This article was originally published in a journal published by

Elsevier, and the attached copy is provided by Elsevier for the

author’s benefit and for the benefit of the author’s institution, for
non-commercial research and educational use including without
limitation use in instruction at your institution, sending it to specific
colleagues that you know, and providing a copy to your institution’s
administrator.
All other uses, reproduction and distribution, including without
limitation commercial reprints, selling or licensing copies or access,
or posting on open internet sites, your personal or institution’s
website or repository, are prohibited. For exceptions, permission
may be sought for such use through Elsevier’s permissions site at:

http://www.elsevier.com/locate/permissionusematerial
 ARTICLE IN PRESS

Molecular and Cellular Probes 21 (2007) 312–315

www.elsevier.com/locate/ymcpr

Short communication

Evaluation of an alkaline phosphatase-labeled oligonucleotide probe

py
for detection and enumeration of vibrio spp. from
shrimp hatchery environment

co
P. Raghunath, Indrani Karunasagar, Iddya Karunasagar
Department of Fishery Microbiology, Karnataka Veterinary, Animal and Fisheries Sciences University, College of Fisheries, Mangalore 575 002, India
Received 29 August 2006; accepted 8 March 2007
Available online 14 March 2007

al
Abstract

An alkaline phosphatase (AP)-labeled genus-specific oligonucleotide probe was developed to detect and enumerate vibrios in shrimp
on
larvae and their surrounding environment. The probe was evaluated using 35 laboratory isolates of Vibrio species and 29 isolates of non-
vibrio species. The probe was specific for the Vibrio species and no cross reaction was found with the non-vibrios included in the study.
The total Vibrio counts obtained by plating on thiosulfate-citrate-bile salts-sucrose agar (TCBS) and using oligonucleotide probe were
compared. Total Vibrio counts obtained by probe were comparatively higher than the counts obtained by plating on TCBS agar. The
rs

difference between the counts obtained by the probe and by plating on TCBS agar ranged from 2 to 21 times. The study reveals that the
use of a non-selective medium such as T1N3 agar followed by detection using a genus-specific probe would help to precisely enumerate
the total Vibrio load in the aquaculture environments.
r 2007 Elsevier Ltd. All rights reserved.
pe

Keywords: Oligonucleotide probe; Vibrio spp.; Rapid detection

1. Introduction Vibrio population in aquaculture systems could help to

predict the possibility of disease outbreaks.
r's

The members of the genus Vibrio are widespread in the
estuarine-marine environments and constitute the natural
microbial flora of aquatic animals. Some Vibrio spp. are
also considered important pathogens of aquatic inverte-
o
Traditionally, estimation of total Vibrio count in the
shrimp and the rearing water has been done by plating an
aliquot of sample on thiosulfate-citrate-bile salts-sucrose
(TCBS) agar. Some species of Vibrio grow poorly on TCBS

brates such as crustaceans and mollusks. Luminous Vibrio agar and the medium has been found to be inhibitory at
species are known to cause serious production loss in different levels to different Vibrio species [9,10]. Several
th

shrimp hatcheries and farms particularly in postlarvae and researchers have reported that recovery of Vibrios on
juvenile populations [1–4]. The Vibrios that are known to TCBS was low when compared to non-selective media like
affect shrimp aquaculture are Vibrio harveyi, V. parahae- trypticase soya agar [11]. Therefore, alternative methods
Au

molyticus, V. alginolyticus, V. vulnificus, V. fluvialis and
V. anguillarum [5–8]. Occurrence of shrimp mortalities in a
shrimp farm are often accompanied by the presence of high
numbers of Vibrios in the shrimp as well as in its
surrounding environment. Hence the knowledge of total
Corresponding author. Tel.: +91 824 2246384; fax: +91 824 2246384.
E-mail addresses: mircen@sancharnet.in, karuna8sagar@yahoo.com
(I. Karunasagar).
are required to estimate the levels of Vibrio spp. in shrimp
aquaculture environments. We considered the possibility of
using genus-specific oligonucleotide probe for enumeration
of Vibrios by colony hybridization after plating on non-
selective medium. Several investigators have recently
described the use of sequence of gyrB gene, which encodes
the subunit B protein of DNA gyrase for discrimination
between closely related bacteria [12,13]. We compared the
sequences of gyrB genes of Vibrio spp. available in Gen

