE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA) and stored at -20oC. 2.15.8 Transformation of E. coli Transformation of E. coli with plasmid DNA was done by utilizing CaCl2 for the preparation of competent cells. Briefly the following procedure was used. i. A single colony of freshly revived E. coli culture was inoculated in 3 mL of LB and grown at 37oC overnight. ii. 100 L of overnight culture was inoculated into 50 mL LB medium in conical flask and allowed to grow at 37oC till 0.6 OD600. iii. Culture was chilled on ice for 30 min and centrifuged at 4500 g for 10 min at 4oC. iv. The cell pellet was resuspended in 10 mL of 100 mM ice-cold MgCl2 and incubated on ice for 20 min. v. Cells were pelleted as in step 3 and the pellet was resuspended in 25 mL of 100 mM ice-cold CaCl2 and incubated on ice for 30 min. of ethanol or equal volume of isopropanol for 30 min at -20oC and pelleted by centrifugation

63

vi.

Cells were again pelleted as in step 3 and resuspended in 2 mL of 100 mM CaCl2. Approximately 10-20 ng of DNA was added to 100 L of above cells and further incubated for 30 min on ice.

vii. A heat shock at 42oC was given for 90 seconds and chilled on ice for 5 min. viii. To this tube 400 L of LB medium was added, allowed to grow for 1 h at 37oC and 100 L was plated onto LB agar plates supplemented with appropriate antibiotics. ix. A positive control plasmid was used in all the experiments to verify the transformation efficiency. Cells with no DNA added served as negative controls. For transformation in E. coli (GJ1158) LB medium without NaCl was used in all steps. 2.15.9 SDS-Polyacrylamide Gel Electrophoresis Proteins extracted from recombinant E. coli or tissue samples were analysed by the method of Laemmli (1970) with minor modifications. The various buffers used are as follows. i. Monomer solution: 29.2% acrylamide and 0.8% N, Nmethylene bis acrylamide in distilled water. The solution was filtered through whatman filter paper and stored in amber color bottles at 4oC. ii. iii. Separating gel buffer: 1.5 M Tris-Cl, pH 8.3 Stacking gel buffer: 1 M Tris-Cl, pH 6.8

64

iv.

Electrophoresis buffer: 0.025 M Tris-Cl, 0.192 M glycine, 0.1% SDS, pH 8.3.

v. vi.

Ammonium persulphate (APS): 120 mg/mL (12%). SDS: 10% solution.

vii. Tetramethylethylenediamine (TEMED) viii. Sample solubilizing buffer (SSB) (5X): 10% SDS, 10% (v/v) -mercaptoethanol, 50% sucrose, 0.025% bromophenol blue in stacking gel buffer. 1X SSB was added to the cell pellet and resuspended with appropriate volume of 1X PBS and kept in boiling water bath for 10 min. Depending on the proteins to be separated, 1015% separating gel and 5% stacking gels were used. Stacking gel was approximately 1/5 of the separating gel. Protein estimations were performed (Bradford 1976) and equal amounts (20-25 g) of total protein were loaded in each well. Electrophoresis was performed at room temperature with constant current of 20 mA for stacking gel and 30 mA for separating gel. Gels were stained with staining solution (0.25 g of Coomassie Brilliant Blue R-250 in 45% methanol, 10% acetic acid) overnight and destained with 45% methanol, 10% acetic acid solution until a clear background was obtained. Photographs were taken with ChemiImager Gel Documentation system (Bio-Rad, CA, USA). 2.15.10 Western Blotting After electrophoresis, the SDSPAGE gel was transferred for Western blotting as described by Towbin et al (1979). The separating SDS PAGE gel and nitrocellulose membrane (NC) (HyBond, Amersham Pharmacia, U.K) cut to the exact size of separating gel was incubated in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, 0.1% SDS) for

65

10 min. The nylon mask was laid in the apparatus to block the extra area of transfer. Without trapping air bubbles, the NC was overlaid on the gel and sandwiched between filter papers and scotch brite pads. Electrophoretic transfer was carried out at 120 mA for 90 min using Hoefer TE 70 semi-dry electroblotting apparatus (Amersham Pharmacia Biotech, U.K). After transfer, the molecular weight marker lane was cut and stained with amido black (100 mg amido black in 45% methanol, 10% acetic acid). The rest of the NC was stained with Ponceau S (0.2% Ponceau S [Sigma, St Louis, USA] in 0.3% trichloroacetic acid and 0.3% sulfosalicylic acid) to ensure the transfer of the proteins. Membrane was washed in PBS and blocked overnight at 4C with 5% non-fat milk powder in PBS. The NC was washed in wash buffer (PBS with 0.05% Tween-20) thrice for 5 min, followed by washing in 1X PBS thrice and then incubated with appropriately diluted primary antibody at room temperature for 1 h. The membrane was washed again as described above and was incubated in recommended dilution of secondary antibody conjugated with alkaline phosphatase for 1 h. After extensive washing, the blot was incubated in detection buffer (100 mM TrisCl, pH 9.5, 100 mM NaCl, 5 mM MgCl2) for 10 min. The colour development was achieved using 33 L of 5bromo-4-chloro-3-indolyl phosphate (50 mg/mL in dimethyl formamide; USB, Amersham Pharmacia) and 66 L of nitroblue tetrazolium (50 mg/mL in 70% dimethyl formamide; USB, Amersham Pharmacia) in 10 mL of detection buffer. The reaction was stopped after 15 min by adding 10 mM EDTA. Primary antibodies, mouse monoclonal anti-His (Sigma, St Louis, USA), diluted at 1:20000 in 1X PBS was used in detecting the expressed recombinant fusion protein. Various field samples were used at 1:100 dilution for immunoblot analyses. Mouse, chicken and rabbit anti-VP252-417 were used in 1:5000 dilution. The secondary antibodies anti-chicken (Chromous

66

Biotech, Bangalore, India), anti-rabbit and anti-mouse (Sigma, St.Louis, USA) IgG-ALP conjugate were used at 1:1000 dilution. 2.16 2.16.1 IMMUNOLOGICAL STUDIES Chicken Sera Samples All serum samples used in this study were obtained from different chicken farms located at Namakal district of Tamil Nadu. All the procedures followed were in accordance with the guidelines issued by Department of Public Health, Government of TamilNadu, India, for dealing with animal subjects. The Institutional review board at the Center for Biotechnology, Anna University, India also approved the protocols. 2.16.2 Immunoreactivity with Field Sera The optimum dilutions for assay reagents were determined by titration, and the blocking/assay conditions were determined by a series of comparative trials. VP252-417 and purified IBDV antigens were (100 ng/well) diluted in coating buffer (0.1M carbonate/bicarbonate, pH 9.6). The antigens were then coated in 96-well plates (Nunc Maxisorp, Nalge Nunc International, Denmark) and incubated o/n at 4C. After washing three times with PBS-T, the plates were blocked with 5% skimmed milk powder at 37C for 1 h. Chicken field sera were diluted in PBS (1:100), added to the wells (100 L/well) and incubated at 37C for 1 h. After washing with PBS-T,

chicken anti-IgG alkaline phosphatase conjugate (Sigma, St Louis, USA), (1:2000 dilution in PBS-T) was added (100 L/well) and incubated for 1 h at 37C. Plates were washed three times with PBS-T and the substarte pNPP (pnitrophenyl phosphate, disodium salt) was added to the wells (Sigma, St Louis, USA) at 1mg/mL in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured 405 nm after 30 min using a micro plate ELISA reader (BioTek Instruments, Inc., USA).

67

2.16.3

Animals, Immunization and Sera Collection One day old specific-antibody negative (SAN) Leghorn chickens

were procured from Poultry Research Centre, Tamilnadu Veterinary and Animal Science University, Chennai and were grouped according to the experiment requirement. All the experiments were performed in accordance with Institutional Animal Ethics Committee regulations. Their maternal antibody was determined by ELISA on the day before vaccination. The chickens that had no detectable anti-IBDV antibody were used as experimental chickens. For protein immunization, chickens were injected via

intramuscular route with 50 g of the rVP252-417 or commercial whole viral vaccines (IV 95 vaccine strain and Georgia vaccine strain) suspended in 100 L of Phosphate Buffer Saline (PBS) and mixed with alum at 1:1 ratio. The control group of chickens received alum alone in 100 L PBS. Same dose of booster was given on days 7, 14, and 21. Blood was collected every two weeks from 0th day to till 84th day. The blood was allowed to clot and centrifuged at 2500 rpm for 10 min. The sera were separated and stored at 20oC. Similarly for DNA immunization, chickens were injected via

intramuscular route with 100 g of pVAXVP252-417 was suspended in 100 L of water for injection. The control group of chickens received pVAX vector in 100 L water for injection. 2.16.4 Measurement of Total IgY Protein specific IgY levels in the chickens sera were determined by ELISA as described above. 96-well microtiter plates were coated with 100 L of protein (100 ng/well). After washing and blocking with 5% skimmed milk powder, a serial two-fold dilution (1:500-128000) of antisera was used. Antibody titers were assessed as the highest serum dilution giving an

68

absorbance (0.15) higher than that of preimmune sera. The color was developed using p-nitrophenyl phosphate substrate (1 mg/mL) in substrate buffer and absorbance was read at 405nm. 2.16.5 Direct Binding Assay ELISA plates were coated with rVP252-417 protein and incubated o/n at 4C. The plates were washed with PBS-T followed by PBS and blocked in 5% skimmed milk powder as described above. The anti-sera raised against corresponding IBDV vaccines were diluted in 1% skimmed milk powder (1:1000) and incubated at 37C for 2 h. After washing as described above, rabbit anti-chicken IgY (1:1000) (Sigma, St Louis, USA) was added and kept at 37C for 1 h, washed and reacted with pNPP (p-nitrophenyl phosphate, disodium salt) substrate system (Sigma, St Louis, USA). The optical density of the reaction product was read at 405 nm after 30 min (Tripathi et al 2006). Alternatively, reactivity of rVP252-417 antisera with different commercial vaccines was also performed, wherein, ELISA plates were coated with commercial vaccines and incubated with rVP252-417 antisera at 1:1000 dilution. Binding of rVP252-417 with antisera raised against it was considered as the reference binding in both the assays. 2.16.6 Splenocyte Proliferation Assay All the procedures were performed in aseptic conditions under a laminar hood. The DNA and protein immunized chickens were sacrificed on day 42 and the spleens were removed aseptically. Splenocytes were separated and washed twice with fresh culture medium (RPMI 1640). Lysis buffer (0.1% ammonium chloride) was added to the pellet to remove the RBCs and the cell suspensions were overlaid onto Histopaque 1077 density gradient medium and centrifuged at 1800 rpm for 20 min at room temperature. Lymphocytes at the interface were collected and cells were counted by the

69

trypan blue dye exclusion assay. The single cell suspension was cultured in triplicates in 96 well plates (Nunc, Denmark) at 2 x 105 cells/mL in RPMI 1640 medium (100 L/well) supplemented with gentamycin ( 80 g/mL) (Ranbaxy Laboratories, India), 25 mM HEPES (USB, Amersham Pharmacia, UK), 2 mM glutamine (USB, Amersham Pharmacia, UK) and 10% fetal bovine serum. The cells were then stimulated in vitro with different concentration of antigens (0.1, 1, 5, 10, 50 g/well), along with Con A (1g/well, positive control). Wells with medium alone were used as unstimulated controls. The plates were incubated for 72 h at 37oC in a CO2 incubator (Forma Scientific Inc., Marietta, USA) with 5% CO2. After 72 h cell proliferation was measured by MTT assay (Promega, USA). The proliferative response was expressed as stimulative index. (SI = geometric mean (GM) of absorbance in experimentally stimulated cells divided by absorbance of unstimulated cells). All cultures were taken in triplicates and the results expressed as mean SI SEM. 2.16.7 Tissue Distribution Plasmid DNA (pVAXVP252-417) at a dose of 100 g/ individual was administered to separate groups of five for DNA distribution analysis at various time points. At various time points (2, 15, 45 and 60 days) following the administration of the recombinant plasmid, samples of different organs and cell types like muscle, spleen, kidney, liver, and bursa cells were obtained. Around 100 mg of tissues were taken for isolating the DNA as described below. The DNA from different tissues at different time points were subjected to PCR amplification with VP252-417 gene specific primers for studying the distribution

70

2.16.8

DNA Isolation from Different Tissues A piece of tissue (100 mg) was homogenized with 200 L low salt

buffer (10mM Tris HCl, pH 7.6; 10mM KCl, 10mM MgCl2 and 2mM EDTA TKM1) and transferred to a 1.5 mL eppendorf tube. To this 10L of Nonidet P-40 (NP-40, Sigma) was added to lyses the cells and mixed well by inversion several times. The mixture was then centrifuged at 10000 rpm for 10 min at room temperature. The supernatant was discarded and pellet was washed with TKM1 buffer and centrifuged as before. The pellet was resuspended in 200 L of high salt buffer (10mM Tris HCl, pH 7.6; 10mM KCl, 10mM MgCl2 and 2mM EDTA, 0.4 M NaCl TKM2). To the mixture 15 L of 10% SDS was added. Then mixed the whole suspension thoroughly by pipetting back and forth several times, and incubated for 10 min at 55oC, after which 125 L of 5mM NaCl was added and mixed well. Then the mixture was centrifuged at 12000 rpm for 5 min and the supernatant containing DNA was collected. The DNA was recovered by ethanol precipitation and dried. The dried DNA was resuspended in 20 L TE buffer. 2.16.9 RT-PCR for Expression of the DNA Vaccines in Immunized Chicken Muscle 100 mg of chicken muscle tissue was taken and treated with Trizol reagent (Invitrogen, USA).Total RNA (from muscle tissue on days 2, 15, 45 and 60 days after vaccination) isolated was converted to cDNA by reverse transcriptase enzyme by using Retroscript kit as per the manufacturer instructions (ProtoScript, New England Biolabs). The contaminating plasmid DNA was removed by treatment with DNAse I, amplification grade (Boehringer Mannheim), according to the manufacturer protocol. The cDNA (1 g) was amplified for 35 cycles at 94C for 60 seconds, 54C for 60 seconds and 72C for 1 minute, using the primer pairs for the genes encoding VP252-417. The products were visualized by electrophoresis on 1.2% agarose gels containing ethidium bromide.

71

2.17 2.17.1

IMMUNOPROPHYLACTIC STUDIES Animals for Protection Study and Immunization One day old specific-antibody negative (SAN) Leghorn chickens

were procured from Poultry Research Centre, Tamilnadu Veterinary and Animal Science University, Chennai and were grouped so that each group consisted of 20 chickens. All the experiments were performed in accordance with Institutional Animal Ethics Committee regulations. Their maternal antibody was determined by ELISA on the day before vaccination. The chickens that had no detectable anti-IBDV antibody were used as experimental chicks. The animals were immunized with 50 100 g of protein in alum or

g of DNA suspended in water for injection. Four doses at weekly

intervals were administered intramuscularly. The control group for protein received PBS alone in alum, while the DNA group control received pVAX vector in water for injection. Sera collected periodically after immunization was used to check the antibody titre by ELISA. Chickens were challenged with 2104 embryo infective dose (EID50)/mL of standard challenge strain IBDV (characterized vIBDV strain from TANUVAS, Chennai, India) by the oral route, observed clinically for 10 days. Protection against challenge was evaluated by the following methods: Three days post-challenge, the presence of viral particles in the Bursa of Fabricius was tested by AGP. Chickens were inspected for mortality, bursal gross lesions and bursa to body weight ratio (bursa/body weight (%)).

72

Reduced bursa to body weight ratio is indicative of bursal atrophy caused by IBD. Chickens were weighted and their blood and bursa of Fabricius were collected at the termination of the study. Bursa of Fabricius were weighed and the ratio of bursa of Fabricius (BF) and body weight (BW) was calculated using the formula: (BF weight (in g)/BW (in g))1000 (Chang et al 2003). Histological examination was performed to confirm the status of protection. The samples of bursal tissue were taken and fixed in formalin acetic acid alcohol (FAA) fixative. Bursa of Fabricius were sectioned and stained with hematoxylin and eosin. Bursal damage measured by microscopical examination, all sections were randomised and read blind by two people to reduce bias. The lesions on bursa of Fabricius were scored using the system developed by Shaw and the protection was defined by the number of chickens with histopathological BF lesion score 0 and 1 (Shaw and Davison 2000). 2.18 2.18.1 MONOCLONAL ANTIBODY PRODUCTION Immunization of Mice with rVP252-417 for Hybridoma Six-eight week old female BALB/c mice were immunized subcutaneously with 100 L of emulsion containing 50 g of purified

rVP252-417 protein in PBS emulsified with equal volume of Freunds complete adjuvant. The first booster was given 3 weeks later, by subcutaneous route in incomplete Freunds adjuvant. The Second booster was given 3 weeks from the first, and the blood sample was collected 10 days later. Antibody titer was determined by ELISA. When antibody titre reached approximately greater than 1/30,000 the mice were rested. After resting for 1 month, 4 days prior to fusion, the mice were injected intraperitoneally with 200 g of the antigen in saline.

73

2.18.2

Preparation of Myeloma Cells and Splenocytes The cell-line used for fusion was Sp2/0-Ag-14, originally derived

from a fusion between spleen cells from BALB/c mice with X63-Ag8. Sp2/0 myeloma cells were maintained in IMDM supplemented with 36 mM sodium bicarbonate, penicillin (100 U mL-1), streptomycin (100 g mL-1), gentamycin (50 g mL-1), nystatin (5 U mL-1), 10 % (v v-1) FBS and -mercaptoethanol (5 10-5 M). Prior to fusion with splenocytes, Sp2/0 cells in the log phase were harvested, pelleted down by centrifugation at 1500 rpm at 4oC and washed twice with IMDM to remove serum. After excision of spleen from the immunized mice under aseptic conditions, the splenocytes were recovered using needle and piston assembly, washed twice and resuspended in 10 mL of IMDM. An aliquot of the cells suspension was counted. About 80 - 100 splenocytes could be recovered from one mouse. 2.18.3 Preparation of Macrophage Feeder Layer Mice were sacrificed and macrophages collected by flushing the peritoneal cavity with 10 mL of ice cold IMDM. About 5-7 be obtained from a normal mouse. 2.18.4 Fusion of Cells A suspension of the SP2/O cells and splenocytes in a 1:5 ratio was centrifuged to obtain a tight pellet. To the dry pellet, 0.5 mL of the PEG-4000 solution (1 g in 0.8 mL of IMDM and 0.2 mL of DMSO Merck, Rahway, NJ) was added drop wise over 1 min, with gentle tapping of the tube throughout the course of addition and exposed to PEG for another 1 min. PEG was diluted with 5 mL of IMDM (with 20% fetal bovine serum) over 5 min, first 1 mL being added drop wise over one minute. The cells were incubated at 37C for 20-60 min. After centrifugation, the cell pellet was resuspended gently in HAT supplemented IMDM.The cells were then aliquoted in 96-well plates. 106 cells could 106

74

2.18.5

Cell Viability Test To determine the number of viable cells in the cell culture, trypan

blue staining was performed just before observing under microscope. One part of trypan blue solution (0.4% trypan blue in phosphate buffered saline (PBS) and one part cell suspension was mixed together and applied to a Heamocytometer chamber. The viable cells have clear cytoplasm whereas the dead cells have blue cytoplasm. The viable cells present in all four corner squares were counted (including those that lie on the bottom and left-hand perimeters but not those that lie on the top and right-hand perimeters). Any clump present was counted as one cell. The mean number of cells per 0.1 mm3 volumes was calculated and multiplied by 104 to obtain the number of cells/mL (ie. cells/cm3/mL). The dilution factor used for trypan blue (2x) was applied to obtain the number of cells per mL of culture. Number of viable cells Viable cells (%) = Total number of cells (Dead and viable) 2.18.6 Selection of Hybridoma The HAT selection medium consisted of IMDM supplemented with 20% FBS, hypoxanthine (1 thymidine (1.6 10-4 M), aminopterin (4 10-7 M) and 10-5 M). After resuspending in HAT medium, 0.2 mL 106 splenocytes and 3-5 103 macrophages were 100

aliquots containing 0.2

distributed in the wells of a 96 well micro titer plate. The plates were kept in a humidified incubator containing 5% CO2 in the air at 37C. Medium from individual wells was replaced with fresh medium as above but without aminopterin after 7 days. The unfused Sp2/0 cells are killed within 72-96 h during selection in HAT medium. After 10-12 days following fusion, supernatants from wells containing hybrids that were 50% confluent were tested for their ability to secrete specific antibody by ELISA using rVP252-417 as antigen.

75

Single cluster clones secreting antibodies specific to rVP252-417 was selected, expanded and subsequently subcloned to monoclonality by the method of limiting dilution on feeder cells. Monoclonality was confirmed by subclass isotyping using mAb isotyping kit II (ImmunoPure, PIERCE). 2.18.7 Analysis of Serum Samples and Monoclones by rVP252-417 Antigen Based ELISA The ELISA method for the detection of antibodies to rVP252-417 was standardized in the laboratory. i. The rVP252-417 antigen (1 g well-1) in PBS, pH 7.2, was placed in the wells of a polystyrene plate for overnight incubation followed by blocking of the unoccupied sites with a 1% solution of gelatin in PBS. Followed by incubation with monoclonal or polyclonal antibodies for 2 h. ii. The unbound antibodies were removed by three washes (3 min each) with PBS containing 0.1% Tween (PBST) followed by three washes with PBS. iii. This was followed by incubation for 1 h with goat antimouse IgG conjugated to alkaline phosphatase (ALP) at the dilution of 1:2,000 in PBS containing 0.2% of BSA (RIA buffer). iv. After washing with PBST and PBS, the immunoreactivity of the MAbs was visualized by addition of the substrate pNPP (p-nitrophenyl phosphate, disodium salt) to the wells (Sigma, St Louis, USA) at 1mg/mL in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 - 1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured at 405 nm after 30 min using

76

a micro plate ELISA reader (BioTek Instruments, Inc., USA). v. For the serum antibodies in positive and control group was based on the titer criteria, Mean 3 SD. The cutoff for a positive response was considered when the ELISA OD value was at least 3 times higher than the mean control value. 2.18.8 Expansion of Secretor Clones Antibody secreting clones were expanded by transferring them from 0.2 mL culture wells to 1 mL culture wells of 24 well culture plates in the presence of 3-5 103 macrophages. During subsequent subcloning or

expansion, the cells were weaned off HT medium, by replacement with serially diluted concentrations of HT (hypoxanthine and thymidine). Before transferring to plastic culture flasks (25 cm3), cells with more than 75% confluency in the 1 mL wells were confirmed for stable antibody secretion, by ELISA. 2.18.9 Cloning under Limited Dilution (Subcloning) Subcloning was carried out after cell-lines were well established. The cells in the log phase of growth were diluted ten-fold so as to obtain one cell in 0.2 mL of IMDM containing 20% FBS and 3-5 103 macrophages.

Three to four days after plating in the 96 culture plate, wells were examined microscopically to determine the number of clones in the well. Wells containing single hybridoma were replenished with 0.2 mL of fresh medium and when the clones reached 50% confluency, the supernatants were assayed for the presence of antibody. Antibody producing clones (monoclonals) were expanded as described above.

77

2.18.10

Subclass Isotyping of Monoclonal Antibodies Subclass isotyping was done with Rapidot Kit (mouse

Immunoglobulin isotyping) Department of Aquaculture, College of Fisheries, Mangalore, India to check the isotypes of all five monoclonal antibodies. 2.18.11 Maintenance of Cell-Lines Hybridoma cell lines were maintained in IMDM, supplemented with 36 mM sodium bicarbonate, penicillin (100 U mL-1), streptomycin (100 g mL-1), gentamycin (50 g mL-1), nystatin (5 U mL-1), 8-10% (v v-1) FBS and -mercaptoethanol (5 37 C incubator with 5% CO2. 2.18.12 Cryopreservation of Cells Myeloma, hybridoma cells were stored frozen (in liquid nitrogen) at various stages during the course of the experiment, so as to be able to revive them when required. The composition of freezing mixture includes 50% IMDM/DMEM, 40% FBS and 10% DMSO. For freezing, cells in the log phase of the growth were centrifuged and the cell pellet was re-suspended in the chilled freezing mixture by drop wise addition and transferred to 80C in the freezing vials and subsequently to liquid nitrogen. For reviving the cells, the vials were removed from liquid nitrogen and warmed rapidly to 37C. Freezing mixture was removed by centrifugation and the cells were transferred to culture flasks containing 5 mL culture medium. 2.18.13 Affinity Measurement of Monoclonal Antibodies The affinity of antibodies raised against rVP252-417 was measured by estimating the disassociation constant (Kd). For the measurement of the Kd in solution, the method of Friguet et al. (1985) was used. 10-5 M). All the cultures were grown at

78

i.

