Você está na página 1de 7

Biologia Molecular Prof Dra.

Claudia Barbosa Ladeira de Campos


Genomas 1. Defina genoma e gene. Descreva a funo de cada um.

2. Diferencie genomas procariticos e eucariticos quanto ao tamanho, presena de regies no codificantes (introns e intergnicas), contedo gnico e estrutura dos genes. 3. Alm do genoma principal, as clulas eucariticas possuem outros genomas. Onde so encontrados esses outros genomas. Compare esse genoma com o genoma principal de eucariotos e procariotos. 4. Alguns procariotos possuem uma molcula de DNA acessria com funo diferente do genoma principal. Que molcula essa, qual sua funo e quais as conseqncias para a clula que a hospeda. 5. a. b. c. 6. 7. 8. 9. Faa esquemas da estrutura geral dos genes: Procariticos Eucariticos Operon Defina exon e intron. O que so seqncias regulatrias O que so as seqncias intercalantes nos genes, conhecidos como introns? O que so famlias gnicas.

10. Descreva uma semelhana e uma diferena entre gene e pseudogene. 11. O genoma divido em regies com seqncias relacionadas a genes e seqncias no codificantes. Como cada regio pode ser subdividida. 12. O que so seqncias repetitivas do tipo satlite e quais os tipos de seqncias satlites. Caracterize cada um dos tipos. 13. O que so elementos transponveis, quais os tipos e como so classificados aos intermedirios formados. 14. Discuta sobre uma hiptese para a existncia de grandes regies no codificantes, ou regies intergnicas, no genoma de mamferos. 15. A afirmativa O nmero de cromossomos dos organismos eucariticos maior quanto maior a complexidade do organismo incorreta, por qu?

Estrutura dos cidos nuclicos 16. Como so denominados os monmeros de DNA? E do RNA? Quais as bases nitrogenadas encontradas no RNA e no DNA? 17. Quais so as diferenas entre o DNA e o RNA? 18. Quais so as bases pricas (ou purinas) e quais as pirimdicas (ou pirimidinas)? 19. Nomeie as partes constituintes do nucleotdeo abaixo. Responda se encontrado no DNA ou no RNA e justifique sua resposta.

c
20. Para diferenciar os carbonos participantes da molcula do acar dos carbonos que compem as bases nitrogenadas purinas e pirimidinas dos carbonos das pentoses, adiciona-se uma (linha) aos nmeros (1, 2, 3, 4 e 5). Portanto, os carbonos da pentose so denominados 1, 2, 3, 4 3 5. Numere os carbonos da pentose do nucleotdeo do esquema anterior. 21. Desenhe uma fita de RNA composta por 3 nucleotdeos, nomeia a ligao entre os nucleotdeos e indique a polaridade da molcula. 22. Um determinado organismo possui 29% de bases de timina. Qual porcentagem de bases deste DNA de resduos de citosina? Explique. 23. Quando separadas, as duas fitas de uma dupla-hlice so idnticas? Explique. 24. Quais os 3 tipos de conformao de DNA existem? Quais os naturais? Em que condies a conformao artificial encontrada? 25. O equilbrio entre as foras de repulso e atrao fundamental para a plasticidade necessria para que a molcula de DNA possa cumprir seu papel. O esqueleto hidroflico de pentoses e grupos fosfato fornecem o carter cido ao polmero. Quais partes da molcula exercem as foras de repulso e coeso que sofre uma longa cadeia de DNA. Saiba exemplificar e explicar essa afirmativa. 26. A molcula de DNA tem polaridade 5-3 e formada por duas fitas antiparalelas. Ao acar liga-se um grupo fosfato no carbono na posio 5. Um nucleotdeo como parte integrante de um cido nuclico tem um nico grupo fosfato, sendo, portanto um nucleotdeo monofosfato. Qual a extremidade onde monmeros so adicionados? 27. Por que a sntese do DNA (e RNA) depende da participao de um nucleotdeo trifosfato? Porque no h adio de nucleotdeo no lado 5 da molcula?

Estrutura e compactao do DNA 28. Defina cromatina. Em que fase do ciclo celular encontrada. 29. Diferencie eucromatina de heterocromatina quanto estrutura e funo. 30. O que so histonas e cite duas funes. 31. O que so os nucleossomos? 32. Qual o papel das histonas no empacotamento do DNA? 33. A estrutura das histonas esto intimamente relacionadas a funo da cromatina. Descreva dois tipos de modificao ps-traducionais sofrido pelas histonas que tenham conseqncias para a funo do DNA no trecho onde esto essas histonas modificadas. Replicao 34. Baseado na complementaridade e no antiparalelismo da molcula de DNA, desenhe a fita complementar do DNA: 5-GTACCATGCTAGGGTCTAGATATTCTGATAGCT-3. 35. Qual a importncia da complementaridade da molcula de DNA durante a replicao? 36. Defina origem de replicao. Porque cada molcula de DNA em cromossomos eucariotos contm mltiplas origens de replicao? 37. Muitas origens de replicao foram caracterizadas por conter seqncias ricas em A:T. Esses ncleos ricos em A:T tm algum significado funcional? Qual? 38. Explique a figura abaixo.
a b c d e

39. A Replicao do DNA tem regras e mecanismos bsicos que se aplicam a procariotos e eucariotos. Quais so eles? 40. Esquematize uma forquilha de replicao e indique qual fita de DNA ser usada como molde para a sntese contnua e para a sntese descontnua das fitas filhas.