0890-8508/$ - see front matter r 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.mcp.2007.03.003
 ARTICLE IN PRESS
P. Raghunath et al. / Molecular and Cellular Probes 21 (2007) 312–315 313

Bank and identified a region that is conserved in all Vibrio
spp. An oligonucleotide based on this sequence was
synthesized, labeled with alkaline phosphatase (AP) and
evaluated in this study.
2. Materials and methods
V. parahaemolyticus (AQ 4037), V. vulnificus (ATCC
A 32-mer oligonucleotide sequence (TGTCAGGAA-
AAAGATCCTGCACTGTCTGAACT) that is unique to
the gyrase B sub unit (gyrB) of Vibrio spp. was synthesized
and labeled with the AP enzyme by DNA technology A/S
(Aarhus, Denmark). The probe was evaluated using 35
isolates of different Vibrio species and 29 isolates of non-
vibrio species. All the isolates were spot inoculated on
T1N1 agar plates and incubated at 37 1C overnight. Colony

27562), V. cholerae (ATCC 39315) and V. harveyi
(laboratory isolate) were used as positive controls; Aero-
monas hydrophila (laboratory isolate), Pseudomonas spp.
(laboratory isolate), Bacillus spp. (laboratory isolate),
py
lifts were performed onto Whatman No. 541 filter papers
and colony hybridization was carried out as described in
the FDA Bacteriological Analytical Manual [14], except
that hybridization and washing temperatures were varied

Moraxella spp. (laboratory isolate), Acinetobacter spp.
(laboratory isolate) and Salmonella enterica enterica
serovar Typhi (ATCC 12225) were used as negative
controls. Other cultures used in this study were isolated
from environmental samples such as shrimp farm water,
sediment, estuarine water, cultured shrimp and shrimp
larvae and identified using a battery of biochemical tests
co
with the optimal temperature being 56 1C.
Twenty samples which included 12 shrimp larval
samples, 4 water samples and 4 sediment samples were
collected from the aquaculture ponds in Kundapura and
Udupi district on the south west coast of India during the
period from March 2006 to April 2006. The samples were
processed within 2 h of collection. Shrimp larvae (10–15)

[14]. All the cultures were maintained as glycerol stock at
80 1C. The cultures were retrieved from 80 1C stock and
maintained on agar slants during this study. All the Vibrio
on
cultures were maintained on T1N1 agar slants (1%
tryptone, 1% NaCl and 2% agar) at room temperature.
Non-vibrio species were maintained on tryptone soya agar
(TSA) slants at room temperature. A list of the isolates
rs
al
were homogenized and 1:1, 1:10 and 1:100 dilutions of the
homogenate and sediment samples were prepared in
physiological saline. Water samples were diluted 1:10 and
1:100 in physiological saline. In the case of shrimp larvae
and sediment samples, a 0.2 g of the 1:1 dilution and 100 ml
of the 1:10 and 1:100 dilutions were surface spread in
parallel on TCBS agar plates and T1N3 agar plates (1%

used in this study is given in Table 1. tryptone, 3% NaCl, 2% agar, pH 7.4) in duplicate. In the
case of water samples, 100 ml each of undiluted sample as
Table 1 well as 1:10 and 1:100 dilutions were surface spread in
pe

