This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
 Author's personal copy

Veterinary Parasitology 191 (2013) 143–145

Contents lists available at SciVerse ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

Short communication

Naturally occurring infections of cattle with Theileria lestoquardi and

sheep with Theileria annulata in the Sudan
K.M. Taha a , D.A. Salih b,∗ , A.M. Ali c , R.A. Omer d , A.M. El Hussein e
a
Atbara Veterinary Research Laboratory (AVRL), P.O. Box 121, Atbara, Sudan
b
Kassala Veterinary Research Laboratory (KVRL), P.O. Box 237, Kassala, Sudan
c
Faculty of Veterinary Medicine, University of Khartoum, Sudan
d
Veterinary Research Institute, P.O. Box 8067, Khartoum, Sudan
e
Animal Resources Research Corporation, P.O. Box 610, Khartoum, Sudan

a r t i c l e i n f o a b s t r a c t

Article history: Theileria annulata is endemic in northern Sudan, hindering all efforts at upgrading cattle for
Received 23 April 2012 milk production. T. lestoquardi clinical cases occur throughout the year and causes annual
Received in revised form 29 July 2012
outbreaks that result in substantial losses in sheep. In the northern Sudan both cattle and
Accepted 2 August 2012
small ruminants are frequently raised together and/or share common grazing grounds at
river banks. In an attempt to evaluate field cross infectivity of Theileria lestoquardi and
Keywords:
T. annulata in cattle and sheep respectively, a PCR analysis was carried out on samples
Cattle
Cross-infection collected from closely reared sheep and cattle using both T. annulata and T. lestoquardi
Theileria annulata specific primers. A total of 19 sheep out of 51 (37.3%) were positive for T. lestoquardi while
Theileria lestoquardi four sheep (7.8%) showed T. annulata specific amplicons. A total of 38 out of 52 (73.1%)
Sudan surveyed cattle were PCR positive for T. annulata and only two (3.8%) showed T. lestoquardi
Sheep specific bands. These findings indicate complex epidemiology of both infections in areas
where both parasites are transmitted by the same vector and call for further investigations
of this phenomenon.
© 2012 Elsevier B.V. All rights reserved.

1. Introduction phylogenetically. Schizont infected lymphocytes of

Theileriosis is an infectious non-contagious tick-borne
protozoan disease transmitted by species of ticks of the
family Ixodidae (Dolan, 1989). In northern Sudan the
pathogenic parasite species for cattle is Theileria annulata,
while that for small ruminants (sheep and goats) is Theile-
ria lestoquardi (El Hussein et al., 2004). Prevalence of these
diseases is associated with the distribution of the vector
(Dolan, 1989). Hyalomma anatolicum is considered as the
main field vector of tropical theileriosis as well as of malig-
nant ovine theileriosis in Sudan (Um El Hussan et al., 1983).
These two species of parasite are closely related
morphologically, biologically, antigenically and
∗ Corresponding author. Tel.: +249 912649292; fax: +249 183 380011.
E-mail address: diaeldin2000@hotmail.com (D.A. Salih).
both parasite species can be cultured in vitro (Brown,
1987) and showed antigenic cross reactivity in the indirect
fluorescent antibody test (IFAT) (Leemans et al., 1997). In
addition, T. annulata sporozoites can infect sheep periph-
eral blood mononuclear cells (PBMC) in vitro (Entrican
et al., 1991). However, experimentally, Brown et al. (1998)
failed to transmit T. lestoquardi to Holstein-Friesian calves
by cell culture inoculation but inoculation of T. annulata
infected cell lines into sheep or goats induced a clear
disease in sheep and a milder picture in goats. Similarly,
Leemans et al. (1999a,b) also showed that T. lestoquardi
was unable to infect cattle, while T. annulata could infect
sheep causing mild clinical disease.
In northern Sudan, a diversity of tick species occurs
including H. anatolicum the proven vector of T. annulata
and T. lestoquardi (Ahmed et al., 2003). Tropical theileriosis
and malignant ovine theileriosis in this area are considered