The rVP252-417 antigen (1 g well-1) in PBS, pH 7.2, was placed in the wells of a polystyrene plate for overnight incubation followed by blocking of the unoccupied sites with a 5% solution of non-fat milk in PBS.

ii.

The monoclonal antibodies were incubated with gradient of rVP252-417 antigen concentration for 16 h at 25C so as to attain antigen-antibody equilibrium. The
-1

starting

concentration of inhibiting antigen was 50g mL and was carried out at twofold serial dilutions. iii. These complexes were transferred onto the wells of the microtitre plates previously coated with the respective antigen and blocked and were incubated for 2 h at 37C. iv. After three washes with PBS containing 0.1% Tween (PBST) followed by three washes with PBS, goat anti-mouse IgG conjugated to alkaline phosphatase (ALP) at the dilution of 1:2000 in PBS containing 0.2% of BSA was added and incubated for 1 h at 37 C. v. After washing with PBST and PBS, the immunoreactivity of the MAbs was visualized by addition of the substrate pNPP (p-nitrophenyl phosphate, disodium salt) to the wells (Sigma, St Louis, USA) at 1mg/mL in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 - 1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured at 405 nm after 30 min using a micro plate ELISA reader (BioTek Instruments, Inc., USA). vi. Dissociation constant (Kd) was calculated using the following equation derived from Scatchard and Klotz (Friguet et al 1985):

A0 A0 A

KD a0

79

Wherein A0 and A: absorbance measured for antibody in absence and presence of antigen respectively; KD: disassociation constant; a0: total antigen concentration. 2.18.14 Avidity Measurement of Monoclonal Antibodies The ELISA for monoclonal antibodies reactivity with rVP252-417 and purified IBDV antigen were performed as previously. The protocol followed in the present assay has been previously described by Binley et al (1997) and used with modification. i. The 1 g well-1 of rVP252-417 antigen and 2 g well-1 of purified IBDV antigen in PBS, pH 7.2, was placed in the wells of a polystyrene plate for overnight incubation followed by blocking of the unoccupied sites with a 5% non-fat milk

solution in PBS. This was followed by incubation wit two fold dilution of monoclonal or polyclonal antibodies in PBS containing 0.5% non-fat milk for 1 h. ii. For avidity measurement, plate was divided in such a way that rows A, B, and C are coated with antigen (PBS wash) and rows F, G, and H are coated with antigen for avidity (8M Urea treatment) rows D and E are blank. iii. For avidity, each plate was washed three times, 5 min each, with 200 mL well-1 as follows: a. b. iv. Rows A, B, and C with PBS Rows D, E, and F with 8 M urea in PBS

This was followed by incubation for 1 h with goat anti-mouse Ig conjugated to alkaline phosphatase (ALP) at the dilution of

80

1:2,000 in PBS containing 0.5% of non-fat milk solution in PBS. v. The unbound antibodies were removed by three washes (3 min each) with PBS containing 0.1% Tween (PBST) followed by three washes with PBS. vi. The immunoreactivity of the MAbs was visualized by addition of the substrate pNPP (p-nitrophenyl phosphate, disodium salt) to the wells (Sigma, St Louis, USA) at 1mg/ml in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 - 1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured at 405 nm after 30 min using a micro plate ELISA reader (BioTek Instruments, Inc., USA). Data presentation: Midpoint titers are defined as the antibody dilutions giving half-maximal binding (after background subtraction). The avidity index is defined here as (A/B 100%), where A is the absorbance

value with urea treatment and B is the absorbance value without urea treatment at a given dilution/concentration of antibody. The value of B in every avidity index calculation was derived from titration curves, where the absorbance value A was then read at the same antibody dilution, correcting for background for both values. Avidity indices calculated are the average of two replicates. Antibodies with avidity indices of < 30% are designated lowavidity antibodies, those with values of 30-50% are designated intermediateavidity antibodies, and those with values > 50% are designated high-avidity antibodies. When a urea wash was used in ELISAs, we define the binding property of monoclonal or polyclonal antibodies as its avidity, although it should be noted that monoclonal antibodies, owing to their clonal nature,

81

cannot have avidity per se. We use this term here to conveniently distinguish binding observed after a urea wash step from that without the urea wash. 2.18.15 Production of Polyclonal Antibody against rVP252-417 Laboratory bred rabbits were immunized with the purified recombinant protein rVP252-417 to produce polyclonal antibodies, as per protocol described (Harlow et al 1988). Briefly, the rabbit was immunized subcutaneously with 250 g of purified rVP252-417 protein emulsified in Freunds complete adjuvant, followed by administration of 125 g of the antigen in Freunds incomplete adjuvant. Animals were pre-bled before immunization to be used as control. Serum samples were collected 2 weeks after the final immunization and tested for immunoreactivity against the rVP252-417 antigen by Western blotting and the antibody titers by ELISA. The antibody titre in immunized animals was estimated by serial dilution and compared with control or pre immune serum. The criteria for serum titre were Mean 3 SD against the control. The cutoff for a positive response was fixed atleast 3 times higher than the mean control value. 2.18.16 Purification of Monoclonal Antibody Culture supernatants of murine mAb IgG2b (3A11A2 + 1C7F12) were equilibrated against 50 mM glycine-NaOH buffer, pH 8.5 containing 2M NaCl and loaded onto a protein A-Sepharose column (Amersham, USA). After washing, the bound mAbs were eluted with 0.1M glycine-HCl, pH 3.0, and neutralized with 1 M Tris-HCl, pH 8.0.

82

2.18.17

Enrichment of mAbs and Polyclonal Antibodies Monoclonal and polyclonal antibodies raised against rVP252-417

were precipitated with 50% and rinsed twice with 40% ammonium sulphate to remove albumin fraction. Concentrated antibodies were dissolved and dialyzed against 50 mM PBS and estimated. 2.18.18 Standardization of IBDV Antigen Capture ELISA Sandwich ELISA was standardized for antigen detection with monoclonal and polyclonal antibodies in combination as capture antibody and detection antibody to detect antigens. The methods previously described by Rao et al (2000) and Lalitha et al (2002) and used with modification. i. Flat bottom 96-well microtitre plates (Immunolon 4, Dynatech Laboratories, Inc., Alexandria, VA) were coated with 1g/well of antiovernight at 4C. ii. The plates were washed in phosphate buffered saline (PBS) containing 0.05% Tween 20 (Sigma) and blocked with blocking buffer, PBS two h at 37C. iii. After six washes, rVP252-417 or purified IBDV sample was mixed with equal volumes of glycine (0.15 M; pH 2.0/Tris (0.1 M; pH 9.0) and added to the wells in duplicates and the plates were incubated at 37C for 2 h. iv. The plates were washed as before and incubated with either rabbit anti- IBDV antibody or rabbit anti-rVP252-417 (dilution of 1:2000) at 37C for 1 h. After washing the plate, goat anti rabbit IgG ALP conjugate was added and incubated at 37C for 1 h. containing 5% skimmed milk for rVP252-417 MAb (500 ng of 3A11A2 pH 7.2 and kept and 1C7F12) diluted in 50 mM PBS

83

v.

The capturing activity of the MAbs was visualised by addition of the substrate pNPP (p-nitrophenyl phosphate, disodium salt) to the wells (Sigma, St Louis, USA) at 1mg/mL in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured at 405 nm after 30 min using a micro plate ELISA reader (BioTek Instruments, Inc., USA).

2.19

DEVELOPMENT OF RAPID DIPSTICK DIAGNOSTIC ASSAY FOR DETECTION Prototype of dipstick device was developed and assayed as

described below: i. Briefly, the prototype contains a test line of capture rabbit anti-rVP252-417 polyclonal and a control line with goat-anti mouse IgG on nitro cellulose membrane. ii. The sample adsorbent pad contains detection reagent with colloidal gold conjugated monoclonal anti-rVP252-417 antibody (3A11A2). iii. The processed infected bursal sample will be drawn in the adsorbent pad and any native antigen present will bind with the colloidal gold conjugated monoclonal and will be carried further across the test and control line. iv. The indication of positive reaction will be seen as two magenta coloured lines in test and control regions respectively. v. The negative reaction will be represented as a single magenta coloured line in the control region.

84

2.19.1

Preparation of Colloidal Gold Gold chloride (AuCl4) was procured from Amresco, OH, USA.

Colloidal gold with an average diameter of 25-30 nm (validated by electron microscopy, Amresco) was prepared by controlled reduction of a boiling solution of 0.02 % chloroauric acid with 1 % sodium citrate according to the method of Frens (1973). The solution was stored in refrigeration 4C away from light until use. Criteria for the colloidal gold solution batch having maxima between 525530 nm and A1cm 527 nm = 2.0 + 0.05 was used for preparing the conjugate with antibody (Basker et al 2004). 2.19.2 Preparation of Gold Antibody Conjugate i. Added 30 mL of colloidal gold (40nm) with 15 ml of 10mM sodium phosphate buffer and add 150 g purified antibody. ii. Mixed the reaction for 30 mins using magnetic stirrer and added 5 mL of blocking agent (0.2% Casein, 0.1% Azide in 100 mM Borate pH 7.5).

iii.

Mixed again for 30 mins using magnetic stirrer and centrifuged at 7000 rpm for 30 mins at 4oC.

iv.

Collected the pellet and resuspended in 1 mL of blocking agent

v.

The absorbance was measured at 520 nm.

85

2.20

STATISTICAL ANALYSIS All statistical analyses were done using Graphpad prism software

version 5.0. The difference in two means was compared using nonparametrical analysis of Students t-test. For multiple comparisons, nonparametric Kruskal-Wallis test was used along with the Bonferroni's post test. For T cell proliferation studies two ways ANOVA was used. A probability (p) value < = 0.05 was considered statistically significant.

86

CHAPTER 3 RESULTS

3.1

CLONING, EXPRESSION, PURIFICATION AND IMMUNOPROPHYLACTIC EFFICACY OF RECOMBINANT VP2 FRAGMENT In order to make a recombinant protein of the immunodominant

region, a 366 bp from the N-terminal end of VP2 protein was amplified based on the prediction of antigenic determinants using the bioinformatic tools BcePRED (Saha et al 2004) and IEDB (Peters et al 2005). The amplified immunodominant region was cloned in to a prokaryotic expression vector, pRSET B. The authenticity of the clone was checked by PCR using different combinations of T7 or insert-specific primers and was further confirmed by nucleotide sequencing. The expression of recombinant VP252-417 was obtained in BL21 (DE3) and GJ1158 strains of E.coli. The large-scale expression was optimized in GJ1158 strain of E. coli, since the induction can be achieved with NaCl. The recombinant VP252-417 expressed as a histidine tagged fusion protein was purified by gel-elution as well as by IMAC. The IMAC purified recombinant VP252-417 was assessed for humoral and cellular immune response. The hyper immune serum raised against the purified recombinant VP252-417 was used as the positive control in all the western blotting experiments carried out with the infected and vaccinated sera. The reactivity of the purified recombinant VP252-417 with the sera raised against field isolates and commercial vaccine strains confirmed that the immunodominant N-terminal region is immunoreactive to IBDV and confers humoral immune response. Further, the rVP252-417 was evaluated as

87 vaccine by viral challenge studies in immunized chickens which confirmed protection. 3.1.1 Amplification and Analysis of VP252-417 Gene The antigenic determinants in the amino acid sequence encoded by the 366 bp region from 52 to 417 bp of VP2 gene was examined by semiempirical method and showed the presence of three immunogenic regions with 20-29 amino acids that could be linear epitopes. The bioinformatics tools BcePRED (Saha et al 2004) and IEDB (Peters et al 2005) showed a length of 25-29 amino acids that is hydrophilic, surface accessible, flexible and thus possibly antigenic. The sequences of the antigenic determinants obtained by both the methods are given in Table 3.1. The 366 bp fragment of VP2 gene was amplified from the infected bursal samples by RT-PCR (Figure 3.1a). The specificity of the 366 bp amplicon was tested by digestion with Bsa I and
Bfa I restriction enzymes. The Bsa I digestion released 67 and 299 bp

fragments and Bfa I digestion released 253 and 113 bp fragments (Figure 3.1b). 3.1.2 Cloning of VP252-417 Gene The ORFs of the VP252-417 sequence was amplified by PCR using VP252-417 sequence specific primers with Bgl II and Hind III sites. The PCR products were purified and digested with Bgl II and Hind III restriction enzymes. The digested PCR and the predigested vector, pRSET B were ligated using T4 DNA ligase. To select the recombinants, the ligation mixture was transformed into DH5 strain of E. coli and selected on LB agar plates containing ampicillin. Screening for positive clones was carried out by colony lysate PCR with insert specific primers (Figure 3.1c). The positive transformants were used for further characterization.

(a)

(b)

(c)

Figure 3.1 Amplification and Cloning of VP2 Gene Fragment

10 L of the PCR or restriction digestion products were loaded on 1.2% agarose gel, stained with ethidium bromide (0.5 g/mL) and observed in the gel documentation unit. (a) RT- PCR amplification of VP2 gene fragment from IBDV infected bursal samples Lanes: 1 100 bp DNA molecular weight marker, 2 Negative control, 3 and 4- Infected bursal samples. The 366 bp amplified product is indicated by an arrow on the right side. (b) Specificity of the RT-PCR product by Restriction enzyme analysis Lanes: 1 100 bp DNA molecular weight marker, 2 Undigested 366 bp PCR product, 3 and 4 Bsa I and Bfa I digested 366 bp PCR product respectively. (c) Screening of transformants by colony PCR The 366 bp insert in the pRBVP252-417 was amplified by PCR using insert specific primers. Lanes: 1- 100 bp DNA molecular weight marker, 2 to 8 Positive transformants, 9 Positive control (cDNA from infected bursa), 10 - Negative control. The amplified product is indicated by an arrow.

88

89

Table 3.1

The Antigenic Determinants Identified in 122 aa Region by BcePRED and IEDB

Sl. Start End Length No Position Position (aa) 1 2 3 5 39 67 29 58 95 25 20 29

Antigenic determinants (Sequence) PTTGPASIPDDTLEKHTLRSETSTY GLIVFFPGFPGSIVGAHYTL DQMLLTAQNLPASYNYCRLVSRSLTVRSS

The amino acid sequence of antigenic determinants with the starting and end positions are given along with the length of the antigenic determinants. Single letter code for the amino acids is used. 3.1.3 Restriction Profile Analysis Plasmids were prepared from the transformants for each clone and digested with Bgl II and Hind III for confirmation of cloning. Single digestion with the enzymes linearized the pRBVP252-417 to the size of approximately 3.3 kb, whereas the pRSET B linearized to 2.9 kb. When the pRBVP252-417 plasmid was subjected to double digestion with Bgl II and Hind III, the 366 bp insert was observed (Figure 3.2a), which confirmed the presence of the gene fragment in the vector.

3.1.4

Confirming the Orientation of the Insert in pRBVP252-417 The orientation of the insert in the recombinant plasmid designated

as pRBVP252-417, was analyzed by PCR using different combinations of T7 promoter and insert specific primers. The size of the amplicons, 550 bp and 433 bp for pRBVP252-417 was obtained in the PCR showing the correct orientation of the insert (Figure 3.2b) which was further confirmed by sequencing the clone using T7 primers. The nucleotide sequence of the 366

90

bp region obtained from pRBVP252-417 was deposited in the Genbank database (Accession No. FJ848772). The nucleotide and the deduced amino acid sequence of 366 bp are given in Figure 3.3. BLAST analysis of the nucleotide sequence of the 366 bp showed 9899% homology with the other VP2 gene fragment sequences (Table 3.2) whereas, the amino acid sequence showed 100% homology with the VP2 fragment of IBDV isolates across the globe (Table 3.3).

Figure 3.2

Confirmation of the Insert and its Orientation in the Recombinant Plasmid, pRBVP252-417

(a) Restriction digestion analysis 2 g of the recombinant plasmid (pRBVP252-417) and pRSET B were digested with Bgl II and Hind III and resolved on 1.2 % agarose gel. Lanes: 1 - 100 bp DNA molecular weight marker, 2 - Undigested pRSET B, 3 Double digested pRSET B, 4 Undigested pRBVP252417, 5 & 6 - Double digested pRBVP252-417. (b) Confirmation of orientation of the insert The orientation of 366 bp insert was confirmed by PCR using different combination of T7 promoter and insert specific primers. The PCR products were resolved on 1.2 % agarose gel. Lanes: 1 - 100 bp DNA molecular weight marker, 2 - Insert specific primers, 3 - T7 promoter forward and insert reverse primers, 4 - Insert forward and T7 promoter reverse primers, 5 - T7 promoter forward and reverse primers, 6 - Negative control.

91

Figure 3.3

Nucleotide and the Deduced Amino Acid Sequence of 366 bp N-terminal Region of VP2 Protein The 366 bp region is shown in the upper case with amino acid sequence below the corresponding codon. Single letter code for amino acids is used.

92

Table 3.2 BLASTN Analysis of 366 bp of VP2 Gene Fragment

SEQUENCES PRODUCING SIGNIFICANT ALIGNMENTS gb|HQ224883.1| Infectious bursal disease virus strain KNU08010 gbI| FJ848772.1 Infectious bursal disease virus isolate TNcbt1 VP2 dbj|AB368970.1 Infectious bursal disease virVP5, pVP2-VP4-VP3 dbj|AB368968.1|Infectious bursal disease vir VP5, pVP2-VP4-VP3 gb|EU328334.1| Infectious bursal disease virus isolate VP2 mRNA, gb|EU328331.1| Infectious bursal disease virus isolate QD-h VP2 gb|EU328329.1| Infectious bursal disease virus isolate JS-h VP2 gb|EU328327.1| Infectious bursal disease virus isolate HeN-h VP2 gb|EU184685.1| Infectious bursal....Cro-Ig/02 VP5 and structural polyprotein genes, gb|EU042143.1| Infectious bursal virus isolate HLJ-7 VP2 mRNA gb|DQ286035.1| Infectious bursal disease virus isolate MG7 nonfunctional VP5 gene, partial seq; polyprotein gene, partial cds gb|DQ927042.1| Infectious bursal strain ks segment A mRNA, gb|DQ927040.1| Infectious bursal strain mb segment A mRNA gb|DQ450988.1| Infectious bursal disease virus polyprotein gene, partial cds gb|AY780423.1| IBDV isolate JNeto-BR segment A partial cds gb|AY780418.1| IBDV isolate SM-BR segment partial cds gb|AF533670.1|IBD strain SH/92 polyprotein mRNA,complete cds gb|AF322444.1|IBDV segment A VP5 protein and polyprotein genes, complete cds gb|AY323952.1| IBDV seg A VP5 and polyprotein genes, cds gb|AF508177.1| IBDV VP2 gene, complete cds

Score (Bits) 676 676 676 676 676 676 676 676 676

E-Value Percentage of Identity 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 100 100 100 100 100 100 100 100 100

676 676

0.0 0.0

100 100

676 676 676 676 676 676 676

0.0 0.0 0.0 0.0 0.0 0.0 0.0

100 100 100 100 100 100 100

676 676

0.0 0.0

100 100

The BLAST N analysis showing the first 20 hits from Infectious bursal disease virus isolates. The homology between the 366 bp sequenced in the present study and other IBDV isolates were 99-100%.

93

Table 3.3

BLASTP Analysis of the Deduced Amino Acid of 366 bp

SEQUENCES PRODUCING SIGNIFICANT ALIGNMENTS gb|ACO59489.1| VP2 [Infectious bursal disease virus] gb|ABY57305.1| VP2 [Infectious bursal disease virus] gb|ABS87226.1| VP2 [Infectious bursal disease virus] gb|ABY57307.1| VP2 [Infectious bursal disease virus] gb|ABS87227.1| VP2 [Infectious bursal disease virus] gb|ABS87228.1| VP2 [Infectious bursal disease virus] gb|ACP30643.1| polyprotein [Infectious bursal disease virus] gb|ABS87230.1| VP2 [Infectious bursal disease virus] gb|ABE02188.1| polyprotein [Infectious bursal disease virus] dbj|BAA87931.1| VP2-4-3 polyprotein [Infectious bursal disease virus] gb|AAK27323.1|AF248612_1 VP2 protein IBDV gb|ABC86599.1| VP2 [Infectious bursal disease virus] gb|AAK50615.1| polyprotein [Infectious bursal disease virus] gb|ABY57302.1| VP2 [Infectious bursal disease virus] gb|AAU05319.1| VP2 [Infectious bursal disease virus] gb|AAW29102.1| VP2 [Infectious bursal disease virus] gb|AAS87050.1| VP2 [Infectious bursal disease virus] gb|ACP30640.1| polyprotein [Infectious bursal disease virus] gb|AAM28900.1| VP2 [Infectious bursal disease virus] gb|ABC86600.1| VP2 [Infectious bursal disease virus]

Score (Bits) 246 249 249 249 249 249 249 248 248 249

E% Value Identity 1e-83 2e-80 2e-80 2e-80 2e-80 3e-80 3e-80 3e-80 3e-80 3e-80 100 100 100 100 100 100 100 100 100 100

249 249 249 248 249 248 249 249 249 249

3e-80 3e-80 3e-80 3e-80 3e-80 3e-80 3e-80 3e-80 3e-80 3e-80

100 100 100 100 100 100 100 100 100 100

The BLASTP analysis showed 100% homology with the VP2 fragment protein of Infectious bursal disease virus isolates across the globe.

3.1.5

Expression of rVP252-417 Fragment Protein The plasmid pRBVP252-417 was transformed into GJ1158 cells in

order to obtain high-level expression of the proteins using salt induction. The

94

transformants were selected on LB agar plates without NaCl (LBON), containing ampicillin (100 g/ mL of LB agar). Transformants were randomly selected to screen the expression of protein. One of the transformants, giving highest level of expression was selected for further expression studies. Initially, the expression was tested in 3 mL medium by induction with different concentrations of NaCl. The expression was analyzed on a 12% SDS-PAGE (Figure 3.4a). The recombinant construct showed expression of a protein of 21 kDa molecular mass as expected. The expression was confirmed using anti-His monoclonal antibody as the primary antibody by western blotting (Figure 3.4b). The induced pRSET B vector alone was used as negative control. Leaky expression was observed in the uninduced culture. Expression parameters like concentration of the inducer (NaCl), OD of induction and time period were optimized before large scale expression. About 2.5% of the pre-inoculum was transferred into flasks containing 200 mL LB with ampicillin and grown till OD600 reached 0.6. The cultures were induced with the optimized concentration of 0.3 M NaCl for 3 hours. In addition to using a cheaper and non-toxic inducer, the expression of the recombinant VP252-417 in GJ1158 strain was stable at least for a month which is convenient for large-scale expression.

95

Figure 3.4

Expression of Recombinant VP2 Fragment Protein and its Confirmation by Western Blotting
(a) Expression of recombinant VP2 fragment protein Total protein extracts from pRBVP252-417 and pRSET B vector were solubilized in 1X SSB, resolved on 12% SDS-PAGE gel and stained with CBB dye. Lanes: 1 - protein molecular weight marker, 2 pRBVP252-417 uninduced, 3 to 6 - pRBVP252-417 induced with different NaCl concentration (0.15, 0.3, 0.45 and 0.6 M respectively), 7 - pRSET B induced. (b) Confirming the expression of recombinant VP2 fragment protein Total protein extracts from pRBVP252-417 and pRSET B were solubilized in 1X SSB, resolved on 12% SDS-PAGE gel and were transferred on to a nitrocellulose membrane and were probed with anti-his monoclonal antibody. Lanes: 1 - protein molecular weight marker, 2 pRBVP252-417 uninduced, 3 to 6 - pRBVP252-417 induced with different NaCl concentration (0.15, 0.3, 0.45 and 0.6 M respectively), 7 - pRSET B induced.