Bacterial strains used for determining specificity of the probe duplicate. All the plates were incubated at 37 1C overnight.
Name of organism Number of strains Source
Total Vibrio counts were obtained by counting green and
yellow colonies on TCBS agar. Colony lifts were performed
Vibrio parahaemolyticus 02 SW on T1N3 agar plates with 100–1000 colonies onto Whatman
03 SS No. 541 filter paper. Colony hybridization was carried out
Vibrio vulnificus 03 SW
02 CS
as described in the FDA Bacteriological Analytical Manual
Vibrio cholerae 01 01 Seawater [14], except that in the present study, hybridization and
r's

Vibrio cholerae non-01 03 SW washing were performed at an optimal temperature of

Vibrio harveyi 04 Shrimp larvae 56 1C. The total Vibrio counts obtained by direct enumera-
03 SW tion on TCBS agar and by using AP-labeled oligonucleo-
Vibrio alginolyticus 02 SW
02 SS
tide probe were compared. Further, to assess the specificity
o

Vibrio fischeri 03 SW of the probe at least 20 colonies that reacted with the probe
Vibrio mimicus 01 SW were recovered from each sample and subjected to a
th

Vibrio pelagicus 01 SS battery of biochemical tests such as oxidase test, produc-

Vibrio orientalis 01 SW tion of acid from glucose fermentation in Kligler iron agar
Vibrio cincinnatiensis 01 SS
Vibrio hollisae 01 SW
(KIA), sensitivity to vibrio static agent (150 mg) and the
Au

Vibrio fluvialis 01 SS capability of growth at 3% NaCl for the identification of

Vibrio anguillarum 01 SW isolates upto genus level [15,16]. All the biochemical tests
Salmonella Typhi (ATCC 12225) 01 Unknown were performed strictly as per the protocol described by
Pseudomonas spp. 04 EW Ottaviani et al. [16]. Over 400 colonies reacting with the
Bacillus spp. 03 EW
Escherichia coli 03 CS
probe were identified by biochemical reactions.
Aeromonas hydrophila 03 Fish
Moraxella spp. 05 CS 3. Results and discussion
Acinetobacter spp. 05 CS
Moritella marina 02 SS The probe was evaluated using 35 isolates of different
Photobacterium damselae 03 SW
Vibrio species and 29 isolates of non-vibrio species. The
SW: shrimp farm water; SS: shrimp farm sediment; CS: cultured shrimp; probe reacted only with the Vibrio spp and none of the
EW: estuarine water. non-vibrio species such as A. hydrophila, Pseudomonas
 ARTICLE IN PRESS
314 P. Raghunath et al. / Molecular and Cellular Probes 21 (2007) 312–315

Table 2
Comparison of total Vibrio counts obtained by colony hybridization with AP-probe on T1N3 agar and TCBS agar

Sample no. Sample type Vibrio counts on TCBS agar (cfu/g or ml) Vibrio counts by AP-labeled probe (cfu/g or ml)

01 Shrimp larvae 800 6000

02 Shrimp larvae 2500 10 000
03 Shrimp larvae 1250 14 000
04 Shrimp larvae 2600 20 000
05 Shrimp larvae 800 1400

py
06 Shrimp larvae 600 1800
07 Shrimp larvae 1000 21 000
08 Shrimp larvae 19 000 32 000
09 Shrimp larvae 600 3600
10 Shrimp larvae 80 1000

co
11 Shrimp larvae 425 000 810 000
12 Shrimp larvae 3000 20 000
13 Water Nil Nil
14 Water 100 1100
15 Water 70 400
16 Water 2500 28 000
17 Sediment 1600 7000
18 Sediment 5700 8300

al
19 Sediment 1700 12 200
20 Sediment 1900 on 3800

spp., Moraxella spp., Acinetobacter spp., Escherichia coli, tion of quantitative PCR (QPCR) with constant denatur-
S. Typhi (ATCC 12225), Bacillus spp., Moritella maina and ant capillary electrophoresis (CDCE) has been developed
Photobacterium damselae reacted with the probe. The for the detection and quantification of Vibrios [18].
rs