0304-4017/$ – see front matter © 2012 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.vetpar.2012.08.003
 Author's personal copy
144 K.M. Taha et al. / Veterinary Parasitology 191 (2013) 143–145
the major diseases of cattle and sheep causing mortality,
respectively (El Ghali and El Hussein, 1995). Furthermore,
tropical theileriosis was shown to cause substantial eco-
nomic losses to dairy farms (Gamal and El Hussein, 2003).
Routine diagnosis of both diseases has depended on micro-
scopic examination, and the species of Theileria identified
purely on the basis of the host animal from which the sam-
ple was obtained. However, there are now PCR based tests
(Allsopp et al., 1993) to define each species, so that it is
possible to assess whether these two species of Theileria
are wholly host specific in natural field infections.
A recently published report indicated natural infection
of sheep with T. annulata in Iran (Zaeemi et al., 2011).
However, no published reports are available that indicated
natural infection of cattle with T. lestoquardi. The present
study aimed at determining the occurrence of natural cross
infections of T. lestoquardi in cattle and T. annulata in sheep
in River Nile State, northern Sudan using PCR analysis.
2. Materials and methods
2.1. Field sampling
Surveillance was carried out in and around Atbara Town,
River Nile State, Sudan. Targeted animals were sheep and
cattle (local Butana zebo) reared together and/or grazed in
the same pasture. Apparently healthy sheep (51 samples)
and cattle (52 samples) were sampled by spotting of ear
vein blood onto filter papers (Whatman No. 3).
2.2. PCR amplification
For T. lestoquardi, the forward primers used
was -5 GTGCCGCAAGTGAGTCA3 (T. lestoquardi
specific forward) and the reverse primer was
5 GGACTGATGAGAAGACGATGAG3 (T. lestoquardi spe-
cific reverse) generating an amplicon of 730 bp. For T.
annulata, the primers used were SSU rRNA gene 989
5 AGTTTCTGACCTATCAG3 and the reverse primer was
1347 5 TGCACAGACCCCAGAGG3 giving an amplicon of
370 bp.
The PCR reactions were performed in a total volume of
50 ␮l as follows: 25 ␮l Green master mix, containing dNTPs,
PCR buffer and Taq polymerase (Fermentas, Germany),
16 ␮l H2 O, 2 ␮l of each primer at a dilution of 10 pmol
(Allsopp et al., 1993) and 5 ␮l genomic DNA. The thermo
cycler program for T. lestoquardi was as follows: 94 ◦ C for
3 min, then 35 cycles at 94 ◦ C for 1 min, 52 ◦ C for 1 min,
and 72 ◦ C for 1 min, a final extension step 72 ◦ C for 7 min,
and then held at 4 ◦ C. While for T. annulata, the cycling
program was the same as above with exception that the
annealing temperature was raised to 55 ◦ C. In each run,
positive and negative controls were included. The positive
controls were DNA extracted from a T. lestoquardi and T.
annulata cell lines, while the negative control was distilled
water.
The amplified fragments were separated by elec-
trophoresis on 1.5% agarose gels. A volume of 5 ␮l from
each PCR reaction (containing the loading dye) was loaded
on the agarose gel. A volume of 5 ␮l of 100 bp DNA-ladder
(Roth, Germany) was also loaded. The separated fragments
Table 1
Results of molecular surveillance of cattle and sheep for T. lestoquardi and
T. annulata.
Parasite spp. Animal species
Cattle (N 52) Sheep (N 51)
T. annulata 36 (69%) 0
T. lestoquardi 0 15 (29.5%)
Mixed infection 2 (3.8%) 4 (7.8%)
Total 38 (73.1%) 19 (37.2%)
were viewed using a UV-transilluminator and the results
were documented.
2.3. Verification of amplicons
Amplified fragments corresponding to the size pre-
dicted for T. lestoquardi from one sample taken from
infected sheep were purified using a PCR purification kit
(GeneJET, Fermentas, Germany). Similarly amplified frag-
ments of the size predicted for T. annulata from two
samples taken from infected cattle were also purified. The
PCR fragments were then sequenced directly by MWG
(Germany) to confirm the identity of the PCR products.
3. Results and discussion
The cattle and sheep DNA extracted from blood samples
were investigated by PCR using sets of primers specific for
either T. lestoquardi or T. annulata and the results are sum-
marised in Table 1. Nearly 30% of the sheep samples were
positive for T. lestoquardi of which 4 (7.8%) samples were
positive for both Theileria species. The majority of cattle
samples (69%) were positive for T. annulata (Table 1) but
two samples (3.8%) were also positive for T. lestoquardi.
These results showed that transmission and infection of
sheep with T. annulata and cattle with T. lestoquardi occurs