96

3.1.6

Purification of Recombinant VP252-417 Protein

The expression of proteins in the T7 expression system facilitates an easy one step purification on Ni2+ immobilized columns. The rVP252-417 protein was expressed in GJ1158 in soluble form without inclusion bodies. After centrifuging the culture, the cells were resuspended in binding buffer and sonicated for cell lysis. Soluble fractions or clarified lysates obtained after sonication were used for the purification on IMAC columns. The binding and elution buffer conditions were optimized and the combination of 50 mM TrisSodium phosphate, 10 mM Imidazole and 0.4 M NaCl at pH 6.5 was used. The pure fraction of rVP252-417 was eluted at 200-300 mM Imidazole. In addition to IMAC, gel elution was also used to purify the protein based on the formation of the insoluble potassium salt of lauryl sulfate bound to the protein. Precipitates thus formed are visible within minutes down to the level of 0.06 pg of protein/mm2 of gel cross-sectional surface area. Thus the protein band of interest was cut and eluted in PBS incubating at 95oC for 10 mins. This method was rapid and sensitive technique for protein purification. Both the IMAC purified protein and the gel-eluted protein were analyzed on 12% SDS-PAGE (Figures 3.5a and 3.5b). The proteins were confirmed by western blotting with anti-His antibody (Figures 3.6a and 3.6b).

97

Figure 3.5 Purification of Recombinant VP252-417 Protein by IMAC and Gel- Elution
(a) Purification of recombinant VP252-417 by IMAC The recombinant VP252-417 was eluted at 200-300 mM imidazole concentration from Ni2+ bound sepharose column. The wells were loaded with 25 L volume of the following on 12% SDS-PAGE. Lanes: 1 protein molecular weight marker, 2, 3 & 4 50, 100, 150 mM imidazole eluent respectively, 5, 6 & 7 - 200, 250, 300 mM imidazole eluent respectively, 8 - total protein extract from pRBVP252-417. (b) Purification of recombinant VP252-417 by Gel elution pRBVP252-417 total protein extract was resolved on 12% SDS-PAGE gels, stained with CBB R-250 and the recombinant VP252-417 band alone was cut and eluted from the gel pieces. Lanes: 1- protein molecular weight marker, 2 & 3 gel eluted protein, 4 - total protein extract from pRBVP252-417.

98

Figure 3.6 Immunoblot Analysis of Purified Recombinant VP252-417 Protein (a) Analysis of IMAC purified recombinant VP252-417
25 L of each elution was resolved on 12% SDS-PAGE, transferred onto a nitrocellulose membrane and were probed with anti-his monoclonal antibody. Lanes: 1 protein molecular weight marker, 2, 3 & 4 50, 100, 150 mM imidazole eluent respectively, 5, 6 & 7 200, 250, 300 mM imidazole eluent respectively, 8 - total protein extract from pRBVP252-417. (b) Analysis of gel eluted purified recombinant VP252-417 10 L of gel-purified recombinant VP252-41 was resolved on 12% SDS-PAGE, transferred onto a nitrocellulose membrane and was probed with anti-His monoclonal antibody as follows. Lanes: 1protein molecular weight marker, 2 & 3 gel eluted protein, 4 - total protein extract from pRBVP252-417.

99

3.1.7

Antibody Titre of rVP252-417 Protein in Mice The purified rVP252-417 was used for the production of polyclonal

immune serum in female BALB/c (H-2d) mice. After each immunization, the mice were bled and the sera were separated. The immunoreactivity of the antibodies in the immune sera was assessed by western blotting and the antibody titre was determined by ELISA. After final immunization, the collected sera were pooled and the antibody titre of the rVP252-417 immunized sera was determined by ELISA using the preimmune sera (Figure 3.7a). The polyclonal immune serum and the preimmune serum were serially diluted from 1:100 to 1:64,000. The rVP252-417 protein was found to be highly immunogenic inducing a titer of 64, 000. In the western blotting (Figure 3.7b), the immune sera showed reactivity up to 1:10,000 dilution, whereas the pre immune sera did not show any reactivity.

3.1.8

Characterization of rVP252-417 Protein Mice polyclonal serum raised against purified IBDV whole

antigens and serum from IBDV infected chicken were tested with rVP252-417 protein. The reactivity of the rVP252-417 with these sera as a 21 kDa protein in western blotting (Figure 3.7c) confirmed the origin of the recombinant VP252-417. The reactivity of the recombinant protein with anti-His monoclonal antibody was used as positive control.

100

Figure 3.7 Determination of Antibody Titre and the Specificity of Mouse Anti-rVP252-417 Sera
(a) Determination of antibody titre by ELISA The ELISA plate was coated with 100 ng/well of purified rVP252-417 and the assay was performed with serial dilution of mouse pre and pooled post immune rVP252-417 sera. The anti- rVP252-417 antibody titre was found to be 1:64,000. (b) Western blot analysis of mouse anti- rVP252-417 sera 10 g of purified rVP252-417 was resolved on 12% SDS-PAGE, transferred to nitrocellulose membrane and probed with different dilution of post immune sera. The immunoreactivity of the sera with the rVP252-417 was indicated by the appearance of 21-kDa protein band. Lanes: 1 - protein molecular weight marker, 2 anti-His monoclonal antibody, 3 preimmune sera (1: 100), 4, 5, and 6 antirVP252-417 sera at 1:1,000, 1:5,000 and 1:10,000, respectively. (c) Characterization of rVP252-417 by Western blot analysis Lanes: 1 - protein molecular weight marker, 2 - Anti-his monoclonal antibody (1:20,000), 3 - Hyper immune serum against purified IBDV whole antigens raised in mice (1:2000), 4 - Polyclonal serum from IBDV infected chicken (1:2000).

101

3.1.9 3.1.9.1

Humoral Responses of rVP252-417 in Chickens Antibody titer in chicken

The antibody response in chicken was measured in terms of peak IgY titers. The total IgY raised against recombinant VP252-417 and commercially available IBDV whole virus vaccine strains in chickens were measured by ELISA and was represented as antibody titer. The recombinant VP252-417 elicited potent humoral responses with peak titers of 25,000 in chicks at 42nd day after immunization (Figure 3.8a) while the IBDV vaccines, IV 95 strain and Georgia strain showed peak titers of 16,000 and 18,000, respectively. The rVP252-417 specific IgY level was high compared to both the commercial whole viral vaccines (Figure 3.8b).

3.1.9.2

Reactivity with commercial IBDV strains

The ability of the antisera raised against rVP252-417 to bind the IBDV IV 95 and Georgia vaccine strains was tested by ELISA. The rVP252-417 antisera showed significantly high reactivity (P < 0.0001) against IBDV vaccine strains compared to the control sera even at a very high dilution (1:1000) (Figure 3.9a). Since the IBDV vaccine strains contain the whole virus, this indicates that the antibodies raised against the rVP252-417 binds the IBD virus and shows the similar antigenicity.

102

Figure 3.8 Humoral Responses of rVP252-417 in Chickens (a) Measurement of antibody titer for recombinant protein and
commercial IBDV vaccines in chickens The total IgY induced by the rVP252-417 and IBDV whole virus vaccine strains, at different intervals post immunization in chicken (n=5 per group) was assessed by ELISA. Chickens were immunized with 50 g of recombinant protein in alum or 50 g of commercial IBDV vaccine and blood was collected at different intervals. Serum from the chickens immunized with alum alone was taken as negative control (b) Peak titers induced by the recombinant protein and commercial IBDV vaccines in chickens The peak antibody titers were induced on the 42nd day by all the immunized chickens. Comparison of peak titers shows that the recombinant protein is highly immunogenic. Data represents mean titer of five chickens SEM.

103

Conversely, the reactivity of antisera raised against IBDV vaccine strains with rVP252-417 was also assessed by ELISA. The antisera raised against IBDV vaccine strains showed significantly high reactivity (P < 0.05) with rVP252-417 compared to preimmune sera (Figure 3.9b). This demonstrates that the polyclonal sera of IBDV vaccine carry antibodies against the rVP252417 confirming

the presence of the dominant epitopes in VP252-417.

3.1.9.3

Reactivity with field isolates

To further analyze the reactivity of the antibodies raised against the rVP252-417 with the IBDV antigens, western blotting was carried out with IBDV field isolate antigens prepared from infected chicken using anti-VP2 52417

sera. It was interesting to observe that the rVP252-417 antisera showed

reactivity with VP2 precursor protein, VPX at 54 kDa, indicating that the antibodies recognized the epitopes of native antigen in field isolate (Figure 3.10a). Also, antisera against the IBDV vaccine strains showed reactivity with rVP252-417 showing the 21 kDa band (Figure 3.10b).

104

Figure 3.9 Reactivity with Commercial IBDV Strains

(a) Reactivity of rVP252-417 protein and IBDV vaccine strains with antisera raised against rVP252-417 protein in chicken and (b) Reactivity of rVP252-417 protein with antisera raised against rVP252-417, IV 95 vaccine strain and Georgia vaccine strain in chicken. Absorbance of the recombinant protein with its antisera was taken as positive control. Reactivity of alum control serum was taken as negative control. Data is represented as mean absorbance SEM.

105

Figure 3.10 Reactivity with Field Isolates and Commercial Strains (a) Reactivity of the IBDV strain isolated from infected chickens and
commercial IBDV vaccine- IV 95 vaccine, Georgia vaccine, with polyclonal sera raised against rVP252-417 protein in chickens. After transfer, the blots were incubated with appropriate primary antibody followed by rabbit anti-chicken IgY ALP (1:10,000) and developed with NBT and BCIP. Lanes: 1 - protein molecular weight marker, 2 - IV 95 vaccine strain, 3 - Georgia vaccine strain, 4 - Field isolate IBDV strain. (b) Reactivity of the rVP252-417 with polyclonal sera raised against commercial IBDV vaccines- IV 95 vaccine, Georgia vaccine. Reactivity of the rVP252-417 against its antisera was considered as the positive control. After transfer, the blots were incubated with appropriate corresponding primary antibodies, followed by rabbit anti-chicken IgY ALP (1:10,000) and developed with NBT and BCIP. Lanes: 1 - protein molecular weight marker, 2 - IV 95 vaccine strain antisera, 3 - Georgia vaccine strain antisera , 4 - rVP252-417 antisera.

106

3.1.10

Cellular Response of rVP252-417 To evaluate the presence of possible T cell epitopes recognized in

the SAN chickens, splenocyte proliferation assay was carried out. The cellular response of rVP252-417 to stimulate the spleen lymphocytes of chickens immunized with either rVP252-417 or the commercial IBDV vaccine was studied.

Chicks were primed with rVP252-417 or with IBDV vaccines and spleen cells stimulated in vitro, with rVP252-417 antigen and respective IBDV vaccines. rVP252-417 showed significantly (P < 0.01) high proliferation (mean S.I = 7.21 9.45) with concentrations as low as 10 g/mL in groups immunized with rVP252-417 and IBDV commercial vaccines compared to control (Figure 3.11b and 3.11c). When rVP252-417 primed spleen cells were stimulated with the commercial vaccines, the cells showed significantly (P < 0.01) high proliferation (mean S.I = 6.45 7.55) with a concentration of 50 g/mL in rVP252-417 immunized group compared to control (Figure 3.11a). The study suggests the presence of T cell epitopes in rVP252-417 and thus is capable of inducing a potent cellular response in chicken. The positive control ConA showed proliferation in both control and rVP252-417 immunized chickens.

107

Figure 3.11 Splenocyte Proliferation Assay in Chickens

Splenocyte proliferation of (a) rVP252-417 (b) IV 95 vaccine strain (c) Georgia vaccine strain immunized chickens stimulated with the recombinant protein, vaccines and ConA compared to that of the alum control chickens. The data is represented as mean stimulation index (S.I) of five chickens SEM.

3.1.11

Protection against Virulent IBDV Challenge The BF/BW ratios of chickens vaccinated with rVP252-417 protein

were not different from those of the unvaccinated and unchallenged normal control (group 5) (P> 0.05) but significantly higher than challenged control group (group 4) (P< 0.05). The chickens vaccinated with commercial IBDV strains IV 95 (group 2) and Georgia vaccine (group 3) showed higher BF/BW ratios compared to challenge control group, though the difference was not significant (P> 0.05) (Table 3.4)

Protection of chicken from all the experimental groups against vIBDV challenge was measured by the histological bursal damage scoring

108

system described in Table 3.4 (Rong et al 2005). It shows the bursal damage score for five different groups 10 day after challenge with vIBDV. No chicken in unvaccinated and challenged control group (group 4) was free of infection while the protection of rVP252-417 protein group (group 1) was 100%. The chickens of group 3 and 4, vaccinated with commercial IBDV IV 95 and Georgia vaccines showed ~55% and 60% protection respectively from bursal damage. 75% from group 1 were valued 0 while scoring the histological section. But in groups 3 and 4 only 20% and 25% of chickens respectively showed score 0.

Table 3.4 Protection Efficacy of rVP252-417 Protein Vaccine after Virus Challenge in Immunized Chickens
Group Vaccinea BF/BW ratiob Mortalityc Histopathological BF lesion scoresd Scores 0 ratiose 0 1 2 3 4 5

Protectionf (%)

1 5 7 7 0 0

2 0 5 7 0 0

3 0 3 3 1 0

4 0 1 0 2 0

5 0 0 0 7 0

Avg 0.25 1.5 1.5 4.6 0 15/20 4/20 5/20 0/10 10/10 20/20 = 100 11/20 = 55 12/20 = 60 0/10 = 0 NA

rVP252-417 IV 95 vaccine strain Georgia vaccine strain CC NC

1.1450.15 0.7730.32 0.6980.28 0.5310.18 1.2530.17

0/20 3/20 2/20 10/10 0/10

15 4 5 0 10

a b c d e f

CC: Challenge control, NC: Normal control All groups, except NC (group 5), were challenged with 2104 embryo infective dose (EID50)/ml of standard challenge strain IBDV (vIBDV strain from TANUVAS) by the oral route. BF/BW ratio was calculated by bursal weight 1000 then divided by body weight and presented as the mean SD from each group. Mortality was recorded during 10-day-period after virus challenge and presented as number of dead chickens/total number of chickens in each group. Bursal gross lesions were scored from 0 to 5 based on the severity of bursal involvement at time of euthanasia (0: no lesion, 1: slight change, 2: scattered or partial bursal damage, 3: 50% or less follicle damage, 4: 5175% follicle damage, 5: 76100% bursal damage). Score 0 ratio was calculated by the number of chickens with histopathlogical BF lesion score 0/the number of chickens in the group. Protection was defined by the number of chickens with histopathlogical BF lesion score 0 and 1/the number of chickens in the group.

109

110

3.2

CLONING, IN VIVO EXPRESSION AND IMMUNOPROPHYLACTIC EFFICACY OF VP2 FRAGMENT (VP252-417) AS DNA VACCINE The 366 bp from the N-terminal end of VP2 protein was

subcloned in pVAX1, eukaryotic expression vector. The pVAX-VP252-417 clone was transformed into the high-efficiency plasmid propagation host DH5 strain of E .coli. The large-scale plasmid extraction was carried out using QIAGEN endo-toxin free plasmid purification giga kit as per manufacturers instructions. Prior to immunization, the in vitro and in vivo expression of the DNA vaccines in CHO cell lines and chicken muscle tissue respectively were confirmed by RT-PCR and western blot analysis. The protective efficacy as DNA vaccine pVAX-VP252-417 was evaluated by viral challenge studies in chickens, which showed high protection against IBD.

3.2.1

Sub Cloning of VP252-417 in pVAX1 Vector The VP252-417 was sub cloned in DNA vaccine mammalian

expression vector pVAX1. The VP2 fragment was amplified from pRBVP252417

clone by PCR using gene-specific primers incorporating the restriction

sites for Eco RI in the forward primer and Hind III in the reverse primer. The purified PCR product was digested with the same enzymes and then ligated into the multiple cloning site of pVAX1 vector digested with the same enzymes. The ligation mixture was transformed in to TOP10 strains of E. coli. The positive clones were selected by lysate PCR using gene specific forward and reverse primers. All the positive clones showed amplification of 366 bp size VP252-417 insert DNA (Figure 3.12a).

111

3.2.2

Restriction Digestion Analysis

Plasmid DNA was prepared from the transformants containing positive clones and restriction digestion was carried out for further confirmation of the clones. Double digestion with Eco RI and Hind III showed the products 366 bp insert and the 2.9 kb vector back bone, confirming the presence of Insert (Figure 3.12b). The DNA vaccine vector containing VP252-417 was designated as pVAX-VP252-417, and was sequenced. 3.2.3
In Vitro Expression of the DNA Vaccine Construct in CHO

Cell Line The CHO cell line was used for the transient transfection of DNA vaccine construct of VP252-417 to check the expression. CHO Cells were transiently transfected with pVAX - VP252-417 using lipofectamine reagent. The transfected cells were harvested after 72 hours and the cells were transfected with a positive control plasmid pEGFPN3 which contains green fluorescent protein under CMV promoter (Figure 3.13b). Total RNA was extracted from cells Trizol and converted into cDNA. The cDNA was tested for the presence of pVAX - VP252-417 gene in the transfected CHO cell by PCR with VP252-417 gene specific primers. Figure 3.13a shows the amplification of cDNA from transfected cells with a PCR product of 366 bp with VP252-417 gene-specific primers. The level of GAPDH mRNA (house keeping gene) was used as positive control (Figure 3.13c). Further, to confirm the expression of the encoded antigens, western blot analysis was done with the transfected cell lysate. IBDV-antibody was used to probe the proteins after transfer from polyacrylamide gel to nitrocellulose membrane. The reactivity of protein at the corresponding molecular size confirmed the authenticity of the expressed antigen (Figure 3.13d).

112

Figure 3.12 Cloning of VP252-417 in pVAX1 Plasmid

10 L of the PCR or restriction digestion products were loaded on 1.2% agarose gel, stained with ethidium bromide (0.5 g/mL) and observed in the Gel documentation unit. (a) Screening of transformants by Lysate PCR The 366 bp insert in the pVAX-VP252-417was amplified by PCR using insert specific primers. Lanes: 1- 100 bp DNA molecular weight marker, 2 - Negative control, 3 to 5 Positive Transformant, 6 Positive control (pRBVP252-417) for the PCR. The amplified product is indicated by an arrow. (b) Restriction digestion analysis 2 g of the recombinant plasmid (pVAX-VP252-417) was digested with Hind III and Eco RI and resolved on 1.2% agarose gel. Lanes: 1 - 100 bp DNA molecular weight marker, 2 - Undigested pVAXVP252-417, 3 to 5 Double digested pVAX-VP252-417.

113

Figure 3.13 In Vitro Expression of pVAXVP252-417 Construct in CHO Cell Line

(a) RT-PCR of transfected cells with pVAX-VP252-417 primers. The 366 bp VP252-417was amplified by PCR using insert specific primers. Lanes: 1- 100 bp DNA marker, 2 - cDNA from untransfected cells, 3 - cDNA from pVAX-transfected (vector control), 4 -cDNA from pVAX-VP252-417 transfected cells showing PCR product (~366 bp), 5 - PCR positive control (pVAX- VP252-417 plasmid), 6 - Negative control. CHO cells transfected with positive control plasmid pEGFP showing Green Fluorescence RT-PCR of pVAX-VP252-417 transfected cells with control primers (GAPDH) Lanes: 1- 100 bp DNA molecular weight marker, 2 - Negative control for GAPDH primers, 3 - cDNA with GAPDH primers (positive control), 4 Negative control for VP252-417 primers, 5 - cDNA with VP252-417 primers showing PCR product (366 bp). The amplified products are indicated by arrows. Western blot analysis for in vitro synthesis of DNA encoded VP252-417 in CHO cells Total protein was extracted from the transfected cells after 48 h. Lanes: 1Molecular weight marker, 2 - Total protein from cells transfected with DNA encoding VP252-417, 3 - E.coli expressed rVP252-417, 4 - un-treated cell lysate. Samples were probed with VP252-417 - antibodies.

(b) (c)

(d)

114

3.2.4

In Vivo Expression of the DNA Vaccine Constructs in Chicken

Muscle Tissue

The expression of the antigens at the transcriptional level was also studied in vivo. Intramuscular injection of 100 g of pVAX-VP252-417 was

given at the right pectoral muscle of chicken. RNA was extracted from the injected muscle tissue at three different time points (1d, 14d, 28d and 42d). RT-PCR showed the amplified product at the expected size (366 bp) (Figure 3.14). For 42d post immunization samples, the RT-PCR product was very less compared to other time-points.

Figure 3.14

Expression of the DNA vaccine Constructs in Muscle Tissue

The RNA was extracted from the immunized muscle tissue after 1d, 14d, 28d and 42d and RT-PCR was performed, following treatment with DNAse, using gene specific primers. PCR products were electrophoresed on 1.2% agarose gel. Lane M, 100 bp ladder; Lane 1, negative control (injected with empty vector); Lanes 2, 3 & 4-RTPCR products for 1d, 14d, 28d and 42d time points respectively.

115

3.2.5

Tissue Distribution and Persistence of DNA Vaccine in Immunized Chickens

To determine the fate of the injected plasmid DNA in chicken, a tissue distribution study employing PCR analysis was conducted following a single intramuscular injection (Figure 3.15). In this study two experimental groups were evaluated: one group vaccinated with pVAXVP252-417 and the other, an unvaccinated negative control group. An equal number of tissues from both the groups were processed and analyzed at the same time. Postimmunization, the chickens were sacrificed by administering anesthesia at different time points viz 1 day, 14 days 28 days and 42 days. Different organs like muscle, spleen, kidney, liver, and bursa were isolated and DNA was extracted from these tissues. The DNA from different tissues at different time points was subjected to PCR amplification using VP252-417 primers for studying the distribution of the pVAXVP252-417. The level of expression at different time points were evaluated based on the band intensity of the PCR amplified product

Shortly after intramuscular injection (1 day), pVAXVP252-417 plasmid DNA was detected in all tissues analyzed, suggesting that the DNA vaccine has quick absorption. Majority of the plasmid DNA exists in the injected local muscles for all vaccinated chickens. On post inoculation day (PID) 14, plasmid DNA was detectable in muscle, spleen, kidney, liver, and bursa, but the opposite muscle and kidney samples displayed much weaker positive bands compared to earlier time-points and the other samples. However PID 28, Plasmid DNA was detected only in injected site muscle, spleen, liver, and bursa. The long-term existence of the plasmid DNA in spleen and bursa implies the production of effective immune response in chickens. By PID 42, the DNA was still detected at the site of injection of the birds while all other samples were negative (Table 3.5). All tissues analyzed

116

from the unvaccinated group were found to be free of plasmid as determined by the absence of any amplification products, thereby validating that the tissue collection and PCR analysis was free of contamination.

Table 3.5 In Vivo Tissue Distribution of pVAXVP252-417 Tissue types Muscle Opposite muscle Spleen Kidney Liver Bursa Days after intramuscular inoculation 1 + + + + + + 14 + + + + + + 28 + + + + 42 + -

Figure 3.15 Tissue Distribution Analyses for pVAXVP252-417 DNA in Immunized Chickens
Tissue distribution of the pVAXVP252-417 DNA in the immunized chicken at different time-points by PCR analysis with VP252-417 primers on days 1 (A), 14 (B), 28 (C) and 42 (D) after vaccination. Lane 1 to 6: DNA template from muscle tissue, opposite muscle tissue, spleen, kidney, liver, and bursa respectively. Lane 7: negative control

117

3.2.6

Immune Response Studies of DNA Vaccine (pVAXVP252-417) in Chickens

3.2.6.1

Antibody titer in chicken

Groups of one day old SAN white leghorns were immunized with 100 g of DNA vaccine (pVAXVP252-417 and pVAX) intramuscularly. Four immunizations with one week interval were administered. Blood was collected every two weeks from 0th day till 84th day. Unimmunized chickens were used as control group. The antibody titer was determined by ELISA to determine the level of anti- rVP252-417 IgY in the serum. As shown in Figure 3.16, there were no rVP252-417 specific antibodies generated by the chickens immunized with pVAX vector, while pVAXVP252-417 vaccinated chickens produced specific antibodies against rVP252-417. The antibody titers of the DNA vaccinated chickens were significantly lower than those immunized with recombinant protein (rVP252417).