probe was found to be highly specific to genus Vibrio. Thompson and colleagues [19] have developed multilocus
The total Vibrio counts obtained by direct enumeration on sequence analysis for detection of Vibrios. But these
TCBS agar and by using AP-labeled oligonucleotide probe methods are expensive and time consuming. Though
pe

were compared (Table 2). In all the samples, the total
Vibrio counts obtained by oligonucleotide probe on
colonies developed on T1N3 agar were comparatively
higher than the counts obtained by direct enumeration on
TCBS agar. The difference between the counts obtained by
the probe and by plating on TCBS agar ranged from 2 to
21 times (Table 2). To assess the specificity of the probe at
r's
PCR based methods offer the possibility of increased
sensitivity, the use of PCR amplification in complex
substrates such as shrimp larvae and sediment is limited
due to the possible presence of PCR inhibitors that may
give false negative results. The use of QC-PCR for
quantification of Vibrio population may give rise to higher
counts than actual Vibrio counts for samples where intact

least 20 colonies that reacted with the probe were recovered
from each sample and all such probe-positive colonies
(over 400) were identified as Vibrios biochemically [15,16].
A large number of Vibrio spp. in the aquaculture
o
DNA sequences of Vibrios are present despite the absence
of live Vibrio cells. Therefore, colony hybridization using
genus-specific oligonucleotide probe may be an alternative
method for quantification of Vibrios in aquaculture

environment are unable to grow on TCBS agar. TCBS is systems. The results indicate that colony hybridization
a highly selective agar and the selective agents present in it with the genus-specific oligonucleotide probe is an efficient
th

may inhibit the growth of some species of Vibrio. Previous method of enumerating total Vibrio spp. in aquaculture
studies have shown that the inhibitory activity and systems. Since T1N3 is a non- selective medium, all the
selectivity of this medium vary considerably with different species of Vibrio including metabolically injured cells grow
Au

