Você está na página 1de 4

GARRA PR-VESTIBULAR

Prof. Julio Borges






1) A exciso dos ntrons denominado splicing um dos processos importantes e necessrios para formar um RNAm
maduro funcional. Porm mesmo requer uma extrema preciso das molculas envolvidas no processo, onde
excluso ou o acrscimo de um nico nucleotdeo em um xon pode levar a uma alterao da fase de leitura e
produo de uma protena completamente diferente da original ou defeituosa. Analise a sequncia abaixo e assinale
a alternativa que corresponde a sequncia correta da fita ps-splicing.

5 ACG AUG CCA UGA UUA GTG AUG CAA AGC UAG CGG CAG 3

a) AUG CCA UGA UUA GUG AUG CAA AGC UAG
b) AUG CAA AGC UAG CGG CAG
c) AUG CCA AUG CAA AGC
d) ACG AUG CCA UGA UUA GUG AUG CAA AGC UAG CGG CAG
e) AUG CCA

2) O cdigo gentico universal e degenerado, isto , um mesmo cdon corresponde a um mesmo aminocido em
todo e qualquer ser vivo, e diferentes cdons podem corresponder a um mesmo aminocido. Por exemplo, o cdon
UUU codifica a Fenilalanina para os seres humanos, mosquitos, cogumelos, buritis e todos os outros seres vivos. Ao
mesmo tempo, tanto o cdon UUU quanto o cdon UUC, codificam o aminocido Fenilalanina. Com base nas
informaes contidas no quadro abaixo, marque a alternativa que contm o ltimo aminocido expresso pela
seguinte sequncia da fita complementar do DNA:
5-TACTTCGAACGACGATATCTTACCATT-3
A) Triptofano
B) Tirosina
C) Metionina
D) Lisina
E) Isoleucina

3) As propriedades biolgicas e funcionais de uma clula so determinadas pelo conjunto de protenas expressos
em um momento fisiolgico qualquer. Porm para que o coletivo de eventos necessrios ao funcionamento do
organismo possa ocorrer de forma adequada e correta, diversos mecanismos de regulao gnica necessitam estar
ativos, permitindo que os produtos gnicos sejam gerados pelas clulas certas, nos momentos certos e nas
quantidades adequadas. Neste aspecto, a regulao da expresso gnica nos eucariotos bem mais complexa que
em procariontes, contando com os mais diversos mecanismos para assegurar a preciso do processo de
modulao. Levando-se em conta as diferenas bsicas entre os sistemas de regulao procarionte e eucarionte
pode-se citar:
a) A ausncia de ntrons e e a presena do splicing em procariotos
b) A ausncia de xons e do splicing em procariotos.
c) A ausncia de ntrons e e a presena do splicing em Eucariotos.
d) A ausncia de ntrons e do splicing em Eucariotos.
e) Em eucariotos a juno dos xons parte codificante do DNA se torna imprescindvel para que ocorra a retirada
dos ntrons parte no codificante do DNA, afim de que a expresso gnica acontea.

4) Nos ltimos anos, a biologia molecular tem fornecido ferramentas teis para a produo de plantas e animais
transgnicos. As informaes armazenadas nas molculas de DNA so traduzidas em protenas por meio de
molculas intermedirias denominadas:
a) Proteases
b) Plasmdeos
GARRA PR-VESTIBULAR
Prof. Julio Borges