Antigen specific antibodies in chickens immunized with pVAXVP252-417

DNA vaccine constructs were detectable only after the second immunization. The level of antigen specific antibodies was observed to increase during the course of immunization. The pVAXVP252-417 elicited potent humoral responses with peak titers of 12,000 in chickens at 42nd day after immunization. There was no significant difference in the titer of pVAX immunized chickens and unimmunized chickens. 3.2.6.2 Cellular response of pVAXVP252-417 To evaluate cellular response of pVAXVP252-417 in the SAN chickens, splenocyte proliferation assay was carried out. The cellular response of pVAXVP252-417 immunized chickens spleen lymphocytes, when stimulated with either rVP252-417 or the commercial IBDV vaccine was

118

studied. Chickens primed with pVAXVP252-417 and stimulated in vitro, with rVP252-417 antigen and IBDV vaccines showed significantly (P < 0.01) high proliferation (mean S.I = 11 12.5) with concentrations as low as 10 g/mL compared to chickens primed with pVAX vector (Figure 3.17). There was no significant difference in the splenocyte proliferation of pVAX immunized chickens and unimmunized chickens, when stimulated with different antigens.

3.2.7

Protection Studies of pVAXVP252-417 against Virulent IBDV Challenge The BF/BW ratios of chickens vaccinated with pVAXVP252-417

plasmid were not different from those of the unvaccinated and unchallenged normal control (group 4) (P> 0.05) but significantly higher than challenged group which was vaccinated with pVAX plasmid and unvaccinated control groups. There was no significant difference in the BF/BW ratios of pVAX immunized chickens and unimmunized chickens (Table 3.6)

Protection of chicken from all the experimental groups against vIBDV challenge was measured by the histological bursal damage scoring system described in Table 3.6 (Rong et al 2005). It shows the bursal damage score for five different groups 10 day after challenge with vIBDV. No chicken in groups of pVAX vaccinated and unvaccinated but yet challenged (group 2 and 3 respectively) were free of infection while the protection of pVAXVP252-417 vaccinated (group 1) was 75%. 60% of bursal samples from group 1 were valued 0 while scoring the histological section. But in group 2 and 3 none of the bursal samples showed score 0.

119

Figure 3.16 Measurement of Antibody Titer for Recombinant DNA Vaccine in Chickens
Mean ELISA antibody titer from different groups of birds vaccinated with recombinant DNA vaccine at different time intervals postchallenge.

Figure 3.17 Splenocyte Proliferation Assay in Chicken Immunized with DNA Vaccine
Splenocyte proliferation of pVAXVP252-417 immunized chickens stimulated with the recombinant protein, vaccines and ConA compared to that of the pVAX control chickens. The data is represented as mean stimulation index (S.I) of five chickens SEM.

Table 3.6 Protection Efficacy of rVP252-417 DNA Vaccine after Virus Challenge in Immunized Chickens BF/BW ratiob 1.0560.15 0.4450.14 0..4320.12 1.1530.17 Histopathological BF lesion scoresd 0 2/20 20/20 10/10 0/10 12 0 0 10 1 3 0 0 0 2 3 0 0 0 3 2 2 1 0 4 0 2 2 0 5 Avg 12/20 0/20 0/10 10/10 15/20 =75 0/20 = 0 0/10 = 0 NA Scores 0 ratiose Protectionf (%)

Group 1 2 4 5

Vaccine

Mortality

pVAXVP252-417 pVAX CC NC

0 0.75 16 4.7 7 4.6 0 0

CC: Challenge control, NC: Normal control

a All groups, except NC (group 4), were challenged with 2104 embryo infective dose (EID50)/ml of standard challenge strain IBDV (vIBDV strain from TANUVAS) by the oral route. b BF/BW ratio was calculated by bursal weight 1000 then divided by body weight and presented as the mean SD from each group. c Mortality was recorded during 10-day-period after virus challenge and presented as number of dead chickens/total number of chickens in each group. d Bursal gross lesions were scored from 0 to 5 based on the severity of bursal involvement at time of euthanasia (0: no lesion, 1: slight change, 2: scattered or partial bursal damage, 3: 50% or less follicle damage, 4: 5175% follicle damage, 5: 76100% bursal damage). e Score 0 ratio was calculated by the number of chickens with histopathlogical BF lesion score 0/the number of chickens in the group. f Protection was defined by the number of chickens with histopathlogical BF lesion score 0 and 1/the number of chickens in the group. 120

121 3.3 DEVELOPMENT OF MONOCLONAL ANTIBODIES TO RECOMBINANT VP2 FRAGMENT (rVP252-417) The recombinant VP252-417 was expressed in E. coli GJ1158. The purified VP252-417 protein was used for immunizing homozygous Balb/c female mice and establishment of hybridomas. Hybridomas developed by fusion of mouse myeloma cells, Sp2/o with spleen cells of immunized mice resulted in several antibody secreting clones. The clones were screened for monoclonal antibodies against rVP252-417 by ELISA and those showing high reactivity were selected for diagnostic assays. 3.3.1 Immunization and Antibody Titre For immunization, 50 g of purified recombinant VP252-417 antigen (per mouse) in Freunds complete adjuvant was injected subcutaneously as a primary dose followed by two booster doses in Freunds incomplete adjuvant at a regular interval of 21 days. ELISA was performed to determine the antibody titre every 10th day after booster. The animals were rested for 2 months to ensure that the antibody titer levels, particularly the IgM level drops, shifting the immune system to secrete IgG. A final booster of 250 g in 0.4 ml PBS was injected intraperitoneally 3-4 days prior to fusion. A final serum titer of 30,000 was achieved after the immunization. 3.3.2 Harvest of Myeloma Cells A seeding cell density of 5 104 cells/mL worked was used for Sp2/0 cells. Sp2/0 cells grew to a maximum density of 9 105 cells/mL, with a doubling time of approx. 20 hrs. A total of 1 107 Sp2/0 cells (i.e. 1:5 ratio to immune spleen cells) was used for fusion.

122 3.3.3 Harvest of Mouse Feeder Cells To maximize the yield of hybrids from the fusion and cloning procedures, feeder cells were co-cultured with the hybrids. Mouse peritoneal cells, most of which were macrophages, have been found to be effective feeder cells, providing soluble growth factors for hybridoma cells. Approximately 5-7 106 peritoneal feeder cells were harvested from one

mouse and the above concentration was enough to seed 100 wells (96 well plate) (i.e. 3000-5000 cells/well) for conditioning and for removal of dead cells. 3.3.4 Cell Fusion and Hybrid Yield The fused cells were screened for the hybridomas in HAT selection medium. The plates were observed and screened for clones secreting immunoglobulins. Around 50% of the hybrids were growing to confluency and secreted immunoglobulins (either IgM or IgG). Every such well had at least two hybrid clones. The supernatant from those clones were used for ELISA on plate coated with recombinant VP252-417 (1 g/well). The results showed that 61 clones secreted specific antibodies to recombinant VP252-417. These clones showed an absorbance of more than 0.8 in ELISA (Figure 3.18).

123

Figure 3.18 Primary screening of Hybrids Primary screening of hybrids from 96 well plates to select the clones for further analysis and scale up. 3.3.5 Scale-Up of the Clones The clones secreting antibodies with positive reactivity to recombinant VP252-417 were scaled-up to 1mL culture in 24 well plate at 1X HT and tested again by ELISA after 3-5 days of growth. The results showed that 35 clones secreted specific antibodies to recombinant VP252-417 and the selected clones were further screened with rVP252-417 and partially purified IBDV antigen for reactivity (Figure 3.19). Of these, 10 clones secreted specific antibodies to recombinant and IBDV antigen which were selected for further expansion. The selected hybrids were expanded to 5 ml in culture flasks at 0.5X HT and tested again by ELISA after 3-5 days of growth. The cells were slowly weaned off HT. After 3-4 passages 5 hybrid cells were cloned to monoclonality by the limiting dilution method.

124

Figure 3.19 Secondary Screening of Hybrids from 24 Well Plates Screening of hybrids from 24 well plates to select the clones for further analysis and scale up. 3.3.6 Sub-Cloning: Cloning by Limiting Dilution and Derivation of Stable Clones Cloning by limiting dilution was a standard method based on the Poisson distribution. Dilution of cells to an appropriate number per well maximized the proportion of wells that could contain a single clone. Hybridomas to be cloned were diluted to 1 cell/well. This kind of dilution provides ~ 30-40 % of wells with 1 cell/well as per the poisson statistics. As a standard procedure, hybridoma that yielded > 90 % antibody positive cultures upon recloning was considered to be stable. At the end of this cloning process, the clones were selected and cryopreserved.

125 3.3.7 Selection of Monoclones We screened for stable, high antibody secreting clones which showed good affinity to IBDV antigen and VP252-417 in ELISA which was scaled-up to 1 mL and subsequently to 5 mL culture. Finally, five clones namely 1C7F12, 2C6H2, 3A11A2, 6E6B12 and 8G5C6 were selected (Figure 3.20) and cryopreserved.

Figure 3.20 Screening of the Clones Secreting Monoclonal Antibody for rVP252-417, Partially Purified and Purified IBDV 3.3.8 Characterization of the mAbs To determine the titers and sensitivity of the antibodies, the mAbs were again tested for binding to rVP252-417 antigen in ELISA by varying dilution. The five clones selected were tested in ELISA by varying the dilution of supernatant (Figure 3.21) and for different concentrations of rVP252-417 (Figure 3.22).

126

Figure 3.21 Reactivity of mAbs against rVP252-417 in ELISA The assay data plotted are mean value of triplicates +/- deviations. As per the procedure, the ELISA was performed. The two fold dilution of mAbs supernatant was used as primary antibody.

Figure 3.22 Reactivity of Monoclonal Antibodies against rVP252-417 using ELISA

127 The assay performed with varying concentration of rVP252-417 from 1000 ng to 31.25 ng. The mAbs supernatant was used as primary. 3.3.9 Confirmation of mAbs against rVP252-417 in Western Blot The selected mAbs (1C7F12, 2C6H2, 3A11A2, 6E6B12 and 8G5C6) were further characterized by western blot. The affinity and sensitivity of the clones were again confirmed using the mAbs supernatant as primary antibody against rVP252-417 and rVP2 (Full length VP2) (Figure 3.23).

Figure 3.23 Western Blot Analysis of Hybridoma Culture Supernatant against (a) rVP252-417 and (b) rVP2 (Full length VP2) Lanes 1: Molecular weight marker, 2: 1C7F12 clone, 3: 2C6H2 clone, 4: 6E6B12 clone, 5: 3A11A2 clone, 6: 8G5C6 clone. After sub-cloning, the selected clones (1C7F12, 2C6H2, 3A11A2, 6E6B12 and 8G5C6) were scaled up and found to produce mAb continuously against rVP252-417. Thus it was confirmed that the mAbs 1C7F12, 2C6H2, 3A11A2, 6E6B12 and 8G5C6 were stable and these can be further used for developing suitable kits for detection of IBDV.

128 3.3.10 Isotyping of Monoclones The Isotyping of all five mAbs was carried out by the Rapidotmouse immunoglobulin isotyping kit. All the clones belonged to IgG2b isotype class except clone 6E6B12 which belonged to IgM class isotype. 3.3.11 Affinity of Anti-VP252-417 Monoclonal Antibodies Hybridomas were screened by the differential ELISA to identify wells with high-affinity mAbs, and the selected hybridoma cells were cloned. Affinities of selected mAb clones to VP252-417 protein were measured. The Kd of each mAb was determined by measuring the rate of binding to the antigen at different protein concentrations and was calculated using the equation derived from Scatchard and Klotz (Friguet et al 1985). The result revealed high affinity of 3A11A2 monoclonal antibody to the VP252-417 antigen. The
Kd value of the 3A11A2 monoclonal antibody for VP252-417 was threefold

lower than 1C7F12 and 2C6H2, monoclonal antibodies (Table 3.7). The 6E6B12 and 8G5C6 monoclonal antibodies showed high Kd values and low affinity to VP252-417 antigen. Table 3.7 Affinity of Anti-VP252-417 Monoclonal Antibodies mAb 1C7F12 2C6H2 3A11A2 6E6B12 8G5C6 Isotype IgG2b IgG2b IgG2b IgM IgG2b
Kd (molL-1)

6.32 6.12 2.95 3.4

10-9 10-9 10-7 10-8

2.3 10-9

129 3.3.12 Avidity of Anti-VP252-417 Monoclonal Antibodies Urea wash was given in ELISA to measure the specificity and binding strength of mAbs to their corresponding epitope. Effect of urea treatment was previously described by Binley et al (1997) on the binding of gp120 of HIV type1 with panel of monoclonal antibodies. Result of urea elution showed high avidity index for 3A11A2 with recombinant VP252-417 and moderately high with purified IBDV antigen. Both 1C7F12 and 2C6H2 clones showed intermediate avidity index with recombinant as well as purified IBDV antigen, while other clones showed low avidity index with recombinant as well as purified IBDV whole virus antigen (Table 3.8). VP252417

polyclonal antibodies showed high avidity index for both recombinant and

purified IBDV antigen. Low avidity index of high reactive monoclonal antibodies with recombinant and IBDV antigen may explain the cross reactivity of monoclonal and low affinity immune complexes was eluted with the treatment of mild denaturant (8M Urea). Table 3.8 Avidity Index of mAbs with rVP252-417 and Purified IBDV Antigen mAbs 1C7F12 2C6H2 3A11A2 6E6B12 Isotype IgG2b IgG2b IgG2b IgM Avidity Index percentage (%) rVP252-417 45.4 34.8 69.8 10.5 28.9 74.8 Purified IBDV 31.9 28,5 48 12 10 56.6

8G5C6 IgG2b Mouse Anti- rVP252-417 polyclonal

130 3.4 DEVELOPMENT OF SANDWICH ELISA (ANTIGEN

DETECTION) FOR IBDV DETECTION Sandwich ELISA was standardized for antigen detection with mAbs and polyclonal antibodies in combination as capture antibody and detection antibody for detecting viral antigens. The results showed significantly high detection of rVP252-417compared to control when mAbs were used as capture antibody. Sandwich ELISA prototype for detecting IBDV was developed for field trial. 3.4.1 Optimization of Various Parameters for the Development of Sandwich ELISA Criss cross serial dilution analysis was carried out to determine optimal reagent concentration to be used in the ELISA. All the three reactants in this ELISA namely - a primary solid phase coating reagent, a secondary reagent (rVP252-417, and purified IBDV antigen) that binds to the primary reagent and the second antibody which binds to the secondary reagent were serially diluted and analyzed by criss cross matrix. Sandwich ELISA was standardized for rVP252-417 with mAbs and polyclonal antibodies in combinations using either one as capture antibody and the other as detection antibody to detect antigens. Results showed that mAb can be the better option as capture antibody than rabbit anti VP252-417 polyclonal antibody. Sandwich ELISA was carried out for five mAbs as capture antibody and rabbit anti VP252-417 polyclonal as detection antibody, while 50 ng of rVP252-417 and 1 g of purified IBDV antigen were used as standard and 1 g E.coli protein was used as control. Two mAbs, 3A11A2 and 1C7F12 showed the detection of recombinant and native antigen in sandwich assay and were consequently selected for further standardization, while detection was not significant enough with monoclonal antibodies 2C6H2, 6E6B12 and 8G5C6 (Figure 3.24). Both of

131 mAbs (namely 3A11A2 and 1C7F12) were used in combination to develop the assay which showed promising results for antigen detection than when either mAbs were used as single capture antibody. Purified IBDV antigen showed the same pattern of absorbance in sandwich assay as recombinant antigen (Figure 3.24).

Figure 3.24 Sandwich ELISA with rVP252-417 and Purified IBDV 1 g of VP252-417 mAbs were used as capture antibody and 1:1000 dilution of rabbit anti VP252-417 polyclonal as detection antibody, while 50 ng of rVP252-417 and 1 g of purified IBDV antigen used as standard test antigen. 1 g of E.coli host protein was used as control. Two mAbs 3A11A2 and 1C7F12 showed the detection of recombinant and native antigen in sandwich assay, while other mAbs did not show significant detection. 3.4.2 Sensitivity of the Sandwich ELISA Using Recombinant VP252-417 and Purified IBDV Antigen ELISA was carried out to find out the minimum detectable concentration of purified rVP252-417 and IBDV antigen. A known amount

132 of the purified rVP252-417 antigen starting from 100 ng to 6.25 ng (Figure 3.25) and purified IBDV antigen from 1 g to 62.5 ng was added to normal sera (Figure 3.26). The serum was added to the microtitre plate, which was coated with anti rVP252-417 monoclonal antibody and the assay performed as mentioned above. The E. coli antigen was used as control. It was found that the minimum amount of rVP252-417 antigen that could be detected was 10 ng by ELISA and no reactivity to E. coli antigen was observed even at a higher concentration. IBDV antigen was detected significantly at 125 ng level in capture assay.

Figure 3.25 Capture Assay with Different Amounts of rVP252-417 Antigen

The monoclonal antibodies, mAbs 3A11A2 and 1C7F12, were selected for validating capture assay at 1 g as single and in combinations. The rabbit anti VP252-417 polyclonal antibody was used at the dilution of 1:1000 for detection. The cocktail monoclonal (3A11A2 + 1C7F12) showed better sensitivity compared to the individual

133

Figure 3.26 Capture Assay with Different Amounts of Purified IBDV Antigen The cocktail monoclonal (3A11A2 + 1C7F12) showed better sensitivity compared to the individual purified IBDV antigen. 3.4.3 Determination of the Titers of Anti-VP252-417 Polyclonal Antibodies ELISA plates (96 wells) were coated with 100 ng /well of purified rVP252-417 antigen and 1 g of purified IBDV antigen and direct ELISA was performed. The pre and post immune sera were serially diluted starting from 1:100 to 1:16000. Rabbit anti rVP252-417 sera showed reactivity with the rVP252-417 antigen and purified IBDV antigen. Preimmune control sera showed no reactivity with recombinant antigen as well as purified IBDV (Figure 3.27).

134

Figure 3.27 Reactivity of Rabbit rVP252-417 Polyclonal Antibody 100 ng of rVP252-417 and 1g of purified IBDV antigens were coated on 96 well microtiter plates. The two fold dilution of rabbit anti-rVP252-417 polyclonal serum was used as primary. The assay data plotted are mean value of duplicate + deviations. 3.5 DEVELOPMENT OF RAPID DIPSTICK DIAGNOSTIC ASSAY FOR DETECTION Prototype of dipstick device was developed (Figure 3.28) and assayed. Briefly, the prototype contains a test line of capture rabbit antiVP252-417 polyclonal and a control line with goat-anti mouse IgG on nitro cellulose membrane. The sample adsorbent pad contains detection reagent with colloidal gold conjugated monoclonal anti-VP252-417 antibody

(3A11A2).The IBDV infected processed bursal sample will be drawn in the adsorbent pad and any native antigen present will bind with the colloidal gold conjugated monoclonal and will be carried further across the test and control line. The indication of positive reaction will be seen as two dark magenta coloured lines in test and control regions respectively. The negative reaction

135 will be represented as a single magenta colored line in the control region. Rapid dipstick diagnostic assay for IBDV detection was optimized using rabbit anti-VP252-417 polyclonal and 3A11A2 monoclonal as capture and detection antibody respectively. Purified rVP252-417 and IBDV was used as standard test antigen.

Figure 3.28 Dipstick Prototype Device It contains test and control line with capture rabbit anti-VP252417

polyclonal and goat-anti mouse IgG respectively on nitro

cellulose membrane. The sample adsorbent pad contains colloidal gold conjugated monoclonal anti-VP252-417 antibody (3A11A2) for detection. The test is confirmed positive with two dark magenta coloured lines in test and control regions respectively and negative reaction with a single magenta coloured line in the control region. (a). Dipstick device assembly; (b). Dipstick prototype

136 The minimal detection limit of the dipstick assay, based on the reactivity of dipsticks in samples containing various concentrations of the purified rVP252-417 and IBDV antigen, was 50 ng/mL and 250 ng/mL of sample respectively. Finally IBDV infected bursal samples were tested as a means to develop field-mode-rapid diagnostic prototype as the same with recombinant antigens gave promising sensitivity and specificity. The samples tested in this fashion showed a sensitivity of (60%) and high levels of specificity (100%).

137

CHAPTER 4 DISCUSSION

During the last decade, the proportion of chicken meat in the overall meat market has increased phenomenally because of lower price and a positive health consciousness among consumers. Consumer demand in the area of food safety appears to be for a product without chemicals and without pathogens. Consumers also expect chicken meat to be produced from flocks in which the needs of animal health and welfare have been fulfilled. In this regard, much interest in research has been given to chicken health, focusing on diagnosis and characterization of the infectious pathogens (mainly viruses) and more recently on vaccination strategies. The efficacy of vaccination can be significantly hampered by virus infections affecting the chickens immune system. Among these, IBDV is one of the most important infectious virus. Although first observed about 40 years ago, Gumboro disease continues to pose an important threat to the commercial poultry industry. The control of the disease has unfortunately not been successful till now. The virus causes an acute disease in chickens which leads to high morbidity and mortality in susceptible chickens. In addition, the virus induces immunosuppression which increases the susceptibility of chickens to other pathogens and decreases vaccination efficacy, which is a major disease control measure in this industry. Despite all efforts with improved bio-safety practices and vaccination, the virus is still pandemic. Currently, live attenuated or inactivated whole virus vaccines are widely used in the field.

138

However, there is always a possibility of reversion to virulence in case of live vaccines and accidental wrong inactivation poses a threat of disease incidence in the field. Both these drawbacks can be overcome by the use of highly immunogenic recombinant vaccine, which is safer and more efficacious to control IBD. Selecting appropriate antigens is vital in the design of an effective IBDV vaccine. The complete genome sequence of IBDV and the characterization of most of the structural proteins were helpful in selection of putative vaccine candidates. VP2 protein, containing most of the neutralization sites, is the primary host-protective immunogen of IBDV and has been the target protein for recombinant vaccine studies using a variety of different expression systems (Darteil et al 1995, Tsukamoto et al 1999, Butter et al 2003, Huang et al 2004). In this dissertation the major antigenic protein VP2, has been exploited to develop subunit protein and DNA vaccines for IBDV and also to develop an efficient diagnostic tool to detect IBDV infection in chickens. 4.1 SUBUNIT PROTEIN VACCINE (VP252-417) Recent advances in immunomics have led to the identification of antigenic regions that can be used as subunit vaccines. The present study attempts to circumvent the dual difficulty in culturing virus isolated from clinical samples and amplifying full length VP2 gene with the single plausible option of using immunogenic regions of VP2 for subunit vaccine development. In this study, attempts were made to develop a VP2 subunit vaccine encoding immunodominant regions and study its efficacy in chicken models against viral challenge. Restriction digestion of 366 bp RT-PCR amplicons of capsid gene obtained from IBDV infected bursal samples were subjected to digestion with Bsa I and Bfa I restriction enzymes to confirm the VP2 fragment. The sizes of the restriction fragments, 299 and 67 bp produced

139

by Bsa I digestion and 253 and 113 bp released by Bfa I digestion confirmed the specificity of the RT-PCR reaction. Liu et al (2000) also confirmed the specificity of the IBDV amplicons using digoxigenin-labeled 491bp nested PCR product as probe for in situ hybridization (ISH) to detect and localize IBDV RNA in formalin-fixed, paraffin-embedded Bursae of Fabricius from both experimentally infected as well as commercially reared chickens. The orientation of the 366 bp insert was examined by PCR. The sizes of the amplicons obtained by the combination of T7 forward and insert reverse primers 550 bp and insert forward and T7 reverse primers 433 bp confirmed the orientation. In this way, both orientation and the correct size of the cloned fragment are determined simultaneously (Dooley et al 1993). The BLAST analysis of the 366 bp nucleotide sequence of VP2 gene obtained from IBDV in the present study revealed 9899% homology with other isolates of IBDV reported earlier in the GenBank. Cent percent similarity of the deduced amino acid sequence of 366 bp with other global isolates indicated that the changes at the nucleotide level resulted only in silent mutations. Earlier, Kataria et al (1999) reported a 552 bp RT-PCR amplified product, comprising the complete variable region of the VP2 gene, to be similar to very virulent viruses from European and other Asian countries. The VP2 fragment clone (VP252-417) was further expressed, purified and characterized using T7 expression system. The recombinant VP252-417 was expressed as a fusion protein of 21 kDa with N-terminal histidine tag which was confirmed using anti-his monoclonal antibody as the primary antibody in the western blotting. The expression of proteins in the T7 expression system facilitates an easy one step purification on Ni2+ immobilized columns. Thus the rVP252-417 was purified using Immobilized Metal Affinity Chromatography. SDS-PAGE gel electro-elution method of

140

protein purification could obtain high concentration of purified recombinant protein (Nanni et al 2005). Electro-eluted recombinant 3AB1, a non-structural protein of foot-and mouth disease virus was used to develop an indirect ELISA for differentiating animals infected with foot-and-mouth disease virus (FMDV) from vaccinated animals (Nanni et al 2005). The sensitivity and specificity of the assay was 97.5 and 100 % respectively. Moreover electroeluted method yielded more purified protein than the IMAC. Therefore, purification of rVP252-417 was also carried out using SDS-PAGE gel electroelution. Both the methods yielded high quality purified rVP252-417, which was confirmed through western blot analysis. `The antigenic sites on a protein are fundamental to elicit humoral immune response and can be used as antigens for developing sub unit vaccine (He et al 2004). In the present study, analysis of the deduced amino acid sequence of 366 bp by different epitope prediction softwares revealed four probable epitopes carrying both B and T epitopes involved in eliciting immune response. The reactivity of the recombinant VP252-417 with sera from IBDV infected and vaccinated chickens further suggested that the conserved N-terminal region is immunodominant and gets exposed to the immune system of chickens. A similar strategy has been widely applied for epitopebased vaccines in various viral, bacterial and parasitic diseases which showed potent responses compared to whole protein (Srinivasan et al 2004, Madhumathi et al 2010). The high antibody titre induced by the 122 amino acid of VP2 protein in chickens in our study confirmed its immunogenicity. Mundt et al (2003) has shown that recombinant VP2 protein has protective efficacy on par with the cell cultured attenuated strains and similarly the subunit recombinant VP2 fragment used in our experiments have shown high anti-IBDV titres against commercial vaccine strains.