batches and brands [9,10]. Metabolically injured Vibrios
may not grow on TCBS agar. Even Vibrio strains that are
isolated on TCBS agar may become non-culturable after
stress. Even though TCBS is a highly selective medium,
some times non-vibrios may also grow on TCBS agar.
Therefore, there is a need for the development of
alternative method for quantification of Vibrios in the
aquaculture environment. Eiler et al. [17] have developed a
method which combines quantitative competitive PCR
(QC-PCR) with denaturant gradient gel electrophoresis
(DGGE) for the detection and quantification of Vibrio
population. Other molecular technique such as combina-
well on this medium. The results of this study show that the
oligonucleotide probe specific for the detection of Vibrio
genus would help in the accurate monitoring of Vibrio
density in the aquaculture and hatchery environments and
would be useful for predicting the possibility of outbreaks
of disease in shrimp hatchery and farm environments.
Acknowledgements
The authors thank the Department of Biotechnology,
Govt. of India, New Delhi for providing the financial
support.
 ARTICLE IN PRESS
P. Raghunath et al. / Molecular and Cellular Probes 21 (2007) 312–315
References
[1] Karunasagar I, Pai R, Malathi GR, Karunasagar I. Mass mortality
of Penaeus monodon larvae due to antibiotic resistant Vibrio harveyi
infection. Aquaculture 1994;128:203–9.
[2] Prayitno SB, Latchford JW. Experimental infections of crustaceans
with luminous bacteria related to Photobacterium and Vibrio—
effect of salinity and pH on infectiosity. Aquaculture 1995;132:
105–12.
[3] Vandenberghe J, Lib Y, Verdoncka L, Lib J, Xub HS,
Swings J. Vibrios associated with Penaeus chinensis (Crustacea:
Decapoda) larvae in Chinese shrimp hatcheries. Aquaculture
1998;169:121–32.
[4] Sudheesh PS, Xu HS. Pathogenicity of Vibrio parahaemolyticus in
tiger prawn Penaeus monodon Fabricius: possible role of extracellular
proteases. Aquaculture 2001;196:37–46.
[5] Leangphibul P, Nilalul C, Sornchai C, Tantimavanich C, Kasem-
suksakul K. Investigation of pathogenic bacteria from shrimp farms.
J Kasetsart Sci 1985;7:171–99.
[6] Lighter DV. Diseases in penaeid shrimp. In: Sinderman CJ,
Lightner DV, editors. Disease diagnosis and control in North
American marine aquaculture. 2nd ed. Amsterdam: Elsevier; 1988.
p. 8.
[7] Ruangpan L, Kitao T. Vibrio bacteria isolated from black tiger
shrimp, Penaeus monodon Fabricius. J Fish Dis 1991;14:383–8.
[8] Nash G, Nithimathachoke C, Tungmandi C, Arkarjamorn A,
Prathanpipat P, Ruamthaveesuv P. Vibriosis and its control in pond
reared Penaeus monodon in Thailand. In: Shariff M, Subasinghe RP,
Arthur JR, editors. Diseases in Asian aquaculture I. Manila,
Philippines: Fish Health Section, Asian Fisheries Society; 1992.
p. 143–55.
rs
[9] McCormack WM, DeWitt WE, Bailey PE, Morris GK, Socharjono
P, Gangarosa EJ. Evaluation of thiosulfate citrate bile salt sucrose
agar, a selective medium for the isolation of Vibrio cholerae and other
pathogenic vibrio. J Infect Dis 1974;129:497–500.
pe
o r's
th
Au
315
[10] Nicholls KM, Lee JV, Donovan TJ. An evaluation of commercial
thiosulphate citrate bile salt sucrose agar (TCBS). J Appl Bacteriol
1976;41:265–9.
[11] Roberts NC, Seidler RJ. Methods for monitoring vibrios in the
environment. In: Colwell RR, editor. Vibrios in the environment, vol.
18. USA: Wiley-Interscience, Publications; 1984. p. 269–75.
[12] Dauga C. Evolution of the gyrB gene and the molecular phylogeny of
Enterobacteriaceae: a model molecule for molecular systematic
studies. Int J Syst Evol Microbiol 2002;52:531–47.
[13] Fukushima M, Kakinuma K, Kawaguchi R. Phylogenetic analysis of
py
Salmonella, Shigella, and Escherichia coli strains on the basis of the
gyrB gene sequence. J Clin Microbiol 2002;40:2779–85.
[14] Food and Drug Administration. Bacteriological analytical manual on
line. Food and Drug Administration, 8th ed. Revision A, 1998.
co
Arlington, VA: AOAC International; 2004 [chapter 9]. /http://
www.cfsan.fda.gov/ebam/bam-toc.htmlS.
[15] Elliot EL, Kaysner AC, Tamplin ML. V. cholerae, V. parahaemoly-
ticus, V. vulnificus and other Vibrio spp. In: Bacteriological analytical
manual online, 9th ed. US FDA Centre for Food Safety and Applied
Nutrition, 2001 [chapter 9]. Available at: /http://vm.cfsan.fda.gov/
_ebam/bam-toc.htmlS.
[16] Ottaviani D, Masini L, Bacchiocchi S. A biochemical protocol for the
al
isolation and identification of current species of Vibrio in seafood.
J Appl Microbiol 2003;95:1277–84.
[17] Eiler A, Johansson M, Bertilsson S. Environmental influences on
Vibrio populations in northern temperate and boreal coastal waters
on
(Baltic and Skagerrak Seas). Appl Environ Microbiol 2006;72:
6004–11.
[18] Thompson JR, Randa MA, Marcelin LA, Mitchell AT, Lim E,
Polz MF. Diversity and dynamics of a North Atlantic coastal Vibrio
community. Appl Environ Microbiol 2004;70:4103–10.
[19] Thompson FL, Gevers D, Thompson CC, Dawyndt P, Naser S,
Hoste B, et al. Phylogeny and molecular identification of Vibrios on
the basis of multilocus sequence analysis. Appl Environ Microbiol
2005;71:5107–15.