PRODUCTION, MODELING, AND EDUCATION

Computational modeling and preliminary iroN, fepA, and cirA gene expression
in Salmonella Enteritidis under iron-deficiency-induced conditions1

Lina J. Zárate-Bonilla,*† Patricia del Portillo,*2 Homero Sáenz-Suárez,‡

Janneth Gonzáles-Santos,§ George E. Barreto-Sampaio,§ Raúl A. Poutou-Piñales,†2
Andrés Felipe Rey,# and Jairo Guillermo Rey#

*Corporación CorpoGen, 110231, Bogotá, DC, Colombia; †Laboratorio de Biotecnología Molecular,

Grupo de Biotecnología Ambiental e Industrial (GBAI), Departamento de Microbiología, Facultad de Ciencias,
Pontificia Universidad Javeriana, 110-23, Bogotá, DC, Colombia; ‡Unidad de Biología Celular y Microscopía,
Decanato de Ciencias de la Salud, Universidad Centroccidental Lisandro Alvarado, 3001, Barquisimeto, Venezuela;
§Grupo de Bioquímica Computacional y Estructural, Departamento de Bioquímica y Nutrición,
Facultad de Ciencias, Pontificia Universidad Javeriana, 110-23, Bogotá, DC, Colombia;
and #FINMARK Laboratories SA, 111211, Bogotá, DC, Colombia

ABSTRACT Salmonellosis outbreaks in Europe, the determine chelating-agent addition timing to augment
United States, and Latin America have been associat- relative gene expression. Two antigenic peptides locat-

Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014

ed with contaminated food derivatives including meat ed at the external face of each protein and 2 typical
from the poultry industry. Salmonella grown under domains of iron-regulated outer-membrane proteins,
iron-limiting conditions has the capability to increase plug and TonB-dep-Rec, were identified from the 3-di-
concentration of several iron-regulated outer-membrane mensional models. Tryptone was selected as the best
proteins to augment the acquisition of the metal. These nitrogen source based on growth rate (µx = 0.36 h−1)
proteins have been proved to have immunogenic prop- and biomass productivity (Px = 0.9 g·h−1·L−1) as de-
erties. Our aim was to increase the relative expression termined by a general factorial design. Optimum tim-
of iroN, fepA, and cirA in Salmonella Enteritidis do- ing for chelating agent addition was in the middle of
mestic strain. Furthermore, we proposed a 3-dimen- the log phase, which allowed relative expressions at 4
sional structure model for each protein to predict and h of culture. Increase in iroN, fepA, and cirA relative
locate antigenic peptides. Our eventual objective is to expression was favored by the length of log phase and
produce an effective vaccine against regional avian sal- the addition of chelating agent, which decreased chelat-
monellosis. Two simple factorial designs were carried ing toxicity and enhanced cell growth rate.
out to discriminate between 2 nitrogen sources and
Key words: Salmonella Enteritidis, computer modeling, iroN, fepA, cirA,
iron-regulated outer-membrane protein, iron deficiency condition
2014 Poultry Science 93:221–230
http://dx.doi.org/10.3382/ps.2012-02993

INTRODUCTION However, under oxygenic conditions at neutral pH, iron

Bacterial iron acquisition is essential for Salmonella
spp. survival and growth within its host (Andrews et
al., 2003). Iron is soluble under anaerobic conditions
at physiological pH, favoring bacterial iron acquisition.
©2014 Poultry Science Association Inc.
Received December 18, 2012.
Accepted August 15, 2013.
1 Disclosure statement: The FINLAB broth was designed specially
for the cultivation of Salmonella strains by the research staff of FIN-
MARK Laboratories SA, Bogotá, DC, Colombia; they consider it as
know-how and do not want to reveal its composition.
2 Corresponding author: pdelportillo@corpogen.org or rpoutou@ja-
veriana.edu.co
in the form of Fe3+ forms insoluble hydroxides, making
the metal less accessible. To obtain iron, the bacte-
rial pathogen secretes siderophores, which chelate Fe3+
with high affinity and specificity, even when bound
to host proteins transferrin and lactoferrin (Miethke
and Marahiel, 2007). The bacteria then recover the Fe-
siderophore complex through specific receptors on the
outer membrane (Sood et al., 2005a), a mechanism that
is common among Enterobacteriaceae (Andrews et al.,
2003; Rabsch et al., 2003).
Iron limitation induces the expression of iron-regu-
lated outer-membrane proteins (IROMP). These pro-
teins have immunogenic properties and induce a strong
antibody response, and thus have been used for vac-