141

Earlier studies have shown that passive antibodies to VP2 neutralise the IBDV, protecting the chicks from active infection (Fahey et al 1989, Lukert et al 1991, Vakharia et al 1993). An interesting observation by Maw et al (2008) shows that chicks free from IBDV vaccination carried antibodies to neutralise virulent infectious strains through natural harbouring of IBD like virus. Thus the presence of antibodies against VP2 or IBD whole virus could indicate protective response against IBDV infection. In the current study, immunization with recombinant VP252-417 elicited higher antibody titre in SAN chicks compared to whole attenuated viral vaccines and hence could be effective in protection. Since, reactivity of antibodies raised against rVP2 epitope subunit to the field isolate is a requisite for protective humoral response, we analyzed the cross-reactivity of the anti-VP252-417 sera with the whole virus antigens isolated from the infected bursa which showed binding to a 54 kDa protein, representing the VPX- the precursor of full length VP2. Further, the recognition of anti-VP252-417 with the whole virus in the commercially available vaccine strains was analyzed, which showed significantly high reactivity with the IBDV vaccines and vice versa. Similarly, a reverse verification of sera from IBDV virus vaccinated chicks against recombinant VP252-417 also showed significant cross reactivity. Additionally, the observation from splenocyte assays has shown high levels of T cell proliferation confirming the presence of T epitope in rVP252-417 recognized in chicken. This indicates the augmentation of the immune function through cell mediated response, suggesting the multi-epitope nature of the selected VP2 region.

142

Elaborate immune responses have not been studied for IBD virus vaccination in the light of protective epitope search. The present study with the putative VP2 epitope region confirms its immunogenic potential in eliciting active humoral and cell mediated immune responses. Further, the reactivity of anti-VP252-417 sera with whole IBD virus from various sources in addition to high antibody titer shows the presence of immunodominant B cell epitopes encompassing VP252-417 region that confirms the epitope prediction result (Srinivasan et al 2004, Van Regenmortel 2006). The challenge study against vIBDV infection in the immunized chickens showed that the recombinant VP252-417 conferred 100% protection confirming its efficacy as subunit vaccine for IBDV. Surprisingly, the commercial intermediate vaccine strains showed only ~55-60% protection which was significantly lesser than that of recombinant protein. Moreover, only 20-25% of chickens immunized with these vaccines showed score 0 in the histopathological analysis of bursa with an average of 1.5 BF lesion score. This could be explained since the live attenuated IBD vaccine can itself result in bursal damages (Mazariegos et al 1990). Presently, the whole attenuated IBDV is used for field vaccination, which involves strenuous maintenance of virus through passages in selected cultures. Besides, this conventional method carries the possible risk of bursal atrophy and immunosuppression, augmenting the need for better and safer IBD vaccines. A recombinant method of vaccination is more economical, considering the growing demands of poultry consumption in the world. Here, we have shown that the rVP52-417 carrying dominant epitopes is effective in protecting against IBDV infection and thus could be a promising subunit vaccine.

143

4.2

VP2 SUBUNIT DNA VACCINE (VP252-417) The administration of naked nucleic acids into animals is

increasingly being used as a research tool to elucidate mechanisms of gene expression and the role of genes and their cognate proteins in the pathogenesis of disease in animal models. Naked DNA is an attractive non-viral vector because of its inherent simplicity. It can be easily produced in bacteria and manipulated using standard recombinant DNA techniques. It shows very little dissemination and transfection at distant sites following delivery and can be re-administered multiple times into mammals (including primates) without inducing an antibody response against itself (i.e., no anti-DNA antibodies generated). Also, long-term foreign gene expression from naked plasmid DNA (pDNA) is possible even without chromosome integration if the target cell is post-mitotic (as in muscle) or slowly mitotic (as in hepatocytes) and if an immune reaction against the foreign protein is not generated (Wolff et al 1990). Direct injection of plasmid DNA expressing a protein of a pathogen has been observed to be a novel and an effective modality of vaccination (Wolff et al 1990). Immunization with DNA vaccines leads to the uptake of plasmids by host cells and expression of the protein (Wolff et al 1990). The expressed protein has been observed to enter the antigen presenting pathways, resulting in strong and persistent cellular and humoral immune responses. Sometimes the isolation of enough pure protein for

vaccination is time-consuming and in such instances, genetic immunization may be both time and labour-saving in producing antibodies and may offer a unique method for vaccination (Tang et al 1992). DNA based vaccines that induce antigen expression in vivo may ameliorate pitfalls associated with subunit, live and attenuated vaccines.

144

DNA vaccines have been successfully administered to confer protection against bacterial (Cornell et al 1999), viral (Hooper et al 2000)

and parasitic diseases such as Schistosomiasis (Dupre et al 1999) in various animal models. In chickens DNA vaccines have conferred protection against several viral disease like Mareks disease (Tischer et al 2002), Infectious bronchitis (Yang et al 2009) and H5N1 Avian influenza (Rao et al 2008) etc. Direct administration of plasmid DNA encoding an antigen represents an attractive approach to vaccination against infectious diseases, particularly in developing countries where easy-to-handle and cost-effective vaccines are needed. The strong and long-lasting antigen-specific humoral (antibodies) and cell-mediated (T help, other cytokine functions and cytotoxic T cells) immune responses induced by DNA vaccines appear to be due to the sustained in vivo expression of antigen, efficient antigen presentation and the presence of stimulatory CpG motifs. These features are desirable for the development of prophylactic vaccines against numerous infectious agents. Hence, VP52-417 was also cloned into the DNA vaccine vector pVAX1, as described earlier. The recombinant construct pVAX- VP52-417 was purified in large-scale and the transient expression was confirmed in CHO cell lines In order to assess the fate of the injected DNA in the immunized chickens, tissue distribution analysis was performed. The results of this study revealed that immediately after injection, plasmid DNA was distributed throughout multiple tissues of chicken, whereas at later time points DNA persisted mainly within muscle tissue. The finding that plasmid DNA was rapidly detected systemically and later found primarily at the injection site is consistent with other reports of direct introduction of DNA by intramuscular injection of fish (Garver et al 2005) mice (Parker et al 1999) and sheep (Mena et al 2001). Therefore it is likely that the mechanism of plasmid dispersal is

145

similar for chickens and these animals. Studies with vertebrates have indicated that the circulatory system is a possible route for the dispersal of plasmid DNA after intramuscular vaccination (Parker et al 1999; Mena et al 2001). Likewise, the dispersal of DNA plasmids in chickens may well occur via the circulatory system. In our study, plasmid DNA was detected in the various distal tissues, which after injection would have been distributed via the circulatory system. Plasmid DNA persisted in the muscle tissue as long as 42 days; however, no plasmid DNA was detected beyond 28 days after vaccination in all other tissues analyzed with a 10 g of vaccine dose,

suggesting that the plasmid was either absent or below the detection limit. Hulse and Romero (2002) have shown expression of IBDV capsid protein in muscle tissue by using an indirect immunofluorescence assay. The present study indicated that DNA vaccine construct was intact in a wide range of chicken tissues including thymus, spleen, and bursa of Fabricius up to 28 days post-injection. These results demonstrate that plasmid DNA injected directly into the pectoral muscle of chickens is transcribed and translated at the injection site and promptly distributed to primary and secondary lymphoid tissues. Expression of the DNA encoded antigens was confirmed in chicken muscle near the site of injection at different time-points up to 42 days by RT-PCR,. However it is not clear from these data whether protein is readily accessible to antigen-presenting cells after synthesis and makes transfected cells as targets for destruction by phagocytic cells. Further immune-histochemical analyses are required to elucidate the mechanism activated by the DNA encoded antigen. The plasmid DNA, was not only immediately distributed to multiple tissues, but was persistent for a long period. In contrast, in the case of DNA vaccination in fishes the injected DNA usually gets rapidly cleared from the peripheral sites and is only retained in

146

muscle tissue (Garver et al 2005). The absence of histopathologic changes at the 42-day time point is a positive indication for the safety of this vaccine in chickens. The humoral and cellular responses elicited against the DNA construct of pVAX- VP52-417 was carried out in the immunized chicken to analyze the immunogenicity of the vaccine construct. Since DNA vaccines are intracellular antigens known to elicit higher Th1 responses and poor Th2 responses, the antibody responses elicited by pVAX VP52-417 was lesser compared to protein vaccine. However, the T cell responses were significantly high as expected which is highly essential for viral infection. In order to evaluate the prophylactic efficacy of the DNA vaccine, viral challenge study was performed in immunized and unimmunized chickens. The results showed a promising 75% protection for pVAX VP52-417 indicating a potential use for the DNA vaccine construct. In comparison, the protein vaccine showed 100% protection which proves clearly that the protein vaccine is more efficient than the DNA vaccine. However, DNA vaccine has other advantages like ease and lower cost of production, ease in transport and storage due to long term stability. Additionally, DNA vaccines elicit potent T cell responses needed for memory response and viral clearance. 4.3 DEVELOPMENT OF VP2 MONOCLONAL ANTIBODIES FOR ANTIGEN DETECTION With the mutations of infectious bursal disease virus, the new variant strains and subtypes come out ceaselessly. Hence an ongoing research is required in the prevention and control of IBD. The laboratory diagnoses of the suspected IBD specimens are very crucial to accurately grasp the epidemic situation of IBDV and develop effective precautionary measures. As for the diagnosis of IBDV, the infected bursa samples should be collected in

147

the epidemic areas, and then transported to the specialized laboratories for diagnosis. There is a wide lacuna for IBD diagnosis in developing countries owing to ambiguity resulting from transportation of putrid specimens, false negative tests from improper preservation of the specimens etc., However, among the current diagnostic methods of IBDV, the methods such as virus isolation, neutralization tests, indirect ELISA, RT-PCR, etc. must be completed in the laboratories on certain conditions. Moreover, with a current scenario of grass-roots inspection institutions devoid of advanced detecting equipments and specialized technical personnel along with vast livestock and poultry farms in India, creates a greater need for developing rapid and simple diagnostic methods, which can be operated on the wild and field without professionals and equipments. Because binding of an antibody to an antigen is dependent on the recognition of specific amino acid epitopes by the antibody, in this regard mAbs technology has facilitated the development of sensitive and specific tests for the detection of many microbial and viral antigens in clinical specimens. Several immunological techniques that incorporate the use of mAbs have been described, including ELISA (Czeruy and Eichhorn, 1989; McNulty et al 1984), IFA, and fluorescent-antibody assay (Heckert et al 1990), immune-histochemical staining of fixed tissues (Unicom et al 1989), and immune-blot assays (Herbrink et al 1982). In this study, an attempt was made to develop a monoclonal antibody based diagnostic test for IBDV detection. Monoclonal antibodies were developed for an immunodominant region of IBDV capsid protein VP2 (VP252-417). A serological test (Sandwich ELISA) was carried out using these mAbs which assessed the detection sensitivities of purified IBDV and IBDV-infected bursal tissues.

148

The results showed that the antigen preparations containing the expressed VP252-417 of IBDV capsid protein could induce the production of mAbs. After screening and sub-cloning, the five mAbs directed against VP252417

were isolated and characterized by analyzing the reactivity with

recombinant VP252-417 and purified IBDV, affinity and avidity to recombinant antigen. All the five mAbs were able to react with recombinant VP252-417 and purified IBDV in indirect ELISA under denaturing conditions. Further all of them showed reactivity with recombinant VP252-417 in western blot indicating that the recognized epitopes were not affected by the denatured protein. The mAbs also bound the full length recombinant VP2 in western blot which extend their capacity for detecting IBDV. It is vital to detect IBDV antigen in the infected bursal at low concentration to identify active IBDV infection, which needs high affinity of the mAbs towards antigen. Indirect ELISA was used for studying the association-dissociation equilibrium between a monoclonal antibody and the corresponding antigen, and to measure the concentration of free antibody at equilibrium, that gave reliable values of the real dissociation (or affinity) constants of the system in solution. Because of the very high sensitivity of the indirect ELISA, it was possible to measure very small concentrations of free antibodies. This gave easy access to dissociation constants as low as about 109

M. Three of the mAbs 3A11A2, 1C7F12 and 2C6H2 showed high affinity

towards the rVP252-417 with dissociation constants about 10-9 M, thus specific to IBDV with minimal cross-reactivity. While affinity is an absolute thermodynamic measure of the strength of interaction determined at equilibrium, avidity can be defined as a more relative measure of the strength of interaction which is a function of antigenic valence and structure, antibody bivalence, the concentrations of antibody and antigen, and affinity. Affinity of polyclonal antisera cannot be determined, but relative avidity of polyclonal antisera can be estimated by using so-called avidity ELISAs in which the

149

ability of chaotropic agents (such as urea) to disrupt antigen antibody interactions is determined (Binley et al 1997 (a); Gray et al 1993; Richmond et al 1998). Urea displacement ELISAs demonstrated that the avidity of the mAbs towards the rVP252-417 and purified IBDV which showed mAb 3A11A2 with high avidity index of 69.8% and 48% respectively, while the mAbs 6E6B12 and 8G5C6 showed very less avidity index. It is possible that the marked difference in antibody responses elicited by immunization of antigen reflect fundamental differences in the epitopes present in them and their interaction with the immune system. The lower avidity index of the two monoclonal antibodies could be due to the difference in the binding sites. Two of the monoclonal antibodies, namely 3A11A2 and 1C7F12 showed better reactivity with recombinant and purified IBDV antigen with higher affinity and avidity to recombinant antigen. These mAbs were thus used for validating capture assay as individual antibody and in combination. The assay showed higher sensitivity when mAbs were used in combination. The two mAbs recognize two different epitopes in rVP252-417 protein, leading to synergistic binding that allows a more stable antigen-antibody interaction and shows higher sensitivity in combination. Further these two mAbs were of IgG2 class. As the affinity to the antigen of IgG is higher than that of the IgM antibody, this suggests that these mAbs can be used widely for serological tests. 4.4 DEVELOPMENT OF PROTOTYPE ANTIGEN BASED IMMUNO-DIAGNOSTICS DISEASE Infectious bursal disease has been a great concern for the poultry industry for a long time, but particularly for the past decade. Indeed, its reemergence in variant or highly virulent forms has been the cause of significant economic losses (Van den Berg et al 2000). Rapid diagnostic FOR INFECTIOUS BURSAL

150

procedures are essential and emphasized for early detection, proper surveillance and eradication of the disease. An immunological assay like indirect ELISA has been used to detect IBDV specific antibodies in chicken serum (Howie and Thorsen, 1982). Commercially available ELISA kits for antibodies to IBDV strains detect antibodies to both serotypes 1 and 2 in addition to all the known subtypes of serotype 1 viruses (Ismail and Saif, 1990). Identification of antibodies to different antigenic subtypes of IBDV is currently possible only by the VN assay (Jackwood and Saif, 1987). Thus, an immune response to antigenic variants of IBDV cannot be distinguished from an immune response to other antigenic types of IBDV or serotype 2 viruses with ELISA kits. Jackwood et al (1990) showed that recombinant VP2 based ELISA appeared to be more sensitive than the commercial ELISA kits in detecting antibodies to the IBDV. The antibody assays based on recombinant VP2 have shown improved sensitivity and specificity, than that based on purified IBDV antigen (Singh et al 1997). Antibody assays using recombinant VP2, were evaluated in a multi-centre trial (Martnez-Torrecuadrada et al 2000, Dey et al 2009). However, the specificity of the tests has been reported to be a great concern since they cannot distinguish current infection from past infection or exposure to the IBDV. Hence, there is a need to develop effective diagnostics for detection of active infections by IBDV. In the present study, monoclonal antibodies against the rVP252-417 have been used to develop a sandwich ELISA to detect IBDV antigen in chicken. Capture assay was developed with rVP252-417 monoclonal as capture antibody and rabbit anti-rVP252-417 polyclonal as detection antibody and validated against recombinant as well as purified IBDV antigen. The assay showed high sensitivity. Rapid dipstick diagnostic assay for the rapid detection of IBDV antigen was optimized using 3A11A2 and 1C7F12 monoclonal antibodies as capture and detection antibody and pure rVP252-417 protein was used as standard test antigen. IBDV

151

positive samples were tested as a means to develop field-mode-rapid diagnostic prototype which showed the promising sensitivity and specificity. The samples tested in this fashion showed a moderate sensitivity of 60% and 100% specificity. An extensive on-the-field trials (with samples procured and tested immediately) in the future could enhance sensitivity and remedy existing limitation when fresh samples are used.

152

CHAPTER 5 CONCLUSION

5.1

CHARACTERIZATION OF RECOMBINANT VP252-417 AND IMMUNE RESPONSE STUDIES IN CHICKEN The fragment of IBDV capsid protein VP2 (VP252-417) carrying putative immunodominant epitopes was cloned and expressed in
E. coli. The recombinant VP252-417 was purified using gel elution

and IMAC. The immune responses of rVP252-417 were compared with two of the attenuated IBDV commercial vaccines. The humoral immune responses showed that immunization with recombinant rVP252-417 elicited higher antibody titre in SAN chicks compared to whole attenuated viral vaccines. In the direct binding assay, anti-VP252-417 showed significantly high reactivity with the whole virus in the commercially available IBDV vaccine strains. Similarly, a reverse verification of sera from IBDV virus vaccinated chicks against recombinant VP252-417 also showed significant cross reactivity. The cellular immune responses based on proliferation data showed high levels of T cell proliferation confirming the presence of T epitope in rVP252-417 recognized in chicken. The challenge study against vIBDV infection in the immunized chickens showed that the recombinant VP252-417 conferred 100% protection confirming its efficacy as subunit vaccine for IBDV.

153

5.2

CHARACTERIZATION OF RECOMBINANT VP252-417 AS DNA VACCINE The efficacy of VP252-417 as DNA vaccine was studied by sub cloning the VP2 fragment in DNA vaccine vector pVAX1. The recombinant construct pVAX- VP52-417 was purified in largescale and the transient expression was confirmed in CHO cell lines. Tissue distribution analysis was performed to assess the fate of the injected DNA in the immunized chickens, which revealed that immediately after injection, plasmid DNA was distributed throughout multiple tissues of chicken, whereas at later time points DNA persisted mainly within muscle tissue. The humoral responses of pVAXVP252-417 immunized chickens was significantly higher compared to the pVAX vector immunized chickens but lesser compared to the rVP252-417 protein immunized chickens. The cellular immune response for pVAXVP252-417 was significantly higher compared to the pVAX immunized chickens. In the viral challenging studies pVAXVP52-417 showed a promising 75% protection indicating a potential use for the DNA vaccine construct.

5.3

DEVELOPMENT OF MONOCLONAL ANTIBODY FOR THE DETECTION OF IBDV Monoclonal antibodies were developed for an immunodominant region of IBDV capsid protein VP2 (VP252-417). All monoclonal hybridoma clones were screened against rVP252-417 as well as

154

purified

IBDV.

Five

mAbs

were

selected

for

the

characterization. In the isotyping ELISA it was found that all the sclones belonged to IgG2b class except clone 6E6B12 which belonged to IgM class isotype. Three of the mAbs 3A11A2, 1C7F12 and 2C6H2 showed high affinity towards the rVP252-417 with dissociation constants of about 10-9 M, thus being specific to IBDV with minimal cross-reactivity. Urea displacement ELISAs demonstrated that the mAb 3A11A2 towards rVP252-417 and purified IBDV showed high avidity index of 69.8% and 48% respectively, while the mAbs 6E6B12 and 8G5C6 showed very less avidity index. Sandwich assay was developed with VP252-417 monoclonal as capture antibody and anti-VP252-417 polyclonal as detection antibody. The response of sandwich ELISA was tested with rVP252-417 and purified IBDV. The minimal detection limit of the sandwich assay, based on the reactivity of samples containing various concentrations of the rVP252-417 and IBDV antigen, was 50 ng/mL and 250 ng/mL respectively. The dipstick was tested with IBDV positive samples and showed 60% sensitivity and 100% specificity.

155

5.4 5.4.1

FUTURE DIRECTIONS Part I Bimodal Vaccine (Combination of rVP252-417 and pVAXVP252-417) The current study has shown that rVP252-417 and pVAXVP252-417 are effective protein and DNA vaccines conferring protection of 100% and 75% respectively. Further, the protection efficacy of the DNA vaccine can be enhanced by bimodal vaccine strategy with a booster of protein vaccine rVP252-417 making it both long lasting and efficacious. Also, dominant epitopes from other antigens like VP3 can be combined with VP2 to make it multi-antigen targeted approach.

5.4.2

Part II Development of monoclonal antibody using immunodominant region of VP3 The mAbs developed using rVP252-417 showed high efficiency in detecting IBDV. Therefore developing monoclonal antibody using immunodominant region of IBDV capsid protein VP3 can further enhance the detection of IBDV.

156

APPENDIX 1 GENOTYPES OF BACTERIAL STRAINS

S. No Strain
E. coli DH5

Description

Genotype
-

Uses

1.

F endA1 glnV44 thi-1 An Hoffman-Berling 1100 recA1 relA1 gyrA96 deoR strain derivative Plasmid nupG 80dlacZ M15 (Meselson68) . Nalidixic maintenance (lacZYA-argF )U169, acid resistant hsdR17(rK- mK+),
E. coli B strain with DE3, a prophage (lysogen) carrying the T7 RNA polymerase gene under control of lacUV5 promoter and lacIq gene

2.

E. coli BL21 (DE3)

F ompT gal dcm lon hsdSB(rB- mB-) (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

IPTGinduced high level expression

3.

E. coli BL21 (DE3) plysS

Carries pLysS plasmid encoding T7 phage lysozyme, an inhibitor for F- ompT gal dcm lon T7 polymerase which hsdSB(rB- mB-) (DE3) reduces expression and pLysS(cmR) provides tighter control of protein expression. Chloramphenicol resistant ompT hsdS gal dcm T7 RNA polymerase gene malAp510 malP::(proUpunder salt inducible pro U T7 RNAP) alQ::lacZhyb11 promoter (zhf-900::Tn10dTet

IPTGinduced controlled expression

4.

E. coli GJ1158

Salt (NaCl) induced high level expression of soluble proteins

157

APPENDIX 2 VECTOR MAP OF pRSET

158

APPENDIX 3 VECTOR MAP OF pVAX1

159

REFERENCES

1.