41. Todas as DNA polimerases conhecidas, alm de sua atividade polimerase, tem capacidade de editorao (proofreading). Que tipo de atividade enzimtica responsvel pela editorao? Qual sua contribuio para a fidelidade do processo de replicao. 42. Quais as polimerases que atuam no processo de replicao e descreva em que fase cada uma delas atua. 43. Coloque as protenas e enzimas em ordem temporal de atuao no processo de replicao. DNA Pol I, ligase, fragmento de Okazaki, DNA Pol III, primer, helicase, primase. 44. Descreva a funo de cada um dos componentes do processo de replicao listados na questo anterior. 45. O avano de uma forquilha de replicao ao longo de uma molcula de DNA leva a superhelicoidao da dupla fita. Qual enzima atua para permitir o relaxamento da toro e qual seu mecanismo de ao? 46. Considerando a seqncia abaixo, e o sentido de polimerizao da esquerda para direita, aponte qual fita ser molde para a sntese da fita contnua e qual ser da descontnua. 5 AACTGGTCGATGCTATTGATCGATGCTAG 3 3 TTGACCAGCTACGATAACTAGCTACGATC 5 47. No processo de replicao, diferencie fica contnua, ou lder, da fita descontnua, ou lerda. 48. Uma das principais diferenas entre os cromossomos da maioria das bactrias e clulas eucariticas que os cromossomos dos eucariotos so lineares. A manuteno da integridade das extremidades dos cromossomos lineares demanda um tipo de replicao especfica que evita perdas sucessivas de DNA. Como so chamados esses terminais cromossmicos e explique como as extremidades so replicadas. 49. Qual a funo das nucleases. Diferencie exonuclease de endonuclease. 50. Existe alguma relao entre telomerase e cncer, e telomerase e envelhecimento celular? 51. Proponha uma forma de sntese de DNA em tubo de ensaio (in vitro) usando alguns dos componentes do processo de replicao que voc julgue essencial para tal fim. Transcrio 52. O que so fatores de transcrio? O que so os fatores de transcrio basais? 53. Defina promotor e o que significa seqncia consenso da maquinaria basal de transcrio. 54. Quais as RNA polimerases conhecidas de clulas eucariticas e qual as funes conhecidas para cada uma delas? 55. O que uma fase aberta de leitura (open reading frame - ORF)? 56. A sntese de DNA tambm poder ser feita utilizando uma molcula de RNA como molde. Qual o nome da enima responsvel por esse tipo de processo? Onde so encontradas? Existe similares no genoma de mamferos? 57. Defina fita molde e fita codificadora.

58. A fita codificadora de um gene composto pela seqncia: 5 CCATGTTGACATGATACCATGATCACATGTATTTGACTAT 3 Qual a seqncia do RNA que ser sintetizado por esse gene? 59. Quais seqncias encontradas no promotor bacteriano so reconhecidas pela RNA Pol e quais subunidades da enzima as reconhecem. 60. Explique o processo de terminao da transcrio em procariotos. 61. Quais os trs tipos principais de RNA celulares eucariticos? Qual a funo de cada classe? Por quais RNA polimerase cada classe sintetizado? 62. Compare os fatores de transcrio eucariticos ao fator sigma de procariotos. 63. Diferencie fatores de transcrio basal (ou geral) de fatores de transcrio especficos, levando em considerao: o papel dos fatores de transcrio e as circunstncias os fatores especficos so ativados. 64. A afirmativa Os genes so encontrados em apenas uma das fitas da molcula de DNA est incorreta. Justifique. 65. Os componentes do complexo de transcrio basal ocorrem em todas as clulas? Justifique. 66. Qual a modificao crtica da RNA polimerase para que se inicie a transcrio? 67. Para que um "enhancer" funcione, critico que ele esteja a uma distncia correta e em fase com o promotor? Ele funciona se invertido? Um promotor funciona corretamente se invertido (o gene controlado transcrito)? 68. Defina processamento de RNA, sua funo e indique se ocorre em procariotos ou eucariotos ou ambos. 69. O que cap, onde ocorre e qual sua funo? 70. O que cauda poli-A, onde ocorre e qual sua funo? 71. Defina splicing, d sua funo e indique em que fase da transcrio ocorre. 72. Qual a funo dos snRNA no processo de splicing. 73. O que so microRNAs. Descreva duas de suas funes.