under field conditions. The only sheep or cattle samples
containing T. annulata or T. lestoquardi infections respec-
tively, were also infected with the host ‘specific’ Theileria
species as well (Table 1).
In order to confirm the specificity of the PCR analysis, the
730 bp amplicons obtained from one of the sheep samples
and the 370 bp amplicons from two of cattle samples were
sequenced. The identity of the PCR products was confirmed
as T. annulata or T. lestoquardi and these results establish the
specificity of the PCR reactions. GenBank accession num-
bers for T. lestoquardi is JN675226, while those of T. annulata
are JN675224 and JN675225.
T. annulata and T. lestoquardi in cattle and sheep respec-
tively are widespread in northern Sudan. Both infections
are transmitted by the same vector (H. anatolicum) and in
most of these areas both cattle and sheep are raised close
to each other (Salih et al., 2003, 2009).
Detection of the parasites T. lestoquardi in cattle and T.
annulata in sheep in the field is likely to reflect an accu-
rate picture of the susceptibility of the two hosts to the
two species of Theileria. The present detection of T. annu-
lata in sheep and T. lestoquardi, albeit at lower rates (3.8%);
in cattle indicates the susceptibility of sheep and cattle
to infection with these parasites, respectively. Given the
 Author's personal copy
K.M. Taha et al. / Veterinary Parasitology 191 (2013) 143–145
observed prevalence of the two Theileria species in their
normal hosts, the lower level of cross host species infec-
tions suggests that susceptibility of cattle to T. lestoquardi
and sheep to T. annulata is low. Our findings are sup-
ported by those of Taha (2009) who reported successful
experimental transmission of T. lestoquardi to cattle and T.
annulata to sheep using infected ticks. Our data also agree
with those of Salih et al. (2003) who detected T. annulata
antibodies in Sudanese sheep with a prevalence rate of
9.3%. Moreover, the current results are comparable with
those of Zaeemi et al. (2011) who detected T. annulata by
PCR-RFLP in apparently healthy sheep in Iran.
The relatively higher prevalence of T. annulata in sheep
compared to the prevalence of T. lestoquardi in cattle sup-
ports the results of Leemans et al. (1998). These authors
concluded that previous infection of cattle with T. annu-
lata led to the development of cross immunity against T.
lestoquardi, while immunity against T. annulata that devel-
oped in sheep due to previous infection with T. lestoquardi
was less marked. These authors also succeeded in growing
cell culture lines of T. annulata from five out of six naïve
sheep but were unable to induce growth from challenged
sheep (Leemans et al., 1998). As the sampled animals were
apparently healthy, the current survey only indicates a car-
rier status but this may not reflect the pathogenicity of the
parasites during acute infection.
The results reported here may raise the possibility
of sheep acting as a reservoir of T. annulata and cattle
acting as a reservoir of T. lestoquardi under field condi-
tions in Sudan. This remains to be definitely determined
through experimental studies in which clean ticks fed on
sheep or cattle infected with both Theileria species are
used to test transmission of the infection to the other
host.
Interestingly no single infection with T. lestoquardi or
with T. annulata was detected in cattle or sheep, respec-
tively and only animals infected with both species were
observed. The reasons for this are not clear but exami-
nation of more samples from the field could clarify this
finding.
Clinical infections under natural conditions due to T.
lestoquardi in cattle or T. annulata in sheep have not
been documented. However, it was recently shown that T.
annulata may produce mild clinical symptoms in sheep fol-
lowing experimental infection and that T. lestoquardi may
also do the same in cattle (Taha, 2009). Hence, the present
findings may highlight the need to investigate the role
played by dual infections in cases of frank clinical diseases
of malignant ovine theileriosis and tropical theileriosis,
both experimentally and under field conditions. Further-
more, as both T. annulata and T. lestoquardi are known to
share common antigens, it would be worth investigating
the effects of cross protection induced by each species and
the role this might play in the epidemiology of the diseases
caused by these parasites.
Finally, the results of the present report and the find-