Abdel-Alim G.A. and Saif Y.M. Detection and persistence of infectious bursal disease virus in specific-pathogen-free and commercial broiler chickens, Avian Dis., Vol.45, pp.646-654, 2001. Aini H. Hairul, Omar A.R., Hair-Bejo M. and Aini I Green I. Comparison of Sybr ELISA and conventional agarose gel-based PCR in the detection of infectious bursal disease virus, Vol. 163, No. 5, pp. 556-563, 2008. Ajinkya S.M., Survashe B.D. and Sardeshpande P.D. Breakdown in immunity to Ranikhet disease (Newcastle disease) with infectious bursal disease (Gumboro disease) in broiler chicks. Indian Vet. J., Vol.57, pp. 265-269, 1980. Akin Aydemir, Wu Ching Ching and Lin Tsang Long A comparison of two RNA isolation methods for double-stranded RNA of infectious bursal disease virus, Journal of Virological Methods, Vol.74, No.2, pp.179-184, 1998. Alexander, D.J., Chettle, N.J., Heat inactivation of serotype 1 infectious bursal disease virus. Avian Pathol., Vol.27, pp. 97-99, 1998. Allan G.M., McNulty M.S., Connor T.J., McCracken R.M. and McFerran J.B. Rapid diagnosis of infectious bursal disease infection by immunofluorescence on clinical material, Avian Pathol. Vol.13, No.3, pp.419-427, 1984. Altschul S.F., Gish W., Miller W., Myers E.W. and Lipman D.J. Basic local alignment search tool, Journal of Molecular Biology, Vol. 215, pp. 403-410, 1990. Amakye-Anim J., Lin T.L., Hester P.Y., Thiagarajan D., Watkins B.A. and Wu C.C. Ascorbic acid supplementation improved antibody response to infectious bursal disease vaccination in chickens, Poult Sci., Vol.79, No.5, pp.680-688, 2000.

2.

3.

4.

5.

6.

7.

8.

160

9.

Anil T.M., Shankar K.M. and Mohan C.V., Monoclonal antibodies developed for sensitive detection and comparison of white spot syndrome virus isolates in India, Diseases of Aquatic Organisms, Vol.51, pp. 67-75, 2002. Ather M. A. Infectious bursal disease in chicken, Poult, Advisor., Vol.26, No.12, pp.27-30, 1993. Azad A. A., Jagadish M. N., Brown M. A. and Hudson P. J. Deletion mapping and expression in Escherichia coli of the large genomic segment of a birnavirus, Virology, Vol.161, pp. 145-152, 1987. Azad A. A., McKern N. M., Macreadie I. G., Failla P., Heine H. G., Chapman A., Ward C. W. and Fahey K. J. Physicochemical and immunological characterization of recombinant host-protective antigen (VP2) of infectious bursal disease virus,. Vaccine, Vol.9, pp. 715-722, 1991. Azad A.A., Jagadish M.N., Brown M.A. and Hudson P.J. Deletion mapping and expression in Escherichia coli of the large genomic segment of a birnavirus, Virology, Vol.161, No.1, pp. 145-152, 1987. Baskar L. K., Srikanth T. R., Suba S., Mody H. C., Desai P. K. and Kaliraj P. Development and evaluation of a rapid flow through immunofiltration test using recombinant filarial antigen for diagnosis of brugian and bancroftian Filariasis, Microbiol. Immunol., Vol. 48, No. 7, pp. 519-525, 2004. Bayliss C.D., Peters R.W., Cook J.K., Reece R.L., Howes K., Binns M.M. and Boursnell M.E., A recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease virus induces protection against mortality caused by the virus. Arch. Virol., Vol.120, pp. 193-205, 1991. Becht H. Infectious bursal disease virus, Curr Top Microbiol Immunol., Vol.90, pp.107-121, 1980. Becht H., Muller H. and Muller H. K. Comparative studies on structural and antigenic properties of two serotypes of infectious bursal disease virus. J. Gen. Virol., Vol.69, pp. 631-640, 1988. Benton W.J., Cover, M. S. and Rosenberger J. K. Studies on the transmission of the infectious bursal agent (IBA) of chickens. Avian Dis., Vol.11, pp. 430-438, 1967.

10.

11.

12.

13.

14.

15.

16.

17.

18.

161

19.

Bhandari P. and Gowrishankar J. An Escherichia coli host strain useful for efficient overproduction of cloned gene products with NaCl as the inducer, J. Bacteriol., Vol. 179, No.13, pp.4403-4406, 1997. Biao Qian and Frederick S.B. Kibenge Observations on polymerase chain reaction amplification of infectious bursal disease virus dsRNA, Journal of Virological Methods, Vol.47, No.1-2, pp.237-242, 1994. Binley J.M., Arshad H., Fouts T.R. and Moore J.P. An Investigation of the High-Avidity Antibody Response to Glycoprotein 120 of Human Immunodeficiency Virus Type 1, AIDS Research and Human Retroviruses, Vol. 13, No. 12, 1997. Birghan C., Mundt E. and Gorbalenya A.E. Anon-canonical lon proteinase lacking the ATPase domain employs the ser-Lys catalytic dyad to exercise broad control over the life cycle of a double stranded RNA virus. EMBO J. Vol.19, pp. 114-123, 2000. Birnboim H.C. and Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA, Nucleic Acids Research, Vol. 7, pp. 1513-1523, 1979. Boonchit S., Xuan X., Yokoyama N., Goff W.L., Waghela S.D., Wagner G. and Igarashi I., Improved enzyme-linked immunosorbent assay using C-terminal truncated recombinant antigens of Babesia bovis rhoptry-associated protein-1 for detection of specific antibodies, Journal of Clinical Microbiology, Vol. 42, pp. 1601-1604, 2004. Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Analytical Biochemistry, Vol. 72, pp. 248-254, 1976. Brown F. The classification and nomenclature of viruses. Intervirology, Vol.25, pp. 141-143, 1986. Burkhardt E. and Muller H. Susceptibility of chicken blood lymphoblasts and monocytes to infectious bursal disease virus (IBDV), Arch Virol., Vol.94, No.3-4, pp. 297-303, 1987. Butter C., Sturman T.D., Baaten B.J. and Davison T.F. Protection from infectious bursal disease virus (IBDV)-induced immunosuppression by immunization with a fowlpox recombinant containing IBDVVP2, Avian Pathol., Vol.32, pp. 597-604, 2003.

20.

21.

22.

23.

24.

25.

26.

27.

28.

162

29.

Cao Y.C., Shi Q.C., Ma J.Y., Xie Q.M. and Bi Y.Z. Vaccination against very virulent infectious bursal disease virus using recombinant T4 bacteriophage displaying viral protein VP2, Acta Biochim Biophys Sin (Shanghai), Vol.37, No.10, pp.657-664, 2005. Cardoso T.C., Rahal P., Pilz D., Teixeira M.C.B. and Arns C.W. Replication of classical infectious bursal disease virus in the chicken. embryo related cell line, Avian Pathol., Vol.29, pp.213-217, 2000. Caston J.R. C terminus of infectious bursal disease virus major capsid protein VP2 is involved in definition of the T number for capsid assembly. J Virol., Vol.75, pp. 10815-10828, 2001. Caterina Kristen M., Salvatore Frasca Jr, Girshick Theodore and Khan Mazhar I. Development of a multiplex PCR for detection of avian adenovirus, avian reovirus, infectious bursal disease virus, and chicken anemia virus, Molecular and Cellular Probes, Vol.18, No.5, pp.293-298, 2004. Chai Y.F., Christensen N.H., Wilks C.R. and Meers J. Characterisation of New Zealand isolates of infectious bursal disease virus. Arch. Virol., Vol.146, pp. 1571-1580, 2001. Chang H.C., Lin T.L. and Wu C.C. DNA vaccination with plasmids containing various fragments of large segment genome of infectious bursal disease virus, Vaccine, Vol.21, pp. 507-513, 2003. Chang H.C., Lin T.L. and Wu C.C. DNA-mediated vaccination against infectious bursal disease in chickens. Vaccine, Vol.20, No.3-4, pp.328-335, 2001. Chauhan H.V.S., Jha G.J., Singh U.P. and Thakur N. Outbreaks of infectious bursal disease (Gumboro disease) in poultry (First report in Bihar state), Indian J. Poult. Sci., Vol.15, pp. 253-258, 1980. Chettle N., Stuart J.C. and Wyeth P.J. Outbreak of virulent infectious bursal disease in East Anglia. Vet Rec., Vol.125, No.10, pp. 271-272, 1989. Chevalier C., Lepault J., Erk I., Da Costa B. and Delmas B., The maturation process of pVP2 requires assembly of infectious bursal disease virus capsids, J. Virol., Vol.76, pp. 2384-2392, 2002.

30.

31.

32.

33.

34.

35.

36.

37.

38.

163

39.

Cho Y. and Edgar S.A. Characterization of the infectious bursal agent. Poultry Science, Vol.48, pp.2102-2109, 1969. Cornell K.A., Bouwer H. G., Hinrichs D. J. and Barry R. A., Genetic immunization of mice against Listeria monocytogenes using plasmid DNA encoding listeriolysin O, The Journal of Immunology, Vol. 163, pp. 322-329, 1999. Cosgrove S. D., An apparently new disease of chickensavian nephrosis, Avian Dis., Vol.6, pp. 385-389, 1962. Coulibaly F., Chevalier C., Gutsche I., Pous J., Navaza J., Bressanelli S., Delmas B. and Rey F.A. The birnavirus crystal structure reveals structural relationships among icosahedral viruses, Cell, Vol.120, pp. 761-772, 2005. Crowe J., Masone B.S. and Ribbe J. One-step purification of recombinant proteins with the 6xHis tag and Ni-NTA resin, Mol. Biotechnol., Vol. 4, No. 3, pp. 247-258, 1995. Cruz-Coy J.S., Giambrone J.J. and Hoerr F.J. Immunohistochemical detection of infectious bursal disease virus in formalin-fixed, paraffinembedded chicken tissues using monoclonal antibody, Avian Dis., Vol.37, No.2, pp.577-581, 1993. Cruz-Coy J.S., Giambrone J.J. and Panangala V.S. Production and characterization of monoclonal antibodies against variant A infectious bursal disease virus, Avian Is., Vol. 37, No.2, pp.406-411, 1993. Czeruy C. P. and Eichhorn W. Characterization of monoclonal and polyclonal antibodies to bovine enteric coronavirus: establishment of an efficient ELISA for antigen detection in feces, Vet. Microbiol., Vol.20, pp. 111-122, 1989. Daniel Luque, German Rivas, Carlos Alfonso, Jose L. Carrascosa, Jose F. Rodrguez and Jose R. Caston. Infectious bursal disease virus is an icosahedral polyploid dsRNA virus. PNAS, Vol. 106, No. 7, pp. 2148-2152, 2009.

40.

41.

42.

43.

44.

45.

46.

47.

164

48.

Daniel Luque, Irene Saugar, Jose F. Rodr guez, Nuria Verdaguer, Damia Garriga, Carmen San Martin, Javier A. Velazquez-Muriel, Benes L. Trus, Jose L. Carrascosa, and Jose R. Caston Infectious Bursal Disease Virus Capsid Assembly and Maturation by Structural Rearrangements of a Transient Molecular Switch, Journal of Virology, pp. 6869-6878, 2007. Darteil R., Bublot M., Laplace E., Bouquet J.F., Audonnet J.C. and Riviere, M., Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce protection against an IBDV virulent challenge in chickens, Virology, Vol.211, pp. 481-490, 1995. Davis V.S. and Boyle J.A. Random cDNA probes to infectious bursal disease virus, Avian Dis., Vol.34, No.2, pp.329-335, 1990. Deng X.Y., Gao Y.L., Gao H.L., Qi X.L., Wang X.Y. and Wang X.M. Identification of VP3 antigenic epitopes of infectious bursal disease virus, Bing Du Xue Bao., Vol.23, No.4, pp.305-311, 2007. Dey S., Upadhyay C., Mohan C.M., Kataria J.M. and Vakharia, V.N., Formation of sub-viral particles of the capsid protein VP2 of infectious bursal disease virus and its application for serological diagnosis, J. Virol. Methods, Vol.157, pp. 84-89, 2009. Dobos P., Hill B. J., Hallett R., Kells D. T. C., Becht H. and Teninges D. Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded RNA genomes. J. Virol., Vol.32, pp. 593-605, 1979. Dolz R., Maj N., Ordez G. and Porta R. Viral genotyping of infectious bursal disease viruses isolated from the 2002 acute outbreak in Spain and comparison with previous isolates, Avian Dis., Vol. 49, No.3, pp.332-339, 2005. Dooley S., Seib T., Engel M. and Welter C. A rapid method to determine the orientation of blunt end ligated polymerase chain reaction products, Electrophoresis, Vol. 14, pp. 662-663, 1993. Dupre Herv M., Schacht A. M., Capron A. and Riveau G., Control of schistosomiasis pathology by combination of Sm28GST DNA immunization and praziquantel treatment, The Journal of Infectious Diseases, Vol.180, pp. 454-463, 1999.

49.

50.

51.

52.

53.

54.

55.

56.

165

57.

Dybing J.K. and Jackwood D.J., Antigenic and immunogenic properties of baculovirus-expressed infectious bursal disease viral proteins, Avian Dis., Vol.42, pp. 80-91, 1998. Elankumaran S., Heckert R.A. and Moura L. Pathogenesis and tissue distribution of a variant strain of infectious bursal disease virus in commercial broiler chickens, Avian Dis., Vol.46, No.1, pp.169-176, 2002. Eleuterio Lombardo, Antonio Maraver, Jose R. Caston, Jose Rivera, Armando Fernandez-Arias, Antonio Serrano, Jose L Carrascosa, and Jose F Rodriguez, VP1, the Putative RNA-Dependent RNA polymerase of Infectious Bursal Disease Virus, Forms Complexes with the Capsid Protein VP3, Leading to Efficient Encapsidation into VirusLike Particles. Journal of virology, pp. 6973-6983, 1999. Eterradossi N., Arnauld C., Toquin D. and Rivallan G. Critical amino acid changes in VP2 variable domain are associated with typical and atypical antigenicity in very virulent infectious bursal disease viruses, Arch. Virol. Vol.143, pp. 1627-1636, 1998. Eterradossi N., Rivallan G., Toquin D. and Guittet M. Limited antigenic variation among recent infectious bursal disease virus isolates from France, Arch. Virol., Vol.142, pp. 2079-2087, 1997. Eterradossi N., Toquin D., Abbassi H., Rivallan G., Cotte J.P. and Guittet M., Passive protection of specific pathogen free chicks against infectious bursal disease by in-ovo injection of semi-purified egg-yolk antiviral immunoglobulins, Zentralbl Veterinarmed B., Vol.44, No.6, pp. 371-383, 1997. Fahey K. J., Erny K. and Crooks J. A conformational immunogen on VP-2 of infectious bursal disease virus that induces virus-neutralizing antibodies that passively protect chickens. J. Gen. Virol., Vol.70, pp. 1473-1481, 1989.

58.

59.

60.

61.

62.

63.

166

64.

Fahey K.J., Chapman A.J., Macreadie I.G., Vaughan P.R., McKern N.M., Skicko J.I., Ward C.W. and Azad A.A. A recombinant subunit vaccine that protects progeny chickens from infectious bursal disease, Avian Pathol., Vol.20, No.3, pp. 447-460, 1991. Fahey K.J., O'Donnell I.J. and Bagust T.J. Antibody to the 32K structural protein of infectious bursal disease virus neutralizes viral infectivity in vitro and confers protection on young chickens, J Gen Virol., Vol.66, No.Pt 12, pp. 2693-702, 1985. Faragher J.T. Infectious bursal disease in chickens, Vet. Bull., Vol.42, pp.361- 369, 1972. Fodor I., Horvth E., Fodor N., Nagy E., Rencendorsh A., Vakharia V.N. and Dube S.K. Induction of protective immunity in chickens immunised with plasmid DNA encoding infectious bursal disease virus antigens, Acta Vet Hung., Vol.47, No.4, pp.481-492, 1999. Francois A., Eterradossi N., Delmas B., Payet V. and Langlois P., Construction of avian adenovirus CELO recombinants in cosmids, J. Virol., Vol.75, pp. 5288-5301, 2001. Frens G. Colloidal nucleation for the regulation of the particle size in monodisperse gold suspension, Nature Phys. Sci., Vol. 241, pp. 20-25, 1973. Friguet B., Chaffotte A.F., Djavadi-Ohaniance L. and Goldberg M.E. Measurements of the true affinity constant in solution of antigenantibody complexes by enzyme-linked immunosorbent assay, J. Immunol. Methods, Vol. 77, pp. 305-319, 1985. Fukumoto S., Xuan X., Kadota K., Igarashi I., Sugimoto C., Fujisaki K., Nagasawa H., Mikami T. and Suzuki H., High-level expression of truncated surface antigen P50 of Babesia gibsoni in insect cells by baculovirus and evaluation of its immunogenicity and antigenicity, Clinical and Diagnostic Laboratory, Vol. 10, pp. 596-601, 2003. Fussell L. W. IBD vaccination strategies: Tyson Foods, Inc., In: International Poultry Symposium, Summit on IBD, Athens, GA., pp.15-16, 1995. Ganesan P.I., Appaji R.V.N., Karunakaran K., Elankumaran S. and Ramkrishna J. Diagnosis of infectious bursal disease by detection of viral antigen, Cheiron, Vol.19, pp.205-208, 1990.

65.

66.

67.

68.

69.

70.

71.

72.

73.

167

74.

Garcia A., Roson B. and Perez J.L., Usefulness of PCR and antigen latex agglutination test with samples obtained by transthoracic needle aspiration for diagnosis of pneumococcal pneumonia, Journal of Clinical Microbiology, Vol. 37, pp. 709-714, 1999. Garver K.A., Conway C.M., Elliott D.G. and Kurath G. Analysis of DNA-Vaccinated Fish Reveals Viral Antigen in Muscle, Kidney and Thymus, and Transient Histopathologic Changes, Marine biotechnology, Vol. 7, pp. 540-553, 2005. Ghorashi Seyed A., Rourke Denise O, Ignjatovic Jagoda and Noormohammadi Amir H. Differentiation of infectious bursal disease virus strains using real-time RT-PCR and high resolution melt curve analysis, Journal of Virological Methods, Vol. 171, No. 1, pp. 264-271, 2011. Giambrone J. J. Broiler vaccination-additional protection is often needed, In: International Poultry Symposium, Summit on IBD, Athens, GA., pp.17-20, 1995. Giambrone J.J. and Clay R.P. Evaluation of the immunogenicity, stability, pathogenicity, and immunodepressive potential of four commercial live infectious bursal disease vaccines, Poult Sci., Vol.65, No.7, pp.1287-1290, 1986. Gowri Mangala A., Jaykumar R., Kumaran K. and Nachimuthu K. Avidin - biotin dot ELISA for detection of infectious bursal disease virus antigen, Indian Vet. J., Vol.12, pp. 103-104, 1996. Granzow H., Birghan C., Mettenleiter T. C., Beyer J., Kollner B., Mundt E. A second form of infectious bursal disease virus associated tubule contains VP4. Journal of Virology, Vol.71, pp. 8879-8885, 1997. Granzow H., Birghan C., Mettenleiter T.C., Beyer J., Kollner B. and Mundt, E. A second form of infectious bursal disease virus-associated tubule contains VP4,. J Virol., Vol.71, No.11, pp. 8879-8885, 1997. Gray B. M. and Shaw D. R. Artifacts with the thiocyanate elution method for estimating relative antibody avidity, J. Immunol. Methods, Vol.157, pp. 269-271, 1993.

75.

76.

77.

78.

79.

80.

81.

82.

168

83.

Greenfield C. L., Dohms J. E. and Dietert R. R. Infectious Bursal Disease Virus Infection in the Quail-Chicken Hybrid Infectious, Bursal Disease Virus Infection in the Quail-Chicken Hybrid, pp. 536542, 1986. Hamoud M.M., Villegas P. and Williams S .M. Detection of infectious bursal disease virus from formalin-fixed paraffin-embedded tissue by immunohistochemistry and real-time reverse transcriptionpolymerase chain reaction, J Vet Diagn Invest.,Vol.19, No.1, pp.3542, 2007. Harlow E. and Lane D. Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York, 1988. Hassan M.K. and Saif Y.M. Influence of the host system on the pathogenicity, immunogenicity, and antigenicity of infectious bursal disease virus, Avian Dis., Vol.40, No.3, pp. 553-561, 1996. Hassan M.K., Al-Natour M.Q., Ward L.A. and Saif Y.M. Pathogenicity, attenuation, and immunogenicity of infectious bursal disease virus, Avian Dis., Vol.40, No.3, pp.567-571, 1996. Hathcock T.L. and Giambrone J.J. Digoxigenin-labeled nucleic acid probe for the detection of infectious bursal disease virus in infected cells, Avian Diseases, Vol.36, No.2, pp.206-210, 1992. Heckert R. A., Saif L. J., Hoblet K. H. and Agnes A. G. Development of protein A-gold immunoelectron microscopy for detection of bovine corona virus in calves: comparison with ELISA and direct immunofluorescence of nasal epithelial cells, Vet. Microbiol., Vol.19, pp. 217-231, 1990. Heine H. G. and Boyle D. B. Infectious bursal disease virus structural protein VP2 expressed by a fowlpox virus recombinant confers protection against disease in chickens, Arch. Virol., Vol.131, pp. 277-292, 1993. Henderson K.S. and Jackwood D.J. Comparison of the dot blot hybridization assay with antigen detection assays for the diagnosis of infectious bursal disease virus infections, Avian Dis., Vol.34, No.3, pp.744-748, 1990.

84.

85.

86.

87.

88.

89.

90.

91.

169

92.

Herbrink P. F., Van Bussel J. and Warnaar S. O. The antigen spot test (AST): highly sensitive assay for the detection of antibodies, J. Immunol. Methods, Vol.48, pp. 293-298, 1982. Hirai K., Funakoshi T., Nakai T. and Shimakura S. Sequential changes in the number of surface immunoglobulin-bearing B lymphocytes in infectious bursal disease virus-infected chickens, Avian Dis., Vol.25, No.2, pp. 484-496, 1981. Hirai K., Kunihiro K. and Shimakura S. Characterization of Immunosuppression in chickens by infectious bursal disease virus. Avian Dis., Vol.23, No.4, p. 950-965, 1979. Hirata H., Ikadai H., Yokoyama N., Xuan X., Fujisaki K., Suzuki N., Mikami T. and Igarashi I., Cloning of a truncated Babesia equi gene encoding an 82-kilodalton protein and its potential use in an enzymelinked immunosorbent assay, Journal of Clinical Microbiology, Vol. 40, pp. 1470-1474, 2002. Hooper J.W., Custer D.M., Schmaljohn C.S. and Schmaljohn A.L., DNA vaccination with vaccinia virus L1R and A33R genes protects mice against a lethal poxvirus challenge, Virology, Vol. 266, pp. 329339, 2000. Howie R. and Thorsen J. An Enzyme-linked Immunosorbent Assay (ELISA) for Infectious Bursal Disease Virus, Can. J. comp. Med., Vol.45, pp. 51-55, 1981. Hu Y.C., Bentley W.E., Edwards G.H. and Vakharia V.N. Chimeric infectious bursal disease virus-like particles expressed in insect cells and purified by immobilized metal affinity chromatography. Biotechnol Bioeng., Vol.63, No.6, pp.721-729, 1999. Huang Z., Elankumaran S., Yunus A.S. and Samal S.K. A recombinant Newcastle disease virus (NDV) expressing VP2 protein of infectious bursal disease virus (IBDV) protects against NDV and IBDV, J Virol, Vol.78, No.18, pp.10054-10063, 2004. Hulse D. J. and Romero C. H. Fate of Plasmid DNA Encoding Infectious Bursal Disease Virus VP2 Capsid Protein Gene after Injection into the Pectoralis Muscle of the Chicken, Poultry Science, Vol.81, pp.213-216, 2002.

93.

94.

95.

96.

97.

98.

99.

100.

170

101.