221
222 Zárate-Bonilla et al.
cines (Chanana et al., 2006). Outer membrane proteins
regulated by iron have been described in different bac-
terial species such as Salmonella enterica serovar Typhi
(Sood et al., 2005a,b), Pasteurella multocida (Snipes et
al., 1988), Nesisseria meningitidis (Banerjee-Bhatnagar
and Frasch, 1990), Escherichia coli (Allan et al., 1993),
Helicobacter pylori (Worst et al., 1995), and Hemophi-
lus parainfluenzae (Morton and Williams, 1989).
There are currently 2 inactivated vaccines based on
IROMP overexpression: the first contains Salmonella
Enteritidis (Woodward et al., 2002), and the second
one contains a mixture of Salmonella Enteritidis and
Salmonella Typhimurium. For both vaccines, micro-
organisms are grown under iron deficiency conditions
(Clifton-Hadley et al., 2002). These vaccines have prov-
en to be highly immunogenic and protective against
salmonellosis. Thus, they have been considered an ef-
fective option in the control of avian illness (Gast and
Beard, 1993; Nakamura et al., 1994).
The poultry industry in Colombia is one of the most
dynamic economic activities, occupying the sixth posi-
tion in the continent for chicken production and the
fourth for egg production (Zárate-Bonilla, 2009). Con-
sidering not all Salmonella strains behave similarly
under iron-limiting conditions, and native circulating
strains can be more effective for vaccine preparations,
the main objective of this preliminary research was to
assay the increase in iroN, fepA, and cirA relative gene
expression in a domestic Salmonella Enteritidis strain.
Furthermore, we proposed a 3-dimensional (3D) struc-
ture model for the immunogenic IROMP proteins IroN,
FepA, and CirA to predict or locate possible antigenic
peptides. Future work aims to produce a recombinant
or synthetic vaccine against domestic avian salmonel-
losis.
MATERIALS AND METHODS
Selection and Bioinformatical Analysis
of Genes Coding for IROMP
The IROMP genes from Salmonella spp. sequences
were compared with all nonredundant data retrieved
from GenBank database using Basic Local Align-
ment Search (BLAST). As reference genes, we used
sequences from Salmonella enterica ssp. Enterica se-
rovar Enteritidis str. P125109 [National Center for
Biotechnology Information (NCBI) accession number
AM933172, Thomson et al., 2008]. Forty-three sequenc-
es were selected to run a multiple alignment (Larkin et
al., 2007). Through multiple sequence alignment, we
identified sequence motifs, which are IROMP signature.
By using P-fam (Finn et al., 2008), we determined con-
served domains. Analysis of amino acid (aa) distribu-
tion within the IROMP family displayed the role of
highly conserved residues within specific domains. We
obtained a consensus sequence for each gene. Patterns
and conserved regions were identified for each consen-
sus sequence.
Native Strain Nucleic Acid Extraction,
Quantification, and Sequencing
of Selected Genes
Bacterial DNA extraction was performed with proD-
NA-Kit (CorpoGen, Bogotá, Colombia). Bacterial
RNA extraction was carried out with chaotropic agents
(RNA extraction kit, CorpoGen; Zárate-Bonilla, 2009).
Nucleic acid purity and concentration were determined
by using Nanodrop (Thermo Scientific NanoDrop 2000,
Wilmington, DE). Genes encoding IROMP proteins
were amplified by PCR from the native strain, using
primers and conditions described in Table 1. The am-
plicons obtained were purified and sequenced in Macro-
gen Inc., Seoul, Korea. The assembled sequence analy-
sis was performed using Sequencher 4.1.0 (Ann Arbor,
MI).
Secondary-Structure Prediction
Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014
Secondary structures of target proteins were predict-
ed by using 7 secondary-structure prediction programs
corresponding to different prediction methods (Garnier
et al., 1978; Levin et al., 1986; Deléage and Roux, 1987;
Geourjon and Deléage, 1994, 1995; Frishman and Ar-
gos, 1996; Garnier et al., 1996; King and Sternberg,
1996). Based on the results, a consensus prediction was
calculated according to a simple majority vote type
procedure.
IROMP Molecular Modeling
Because crystal structures for IroN, FepA, and CirA
proteins have not been previously determined, BLAST
sequence analysis was performed against the complete
protein data bank to detect homologous/analogous pro-
tein templates by matching the whole-chain sequences
of target proteins to resolved protein structures. Mul-
tiple sequence alignment was performed by Clustal W2
(EMBL-European Bioinformatics Institute, Hinxton,
Cambridge, UK). Three-dimensional structure models
were generated by the biopolymer homology modeling
software Esypred3D (Lambert et al., 2002).
Following this approach, the generated model was
validated using PROCHECK (Laskowski et al., 1993)
and compared with the previous secondary structure.
The aim of PROCHECK was to assess residue geom-
etry for a given protein structure compared with stereo-
chemical parameters of well-refined and high-resolution
structures.
Antigenicity Profile Analysis
Each protein sequence was processed by Antibody
Epitope Prediction (http://tools.immuneepitope.org/
tools/bcell/iedb_input) using the Kolaskar and Ton-
gaonkar antigenicity algorithm (Kolaskar and Ton-
gaonkar, 1990). Antigenic regions were identified and
mapped on the tertiary structure model for each pro-
 COMPUTATIONAL MODELING AND GENE EXPRESSION 223
Table 1. Primers used in the study
Gene Primer1 Sequence (5′ to 3′)

iroN Amplification CiroNUP AGCGACGGGCATAATCCA

CiroNLO TGTGAGCTTGAGGGCAACAG
Sequencing ciroNUPS CGCGCCGACGGTGA
ciroNLOS CAGCGGCGAGGTGAATGT
fepA Amplification CfebUP CCGAATGAGGGAGGGAAG
CfebLO CGTGATGGCGGAAGACAA
Sequencing cfebUPS GCTCACTTCGCTGTGTAGGG
cfebLOS GCCGATGCCGATTTGA
cirA Amplification CcirUP CGGCTGTCTGGATGTGA
CcirLO TGCTTATCTGGTTCGGCTAC

Primer2
iroN Expression iroNup CGCACTGATTTCCGATTTATTT
iroNlowNEW GTCCCGGTGATATGGCTATTT
fepA fepAup TGGGCTGACCGCTTGCT
fepAlow GAACGCCTGTCGATTATTCCAC
cirA cirAup CGCCACTCATCTTCAAGGAACA
cirAlow AGCCCTATCACGTCAGAAAGCA
gyrB gyrBup CGTCGATAGCGTTATCTACC
gyrBlow GTCGAATTCTTATGACTCCTCC
1Primers to amplify and sequence the genes iroN, fepA, and cirA from the native strain Salmonella Enteritidis.
Amplification conditions: 95°C for 5 min; 40 cycles (95°C for 45 s, 60°C for 45 s, 72°C for 3 min); 72°C for 10 min.

Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014

2Primers designed for analysis of expression by quantitative reverse-transcription PCR. Amplification condi-
tions: denaturation 95°C for 10 min; Amplification 40 cycles (95°C for 10 min; 57°C for 10 min; 72°C for 20 min;
82°C); melting curve 95°C, 65°C-55 s, 95°C. Cooling 40°C-30 s.

tein regardless of the hydrophobicity of the region, us-
ing PyMol software version 1.4.1. (DeLano Scientific
LLC, Portland, OR).
Strain, Improvement of Culture Media,
and Expression of cirA, fepA, and iroN
Genes Under Iron Deficiency Conditions
Salmonella enterica serovar Enteritidis (native isolate
provided by Finmark Laboratories SA, Colombia) was
isolated from poultry in the city of Fómeque Cundina-
marca, Colombia. For a previous study (unpublished
data) we determined tryptone was the principal organ-
ic nitrogen source influencing this strain’s growth. For
this study, we used a general factorial design (simple
design; Duque-Jamaica et al., 2010) performed with 2
levels of only one categorical factor (21 × 6) to dis-
criminate between tryptone (15 g/L) and tryptone T
broth at 15 g/L. All nutrients were purchased from
Oxoid, Thermo Scientific, Hampshire, UK. Cultures
were grown at 37°C at 150 rpm with an effective work-
ing volume of 1/5 of the shake flask. Growth kinet-
ics were monitored every 2 h by measuring OD600nm
(optical density at 600 nm) and transformed into dry
weight by using a calibration curves (OD600nm vs. dry
weight) [equation 1]. McFarland [equation 2] was used
to calculate dry biomass concentration (g/L) and cell/
mL concentration, respectively. To establish growth log
phase, cells per milliliter were transformed according
to equation 3. To determine biomass productivity of
P(x), equation 4 was used. SigmaPlot V-11.0 was used
for kinetic behavior graphs, and factorial designs were
analyzed using Design-Expert V-8.0.5 software.
OD600nm = 0.1872X + 0.1215; R2 = 0.9905; [1]
OD600nm = 0.51267 × 10−3X + 0.03768;
R2 = 0.9875; and [2]
log10 (X/X0), [3]
where X is the concentration (cell/mL) at different
times of culture and X0 is the concentration (cell/mL)
at the beginning of the culture (Duque-Jamaica et al.,
2010).
Px = dry biomass(g/L)/(culture − Timehour). [4]
The cirA, fepA, and iroN gene induction was performed
by addition of deferoxamine mesylate (Novartis-Colom-
bia) at 50 µM at different times during growth: in the
beginning of culture (0 h), during the middle of log
phase (2.5 h of culture), and at the end of log phase
(5 h). A second general factorial design (simple design;
Duque-Jamaica et al., 2010) was performed with 3 lev-
els of only one categorical factor (31 × 6) to identify the
optimal time for chelating agent addition. Salmonella
enterica serovar Enteritidis (native strain) was grown
in FINLAB broth (Finmark Laboratories SA) supple-
mented with the selected nitrogen source for normal
and iron deficiency conditions (in the presence of the
chelating agent). Experiments were carried out in du-
plicate in an effective working volume of 1/5 of the
shake flask at 37°C and 150 rpm. Bacterial growth was
monitored by OD600nm. Data were replaced in equation
1 to obtain dry biomass (g/L). Culture samples were
taken at 4, 8, and 10 h, centrifuged at 4,000 × g for 15
224
min at 25°C. The RNA was extracted from pellets for
synthesis of cDNA and analysis of gene expression by
quantitative reverse-transcription PCR (qRT-PCR).
Quantification of cirA, fepA, and iroN
Relative Expression
Total RNA was extracted from culture samples at 4,
8, and 10 h with 2 biological replicates for each con-
dition (normal and iron deficiency cultures). Samples
were treated with DNase (RQ1 DNase; Promega, Bo-
gotá, Colombia) and then subjected to reverse tran-
scription generating cDNA (SuperScrip III, Roche, Bo-
gotá, Colombia). From each cDNA 3 replicates were
evaluated by qRT-PCR using specific primers designed
(Table 1) with SybrGreen as a product detector. Reac-
tions were run on a LightCycler (Roche), crossing point
(CP) was determined by using 4.05 version software.
Target gene rate of relative expression was determined
by comparing with gyrB gene from Salmonella (which
codes for the β-subunit of the DNA gyrase), as a nor-
malizer gene and using equation 5, proposed by Pfaffl
W (Pfaffl, 2001; Bustin et al., 2005). Efficiency for each
primer pair taken from a standard curve was used for
comparison with the control culture for gene expres-
sion. Six replicate samples were used to obtain values
for relative expression. Statistical significance was de-
termined using the Mann-Whitney U tests; P < 0.05
was considered significant.
∆CP target(control−sample)
(E target )
RER =
∆CP ref (control−ssample)
(E ref )
where RER is the relative expression rate; Etarget is
the specific primer efficiency, Eref is reference primer
efficiency and ΔCP is the crossing point variation be-
tween control and sample. Control defined as the cul-
ture without a chelating agent.
RESULTS AND DISCUSSION
Selection and Bioinformatical Analysis
of Genes Coding for IROMP
Three single-copy IROMP genes were identified in
Salmonella’s spp. genome: the 2,181-bp iroN gene cod-
ing for a 724 aa protein (IroN), fepA gene (2,256 bp)
coding for a 751 aa FepA protein, and cirA (1,992
bp) coding for a 650 aa CirA protein. The molecular
weights for these proteins are 65, 78, and 85 kDa for
CirA, IroN, and FepA, respectively. All are catecholate-
type siderophores receptors.
Alignment studies for the iroN gene with respect to
Salmonella spp. revealed 100% identity as reported in
the NCBI database. However, fepA and cirA sequences
presented 100% identity for only 63% (10 out of 16)
Zárate-Bonilla et al.
strains reported in the NCBI database. In addition,
fepA and cirA genes were identified as a single copy
gene in other enteric strains such as E. coli BW2952
(NCBI accession number CP001396), with an identity
percentage of 76% for fepA and 78% for cirA. The high
identity found between the IroN, FepA, and CirA pro-
teins for our strain and those in Salmonella spp., and E.
coli increases the possibility of using the native strain
for a chicken vaccine preparation.
IROMP Primary Structure Analysis
As a result of multiple sequence analysis and Pfam
profiles searches, IROMP evidenced the presence of
2 conserved regions: a typical plug domain useful for
siderophore-iron complex binding, which allow its en-
try through the membrane and a TonBdep-rec do-
main, needed for active transport and binding site for
transmembrane protein TonB. This complex transmits
signals from the cytoplasm and provides the energy
Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014
required to internalize the complex, which, due to its
large side, cannot penetrate without the aid of IROMP
(Klebba, 2003; Oke et al., 2004). These domains were
selected for 3D structure modeling and antigenicity
profile (Figure 1).
Folding Pattern Determination
Results obtained from PFP-Pred, a protein fold pre-
diction server, described for IROMP an iron ion bind-
ing folding type model.
, [5]
Salmonella enterica Serovar
Enteritidis Native Strain iroN, fepA,
and cirA Sequencing
The BLAST analysis showed that the iroN, fepA,
and cirA genes from the native strain had 99% nu-
cleotide identity with the reference strain P125109.
Conceptual translation of iroN, fepA, and cirA
genes from the native strain generates proteins that
were compared with those reported at GenBank,
IroN (accession code WP_001653523), FepA (acces-
sion code WP_001034969), and CirA (accession code
YP_002147170). The identity found was 99% with 0%
of gaps and 100, 99, and 100% of positives for each
protein, respectively.
Secondary Structure Prediction
Consensus of 7 computer programs for IroN’s second-
ary structure prediction suggested a secondary struc-
ture composed of 7.32% α helices, and 62.15% β folds in
E. coli. For FepA, 10.52% α helices and 60.59% β folds
in E. coli. Last for CirA 11.23% presented α helices,
0.15 and 57.54% β folds in E. coli (Figure 2). This pre-
diction is in agreement with the predicted 3D structure.
 COMPUTATIONAL MODELING AND GENE EXPRESSION 225

Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014

Figure 1. I: Salmonella spp. iron-regulated outer-membrane protein tertiary structure model. Mature proteins visualized in Pymol 4.1. A: IroN
protein; B: FepA protein; and C: CirA protein. Tertiary structure showing plug domains (in red) and TonB-dep-Rec (in orange) localization. II:
Antigenicity site prediction. A1) Antigenicity sites predicted for IroN. The figure depicts amino acid regions from 364 to 380 and 439 to 449. B1)
Antigenicity sites predicted for FepA. The figure depicts amino acid regions from 368 to 388 and 675 to 687. C1) Antigenicity sites predicted for
CirA. The figure depicts amino acid regions from 306 to 320 and 515 to 527. III. Protein superposition. A2) Superposition 1FEP template against
FepA. The root mean square distance (RMSD) was 0.259 Å for 2,810 atoms. The template is in red, and FepA is in white. B2) Superposition
1FEP template against IroN. RMSD 0.284 Å for 2,453 atoms. The template is in gray, and IroN is in yellow. C2) Superposition 2HDI template
against CirA. The RMSD 0.303 Å for 2,294 atoms. The template is in purple, and CirA is in green.

Molecular Modeling quality of a model, and described the chance a given

To select a template to generate the IroN model we
performed a BLAST for the entire PDB. Ferric entero-
bactin receptor (1fep A) and Colicin I receptor Cir from
E. coli Crystal Structure primary structures displayed
the best scores. Furthermore, generated 3D-structure
models were similar to those templates with root mean
square distance values of 0.303, 0.259, and 0.284Å for
IroN, FepA, and CirA, respectively.
After homology modeling, to prevent residue side-
chain orientation problems, we used minimization algo-
rithms to obtain the lowest energy of residue side-chain
positions. To validate our approach and check refined
models, we used the Swiss-model structure assessment
tool to validate the predicted models. The QMEAN Z-
score corresponded to a measurement of the absolute
model might have compared with experimental struc-
tures. Models with low quality are expected to have
strongly negative values. To assess the geometry of the
residues in the models proposed, the stereochemical pa-
rameters were calculated (Tables 2 and 3).
The IroN had a 22 aa signaling peptide and showed
homology with 46 proteins with an experimentally de-
termined tertiary structure, with the ferric enterobactin
receptor (1fep A) and the colicin I receptor (2hdi A)
from E. coli, with the highest occurrence probability.
These molecules showed identities of about 10 and 51%,
similarities ranging from 0.172 to 0.853, and occurrence
probabilities ranging from 21.5 to 99.99%. The 3D
model for IroN presented a β-barrel protein composed
of 702 aa with 10 α helix regions, 58 β-sheet regions,
and coil regions (Figure 1-IA).
226 Zárate-Bonilla et al.

Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014

Figure 2. Secondary protein structure prediction of IroN (A), FepA (B), and CirA (C). Protein’s secondary structure was predicted after
establishing a consensus of the following programs: GOR I (Garnier et al., 1978, 1996), SOPMA (Geourjon and Deleage, 1995), SOPM (Geourjon
and Deleage, 1994), DPM (Deleage and Roux, 1987), DSC (King and Sternberg, 1996), PREDATOR (Frishman and Argos, 1996), and SIMPA96
(Levin et al., 1986). Helix (blue), beta (red), beta pleated (green), coil (yellow), ambiguous states (black).

The signal peptide for FepA included the first 24
aa. After alignment, the mature protein showed ho-
mology with other 46 proteins with tertiary structures
that were determined experimentally. These molecules
showed identities of about 10 to 81%, similarities rang-
ing from 0.146 to 1.296, and occurrence probabilities
ranging from 21.12 to 99.99%. Among the 46 proteins
found, ferric enterobactin receptor (1fep A) and YCEI”
(1y0gA) from the E. coli membrane had the highest
probability of occurrence. Finally, the 3D model for
Table 2. Percentage of residues that lay in the most favored
regions (Allow), percentage of residues that lay in additionally
allowed regions (Gener Allow), and percentage of residues that
lay in disallow regions for IroN, FepA, and CirA proteins accord-
ing to Ramachandran plot
Protein
FepA was a β-barrel protein composed of 727 aa, 10
occurring as α helices, 58 and 67 as β-sheets, and coil
regions, respectively (Figure 1-IB).
The CirA had a 26-aa signal peptide. After align-
ment, the mature protein displayed homology with 34
other proteins, whose tertiary structure has been ex-
perimentally determined. These molecules showed iden-
tities of about 13 and 86%, similarities ranging from
0.001 to 1.363, and occurrence probabilities ranging
from 25.16 to 99.99%. Among the 34 proteins found,
the colicin I receptor (2hdi A) and the ferric entero-
bactin receptor (1fep A) from E. coli membrane had
the highest probability of occurrence. Finally, the 3D
Table 3. QMEAN6 and Z scores for the validation of the ter-
tiary structure: IroN, FepA, and CirA
Protein QMEAN6 Z-score1

Item IroN FepA CirA IroN 0.369 −4.059

FepA 0.425 −3.736
Allow (%) 10.3 7.4 6.4 CirA 0.492 −3.000
Gener Allow (%) 1.3 0.3 0.7 1The Z-score was less than 0 an Q mean was less than 0.6, both indi-
Disallow (%) 0.7 0.7 0.2
cating poor quality of the proteins.
 COMPUTATIONAL MODELING AND GENE EXPRESSION
model for CirA was a β-barrel protein composed of 624
aa with 11 regions in α helices, 53 and 55 β-sheets, and
coil regions, respectively (Figure 1-IC).
Antigenicity Profile Analysis
It was also possible to predict several antigenic re-
gions, probably responsible for immune response acti-
vation against Salmonella spp., in chickens. Epitopes
were predicted using classical methods that assign val-
ues to each aa according to their physicochemical prop-
erties and therefore allowed selecting peptides based
on inferences made regarding their probable antigenic
activity. Flexibility profiles were obtained using the
Bhaskaran scale, which gives flexibility values for each
aa. Because antigenic sites are those recognized by an-
tibodies, it is most likely that these sites are accessible
on a protein’s surface; with higher mobility compared
with interior regions. For IroN, FepA, and CirA pro-
teins the antigenic sites were predicted and mapped
on predicted 3D structures (Figure 1-II). Based on the
methodology used, the 2 most antigenic regions were
located on each protein’s external face. For CirA, the
most antigenic peptides were G277KYVLPLASVN-
QFLT291 and I486QGVETELKVPFN498; for IroN,
the peptides E322VNVPVIWLFEQTLTVG338 and
I397PGLRFDYLSE407, and for FepA: L322NDVTLH-
SEVSLPFDLLVNQN342 and K629QAVSPYSIVGLS641.
These peptides should be synthesized and evaluated as
possible candidates for development of future recombi-
nant or synthetic peptide vaccines.
We suggest such vaccine could generate an immune
cross-response, promoting animal protection against
different Enterobacteria, considering the identity found
with IROMP from Salmonella spp., and E. coli.
Culture Media Improvement and cirA, fepA,
and iroN Gene Expression Under Iron
Deficiency Conditions
General Factorial Design for Nitrogen Source Se-
lection. Factorial design results pointed to a significant
effect when FINLAB culture media supplemented with
tryptone was used (μ(x) = 0.36 h−1; td = 1.92 h), where
td = duplication time, compared with FINLAB media
supplemented with tryptone T (μ(x) = 0.31 h−1; td =
2.24 h). These results are supported by the predicted
effect of the lineal model applied, explained by the fol-
lowing values: degrees of freedom = 1; MS = 6.936 ×
10−3; F-value = 36.30 (test for comparing variance as-
sociated with that term with residual variance); prob-
ability P > F = 0.0001 (probability value associated
with the term’s F-value; it is the probability of get-
ting an F-value of this size if the term did not have a
response effect); R2 = 0.7840; adjusted R2 = 0.7624;
predicted R2 = 0.6890; PRESS = 2.751 × 10−3, and
adequate precision = 8.521, where PRESS = predicted
residual sum of squares.
227
Predicted R2 was in agreement with the adjusted
R2 and the F-value obtained suggests the model was
significant and there was only a 0.01% possibility the
model F-value could be due to noise. On the other
hand, an adequate precision higher than 4.0 indicates
an acceptable signal, sufficient evidence to navigate the
design space.
In contrast to what was expected, tryptone T did not
have a significant effect on native strain growth under
the conditions tested. Thus, we selected tryptone as the
organic nitrogen source for our next set of experiments
based on biomass productivity at the end of the expo-
nential phase (~5 h of culture), specific growth rate
(μx), low tryptone cost (~$195 USD/500 g) compared
with tryptone T (~$264 USD/500 g), and results of
prediction analysis (Figure 3).
Chelating Agent Addition Improvement of IROMP
Expression. General factorial design or simple design
demonstrated that biomass productivity at 4 h of cul-
ture did not change significantly (P > F = 0.4440), and
Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014
was unrelated to chelating agent addition time (0 or
2.5 h of culture). Biomass productivity at 8 h of culture
decreased with respect to 4 h, but no significant dif-
ferences were found (P > F = 0.2388) with respect to
chelating agent addition time (0, 2.5, or 5 h). The same
was observed when biomass productivity was measured
at 10 h of culture (P > F = 0.1761).
Figures 3 and 4A shows the effect of chelating agent
addition at different times of culture on cells per mil-
liliter, biomass grams per liter, biomass productivity
grams per liter hours, cell specific growth rate per hour,
and td hours.
The IROMP gene expression was evident at 4 h of
growth when the chelating agent was added at 0 and
2.5 h of culture (Figure 4B). The best outcome was not-
ed when the chelating agent was supplied in the middle
of the exponential phase at 2.5 h of culture (Figure 4C).
At this time (4 h of culture), we observed an increased
in the relative expression of the 3 genes (iroN, fepA,
and cirA). On the other hand, at 8 h of culture, gene
expression did not exceed the basal expression level.
Only fepA presented a marked expression at 10 h of
culture when the chelating agent was added at 2.5 h.
Generally it is said that in Salmonella spp. cultured
under iron limiting conditions, starvation caused by
lack of iron limits growth rate. These events are evi-
denced by lag phase prolongation and a decrease in cell
density at the end of the exponential phase (Fernandez-
Beros et al., 1989). Iron as an enzymatic cofactor plays
a critical role in oxygen metabolism, electron transfer,
and RNA synthesis, among others (Moeck and Coul-
ton, 1998). These functions are affected directly by the
type and concentration of chelating agent used to gen-
erate the iron deficiency condition.
Our results proved that iron deficiency might play
a less significant effect on cell growth when chelating
agent addition is carried out in the middle of the ex-
ponential phase. Regardless of chelating agent addition
228 Zárate-Bonilla et al.

Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014

Figure 3. Salmonella Enteritidis growth curves in FINLAB culture media supplemented with tryptone. Chelating agent addition at 0 h: [µ(x)
= 0.33 h−1; td = 2.1 h], where µ(x) = cell-specific growth rate per hours and td = duplication time. Chelating agent addition at 2.5 h: [µ(x) =
0.34 h−1; td = 2.04 h]. Chelating agent addition at 5 h: [µ(x) = 0.35 h−1; td = 1.98 h]. Without chelating agent: [µ(x) = 0.36 h−1; td = 1.93 h].
The arrow indicates the point of growth with highest productivity. Color version available in the online PDF.

time (0, 2.5, or 5 h of culture), biomass productivity
was greatest at 4 h of culture, including the control
without deferoxamine mesylate (Figure 4-A). There
were no significant differences in productivity as a func-
tion of growth time when deferoxamine mesylate was
added (0, 2.5, or 5 h), demonstrating the minimal effect
of the chelating agent on growth. We speculate this ef-
fect was due to the low concentration used, suggesting
low toxicity.
The IroN captures enterobactin, salmochelin, and
2,3-dihydroxybenzoylserine, FepA transport entero-
bactin and 2,3-dihydroxybenzoylserine, whereas CirA
is the receptor for 2,3-dihydroxybenzoylserine. Some
studies have reported that the 3 genes are crucial for
the survival of Salmonella in the host (Hantke et al.,
2003; Rabsch et al., 2003). Under the conditions here
evaluated, iroN expression tended to be slightly higher
than fepA and cirA (Figures 4-B and C). Taking into
account that all these genes are transcriptionally regu-
lated by FUR, it is possible that FUR affinity degree
may be different for each gene promoter (iroN, fepA,
and cirA; Andrews et al., 2003).
Finally, it is logical to think that the iron deficiency
conditions generated in this study could stimulate the
production of other proteins related or not with iron
uptake, whose expression was not measured and that
probably will have an immunological effect.
Conclusions
To increase iroN, fepA, and cirA relative gene ex-
pression in native Salmonella enterica serovars under
the culture conditions studied, the Enteritidis strain
requires maximum log phase extension. In addition, a
chelating agent should be added in the middle of the
exponential phase, when the cell is at an accelerated
metabolic growth rate. Our study confirms that iron de-
ficiency did not simultaneously stimulate IROMP gene
expression, probably due to differential gene promoter
affinity. Our methodology and results can be used to
enhance the expression of other IROMP, such as Fiu,
FecA, FhuA, and FhuE in other strains. Moreover, it
can be applied to generate more efficient vaccines that
combine several Salmonella spp. serotypes. The pro-
 COMPUTATIONAL MODELING AND GENE EXPRESSION 229

Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014

Figure 4. Biomass productivity and iron-regulated outer-membrane protein expression after chelating agent addition at 0, 2.5, and 5 h. A:
Biomass productivity P(x) expressed as grams per liter hours of dry biomass calculated at different culture times (4, 8, and 10 h) as result of che-
lating agent addition at 0, 2.5, and 5 h. B: Relative expression of iroN, fepA, and cirA after chelating agent addition at 0 h of culture. C: Relative
expression rate of iroN, fepA, and cirA after chelating agent addition at 2.5 h of culture. D: Relative expression rate of iroN, fepA, and cirA after
chelating agent addition at 5 h of culture.

posed native strain 3D structure of 3 IROMP proteins
and 6 antigenic peptides should be studied in detail as
possible components or candidates for a synthetic or
recombinant vaccine against avian Salmonellosis and
for IgY production. We propose the antigenic peptides
identified in this work through 3D structure modeling
could be in part responsible for poultry seroprotection.
ACKNOWLEDGMENTS
This work was granted by Colciencias (grant 6570-
454-21809, Bogotá, Colombia). The authors thank
María Mercedes Zambrano (Corpogen, Bogotá, Colom-
bia) for critical reading of the manuscript and María
Lucía Gutiérrez (Instituto de Errores Innatos del Meat-
bolismo, Facultad de Ciencias, Pontificia Universidad
Javeriana, Bogotá, Colombia) for English editing.
REFERENCES
Allan, B. J., J. V. Hurk, and A. A. Potter. 1993. Characterization of
Escherichia coli isolated from cases of avian colibacillosis. Can.
J. Vet. Res. 57:146–151.
Andrews, S., A. Robinson, and F. Rodríguez. 2003. Bacterial iron
homeostasis. FEMS Microbiol. Res. 27:215–237.
Banerjee-Bhatnagar, N. B., and C. E. Frasch. 1990. Expression of
Neisseria meningitidis iron-regulated outer membrane proteins,
including a 70-kilodalton transferrin receptor, and their potential
for use as vaccines. Infect. Immun. 58:2875–2881.
Bustin, S. A., V. Benes, T. Nolan, and M. W. Pfaffl. 2005. Quan-
titative real-time RT-PCR—A perspective. J. Mol. Endocrinol.
34:597–601.
Chanana, V., S. Majumdar, P. Ray, M. Sharma, and P. Rishi. 2006.
Coordinated expression and immunogenicity of an outer mem-
brane protein from Salmonella enterica serovar Typhi under iron
limitation, oxidative stress and anaerobic conditions. J. Biomed.
Sci. 13:303–312.
Clifton-Hadley, F. A., M. Breslin, L. M. Venables, K. A. Sprigings,
S. W. Cooles, S. Houghton, and M. J. Woodward. 2002. A labo-
ratory study of an inactivated bivalent iron restricted Salmo-
nella enterica serovars Enteritidis and Typhimurium dual vac-
cine against Typhimurium challenge in chickens. Vet. Microbiol.
89:167–179.
Deléage, G., and B. Roux. 1987. An algorithm for protein second-
ary structure prediction based on class prediction. Protein Eng.
1:289–294.
Duque-Jamaica, R., A. Arévalo-Galvis, R. A. Poutou-Piñales, and
A. A. Trespalacios-Rangel. 2010. Sequential statistical improve-
ment of the liquid cultivation of Helicobacter pylori. Helicobacter
15:303–312.
Fernandez-Beros, F. E., C. Gonzáles, M. A. McIntosh, and F. C. Ca-
ballero. 1989. Immune response to the iron-deprivation-induced
proteins of Salmonella typhi in typhoid fever. Infect. Immun.
57:1271–1275.
Finn, R. D., J. Tate, J. Mistry, P. C. Coggill, J. S. Sammut, H. R.
Hotz, G. Ceric, K. Forslund, S. R. Eddy, E. L. Sonnhammer, and
A. Bateman. 2008. The Pfam protein families database. Nucleic
Acids Res. 36:D281–D288.
230 Zárate-Bonilla et al.
Frishman, D., and P. Argos. 1996. Incorporation of non-local inter-
actions in protein secondary structure prediction from the amino
acid sequence. Protein Eng. 9:133–142.
Garnier, J., J. F. Gibrat, B. Robson, and R. F. Doolittle. 1996. GOR
secondary structure prediction method version IV. Methods En-
zymol. 266:540–553.
Garnier, J., D. J. Osguthorpe, and B. Robson. 1978. Analysis of
the accuracy and implications of simple methods for predict-
ing the secondary structure of globular proteins. J. Mol. Biol.
120:97–120.
Gast, R. K., and C. W. Beard. 1993. Research to understand and
control Salmonella enteritidis in chickens and eggs. Poult. Sci.
72:1157–1163.
Geourjon, C., and G. Deléage. 1994. SOPM: A self-optimized meth-
od for protein secondary structure prediction. Protein Eng.
7:157–164.
Geourjon, C., and G. Deléage. 1995. SOPMA: Significant improve-
ments in protein secondary structure prediction by consensus
prediction from multiple alignments. Comput. Appl. Biosci.
11:681–684.
Hantke, K., G. Nicholson, W. Rabsch, and G. Winkelmann. 2003.
Salmochelins, siderophores of Salmonella enteric and uropatho-