Traduo 74. Porque o cdigo gentico formado por trincas? Quantos aminocidos so especificados pelo cdigo gentico? Quantas sequncias de aminocidos so possveis em um polipeptdeo de 146 aminocidos? 75. O que se entende por cdigo gentico degenerado e descreva usando os cdons que codificam para a leucina (Leu) como exemplo. 76. Sobre a seqncia de RNA abaixo, responda: 5- GCUAUGGCAAAACUGUGGGUACGCACUUAGGCAAUUCCUAAAAAAAAAAAAA-3 a.Que tipo de RNA esse? b.Circule onde se inicia a sntese das protenas e risque onde esta termina. c.D a seqncia de aa resultante de sua traduo e diga se um dipeptdeo, um peptdeo ou uma protena. d.Quais as caractersticas que permitem sua classificao? e.Qual o sentido em que traduzido? 77. Cite 3 diferenas entre os ribossomos eucariticos, procariticos e mitocondriais. 78. Qual o nmero de cdons gerados a partir dos 4 nucleotdeos presentes na molcula de mRNA? Quantos so codificantes? Qual a funo dos que no so codificantes? 79. O que significa universalidade do cdigo gentico e qual situao a universalidade no se aplica? 80. Onde feita a sntese proteica na clula? Comente algumas diferenas entre as protenas sintetizadas em polirribossomos e no retculo endoplasmtico rugoso. 81. Em que extremidade do tRNA ligado o aminocido? Em qual nucleotdio o aa se liga? Qual a denominao geral das enzimas que fazem esse acoplamento? 82. Qual subunidade associa-se primeiro ao mRNA para a iniciao da sntese proteica? Qual o primeiro aminocido de toda protena? Como se chama esse aa em procariotos? Qual o anticdon encontrado no tRNA que carrega esse aminocido? 83. Descreva brevemente o que acontece em cada uma das fases da sntese de protenas: a. Ativao dos aminocidos b. Iniciao c. Alongamento d. Terminao 84. Qual a funo da seqncia de Shine-Dalgarno? 85. Aps formado o complexo de iniciao, o segundo aminocido ligado ao seu tRNA entra no passo seguinte com o auxlio do fator Tu. Qual o nome do fator que tem essa mesma funo em eucariotos? De onde estes fatores tiram a energia para encaixar o aminoacil-tRNA correto para o cdon presente no stio A? 86. Qual o sentido em que so adicionados os aminocidos na cadeia polipeptdica nascente?

87. Aps a transferncia do polipeptdio nascente para o aminoacil tRNA presente no stio A do ribossomo, ocorre a translocao do ribossomo pra o cdon seguinte. Qual a molcula que medeia a translocao em eucarioto e em procarioto, e qual a fonte de energia utilizada para realizar esse processo? 88. Ao encontrar um cdon sem sentido o que ocorre com a sntese proteica? Qual o papel dos fatores de terminao? 89. A mdia de massa de 20 aminocidos comuns por volta de 137 dltons. Calcule o comprimento aproximado de uma molcula de RNAm que codifica um polipeptdeo com uma massa de 65.760 dltons. Assuma que o polipeptdeo contm quantidade iguais de todos os aminocidos. 90. Identifique trs tipos de RNA que esto envolvidos na traduo e liste as caractersticas e funo de cada um deles. 91. Descreva o que traduo monocistrnica e policistrnica. Existe vantagem de uma sobre a outra? Qual? 92. O que significa universalidade do cdigo gentico? 93. O que significa no ambigidade do cdigo gentico? 94. Porque na clula eucaritica, diferente da clula procaritica, a traduo de um RNA no pode ocorrer ao mesmo tempo em que este RNA transcrito? 95. Defina anti-codon. 96. Em que stio do ribossomo se liga o primeiro Met-tRNA? Quais as protenas envolvidas na iniciao da traduo? 97. Qual a funo dos fatores de alongamento da traduo? 98. Tenha em mos a tabela de correspondncia codons/aminocidos, observe abaixo a seqncia de DNA correspondente fita codificante de um gene e responda: 5-CGATCGACCTAGATGGATTCGATCGATTCGGAGCTAGGCTAGTCTAACTGATCG-3 a) Transcreva a molcula de RNA correspondente a este gene b) Circule o cdon onde comea a sntese da protena (cdon de iniciao) c) Sublinhe o cdon de iniciao (note que este cdon deve estar na mesma fase de leitura usada para a sntese da protena) d) Traduza a seqncia do RNA em protena

Formao complementar http://www.dnalc.org/resources/ http://www.ac-creteil.fr/biotechnologies/ http://www.johnkyrk.com/ http://www.ncbi.nlm.nih.gov/