Hung C.M., Yeh C.C., Chen H.L., Lai C.W., Kuo M.F., Yeh M.H., Lin W., Tu M.Y., Cheng H.C. and Chen C.M. Porcine lactoferrin administration enhances peripheral lymphocyte proliferation and assists infectious bursal disease vaccination in native chickens, Vaccine, Vol.28, No.16, pp.2895-2902, 2010. Hung C.M., Yeh C.C., Chong K.Y., Chen H.L., Chen J.Y., Kao S.T., Yen C.C., Yeh M.H., Lin M.S. and Chen C.M. Gingyo-San Enhances Immunity and Potentiates Infectious Bursal Disease Vaccination, Evid Based Complement Alternat Med. Vol.22, 2009. Ide P R. A comparison of gel diffusion, fluorescent antibody and virus isolation methods in experimental and natural cases of infectious bursal disease, Can J Comp Med., Vol.39, No.2, pp.183-190, 1975. Islam M.R., Zierenberg K., Eterradossi N., Toquin D., Rivallan G. and Mller H., Molecular and antigenic characterization of Bangladeshi isolates of infectious bursal disease virus demonstrate their similarities with recent European, Asian and African very virulent strains, J. Vet. Med. B., Vol.48, pp. 211-221, 2001. Ismail N.M. and Saif Y.M. Differentiation between antibodies to serotypes 1 and 2 infectious bursal disease viruses in chicken sera, Avian Dis., Vol.34, pp. 1002-1004, 1990. Jackwood D. H. and Saif Y. M. Antigenic diversity of infectious bursal disease virus, Avian Dis., Vol.31, pp. 766-770, 1987. Jackwood D. J. Development and characterization of nucleic acid probes to infectious bursal disease viruses, Veterinary Microbiology. Vol. 24, No. 3-4, pp.253-260, 1990. Jackwood D.J, Kibenge F.S.B. and Mercado C.C. The Use of BiotinLabeled cDNA Probes for the Detection of Infectious Bursal Disease Viruses, pp. 129-136, 1990. Jackwood D.J. and Jackwood R.J., Infectious bursal disease viruses: molecular differentiation of antigenic subtypes among serotype 1 viruses. Avian Dis., Vol.38, pp. 531-537, 1994. Jackwood D.J., Henderson K.S. and Jackwood R. J. Enzyme-Linked Immunosorbent Assay-Based Detection of Antibodies to Antigenic Subtypes of Infectious Bursal Disease Viruses of Chickens, Clinical

102.

103.

104.

105.

106.

107.

108.

109.

110.

171

And Diagnostic Laboratory Immunology, Vol. 3, No. 4, pp. 456-463, 1996. 111. Jackwood D.J., Henderson K.S. and Jackwood R.J. Enzyme-linked immunosorbent assay-based detection of antibodies to antigenic subtypes of infectious bursal disease viruses of chickens, Clin Diagn Lab Immunol., Vol.3, No.4, pp.456-463, 1996. Jackwood D.J., Kibenge F.S. and Mercado C.C. Detection of infectious bursal disease viruses by using cloned cDNA probes, J Clinical Microbiology. Vol.27, No.11, pp.2437-2443, 1989. Jackwood D.J., Saif Y. M. and Hughes J. H. Characteristics and serologic studies of two serotypes of infectious bursal disease virus in turkeys, Avian Dis., Vol.26, pp. 871-882, 1982. Jackwood D.J., Saif Y.M. and Moorhead P.D. Immunogenicity and antigenicity of infectious bursal disease virus serotypes I and II in chickens, Avian Dis., Vol.29, No.4, pp.1184-1194, 1985. Jackwood D.J., Swayne D.E. and Fisk R.J. Detection of Infectious Bursal Disease Viruses Using in situ Hybridization and NonRadioactive Probes, Avian Diseases, Vol. 36, No. 1, pp. 154-157, 1992. Jagadish M. N., Staton V. J., Hudson P. J. and Azad A. A. Birnavirus precursor polyprotein is processed in Escherichia coli by its own virusencoded polypeptide, Journal of Virology, Vol.62, pp. 1084-1087, 1988. Jayaramiah D.H. and Mallick B.B. Identification of infectious bursal disease in India, Indian J. Anim. Hlth., Vol. 13, pp. 99-103, 1974. Johnson A.M. Immunoprecipitation in gels, Chapter 4. In Manual of Clinical Laboratory Immunology, 3rd Ed. By Rose, N.R.; Friedman, H. and Fahey, J.L. American Society for Microbiology, Washington, D.C. pp. 14-24, 1986. Jordan F.T.W. and Pattison M. In Poultry Diseases, 5th, WB Saunders, 2001. Joshi R.K. and Shakya S. Studies on an infectious bursal disease outbreak in a commercial poultry farm in Madhya Pradesh, Indian Vet. Med. J., Vol.20, pp. 41-42, 1996.

112.

113.

114.

115.

116.

117.

118.

119.

120.

172

121.

Kataria R.S., Tiwari A.K., Butchaiah G. and Kataria J.M. Differentiation of infectious bursal disease virus strains by restriction analysis of RT-PCR-amplified VP2 gene sequences, Acta Virologica, Vol. 43, pp.245-249, 1999. Kaufer I. and Weiss E. Significance of bursa of Fabricius as target organ in infectious bursal disease of chickens, Infect Immun., Vol.27, No.2, pp.364-367, 1980. Kembi F.A., Delano O.O. and Oyekunle M.A. Effect of three different routes of administration on the immunogenicity of infectious bursal disease vaccine, Rev Elev Med Vet Pays Trop., Vol.48, No.1, pp.33-35, 1995. Kibenge F. S. B., Dhillon A. S. and Russell R. G. Biochemistry and immunology of infectious bursal disease virus, Journal of General Virology Vol.69, pp. 1757-1775, 1988. Kibenge F. S., Qian B., Cleghorn J. R. and Martin C. K. Infectious bursal disease virus polyprotein processing does not involve cellular proteases, Archives of Virology, Vol.142, pp. 2401-2419, 1997. Kibenge F.S., Qian B., Nagy E., Cleghorn J.R. and Wadowska D. Formation of virus-like particles when the polyprotein gene (segment A) of infectious bursal disease virus is expressed in insect cells, Can J Vet Res., Vol. 63, No.1, pp.49-55, 1999. Kim I.J. and Sharma J.M. IBDV-induced bursal T lymphocytes inhibit mitogenic response of normal splenocytes, Vet Immunol Immunopathol Vol.74, No.1-2, pp.47-57, 2000. Kim I.J., Gagic M. and Sharma J.M. Recovery of antibody-producing ability and lymphocyte repopulation of bursal follicles in chickens exposed to infectious bursal disease virus, Avian Dis., Vol.43, No.3, pp. 401-413, 1999. Koester J., Becht H. and Rudolph R. Properties of the infectious bursal agent of chicken (IBA). Med. Microbiol. Immunol., Vol.157, pp. 291-298, 1972.

122.

123.

124.

125.

126.

127.

128.

129.

173

130.

Kosters J. Der Nachweis von Antigen und prazipitierendea Antikorpun nach experimentller Injektion mit dem Erreger der Injektiosen Bursitis (Gumboro-Krankheit) bei verscheden alten kuken, Proc. 19th World Vet. Congr., Mexico Vol.3, pp. 1180-1181, 1971. Kosters J. and Geissler H. Serologische Untersuchungen uber die verbreitung der infektiosen Bursitis der Junghennen (Gumboro disease), tierarztl, Umsch, Vol.26, pp.573-575, 1971. Kulkarni D.D., Kulkarni M.N. and Gujar M.B. Serological studies on chicks infected with infectious bursal disease virus and vaccinated for Ranikhet disease:, Indian J. Anim. Sci., Vol.53, pp.1281-1285, 1983. Kumar R., Chandra R., Rao V.D.P. and Shukla S.K. Isolation and characterization of infectious bursal disease (IBD) virus,. Indian Vet. J., Vol.66, pp. 994-997, 1996. Kumar S., Ahi Y.S., Salunkhe S.S., Koul M., Tiwari A.K., Gupta P.K. and Rai A. Effective protection by high efficiency bicistronic DNA vaccine against infectious bursal disease virus expressing VP2 protein and chicken IL-2, Vaccine, Vol.27, No.6, pp.864-869, 2009. Kumar, R., Chandra R., Rao V.D.P. and Shukla S.K. Adaptation of infectious bursal disease virus in chicken embryo fibroblast cell culture and its fine structure, Indian J. Anim. Sci., Vol.70, pp. 110-113, 2000. Kusk Mette, Kabell Susanne, Jrgensen Poul H. and Handberg Kurt J. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR, Veterinary Microbiology, Vol.109, No.3-4, pp. 159-167,2005. Kwang M.J., Lu Y.S., Lee L.H., Lin D.F., Liao Y.K. Lee C. and Lee Y.L. Detection of infectious bursal disease viral antigen prepared from the cloacal bursa by ELISA, J. Chin. Soc. Vet. Sci., Vol.13, pp. 265-269, 1987. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature, Vol. 227, pp. 680-685, 1970.

131.

132.

133.

134.

135.

136.

137.

138.

174

139.

Lalitha P., Eswaran D., Gnanasekar M., Rao K.V., Narayanan R.B., Scott A., Nutman T. and Kaliraj P. Development of antigen detection ELISA for the diagnosis of brugian and bancroftian Filariasis using antibodies to recombinant filarial antigens Bm-SXP-1 and Wb-SXP1, Microbiol. and Imm., Vol. 46, No. 5, pp. 327-332, 2002. Landgraf H., Vielitz E. and Kirsch R. Occurrence of an infectious disease affecting the bursa of Fabricius (Gumboro disease), Dt. Tierarztl. Wschr., Vol.74, pp. 6-10, 1967. Lange H., Muller H., Kaufer I. and Becht H. Pathogenic and structural properties of wild type infectious bursal disease virus (IBDV) and virus grown in vitro, Arch Virol., Vol.92, No.3-4, pp.187-196, 1987. Lasher H.N. and Davis V.S. History of infectious bursal disease in the U.S.A.--the first two decades, Avian Dis., Vol.41, No.1, pp.11-19, 1997. Lee L.H. Characterization of nonradioactive hybridization probes for detecting infectious bursal disease virus, Journal of Virological Methods, Vol. 38, No.1, pp.81-92, 1992. Lee L.H., Ting L.J., Shien J.H. and Shieh H.K. Single-tube, noninterrupted reverse transcription-PCR for detection of infectious bursal disease virus, J. Clin. Microbiol., Vol.32, pp. 1268-1272, 1994. Leong J.C., Brown D., Dobos P., Kibenge F.S.B., Ludert J. E., Muller H., Mundt E. and Nichsolson B. and Birnaviridae, In the 7th Report of the International Committee on the Taxonomy of Viruses. Academic Press: San Diego, pp. 481-490, 2000. Li Y.P., Handberg K.J., Kusk Kabell S., Zhang M.F. and Jorgensen P.H. Relative quantification and detection of different types of infectious bursal disease virus in bursa of Fabricius and cloacal swabs using real time RT-PCR SYBR green technology, Research in Veterinary Science, Vol. 82, No. 1, pp. 126-133, 2007. Lin Z., Kato A., Otaki Y., Nakamura T., Sasmaz E. and Ueda S., Sequence comparisons of highly virulent infectious bursal disease virus prevalent in Japan. Avian Dis., Vol.37, pp. 315-323, 1993. Liu J., Zhou J. and Kwang J., Antigenic and molecular characterization of recent infectious bursal disease virus isolates in China. Virus Genes, Vol.24, pp. 135-147, 2002.

140.

141.

142.

143.

144.

145.

146.

147.

148.

175

149.

Liu X., Giambrone J. J. and Hoerr. F. J. In situ Hybridization, Immunohistochemistry, and in situ Reverse Transcription-Polymerase Chain Reaction for Detection of Infectious Bursal Disease Virus, Avian Diseases Vol. 44, pp.161-169, 2000. Liu, X., Giambrone J.J. and Dormitorio T. Simplified sample processing combined with a sensitive nested polymerase chain reaction assay for detection of infectious bursal disease virus in the bursa of Fabricus, Avian Dis., Vol.42, pp. 480-485, 1998. Lukert P. D. and Saif Y. M. Infectious bursal disease, In B. W. Calnek, H. J. Barnes, C. W. Beard, W. M. Reid, and H. W. Yoder, Jr. (ed.), Diseases of poultry. Iowa State University Press, Ames, pp. 648-663. 1991. Lunger P. D. and Maddux T. C. Fine-structure studies of the avian infectious bursal agent. I. In vivo viral morphogenesis. Avian Dis. Vol.16, pp.874-893, 1972. Luque D., Saugar I., Rejas M. T., Carrascosa J. L., Rodrguez J. F. and Caston J. R. Infectious bursal disease virus: ribonucleoprotein complexes of a double-stranded RNA virus, J. Mol. Biol., Vol.386, pp. 891-901, 2009. MacDonald R. O. and Gower D. A. Genomic and phenotypic divergence among three serotypes of aquatic birnaviruses (infectious pancreatic necrosis virus), Virology, Vol.l114, pp. 187-195, 1981. Macdonald R.D. Immunofluorescent detection of double-stranded RNA in cells infected with reovirus, infectious pancreatic necrosis virus, and infectious bursal disease virus. Can J Microbiol., Vol.26, No.2, pp.256-261, 1980. Madhumathi J., Prince P.R., Anugraha G., Kiran C., Rao D.N., Reddy M.V.R. and Kaliraj, P. Identification and characterization of nematode specific protective epitopes of Brugia malayi TRX towards development of synthetic vaccine construct for lymphatic filariasis. Vaccine, Vol.28, pp. 5038-5048, 2010. Malik M.W., Ayub N. and Qureshi I.Z. Passive immunization using purified IgYs against infectious bursal disease of chickens in Pakistan, J Vet Sci., Vol. 7, No.1, pp.43-46, 2006.

150.

151.

152.

153.

154.

155.

156.

157.

176

158.

Maraver A., Ona A., Abaitua F., Gonzalez D., Clemente R., Ruiz-Daz J. A., Caston J. R., Pazos F. and Rodriguez J. F. The oligomerization domain of VP3, the scaffolding protein of infectious bursal disease virus, plays a critical role in capsid assembly, J. Virol., Vol.77, pp. 6438-6449, 2003. Marsh M. and Helenius A. Virus entry into animal cells, Adv. Virus Res. Vol.36, pp. 107-151, 1989. Martnez-Torrecuadrada J.L., Caston J.R., Castro M., Carrascosa J.L., Rodrguez J.F. and Casal J.I., Different architectures in the assembly of infectious bursal disease virus capsid proteins expressed in insect cells, Virology, Vol.278, pp. 322-331, 2000. Mason H.S., Lam D.M.K. and Arntzen C.J. Expression of hepatitis B surface antigen in transgenic plants, Proc. Natl. Acad. Sci. USA 89, pp.11745-11749, 1992. Maw M.T., Yamaguchi T., Ohya K. and Fukushi H. Detection of Vaccine-Like Infectious Bursal Disease (IBD) Virus in IBD VaccineFree Chickens in Japan, J. Vet. Med. Sci., Vol.70, pp. 833-835, 2008. Mazariegos L.A., Lukert P.D. and Brown J., Pathogenicity and immunosuppressive properties of infectious bursal disease intermediate strain, Avian Dis., Vol.34, pp. 203-208, 1990. Mcferran J.B., Mcnulty M.S., Mccillop E., Corner T.J., Mccracken R. M., Collins D. S. and Allan G. Isolation and serological studies with infectious bursal disease viruses from fowl, turkeys and ducks, demonstration of a second serotype. Avian Pathol., Vol.9, pp. 395-404, 1980. McMurray B. Vaccination strategies: Reflections from the field, Seaboard Farms. In: International Poultry Symposium, Summit on IBD, Athens, GA., pp.35-37, 1995. McNulty M.S., Todd D., Allan G. M., McFerran J. B. and Green J. A. Epidemiology of rotavirus infection in broiler chicken: recognition of four sero groups, Arch. Virol., Vol.81, pp. 113-121, 1984. Mena A., Andrew M.E. and Coupar B.E. Rapid dissemination of intramuscularly inoculated DNA vaccines, Immunology and Cell Biology, Vol. 79, pp. 87-89, 2001.

159.

160.

161.

162.

163.

164.

165.

166.

167.

177

168.

Meulemans G., Antoine O. and Halen P. Application de limmunofluorescence au diagnostic de la Maladie de Gumboro, OIE Bull., Vol.88, pp. 225-229, 1977. Mickael C.S. and Jackwood D.J. Real-time RT-PCR analysis of two epitope regions encoded by the VP2 gene of infectious bursal disease viruses, Journal of Virological Methods, Vol. 128, No. 1-2, pp. 37-46, 2005. Miller Heins S. The emergence of the Delaware strain of IBD and its control in the U.S., In: International Poultry Symposium, Summit on IBD, Athens, GA., pp.99-101,1995. Mohanty G.C., Pandey A.P. and Rajya B.S. Infectious bursal disease in chickens. Curr. Sci., Vol.40, pp. 181-184, 1971. Moody Adrian, Sellers Scott and Bumstead Nat Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT-PCR, Journal of Virological Methods, Vol. 85, No.1-2, pp.55-64, 2000. Muller H. Replication of infectious bursal disease virus in lymphoid cells, Arch Virol., Vol.87, No.3-4, pp. 191-203, 1986. Muller H. and Becht H. Biosynthesis of virus-specific proteins in cells Infected with infectious bursal disease virus and their significance as structural elements for infectious virus and incomplete particles. Journal of Virology, Vol.44, pp. 384-392, 1982. Muller H., Islam M.R. and Raue R. Research on infectious bursal disease--the past, the present and the future, Vet Microbiol., Vol.97, No.1-2, pp.153-165, 2003. Muller H., Scholtissek C. and Becht H., The genome of infectious bursal disease virus consists of two segments of double-stranded RNA, J. Virol., Vol.31, pp. 584-589, 1979. Muller R., Kaufer I., Reinacher M. and Weiss E. Immunofluorescent studies of early virus propagation after oral infection with infectious bursal disease virus (IBDV), Zentralbl Veterinarmed B., Vol.26, No.5, pp. 345-352, 1979.

169.

170.

171.

172.

173.

174.

175.

176.

177.

178

178.

Mullis K. and Faloona F. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction, Methods Enzymol., Vol.155, pp.335-350, 1987. Mundt E., Beyer J. and Muller H. Identification of a novel viral protein in infectious bursal disease virus-infected cells, Journal of General Virology Vol.76, pp. 437-443, 1995. Mundt E., de Haas N. and van Loon A.A. Development of a vaccine for immunization against classical as well as variant strains of infectious bursal disease virus using reverse genetics, Vaccine, Vol.21, No.31, pp.4616-4624, 2003. Mundt E., Kollner B. and Kretzschmar D. VP5 of infectious bursal disease virus is not essential for viral replication in cell culture, Journal of Virology Vol.71, pp. 5647-5651, 1997. Nachimuthu K., Raj G.D., Thangavelu A. and Venkatesan R.A. Reverse passive haemagglutination test in the diagnosis of infectious bursal disease, Trop Anim Health Prod., Vol. 27, No.1, pp.43-46, 1995. Nachimuthu K., Raj G.D., Thangavelu A., Koteeswaran A., Palaniswamy K.S. and Venugopalan A.T. Seroprevalence of infectious bursal disease in Tamil Nadu, Indian Vet. J., Vol.70, pp. 100-103, 1993. Nakamura T., Kato A., Lin Z., Hiraga M., Nunoya T., Otaki Y. and Ueda S. A rapid quantitative method for detecting infectious bursal disease virus using polystyrene latex microspheres, J Virol Methods., Vol.43, No.1, pp. 123-129, 1993a. Nakamura T., Otaki Y., Lin Z. and Kato A. Rapid and quantitative assay system for measuring anti-infectious bursal disease virus antibody using monoclonal antibody bound to polystyrene latex microspheres, Avian Dis., Vol.37, No.3, pp.786-792, 1993b. Nakamura T., Otaki Y., Lin Z., Nunoya T., Hoshi S. and Kato A. Direct correlation between the titer of infectious bursal disease virus VP2-specific antibody and protection, Avian Dis., Vol.38, No.2, pp.251-255, 1994.

179.

180.

181.

182.

183.

184.

185.

186.

179

187.

Nanni Mariana, Alegre Mariana, Compaired Diego, Taboga Oscar and Fondevila Norberto, Novel purification method for recombinant 3AB1 nonstructural protein of foot-and mouth disease virus for use in differentiation between infected and vaccinated animals, J Vet Diagn Invest., Vol.17, pp. 248-251, 2005. Negash T., al-Garib S.O. and Gruys E. Comparison of in ovo and post-hatch vaccination with particular reference to infectious bursal disease, A review. Vet Q., Vol.26, No.2, pp. 76-87, 2004. Nicosia G., Cutello V., Bentley P.J., Timis J., Saha S. and Raghava G.P.S. BcePRED: prediction of continuous B-Cell epitopes in antigenic sequences using physico-chemical properties, Eds. ICARIS, LNCS, Vol. 3239, pp.197-204, 2004. Nurulfiza I., Hair-Bejo M., Omar A.R. and Aini I. Immunochromatographic gold-based test strip for rapid detection of Infectious bursal disease virus antibodies, J Vet Diagn Invest., Vol.23, No.2, pp.320-4, 2011. Okoye J.O.A. and Uzoukwo M. Histopathogenesis of infectious bursal disease in the bursa of Fabricius. Persistence of infectious bursal virus and the appearance of precipitins in infected chickens, Tropical veterinarian, Vol.2, pp. 91-102, 1984. Ona A., Luque D., Abaitua F., Maraver A., Caston J. R. and Rodrguez J. F. The C-terminal domain of the pVP2 precursor is essential for the interaction between VP2 and VP3, the capsid polypeptides of infectious bursal disease virus, Virology, Vol.322, pp. 135-142, 2004. Ouyang W., Wang Y., Zhou Y., Zhang H. and Tang Y. Recombinant VP2 protein of infectious bursal disease virus AH1 strain expressed in insect cells: a vaccine candidate, Sheng Wu Gong Cheng Xue Bao, Vol.26, No.5, pp.595-603, 2010. Parker S.E., Borellini F., Wenk M.L., Hobart P., Hoffman S.L., Hedstrom R., Le T. and Norman J.A. Plasmid DNA malaria vaccine: tissue distribution and safety studies in mice and rabbits, Human Gene Therapy, Vol. 10, pp. 741-758, 1999. Pattison M., Alexander D. J. and Harkness J. W. Purification and preliminary characterization of a pathogenic strain of infectious bursal dis-ease virus. Avian Pathol., Vol.4, pp. 175-187. 1975.

188.

189.

190.

191.

192.

193.

194.

195.

180

196.

Perozo F., Villegas P., Estevez C., Alvarado I.R., Purvis L.B. and Williams S. Protection against infectious bursal disease virulent challenge conferred by a recombinant avian adeno-associated virus vaccine, Avian Dis, Vol.52, No.2, pp.315-319, 2008. Petek M., D'Aprile P.N. and Cancellotti F. Biological and physicochemical properties of the infectious bursal disease virus (IBDV), Avian Pathol., Vol.2, No.2, pp. 135-152, 1973. Peters B., Sidney J., Bourne P., Bui H.H., Buus S. and Doh G. The design and implementation of the immune epitope data base and analysis resource, Immunogenetics, Vol. 57, No.5, pp.326-336, 2005. Peters Michelle A., Lin Tsang Long and Wu Ching Ching Real-time RT-PCR differentiation and quantitation of infectious bursal disease virus strains using dual-labeled fluorescent probes, Journal of Virological Methods, Vol. 127, No.1, pp. 87-95, 2005. Phenix K.V., Wark K., Luke C.J., Skinner M.A., Smyth J.A., Mawhinney K.A. and Todd D., Recombinant Semliki Forest virus vector exhibits potential for avian virus vaccine development, Vaccine, Vol.19, pp. 3116-3123, 2001. Pitcovski J., Di-Castro D., Shaaltiel Y., Azriel A., Gutter B., Yarkoni E., Michael A., Krispel S. and Levi B.Z. Insect cell-derived VP2 of infectious bursal disease virus confers protection against the disease in chickens, Avian Dis., Vol.40, No.4, pp.753-761, 1996. Pitcovski J., Goldberg D., Levi B.Z., Di-Castro D., Azriel A., Krispel S., Maray T. and Shaaltiel Y. Coding region of segment A sequence of a very virulent isolate of IBDV - comparison with isolates from different countries and virulence, Avian Dis., Vol.42, pp. 497-506, 1998. Pitcovski J., Gutter B., Gallili G., Goldway M., Perelman B., Gross G., Krispel S., Barbakov M. and Michael A. Development and large-scale use of recombinant VP2 vaccine for the prevention of infectious bursal disease of chickens, Vaccine, Vol.21, No.32, pp.4736-4743, 2003. Poonia B. and Charan S. Early and transient induction of nitric oxide (NO) in infectious bursal disease virus infection is T-cell dependent: a study in cyclosporin-A treated chicken-model, Indian J Exp Biol., Vol.43, No.2, pp.192-196, 2005.