genic Escherichia coli strains, are recognized by the outer mem-
brane receptor IroN. Proc. Natl. Acad. Sci. USA 100:3677–3682.
King, R. D., and M. J. Sternberg. 1996. Identification and applica-
tion of the concepts important for accurate and reliable protein
secondary structure prediction. Protein Sci. 5:2298–2310.
Klebba, P. E. 2003. Three paradoxes of ferric enterobactin uptake.
Front. Biosci. 8:s1422–s1436.
Kolaskar, A. S., and P. C. Tongaonkar. 1990. A semi-empirical
method for prediction of antigenic determinants on protein anti-
gens. FEBS Lett. 276:172–174.
Lambert, C., N. Leonard, X. De Bolle, and E. Depiereux. 2002.
ESyPred3D: Prediction of proteins 3D structures. Bioinformat-
ics 18:1250–1256.
Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. Mc-
Gettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R.
López, J. D. Thompson, T. J. Gibson, and D. G. Higgins. 2007.
Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–
2948.
Laskowski, R. A., M. W. MacArthur, D. S. Moss, and J. M. Thorn-
ton. 1993. PROCHECK—A program to check the stereochemical
quality of protein structures. J. Appl. Cryst. 26:283–291.
Levin, J. M., B. Robson, and J. Garnier. 1986. An algorithm for
secondary structure determination in proteins based on sequence
similarity. FEBS Lett. 205:303–308.
Miethke, M., and M. Marahiel. 2007. Siderophore-based iron acquisi-
tion and pathogen control. Microbiol. Mol. Biol. Rev. 71:413–
451.
Moeck, G. S., and J. W. Coulton. 1998. TonB-dependent iron ac-
quisition: mechanisms of siderophore-mediated active transport.
Mol. Microbiol. 28:675–681.
Morton, D. J., and P. Williams. 1989. Characterization of the out-
er-membrane proteins of Haemophilus parainfluenzae expressed
under iron-sufficient and iron-restricted conditions. J. Gen. Mi-
crobiol. 135:445–451.
Nakamura, M., N. Nagamine, T. Takahashi, S. Suzuki, and S. Sato.
1994. Evaluation of the efficacy of a bacterin against Salmonella
enteritidis infection and the effect of stress after vaccination.
Avian Dis. 38:717–724.
Oke, M., R. Sarra, R. Ghirlando, S. Farnaud, A. R. Gorringe, R.
W. Evans, S. K. Buchanan, and F. Lett. 2004. The plug domain
of a neisserial TonB-dependent transporter retains structural in-
tegrity in the absence of its transmembrane beta-barrel. FEBS
Lett. 564:294–300.
Pfaffl, M. W. 2001. A new mathematical model for relative quantifi-
cation in real-time RT-PCR. Nucleic Acids Res. 29:e45.
Rabsch, W., U. Methner, W. Voigt, H. Tschape, R. Reissbrodt, and
P. H. Williams. 2003. Role of receptor proteins for enterobactin
and 2,3-dihydroxybenzoylserine in virulence of Salmonella enteri-
ca. Infect. Immun. 71:6953–6961.
Snipes, K. P., L. M. Hansen, and D. C. Hirsh. 1988. Plasma- and
iron-regulated expression of high molecular weight outer mem-
brane proteins by Pasteurella multocida. Am. J. Vet. Res.
49:1336–1338.
Sood, S., P. Rishi, V. Dhawan, S. Sharma, and N. K. Ganguly.
2005a. Protection mediated by antibodies to iron-regulated out-
er-membrane proteins of S. typhi in a mouse peritonitis model.
Mol. Cell. Biochem. 273:69–78.
Downloaded from http://ps.oxfordjournals.org/ at :: on January 9, 2014
Sood, S., P. Rishi, H. Vohra, S. Sharma, and N. K. Ganguly. 2005b.
Cellular immune response induced by Salmonella enterica sero-
type Typhi iron-regulated outer-membrane proteins at peripheral
and mucosal levels. J. Med. Microbiol. 54:815–821.
Thomson, N., D. Clayton, D. Windhorst, G. Vernikos, S. David-
son, C. Churcher, M. Quail, M. Stevens, M. Jones, M. Watson,
A. Barron, A. Layton, D. Pickard, R. Kingsley, A. Bignell, L.
Clark, B. Harris, D. Ormond, Z. Abdellah, K. Brooks, I. Chere-
vach, T. Chillingworth, J. Woodward, H. Norberczak, A. Lord,
C. Arrowsmith, K. Jagels, S. Moule, K. Mungall, M. Sanders, S.
Whitehead, J. Chabalgoity, D. Maskell, T. Humphrey, M. Rob-
erts, P. Barrow, G. Dougan, and J. Parkhill. 2008. Comparative
genome analysis of Salmonella Enteritidis PT4 and Salmonella
Gallinarum 287/91 provides insights into evolutionary and host
adaptation pathways. Genome Res. 18:1624–1637.
Woodward, M. J., G. Gettinby, M. F. Breslin, J. D. Corkish, and S.
Houghton. 2002. The efficacy of Salenvac, a Salmonella enterica
ssp. Enterica serotype Enteritidis iron-restricted bacterin vac-
cine, in laying chickens. Avian Pathol. 31:383–392.
Worst, D. J., B. R. Otto, and J. de Graaff. 1995. Iron-repressible
outer membrane proteins of Helicobacter pylori involved in heme
uptake. Infect. Immun. 63:4161–4165.
Zárate-Bonilla, L. J. 2009. Mejoramiento de la expresión de proteí-
nas externas de membrana reguladas por hierro (IROMPs) en
Salmonella spp. Microbióloga Industrial. Pontificia Universidad
Javeriana, Bogotá, DC, Colombia.