ings by Zaeemi et al. (2011), suggest that cross infection of
cattle with T. lestoquardi and sheep with T. annulata may
occur whenever both parasites and common competent
vector coexist in the same area. This should call for further
investigation into this phenomenon.
145
Acknowledgments
This work was supported in part by DFG project
“Molecular epidemiology network for promotion and
support of delivery of life vaccines against Theileria parva
and T. annulata infection in Eastern and Northern Africa”
(AH 41/7-1). The authors are indebted to Prof. Andrew
Tait, Glasgow University, for revising the manuscript. This
work is published by the kind permission of the Director
General of the Animal Resources Research Corporation
(ARRC), Khartoum, Sudan.
References
Ahmed, B.M., El Hussein, A.M., El Ghali, A., Salih, D.A., 2003. Some Studies
on the epidemiology of ovine theileriosis in River Nile State, Northern
Sudan. J. Anim. Vet. Adv. 2, 681–685.
Allsopp, B.A., Bayliss, H.A., Allsopp, M.T.E.P., Cavalier-smith, T., Bishop,
R.P., Carrington, D.M., Sohanpal, B., Spooner, P., 1993. Discrimina-
tion between six species of Theileria using oligonucleotide probes
which detect small subunit ribosomal RNA sequences. Parasitology
107, 157–165.
Brown, C.G., 1987. Theileriidae. In: Taylor, A.E.R., Baker, H.R. (Eds.), In
Vitro Methods for Parasite. Cultivation. Academic Press, London, pp.
230–253.
Brown, C.G., Ilhan, T., Kirvar, E., Thomas, M., Wilkie, G., Leemans, I., Lee-
mans, I., Hooshmand-Rad, P., Uggla, A., 1998. The indirect fluorescent
antibody test based on schizont antigen for the study of the sheep
parasite Theileria lestoquardi. Vet. Parasitol. 69, 9–18.
Dolan, T.T., 1989. Theileriosis: a comprehensive review. Revue Scientifique
et Technique (International Office of Epizootics). Rev. Sci. Tech. Off. Int.
Epiz. 8, 11–36.
El Ghali, A., El Hussein, A.M., 1995. Diseases of livestock in EdDamer
Province, El Nil State, Sudan: a two-year retrospective study. Sud. J.
Vet. Sci. Anim. Husb. 34, 37–45.
El Hussein, A.M., Majid, A.A., Hassan, S.M., 2004. The present status of
tick-borne diseases in the Sudan. Country reports. Archs. Inst. Pasteur
Tunis 81, 1–4.
Entrican, G., McInnes, C.J., Logan, M., Preston, P.M., Martinod, S., Brown,
C.G.D., 1991. Production of interferons by bovine and ovine cell lines
infected with Theileria annulata or Theileria parva. Parasite Immunol.
13, 339–343.
Gamal, A., El Hussein, A.M., 2003. Economic impact of Theileriosis on a
dairy farm in River Nile State. Sud. J. Vet. Sci. Anim. Husb. 42, 268–373.
Leemans, I., Hooshmand-Rad, P., Uggla, A., 1997. The indirect fluorescent
antibody test based on schizont antigen for the study of the sheep
parasite Theileria lestoquardi. Vet. Parasitol. 69, 9–18.
Leemans, I., Brown, D., Fossum, C., Hooshmand-Rad, P., Kirvar, E., Wilkie,
G., Uggla, A., 1999a. Infectivity and cross-immunity studies of Theileria
lestoquardi and Theileria annulata in sheep and cattle II. In vitro studies.
Vet. Parasitol. 82, 193–204.
Leemans, I., Brown, D., Hooshmand-Rad, P., Kirvar, E., Uggla, A., 1999b.
Infectivity and cross-immunity studies of Theileria lestoquardi and
Theileria annulata in sheep and cattle I. In vivo responses. Vet. Parasitol.
82, 179–192.
Leemans, I., Hooshmand-Rad, P., Brown, C.G.D., Wilkie, G., Uggla, A., 1998.
In Vitro infectivity and In vivo cross-protectivity of Theileria lestoquardi
and T. annulata in sheep and cattle. Annu. N.Y. Acad. Sci. 849, 408–411.
Salih, D.A., El Hussein, A.M., Hayat, M., Taha, K.M., 2003. Survey of Thei-
leria lestoqurdi antibodies among Sudanese sheep. Vet. Parasitol. 111,
361–367.
Salih, D.A., Abdel Rahman, M.B., Mohammed, A.S., Ahmed, R., Kamal, S., El
Hussein, A.M., 2009. Use the “Insert Citation” button to add citations
to this document. Sero-prevalence of tick-borne diseases antibodies
among cattle in the Sudan. Parasitol. Res. 104, 845–850.
Taha, K.M., 2009. Experimental transmission of Theileria lestoquardi and
Theileria annulata (Apicomplexa: Theileridae) and their cross trans-
mission between cattle and sheep. Ph.D. Thesis. Sudan Academy of
Science, p. 89.
Um El Hussan, M., Jongejan, F., Morzaria, S.P., 1983. Notes on the trans-
mission of Theileria annulata by Hyalomma ticks in the Sudan. Vet. Q.
5, 112–113.
Zaeemi, M., Haddadzadeh, H., Khazraiinia, P., Kazemi, B., Bandehpou, M.,
2011. Identification of different Theileria species (Theileria lestoquardi,
Theileria ovis, and Theileria annulata) in naturally infected sheep using
nested PCR-RFLP. Parasitol. Res. 108, 837–843.