c) RNA-r
d) RNA-t
e) RNA-m

5) A replicao deve acontecer antes da diviso celular. Em procariotos a replicao ocorre entre as divises
celulares, enquanto que nos eucariotos ocorre na fase S da interfase. A replicao tambm pode ser reproduzida
em laboratrio atravs de um ensaio conhecido como PCR (Reao em Cadeia da Polimerase). Uma das principais
aplicaes da PCR na medicina forense, onde pequenas amostras de DNA retiradas da cena de um crime,so
amplificadas para serem analisadas pelo mtodo de fingerprinting atravs da eletroforese. Em relao a esta
ferramenta descrito por Kary Mullis em 1983, tendo-lhe sido posteriormente, em 1993, atribudo o Prmio Nobel da
Qumica pelo seu trabalho incorreto afirmar que:
a) Mesmo sendo um processo acelular para clonar fragmentos de DNA segue o princpio da replicao onde a
quebra das pontes de hidrognio so feitas pela enzima helicase.
b) Os primers so necessrios para o incio da replicao do DNA. Durante a replicao do DNA em clulas os
primers so produzidos pela ao da RNA-polimerase especial (primase) usualmente sintetizada no sentido RNA de
transcrio 5'-3'.
c) Pode ser utilizado em conjunto com a eletroforese para identificao de patgenos atravs de seus genomas
como por a exemplo identificao de agentes como: HPV Vrus do papiloma humano, HIV e Vrus da Hepatite B.
d) O processo consiste basicamente em utilizar os mecanismos da replicao in vitro.
e) A reao de PCR diferencia-se da replicao celular pelo fato da quebra das pontes de hidrognio serem feitas
pela temperatura e no pela enzima helicase como acontece nas clulas.

6) Em um organismo saudvel, h equilbrio entre o nmero de clulas mortas por morte celular programada, doenas ou
leses e a proliferao de novas clulas. Isso garante a integridade de tecidos e rgos. Entretanto alteraes no cdigo
gentico que dita as regras do corpo podem perturbar os processos, causando doenas como o cncer. Assinale a
alternativa correta em relao ao controle e funcionamento das clulas.
a) Todos possuem em seu organismo genes responsveis pela imortalizao da clula. Porm preciso que estes genes
sejam ativados.
b) Todas as pessoas nascem com uma sequncia especfica em seu DNA, cuja funo fazer com que em determinado
perodo da vida tais genes sejam ativados, aumentando a probabilidade das clulas adquirirem a imortalidade celular e o
envelhecimento.
c) Genes apoptticos ou proto-oncogenes so os responsveis por este controle e equilbrio. Tais genes a exemplo de
todo material gentico ficam expostos a sofrerem mutaes de acordo o ambiente em que esto submetidos, e por
consequncia destas mutaes perdem o controle sobre o ciclo mittico.
d) Os genes indutores do processo de replicao celular denominados topoisomerases a exemplo de todo material
gentico sofrem mutaes constantes. E estas mutaes vo causando erros que se no corrigidos no processo de
traduo causam a imortalidade celular.
e) O Ciclo mittico controlado pelo DNA, sendo assim independente das modificaes que ocorram em seu material
gentico, a morte celular ir ocorrer. Assim a formao do Cncer s acontece em casos extremos aonde a diferenciao
celular no acontece e tais clulas escapam dos mecanismos de controle do ciclo celular.

7) Em biologia Traduo o nome dado ao processo biolgico no qual a sequncia nucleotdica de uma molcula
de RNAm utilizada para ordenar a sntese de uma cadeia polipeptdica com sequncia de aminocidos que
determina uma protena. Analisando a cadeia abaixo, e com o uso da tabela podemos dizer que a mesma produzir
quantos aminocidos?
GARRA PR-VESTIBULAR
Prof. Julio Borges



3 GUUGGCGUAUACGAUGUAGAUAGC 5
a) Val, Gly, Val, Tyr, Asp, Val, Asp, Arg.
b) Arg, Stop, Met, Stop, His, Met, Arg, Leu.
c) Met, Stop, Met, Arg, Leu.
d) Met, Met, Arg, Leu.
e) Arg, Leu.

8) No considerando os chamados cdons de terminao, correto afirmar que existem.............. cdons para
especificar os aminocidos das molculas proticas nas clulas eucariticas.
a) 64
b) 63
c) 62
d) 61
e) 60


9) 0 cdon que corresponde ao aminocido alanina dado pela seguinte sequncia de bases: guanina, citosina,
adenina. Isso permite dizer que o anticdon da alanina no RNAt :
a) GCA
b) CGU
c) UGC
d) GTC
e) CTG