197.

198.

199.

200.

201.

202.

203.

204.

181

205.

Purushothaman V., Pannerselvam S., Venugopal K. and Thangaraj T.M., A report on the outbreak of infectious bursal disease in chickens. Cheiron, Vol.17, pp. 229-31, 1988. Putnam M. Reflections from the field: Wayne Poultry, In: International Poultry Symposium, Summit on IBD, Athens, GA., pp. 40-41, 1995. Rao K.V.N., Eswaran M., Ravi V., Gnanasekhar B., Narayanan R. B., Kaliraj, P., Kunthala J., Marson A., Nithyakalyani R. and Scott A.L. The Wuchereria bancrofti orthologue of Brugia malayi SXP-1 and the diagnosis of bancroftian Filariasis, Mol. Biochem. Parasitol., Vol. 107, pp. 71-80, 2000. Rao S., Kong W.P., Wei C.J., Yang Z.Y., Nason M., Styles D., DeTolla L.J., Panda A,, Sorrell E.M., Song H., Wan H., Ramirez-Nieto G.C., Perez D. and Nabel G.J. Multivalent HA DNA vaccination protects against highly pathogenic H5N1 avian influenza infection in chickens and mice, PLoS One. Vol.3, No.6, 2008. Rautenschlein S., Yeh H.Y. and Sharma J.M. The role of T cells in protection by an inactivated infectious bursal disease virus vaccine, Vet Immunol Immunopathol, Vol.89, No.3-4, pp. 159-167, 2002. Reddy S. K., Silim A. and Ratcliffe M.J. Biological roles of the major capsid proteins and relationships between the two existing serotypes of infectious bursal disease virus, Arch. Virol., Vol.127, pp. 209-222, 1992. Richmond J.F., Lu S., Santoro J.C., Weng J., Hu S.L., Montefiori D.C. and Robinson H.L. Studies of the neutralizing activity and avidity of anti-human immunodeficiency virus type 1 Env antibody elicited by DNA priming and protein boosting, J Virol., Voll.72, No.11, pp.90929100, 1998. Rodenberg J., Sharma J.M., Belzer S.W., Nordgren R.M. and Naqi S. Flow cytometric analysis of B cell and T cell subpopulations in specific-pathogen-free chickens infected with infectious bursal disease virus,. Avian Dis., Vol.38, No.1, pp. 16-21, 1994.

206.

207.

208.

209.

210.

211.

212.

182

213.

Rogel A., Benvenisti L., Sela I., Edelbaum O., Tanne E., Shachar Y., Zanberg Y., Gontmakher T., Khayat E. and Stram Y. Vaccination with E. coli recombinant empty viral particles of infectious bursal disease virus (IBDV) confer protection, Virus Genes, Vol.27, No.2, pp. 169-175, 2003. Rong J., Cheng T., Liu X., Jiang T., Gu H. and Zou G. Development of recombinant VP2 vaccine for the prevention of infectious bursal disease of chickens, Vaccine, Vol.23, No.40, pp.4844-4851, 2005. Saif E.M., Aly M., El, Aziz, A.M.A. and Mohamed, F.M. Epidemiological studies on Gumboro disease in upper Egypt. Assiut. Vet. Med. J., Vol.42, pp. 223-241, 2000. Sambrook J., Fitsch E.F. and Maniatis T. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Vol. I. 2nd edition, 1989. Sapats S.I. and Ignjatovic J., Antigenic and sequence heterogeneity of infectious bursal disease virus strains isolated in Australia, Arch. Virol., Vol.145, pp. 773-785, 2000. Saravanan P., Kumar S. and Kataria J.M. Use of multiple antigenic peptides related to antigenic determinants of infectious bursal disease virus (IBDV) for detection of anti-IBDV-specific antibody in ELISA-quantitative comparison with native antigen for their use in serodiagnosis, J Immunol Methods, Vol.293, No.1-2, pp.:61-70, 2004. Saravanan P., Satishkumar, Kataria J.M. and Rasool T J. Detection of Infectious bursal disease virus by ELISA using an antipeptide antibody raised against VP3 region, Acta Virol., Vol.48, No.1, pp.39-45, 2004. Selegean M., Putz M.V. and Rugea T. Effect of the polysaccharide extract from the edible mushroom Pleurotus ostreatus against infectious bursal disease virus, Int J Mol Sci., Vol.10, No.8, pp.36163634, 2009. Sharma J. and Rosenberger J. K. Infectious bursal disease and reovirus infection of chickens: Immune responses and vaccine control, Avian Immun Basis Pract., Vol.2, pp.149-150, 1987. Sharma J.M. and Fredericksen T.L. Mechanism of T cell immunosuppression by infectious bursal disease virus of chickens, Prog Clin Biol Res., Vol.238, pp.283-294, 1987.

214.

215.

216.

217.

218.

219.

220.

221.

222.

183

223.

Sharma J.M., Dohms J.E. and Metz A.L. Comparative pathogenesis of serotype 1 and variant serotype 1 isolates of infectious bursal disease virus and their effect on humoral and cellular immune competence of specific-pathogen-free chickens, Avian Dis., Vol.33, No.1, pp.112-124, 1989. Sharma J.M., Kim I.J., Rautenschlein S. and Yeh H.Y. Infectious bursal disease virus of chickens: pathogenesis and immunosuppression, Dev Comp Immunol., Vol.24, No.2-3, pp. 223-235, 2000. Shaw I. and Davison T.F. Protection from IBDV-induced bursal damage by a recombinant fowlpox vaccine, fpIBD1, is dependent on the titre of challenge virus and chicken genotype, Vaccine, Vol.18, pp. 3230-3241, 2000. Sheppard M., Werner W., Tsatas E., McCoy R., Prowse S. and Johnson M., Fowl adenovirus recombinant expressing VP2 of infectious bursal disease virus induces protective immunity against bursal disease, Arch. Virol., Vol.143, pp. 915-930, 1998. Singh N.K., Dey S., Madhan Mohan C., Mohan Kataria J. and Vakharia V.N. Evaluation of four enzyme linked immunosorbent assays for the detection of antibodies to infectious bursal disease in chickens, J Virol Methods., Vol.165, No.2, pp. 277-282, 2010. Skeeles J.K., Lukert P.D., De Buysscher E.V., Fletcher O.J. and Brown, J. Infectious bursal disease viral infections. I. Complement and virus-neutralizing antibody response following infection of susceptible chickens Avian Dis., Vol.23, No.1, pp. 95-106, 1979a. Skeeles J.K., Lukert P.D., De Buysscher E.V., Fletcher O.J. and Brown J. Infectious bursal disease viral infections. II. The relationship of age, complement levels, virus-neutralizing antibody, clotting, and lesions, Avian Dis., Vol.23, No.1, pp. 107-117, 1979b. Snyder D.B., Lana D.P., Savage P.K., Yancey F.S., Mengel S.A. and Marquardt W.W. Differentiation of infectious bursal disease viruses directly from infected tissues with neutralizing monoclonal antibodies: Evidence for a major antigenic shift in recent field isolates, Avian Dis., Vol.32, pp. 535-539, 1988.

224.

225.

226.

227.

228.

229.

230.

184

231.

Snyder D.B., Yancey F.S. and Savage P.K. A monoclonal antibody based agar gel precipitation test for antigenic assessment of infectious bursal disease virus, Avian Pathol., Vol.21, pp. 153-157, 1992. Spies U., Muller H. and Becht H. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products, Virus Res., Vol.8, pp.127140, 1987. Srinivasan K.N., Brusic V. and August J.T. New technologies for vaccine development, Drug Dev Res., Vol.62, pp. 383-392, 2004. Staneck J.L., Weckbach L.S., Allen S.D., Siders J.A., Gilligan P.H., Coppitt G., Kraft J.A. and Willis D.H., Multicenter evaluation of four methods for Clostridium difficile, cytotoxin assay, culture, and latex agglutination, Journal of Clinical Microbiology, Vol. 34, pp. 27182721, 1996. Stram Y., Meir R., Molad T., Blumenkranz R., Malkinson M. and Weisman Y. Applications of the polymerase chain reaction to detect infectious bursal disease virus in naturally infected chickens, Avian Dis., Vol.38, pp. 879-884, 1994. Studier F.W. and Moffatt B. A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes, J. Molecular Biology, Vol. 189, pp. 113-130, 1986. Tacken M.G., Peeters B. P., Thomas A. A., Rottier P. J. and Boot H. J. Infectious bursal disease virus capsid protein VP3 interacts both with VP1, the RNA-dependent RNA polymerase, and with viral doublestranded RNA, J. Virol., Vol.76, pp. 11301-11311, 2002. Tang D.C., De Vit M. and Johnston S.A. Genetic immunization is a simple method for eliciting an immune response, Nature, Vol. 356, pp. 152-154, 1992. Tham K.M., Young L.W. and Moon C. D. Detection of infectious bursal disease virus by reverse transcription-polymerase chain reaction amplification of the virus segment A gene, Journal of Virological Methods, Vol.53, No.2-3, pp.201-212, 1995. Thevathasan C. and Jayawardana G.W.L. Studies on infectious bursal disease virus isolated from field outbreaks, Trop. Agril. Res., Vol.9, pp.372-377, 1997.

232.

233.

234.

235.

236.

237.

238.

239.

240.

185

241.

Tischer B.K., Schumacher D., Beer M., Beyer J., Teifke J.P., Osterrieder K., Wink K., Zelnik V., Fehler F. and Osterrieder N. A DNA vaccine containing an infectious Marek's disease virus genome can confer protection against tumorigenic Marek's disease in chickens, J Gen Virol., Vol. 83, No. 10, pp.2367-2376, 2002. Todd D. and McNulty M.S. Biochemical studies with infectious bursal disease virus: comparison of some of its properties with infectious pancreatic necrosis virus, Arch Virol., Vol.60, pp. 265-277, 1979. Toma C., Sisavath L. and Iwanaga M. Reversed passive latex agglutination assay for detection of toxigenic Corynebacterium diphtheriae, Journal of Clinical Microbiology, Vol. 35, pp. 3147-3149, 1997. Towbin H., Syaehelin T. and Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications, Proceedings of the National Academy of Sciences of the United States of America, Vol. 76, pp. 4350-4354, 1979. Tripathi V., Chitralekha K.T., Bakshi A.R., Tomar D., Deshmukh R.A., Baig M.A. and Rao D.N., Inducing systemic and mucosal immune responses to B-T construct of F1 antigen of Yersinia pestis in microsphere delivery, Vaccine, Vol. 24, No. 16, pp.3279-3289, 2006. Tsukamoto K., Kojima C., Komori Y., Tanimura N., Mase M. and Yamaguchi S., Protection of chickens against very virulent infectious bursal disease virus (IBDV) and Mareks disease virus (MDV) with a recombinant MDV expressing IBDV VP2. Virology, Vol.257, pp. 352-362, 1999. Tsukamoto K., Obata H. and Hihara H. Improved preparation of ELISA antigen of infectious bursal disease virus. Avian Dis., Vol.34, No.1, pp.209-213, 1990. Tsukamoto K., Saito S., Saeki S., Sato T., Tanimura N., Isobe T., Mase M., Imada T., Yuasa N. and Yamaguchi S., Complete, long-lasting protection against lethal infectious bursal disease virus challenge by a single vaccination with an avian herpesvirus vector expressing VP2 antigens, J Virol., Vol.76, No.11, pp.5637-5645, 2002.

242.

243.

244.

245.

246.

247.

248.

186

249.

Tsukamoto K., Tanimura N., Kakita S., Ota K., Mase M., Imai K. and Hihara H. Efficacy of three live vaccines against highly virulent infectious bursal disease virus in chickens with or without maternal antibodies, Avian Dis., Vol.39, No.2, pp.218-229, 1995. Ulbrich F. and Zureck I. Agar-gel precipitation test for diagnosis of infectious bursitis in fowl (Gumboro disease), Mn. Vet. Med., Vol.32, p.588, 1977. Umapathi V., Parthiban M., Thiagarajan V. and Nachimuthu K. Preparation and characterization of immunogen for monoclonal antibody production against infectious bursal disease virus serotype 1 of poultry, J. Immu. Immunopatho., Vol.4, pp. 113-116, 2002. Unicom L. E., Coulson B. S. and Bishop R. F. Experience with an enzyme immunoassay for serotyping human group A rotaviruses, J. Clin. Microbiol., Vol.27, pp.586-588, 1989. Ursula I von Einem, Alexander E Gorbalenya, Horst Schirrmeier, Sven-Erik Behrens, Tobias Letzel and Egbert Mundt, VP1 of infectious bursal disease virus is an RNA-dependent RNA polymerase, Journal of General Virology, Vol.85, pp. 2221-2229, 2004. Vakharia V.N., Snyder D.B., He J., Edwards G.H., Savage P.K. and Mengel-Whereat S.A. Infectious bursal disease virus structural proteins expressed in a baculovirus recombinant confer protection in chickens, J Gen Virol, Vol.74, No.6, pp.1201-1206, 1993. Vakharia V.N., Snyder D.B., Ltticken D., Mengel-Whereat S.A., Savage P. K., Edwards G.H. and Goodwin M.A. Active and passive protection against variant and classic infectious bursal disease virus strains induced by baculovirus-expressed structural proteins, Vaccine, Vol.12, No.5, pp.452-456, 1994. Van den Berg T.P., Acute infectious bursal disease in poultry: a review, Avian Pathol., Vol.29, pp. 175-194, 2000. Van den Berg T.P., Eterradossi N., Toquin D. and Meulemans G. Infectious bursal disease (Gumboro disease), Rev Sci Tech., Vol.19, No.2, pp. 509-543, 2000.

250.

251.

252.

253.

254.

255.

256.

257.

187

258.

Van den Berg T.P., Gonze M. and Meulemans G. Acute infectious bursal disease in poultry and characterization of a highly virulent strain. Avian Pathol., Vol.20, pp. 133-143, 1991. Van Regenmortel M. H., (ed.) Immunoinformatics may lead to a reappraisal of the nature of B cell epitopes and of the feasibility of synthetic peptide vaccines, J. Mol. Recognit., Vol.19, pp. 183-187, 2006. Verma K.C., Panisup A.S., Mohanty G.C. and Reddy B.R. Infectious bursal disease (Gumboro disease) and associated conditions in poultry flocks of Andhra Pradesh. Indian J. Poult. Sci., Vol.16, pp. 385-392, 1981. Villegas P., Hamoud M., Purvis L.B. and Perozo F. Infectious bursal disease subunit vaccination, Avian Dis, Vol.52, No.4, pp.670-674, 2008. Viswas K.N., Muniyappa L., Suryanarayana V.V. and Byregowda S.M., Nucleotide sequence analysis of variable region of VP2 gene of two infectious bursal disease virus isolates from commercial poultry farms. Acta Virol., Vol.46, pp. 95-101, 2002. Wang C., Zhao Z., Zhang C., Liu Y., Ding K., Li Y., Cheng X. and Chen P. Influence of fusion protein of IBDV VP2 and chicken interleukin-2 on immune response in chicken, Sheng Wu Gong Cheng Xue Bao, Vol.26, No.4, pp.476-482, 2010. Wang M.Y., Hu H.L., Suen S.Y., Chiu F.Y., Shien J.H. and Lai S.Y. Development of an enzyme-linked immunosorbent assay for detecting infectious bursal disease virus (IBDV) infection based on the VP3 structural protein, Vet Microbiology, Vol.131, No.3-4, pp.229-236, 2008. Wang M.Y., Kuo Y.Y., Lee M.S., Doong S.R., Ho J.Y. and Lee L.H., Self-assembly of the infectious bursal disease virus capsid protein, rVP2, expressed in insect cells and purification of immunogenic chimeric rVP2H particles by immobilized metal-ion affinity chromatography, Biotechnol. Bioeng., Vol.67, pp. 104-111, 2000. Wang S.J., Chang W.F., Wang M.Y., Hsiung K.P. and Liu Y.C. Development of a disperse dye immunochromatographic test for the detection of antibodies against infectious bursal disease virus, Vet Immunol Immunopathol., Vol.125, No.3-4, pp.284-90, 2008.

259.

260.

261.

262.

263.

264.

265.

266.

188

267.

Wang Y.S., Fan H.J., Li Y., Shi Z.L., Pan Y. and Lu C.P. Development of a multi-mimotope peptide as a vaccine immunogen for infectious bursal disease virus, Vaccine, Voll.25, No.22, pp.44474455, 2007. Wang Yongqiang, Qi Xiaole, Gao Honglei, Gao Yulong, Lin Huan, Song Xiuqing, Pei Lei and Wang Xiaomei Comparative study of the replication of infectious bursal disease virus in DF-1 cell line and chicken embryo fibroblasts evaluated by a new real-time RT-PCR, Journal of Virological Methods, Vol. 157, No. 2, pp. 205-210, 2009. Winterfield R.W., Fadly A.M. and Bickford A. Infectivity and distribution of infectious bursal disease virus in the chicken. Persistence of the virus and lesions, Avian Dis., Vol.16, No.3, pp. 622-632, 1972. Winterfield T. W., Hitchner S. B., Appleton G. S. and Cosgrove A. S., Avian nephrosis, nephritis and Gumboro disease, L & M News Views, Vol.3, p.103, 1962. Wolff J.A., Malone R.W., Williams P., Chong W., Acsadi G., Jani A. and Felgner P.L. Direct gene transfer into mouse muscle in vivo, Science, Vol. 247, pp. 1465-1468, 1990. Wu C.C., Lin T.L., Zhang H.G., Davis V.S. and Boyle J.A. Molecular detection of infectious bursal disease virus by polymerase chain reaction, Avian Dis., Vol.36, pp.221-226, 1992. Wu Ching-Ching, Lin Tsang-Long and Akin.Aydemir Quantitative competitive polymerase chain reaction for detection and quantification of infectious bursal disease virus cDNA and RNA, Journal of Virological Methods, Vol.66, No. 1, pp. 29-38, 1997. Wu H., Singh N.K., Locy R.D., Scissum-Gunn K. and Giambrone J.J. Expression of immunogenic VP2 protein of infectious bursal disease virus in Arabidopsis thaliana, Biotechnol Lett., Vol.26, No.10, pp.:787-792, 2004. Wu J., Yu L., Li L., Hu J., Zhou J. and Zhou X. Oral immunization with transgenic rice seeds expressing VP2 protein of infectious bursal disease virus induces protective immune responses in chickens, Plant Biotechnol J, Vol.5, No.5, pp.570-578, 2007.

268.

269.

270.

271.

272.

273.

274.

275.

189

276.

Wyeth P. J. and Chettle N. J. Use of infectious bursal disease vaccines in chicks with maternally derived antibodies, Vet Rec., Vol.126, No.23, pp.577-578, 1990. Wyeth P. J., Chettle N J. and Mohepat A.R. Use of an inactivated infectious bursal disease oil emulsion vaccine in commercial layer chicks, Vet Rec., Vol.130, No.2, pp.30-32, 1992. Xiaojuan Zheng, Lianlian Hong, Lixue Shi, Junqing Guo, Zhen Sun, and Jiyong Zhou, Proteomics Analysis of Host Cells Infected with Infectious Bursal Disease Virus, Molecular and Cellular Proteomics, Vol.7, pp. 612-625, 2008. Xu Jiangtao, Zhenmei Zhang, Yanbo Yin, Shangjin Cui, Shouzhen Xu, Yanyan Guo, Jida Li, Jianlin Wang, Xingcai Liu and Limin Han Development of reverse-transcription loop-mediated isothermal amplification for the detection of infectious bursal disease virus, Journal of Virological Methods, Vol. 162, No. 1-2, pp. 267-271, 2009. Xue C.Y. and Lim B.L. In situ Localization of Infectious Bursal Disease Virus-Binding Cells by a Biotin-Streptavidin System, Avian Diseases Vol.45, No. 2, pp. 504-511, 2001. Yang T., Wang H.N., Wang X., Tang J.N., Gao R., Li J., Guo Z.C. and Li Y.L. Multivalent DNA vaccine enhanced protection efficacy against infectious bronchitis virus in chickens, J Vet Med Sci., Vol.71, No.12, pp.1585-1590, 2009. Yao K., Goodwin M. A. and Vakharia V. N. Generation of a mutant infectious bursal disease virus that does not cause bursal lesions, Journal of Virology, Vol.72, pp. 2647-2654, 1998. Yehuda H., Goldway M., Gutter B., Michael A., Godfried Y., Shaaltiel Y., Levi B.Z. and Pitcovski J. Transfer of antibodies elicited by baculovirus-derived VP2 of a very virulent bursal disease virus strain to progeny of commercial breeder chickens. Avian Pathol., Vol.29, No.1, pp.13-19, 2000. Yip C.W., Yeung Y.S., Ma C.M., Lam P.Y., Hon C.C., Zeng F. and Leung F.C. Demonstration of receptor binding properties of VP2 of very virulent strain infectious bursal disease virus on Vero cells, Virus Res., Vol.123, No.1, pp. 50-56, 2007.

277.

278.

279.

280.

281.

282.

283.

284.

190

285.

Yongping Wu, Lianlian Hong, Juxiu Ye, Zhenyu Huang and Jiyong Zhou The VP5 protein of infectious bursal disease virus promotes virion release from infected cells and is not involved in cell death, Vol.154, No.12, pp. 1873-1882, 2009. Zhang Chunjie Establishment and Application of Sandwich DofELISA in Detection of Infection Bursai Disease Virus, Journal of Luoyang Agricultural College, Vol.01, pp. 33-38, 1994. Zhang G.P., Li Q.M., Yang Y.Y., Guo J.Q., Li X.W., Deng R.G., Xiao Z.J., Xing G.X., Yang J.F., Zhao D., Cai S.J. and Zang W.M. Development of a one-step strip test for the diagnosis of chicken infectious bursal disease, Avian Dis., Vol.49, No.2, pp.177-81, 2005. Zierenberg K., Nieper H., van den Berg Th., Ezeokoli C.D., Vo M. and Mller H., The VP2 variable region of African and German isolates of infectious bursal disease virus: comparison with very virulent, classical virulent, and attenuated tissue culture-adapted strains. Arch. Virol., Vol.145, pp. 113-125, 2000. Zierenberg K., Raue R. and Mller H. Rapid identification of very virulent strains of infectious bursal disease virus by reverse transcription-polymerase chain reaction combined with restriction enzyme analysis. Avian Pathol., Vol.30, pp. 55-62, 2001.

286.

287.

288.

289.

191

LIST OF PUBLICATIONS

1.

Chinnathambi Thangadurai, Pichaimuthu Suthakaran, Pankaj Barfal, Balaiah Anandaraj, Satya Narayan Pradhan, Harith Kamil Boneya, Subramanian Ramalingam, Vadivel Murugan. Rare codon priority and its position specificity at the 5 of the gene modulates heterologous protein expression in Escherichia coli. Biochemical and Biophysical Research Communications. 376, pp 647652. 2008.

Submitted Genbank Sequences 1. Pradhan, S.N., Antony, U., Narayanan, R.B. and Roy,P., Evaluation of immunoprophylactic efficacy of rVP2 subunit vaccine in Infectious bursal disease virus of chicks. 2009, FJ848772 :

192

CURRICULUM VITAE

Satya Narayan Pradhan was born in Berhampur, India. He obtained his B.Pharm degree from College of Pharmaceutical Sciences, Berhampur University. He also holds diploma in pharmaceutical production from IPER, Pune and diploma in management from IGNOU, national university. He qualified JNU national entrance and was awarded a fellowship to pursue M.Tech (Biotech) from Anna University and completed with distinction. His post-graduation dissertation titled Hyper expression of

streptokinase in T7 Expression system was graded excellent. He qualified DBT-BET national entrance and was awarded Research Fellowship to pursue Ph.D. He has presented his work on viral vaccine and detection in various national and international conferences and won prize. He has contributed to one research publications and deposited one sequence in GenBank. He has acquired rich experience during his research work on various techniques related to - molecular biology, genetic engineering, immunology, cell culture, monoclonal antibody development, and animal vaccination.