10) Uma mulher aps um ms de separao, decidiu exigir do seu ex-marido uma penso alimentcia. O homem
ento, solicitou o teste de paternidade onde para isto teve de entregar uma amostra de DNA, assim como a prpria
me teve de o fazer. Foi quando tiveram uma grande surpresa: verificou-se que ela no era me dos seus prprios
dois filhos, assim como do terceiro do qual estava grvida nesse momento. No princpio, os mdicos supuseram que
isso se deveria a uma transfuso de sangue ou a um transplante de rgos, s que a me nunca havia sido
submetida a processos desse tipo. Depois de alguns testes se conseguiu esclarecer o mistrio e a mulher em
questo era sim me das crianas. Tal evento pode ter ocorrido:
a) por terem usado apenas DNA mitocondrial paterno na realizao do teste de DNA.
b) por terem usado apena DNA mitocondrial materno na realizao do teste de paternidade
c) pelo fato da mulher ser portadora de uma doena gentica.
d) pelo fato da mulher ser portadora de qimerismo;
e) por terem usado DNA nuclear na realizao do teste de paternidade.


GARRA PR-VESTIBULAR
Prof. Julio Borges


11) Um indivduo apresenta alelos para olhos azuis. Isso significa que esses alelos so encontrados:
a) apenas nos gametas.
b) apenas nas clulas das gnadas.
c) em todas as clulas do corpo.
d) em todas as clulas do globo ocular.
e) apenas nas clulas da ris.

12) O cncer a doena gentica que mais mata no mundo. Caracterizada pela inativao do genes que controlam
a diviso celular, aonde as clulas se tornam Imortais Tais clulas crescem e se dividem sem respeitar os limites
normais, invadem e destroem tecidos adjacentes, e podem se espalhar para lugares distantes no corpo, atravs de
um processo chamado metstase. Sobre o poder de invasividade destas clulas podemos afirmar que:
a) Ocorrem pelo fato das clulas tumorais se reproduzem mais rapidamente do que as clulas normais, e por
consequncia disso acabam formando um emaranhado celular que nem sempre consegue se alojar no espao
em que ocorrem.
b) Perda de afinidade celular especfica;
c) Perda de afinidade celular especfica somada ao processo de angiognese que capacita as clulas tumorais a
percorrerem o corpo via circulao sangunea.
d) O fato estarem em constante reproduo, faz com que estas clulas procurem substncias nutritivas em tecidos
adjacentes para garantirem o fornecimento de energia e assim sucessivamente a reproduo celular constante.
e) Todas alternativas esto corretas;

13) Uma combinao de testes de anticorpos, antgenos e cido nuclico usada pelos bancos de sangue nos
pases ocidentais. A OMS estimou que, em 2000, o exame inadequado do sangue em alguns pases resultou em um
milho de novas infeces por HIV. Os exames selecionados para examinar o sangue do doador, os componentes
sanguneos e os produtos celulares oferecem um alto grau de confiana de que o HIV no est presente. Porm um
dos principais motivos que interferem nessa identificao :
a) No existirem fatores diferentes que poderiam causar uma reao positiva nos testes de HIV, alm da infeco
por HIV passada ou presente;
b) A possibilidade dos testes de anticorpos apresentarem resultados falsos negativo durante o perodo de janela,
que varia de trs semanas a seis meses a partir do momento da infeco at que o sistema imune produza
quantidades detectveis de anticorpos.
c) O Fato do vrus HIV atingir os linfcitos CD4 gradativamente em um exame sorolgico a contagem das clulas de
defesa fica comprometida j que no portador da doena em mdia a declina na contagem destas clulas.
d) O Fato da doena ser causada por um vrus.
e) A insero do material gentico clula hospedeira torna difcil a sua identificao, j que no se tem como
diferenciar o DNA humano do material gentico viral.

14) Qual (s) o (s) gentipo (s) do olho verde do filho de um casal, onde o pai possui olhos castanhos heterozigoto e
a me possui olhos azuis?
a) AaBb e aabb
b) AABB e aabb
c) Aabb e aaBb
d) AaBb
e) aa e bb

GABARITO:
1 2 3 4 5 6 7 8 9 10 11 12 13 14
C A E B E C D D B D C C B C